WO2015106311A1 - Cell surface prostate cancer antigen for diagnosis - Google Patents

Cell surface prostate cancer antigen for diagnosis Download PDF

Info

Publication number
WO2015106311A1
WO2015106311A1 PCT/AU2015/000018 AU2015000018W WO2015106311A1 WO 2015106311 A1 WO2015106311 A1 WO 2015106311A1 AU 2015000018 W AU2015000018 W AU 2015000018W WO 2015106311 A1 WO2015106311 A1 WO 2015106311A1
Authority
WO
WIPO (PCT)
Prior art keywords
glypican
antibody
body fluid
prostate cancer
mil
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2015/000018
Other languages
French (fr)
Inventor
Bradley Walsh
Douglas Campbell
Irene JUSTINIANO FUENMAYOR
Aline NOCON
Julie SOON
Quach TRUONG
Sandra Wissmueller
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Minomic International Ltd
Original Assignee
Minomic International Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to ES15737205T priority Critical patent/ES2803217T3/en
Priority to JP2016564354A priority patent/JP6691060B2/en
Priority to CA2936805A priority patent/CA2936805C/en
Priority to US15/111,973 priority patent/US10151754B2/en
Priority to AU2015207665A priority patent/AU2015207665B2/en
Priority to SG11201605784YA priority patent/SG11201605784YA/en
Priority to CN201580010766.0A priority patent/CN106164672B/en
Priority to DK15737205.3T priority patent/DK3094976T3/en
Application filed by Minomic International Ltd filed Critical Minomic International Ltd
Priority to EP15737205.3A priority patent/EP3094976B1/en
Priority to KR1020167022084A priority patent/KR102366820B1/en
Publication of WO2015106311A1 publication Critical patent/WO2015106311A1/en
Anticipated expiration legal-status Critical
Priority to US16/175,433 priority patent/US20190120846A1/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21077Semenogelase (3.4.21.77), i.e. prostate specific antigen or PSA or kallikrein 3
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531Production of immunochemical test materials
    • G01N33/532Production of labelled immunochemicals
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433Serine endopeptidases (3.4.21)
    • G01N2333/96441Serine endopeptidases (3.4.21) with definite EC number
    • G01N2333/96455Kallikrein (3.4.21.34; 3.4.21.35)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2400/00Assays, e.g. immunoassays or enzyme assays, involving carbohydrates
    • G01N2400/10Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • G01N2400/38Heteroglycans, i.e. polysaccharides having more than one sugar residue in the main chain in either alternating or less regular sequence, e.g. gluco- or galactomannans, Konjac gum, Locust bean gum or Guar gum
    • G01N2400/40Glycosaminoglycans, i.e. GAG or mucopolysaccharides, e.g. chondroitin sulfate, dermatan sulfate, hyaluronic acid, heparin, heparan sulfate, and related sulfated polysaccharides

Definitions

  • the present invention relates generally to the .field of prostate cancer diagnostics.
  • the present invention relates to the identification of biomarkers in biological samples, which can be used in the detection of prostate cancer.
  • the identified markers may also be used in determining prognosis and monitoring response to treatment for prostate cancer patients.
  • Prostate cancer is the most frequently diagnosed viscera! cancer and the second leading cause of cancer death tor men in the United States, The American Cancer Society estimates that in 2013 about 238,590 new cases of prostate cancer will be diagnosed and 29,720 men will die of the disease. Overall, one in six men will be diagnosed with prostate cancer in their lifetime.
  • prostate cancer can be detected by either digital rectal exam (DRE) or by the measurement of prostate-specific antigen (PSA) in the blood of patients.
  • DRE digital rectal exam
  • PSA prostate-specific antigen
  • neither test is entirely conclusive, and both can lead to false negatives (leaving real cancers undetected), and false positives (signaling cancer where there is none).
  • standard PSA tests conducted at the recommended 4,0 ng/ml cutoff are 86% sensitive to cance patients but only 33% specific, producing false positives in roughly 67% of non-cancer patients (Hoffman et a!. 2002). False positives are usually followed by invasive and painful biopsies.
  • the present invention is based, in part, on the discovery that glypican-t heparan sulfate proteoglycan (GPG-1) levels are elevated in the body fluids or tissues of prostate cancer patients.
  • GPG-1 glypican-t heparan sulfate proteoglycan
  • the present inventors have discovered that glypican-I is a new marker for prostate cancer. Accordingly, the present invention provides for methods of detecting glypican-1 to determine the existence of prostate cancer in patients.
  • the invention provides for methods for detecting prostate cancer in a patient comprising obtaining a body fluid or tissue sample from a patient contacting said sample with an anti-glypican-l antibody, determining that said patient has prostate cancer or an increased likelihood of developing prostate cancer based upon binding of said anti- glypican-l antibody to said body fluid or tissue sample, in some embodiments the levels of one or more additional prostate markers are measured in the body fluid or tissue sample, and the determination that the patient has cance is based upon the levels of glypican-1 and the levels of the one or more additional markers in the. patient body fluid or tissue sample.
  • the cancer is prostate cancer
  • the additional marker is PSA.
  • the anti-g!ypican-1 antibody is MIL-38. In other embodiments, the anti- glypican-l antibody is not MIL-38. In some embodiments, the anti-glypican-l antibody is an antibody fragment or recombinant antibody capable of binding glypican-1. in some embodiments, the anti-glypican-l antibody is labeled for easy detection. In some embodiments the antibody label can be a fluorescent label, a biotin-avidin amplification system, a chemiiuminescence system, microspheres or colloidal gold among others.
  • the body fluid sample obtained from the patient is a blood, serum, plasma, or urine sample.
  • the anti-glypican-l antibody binding to the patient's body fluid or tissue sample is compared to the level of anti-glypiean-1 antibody binding of a control sample; wherein increased anti-glypican-l antibody binding of the body fluid or tissue sample over the control sample is associated with the presence of prostate cancer.
  • said control sample comprises the body fluid from an age-matched prostate cancer- free patient.
  • the level of anti-glypican-l antibody binding to the patient's body fluid or tissue is compared to the level of anti-gl.ypican.-l antibody binding to a reference standard, wherein increased anti-glypican-l antibody binding of the body fluid or tissue sample over the reference standard sample is associated with the presence of prostate cancer.
  • said reference standard comprises a sample with known glypican-1 content.
  • the comparison of the anti-gtypican-1 binding to the body fluid or tissue is compared to the anti-glypican- 1 binding to the glypican-1 standards to quantify the amount of glypiean- in said body fluid,
  • Ing/ml, 5ng/ml, lOng/ml, I5ng ml or 20ng ral in the body fluid sample is indicative of prostate cancer.
  • the diagnostic methods of the invention may further comprise adniinistering one or more prostate cancer treatments to a patient, and following changes in the level of glypican-1 in bod fluids or tissues as a mechanism to monitor patient recovery or responses to the prostate cancer treatments.
  • the anti-glypican- 1 antibody binding is detected via techniques such as immunofluorescence, radiolabeling, biimunoblotting, enzyme-linked immunoassay, flow cytometry, optical density, and chemiluminescence.
  • kits for detecting glypican-1 in the body fluids or tissues of patients comprising a first anti-glypican-1 antibody, a pharmaceutically acceptable carrier, and glypiean-I standards; wherein said kit is capable of detecting glypican- 1 in the body fluid or tissue of a patient.
  • the kit further comprises a secondary ligand.
  • the secondary ligand is a second anti-glypican- 1 antibody.
  • the second anti- glypican-1 antibody is the same as the fust anti-glypican-1 antibody.
  • the secondary ligand is conjugated to a label, for rapid detection of said ligand.
  • the present invention thus relates at least to the following series of numbered embodiments below;
  • Embodiment 1 A method of detecting prostate cance in a patient, the method comprising measuring the level of glypican-1 in a body fluid sample from a patient and determining that said patient has prostate cancer or an increased likelihood of developing prostate cancer based upon the level of glypican-1 in the body fluid sample.
  • Embodiment 2 The method of detecting prostate cancer in a patient of embodiment 1 , comprising the steps of:
  • Embodiment 3 The method of embodiment 2, wherein said anti-glypican-1 antibody is MIL-38.
  • Embodiment 4 The method of embodiment 2, wherein said body fluid sample is contacted with a population of antibodies, wherein:
  • antibodies of the population comprise:
  • CDRI complementarity determining region 1
  • CDR2 complementarity detennining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 69-85 of SEQ ID NO: 10;
  • CDR3 complementarit determining region 3 comprising or consisting of an. amino acid sequence defined by positions 1 18-1.26 of SEQ ID NO: 10;
  • CDRI complementarity detennining region 1
  • CDR2 complementarit ' determining region 2
  • CDR3 complementarity determining region 3 comprising or consisting of an amino acid sequence defined by positions 109-1 17 of SEQ ID NO: 11 ;
  • antibodies of the population do not comprise a light chain variable region comprising:
  • CDRI complementarity detennining region .1
  • CDR2 complementarit determining region 2
  • CDR3 complementarity detennining region 3 comprising or consisting of an amino acid sequence defined by positions 1 13-121 of SEQ ID NO: 12.
  • Embodiment 5 The method of embodiment 4, wherein the antibody population is produced by or otherwise identical to an antibody population as generated by hybridoma cells deposited on 22 August 2014 at CellBank Australia (CBA) under accession number CBA2.0140026.
  • Embodiment 6 The method of embodiment 2, wherein said anti-glypican-l antibod is not lL-38.
  • Embodiment 7 The method of any one of embodiments 2 to 4, wherein said anti- glypican-l antibody is an antibody fragment or recombinant antibody capable of binding glypican- l .
  • Embodiment 8 The method of any one of embodiments 2 to 7, wherein said anti- glypican-l antibody is labeled.
  • Embodiment 9 The method of embodiment 8, wherein said label is chosen from a group consisting of a radiolabel, a fluorescent label, a biotin-avidm amplification system, a chemilumiftescence system, microspheres, and colloidal gold.
  • Embodiment 10 The method of any one of embodiments 2 to 9, wherein anti- glypican-l antibody binding is detected via a technique selected from the group consisting of immunofluorescence, radiolabel ing, immiraoblotting, Western blotting, enzyme -linked immunosorbent assay (ELISA), flow cytometry, immunopreclpitation, inimunohistoeheiiiistry, biofilm test, affinity ring test, antibody array optical density test, and chemi 1 ummescence .
  • a technique selected from the group consisting of immunofluorescence, radiolabel ing, immiraoblotting, Western blotting, enzyme -linked immunosorbent assay (ELISA), flow cytometry, immunopreclpitation, inimunohistoeheiiiistry, biofilm test, affinity ring test, antibody array optical density test, and chemi 1 ummescence .
  • Embodiment 1 1 The method of embodiment 1 , wherein said level of g!ypican- ! in the body fluid sample from a patient is compared to the level of glypican-l in a control sample; wherein increased anti-glypican-l antibody binding of the body fluid sample over the control sample is associated with the presence of prostate cancer.
  • Embodiment 12 The method of embodiment 1 1 , wherein a 50% or more increase in the level of glypican-l of said body fluid sample over the level of glypican-l in the control sample is indicative of prostate cancer.
  • Embodiment 13 The method of any one of embodiments 2 to 10, wherein anti- glypican-l antibody binding to said bod fluid sample is compared to anti-glypican-l antibody binding of a control sample; wherein increased anti-glypican-l antibody binding of the body fluid sample over the control sample is associated with the presence of prostate cancer.
  • Embodiment 14 The method of embodiment 13, wherein a 50% or more increase in the anti-glypican-l antibody binding to said body fluid sample over the level of anti- glypican-l antibody binding of tire control sample is indicative of prostate cancer .
  • Embodiment 15 The method of any one of embodiments 2 to 10, 13 or 14 wherein anti-giypican-1 antibody binding to said body fluid sample is compared to anti-glypican- 1 antibody binding to one or more glypican-1 standards; wherein the aivti-glypican-l antibody binding of the standards is used to quantify the amount of glypican-1 in said body fluid sample.
  • Embodiment 16 The method of any one of embodiments 1 to 15, wherein a glypican- 1 content higher than about JOog/ml in the body fluid sample is indicative of prostate cancer.
  • Embodiment 17 The method of any one of embodiments 1 to 16, further comprising; measuring the level of prostate-specific antigen (PSA) in a body fluid sample from the patient, and
  • PSA prostate-specific antigen
  • Embodiment 18 The method of embodiment 17, wherein the level of prostate-specific antigen (PS A) is measured in blood sample from the patient
  • Embodiment 19 The method of embodiment 17 or embodiment 18, wherein the level of prostate-specific antigen (PSA) in the body fluid sample measured is compared to the level of PSA measured in a control sample; wherein increased PSA levels in the body fluid sample over the control sample is associated with the presence of prostate cancer.
  • PSA prostate-specific antigen
  • Embodiment 20 The method of any one of embodiments 1 to 19, wherein said body fluid is selected from the group consisting of blood, serum, plasma, and urine.
  • Embodiment 21 A kit for detecting prostate cancer comprising a first anti-glypican-1 antibody, a pharmaceutically acceptable carrier, and glypican-1 standards; wherein said kit is capable of detecting glypican-1. in the body fluid of a patient.
  • Embodiment 22 The kit of embodiment 21, wherein the anti-glypican-1 antibody is not MIL-38.
  • Embodiment 23 The kit of embodiment 2.1 , wherein the anti-glypican-l antibody is MIL-38.
  • Embodiment 24 The kit of embodiment 21, wherein the anti-glypican-l antibody is the antibody referred to in any one of embodiments 4, 5 or 7.
  • Embodiment 25 The kit of any one of embodiments 1 to 24, further comprising a secondary ligand.
  • Embodiment 26 The kit of embodiment 25, wherein said secondary Hgand is a second anti-glypican-l antibody or an aptamer capable of binding to glypican- I; wherein said second anti-glypican-l antibody can be the same as the first anti-glypican- l antibody.
  • Embodiment 27 The kit of embodiment 25 or embodiment 26, wherei said secondary Hgand is conjugated to a label for rapid detection of said Hgand.
  • Embodiment 28 The kit of embodiment 27, wherein said label is for use in a detectio method selected from the group consisting of immunofluorescence, radioiabeHng, immunoblottmg, Western blotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, immi oprecipitation, im unohistochemistry, biofilm test, affinity ring test, antibody array optical density test, and chemiluminescence.
  • a detectio method selected from the group consisting of immunofluorescence, radioiabeHng, immunoblottmg, Western blotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, immi oprecipitation, im unohistochemistry, biofilm test, affinity ring test, antibody array optical density test, and chemiluminescence.
  • Embodiment 29 The kit of any one of embodiments 22 to 28, wherein the kit comprises components for conducting an ELISA.
  • DU-I45 prostate cancer cells were processed with a Membrane Protei Extraction Kit (MPEK, Merck) and incubated with the MIL-38 antibody attached to magnetic beads.
  • the antigen was the immunoprecipitated and washed on the magnetic beads before eluting the antigen and subjecting said antigen to mass spectrometry analysis. Results of mass spec analysis are shown identifymg glypican- 1 as the MlL-38 antigen.
  • the 18 unique peptide sequences spanning tire glypican- 1 protein are underlined.
  • DU- 145 prostate cancer cell membrane extracts were immunoprecipitated using MIL- 38 and run through a size-exclusion chromatography column.
  • the figure shows western blot analyses of even numbered chromatography fractions using either MIL-38 antibody or secondary antibody control.
  • the MIL-38 antigen is shown at 60Kd in fractions A28 and A30.
  • Figure 3 Mass spectrometry of size-exclusion chromatography purified MIL-38 antigen.
  • Membrane protein extracts of DI 45 prostate cancer cells were separated on 2 D gel (pi gradient-horizontal, and molecular mass vertical). Western blots using MIL-38 antibody and commercial rGPC-1 rabbit polyclonal antibodies show overlapping reactivity marking a 60 d protein (circled in figure). Lane D is a one dimension separation for DU-I45 extracts as a control Lane M is a one dimension separation lane for molecular size markers as controls.
  • MIL-38 can detect immunoprecipitates of GPC-1 antibodies and vice versa.
  • MIL-38 and rabbit anti-GPC-1 antibodies were each used to immunoprecipitate their antigens from DI 45 prostate cancer or C3 (MIL-38 negative) cell membrane protein extracts. Shown are the western blots of the immuaoprecipitations detected with either MIL- 38 or anti-GPC-1 antibody.
  • Figure 5A depicts GPC-1 detection of MIL-38 min unoprecipitates (left) and MIL-38 detection of GPC-1 immunoprecipitates (right).
  • Figure 5B depicts MIL-38 detection of MIL-38 immunoprecipitates as a control.
  • Lanes are: Magic Mark- commercial protein marker as control; DU1.45 MPEK- prostate cancer membrane protein extract (not inimunopreeipitated); DU145 FT- prostate cancer flow through from immune precipitation; DU145 IP- immunoprecipitate using antibody; C MPEK- (MIL-38 negative) control membrane protein extract (not iramunoprecipitated); C3 FT- (MIL-38 negative) cell flow through from immune precipitation; C3 IP eiution- (MIL- 38 negative) cell immunoprecipitate using antibody.
  • MIL-38 can detect the immunoprecipitate from rGPC-1 antibody and vice versa.
  • MIL-38 can also bind to all controls including DU 145 M PEK and to IP conducted by MIL-38.
  • MIL-38 detects recombinant glypican-l
  • MIL-38 can detect antigen secreted into cell culture supernatant.
  • DLM45 prostate cancer cells were incubated with serum free media for 36 hours to produce cell free conditioned media.
  • the conditioned media without any cells was immunoprecipitated using the M I L-38 antibody and compared to a standard IP using DU-145 MPEK membrane protein extracts. Shown is a western blot of the inimunopreeipitates using the MIL-38 antibody.
  • the MIL-38 antibody can detect antigens of 40 and 55k D in the conditioned liquid media,
  • MIL-38 antigen detected in cell culture supernatant is glypican-1
  • DU-145 prostate cancer cells were incubated with serum free media for 36 hours to produce cell free conditioned media.
  • the conditioned media was immunoprecipitated using the MIL-38 antibody and the immunoprecipitates were sent for mass spectrometry analysis.
  • Figure 8A A sample containin both the 40 and 55kD MIL-38 reactive antigens was subjected, to mass spec analysis. Results of mass spec analysis are shown identifying glypican-1 as the MIL-38 antigen from the conditioned liquid media with 9 unique peptide sequences spanning the N-terminus of the glypican-1 protein underlined.
  • Figure 8B A sample containing the 40 kDa MIL-38 reactive antigen was subjected to mass spec analysis.
  • Results of mass spec analysis are shown identifying glypican-1 as the MIL-38 antigen from the conditioned liquid media with 10 unique peptide sequences spanning the N-terminus of the glypican-1 protein underlined.
  • Figure SC A sample containing the 55 kDa MIL-38 reactive antigen was subjected to mass spec analysis.
  • Results of mass spec analysis are shown identifying glypican- 1 as the MIL-38 antigen from the conditioned liquid media with 9 unique peptide sequences spanning the N-terminus of the glypican-1. protein underlined.
  • Figure 9. MIL-38 antibody can detect glypican-I in the plasma of prostate cancer patients and in membrane extracts of prostate cancers.
  • FIG 9 A Plasma samples from one normal control patient and one prostate cancer patient were immunoprecipitated with the MIL-38 antibody. Shown are western blots with bot the MIL-38 and iGPCl antibodies. MIL-38 immunoprecipitated higher levels of glypican-1 protein in the plasma of the prostate cancer patient than the plasma of the control patient. Lanes are: 046 IP NT- IP from prostate cancer plasma; 046 IP Hepl- IP from prostate cancer plasma treated wit heparinase; 042 IP NT- IP from normal control plasma; 042 IP Hepl- IP from norma! control plasma treated with heparinase; Magic Mark- commercial protein marker as control.
  • Figure 9B Plasma samples from one normal control patient and one prostate cancer patient were immunoprecipitated with the MIL-38 antibody. Shown are western blots with bot the MIL-38 and iGPCl antibodies. MIL-38 immunoprecipitated higher levels of glypican-1 protein in the plasma of the prostate cancer patient than the
  • Membrane protein extracts from one normal prostate and one prostate cancer were obtained from Novus Bio. Equivalent amounts of protein were western blotted using MIL-38 antibody. The prostate cancer extract demonstrated higher expression of the MiL-38 antigen. Figure 10. lL-38 can detect cancer in the (trine of prostate cancer patients.
  • Urine samples from 125 age-matched patients were collected and tested for the presence of prostate cancer using Mil .-38 antibody in a indirect immunofluorescence assay. Patients were classified as health controls, benign prostatic hypertrophy (BPH) or prostate cancer (CaP) based on either biopsy confirmatio (BPH, CaP) or analysis of risk factors (healthy controls).
  • Figure shows exemplary pictures of CaP experimental samples; DU145 positive control samples; and C3 negative control samples.
  • MIL-38 can detect recombinant glypican-1 in a variety of ELISA formats
  • Sandwich ELISAs were performed using 0, 0,1 , 1 or lOng recombinant human NS0- produced glypican-1 protein (iGPCl) as analyte.
  • Figure 11 A Capture with MIL-38 antibody, detection with rabbit polyclonal anti-GPC l (a-GPC l).
  • Figure 11B Capture with attti-glypican-1. antibody, detection with MIL-38.
  • Figure 11C Capture with MIL-38, detection with biotinyiated MIL-38.
  • Figure .12 A shows comparative sandwich ELISAs using AM3 and AM4 as capture antibodies.
  • Figure 12B shows comparative sandwich ELISAs using either a mixed preparation (34 A) or a clonal population (AM4 1 F5) as capture antibodies.
  • Figure 13 Box plot graphs of raw data of antibody screening.
  • the binding of AM4 MIL-38 antibody to each of the synthesized peptides was tested in a PEPSC A -based ELISA.
  • the botto and top of the boxes are the 25th and 75th percentile of the data.
  • the band near the middle of the box is the 50th percentile (the median).
  • the whiskers are at 1.5 the inter-quantile range, an indication of statistical outliers within the dataset (Mcgill ⁇ 3 ⁇ 4 #/., The American Statistician, 32: 12-16, 1978);
  • the present invention is based, in part, on the discovery that glypican-1 heparan sulfate proteoglycan (GPC-I) levels are elevated in the body fluids or cells of prostate cancer patients.
  • GPC-I glypican-1 heparan sulfate proteoglycan
  • the present inventors have discovered that glypican-1 is a new marker for prostate cancer.
  • the present invention provides for methods of detecting the existence of prostate cancer in patients. Normal human cells are only capable of forty to sixty cellular divisions before telomeric shortenings make them unviable. Prostate cancer cells however, are not subject to the Hayfiick limit of divisions and continue to divide indefinitely causing abnormal growths.
  • the prostate cancer tumors can be painless and asymptomatic, in other embodiments, the tumors can cause physical discomfort or other localized symptoms such as fluid blockages or bleeding.
  • the prostate cancer of the present invention may caus systemic symptoms such as those caused by disrupting normal body functions.
  • the symptoms of prostate cancers of the present invention can inc lude change in bowel habits or bladder function.
  • TNM tumor necrosis-associated neoplasm originating from the central nervous system
  • M metastasis
  • the present invention can detect cancers at any one or more stages.
  • the glypican-1 of the present invention is encoded by SEQ ID NO: 1.
  • the glypican-1 protein is the foil amino acid sequence of SEQ ID NO: 2.
  • the glypican-l protein does not include the signal peptide of SEQ ID NO: 3-
  • the glypican-1 protein does not include the propeptide of SEQ ID NO: 4,
  • the giypican-1 protein of the present invention is SEQ ID NO: 5.
  • glypican-I of the present invention includes glypican-1 variants such as isoforrns, splice variants, and allotypes.
  • the present invention also provides a method of determining a prognosis fo a patient with prostate cancer.
  • the method comprises obtaining a bod fluid or tissue test sample from a patient, measuring the levels of glypican-1 in said body fluid or tissue, and comparing said levels with a fixed range of values wherein higher glypican-1 levels are associated with poorer prognosis o less favorable patient outcome.
  • Non-limiting examples of prostate cancers that may be detected with the present invention include prostatic intraepithelial neoplasia, adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma
  • the present invention uses glypican-1 alone to detect prostate cancer.
  • GPC-1 is used together with another antigen wherein the presence of prostate cancer is determined by the detection of both antigens, in one embodiment, the other antigen is PSA.
  • Prostate cancer is the most frequently diagnosed visceral cancer and the second leading cause of cancer death for men in the United States.
  • the American Cancer Society estimates that in 2013 about 238,590 new cases of prostate cancer will be diagnosed and 29,720 men will die of the disease. Overall, one is six men wilt be diagnosed with prostate cancer in their lifetime.
  • Prostate cancers have been associated with many symptoms including difficulty urinating, erectile dysfunction and pain. Although most prostate cancers are slow growing, there are cases of aggressive prostate cancers which can metastasize and can ultimately lead to death.
  • the present invention describes methods for combining glypican- 1 measurements with another prostate cancer antigen, PSA, wherein the presence of prostate cancer is determined based on the levels of glypican-1 in the body fluid or tissue of the patient and the results of the PSA test,
  • BLCA-38 (also known as MIL-38) is an IgGi murine raised antibody against human bladder cancer cell line UC U-BL-17CL (Walker et al, 1 89). The resulting antibody was shown to bind to most huma bladder cancer lines (Russell et al.., .2004). The antibody was described as binding a cell surface protein of 30Kd and to be useful in. detecting certain kinds of bladder carcinoma (US PAT 5,622,836).
  • the present invention describes for the first time the identity of the MIL-38 antigen.
  • the present inventors discovered the antigen through a series of immunoprecipitations, westerns blot analyses, mass spectrometry analyses, and 2D gels described below in Examples 1-8.
  • any suitable agent and/or any suitable technique as known to those of skill i the art can be used to measure the levels of glypican- 1 in a given sample (e.g. a body fluid sample), and use the measurement to diagnose and or prognose prostate cancer in a patient from which the sample is derived.
  • die agent is an anti-glypican- 1 antibody.
  • MIL-38 antibody is used to bind to and detect a 60kD glypican- 1 proteoglycan. In some embodiments the MIL-38 antibody is used to detect the glypican-1 antigen on the surface of prostate cancer cells. In otlier embodiments, the MIL-38 antibody is used to detect soluble glypican- 1 in the body fluids or tissues of prostate cancer patients. In some embodiments, the MIL-38 antibody has binding specificity for a glypican- 1 epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVN ' PQGPGP (SEQ ID NO: 7).
  • the epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQNARAFRD (SEQ ID NO: 9).
  • TQNARA SEQ ID NO: 8
  • TQNARAFRD SEQ ID NO: 9
  • the present invention shows that MIL-38 > s ability to bind to prostate cancer tissue is based on the presence of the glypican-1 antigen and further demonstrates the use of other anti-glypican-1 antibodies to detect cancerous prostate cells. Therefore in some embodiments the anti-glypican- 1 antibody is not MIL-38. Further the present invention demonstrates the ability to detect prostate cancer by detecting glypican-1 levels in the body fluids or tissues of patients. The present inventors have thus discovered that glypican- 1 is a marker for prostate cancer.
  • glypican- 1 levels in body fluids or tissues can be detected using any suitable technique (e.g. any proteomic technique).
  • the glypican- 1 levels can be detected using an anti-glypican- ⁇ antibody.
  • the glypican- 1 levels can be detected using an anti-glypican-1 antibody that comprises: a heavy chain variable region comprising a complementarity determining region I (CDR l) comprising or consisting of an amino acid sequence defined by positions 50-54 of SEQ ID NO: 10; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 69-85 of SEQ ID NO: 10; a complementarity determining region 3 (CBR3) comprising or consisting of an amino acid sequence defined by positions 118-126 of SEQ ID NO: 10; and comprise a light chain variable region comprising a complementarity determining region 1 (CDR l ) comprising or consisting of an amino acid sequence defined by positions 44-54 of SEQ ID NO: 11; a complementarity determining region 2 ( D 2) comprising or consisting of an amino acid sequence defined by positions 70-76 of SEQ ID NO: 11; a complementarity determining region 3 (CDR3) comprising or consisting or consist
  • the anti-glypican-1 antibody used to detect the glypican- 1 levels may not ' comprise: a light chain variable region comprising a complementarity determining region 1 (CDR l ) comprising or consisting of an amino acid sequence defined by positions 48-58 of SEQ ID NO: 12; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 74-80 of SEQ ID NO: 12; and a complementarity determining region 3 (CDR3) comprising or consistin of an amino acid sequence defined by positions 1 13-121 of SEQ ID NO: 12.
  • CDR l complementarity determining region 1
  • CDR2 complementarity determining region 2
  • CDR3 complementarity determining region 3
  • one or more other anti-glypican-1 antibodies may be used to detect glypican- 1 in the body fluids or tissues of patients, in some embodiments, said other anti-glypican-1 antibodies can be any of the antibodies listed in (Table 2) of this application. In yet another embodiment, the antibody used to detect glypican- 1 in the body fluids or tissues of patients could be any antibody capable of binding glypican- 1. In some embodiments the antibodies of the present invention include antibody fragments or recombinant antibodies. In some embodiments the antibodies of the present invention include human antibodies, humanized antibodies and chimeric antibodies.
  • the antibodies of the present invention are conjugated antibodies
  • a non- limiting list of the antibody fragments- of the present invention include fragment antigen binding Fab, F(ab3 ⁇ 4, ScFv, Dt-scFv sdAb, chemically linked F(ab')2, bispecific antibodies, trispeciffc antibodies Fab3, Bis-scFv, Minibody bivalent antibodies, triabody bivalent antibodies, diabody bispecifrie antibodies, tetrabody tetravalent antibodies.
  • a new anti-glypiean-1 antibody can be generated from glypican-1 protein or a fragment or derivative thereof.
  • the anti -glypican- 1 antibody can be raised against a glypican- 1 epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVNPQGPGP (SEQ ID NO: 7).
  • the epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQNARAFRD (SEQ ID NO: 9).
  • TQNARA SEQ ID NO: 8
  • TQNARAFRD SEQ ID NO: 9
  • the glypiean-1 imniirnogen used to create the anti- glypican-l antibodies will include the post translational modifications of the native protein (e.g. folding).
  • the glypican- 1 immunogen will not include the signal peptide (SEQ ID No: 3), or the C-tenninal propeptide (SEQ ID No: 4) sequences.
  • the glypiean-1 imrnunogens are obtained from human or other mammalian cells such as transformed murine NSO, wild type DU-145, or other giypican-I expressing cell line.
  • the glypican- 1 antigen can be cells expressing glypiean- 1.
  • the glypican-1 immimogen can be whole cells or cell parts with glypican- 1 protein on their surface.
  • binding fragments or Fab fragments can be prepared from genetic informatio by various well-known procedures such as those described in (Borrebaeek et at., 1995; and US patent 7,960,5.17).
  • polyclonal antibodies targeting glypican-1 may be created for the detection of prostate cancer.
  • the polyclonal antibody targeting glypican-1 can be raised against a series of glypican- 1 epitopes including a glypican-1 epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVNPQGPGP (SEQ ID NO: 7).
  • the epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQNARAFRD (SEQ I NO: 9).
  • the glypiean-1 protein or fragment thereof may be injected into a host animal.
  • the host animals can include but are not limited to rabbits, mice, rats, etc.
  • the resulting sera is purified and tested for its ability to react with glypican-1 vi techniques well known in the art such as westerns, ELISAs, immunofluorescence screens, flow cytometry, Fluorescence Activated Cell Sorting (FACS) or others.
  • monoclonal antibodies (inAbs) directed against glypican- 1 may be created for the detection of prostate cancer.
  • the monocolonal antibody targeting glypican can be raised against a glypican-l epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVNPQGPGP (SEQ ID NO: 7).
  • the epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQMARAFRD (SEQ ID NO: 9).
  • anti-glypican-l antibodies are created via the hybridoma technique (Kohler and Milstein 1975), or other techniques (Cole et at, 1985; or US PAT 6,1 16,013). For more details and examples on antibody production see US PAT 7,985,560.
  • glypican- 1 is detected in the body fluids or tissues of patients by an anti-glypican-l antibody.
  • the body fluid sample obtained from the patient is a blood, serum, plasma, or mine sample.
  • glypican- l is detected in tissue samples of patients.
  • the tissue samples include tumor biopsies or other patient tissue.
  • the antibody detects glypican-l via Western blot analysis.
  • Enzyme-linked immunosorbent assays ELISAs
  • fluorescent cell sorting or FACS fluorescent cell sorting or FACS
  • immunofluorescence radiolabeling
  • imraunoprecipitation imraunoprecipitation
  • irarairaohistocheniistry immunoblotting
  • chemiluminescence and/or other known techniques to detect protein with an antibody or other ligand such as a protein capable of binding glypican-l .
  • glypican- I is detected vi a biofthn test, or affinit ring test as described in US application 2013/016,736.
  • glypican- l is detected via glypican-l binding agents coated to transparent surfaces (e.g. polycarbonate slides).
  • Binding of glypican-l or glypican-l bearing cells can be detected by changes in optical density.
  • anti- glypican-l antibody binding to said bod fluid or tissue sample is compared to the anri- glyplcan-1 antibody binding to one or more glypican-l calibration standards; wherein the anti-glypican-l antibody binding of the calibration standards is used to quantify the amount of glypican-l in said body fluid sample.
  • the calibration standards comprise one or more samples with known glypican-l concentrations.
  • the measurement of glypican- 1 is accomplished by contacting said body fluid or tissue sample with glypican-l ligand.
  • the ligand can be an anti-glypican- l antibody capable of binding the glypican-l proteoglycan.
  • the tissue ox body fluid of a patient may require a pre- rreatment prior to detection by the anti-glypican-l ligand.
  • said pre- treatment may include treatment with agents such as heparinase FNGaseF, N-Glycosidase, alkaline phosphatase, or heparitinase among others.
  • said pre-treatment may include tissue lysis, membrane purification, blood plasma or serum fractionation, cell purification, or protein purification among others.
  • the measured levels of ' .glypican-l in. the body fluid or tissue of a patient are compared against a control sample of body fluid or tissue from a cancer-free patient in other embodiments the measured levels of glypican-l in the body fluid or tissue of a patient are compared against pre-detenriined reference values or ranges of reference values, in other embodiments, the levels of glypican-l in body fluids or tissues of a patient are indicative of prostate tumor size, or progression.
  • the detection of glypican-l from body fluid or tissue samples is conducted via Enzyme-linked immunosorbent assays (ELISAs).
  • ELISAs comprise those based on colorimetry, chemiluminescence, and fiuorometry.
  • ELISAs have been successfully applied in the determination of low amounts of drugs and other antigenic components in body tissues or fluids such as blood, serum, and plasma samples, and are well known in the art
  • An ELISA that is useful in the present invention may employ any suitable capture, reagent and detectable reagent including antibodies and derivatives thereof, protein ligands and the like, in certain embodiments, the ELISA is cell-based, in other embodiments, the ELISA detects cell-free antigens, in some embodiments the biological sample suspected of containing glypican-l is contacted and incubated with the capture (or coat) antibodies so that the capture antibodies capture or hind to the glypican- l .
  • the detection step involves use of the detectable antibody or detectable protein ligands, which can. bind to said glypican-l and be used to detect the presence or amount of glypican- l based on detection of its label.
  • the biological sample is contacted and incubated with the immobilized capture (or coat) reagent, which can be a glypicao-l antibody.
  • This antibody may be from any species, but in some embodiments the antibody is a murine or rat antibody. In other embodiments the antibody is a murine antibody. In other embodiments the antibody is derived from a hybridoma.
  • the glypican-l antibody is a recombinant antibody or antibody fragment. Immobilization conventionally is accomplished by insolubilizing the capture reagent either before the assay procedure, as by adsorption to a water-insoluble matrix or surface (U.S. Pat No.
  • non-covalent or covalent coupling for example, using glutaraldehyde or carbodiiraide cross-linking, with or without prior activation of the support with, e.g.,. nitric acid and a reducing agent as described in U.S. Pat. No. 3,645,852 or in Rotmans et aL, 1983), or afterward, e.g., by immunoprecipitation.
  • glutaraldehyde or carbodiiraide cross-linking with or without prior activation of the support with, e.g.,. nitric acid and a reducing agent as described in U.S. Pat. No. 3,645,852 or in Rotmans et aL, 1983
  • afterward e.g., by immunoprecipitation.
  • the solid phase used for immobilization may be any inert support or carrier that is essentially water insoluble and useful in immunometric assays, including supports in the form, of, e.g., surfaces, particles, porous matrices, etc.
  • supports in the form, of, e.g., surfaces, particles, porous matrices, etc.
  • commonly used supports include small sheets, Sephadex, polyvinyl chloride, plastic beads, and assay plates or test tubes manufactured from polyethylene, polypropylene, polystyrene, and the like including 96-well microtiter plates, as well as particulate materials such as filter paper, agarose, cross-linked dextran, and other polysaccharides.
  • reactive water- insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described in LIS.
  • Pat. Nos. 3,969,287; 3,691 ,016; 4,1.95,128; 4,247,642; 4,229,537; and 4,330,440 are suitably employed for capture reagent immobilization.
  • the immobilized capture reagent is coated on a microtiter late, and in particular the solid phase used is a multi-well microtiter plate that can be used to analyze several samples at one time, e.g., a microiest 96-well ELISA plate such as that sold as Nunc Maxisorb or Immulon.
  • the plate is a MICROTESTTM o MAXiSORPTM 96- well ELISA plate such as that sold as NUNC MAXISORBTM or IMMULONTM.
  • the solid phase is coated with the capture reagent as defined above, which may be linked by a non-covalent or covIER interaction or physical linkage as desired.
  • Techniques for attachment include those described in U.S. Pat. No. 4,376,110 and the references cited therein. If covended, the plate or other solid phase is incubated with a cross-linking agent together with the capture reagent under conditions well known in the art, e.g., such as for I hour at room temperature.
  • commonly used cross-linking agents for attaching the capture reagent to the solid phase substrate include, e.g., l,l-bis(diazoacetyl)-2-phenylethaiie, gluiaraldehyde, N-hydroxy-s ccinimide esters, for example, esters with 4-azido-salicylic acid, homobifunctional imidoesters, including disuccmimidyi esters such as 3,3'-dithiobis- ⁇ succiniroidyl-propionate), and bifunctiona! malermides such as bis-N-maleimido-1 ,8-octane.
  • Derivatizing agents such as methyl-3-[ip-azidophenyl)-dithio]pro-pioimi-date yield photoactivatahle intermediates capable of forming cross-links in the presence of light.
  • 96-weM plates are utilized.
  • the 96-well plates are coated with the capture reagent (typically diluted in buffer such as 0.05 M sodium carbonate by incubation for at least about 1.0 hours, more preferably at least overnight, at temperatures of about 4-20 C, or about 4-8°C, and at a pH of about 8-12, or about pH 9-10, or about pH 9.6). If shorter coating times are desired, in some embodiments the plate can be coated for less time, e.g.
  • the plates may be stacked and coated long in advance of the assay itself, and then the assay can be carried out simultaneously on several samples in a manual, semi-automatic, or automatic fashion, such as by using robotics.
  • the coated plates can be treated with a blocking agent that binds non-specifically to and saturates the binding sites to prevent unwanted binding of the free ligand to the excess sites on the wells of the plate.
  • a blocking agent that binds non-specifically to and saturates the binding sites to prevent unwanted binding of the free ligand to the excess sites on the wells of the plate.
  • appropriate blocking agents include, e.g., gelatin, bovine serum albumin, egg albumin, casein, and non-fat milk.
  • the blockin treatment can take place under conditions of ambient temperatures for about 1 -4 hours. In other embodiments the blocking can take place over the course of 1 to 3 hours or less. In other embodiments the blocking can take place overnight at 0-4°C.
  • the glypican-1 standard e.g. purified glypican-I protein
  • the biological sample to be analyzed, appropriately diluted is added to the immobilized phase.
  • the dilution rate is about 1-15% by volume.
  • the glypican-1 protein standard will include the post-transiationai modifications of the native protein.
  • the glypican-1 protein standards are obtained from human or other mammalian celts such as transformed ' 1S1S0, wild type DU-145, or other glypican-I expressing cell line.
  • the glypican-1 protein may be purified from body fluids or tissues.
  • the glypican- 1 standard will be a partial glypican-1 peptide or other epitope detected by the glypican-1. detection antibody, or ligand.
  • the standard can be a cell expressing glypican-I .
  • tbe dilution is about 10% by volume.
  • a non-limiting group of buffers that may be used for dilution for this purpose include (a) PBS containing 0.5% BSA, 0.05% TWEEN 20TM detergent (P20), 0.05% PROCLINTM 300 antibiotic, 5 mM EDTA, 0.25% CHAPS surfactant, 0.2% bovine ⁇ -globulins, and 0.35M NaCl, pH 7,4; (b) PBS containing 0.5% bovine serum albumin, 0.05% polysorbate 20, 5 mM EDTA, 0.25% CHAPS, 0.2% bovine y-globulins, and 0.35 M NaCl; pH 7.4 (c) PBS containing 0.5% BSA, 0.05% polysorbate 20 (P20), and 0.05% PROCLINTM 300, pH 7; (d) PBS containing 0.5% BSA, 0.05% P20, 0.05% PROCLINTM 300, 5 mM EDTA, and 0.35 M NaCl, pH 6.35; (e) PBS containing 0.5% BSA, 0.05%
  • PROCLINTM 300 acts as a preservative
  • TWEEN 20TM acts as a detergent to eliminate non-specific binding.
  • the concentration of the capture reagents will generally be determined by the concentration range of interest of the glypican- 1 taking any necessary dilution of the biological sample into account, the final concentration of the capture reagent will normally be determined empirically to maximize the sensitivity of the assay ove the range of interest.
  • the conditions for incubation of sample and immobilized capture reagent are selected to maximize sensitivity of the assay and to minimize dissociation.
  • the incubation is accomplished at fairly constant temperatures, ranging from about 0°C to about 40°C, in other embodiments the incubation is conducted from about 20 to 25 °C.
  • the time for incubation depends primarily on the temperature, being generally no greater than about 10 hours to avoid an insensitive assay. In some embodiments the incubation time is from about 0.5 to 3 hours. In other embodiments the incubation is about 1.5-3 hours or less at room temperature to maximize binding of free glypican-l to capture reagents.
  • the duration of incubation may be longer if a protease inhibitor is added to prevent proteases in the biological fluid from degrading the glypican-l.
  • the detection method is a competitive EL ISA.
  • the incubation step includes the addition of unbound and unlabeled antibody.
  • the known concentration of unlabeled antibody binds the free glypican- 1 antigen and prevents it from becoming immobilized on the plate, in some embodiments the incubation step includes the addition of labeled glypican-l protein of known concentrations.
  • the amount of glypican-l in the body fluid or tissue sample is detected as a diminishing binding of the mixed labeled glypican-l protein.
  • the ELISA is a sandwich ELISA.
  • the pH of the incubation mixture will ordinarily be in the range of about 4-9,5. in other embodiments the pH range will be about 6-9. In yet another embodiment the pH range will be about 7-8.
  • the pH of the assay (ELISA) diluent is pH 7,4.
  • the pH of the incubation buffer is chosen to maintain a significant level of specific binding of the capture reagent to the glypican-l being captured.
  • Various buffers may be employed to achieve and maintain the desired pH during this step, including borate, phosphate, carbonate, Tris-HC ' l. or Trls-phosphate, acetate, barbital, and the like.
  • the particular buffer employed is not critical to the invention, but in individual assays one buffer may be preferred over another.
  • the biological sample is separated (preferably by washing) from the immobilized capture reagent to remove uncaptured molecules.
  • the solution used for washing is generally a buffer ("washing buffer") with a pH determined using the considerations and buffers described above for the incubation step, hi one embodiment, the pH range of the washing buffer is about 6-9.
  • the washing may be done one or more times.
  • the temperature of washing is generally from refrigerator to moderate temperatures, with a constant temperature maintained during the assay period, typically from about 0-40 c' C. In other embodiments the washing temperature is about 4-3G 9 C.
  • the wash buffer can be placed in ice at 4°C in a reservoir before the washing, and a plate washer can be utilized for this step, A cross-linking agent or other suitable agent ma also be added at this stage to allow the now-bound glypican-i to be covalentiy attached to the capture reagent, if there is any concern that the captured glypican-1 may dissociate to some extent in the subsequent steps.
  • the immobilized capture reagent is contacted -with detectable antibodies.
  • the detectable antibodies are anti -glypican- 1 antibodies.
  • the anti-glypican-I antibod is MIL-38.
  • the antibodies are those described in table 2.
  • tiie detectable antibodies are any antibody capable of detecting glypican-1.
  • the detectable antibody is contacted with the immobilized glypican-1 at a temperature of about 2G-40°C.
  • tire detectable antibody is contacted at about 20-25 °C, with the exact temperature and time for contacting the two being dependent primarily on the detection means employed.
  • the contacting is carried out (e.g., about 1 hour or more) to amplif the signal to the maximum.
  • a. molar excess of an antibody or iigand with respect to the maximum concentration of expected free glypican- 1 is added to the plate after it is washed.
  • This antibody is directly or indirectly detectable.
  • the detectable antibody may be a polyclonal or monoclonal antibody, e.g., in certain embodiments, it is a monoclonal antibody, in.
  • the detectable antibody can be directl detectable, and in one embodiment has a oolorimetric label, and in another embodiment has a flurometric label.
  • tbe detectable antibody is biotinylated and the detection means is avidin or streptavidin- peroxidase and 3,3 ⁇ 5,5'-tetramethyl benzidine.
  • the detectable antibody may be labeled with a biotin-avidm amplification system, a. chemihuninescence system, microspheres, or colloidal gold.
  • the readout of the detection means can be fluorimetric or colorimetric among others.
  • the affinity of the antibody must be sufficiently high that small amounts of the free glypican-1 can be detected.
  • the glypican-1 that is bound to the capture reagent is measured using a detection means for the detectable antibody. If the body fluid or tissue sample is from patient, the measuring step comprises comparing the reaction that occurs as a result of the above steps with a standard curve to determine the level of glypican-i in said body fluid or tissue sample, in other embodiments the reaction that occurs as a result of the above steps is compared to a similar reaction using a control body fluid or tissue sample such as the bod fluid or tissue of a age-matched cancer-free individual .
  • the glypican-1. in the body fluid of patients is detected via a Western Blot Analysis, in some embodiments this assay separates the proteins in complex sample using electrophoresis. In other embodiments the electrophoresis separation is performed in a size exclusion gel such as a sodium dodecyl sulfate polyacrvianiide gel (commonly known as SOS-PAGE). In one embodiment the separated proteins are then transferred to a membrane.
  • a size exclusion gel such as a sodium dodecyl sulfate polyacrviissusde gel (commonly known as SOS-PAGE).
  • SOS-PAGE sodium dodecyl sulfate polyacrvianiide gel
  • the separated proteins are then transferred to a membrane.
  • the membrane is made from nitrocellulose or p lyvifcylidene fluoride, PVDF.
  • the transfer occurs in a protein transfer box such that the proteins retain the same separation pattern on the membrane as they had in the gel.
  • the membrane is then incubated in diluted protein solutions, e.g. non-fat dry milk or bovine serum albumin (BSA), to block the non-specific binding sites.
  • BSA bovine serum albumin
  • the blocked membrane can then be incubated with a primary antibody that is specific for the glypican-1 target protein.
  • the membrane is then washed and incubated with a secondary antibody that targets the first antibody, hi some embodiments the first or the second antibody is conjugated to a detectable label such that it can be easily detected.
  • the label includes a fluorescent label, a chemiluminescent label, radiolabef or another label well known in the art.
  • said labels conjugated to the secondary ligand are chosen .from a group consisting of a radiolabel. a fluorescent label, a biotin-avidin amplification system, a chemiluminescence system, microspheres, and colloidal gold.
  • the primary and (optional) secondary antibodies can be snipped from the membrane, and the membrane can be incubated with, an alternative primary antibody that is specific for the same or another protein.
  • the second protein may be used as a loading control. In other embodiments the second protein is another marker for patient health.
  • glypican-1 is detected via flow cytometry. In some embodiments glypican-1 is detected on the cell surface of cells in patient bod fluids or tissues. In certain aspects of the invention the detection of glypican-1 for flow cytometry may be conducted as outlined below, in some embodiments, cells from body fluids or tissues are purified. The purification of the cells can include a neutralization step. In some embodiments the neutralization step comprises storing the cells in neutralization buffer.
  • the neutralization buffer can be made by combining 39ml of 0.2 M aB 2 P0 4 to 61tnl of 0.2M Na 2 HP0 4 and adding water to 200ml, hi some embodiments, the cells are cenirifuged and resuspended in different solutions. In other embodiments, the cells are sorted without purification, in some embodiments the cells are resuspended or washed in CytoLyt solution, in other embodiments the cells axe resuspended or washed in phosphate buffered saline (PBS), to some embodiments the cell suspension is treated with ammonium chloride to lyse the red blood cells. In some embodiments the cells are fixed onto slides.
  • PBS phosphate buffered saline
  • the cells remain free, in some embodiments, cells are contacted with a primarily anti-glypican-1 antibody or other ligand.
  • the primary antibody is MIL-38. In some embodiments the primary antibody is not MIL-38. In other embodiments the primary antibody is any other anti-gtypi.can-1 antibody (Table 2). in certain embodiments, the cells are further contacted with a second detection antibody conjugated to a detection label In alternative embodiments, the antigen may be detected directly by the primary antibody if the primary antibody is conjugated to a detection label.
  • the cells may be distinguish ably labeled with other probes, including, but not limited to, antibodies to cell surface markers that distinguish one cell type from another.
  • the other probes may be used to normalize signals or total cell counts.
  • the other probes label intracellular antigens, In other embodiments the other probes label extracellular antigens.
  • the labeled cells may be isolated by FACS flow cytometry.
  • the FACS machine may isolate labeled cells singly (i.e., as single cells).
  • the labeled cells may be isolated as a mixed population, and then diluted into single cells after FACS.
  • the second label can be a dye.
  • the dye label is DAPI.
  • DAPI labeling is used to quantify the number of cells in the sample.
  • the ceils may be selected using a plurality of different properties. For example, cells may first be sorted by one probe and then another. In some embodiments cells ca first be sorted by cell type and later be sorted by glypican-1 concentration. Similarly cells may be sorted i any sequence as designed together with the probes and the detection of the FACS machine.
  • fluorescence activated cell sorting including methods b which single cell suspensions can be made, methods by which cells can be labeled using, e.g., fluoresceirtly labeled probes, methods by which cells can be separated, from one another, as well as hardware that, can be employed in flow cytometry, including flow cells, reagents, and computer control systems are know and are reviewed in. a variety of publications, including, but not limited to: (Orfao et al., 1996; Johnson et al., 2007; Tung et al., 2007; and Dainiak et al., 2007).
  • kits for detecting glypican-1 in the body fluids or tissues of patients comprises the materials necessary to conduct any of the detectio assays described in this application.
  • the kit for detecting cancer comprises a first anti-glypican-l antibody or other ligand, a pharmaceutically acceptable cairier, and glypican-1 standards; wherein said kit is capable of detecting glypican-1 in the body fluid or tissue of a patient.
  • the first anti-glypican- 1 antibody may or may not be MIL-38.
  • the first anti-glypican-l antibody may comprise: a heavy chain variable regio comprising a complementarity determining region 1 (CDRl) comprising or consisting of a amino acid sequence defined by positions 50-54 of SEQ ID NO: 10; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 69-85 of SEQ ID NO: 10; a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 118-126 of SEQ I D NO: 1.0; and comprise a light chain variable region comprising a complementarity determining region 1 (CDRl ) comprising or consisting of an amino acid sequence defined by positions 44-54 of SEQ ID NO: 11; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 70-76 of SEQ ID NO; 1 1 ; a complementarity determining region 3 (CDR3) comprising or consisting of a amino acid sequence defined
  • the anti-glypican-l antibody used to detect die glypican-1 levels may not comprise: a light chain variable region comprising a complementarity determining region 1 (CDR l ) comprising or consisting of an amino acid sequence defined by positions 48-58 of SEQ ID NO: 12; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 74-80 of SEQ ID NO: 12; and a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 1 13-121 of SEQ ID NO: 1 .
  • CDR l complementarity determining region 1
  • CDR2 complementarity determining region 2
  • CDR3 complementarity determining region 3
  • the first anti-glypican-l antibody may be produced by or otherwise identical to an antibody generated by hybridoma cells as deposited on 22 August 2014 at CellBank Australia (CBA) under accession number CBA20140026.
  • the kit will require the additional use of standard laboratory tools or machinery.
  • necessary tools include pipettes, cell sorting machines, plate readers, centrifuges etc as are known, to those being skilled in the art.
  • use of the kit may require additional standard laboratory reagents such as pipette tips, membranes, buffers, or chemicals as are well known by those being skilled in the art.
  • the kit further comprises a secondary ligand.
  • the secondary ligand is a second anti ⁇ glypican-l antibody.
  • the second anti-g!ypican a tibody is the same as the first anti-glypican-l antibody.
  • the secondar ligand is conjugated to a label for rapid detection of said ligand.
  • the antibodies of the kit can be antibody fragments or antibody combinations as described, in this application.
  • the detection of glypiean-I in the body fluids or tissues of a patient is indicative of the presence of prostate cancer.
  • the detection of glypican-I in the body fluids or tissues of a patient is indicative of the presence of prostate cancer.
  • the detection of glypican- i in the body fluids or tissues of a patient is indicative of the presence of prostate cancer.
  • the presence of I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1.1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 2.9, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 ⁇ / ⁇ ! of glypican- 1 in the body fluid or tissue of a patient is indicati ve of prostate cancer.
  • elevated levels of glypican- 1 , or glypican- 1 detection signal in the body fluid or tissue of a patient is indicative of prostate cancer.
  • the glypican- 1 levels of cancer patients are 1%, 2%, 3%, 4, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%.
  • MIL-38 antigen As a 30kD protein (Russell el i 2004), work. by the present inventors has indicated that the MIL-38 antibody predominantly detects a 60kDa antigeti in a range of cell extracts. Western blot reactivity of MIL-3S with the antigen is lost if the sample has been incubated with reducing agents prior to gel electrophoresis.
  • MIL-38 antibody for imnmnoprecipitation experiments we were able to specifically isolate the 60kDa protein from a variety of cell extracts.
  • live cells were incubated on ice with serum-free media containing the MIL-38 antibody. Cells were then washed, lysates prepared and incubated with protein G beads to isolate any antibody associated with the cells. The 60kDa band was present in these immunoprecipitates indicating that the antigen was recognized on the cell surface by the MIL-38 in the media.
  • Example 2. MIL-38 antigen immunoprecipitation and mass spectrometry
  • DIM 45 prostate cancer cells were processed through a membrane protein extraction kit (MPEK).
  • MPEK membrane protein extraction kit
  • MIL-38 cross-linked to magnetic beads The immunoprecipitates were either run into a gel and excised for mass spectrometry analysi or were eiuted directly from the beads and the subjected to mass spectrometry.
  • Antigens bound to the MIL-38 antibody were then analyzed via mass spectrometry analysis, which can identify peptides based on mass/charge data.
  • the mass spectrometer identified glypican-1 with a peptide score of 4278 and sequence coverage of 46% including I S distinct sequences ( Figure I).
  • Example 3 MIL-38 antigen immunoprecipitation, size exclusion chromatography and mass spectrometry.
  • DU-145 prostate cancer cells were processed through a membrane protein extraction kit (MPEK).
  • MPEK membrane protein extraction kit
  • Membrane extracts were immunoprecipitated with MIL-38 cross-linked to magnetic beads. Following extensive washing, the immunoprecipitate was eiuted in TBS (tris buffered saline) containing 2% SDS. The eluate was subjected to size exclusion chromatography (SEC) and every second fraction was acetone precipitated, resuspended in sample loading buffer and used for MIL-38 western blots.
  • Fractions 28 and 30 contained high amounts of MIL-38 antigen (Figure 2), indicating that fraction 29 would also contain high concentrations of the MIL-38 antigen.
  • Fraction 29 was subjected to mass spec analysis and glypican- ⁇ was identified with sequence coverage of 14% ( Figure 3). This further confirmed that the antigen for the MIL-38 antibody was glypican-1.
  • Example 4 MIL-38 and anrl-gl ican-l (anti-GPC-l) antibodies show overlapping reactivity on 2D western blots.
  • a rabbit anti-GPC- 1 antibody was purchased and showed reactivity with the glypiean- 1 core protein at a molecular weight of approximately 60 kDa ,- the same molecular weight as detected by MIL-38.
  • MIL-38 recognized glypican-l.
  • prostate cancer DU-145 MPEK extracts were subjected to 2D electrophoresis and western blotting.
  • MIL-38 antibod and the anti-GPC-l antibodies showed overlapping reactivity detecting a protein with 60 kDa molecular" weight and isoelectric points ranging from 5 to 7.
  • Example 5 MIL-38 is detected in anti-GPC-l inimunoprecipitates and vice versa.
  • MIL-38 or rabbit anti-GPC-l antibodies were used to tmmonopreeipitate their respective antigens from DU-145 or C3 (MIL-38 negative) MPE extracts.
  • the immunoprecipitates (IPs) were western blotted with either MIL-38 or anti-GPC-l antibody ( Figure 5).
  • the first source was a truncated form produced from wheat germ extracts (note this would not contain appropriate mammalian post-trans lational modifications).
  • the second source was full-length g!ypican-1 produced in murine NSO cells. No MIL-38 reactivity was observed with the wheat germ expressed glypican-1, however it could be detected with the rabbit anti-GPC-l antibody (data not shown). In contrast, very strong reactivity with MIL-38 and anti-GPC-l antibodies was observed for the glypican- 1 produced in NSO cells ( Figure 6),
  • Example 7 MIL-38 can detect antigen secreted into cell culture supernatant.
  • Example 8 G.PC-1 can be detected by MIL-38.in prostate cancer plasma samples and in membrane extracts from prostate cancer patients.
  • Example 9 Detection of MIL-38 antigen in patient urine.
  • MIL-38 can detect cells in the urine of prostate cancer patients. To test the sensitivity and specificity of this detection method, 125 age-matched urine samples were obtained. Cells were spun down from the urine and analyzed by the MIL-38 indirect immunofluorescence assay. A total of 47 healthy controls, 37 benign prostatic hypertrophy (BPH) and 41 biopsy- confirmed prostate cancers were analyzed. Examples of positive prostate cancer cells, DU- 145 positive controls and C3 negative cells are shown ( Figure 10).
  • the MIL-38 immunofluorescence assay (IF A) test demonstrated a sensitivity of 71% and a specificity of 73% in identifying prostate cancers within the cohort. The test showed 71% sensitivity and 76% specificity in identifying prostate cancers compared to BPH patients. (Table 3). Table 3. Sensitivity and specificity calculations of prostate cancer detection in patient urine.
  • Example 10 Combination of MIL-38 antigen detection with PSA level increases ability to detect prostate cancer.
  • PSA > 2 na 'ml PSA 4 sa/ffll Cancer
  • Example 11 MIL-38 can detect recombinant glypican-1 in a variety of ELISA formats.
  • BLCA-38 hybridoma is a mixed population of hybridoma cells that produces two distinct antibody populations, referred to here as "AM3" and "AM4".
  • A3 hybridoma cells that produces two distinct antibody populations
  • AM4 Hybridoma cells responsible for producing each different antibody population were separated, and the "AM 4" hybridoma cells were deposited on 22 August 2014 at CeilBank Australia (CBA) under accession number CBA20.140026.
  • the first ELISA described above was developed using MIL-38 to capture NSO produced GPC-1 (i.e. MIL-38 antigen). This experiment compared monoclonal AM3 MIL-38 and monoclonal AM4 MIL-38 for capture. AM3 did not function as a capture agent in a sandwich ELISA assay, whereas AM4 was shown to do so (Figure 12A).
  • the second ELISA described above compared the ELISA signal obtained whe a mixed population of MIL-38 (AM3 and AM4) was compared to that obtained from a monoclonal AM4 1 F5 clone.
  • AM4 IF5 as a capture agent provided a higher ELISA signal than using the mixed 34A antibody population ( Figure 12B).
  • the sandwich ELISA results demonstrate that only the AM4-like forms of the monoclonal MIL-38 antibody have utility in detecting glypican-i antigen as a capture reagent and that a capture agent containing a monoclonal population provides a superior ELISA signal to that consisting of a mixed population.
  • the first run (coded 224945) utilised bi-clonal hybridoma cells from a mixed (AM4 and AM3) preparation named 1-0.
  • the second run (coded 449295- 1) utilised cells from Alfio I a hybridoma stock that was used to generate AM4.
  • the third run (coded 449295-5) utilised cells from Alfio II, a hybridoma stock that was used to generate AM3.
  • Amplified antibod fragments were separately cloned into a standard cloning vector using standard molecular cloning procedures.
  • Colon PCR screening was performed to identify clones with inserts of correct sizes.
  • V H and V piasmids encoded the full-length variable regions of the antibody and a part of Cii l and C i: .
  • C L plasmid encoded a part of C L In order to get full-length constant regions or heavy light chain, the part, of constant regions encoded by V H and V L piasmids and the part of constant regions encoded by C A and L piasmids were amplified by PCR separately, and then overlap extension PCR was employed to obtain full-length DNAs. Five single colonies with correct V H , V L , Ca and C L insert sizes were sent for sequencing.
  • Sequencing run 449295-5 encountered difficulty obtaining sequence corresponding to the expected IgG! heavy chain sequence.
  • Two UNA preparations were performed.
  • oligo-elT primer and CDS III primers were used for reverse transcription (RT).
  • VH/CH and VK/CK were amplified by PCR using TgGl and Tg specific primers, partial mouse ⁇ -actin gene was amplified as positive control. Normal light chain bands were obtained easily while only weak VH could be observed on the gel.
  • Five individual colonies with correct V and C& insert sizes were sent fo sequencing. The VK and CK genes of five different clones were found to be nearly identical.
  • the consensus light chain sequences from the Alfio 0 hybridoma is listed below.
  • One unproductive heavy chain sequence was obtained from eight randomly sequenced VH positive clones, shown as below.
  • Three kinds of heavy chain constant region sequences were obtained from ten randomly sequenced CH positive clones (one IgGiCH, one and eight IgGsbCi-i).
  • IgGiCH one and eight IgGsbCi-i
  • amplification of the CR using IgM specific primer was performed, but no target PCR product was obtained.
  • oligo-dT primer was used for reverse transcription initially.
  • VH was amplified using IgCi i , IgG2b, Ig , IgA specific primers and IgG degenerate primer, respectively, and YK was amplified using Igf specific printers.
  • Reverse transcription using Random 6 mers primer was also attempted without success.
  • Table 5 provides an overview of heavy and light chain nucleic acid and protein sequences of the antibodies studied, indicating the positions of various internal regions.
  • HFR heavy chain framework region HCDR heavy chain complementarity determming region
  • CM heavy chain constant region
  • LCDR light chain complementarity determining region
  • CL light chain constant region
  • Grey Boxes are indicative of positions within sequence defined in column I by SEQ ID NO.
  • RNA of the sample was ru alongside a DNA marker (Marker III -
  • PCR products of each sample were ran alongside the DNA marker (Marker HI) on a 1.5% agarose/GeiRed !M gel.
  • the PCR products were purified and stored at -20 £ C until further use.
  • V H> Vj , C-B. and Q, genes of five different clones were nearly identical.
  • the consensus sequence, listed below, was detennined to be the sequence of the antibody produced by the monoclonal hybridom population (AM-4).
  • ImJivki i regions of mouse light chain encoded sequence are highlighted with alternating shaded/unshaded text.
  • Positions: i-6() leader sequence; 61-129 framework region (IFRi); 130- 162 - complementarity determining region (ICDRi); 163-207 LFR2: 208- 22& ⁇ LCDR2: 229-324 ⁇ 1.FR3: 325-3S1 ⁇ lO)R3: 352-381 LF.R4: 382-702 - constant regions (CK); 703-705 ⁇ stop codon.
  • mice IgG I heavy chain sequence are indicated in the amino acid sequence above. Positions 1-19 leader sequence; 20-49 - framework region (HFRl); 50- 54 complementarity determining region 1 (HCDl); 55-68 - ⁇ HFR2; 69-85 HCDR2: 86- 117 - HFR3; 118-126 - HCDR3; 127-137 - BFR4 (also called the joining region or J- region); J 38-461 IgG I. chain constant regions (CHI ( ⁇ 3) & stop codon (*). Hinge region - is underl ined in the sequence above. 'VM4 consensus M1L-3 S Light Chain Amino Acid Consensus Sequence (SEP ID NO: 11)
  • LFRl framework region
  • I complementarity determining region
  • Example 14 identification and characterisation of glypiean-l epitope bound by AM4 anti-glypkaii-1 antibodies
  • Table 6 below provides information on the AM4 anti-giypican- 1 antibodies used in this study.
  • the h man glypican-i (GPC-I ) sequence on which this study was based is defined in SEQ ID NO: 16. The following sequences of residues were used:
  • GPC1 res idues # 343- 366 GN PKVNPOG PGPEBKRRRG LAP (SEQ ID NO: 17)
  • CLIPS technology structurally fixes peptides into defined three-dimensional structures. This results in functional mimics of even the most complex binding sites. CLIPS technolog is now routinely used to shape peptide libraries into single, double or triple looped structures as well as sheet- and helix-like folds.
  • the CLIPS reactio takes place between bromo groups of the CLIPS scaffold and thiol sidechains of cysteines. The reaction is fast and specific under mild conditions. Using this chemistry, native protein sequences are transformed into CLIPS constaicts with a range of structures- including single- T2 loops, T3 double loops, conjugated T2+T3 loops, stabilized beta sheets, and stabilized alpha helixes (Timmerman ei ah, J. MoL Recognit. 2007; 20: 283- 29).
  • CLIPS library screening starts with the conversion of the target protein into a library of up to 10,000 overlapping peptide constructs, using a combinatorial matrix design.
  • a matrix of linear' peptides is synthesized, which are subsequently shaped into spatially defined CLIPS constaicts.
  • Constructs representing both parts of the discontinuous epitope in the correct conformation bind the antibody with high affinity, which is detected and quantified.
  • Constructs presenting the incomplete epitope bind the antibody with lower affinity, whereas constructs not containing the epitope do not bind at all.
  • Affinity information is used in iterative screens to define the sequence and conformation of epitopes in detail.
  • the target protein containing a discontinuous conformational epitope is converted into a matrix library.
  • Combinatorial peptides are synthesized on a proprietary minicard and chemically converted into spatiall defined CLIPS constaicts. Binding of antibodies is quantified.
  • CLIPS Chemically Linked Peptides on Scaffolds
  • a 0.5 raM solution of the T2 CLIPS template 1 ,3-bis (bromomethyl) benzene was dissolved in ammonium bicarbonate (20 aiM, pH 7.9)/acetonitriie (l: l(v/v)). This solution was added onto the peptide arrays.
  • the CLIPS template bound to side-chains of two cysteines as present in the solid-phase bound peptides of the peptide-arrays (455 wells plate with 3 ⁇ wells). Tire peptide arrays were gently shake in the solution for 30 to 60 minutes while completely covered n solution.
  • peptide arrays were washed extensively with excess of 3 ⁇ 4Q and sonicated in disrupt-buffer containing 1 percent SDS/0.1 percent beta-mercaptoethanol in PBS (pH 7.2) at 70°C for 30 minutes, followed by sonication in i3 ⁇ 40 for another 45 minutes.
  • the T3 CLIPS carrying peptides were mad in a similar way but with three cysteines.
  • cysteines are placed at the termini and in between the two peptides. These are linked by a T3 CLIPS.
  • the binding of antibody to each of the synthesized peptides was tested in a PEPSCAN- based ELISA.
  • the peptide arrays were incubated with primary antibody solution (overnight at 4°C). After washing, the peptide arrays were incubated with a 1/1000 dilution of an antibody peroxidase conjugate (SB A, cat.nr.2010-05) for one hour at 25°C. After washing, the peroxidase substrate 2,2 , -azino-di-3-etliylbenzthiazoline sulfonate (ABTS) and 2 ⁇ /ml of 3 percent H202 were added. After one hour, the color development was measured. The color development was quantified with a charge coupled devic (CCD) - camera and an image processing system.
  • CCD charge coupled devic
  • the values obtained from the CCD camera range from 0 to 3000 mAU, similar to a standard 96-well plate ELISA-reader.
  • the results are quantified and stored into the Peplab database. Occasionally a well contains an air-bubble resulting in a false-positive value, the cards are manually inspected and any values caused by an air-bubble are scored as 0.
  • Table 7 summarises antibody binding conditions. For the Pepscatt Buffer and Preconditioning (SQ), the numbers indicate the relative amount of competing protein (a combination of horse serum and ovalbumin). able 7: screening conditions
  • FIG. 1.3 A graphical overview of the complete dataset of raw ELISA results generated by the screening is shown in Figure 1.3.
  • a box plot depicts each dataset and indicates the average ELISA signal., the distribution and the outliers within each dataset.
  • experiment conditions amount of antibody, blocking strength etc
  • MIL 38- AM4 binds glypican on stretch 348 VNPQGPG ' PEEK 35 8 (SEQ ID NO: 22), and also binds to the stretch i 35 TQNARA i4 o (SEQ ID NO: 8)/ 335TQNARAF D 14 (SEQ ID NO: 9), which was taken as an indication for a discontinuous epitope.
  • the M1L38 - AM4 antibody investigated in this study binds to an epitope that exclusively or mainly consists of the flexible loop between residues 347 and 358.
  • Monoclonal antibody MIL38-AM4 mainly binds glypican-l on the loop between residues 347-355, but this antibody clearly benefits from the addition of residues from the range 135-140 or 135-143 to the peptide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention provides compositions and methods of detecting prostate cancer in the body fluids or tissues of patients. Prostate cancer is detected by measuring the level of glypican-1 in a body fluid sample. In one embodiment prostate cancer is detected by contacting a body fluid sample with an anti-glypican-1 antibody, such as MIL-38. The invention includes kits for detection of prostate cancer in a body fluid sample, comprising an anti-glypican-1 antibody and glypican-1 standards.

Description

CELL SURFACE PROSTATE CANCER ANTIGEN FOR DIAGNOSIS
INCORPORATION BY CROSS-REFERENCE
The present application claims priority from Unites States of America provisional paten application number 61/928,776 filed on 17 January 2014, the entire contents of which are incorporated herein by cross-reference,
FIELD OF THE INVENTION
The present invention relates generally to the .field of prostate cancer diagnostics. In particular, the present invention relates to the identification of biomarkers in biological samples, which can be used in the detection of prostate cancer. The identified markers may also be used in determining prognosis and monitoring response to treatment for prostate cancer patients.
BACKGROUND OF THE INVENTION
Prostate cancer is the most frequently diagnosed viscera! cancer and the second leading cause of cancer death tor men in the United States, The American Cancer Society estimates that in 2013 about 238,590 new cases of prostate cancer will be diagnosed and 29,720 men will die of the disease. Overall, one in six men will be diagnosed with prostate cancer in their lifetime.
Currently, prostate cancer can be detected by either digital rectal exam (DRE) or by the measurement of prostate-specific antigen (PSA) in the blood of patients. However, neither test is entirely conclusive, and both can lead to false negatives (leaving real cancers undetected), and false positives (signaling cancer where there is none). For example, standard PSA tests conducted at the recommended 4,0 ng/ml cutoff, are 86% sensitive to cance patients but only 33% specific, producing false positives in roughly 67% of non-cancer patients (Hoffman et a!. 2002). False positives are usually followed by invasive and painful biopsies.
A need exists for prostate cancer diagnostic tests with improved accurac and or sensitivity. SUMMARY OF THE INVENTION
The present invention is based, in part, on the discovery that glypican-t heparan sulfate proteoglycan (GPG-1) levels are elevated in the body fluids or tissues of prostate cancer patients. The present inventors have discovered that glypican-I is a new marker for prostate cancer. Accordingly, the present invention provides for methods of detecting glypican-1 to determine the existence of prostate cancer in patients.
In one embodiment, the invention provides for methods for detecting prostate cancer in a patient comprising obtaining a body fluid or tissue sample from a patient contacting said sample with an anti-glypican-l antibody, determining that said patient has prostate cancer or an increased likelihood of developing prostate cancer based upon binding of said anti- glypican-l antibody to said body fluid or tissue sample, in some embodiments the levels of one or more additional prostate markers are measured in the body fluid or tissue sample, and the determination that the patient has cance is based upon the levels of glypican-1 and the levels of the one or more additional markers in the. patient body fluid or tissue sample. In some embodiments, the cancer is prostate cancer, and the additional marker is PSA. In some embodiments, the anti-g!ypican-1 antibody is MIL-38. In other embodiments, the anti- glypican-l antibody is not MIL-38. In some embodiments, the anti-glypican-l antibody is an antibody fragment or recombinant antibody capable of binding glypican-1. in some embodiments, the anti-glypican-l antibody is labeled for easy detection. In some embodiments the antibody label can be a fluorescent label, a biotin-avidin amplification system, a chemiiuminescence system, microspheres or colloidal gold among others.
In some embodiments the body fluid sample obtained from the patient is a blood, serum, plasma, or urine sample.
In one embodiment, the anti-glypican-l antibody binding to the patient's body fluid or tissue sample is compared to the level of anti-glypiean-1 antibody binding of a control sample; wherein increased anti-glypican-l antibody binding of the body fluid or tissue sample over the control sample is associated with the presence of prostate cancer. In some embodiments, said control sample comprises the body fluid from an age-matched prostate cancer- free patient.
In other embodiments, the level of anti-glypican-l antibody binding to the patient's body fluid or tissue is compared to the level of anti-gl.ypican.-l antibody binding to a reference standard, wherein increased anti-glypican-l antibody binding of the body fluid or tissue sample over the reference standard sample is associated with the presence of prostate cancer. hi some embodiments, said reference standard comprises a sample with known glypican-1 content. In some embodiments, the comparison of the anti-gtypican-1 binding to the body fluid or tissue is compared to the anti-glypican- 1 binding to the glypican-1 standards to quantify the amount of glypiean- in said body fluid,
In some embodiments, glypican-1 content higher than about: 0.1ng/ml, 0,5ng/ml,
Ing/ml, 5ng/ml, lOng/ml, I5ng ml or 20ng ral in the body fluid sample is indicative of prostate cancer.
The diagnostic methods of the invention may further comprise adniinistering one or more prostate cancer treatments to a patient, and following changes in the level of glypican-1 in bod fluids or tissues as a mechanism to monitor patient recovery or responses to the prostate cancer treatments. I some embodiments, the anti-glypican- 1 antibody binding is detected via techniques such as immunofluorescence, radiolabeling, biimunoblotting, enzyme-linked immunoassay, flow cytometry, optical density, and chemiluminescence.
The present invention also includes kits for detecting glypican-1 in the body fluids or tissues of patients. In one embodiment the kit for detecting prostate cancer comprises a first anti-glypican-1 antibody, a pharmaceutically acceptable carrier, and glypiean-I standards; wherein said kit is capable of detecting glypican- 1 in the body fluid or tissue of a patient. In some embodiments the kit further comprises a secondary ligand. in some embodiments the secondary ligand is a second anti-glypican- 1 antibody. In one embodiment, the second anti- glypican-1 antibody is the same as the fust anti-glypican-1 antibody.
In some embodiments, the secondary ligand is conjugated to a label, for rapid detection of said ligand.
The present invention thus relates at least to the following series of numbered embodiments below;
Embodiment 1; A method of detecting prostate cance in a patient, the method comprising measuring the level of glypican-1 in a body fluid sample from a patient and determining that said patient has prostate cancer or an increased likelihood of developing prostate cancer based upon the level of glypican-1 in the body fluid sample.
Embodiment 2: The method of detecting prostate cancer in a patient of embodiment 1 , comprising the steps of:
(a) obtaining a body fluid sample from a patient;
(b) contacting said body fluid sample with an anti-glypican- 1 antibody; and (c) detennining that said patient has prostate cancer or air increased likelihood of developing prostate cancer based upon binding of said anti-glypican-1 antibody to said body fluid sample.
Embodiment 3; The method of embodiment 2, wherein said anti-glypican-1 antibody is MIL-38.
Embodiment 4; The method of embodiment 2, wherein said body fluid sample is contacted with a population of antibodies, wherein:
antibodies of the population comprise:
(a) a heavy chain variable region comprising:
a complementarity determining region 1 (CDRI ) comprising or consisting of an amino acid sequence defined by positions 50-54 of SEQ ID NO: .10;
a complementarity detennining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 69-85 of SEQ ID NO: 10;
a complementarit determining region 3 (CDR3) comprising or consisting of an. amino acid sequence defined by positions 1 18-1.26 of SEQ ID NO: 10; and
(b) a light chain variable region comprising:
a complementarity detennining region 1 (CDRI) comprising or consisting of an amino acid sequence defined by positions 44-54 of SEQ ID NO: 11;
a complementarit ' determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 70-76 of SEQ ID NO: M ;
a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 109-1 17 of SEQ ID NO: 11 ; and
antibodies of the population do not comprise a light chain variable region comprising:
a complementarity detennining region .1 (CDRI ) comprising or consisting of an amino acid sequence defined by positions 48-58 of SEQ ID NO: 12;
a complementarit determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 74-80 of SEQ ID NO: 12;
a complementarity detennining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 1 13-121 of SEQ ID NO: 12.
Embodiment 5: The method of embodiment 4, wherein the antibody population is produced by or otherwise identical to an antibody population as generated by hybridoma cells deposited on 22 August 2014 at CellBank Australia (CBA) under accession number CBA2.0140026.
Embodiment 6: The method of embodiment 2, wherein said anti-glypican-l antibod is not lL-38.
Embodiment 7: The method of any one of embodiments 2 to 4, wherein said anti- glypican-l antibody is an antibody fragment or recombinant antibody capable of binding glypican- l .
Embodiment 8: The method of any one of embodiments 2 to 7, wherein said anti- glypican-l antibody is labeled.
Embodiment 9: The method of embodiment 8, wherein said label is chosen from a group consisting of a radiolabel, a fluorescent label, a biotin-avidm amplification system, a chemilumiftescence system, microspheres, and colloidal gold.
Embodiment 10: The method of any one of embodiments 2 to 9, wherein anti- glypican-l antibody binding is detected via a technique selected from the group consisting of immunofluorescence, radiolabel ing, immiraoblotting, Western blotting, enzyme -linked immunosorbent assay (ELISA), flow cytometry, immunopreclpitation, inimunohistoeheiiiistry, biofilm test, affinity ring test, antibody array optical density test, and chemi 1 ummescence .
Embodiment 1 1 : The method of embodiment 1 , wherein said level of g!ypican- ! in the body fluid sample from a patient is compared to the level of glypican-l in a control sample; wherein increased anti-glypican-l antibody binding of the body fluid sample over the control sample is associated with the presence of prostate cancer.
Embodiment 12: The method of embodiment 1 1 , wherein a 50% or more increase in the level of glypican-l of said body fluid sample over the level of glypican-l in the control sample is indicative of prostate cancer.
Embodiment 13: The method of any one of embodiments 2 to 10, wherein anti- glypican-l antibody binding to said bod fluid sample is compared to anti-glypican-l antibody binding of a control sample; wherein increased anti-glypican-l antibody binding of the body fluid sample over the control sample is associated with the presence of prostate cancer.
Embodiment 14: The method of embodiment 13, wherein a 50% or more increase in the anti-glypican-l antibody binding to said body fluid sample over the level of anti- glypican-l antibody binding of tire control sample is indicative of prostate cancer . Embodiment 15: The method of any one of embodiments 2 to 10, 13 or 14 wherein anti-giypican-1 antibody binding to said body fluid sample is compared to anti-glypican- 1 antibody binding to one or more glypican-1 standards; wherein the aivti-glypican-l antibody binding of the standards is used to quantify the amount of glypican-1 in said body fluid sample.
Embodiment 16: The method of any one of embodiments 1 to 15, wherein a glypican- 1 content higher than about JOog/ml in the body fluid sample is indicative of prostate cancer.
Embodiment 17: The method of any one of embodiments 1 to 16, further comprising; measuring the level of prostate-specific antigen (PSA) in a body fluid sample from the patient, and
determining that said patient has prostate cancer o a increased likelihood of developing prostate cancer based upon (i) the level of PSA measured in the body fluid sample, and ( ii ) binding of said anti-glypieaii-1 antibody to said body fluid sample.
Embodiment 18: The method of embodiment 17, wherein the level of prostate- specific antigen (PS A) is measured in blood sample from the patient
Embodiment 19: The method of embodiment 17 or embodiment 18, wherein the level of prostate-specific antigen (PSA) in the body fluid sample measured is compared to the level of PSA measured in a control sample; wherein increased PSA levels in the body fluid sample over the control sample is associated with the presence of prostate cancer.
Embodiment 20: The method of any one of embodiments 1 to 19, wherein said body fluid is selected from the group consisting of blood, serum, plasma, and urine.
Embodiment 21; A kit for detecting prostate cancer comprising a first anti-glypican-1 antibody, a pharmaceutically acceptable carrier, and glypican-1 standards; wherein said kit is capable of detecting glypican-1. in the body fluid of a patient.
Embodiment 22: The kit of embodiment 21, wherein the anti-glypican-1 antibody is not MIL-38.
Embodiment 23: The kit of embodiment 2.1 , wherein the anti-glypican-l antibody is MIL-38.
Embodiment 24: The kit of embodiment 21, wherein the anti-glypican-l antibody is the antibody referred to in any one of embodiments 4, 5 or 7.
Embodiment 25: The kit of any one of embodiments 1 to 24, further comprising a secondary ligand. Embodiment 26: The kit of embodiment 25, wherein said secondary Hgand is a second anti-glypican-l antibody or an aptamer capable of binding to glypican- I; wherein said second anti-glypican-l antibody can be the same as the first anti-glypican- l antibody.
Embodiment 27: The kit of embodiment 25 or embodiment 26, wherei said secondary Hgand is conjugated to a label for rapid detection of said Hgand.
Embodiment 28: The kit of embodiment 27, wherein said label is for use in a detectio method selected from the group consisting of immunofluorescence, radioiabeHng, immunoblottmg, Western blotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, immi oprecipitation, im unohistochemistry, biofilm test, affinity ring test, antibody array optical density test, and chemiluminescence.
Embodiment 29: The kit of any one of embodiments 22 to 28, wherein the kit comprises components for conducting an ELISA.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Characterization of the cell bound MIL-38 glypican-l antigen,
DU-I45 prostate cancer cells were processed with a Membrane Protei Extraction Kit (MPEK, Merck) and incubated with the MIL-38 antibody attached to magnetic beads. The antigen was the immunoprecipitated and washed on the magnetic beads before eluting the antigen and subjecting said antigen to mass spectrometry analysis. Results of mass spec analysis are shown identifymg glypican- 1 as the MlL-38 antigen. The 18 unique peptide sequences spanning tire glypican- 1 protein are underlined.
Figure 2. MIL-38 immunoprecipitation and size-exclusion chromatography.
DU- 145 prostate cancer cell membrane extracts were immunoprecipitated using MIL- 38 and run through a size-exclusion chromatography column. The figure shows western blot analyses of even numbered chromatography fractions using either MIL-38 antibody or secondary antibody control. The MIL-38 antigen is shown at 60Kd in fractions A28 and A30. Figure 3. Mass spectrometry of size-exclusion chromatography purified MIL-38 antigen.
Fraction number A29 from size-exclusion chromatography separation of Figure 2 was analyzed via mass spectrometry. Results of mass spec analysis are shown identifying glypican-l as the MIL-38 antigen with 8 unique peptide sequences spanning the glypican-l protein underli ed. Figure 4. MIL-38 and anti-GPC-1 antibodies show overlapping reactivity on 2D gel western blot,
Membrane protein extracts of DI 45 prostate cancer cells were separated on 2 D gel (pi gradient-horizontal, and molecular mass vertical). Western blots using MIL-38 antibody and commercial rGPC-1 rabbit polyclonal antibodies show overlapping reactivity marking a 60 d protein (circled in figure). Lane D is a one dimension separation for DU-I45 extracts as a control Lane M is a one dimension separation lane for molecular size markers as controls.
Figure 5, MIL-38 can detect immunoprecipitates of GPC-1 antibodies and vice versa.
MIL-38 and rabbit anti-GPC-1 antibodies were each used to immunoprecipitate their antigens from DI 45 prostate cancer or C3 (MIL-38 negative) cell membrane protein extracts. Shown are the western blots of the immuaoprecipitations detected with either MIL- 38 or anti-GPC-1 antibody. Figure 5A depicts GPC-1 detection of MIL-38 min unoprecipitates (left) and MIL-38 detection of GPC-1 immunoprecipitates (right). Figure 5B depicts MIL-38 detection of MIL-38 immunoprecipitates as a control. Lanes are: Magic Mark- commercial protein marker as control; DU1.45 MPEK- prostate cancer membrane protein extract (not inimunopreeipitated); DU145 FT- prostate cancer flow through from immune precipitation; DU145 IP- immunoprecipitate using antibody; C MPEK- (MIL-38 negative) control membrane protein extract (not iramunoprecipitated); C3 FT- (MIL-38 negative) cell flow through from immune precipitation; C3 IP eiution- (MIL- 38 negative) cell immunoprecipitate using antibody. MIL-38 can detect the immunoprecipitate from rGPC-1 antibody and vice versa. MIL-38 can also bind to all controls including DU 145 M PEK and to IP conducted by MIL-38.
Figure 6. MIL-38 detects recombinant glypican-l
A recombinant glypican-l produced in NSO cells was tested for reactivity with MIL-
38 and anti-GPC-1 antibodies. Western blots show reactivity of both MIL-38 and rabbit polyclonal anti-GPC-1 antibody with the recombinant glypican-l . Lanes are: Magic Mark- commercial protein marker as control; GPC-1- recombinant Glypican-l protein; GPC-1 red- recombinant Glypican-l protein with, reducing agent.
Figure 7. MIL-38 can detect antigen secreted into cell culture supernatant.
DLM45 prostate cancer cells were incubated with serum free media for 36 hours to produce cell free conditioned media. The conditioned media without any cells was immunoprecipitated using the M I L-38 antibody and compared to a standard IP using DU-145 MPEK membrane protein extracts. Shown is a western blot of the inimunopreeipitates using the MIL-38 antibody. The MIL-38 antibody can detect antigens of 40 and 55k D in the conditioned liquid media,
Figure 8, MIL-38 antigen detected in cell culture supernatant is glypican-1
DU-145 prostate cancer cells were incubated with serum free media for 36 hours to produce cell free conditioned media. The conditioned media was immunoprecipitated using the MIL-38 antibody and the immunoprecipitates were sent for mass spectrometry analysis. Figure 8A. A sample containin both the 40 and 55kD MIL-38 reactive antigens was subjected, to mass spec analysis. Results of mass spec analysis are shown identifying glypican-1 as the MIL-38 antigen from the conditioned liquid media with 9 unique peptide sequences spanning the N-terminus of the glypican-1 protein underlined. Figure 8B, A sample containing the 40 kDa MIL-38 reactive antigen was subjected to mass spec analysis. Results of mass spec analysis are shown identifying glypican-1 as the MIL-38 antigen from the conditioned liquid media with 10 unique peptide sequences spanning the N-terminus of the glypican-1 protein underlined. Figure SC. A sample containing the 55 kDa MIL-38 reactive antigen was subjected to mass spec analysis. Results of mass spec analysis are shown identifying glypican- 1 as the MIL-38 antigen from the conditioned liquid media with 9 unique peptide sequences spanning the N-terminus of the glypican-1. protein underlined. Figure 9. MIL-38 antibody can detect glypican-I in the plasma of prostate cancer patients and in membrane extracts of prostate cancers.
Figure 9 A. Plasma samples from one normal control patient and one prostate cancer patient were immunoprecipitated with the MIL-38 antibody. Shown are western blots with bot the MIL-38 and iGPCl antibodies. MIL-38 immunoprecipitated higher levels of glypican-1 protein in the plasma of the prostate cancer patient than the plasma of the control patient. Lanes are: 046 IP NT- IP from prostate cancer plasma; 046 IP Hepl- IP from prostate cancer plasma treated wit heparinase; 042 IP NT- IP from normal control plasma; 042 IP Hepl- IP from norma! control plasma treated with heparinase; Magic Mark- commercial protein marker as control. Figure 9B. Membrane protein extracts from one normal prostate and one prostate cancer were obtained from Novus Bio. Equivalent amounts of protein were western blotted using MIL-38 antibody. The prostate cancer extract demonstrated higher expression of the MiL-38 antigen. Figure 10. lL-38 can detect cancer in the (trine of prostate cancer patients.
Urine samples from 125 age-matched patients were collected and tested for the presence of prostate cancer using Mil .-38 antibody in a indirect immunofluorescence assay. Patients were classified as health controls, benign prostatic hypertrophy (BPH) or prostate cancer (CaP) based on either biopsy confirmatio (BPH, CaP) or analysis of risk factors (healthy controls). Figure shows exemplary pictures of CaP experimental samples; DU145 positive control samples; and C3 negative control samples.
Figure 11. MIL-38 can detect recombinant glypican-1 in a variety of ELISA formats
Sandwich ELISAs were performed using 0, 0,1 , 1 or lOng recombinant human NS0- produced glypican-1 protein ( iGPCl) as analyte. Figure 11 A. Capture with MIL-38 antibody, detection with rabbit polyclonal anti-GPC l (a-GPC l). Figure 11B. Capture with attti-glypican-1. antibody, detection with MIL-38. Figure 11C. Capture with MIL-38, detection with biotinyiated MIL-38.
Figure 12. Comparative sandwich ELISAs performed using different MIL-38 antibody preparations as capture antibodies.
Figure .12 A shows comparative sandwich ELISAs using AM3 and AM4 as capture antibodies. Figure 12B shows comparative sandwich ELISAs using either a mixed preparation (34 A) or a clonal population (AM4 1 F5) as capture antibodies.
Figure 13. Box plot graphs of raw data of antibody screening.
The binding of AM4 MIL-38 antibody to each of the synthesized peptides was tested in a PEPSC A -based ELISA. The botto and top of the boxes are the 25th and 75th percentile of the data. The band near the middle of the box is the 50th percentile (the median). The whiskers are at 1.5 the inter-quantile range, an indication of statistical outliers within the dataset (Mcgill <¾ #/., The American Statistician, 32: 12-16, 1978);
Figure 14. Letterplot representation of MIL38-AM4 probed on the substitution analysis of set 3 (Example 13).
DETAILED DESCRIPTION
The present invention is based, in part, on the discovery that glypican-1 heparan sulfate proteoglycan (GPC-I) levels are elevated in the body fluids or cells of prostate cancer patients. The present inventors have discovered that glypican-1 is a new marker for prostate cancer. Accordin gly, the present invention provides for methods of detecting the existence of prostate cancer in patients. Normal human cells are only capable of forty to sixty cellular divisions before telomeric shortenings make them unviable. Prostate cancer cells however, are not subject to the Hayfiick limit of divisions and continue to divide indefinitely causing abnormal growths.
The most common manifestation of cancer is the formation of tumors in the bodies of patients. In some embodiments of the present invention, the prostate cancer tumors can be painless and asymptomatic, in other embodiments, the tumors can cause physical discomfort or other localized symptoms such as fluid blockages or bleeding. In some embodiments, the prostate cancer of the present invention may caus systemic symptoms such as those caused by disrupting normal body functions. In other embodiments the symptoms of prostate cancers of the present invention can inc lude change in bowel habits or bladder function.
One of the distinguishing factors between benign prostate tumors (non cancerous) and malignant prostate tumors (cancerous) is the ability to metastasize. Metastasis is tire ability of cancers to spread (metastasize) to other parts of the body. Prostate cancer in patients is further categorized into stages according to the progression of the disease. The. most common staging system is the TNM system, which categorizes cancer based on the size and extent of the primary tumor (T), the spread of the cance to nearby lymph nodes (N), and the presence of secondary tumor formed by the metastasis (M) of the primary tumor to other parts of the body (American Cancer Society). Table 1 shows example definitions for each cancer stage.
Table L Definitions for cancer stages of the TNM system, adapted from the American.
Cancer Society.
Stage
Definition
Stage 0 Carcinoma in situ
Stage 1, Stage li, and Higher numbers indicate more extensive disease:
Stage ill Larger tumor size and/or spread of the cancer beyond
the organ in which it first developed to nearby lymph
nodes and/or tissues or organs adjaceni io the location
of the primary tumor
Stage !V The cancer has spread to distant tissues or organs
In. some embodiments, the present invention can detect cancers at any one or more stages. In some embodiments, the glypican-1 of the present invention is encoded by SEQ ID NO: 1. In some embodiments the glypican-1 protein is the foil amino acid sequence of SEQ ID NO: 2. In some embodiments, the glypican-l protein does not include the signal peptide of SEQ ID NO: 3- In some embodiments, the glypican-1 protein does not include the propeptide of SEQ ID NO: 4, In some embodiments, the giypican-1 protein of the present invention is SEQ ID NO: 5. In some embodiments glypican-I of the present invention includes glypican-1 variants such as isoforrns, splice variants, and allotypes. The present invention also provides a method of determining a prognosis fo a patient with prostate cancer. In one embodiment, the method comprises obtaining a bod fluid or tissue test sample from a patient, measuring the levels of glypican-1 in said body fluid or tissue, and comparing said levels with a fixed range of values wherein higher glypican-1 levels are associated with poorer prognosis o less favorable patient outcome.
Non-limiting examples of prostate cancers that may be detected with the present invention include prostatic intraepithelial neoplasia, adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma
One of the most powerful tools against cancer is early detection. Earlier stages of cancer tend to be easier to treat, and the prognosis for most cancers is generally better if the disease is still localized. There are many tests that can help diagnose cancer. In some embodiments, the present invention uses glypican-1 alone to detect prostate cancer. In other embodiments GPC-1 is used together with another antigen wherein the presence of prostate cancer is determined by the detection of both antigens, in one embodiment, the other antigen is PSA.
The present invention provides methods for detecting prostate cancer. Prostate cancer is the most frequently diagnosed visceral cancer and the second leading cause of cancer death for men in the United States. The American Cancer Society estimates that in 2013 about 238,590 new cases of prostate cancer will be diagnosed and 29,720 men will die of the disease. Overall, one is six men wilt be diagnosed with prostate cancer in their lifetime. Prostate cancers have been associated with many symptoms including difficulty urinating, erectile dysfunction and pain. Although most prostate cancers are slow growing, there are cases of aggressive prostate cancers which can metastasize and can ultimately lead to death.
There are two major prostate cancer detection tests currently used by medical professionals: a digital rectal exam (DRE), and the measurement of prostate-specific antigen (PSA) in the blood of patients. 'Unfortunately, neither of these tests is entirely conclusive and both can result in false negatives (leaving real cancers undetected), and false positives (signaling cancer where there is none). For example, standard PSA tests conducted at the recommended 4.0 ng/ml cutoff are 86% sensitive to cance patients but only 33% specific, producing false positives in roughly 67% of non-cancer patients (Hoffman et al. 2002). The present invention describes methods for combining glypican- 1 measurements with another prostate cancer antigen, PSA, wherein the presence of prostate cancer is determined based on the levels of glypican-1 in the body fluid or tissue of the patient and the results of the PSA test,
BLCA-38 (also known as MIL-38) is an IgGi murine raised antibody against human bladder cancer cell line UC U-BL-17CL (Walker et al, 1 89). The resulting antibody was shown to bind to most huma bladder cancer lines (Russell et al.., .2004). The antibody was described as binding a cell surface protein of 30Kd and to be useful in. detecting certain kinds of bladder carcinoma (US PAT 5,622,836).
The present invention describes for the first time the identity of the MIL-38 antigen. The present inventors discovered the antigen through a series of immunoprecipitations, westerns blot analyses, mass spectrometry analyses, and 2D gels described below in Examples 1-8. In accordance with the present invention, any suitable agent and/or any suitable technique as known to those of skill i the art can be used to measure the levels of glypican- 1 in a given sample (e.g. a body fluid sample), and use the measurement to diagnose and or prognose prostate cancer in a patient from which the sample is derived. In some embodiments, die agent is an anti-glypican- 1 antibody. In some embodiments of the invention MIL-38 antibody is used to bind to and detect a 60kD glypican- 1 proteoglycan. In some embodiments the MIL-38 antibody is used to detect the glypican-1 antigen on the surface of prostate cancer cells. In otlier embodiments, the MIL-38 antibody is used to detect soluble glypican- 1 in the body fluids or tissues of prostate cancer patients. In some embodiments, the MIL-38 antibody has binding specificity for a glypican- 1 epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVN'PQGPGP (SEQ ID NO: 7). The epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQNARAFRD (SEQ ID NO: 9). The present invention shows that MIL-38 >s ability to bind to prostate cancer tissue is based on the presence of the glypican-1 antigen and further demonstrates the use of other anti-glypican-1 antibodies to detect cancerous prostate cells. Therefore in some embodiments the anti-glypican- 1 antibody is not MIL-38. Further the present invention demonstrates the ability to detect prostate cancer by detecting glypican-1 levels in the body fluids or tissues of patients. The present inventors have thus discovered that glypican- 1 is a marker for prostate cancer.
According to the invention glypican- 1 levels in body fluids or tissues can be detected using any suitable technique (e.g. any proteomic technique). In some embodiments, the glypican- 1 levels can be detected using an anti-glypican-ί antibody. For example, the glypican- 1 levels can be detected using an anti-glypican-1 antibody that comprises: a heavy chain variable region comprising a complementarity determining region I (CDR l) comprising or consisting of an amino acid sequence defined by positions 50-54 of SEQ ID NO: 10; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 69-85 of SEQ ID NO: 10; a complementarity determining region 3 (CBR3) comprising or consisting of an amino acid sequence defined by positions 118-126 of SEQ ID NO: 10; and comprise a light chain variable region comprising a complementarity determining region 1 (CDR l ) comprising or consisting of an amino acid sequence defined by positions 44-54 of SEQ ID NO: 11; a complementarity determining region 2 ( D 2) comprising or consisting of an amino acid sequence defined by positions 70-76 of SEQ ID NO: 11; a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 109- 1 17 of SEQ ID NO: 11. The anti-glypican-1 antibody used to detect the glypican- 1 levels may not' comprise: a light chain variable region comprising a complementarity determining region 1 (CDR l ) comprising or consisting of an amino acid sequence defined by positions 48-58 of SEQ ID NO: 12; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 74-80 of SEQ ID NO: 12; and a complementarity determining region 3 (CDR3) comprising or consistin of an amino acid sequence defined by positions 1 13-121 of SEQ ID NO: 12. The anti-glypican-ί a tibody may be produced by or otherwise identical to an antibody generated by hybridoma cells as deposited on 22 August 2014 at. CeHBank Australia (C'BA) under accession number CBA2G140026.
In. some embodiments of the invention, one or more other anti-glypican-1. antibodies may be used to detect glypican- 1 in the body fluids or tissues of patients, in some embodiments, said other anti-glypican-1 antibodies can be any of the antibodies listed in (Table 2) of this application. In yet another embodiment, the antibody used to detect glypican- 1 in the body fluids or tissues of patients could be any antibody capable of binding glypican- 1. In some embodiments the antibodies of the present invention include antibody fragments or recombinant antibodies. In some embodiments the antibodies of the present invention include human antibodies, humanized antibodies and chimeric antibodies. In some embodiments the antibodies of the present invention are conjugated antibodies, A non- limiting list of the antibody fragments- of the present invention include fragment antigen binding Fab, F(ab¾, ScFv, Dt-scFv sdAb, chemically linked F(ab')2, bispecific antibodies, trispeciffc antibodies Fab3, Bis-scFv, Minibody bivalent antibodies, triabody bivalent antibodies, diabody bispecifrie antibodies, tetrabody tetravalent antibodies. A review of antibody fragraents and domain combinations can be found in (Hoiliger and Hudson 2005, and IJS 2003/0077282).
Table 2. Anti-Glypican- ί Antibodies
Figure imgf000017_0001
Figure imgf000018_0001
In some aspects of the invention, a new anti-glypiean-1 antibody can be generated from glypican-1 protein or a fragment or derivative thereof. By way of non- limiting example only, the anti -glypican- 1 antibody can be raised against a glypican- 1 epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVNPQGPGP (SEQ ID NO: 7). The epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQNARAFRD (SEQ ID NO: 9). One skilled in the art will recognize that many procedures are available for the production of antibodies, for example, the methods described in (Harlow et at, 1988). In some embodiments, the glypiean-1 imniirnogen used to create the anti- glypican-l antibodies will include the post translational modifications of the native protein (e.g. folding). In some embodiments the glypican- 1 immunogen will not include the signal peptide (SEQ ID No: 3), or the C-tenninal propeptide (SEQ ID No: 4) sequences. In some embodiments, the glypiean-1 imrnunogens are obtained from human or other mammalian cells such as transformed murine NSO, wild type DU-145, or other giypican-I expressing cell line. In some embodiments the glypican- 1 antigen can be cells expressing glypiean- 1. In some embodiments the glypican-1 immimogen can be whole cells or cell parts with glypican- 1 protein on their surface. One skilled in the art wil l also appreciate that binding fragments or Fab fragments can be prepared from genetic informatio by various well-known procedures such as those described in (Borrebaeek et at., 1995; and US patent 7,960,5.17).
I another embodiment of the present invention, polyclonal antibodies targeting glypican-1 may be created for the detection of prostate cancer. Again by way of non- limiting example only, the polyclonal antibody targeting glypican-1 can be raised against a series of glypican- 1 epitopes including a glypican-1 epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVNPQGPGP (SEQ ID NO: 7). The epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQNARAFRD (SEQ I NO: 9). Various procedures known in the art may be used for the production of polyclonal antibodies to glypican- 1 or a fragment of glypican-1. In one embodiment of the invention, the glypiean-1 protein or fragment thereof may be injected into a host animal. In some embodiments the host animals can include but are not limited to rabbits, mice, rats, etc. in some embodiments the resulting sera is purified and tested for its ability to react with glypican-1 vi techniques well known in the art such as westerns, ELISAs, immunofluorescence screens, flow cytometry, Fluorescence Activated Cell Sorting (FACS) or others.
I another embodiment, monoclonal antibodies (inAbs) directed against glypican- 1 may be created for the detection of prostate cancer. Again by way of non-limiting example only, the monocolonal antibody targeting glypican can be raised against a glypican-l epitope comprising a first segment KVNPQGPGPE (SEQ ID NO: 6) or KVNPQGPGP (SEQ ID NO: 7). The epitope may further comprise a second segment TQNARA (SEQ ID NO: 8) or TQMARAFRD (SEQ ID NO: 9). In one embodiment, anti-glypican-l antibodies are created via the hybridoma technique (Kohler and Milstein 1975), or other techniques (Cole et at, 1985; or US PAT 6,1 16,013). For more details and examples on antibody production see US PAT 7,985,560.
In some embodiments of the present invention, glypican- 1 is detected in the body fluids or tissues of patients by an anti-glypican-l antibody. In some embodiments the body fluid sample obtained from the patient is a blood, serum, plasma, or mine sample. In other embodiments, glypican- l is detected in tissue samples of patients. In some embodiments, the tissue samples include tumor biopsies or other patient tissue. In. some aspects of this invention, the antibody detects glypican-l via Western blot analysis. Enzyme-linked immunosorbent assays (ELISAs), fluorescent cell sorting or FACS, immunofluorescence, radiolabeling, imraunoprecipitation, irarairaohistocheniistry, immunoblotting, chemiluminescence, and/or other known techniques to detect protein with an antibody or other ligand such as a protein capable of binding glypican-l . In some embodiments, glypican- I is detected vi a biofthn test, or affinit ring test as described in US application 2013/016,736. In some embodiments glypican- l is detected via glypican-l binding agents coated to transparent surfaces (e.g. polycarbonate slides). Binding of glypican-l or glypican-l bearing cells can be detected by changes in optical density. In some embodiments, anti- glypican-l antibody binding to said bod fluid or tissue sample is compared to the anri- glyplcan-1 antibody binding to one or more glypican-l calibration standards; wherein the anti-glypican-l antibody binding of the calibration standards is used to quantify the amount of glypican-l in said body fluid sample. In one embodiment, the calibration standards comprise one or more samples with known glypican-l concentrations.
In some embodiments the measurement of glypican- 1 is accomplished by contacting said body fluid or tissue sample with glypican-l ligand. In some embodiments the ligand can be an anti-glypican- l antibody capable of binding the glypican-l proteoglycan.
In some embodiments, the tissue ox body fluid of a patient may require a pre- rreatment prior to detection by the anti-glypican-l ligand. In some embodiments, said pre- treatment may include treatment with agents such as heparinase FNGaseF, N-Glycosidase, alkaline phosphatase, or heparitinase among others. In other embodiments, said pre-treatment may include tissue lysis, membrane purification, blood plasma or serum fractionation, cell purification, or protein purification among others.
In some embodiments the measured levels of '.glypican-l in. the body fluid or tissue of a patient are compared against a control sample of body fluid or tissue from a cancer-free patient in other embodiments the measured levels of glypican-l in the body fluid or tissue of a patient are compared against pre-detenriined reference values or ranges of reference values, in other embodiments, the levels of glypican-l in body fluids or tissues of a patient are indicative of prostate tumor size, or progression.
In some embodiments, the detection of glypican-l from body fluid or tissue samples is conducted via Enzyme-linked immunosorbent assays (ELISAs). ELISAs comprise those based on colorimetry, chemiluminescence, and fiuorometry. ELISAs have been successfully applied in the determination of low amounts of drugs and other antigenic components in body tissues or fluids such as blood, serum, and plasma samples, and are well known in the art An ELISA that is useful in the present invention may employ any suitable capture, reagent and detectable reagent including antibodies and derivatives thereof, protein ligands and the like, in certain embodiments, the ELISA is cell-based, in other embodiments, the ELISA detects cell-free antigens, in some embodiments the biological sample suspected of containing glypican-l is contacted and incubated with the capture (or coat) antibodies so that the capture antibodies capture or hind to the glypican- l . The detection step involves use of the detectable antibody or detectable protein ligands, which can. bind to said glypican-l and be used to detect the presence or amount of glypican- l based on detection of its label.
In some embodiments, the biological sample is contacted and incubated with the immobilized capture (or coat) reagent, which can be a glypicao-l antibody. This antibody may be from any species, but in some embodiments the antibody is a murine or rat antibody. In other embodiments the antibody is a murine antibody. In other embodiments the antibody is derived from a hybridoma. In some embodiments, the glypican-l antibody is a recombinant antibody or antibody fragment. Immobilization conventionally is accomplished by insolubilizing the capture reagent either before the assay procedure, as by adsorption to a water-insoluble matrix or surface (U.S. Pat No. 3,720,760) or non-covalent or covalent coupling (for example, using glutaraldehyde or carbodiiraide cross-linking, with or without prior activation of the support with, e.g.,. nitric acid and a reducing agent as described in U.S. Pat. No. 3,645,852 or in Rotmans et aL, 1983), or afterward, e.g., by immunoprecipitation.
In some embodiments, the solid phase used for immobilization may be any inert support or carrier that is essentially water insoluble and useful in immunometric assays, including supports in the form, of, e.g., surfaces, particles, porous matrices, etc. Examples of commonly used supports include small sheets, Sephadex, polyvinyl chloride, plastic beads, and assay plates or test tubes manufactured from polyethylene, polypropylene, polystyrene, and the like including 96-well microtiter plates, as well as particulate materials such as filter paper, agarose, cross-linked dextran, and other polysaccharides. Alternatively, reactive water- insoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described in LIS. Pat. Nos. 3,969,287; 3,691 ,016; 4,1.95,128; 4,247,642; 4,229,537; and 4,330,440 are suitably employed for capture reagent immobilization. In one embodiment the immobilized capture reagent is coated on a microtiter late, and in particular the solid phase used is a multi-well microtiter plate that can be used to analyze several samples at one time, e.g., a microiest 96-well ELISA plate such as that sold as Nunc Maxisorb or Immulon. In certain embodiments, the plate is a MICROTEST™ o MAXiSORP™ 96- well ELISA plate such as that sold as NUNC MAXISORB™ or IMMULON™.
In some embodiments the solid phase is coated with the capture reagent as defined above, which may be linked by a non-covalent or covaient interaction or physical linkage as desired. Techniques for attachment include those described in U.S. Pat. No. 4,376,110 and the references cited therein. If covaient, the plate or other solid phase is incubated with a cross-linking agent together with the capture reagent under conditions well known in the art, e.g., such as for I hour at room temperature.
In other embodiments, commonly used cross-linking agents for attaching the capture reagent to the solid phase substrate include, e.g., l,l-bis(diazoacetyl)-2-phenylethaiie, gluiaraldehyde, N-hydroxy-s ccinimide esters, for example, esters with 4-azido-salicylic acid, homobifunctional imidoesters, including disuccmimidyi esters such as 3,3'-dithiobis- {succiniroidyl-propionate), and bifunctiona! malermides such as bis-N-maleimido-1 ,8-octane. Derivatizing agents such as methyl-3-[ip-azidophenyl)-dithio]pro-pioimi-date yield photoactivatahle intermediates capable of forming cross-links in the presence of light.
In some embodiments, 96-weM plates are utilized. In some embodiments the 96-well plates are coated with the capture reagent (typically diluted in buffer such as 0.05 M sodium carbonate by incubation for at least about 1.0 hours, more preferably at least overnight, at temperatures of about 4-20 C, or about 4-8°C, and at a pH of about 8-12, or about pH 9-10, or about pH 9.6). If shorter coating times are desired, in some embodiments the plate can be coated for less time, e.g. at room temperature for two hours or less, hi some embodiments, the plates may be stacked and coated long in advance of the assay itself, and then the assay can be carried out simultaneously on several samples in a manual, semi-automatic, or automatic fashion, such as by using robotics.
In some embodiments, the coated plates can be treated with a blocking agent that binds non-specifically to and saturates the binding sites to prevent unwanted binding of the free ligand to the excess sites on the wells of the plate. Non-limiting examples of appropriate blocking agents for this purpose include, e.g., gelatin, bovine serum albumin, egg albumin, casein, and non-fat milk. In some embodiments the blockin treatment can take place under conditions of ambient temperatures for about 1 -4 hours. In other embodiments the blocking can take place over the course of 1 to 3 hours or less. In other embodiments the blocking can take place overnight at 0-4°C.
In some embodiments the glypican-1 standard (e.g. purified glypican-I protein) or the biological sample to be analyzed, appropriately diluted, is added to the immobilized phase. In some embodiments, the dilution rate is about 1-15% by volume. In some embodiments, the glypican-1 protein standard will include the post-transiationai modifications of the native protein. In some embodiments, the glypican-1 protein standards are obtained from human or other mammalian celts such as transformed '1S1S0, wild type DU-145, or other glypican-I expressing cell line. In other embodiments, the glypican-1 protein may be purified from body fluids or tissues. In some embodiments, the glypican- 1 standard will be a partial glypican-1 peptide or other epitope detected by the glypican-1. detection antibody, or ligand. In some embodiments the standard can be a cell expressing glypican-I . In some embodiments tbe dilution is about 10% by volume. A non-limiting group of buffers that may be used for dilution for this purpose include (a) PBS containing 0.5% BSA, 0.05% TWEEN 20™ detergent (P20), 0.05% PROCLIN™ 300 antibiotic, 5 mM EDTA, 0.25% CHAPS surfactant, 0.2% bovine γ-globulins, and 0.35M NaCl, pH 7,4; (b) PBS containing 0.5% bovine serum albumin, 0.05% polysorbate 20, 5 mM EDTA, 0.25% CHAPS, 0.2% bovine y-globulins, and 0.35 M NaCl; pH 7.4 (c) PBS containing 0.5% BSA, 0.05% polysorbate 20 (P20), and 0.05% PROCLIN™ 300, pH 7; (d) PBS containing 0.5% BSA, 0.05% P20, 0.05% PROCLIN™ 300, 5 mM EDTA, and 0.35 M NaCl, pH 6.35; (e) PBS containing 0.5% BSA, 0.05% P20, 0.05% PROCLIN™ 300, 5 mM EDTA, 0.2% bovine γ-globulins. and 0.35 M NaCl, pH 7.4; and (f) PBS containing 0.5% BSA, 0.05% P20, 0.05% PROCLIN™ 300, 5 mM EDTA, 0.25% CHAPS, and 0.35 M NaCl, pH 7.4. PROCLIN™ 300 acts as a preservative, and TWEEN 20™ acts as a detergent to eliminate non-specific binding.
While the concentration of the capture reagents will generally be determined by the concentration range of interest of the glypican- 1 taking any necessary dilution of the biological sample into account, the final concentration of the capture reagent will normally be determined empirically to maximize the sensitivity of the assay ove the range of interest.
The conditions for incubation of sample and immobilized capture reagent are selected to maximize sensitivity of the assay and to minimize dissociation. In some embodiments, the incubation is accomplished at fairly constant temperatures, ranging from about 0°C to about 40°C, in other embodiments the incubation is conducted from about 20 to 25 °C. The time for incubation depends primarily on the temperature, being generally no greater than about 10 hours to avoid an insensitive assay. In some embodiments the incubation time is from about 0.5 to 3 hours. In other embodiments the incubation is about 1.5-3 hours or less at room temperature to maximize binding of free glypican-l to capture reagents. The duration of incubation may be longer if a protease inhibitor is added to prevent proteases in the biological fluid from degrading the glypican-l.
In some embodiments, the detection method is a competitive EL ISA. In some embodiments the incubation step includes the addition of unbound and unlabeled antibody. In some embodiments the known concentration of unlabeled antibody binds the free glypican- 1 antigen and prevents it from becoming immobilized on the plate, in some embodiments the incubation step includes the addition of labeled glypican-l protein of known concentrations. In some embodiments the amount of glypican-l in the body fluid or tissue sample is detected as a diminishing binding of the mixed labeled glypican-l protein. In other embodiments the ELISA is a sandwich ELISA.
At this stage, the pH of the incubation mixture will ordinarily be in the range of about 4-9,5. in other embodiments the pH range will be about 6-9. In yet another embodiment the pH range will be about 7-8. In another embodiment the pH of the assay (ELISA) diluent is pH 7,4. The pH of the incubation buffer is chosen to maintain a significant level of specific binding of the capture reagent to the glypican-l being captured. Various buffers may be employed to achieve and maintain the desired pH during this step, including borate, phosphate, carbonate, Tris-HC'l. or Trls-phosphate, acetate, barbital, and the like. The particular buffer employed is not critical to the invention, but in individual assays one buffer may be preferred over another.
In some embodiments, the biological sample is separated (preferably by washing) from the immobilized capture reagent to remove uncaptured molecules. The solution used for washing is generally a buffer ("washing buffer") with a pH determined using the considerations and buffers described above for the incubation step, hi one embodiment, the pH range of the washing buffer is about 6-9. The washing may be done one or more times. The temperature of washing is generally from refrigerator to moderate temperatures, with a constant temperature maintained during the assay period, typically from about 0-40c'C. In other embodiments the washing temperature is about 4-3G9C. For example, the wash buffer can be placed in ice at 4°C in a reservoir before the washing, and a plate washer can be utilized for this step, A cross-linking agent or other suitable agent ma also be added at this stage to allow the now-bound glypican-i to be covalentiy attached to the capture reagent, if there is any concern that the captured glypican-1 may dissociate to some extent in the subsequent steps.
In some embodiments, the immobilized capture reagent is contacted -with detectable antibodies. In some embodiments the detectable antibodies are anti -glypican- 1 antibodies. In some embodiments the anti-glypican-I antibod is MIL-38. In other embodiments., the antibodies are those described in table 2. In other embodiments tiie detectable antibodies are any antibody capable of detecting glypican-1. The detectable antibody is contacted with the immobilized glypican-1 at a temperature of about 2G-40°C. In other embodiments tire detectable antibody is contacted at about 20-25 °C, with the exact temperature and time for contacting the two being dependent primarily on the detection means employed. For example, when stre atavidi -peroxidase and 3,3'55,5'-tetraniethyl benzidine are used as the means for detection, e.g., in one embodiment, the contacting is carried out (e.g., about 1 hour or more) to amplif the signal to the maximum. In some embodiments, a. molar excess of an antibody or iigand with respect to the maximum concentration of expected free glypican- 1 is added to the plate after it is washed. This antibody is directly or indirectly detectable. The detectable antibody may be a polyclonal or monoclonal antibody, e.g., in certain embodiments, it is a monoclonal antibody, in. one embodiment murine, and in one embodiment MIL-38. Also, the detectable antibody can be directl detectable, and in one embodiment has a oolorimetric label, and in another embodiment has a flurometric label. In other embodiments tbe detectable antibody is biotinylated and the detection means is avidin or streptavidin- peroxidase and 3,3\5,5'-tetramethyl benzidine. In. some embodiments the detectable antibody may be labeled with a biotin-avidm amplification system, a. chemihuninescence system, microspheres, or colloidal gold. The readout of the detection means can be fluorimetric or colorimetric among others. The affinity of the antibody must be sufficiently high that small amounts of the free glypican-1 can be detected.
In some embodiments, the glypican-1 that is bound to the capture reagent is measured using a detection means for the detectable antibody. If the body fluid or tissue sample is from patient, the measuring step comprises comparing the reaction that occurs as a result of the above steps with a standard curve to determine the level of glypican-i in said body fluid or tissue sample, in other embodiments the reaction that occurs as a result of the above steps is compared to a similar reaction using a control body fluid or tissue sample such as the bod fluid or tissue of a age-matched cancer-free individual .
In other glypican-1 detection embodiments, the glypican-1. in the body fluid of patients is detected via a Western Blot Analysis, in some embodiments this assay separates the proteins in complex sample using electrophoresis. In other embodiments the electrophoresis separation is performed in a size exclusion gel such as a sodium dodecyl sulfate polyacrvianiide gel (commonly known as SOS-PAGE). In one embodiment the separated proteins are then transferred to a membrane. One skilled in the art will recognize that there are a variety of materials that can be used for westerns. In some embodiments the membrane is made from nitrocellulose or p lyvifcylidene fluoride, PVDF. In some embodiments the transfer occurs in a protein transfer box such that the proteins retain the same separation pattern on the membrane as they had in the gel. In some embodiments the membrane is then incubated in diluted protein solutions, e.g. non-fat dry milk or bovine serum albumin (BSA), to block the non-specific binding sites. The blocked membrane can then be incubated with a primary antibody that is specific for the glypican-1 target protein. In some embodiments the membrane is then washed and incubated with a secondary antibody that targets the first antibody, hi some embodiments the first or the second antibody is conjugated to a detectable label such that it can be easily detected. In some embodiments the label includes a fluorescent label, a chemiluminescent label, radiolabef or another label well known in the art. In some embodiments, said labels conjugated to the secondary ligand are chosen .from a group consisting of a radiolabel. a fluorescent label, a biotin-avidin amplification system, a chemiluminescence system, microspheres, and colloidal gold.
Optionally, some aspects of the invention teach that once a user has determined whether a target protein is present in the sample, the primary and (optional) secondary antibodies can be snipped from the membrane, and the membrane can be incubated with, an alternative primary antibody that is specific for the same or another protein. In some embodiments the second protein may be used as a loading control. In other embodiments the second protein is another marker for patient health.
In one embodiment, glypican-1 is detected via flow cytometry. In some embodiments glypican-1 is detected on the cell surface of cells in patient bod fluids or tissues. In certain aspects of the invention the detection of glypican-1 for flow cytometry may be conducted as outlined below, in some embodiments, cells from body fluids or tissues are purified. The purification of the cells can include a neutralization step. In some embodiments the neutralization step comprises storing the cells in neutralization buffer. The neutralization buffer can be made by combining 39ml of 0.2 M aB2P04 to 61tnl of 0.2M Na2HP04 and adding water to 200ml, hi some embodiments, the cells are cenirifuged and resuspended in different solutions. In other embodiments, the cells are sorted without purification, in some embodiments the cells are resuspended or washed in CytoLyt solution, in other embodiments the cells axe resuspended or washed in phosphate buffered saline (PBS), to some embodiments the cell suspension is treated with ammonium chloride to lyse the red blood cells. In some embodiments the cells are fixed onto slides. In other embodiments the cells remain free, in some embodiments, cells are contacted with a primarily anti-glypican-1 antibody or other ligand. In some embodiments the primary antibody is MIL-38. In some embodiments the primary antibody is not MIL-38. In other embodiments the primary antibody is any other anti-gtypi.can-1 antibody (Table 2). in certain embodiments, the cells are further contacted with a second detection antibody conjugated to a detection label In alternative embodiments, the antigen may be detected directly by the primary antibody if the primary antibody is conjugated to a detection label. I particular cases, in addition to being labeled with the glypican-1 antibody, the cells may be distinguish ably labeled with other probes, including, but not limited to, antibodies to cell surface markers that distinguish one cell type from another. In some aspects the other probes may be used to normalize signals or total cell counts. In some embodiments the other probes label intracellular antigens, In other embodiments the other probes label extracellular antigens. Once labeled, the labeled cells may be isolated by FACS flow cytometry. In some embodiments, the FACS machine may isolate labeled cells singly (i.e., as single cells). In other embodiments, the labeled cells may be isolated as a mixed population, and then diluted into single cells after FACS. in some embodiments the second label can be a dye. In some embodiments the dye label is DAPI. In some embodiments DAPI labeling is used to quantify the number of cells in the sample.
In embodiments in which the cell is labeled with a plurality of different labels, the ceils may be selected using a plurality of different properties. For example, cells may first be sorted by one probe and then another. In some embodiments cells ca first be sorted by cell type and later be sorted by glypican-1 concentration. Similarly cells may be sorted i any sequence as designed together with the probes and the detection of the FACS machine.
The general principles of fluorescence activated cell sorting, including methods b which single cell suspensions can be made, methods by which cells can be labeled using, e.g., fluoresceirtly labeled probes, methods by which cells can be separated, from one another, as well as hardware that, can be employed in flow cytometry, including flow cells, reagents, and computer control systems are know and are reviewed in. a variety of publications, including, but not limited to: (Orfao et al., 1996; Johnson et al., 2007; Tung et al., 2007; and Dainiak et al., 2007).
The present invention also includes kits for detecting glypican-1 in the body fluids or tissues of patients. In one embodiment the kit for detecting cancer comprises the materials necessary to conduct any of the detectio assays described in this application. In some embodiments the kit for detecting cancer comprises a first anti-glypican-l antibody or other ligand, a pharmaceutically acceptable cairier, and glypican-1 standards; wherein said kit is capable of detecting glypican-1 in the body fluid or tissue of a patient. The first anti-glypican- 1 antibody may or may not be MIL-38. The first anti-glypican-l antibody may comprise: a heavy chain variable regio comprising a complementarity determining region 1 (CDRl) comprising or consisting of a amino acid sequence defined by positions 50-54 of SEQ ID NO: 10; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 69-85 of SEQ ID NO: 10; a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 118-126 of SEQ I D NO: 1.0; and comprise a light chain variable region comprising a complementarity determining region 1 (CDRl ) comprising or consisting of an amino acid sequence defined by positions 44-54 of SEQ ID NO: 11; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 70-76 of SEQ ID NO; 1 1 ; a complementarity determining region 3 (CDR3) comprising or consisting of a amino acid sequence defined by positions 109- 117 of SEQ ID NO: 11. The anti-glypican-l antibody used to detect die glypican-1 levels may not comprise: a light chain variable region comprising a complementarity determining region 1 (CDR l ) comprising or consisting of an amino acid sequence defined by positions 48-58 of SEQ ID NO: 12; a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 74-80 of SEQ ID NO: 12; and a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 1 13-121 of SEQ ID NO: 1 . The first anti-glypican-l antibody may be produced by or otherwise identical to an antibody generated by hybridoma cells as deposited on 22 August 2014 at CellBank Australia (CBA) under accession number CBA20140026. In some embodiments, the kit will require the additional use of standard laboratory tools or machinery. In some embodiments, necessary tools include pipettes, cell sorting machines, plate readers, centrifuges etc as are known, to those being skilled in the art. In some embodiments, use of the kit may require additional standard laboratory reagents such as pipette tips, membranes, buffers, or chemicals as are well known by those being skilled in the art. In some embodiments the kit further comprises a secondary ligand. In some embodiments the secondary ligand is a second anti~glypican-l antibody. In one embodiment, the second anti-g!ypican a tibody is the same as the first anti-glypican-l antibody. In some embodiments, the secondar ligand is conjugated to a label for rapid detection of said ligand. In some embodiments the antibodies of the kit can be antibody fragments or antibody combinations as described, in this application.
In some embodiments the detection of glypiean-I in the body fluids or tissues of a patient is indicative of the presence of prostate cancer. In some embodiments, the presence of i, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, .14, 15, 16, 1.7, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 4.2, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 5.3, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 600, 700, 800, 900, 1 00 pg/ml of glypican-1 in the body fluid of a patient is indicative of prostate cancer.
In some embodiments the detection of glypican-I in the body fluids or tissues of a patient is indicative of the presence of prostate cancer. In some embodiments, the presence of .1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, .15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 3.10, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 600, 700, 800, 900, 1000 ng ml of glypican-1 in the body fluid of a patient is indicative of prostate cancer.
In some embodiments the detection of glypican- i in the body fluids or tissues of a patient is indicative of the presence of prostate cancer. In some embodiments, the presence of I , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1.1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 2.9, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 μ§/ηι! of glypican- 1 in the body fluid or tissue of a patient is indicati ve of prostate cancer.
In some embodiments elevated levels of glypican- 1 , or glypican- 1 detection signal in the body fluid or tissue of a patient is indicative of prostate cancer. In some cases, the glypican- 1 levels of cancer patients are 1%, 2%, 3%, 4, 5%, 6%, 7%, 8%, 9%, 10%, 1 1 %, 12%. 13%, 14%, 15%, 16%, 17%, 18%, 1.9%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, 450%, 460%, 470%, 480%, 490%, 500, 600%, 700%, 800%, 900%, 1000%, 5,000%, 10,000%, >'15,000% higher than the glypican- 1 levels or glypican-1 detection signal of a control non-cancerous body fluid or tissue. In some embodiments the control noncancerous body fluid or tissue will be age matched to the patient.
EXAMPLES
Example 1. Characterization of the cell bound MIL-38 antigen.
Despite initial reports of the MIL-38 antigen as a 30kD protein (Russell el i 2004), work. by the present inventors has indicated that the MIL-38 antibody predominantly detects a 60kDa antigeti in a range of cell extracts. Western blot reactivity of MIL-3S with the antigen is lost if the sample has been incubated with reducing agents prior to gel electrophoresis.
Using MIL-38 antibody for imnmnoprecipitation experiments we were able to specifically isolate the 60kDa protein from a variety of cell extracts. The presence of the 60kDa antigen on the cell surface was investigated using live cell immunoprecipitations. In these experiments, live cells were incubated on ice with serum-free media containing the MIL-38 antibody. Cells were then washed, lysates prepared and incubated with protein G beads to isolate any antibody associated with the cells. The 60kDa band was present in these immunoprecipitates indicating that the antigen was recognized on the cell surface by the MIL-38 in the media. Example 2. MIL-38 antigen immunoprecipitation and mass spectrometry,
DIM 45 prostate cancer cells were processed through a membrane protein extraction kit (MPEK). Membrane extracts were immunoprecipitated with MIL-38 cross-linked to magnetic beads. The immunoprecipitates were either run into a gel and excised for mass spectrometry analysi or were eiuted directly from the beads and the subjected to mass spectrometry. Antigens bound to the MIL-38 antibody were then analyzed via mass spectrometry analysis, which can identify peptides based on mass/charge data.
The mass spectrometer identified glypican-1 with a peptide score of 4278 and sequence coverage of 46% including I S distinct sequences (Figure I).
Example 3, MIL-38 antigen immunoprecipitation, size exclusion chromatography and mass spectrometry.
DU-145 prostate cancer cells were processed through a membrane protein extraction kit (MPEK). Membrane extracts were immunoprecipitated with MIL-38 cross-linked to magnetic beads. Following extensive washing, the immunoprecipitate was eiuted in TBS (tris buffered saline) containing 2% SDS. The eluate was subjected to size exclusion chromatography (SEC) and every second fraction was acetone precipitated, resuspended in sample loading buffer and used for MIL-38 western blots. Fractions 28 and 30 contained high amounts of MIL-38 antigen (Figure 2), indicating that fraction 29 would also contain high concentrations of the MIL-38 antigen. Fraction 29 was subjected to mass spec analysis and glypican-ϊ was identified with sequence coverage of 14% (Figure 3). This further confirmed that the antigen for the MIL-38 antibody was glypican-1.
Example 4. MIL-38 and anrl-gl ican-l (anti-GPC-l) antibodies show overlapping reactivity on 2D western blots.
A rabbit anti-GPC- 1 antibody was purchased and showed reactivity with the glypiean- 1 core protein at a molecular weight of approximately 60 kDa ,- the same molecular weight as detected by MIL-38. To confirm that MIL-38 recognized glypican-l. prostate cancer DU-145 MPEK extracts were subjected to 2D electrophoresis and western blotting.
As shown in Figure 4, MIL-38 antibod and the anti-GPC-l antibodies showed overlapping reactivity detecting a protein with 60 kDa molecular" weight and isoelectric points ranging from 5 to 7. Example 5. MIL-38 is detected in anti-GPC-l inimunoprecipitates and vice versa.
MIL-38 or rabbit anti-GPC-l antibodies were used to tmmonopreeipitate their respective antigens from DU-145 or C3 (MIL-38 negative) MPE extracts. The immunoprecipitates (IPs) were western blotted with either MIL-38 or anti-GPC-l antibody (Figure 5).
A 60kDa GPC-1 reactive band was detected in MIL-38 IPs blotted with anti-GPC-l, whil a 60 kDa MI L-38 reactive band was detected in anti-GPC-l IPs blotted with MIL-38, No reactivity was detected with the secondary only controls. Furthermore, immtiiioprecipitating with MIL-38 antibody resulted in almost complete depletion of both MIL-38 and anti-GPC-l antigens, strongly suggesting that the MIL-38 antigen is glypican-1.
Example 6. MIL-38 detects recombinant GPC-1
Two sources of purified recombinant glypican-1 were tested or reactivity with MIL- 38 and anti-GPC-l antibodies. The first source was a truncated form produced from wheat germ extracts (note this would not contain appropriate mammalian post-trans lational modifications). The second source was full-length g!ypican-1 produced in murine NSO cells. No MIL-38 reactivity was observed with the wheat germ expressed glypican-1, however it could be detected with the rabbit anti-GPC-l antibody (data not shown). In contrast, very strong reactivity with MIL-38 and anti-GPC-l antibodies was observed for the glypican- 1 produced in NSO cells (Figure 6),
Example 7. MIL-38 can detect antigen secreted into cell culture supernatant.
To date, there has been no experimental evidence for secretion of MIL-38 antigen. To test this, DU-145 cells were washed in serum-free media then incubated with serum- free media for 36 hrs. The resulting conditioned media was immunoprecipitated with MIL-38 and the resulting samples compared with a standard IP from DU- 145 MPEK extracts. Bands of approximately 40 and 55 kDa were observed in the conditioned medium IP, compared to the 60 kDa band isolated from DU-145 extracts (Figure 7).
The conditioned medium IP sample containing the 40 and 55kD bands was subjected to mass spec analysis, Glypican-1 (SEQ ID No: 2) was identified with 16% peptide coverage (Figure 8a). Separate analyses of just the 40kD band (Figure 8b) or the 55kD band (Figure 8c) both identified as the glypican-1 peptide (SEQ ID Not 2).
These results suggest that a MIL-38 reactive form of glypican-1 can be released into cell culture supernatant from the DU-145 prostate cancer cell line. Example 8. G.PC-1 can be detected by MIL-38.in prostate cancer plasma samples and in membrane extracts from prostate cancer patients.
To date, there has been no experimental evidence for secretion of MlL-38 antigen in plasma samples from normal or prostate cancer patients. To test this, plasma samples from one normal, patient (042) and one prostate cancer patient (046) were immunoprecipitated with MIL-38 antibody and the IP sample western blotted with MIL-38 and anti-GPC-l antibodies (Figure 9a).
Both antibodies detected specific bands of approx. 70kDa in both plasma samples. The signals were markedly higher (darker bands) for both MIL-38 and anti-GPC-l antibodies in the prostate cancer patient plasma compared to the normal patient plasma, suggesting that this soluble form of glypican- may be elevated in prostate cancer patients.
To determine if MIL-38 antigen could be detected in membrane protein extracts from normal prostate and prostate cancer, one sample of each was obtained from Novas Bio. Equi valent amounts of protein were western blotted using MIL-38 antibody (Figure 9b). The prostate cancer extract demonstrated much higher expression of the MIL-38 antigen than the normal prostate sample.
Example 9. Detection of MIL-38 antigen in patient urine.
MIL-38 can detect cells in the urine of prostate cancer patients. To test the sensitivity and specificity of this detection method, 125 age-matched urine samples were obtained. Cells were spun down from the urine and analyzed by the MIL-38 indirect immunofluorescence assay. A total of 47 healthy controls, 37 benign prostatic hypertrophy (BPH) and 41 biopsy- confirmed prostate cancers were analyzed. Examples of positive prostate cancer cells, DU- 145 positive controls and C3 negative cells are shown (Figure 10).
The MIL-38 immunofluorescence assay (IF A) test demonstrated a sensitivity of 71% and a specificity of 73% in identifying prostate cancers within the cohort. The test showed 71% sensitivity and 76% specificity in identifying prostate cancers compared to BPH patients. (Table 3). Table 3. Sensitivity and specificity calculations of prostate cancer detection in patient urine.
Figure imgf000034_0001
Example 10, Combination of MIL-38 antigen detection with PSA level increases ability to detect prostate cancer.
When the MIL-38 ummmofluorescence assay (IF A.) test is combined with the PSA test there are increases in sensitivity and specificity. These increases vary according to the cut-off value applied to the PSA test. When the cutoff for a positive diagnosis is greater than 2 ng niL then specificity increases from 73% for just the IFA test to 83% for the two tests combined When the cutoff for a positive diagnosis is greater- than 4 ng/niL then specificity increase from 73% for just the IF A test to 89% for the two tests combined.
This is further illustrated by the logistic regression analysis which shows increases in OR and 95% CI when the two tests are combined.
Table 4, Increases in sensitivity and specificity when the MIL-38 IFA tes is combined with PS scores
Stratified by 2 ηψηύ Cancer
0
PSA < 2 ag ml Sensitivity
Cancer Specificity
IFA
1 0
Figure imgf000034_0003
Sensitivity
GPC-] 100%
Specificity Stratified by 4 i g ml
Figure imgf000034_0002
PSA > 2 na 'ml PSA 4 sa/ffll Cancer
Sensitivity
GPC-1 Specificity
IFA
Figure imgf000035_0001
PSA > 4 ns ml
Cancer
t 0 Sensitivity = 68%
GPC-1 1 Specificity = 89% IFA 0
Figure imgf000035_0002
Logistic regression
OR 95% CI
GPC-1 IFA
GPC-1 IFA (adjusted for PSA <4)
GPC- 1 IF A (adjusted for PS A <2)
Example 11. MIL-38 can detect recombinant glypican-1 in a variety of ELISA formats.
Three ELISA assay formats were conducted as shown in Figure ί 1. Recombinant glypican- i was tested at 0, 0.1 , 1 and 10 ng ml concentrations using MIL-38 as a capture antibody and rabbit anti-GPC-'i as a detection antibody. Similar experiments were conducted using the rabbit antt-GPC-1 as the capture antibody and the MIL-38 as the detection antibody. A single antibody ELISA was also tested using the MIL-38 antibody as the capture antibody, and a biotinylated MIL-38 antibody as the detection antibody. The results indicate that anti-GPC antibodies can be used in a variety of ELISA formats and that the S0 GPC- 1. might represent a suitable positive control.
Example 12. Detection of glypican-1 antigen using AM4 MIL-38 antibodies
Experiments performed by the present inventors determined that an original, deposit of the hyhridoma for MIL-38 antibody (ATCC accession no. HB 1 1785: murine hybridoma BLCA-38), then referred to as the "BLCA-38 hybridoma" is a mixed population of hybridoma cells that produces two distinct antibody populations, referred to here as "AM3" and "AM4". Hybridoma cells responsible for producing each different antibody population were separated, and the "AM 4" hybridoma cells were deposited on 22 August 2014 at CeilBank Australia (CBA) under accession number CBA20.140026.
Ninety-six well plates were coated with MIL-38 preps AM3 or AM.4 (I μ§ΛνβΠ) in carbonate buffer pH 9.5 overnight. Plates were blocked with PBS-T een (0.1%) containing 5% skim milk at 37°C and washed. Antigen (GPC- 1 NS0) was diluted in Buffer II (20mM HEPES pH 7.5, 0.5mM EDTA, 0.5% Triton X-100) with the addition of I SOniM NaCl and incubated overnight at 37C'C. Detection was performed with biotinylated AM4 antibody followed by detection with avidin H P ( ^g/mL). TMB (Sigma cat no T0440) was added and stopped with TMB stop solution (Sigma $5814). Absorbance was read at 450nm. Results are shown in Figure 12 A.
In a second experiment, ninety-six well plates were coated with MIL-38 preps 34A (a mixture of AM 3 and AM4 antibodies) or AM4 (2.5 pg/well) in PBS pH 7.2 for Ih at room temperature. Plates were blocked with Blocker Casein (Thermo) in PBS-Tween (0.05%) for Ih at 37°C. Following washing, antigen (GPC- 1 NS0) was diluted in TBS pH 7.2 containing 50mM Tricine and 150 mM NaCl and incubated at 37°C for I h. Detection was performed with biotinylated AM4 clone 1 F5 followed by detection with avidin HRP (1 μ§/ηιΕ), TMB (Sigma cat no T0440) was added and stopped with TMB stop solution (Sigma S5814). Absorb'ance was read 450nra. Results are shown in Figure 12B.
The first ELISA described above was developed using MIL-38 to capture NSO produced GPC-1 (i.e. MIL-38 antigen). This experiment compared monoclonal AM3 MIL-38 and monoclonal AM4 MIL-38 for capture. AM3 did not function as a capture agent in a sandwich ELISA assay, whereas AM4 was shown to do so (Figure 12A).
The second ELISA described above compared the ELISA signal obtained whe a mixed population of MIL-38 (AM3 and AM4) was compared to that obtained from a monoclonal AM4 1 F5 clone. Using AM4 IF5 as a capture agent provided a higher ELISA signal than using the mixed 34A antibody population (Figure 12B).
The sandwich ELISA results demonstrate that only the AM4-like forms of the monoclonal MIL-38 antibody have utility in detecting glypican-i antigen as a capture reagent and that a capture agent containing a monoclonal population provides a superior ELISA signal to that consisting of a mixed population.
Example 13 sequence analysis of AM4 and AM3 MI L-38 antibody populations
Materials and Methods
- Heavy and light chain sequencing (DMA)
Three separate sequencing runs were performed. The first run (coded 224945) utilised bi-clonal hybridoma cells from a mixed (AM4 and AM3) preparation named 1-0. The second run (coded 449295- 1) utilised cells from Alfio I a hybridoma stock that was used to generate AM4. The third run (coded 449295-5) utilised cells from Alfio II, a hybridoma stock that was used to generate AM3.
For sequencing runs 224945 (l-O) and 449295-1 (Alfio I), total RNA was extracted from frozen hybridoma cells and cDNA was synthesized from the RNA. RT-PCR was then performed to ampl ify the variable regions (heavy and light chains) and constant regions of the antibody, which were then cloned into a standard cloning vector separately and sequenced.
Total RNA was isolated from the hybridoma cells following the technical manual of
TRIzol® Plus RNA Purification System. The total. RNA was analysed by agarose gel electrophoresis. Total RNA was reverse transcribed into cDNA using isotype-specifie anti- sense primers or universal primers following the technical manual of SuperScriptTM III First-Strand Synthesis System. The antibody fragments of VH, VL, CM and CL were am lified according to the standard operating procedure of RACE of Gen Script.
Amplified antibod fragments were separately cloned into a standard cloning vector using standard molecular cloning procedures.
Colon PCR screening was performed to identify clones with inserts of correct sizes.
No less than five single colonies with inserts of correct sizes were sequenced for each antibody fragment.
VH and V piasmids encoded the full-length variable regions of the antibody and a part of Cii l and Ci:. CH plasmid encoded a part of CB1 and full-length C«2 and €.Β3. CL plasmid encoded a part of CL, In order to get full-length constant regions or heavy light chain, the part, of constant regions encoded by VH and VL piasmids and the part of constant regions encoded by CA and L piasmids were amplified by PCR separately, and then overlap extension PCR was employed to obtain full-length DNAs. Five single colonies with correct VH, VL, Ca and CL insert sizes were sent for sequencing.
Sequencing run 449295-5 (Alfio II) encountered difficulty obtaining sequence corresponding to the expected IgG! heavy chain sequence. Two UNA preparations were performed. For the 1 st batch of cells, oligo-elT primer and CDS III primers were used for reverse transcription (RT). VH/CH and VK/CK were amplified by PCR using TgGl and Tg specific primers, partial mouse β-actin gene was amplified as positive control. Normal light chain bands were obtained easily while only weak VH could be observed on the gel. Five individual colonies with correct V and C& insert sizes were sent fo sequencing. The VK and CK genes of five different clones were found to be nearly identical. The consensus light chain sequences from the Alfio 0 hybridoma is listed below. One unproductive heavy chain sequence was obtained from eight randomly sequenced VH positive clones, shown as below. Three kinds of heavy chain constant region sequences were obtained from ten randomly sequenced CH positive clones (one IgGiCH, one
Figure imgf000038_0001
and eight IgGsbCi-i). In order to avoid the influence of potential class switching, amplification of the CR using IgM specific primer was performed, but no target PCR product was obtained. There was also no target PCR product when full-length heavy chain (VH-CH) was amplified using heavy chain FRl degenerate primers.
As no productive heavy chain could be obtained after several attempts, isolation of heavy chain sequence from the 2nd vial of Alfio II cells was attempted. For the 2nd vial of cells, oligo-dT primer was used for reverse transcription initially. VH was amplified using IgCi i , IgG2b, Ig , IgA specific primers and IgG degenerate primer, respectively, and YK was amplified using Igf specific printers. Productive light chain and unproductive heavy chain, which were identical with previous resitits, were obtained. Reverse transcription using Random 6 mers primer was also attempted without success.
In summary, multiple attempts to isolate light chain and heavy chain sequence were made. One rearranged light chain sequence was consistently obtained after different attempts on two batches of cells. However, only weak VH target PCR products were observed and sequencing did not result in any consistent heavy chain sequence.
Remits
- Sequence Summary Table
Table 5 below provides an overview of heavy and light chain nucleic acid and protein sequences of the antibodies studied, indicating the positions of various internal regions.
Table 5: Overview of AM4 and A 3 antibody sequences and interna! regions
Figure imgf000040_0001
Notes: HFR heavy chain framework region: HCDR heavy chain complementarity determming region; CM ~ heavy chain constant region LFR - light chain framework region; LCDR = light chain complementarity determining region; CL - light chain constant region Grey Boxes are indicative of positions within sequence defined in column I by SEQ ID NO.
Sequencing (DNA.)
The isolated total RNA of the sample was ru alongside a DNA marker (Marker III -
TIANGEN, Cat. No. : MD 103) on a 1.5% agarose/GelRed™ gel.
Four microliters of PCR products of each sample were ran alongside the DNA marker (Marker HI) on a 1.5% agarose/GeiRed!M gel. The PCR products were purified and stored at -20 £C until further use.
The VH> Vj ,, C-B. and Q, genes of five different clones were nearly identical. The consensus sequence, listed below, was detennined to be the sequence of the antibody produced by the monoclonal hybridom population (AM-4).
AM4 MIL-38 Mouse IgGi Heavy Chain DNA Consensus Sequence (SEP ID NO: 13)
TCTGGACCTGAGCTGAAGA&GCCTGGAGAGA^
fGGGTGAAGCAGGGTCCAGGAAAGGGTTTAAGGTGGATGGGC
lliillllie^
mG¾¾CA¾ ^CC CAGA>J¾ GA& 5AC¾CGGC ¾CA AXTTC G GCTiU3?
ϊ GG GGCC AAGGG ACTC GGT C AC GTCTCTGC*
Figure imgf000041_0001
individual regions of mouse heav chain encoded sequence are highlighted with alternating shaded/unshaded text. Positions: 1-57 ·- leader sequence; 58-147 ^ framework region (HFRl); M ~162 - eomplemetit rity determining region (HCDRl): 163-204 HFR2; 205- 255 ~ HCDR2; 256-351 - NFR3: 352-378 HCDR3: 379-411 HFR4; 412-1383 constant regions (CH1-CH3); 703-741 ■■■■■■■■ hinge region (underlined); 1384-1386 - Mop codon. AM4 MJL-38 Mouse Kappa Light Chain DNA Consensus Sequence (SEQ D NO: 14) ιιιιιιι§ι¾^
Figure imgf000042_0001
lilGGTGTGCCATCAAGGTTCAGTGGCAGTGGATCAGGAACACAATATTGTCTCAAGATCAATAGCCTGCAGCCT
ImJivki i regions of mouse light chain encoded sequence are highlighted with alternating shaded/unshaded text. Positions: i-6() : leader sequence; 61-129 framework region (IFRi); 130- 162 - complementarity determining region (ICDRi); 163-207 LFR2: 208- 22& ~ LCDR2: 229-324 ~ 1.FR3: 325-3S1 ~ lO)R3: 352-381 LF.R4: 382-702 - constant regions (CK); 703-705 ~ stop codon.
The heavy and light chain AM4 MIL-38 consensus DNA. sequences above translate to the fol lowing heavy chain and light chain amino acid sequences;
AM4 MIL-38 Mouse IgG 1 Heavy Chain Amino Acid Consensus Sequence (SEQ ID NO: 10}
Figure imgf000042_0002
Figure imgf000042_0003
Individual regions of mouse IgG I heavy chain sequence are indicated in the amino acid sequence above. Positions 1-19 leader sequence; 20-49 - framework region (HFRl); 50- 54 complementarity determining region 1 (HCDl); 55-68 -■■ HFR2; 69-85 HCDR2: 86- 117 - HFR3; 118-126 - HCDR3; 127-137 - BFR4 (also called the joining region or J- region); J 38-461 IgG I. chain constant regions (CHI (Ή3) & stop codon (*). Hinge region - is underl ined in the sequence above. 'VM4 consensus M1L-3 S Light Chain Amino Acid Consensus Sequence (SEP ID NO: 11)
Figure imgf000043_0001
Individual regions of light chain amino acid sequence are indicated a label led: Positions 1- 20 ■■■■■■■■ Leader sequence; framework region (LFRl): 2.1 -43 ■■■■■■■■ complementarity determining region I (ICDRl); 44-54 - LFR2; 55-69 LCBR2; 70-76 - LFR3; 77-108 - LCFR3; 109- 117 *» LFR4; 118-234 » kappa constant region (CK «¾ stop codonf*)
AM3 consensus sequences
No consistent heavy chain sequence could be obtained from the AM3-like Alfio II ceils. The light chain sequence obtained from sequencing run 449295-5 (Alfio IT) was consistently obtained and showed clear differences in both the framework regions and the compiementarity-detennming regions compared to the sequence for the other two sequencing runs.
AM3 MIL-38 Kappa Light Chain DMA Consensus Sequence (SEP IP ISO: 15)
IGAC
Figure imgf000043_0002
iGGAGTCAG GATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAAC ACAAAG TGG AAA A?
* Individual regimis of light chain encoded sequen e are highlighted with alternating huded/iimhaded text. Positions: 1-72 - leader sequence: 73- 141 - framework region (LFRl); 142-174 - complementarity determining region (LC!Ml): 175-219- LFR2; 220-240 ■■■■■■■ LCD1U; 241-336 ■■■■■■■■ LFR3; 337-363 ■■■■■■ LCDR3; 364-393 ■■■■■■ LFR4: 394-714 ■■■■■■■■ constant region (€K); 715-717 - stop codon AM 3 JL-38 Light Chain Amino Acid Consensus Sequence (SEP ID NO: 12)
SY£ YSGVT DRFTGSGS TDFTL I NNVQSSDLAEYFCQQYNSF FTFGS GTKLS ΤΚ||||||||1|11|||||1||
Individual regions of light chain amino acid sequence are indicate as l b l led: Positions I- 24 ^ Leader sequence; 25-47 framework region (LFRl): 48-58 complementarity determining region I (ICDRl); 59-73 - LFR2; 74-80 - LCDR2: 81-112 - LFR3; 113-121 - LCDR3; 122-131 - LFR4; 132-238 - kappa constant regio ( Kj & stop codonf*)
Example 14 identification and characterisation of glypiean-l epitope bound by AM4 anti-glypkaii-1 antibodies
Materials and Methods
Table 6 below provides information on the AM4 anti-giypican- 1 antibodies used in this study.
Table 6: description of AM4 antibodies
Figure imgf000044_0001
Produced by h ' ybridama celts as deposited at eiibank Australia under accession number
Peptides
The h man glypican-i (GPC-I ) sequence on which this study was based is defined in SEQ ID NO: 16. The following sequences of residues were used:
GPC1 res idues # 343- 366 GN PKVNPOG PGPEBKRRRG LAP (SEQ ID NO: 17)
GPCl_re s idues # 140-14 9 G E L Y QHM AFRD L Y S E LR (SEQ ID NO: 18)
Peptide synthesis
Peptide synthesis was performed using the methods referred in Example I. Chemically synthesized linear and CLIPS peptides were synthesized according to the designs shown below: Chemically linked Peptides on Sca ffolds (CLIPS) technology
The following provides description of general principles of the CLIPS technology utilised.
CLIPS technology structurally fixes peptides into defined three-dimensional structures. This results in functional mimics of even the most complex binding sites. CLIPS technolog is now routinely used to shape peptide libraries into single, double or triple looped structures as well as sheet- and helix-like folds.
The CLIPS reactio takes place between bromo groups of the CLIPS scaffold and thiol sidechains of cysteines. The reaction is fast and specific under mild conditions. Using this chemistry, native protein sequences are transformed into CLIPS constaicts with a range of structures- including single- T2 loops, T3 double loops, conjugated T2+T3 loops, stabilized beta sheets, and stabilized alpha helixes (Timmerman ei ah, J. MoL Recognit. 2007; 20: 283- 29).
CLIPS library screening starts with the conversion of the target protein into a library of up to 10,000 overlapping peptide constructs, using a combinatorial matrix design. On a solid carrier, a matrix of linear' peptides is synthesized, which are subsequently shaped into spatially defined CLIPS constaicts. Constructs representing both parts of the discontinuous epitope in the correct conformation bind the antibody with high affinity, which is detected and quantified. Constructs presenting the incomplete epitope bind the antibody with lower affinity, whereas constructs not containing the epitope do not bind at all. Affinity information is used in iterative screens to define the sequence and conformation of epitopes in detail.
The target protein containing a discontinuous conformational epitope is converted into a matrix library. Combinatorial peptides are synthesized on a proprietary minicard and chemically converted into spatiall defined CLIPS constaicts. Binding of antibodies is quantified.
Peptide synthesis
To reconstruct discontinuous epitopes of the target molecule a library of structured peptides was synthesized. This was done using Chemically Linked Peptides on Scaffolds (CLIPS) technology. CLIPS technology allowed the generation of structured peptides in single loops, double-loops, triple loops, sheet-like folds, helix-like folds and combinations thereof. CLIPS templates were coupled to cysteine residues. The side-chains of multiple cysteines in the peptides were coupled to one or two CLIPS templates. For example, a 0.5 raM solution of the T2 CLIPS template 1 ,3-bis (bromomethyl) benzene was dissolved in ammonium bicarbonate (20 aiM, pH 7.9)/acetonitriie (l: l(v/v)). This solution was added onto the peptide arrays. The CLIPS template bound to side-chains of two cysteines as present in the solid-phase bound peptides of the peptide-arrays (455 wells plate with 3 μί wells). Tire peptide arrays were gently shake in the solution for 30 to 60 minutes while completely covered n solution. Finally, the peptide arrays were washed extensively with excess of ¾Q and sonicated in disrupt-buffer containing 1 percent SDS/0.1 percent beta-mercaptoethanol in PBS (pH 7.2) at 70°C for 30 minutes, followed by sonication in i¾0 for another 45 minutes. The T3 CLIPS carrying peptides were mad in a similar way but with three cysteines.
Linear and. CLIPS peptides were chemically synthesized according to the following designs:
Mimic Discontinuous epitope mimics
Type
Label MATA MAT.B
Description Constrained peptide mimics of varying length. From the two starting
sequences (SEQ ID NO: 17 and SEQ ID NO: 18) all 10 to 22, and 1.0 to 18 mer peptides with stepsize 4 have been made, and these have been paired.
At the termini and in between the two peptides cysteines are placed. These are linked by a T3 CLIPS.
Set 2
Mimic Linear peptides
Type
Label RN'.PKVNPQGPGPEEKRR. (SEQ ID NO: 19)
Description Substitution analysis, starting from the base sequence PKVNPQGPGPEEKRR
(SEQ ID NO: 20), all individual amino acids are replaced by all naturally occurring amino acids, except cysteine.
Set 3
Mimi c Constrai tied peptide .
Type Label RN.PKVNPQGPGPEEKRR_LOOP (SEQ ID NO: 19),
RN.ELCTQNCRAFRDLYS_heli3 (SEQ ID O; 21)
R .ELCTQNCRAFRDLYSJ.OOP (SEQ ID NO: 21)
Description Substitution analyses, starting from the base sequences as indicated in the
label names, all individual amino acids are replaced by all naturally occurring amino acids, except cysteine.
EIJSA screening
The binding of antibody to each of the synthesized peptides was tested in a PEPSCAN- based ELISA. The peptide arrays were incubated with primary antibody solution (overnight at 4°C). After washing, the peptide arrays were incubated with a 1/1000 dilution of an antibody peroxidase conjugate (SB A, cat.nr.2010-05) for one hour at 25°C. After washing, the peroxidase substrate 2,2,-azino-di-3-etliylbenzthiazoline sulfonate (ABTS) and 2 μΐ/ml of 3 percent H202 were added. After one hour, the color development was measured. The color development was quantified with a charge coupled devic (CCD) - camera and an image processing system.
Data, processing
The values obtained from the CCD camera range from 0 to 3000 mAU, similar to a standard 96-well plate ELISA-reader. The results are quantified and stored into the Peplab database. Occasionally a well contains an air-bubble resulting in a false-positive value, the cards are manually inspected and any values caused by an air-bubble are scored as 0.
Synthesis quality control
To verify tire quality of the synthesized peptides, a separate set of positive and negative control peptides was synthesized in parallel. These were screened with antibody 57.9 (ref. Posthumus et al, L Virology, 1 90, 64:3304-3309).
Table 7 summarises antibody binding conditions. For the Pepscatt Buffer and Preconditioning (SQ), the numbers indicate the relative amount of competing protein (a combination of horse serum and ovalbumin). able 7: screening conditions
Figure imgf000048_0001
Results
Primary experimental results and signal to noise ratio determination
A graphical overview of the complete dataset of raw ELISA results generated by the screening is shown in Figure 1.3. Here a box plot depicts each dataset and indicates the average ELISA signal., the distribution and the outliers within each dataset. Depending on experiment conditions (amount of antibody, blocking strength etc) different distributions of ELISA data are obtained.
A ntibody MIL 38-ΛΜ4
In earlier analyses carried out by the present inventors it was established that MIL 38- AM4 binds glypican on stretch 348VNPQGPG'PEEK358 (SEQ ID NO: 22), and also binds to the stretch i35TQNARAi4o (SEQ ID NO: 8)/ 335TQNARAF D 14 (SEQ ID NO: 9), which was taken as an indication for a discontinuous epitope.
The looped constructs containing the main stretch pinpoint the residues that are most critical to binding. The results of this study demonstrated that residues V348, Q35I, G352, and P353 do not tolerate replacement, with significant requirement for K347, N349 and P350, and to a lesser extent from G354, P355, and E356 (Figure 14).
Conclusions
The conformational epitope of antibody JL38- AM4 was profiled.
Leads obtained in earlier analyses that point to a discontinuous epitope for MIL38 - AM4 were used to generate matrix array in which the loops have different lengths. In addition, full substitution analyses of the individual lead sequences were made. All arrays were probed with MIL38-AM4 antibody.
For recognition of glypican- .1 , the M1L38 - AM4 antibody investigated in this study binds to an epitope that exclusively or mainly consists of the flexible loop between residues 347 and 358.
Monoclonal antibody MIL38-AM4 mainly binds glypican-l on the loop between residues 347-355, but this antibody clearly benefits from the addition of residues from the range 135-140 or 135-143 to the peptide.
Figure imgf000049_0001
Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary ski! ! in the art to which this invention belongs. Although any methods and materials, similar or equivalent to those described herein, can he used in the practice or testing of the present invention, the preferred methods and materials are described herein. All publications, patents, and patent publications cited are incorporated 'by reference herein in their entirety for all purposes.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Notliing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover an variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.
REFERENCES
Aikawa T, Whipple C, Lopez M, Gunn J, Young A, Lander A, Korc M. 2008. "Glypican-1 modulates the angiogenic and metastatic potential of human and mouse cancer cells" The Journal of Cl inical Investigation Vol 1 18: 1
Borrebaeck et al., 1995 Antibody Engineering: A Practical Approach (Borrebaeck, C, ed.),
1995, Oxford University Press, Oxford; J. Immunol 149, 3914-3920 (1992)
Cole et al.. 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77- 96
Dainak M, Kumar A, Gala v IY, Mattiasson B. 2007 "Methods in. Cell Separations" Vol 106: 1 - 18 David G„ Lories V, Decock B, Marynen P, Cassiman JJ, Van den Berghe H. 1990.
"Molecular Cloning of a Phosphatidylinositol-anchored Membrane Heparan Sulfate
Proteoglycan from Human Lung Fibroblasts" The Journal of Cell Biology Vol 1 1 1:6-2 3165- 3176 Filmus J, Capurro M, Rast J. "Glypicans" Genome Biology 2008, 9:224
Filmus J, Selleck SB: Glypicans: proteoglycans with a surprise. J Clin Invest 2001 , 108:497- 501. Fujise M, Takeo S, Kamimura K, Matsuo T, Aigaki T, Izumi S, Nakato H. Dally regulates DPP morphogen gradient formation in the Drosophila wing. Development 2003, 130: 1515- 152.2.
Han C, Belenkaya TY, Wang B, Lin X. "Drosophila glypicans control the ceiS-to-cell movement of hedgehog by a dynamin-independent process". Development 2004, 1.31:601- 61 1.
Harlow et. al 1988, Antibodies, A Laboratory Manual, Ed Harlow and David Lane, Cold Spring Harbor Laboratory (1988), Cold Spring Harbor, N.Y. Harmon 3 Eyre, Robert A Smith, and Curtis J ettlin, "Chapter 28 Cancer Screening and Early Detection" Hol!and-Frei Cancer Medicine 5th Edition. Bast R.C Jr, ufe DW, Pollock RE, editors Hamilto (ON): BC Decker; 2000.
Hoffman .R., Gililand F., Cameron M. Hunt W., and Key C. "Prostate-specific antigen testing accuracy in community practice" BMC Faro Praet 2002, 3: 19.
Holliger P and Hudson P. 2005. "Engineered antibody fragments and the rise of single domains" Nature Biotech 23 1 126- Ϊ 136,
Johnson KW, Dooner M, Queensberry PJ. 2007 "Fluorescence Activated Cell Sorting: A Window on the Stem Cell" Vol 8:133-9 leef J> Ishiwata T, Kumbasar A, Friess H, Bucliler M, Lander A. "The Cell-surface haparan sulfate proteoglycan glypican-1 regulated growth factor action in pancreatic carcinoma ceils and is overexpressed in human pancreatic cancer" J Clin Invest. Vol 102 No 9 Nov 1 98
Ko er and Milstein 1 75 Continuous cultures of fused cells secreting antibody of predefined specificity Nature 256:495-497
Matsuda K, Maruyama H, Quo F, i leef J, Matsumodto Y, Lander AD, Korc M. "Giypican-1 is overexprssed in human breast cancer and modulates the mitogenic effects of multiple heparin-binding growth factors in breast cancer cells." Cancer Res 2001 Jul 15, 61(14)5562- 9.
Orfao A, Ruiz-arguelles, Alejandro. 1 96 "General concepts about cell sorting techniques" Clin. Biochera. Vol 29: 1 5- -Qiao D, Meyer K, Muodhenke C, Friedl S, Friedl D. 2003 "Heparan Sulfate Proteoglycans as Regulators of Fibroblast Growth Factor-2 Signaling in Brain Endothelial Cells: SPECIFIC :ROLE FOR GLYPICAN-l IN GLIOMA ANGIOGENESIS" J. Biol. Chem. .16045-16053. Rotmans et al.1983 Cross-linking of Schistosoma mamoni antigens and their coyalent binding on tlie surface of polystyrene microtitration trays for use in the ELISAJ, Immunol. Methods 57:87-98 (1983) Russell PI, Ow K.T., Tarn PN., Juarez EA., Qu CF„ Li Y., Cozzi PI., and Martiniello-Wilks.
"Immunohistochemical characterization of the monoclonal antibody BLCA-38 for the detection of prostate cancer" Cancer Immunol. Imnxunoother (2004) 53: 995-1004
Spaltro, Andrea Doctoral Dissertation Universit of Bologna 2012
Su G, Meyer. K, andini C. Qiao D, Salamat S, Fried! A. "Glypican- 1 is frequently overexpressed in human gliomas and enhances FGF-2 signaling in glioma cells" Am J Pathol 2006 June 168(6} 2014-2026. Suhovskth A, MostovichL, Kunin 1, Mekhrozhiddin B, Neponmyashchikh G; Aidaulova S, Griorieva E. "Proteoglycan expression in normal human prostate tissue and prostate cancer" Oncology Volume 2013 ID 680136
Tung Jw, Heydari. , Tirouvanziani R, Sahaf B, Parks DR, Herzenherg LA. 2007 "Modern Flow Cytometry: A Practical Approach" Vol 27:453-68
Veugelers M, De Cat B, Ceulemans H, Bruystens AM, Coomans C, Durr J, Vermeesch J, Marynen P, David G. "G!ypican-6, a new member of the glypica family of cell surface proteoglycans." J Biol Chem 1999 274:26968-26977
Walker KZ, Russell PJ, Kkigsley EA. Philips J, Raghavan D. "Detection of maliganant cells in voided urine from patients with bladder cancer, a novel monoclonal assay. J Urol 142: 1578 1989.
Whipple C, Yong A, RLATG, ore M. 2012. "A Krasm D-driven Generic Mouse Model of Pancreatic Cancer Requires Glypican- 1 for Efficient Proliferation and Angiogenesis" Ocogene Ma 17 31(20) 2535-2544.

Claims

L A method of detecting prostate cancer in a patient, the method comprising measuring the level of glypican- 1 in a body fluid sample from a patient and determining that said patient has prostate cancer or an. increased likelihood of developing prostate cancer based upon the level of glypican- 3 in the body fluid sample.
2. The method of detecting prostate cancer in a patient of claim 1, comprising the steps of:
(a) obtaining a body fluid sample from a patient;
(b) contacting said body fluid sample with an anti-glypican-1 antibody; and
(c) determining that said patient has prostate cancer or an increased likelihood of developing prostate cancer based upon binding of said anti-glypican-1 antibody to said body fluid sample.
3, The method of claim 2, wherein said anti-glypican-1 antibody is MIL-38.
4. The method of claim 2, wherein said body fluid sample is contacted with a populatio of antibodies, wherein:
antibodies of the population comprise:
(a) a heavy chain variable region comprising:
a complementarity determining region 1 (CDRl) comprising or consisting of an amino acid sequence defined by positions 50-54 of SEQ ID NO: .1.0;
a complementarity determining region 2 (CDR2) comprising or consisting of a amino acid sequence defined by positions 69-85 of SEQ ID NO;10;
a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 118-126 of SEQ ID NO: 10; and
(b) a light chain variable region comprising;
a complementarity determining region I (CDRl ) comprising or consisting of an. amino acid sequence defined by positions 44-54 of SEQ ID NO: 11;
a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 70-76 of SEQ ID NO: 11;
a com lementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 109-117 of SEQ ID NO: 11; and antibodies of the population do not comprise a light chain variable region comprising:
a complementarity detennining region i (CD 1 ) comprising or consisting of an amino acid sequence defined by positions 48-58 of SEQ ID NO: 12;
a complementarity determining region 2 (CDR2) comprising or consisting of an amino acid sequence defined by positions 74-80 of SEQ ID O: .12;
a complementarity determining region 3 (CDR3) comprising or consisting of an amino acid sequence defined by positions 1 13-121 of SEQ ID 'NO: 12.
5. The method of claim 4, wherein the antibody population is produced by or otherwise identical to an antibody population as generated by hybridoma cells deposited on 22 August 2014 at CeUBaak Australia (CBA) under accession number CBA20140026.
6. The method of claim 2, wherein said anti-glypican-1 antibody is not MI'L-38.
7. The method of any one of claims 2 to 4, wherein said anti-glypican-1 antibody is an antibody fragment or recombinant antibody capable of binding glypican-I.
8. The method of any one of claims 2 to 7, wherein said anti-glypican-i antibody is labeled.
9. The method of claim 8, wherein said label is chosen from a group consisting of a radiolabel, a flitorescent label, a biotin-avidin amplification system, a chemi luminescence system, microspheres, and colloidal gold.
10. The method of any one of claims 2 to 9, wherein anti-glypican-1 antibody binding is detected via a technique selected from the group consisting of immunofluorescence, radiolabe!mg, immunoblotting, Western blotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, inimunopreci itation, immunohistochemistry. biofiim test, affinity ring test, antibody array optical density test, and chemihiminescence.
11. The method of claim .1, wherein said level of glypican-l in the body fluid sample from a patient is compared to the level of glypican-l in a control sample; wherein increased anti- glypican-1 antibody binding of the body fluid sample over the control sample is associated with the presence of prostate cancer .
12. The method of claim 1.1, wherein a 50% or more increase in the level of glypican-1 of said body fluid sample over the level of glypican-1 in the control sample is indicative of prostate cancer.
13. The method of any one of claims 2 to 10, wherem anti-giypican-i antibody binding to said body fluid sample is compared to anti-glypican-l antibody binding of a control sample; wherein increased anti-glypican- l antibody binding of the body fluid sample over the control sample is associated with the presence of prostate cancer.
14. The method of claim 13, wherein a 50% or mor increase in the anti-glypican-l antibody binding to said body fluid sample over the level of anti-glypican-l antibody binding of the control sample is indicative of prostate cancer.
15, The method of any one of claims 2 to 10, 13 or 14 wherein anti-glypican-l antibody binding to said body fluid sample is compared to anti-glypican-l antibody binding to one or more glypican-1 standards; wherein the anti-glypican-l antibody binding, of the standards is used to quantify th amount of glypican-1 in. said body fluid sample.
16. The method of any one of claims 1 to 15, wherein a glypican-1 content higher than about 1 Onu nil in the body fluid sample is indicative of prostate cancer.
17. The method of any one of claims 1 to Ιό, further comprising:
measuring the level of prostate-specific antigen (PSA) in a body fluid sample from the patient, and
determining that said patient has prostate cancer or an increased likelihood of developing prostate cancer based upon (i) the level of PSA measured in the body fluid sample, and (ii) binding of said anti-glypican-l antibody to said body fluid sample.
18. The method of claim 17, wherein the level of prostate-specific antigen (PSA) is measured in a blood sample from the patient.
19, The method of claim 17 or claim 18, wherein the level of prostate-specific antigen (PSA) in the body fluid sample measured is compared to the level of PSA measured in a control sample; wherein increased PSA levels in the body fluid sample over the control sample is associated with the presence of prostate cancer.
20. The method of any one of claims 1 to 1 , wherein said body fluid is selected from the group c onsi sti n g of blood, serum , plasm a, and urine.
21. A kit for detecting prostate cancer comprising a first anti-giypican-l antibody, a pharmaceuticany acceptable carrier, and glypican-l standards; wherein said kit is capable of detecting glypican-l in the body fluid of a patient.
22. The kit of claim 21 , wherein the anti-glypican- 1 antibody is not MIL-38.
23. The kit of claim 21. wherein the anti-giypican-l antibody is M1L-38.
24. The kit of claim 21, wherein the anti-glypican- 1 antibody is the antibody referred, to in any one of claims 4, 5 or 7.
25. The ki t of any one of claims 21 to 24, further comprising a secondary ligand,
26. The kit of claim 25, wherein said secondary ligand is a second anti-giypican-l antibody or an aptamer capable of binding to glypican-l; wherein said second anti-glypican antibod can be the same as the first anti-glypican- 1 antibody.
27. The kit of claim 25 or claim 26, wherein said secondary ligand is conjugated to a label for rapid detection of said l igand.
2S. The kit of claim 27, wherein said label is for use in a detection method selected from the group consisting of immunofluorescence, radio labeling, ir mmob lotting, Western blotting, enzyme-linked immunosorbent assay (ELISA), flow cytometry, immunoprecipitation, immunohistocheraistry, biofilra test, affinity ring test, antibody array optical density test, and c hemil uminescence .
29. The kit of any one of claims 22 to 28, wherein the kit comprises components for conducting an ELISA.
PCT/AU2015/000018 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis Ceased WO2015106311A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
CN201580010766.0A CN106164672B (en) 2014-01-17 2015-01-16 Cell Surface Prostate Cancer Antigen for Diagnosis
CA2936805A CA2936805C (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
US15/111,973 US10151754B2 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
AU2015207665A AU2015207665B2 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
SG11201605784YA SG11201605784YA (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
ES15737205T ES2803217T3 (en) 2014-01-17 2015-01-16 Prostate cancer cell surface antigen for diagnosis
KR1020167022084A KR102366820B1 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
DK15737205.3T DK3094976T3 (en) 2014-01-17 2015-01-16 CELL SURFACE PROSTATE CRAFT ANTI-DIAGNOSIS
EP15737205.3A EP3094976B1 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
JP2016564354A JP6691060B2 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnostics
US16/175,433 US20190120846A1 (en) 2014-01-17 2018-10-30 Cell surface prostate cancer antigen for diagnosis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201461928776P 2014-01-17 2014-01-17
US61/928,776 2014-01-17

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/111,973 A-371-Of-International US10151754B2 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis
US16/175,433 Continuation US20190120846A1 (en) 2014-01-17 2018-10-30 Cell surface prostate cancer antigen for diagnosis

Publications (1)

Publication Number Publication Date
WO2015106311A1 true WO2015106311A1 (en) 2015-07-23

Family

ID=53542211

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2015/000018 Ceased WO2015106311A1 (en) 2014-01-17 2015-01-16 Cell surface prostate cancer antigen for diagnosis

Country Status (11)

Country Link
US (2) US10151754B2 (en)
EP (1) EP3094976B1 (en)
JP (2) JP6691060B2 (en)
KR (1) KR102366820B1 (en)
CN (1) CN106164672B (en)
AU (1) AU2015207665B2 (en)
CA (1) CA2936805C (en)
DK (1) DK3094976T3 (en)
ES (1) ES2803217T3 (en)
SG (1) SG11201605784YA (en)
WO (1) WO2015106311A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106053815A (en) * 2016-07-01 2016-10-26 复旦大学附属中山医院 Application of GPC1 as tumor diagnosis marker
WO2016168885A1 (en) * 2015-04-20 2016-10-27 Minomic International Ltd. Therapeutic antibodies and uses thereof
EP3209686A4 (en) * 2014-10-23 2018-03-07 Minomic International Ltd. Monoclonal anti-gpc-1 antibodies and uses thereof
JP2018520366A (en) * 2015-07-22 2018-07-26 ミノミック インターナショナル リミティド Biomarker combinations for prostate disease
EP3617231A4 (en) * 2017-04-28 2021-04-07 National University Corporation Kochi University ANTI-GPC-1 ANTIBODY
IT202200020571A1 (en) * 2022-10-06 2024-04-06 Centro Di Riferimento Oncologico New compound

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107907684A (en) * 2017-09-29 2018-04-13 何皓 A kind of prostatic cancer early diagnosis system based on multi-fluorescence service life resolved detection technology
CN111187350A (en) * 2019-12-30 2020-05-22 西安英创生物技术有限公司 Antigen binding protein combined with glypican-1
JP7053058B2 (en) * 2020-05-28 2022-04-12 グリピー ホールディングス ピーティーワイ リミテッド Glypican epitopes and their use
WO2025240810A1 (en) * 2024-05-17 2025-11-20 Siemens Healthcare Diagnostics Inc. Sensitivity improvement of an immunoassay via branched dna

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013119964A2 (en) * 2012-02-08 2013-08-15 Stem Centrx, Inc. Identification and enrichment of cell subpopulations

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE337223B (en) 1967-05-23 1971-08-02 Pharmacia Ab
US3720760A (en) 1968-09-06 1973-03-13 Pharmacia Ab Method for determining the presence of reagin-immunoglobulins(reagin-ig)directed against certain allergens,in aqueous samples
US3691016A (en) 1970-04-17 1972-09-12 Monsanto Co Process for the preparation of insoluble enzymes
CA1023287A (en) 1972-12-08 1977-12-27 Boehringer Mannheim G.M.B.H. Process for the preparation of carrier-bound proteins
US4195128A (en) 1976-05-03 1980-03-25 Bayer Aktiengesellschaft Polymeric carrier bound ligands
US4330440A (en) 1977-02-08 1982-05-18 Development Finance Corporation Of New Zealand Activated matrix and method of activation
CA1093991A (en) 1977-02-17 1981-01-20 Hideo Hirohara Enzyme immobilization with pullulan gel
US4229537A (en) 1978-02-09 1980-10-21 New York University Preparation of trichloro-s-triazine activated supports for coupling ligands
US4376110A (en) 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US5622836A (en) 1989-05-24 1997-04-22 The University Of Sydney Monoclonal antibodies which recognize malignant cells from bladder carcinomas
US6116013A (en) 1998-01-02 2000-09-12 Siemens Westinghouse Power Corporation Bolted gas turbine combustor transition coupling
US7108986B2 (en) * 1998-10-16 2006-09-19 The Regents Of The University Of California Glypican-1 in human breast cancer
ATE423571T1 (en) 2001-10-12 2009-03-15 Schering Corp USE OF BISPECIFIC ANTIBODIES AGAINST AN ACTIVATIVE RECEPTOR FCEPSILONRI AND AGAINST AN INHIBITING RECEPTOR OX2RA (CD200RA) TO REGULATE IMMUNE RESPONSES
WO2004022597A1 (en) * 2002-09-04 2004-03-18 Chugai Seiyaku Kabushiki Kaisha Antibody against blood-solubilized n-terminal peptide in gpc3
AU2002330482A1 (en) * 2002-09-04 2004-03-29 Perseus Proteomics Inc. Method of diagnosing cancer by detecting gpc3
KR101300546B1 (en) * 2004-08-24 2013-09-02 추가이 세이야쿠 가부시키가이샤 Adjuvant Therapy with the Use of Anti-Glypican 3 Antibody
US7462697B2 (en) 2004-11-08 2008-12-09 Epitomics, Inc. Methods for antibody engineering
US7723043B2 (en) * 2006-01-04 2010-05-25 Picobella, Lp Methods for screening for prostate cancer
US7842472B2 (en) 2006-11-14 2010-11-30 Alere International Methods and compositions for monitoring and risk prediction in cardiorenal syndrome
EA200901031A1 (en) * 2007-02-02 2010-04-30 Новартис Аг MODULATORS OF SCLEROSTIN-BINDING PARTNERS FOR THE TREATMENT OF BONE-BONE DISORDERS
WO2008140774A2 (en) 2007-05-08 2008-11-20 Picobella Llc Methods for diagnosing and treating prostate and lung cancer
KR101105428B1 (en) * 2009-02-12 2012-01-17 경북대학교 산학협력단 Peptides Specific to Glycocan-3 Proteins
WO2012151609A1 (en) * 2011-05-06 2012-11-15 Women's And Children's Health Research Institute Inc Method of treatment and prophylaxis of pathologies of the bone

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013119964A2 (en) * 2012-02-08 2013-08-15 Stem Centrx, Inc. Identification and enrichment of cell subpopulations

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
DUAN L ET AL.: "GPC-1 may serve as a predictor of perineural invasion and a prognosticator of survival in pancreatic cancer.", ASIAN JOURNAL OF SURGERY, vol. 36, no. 1, 1 January 2013 (2013-01-01), pages 7 - 12, XP055325140, DOI: 10.1016/J.ASJSUR.2012.08.001 *
MATSUDA K ET AL.: "Glypican-1 is overexpressed in human breast cancer and modulates the mitogenic effects of multiple heparin-binding growth factors in breast cancer cells.", CANCER RESEARCH, vol. 61, no. 14, 15 July 2001 (2001-07-15), pages 5562 - 5569, XP003001059 *
OBORT AS ET AL.: "Prostate-specific antigen: any successor in sight?", REVIEWS IN UROLOGY, vol. 15, no. 3, 1 January 2013 (2013-01-01), pages 97 - 107, XP055357333, DOI: 10.3909/RIU0567 *
RUSSE LL PJ ET AL.: "Immunohistochemical characterisation of the monoclonal antibody BLCA-38 for the detection of prostate cancer. Cancer Immunology", IMMUNOTHERAPY, vol. 53, no. 11, 1 November 2004 (2004-11-01), pages 995 - 1004, XP055274228, DOI: 10.1007/S00262-004-0527-7 *
See also references of EP3094976A4 *
SUHOVSKIH, AV ET AL.: "Proteoglycan Expression in Normal Human Prostate Tissue and Prostate Cancer.", ISRN ONCOLOGY, vol. 2013, 1 January 2013 (2013-01-01), pages 1 - 9, XP055357331, Retrieved from the Internet <URL:http://dx.doi.org/10.1155/2013/680136> DOI: 10.1155/2013/680136 *
WISSMUELLER, S. ET AL.: "Development of an antibody based test for the diagnosis of prostate cancer.", BJU INTERNATIONAL, vol. 113, no. SUPP.4, March 2014 (2014-03-01), pages 45, XP055357433 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3209686A4 (en) * 2014-10-23 2018-03-07 Minomic International Ltd. Monoclonal anti-gpc-1 antibodies and uses thereof
US10577418B2 (en) 2014-10-23 2020-03-03 Minomic International Ltd. Monoclonal anti-GPC-1 antibodies and uses thereof
WO2016168885A1 (en) * 2015-04-20 2016-10-27 Minomic International Ltd. Therapeutic antibodies and uses thereof
KR20170138530A (en) * 2015-04-20 2017-12-15 미노믹 인터내셔널 리미티드 Therapeutic antibodies and uses thereof
US11198738B2 (en) 2015-04-20 2021-12-14 Minomic International Ltd. Therapeutic antibodies and uses thereof
KR102739664B1 (en) 2015-04-20 2024-12-05 미노믹 인터내셔널 리미티드 Therapeutic antibodies and uses thereof
JP2018520366A (en) * 2015-07-22 2018-07-26 ミノミック インターナショナル リミティド Biomarker combinations for prostate disease
CN106053815A (en) * 2016-07-01 2016-10-26 复旦大学附属中山医院 Application of GPC1 as tumor diagnosis marker
CN106053815B (en) * 2016-07-01 2018-03-27 复旦大学附属中山医院 Purposes of the GPC1 as diagnosing tumor mark
EP3617231A4 (en) * 2017-04-28 2021-04-07 National University Corporation Kochi University ANTI-GPC-1 ANTIBODY
IT202200020571A1 (en) * 2022-10-06 2024-04-06 Centro Di Riferimento Oncologico New compound
WO2024075067A1 (en) * 2022-10-06 2024-04-11 Centro Di Riferimento Oncologico Cancer vaccine composition that comprises a host cell expressing glypican-1 (gpc-1)

Also Published As

Publication number Publication date
CA2936805A1 (en) 2015-07-23
EP3094976A1 (en) 2016-11-23
JP2017504812A (en) 2017-02-09
EP3094976A4 (en) 2017-07-05
KR20160114088A (en) 2016-10-04
EP3094976B1 (en) 2020-03-25
US20190120846A1 (en) 2019-04-25
SG11201605784YA (en) 2016-08-30
DK3094976T3 (en) 2020-06-22
CN106164672A (en) 2016-11-23
KR102366820B1 (en) 2022-02-22
CA2936805C (en) 2024-02-20
US10151754B2 (en) 2018-12-11
AU2015207665B2 (en) 2021-04-15
ES2803217T3 (en) 2021-01-25
CN106164672B (en) 2018-08-28
JP2020060585A (en) 2020-04-16
HK1225791A1 (en) 2017-09-15
AU2015207665A1 (en) 2016-08-04
US20160349263A1 (en) 2016-12-01
JP6691060B2 (en) 2020-04-28

Similar Documents

Publication Publication Date Title
EP3094976B1 (en) Cell surface prostate cancer antigen for diagnosis
JP6715770B2 (en) Monoclonal anti-TK1 antibody
JP5941615B2 (en) Method for immunological measurement of human CXCL1 protein
JP6324970B2 (en) Anti-uroplakin II antibody system and method
AU2015265976A1 (en) Anti-B7-H3 antibodies and diagnostic uses thereof
CA3189270A1 (en) Method for detecting pancreatic tumor, antibodies, and kit for the detection of pancreatic tumor
KR20190141144A (en) Compositions and Methods for Detecting Prostate Cancer
CN114705858A (en) Compositions and methods for assessing risk of cancer development
KR101138460B1 (en) A marker comprising anti-FASN autoantibodies and a composition comprising antigen thereof for diagnosing liver cancer
KR20130081952A (en) Biomarkers for diagnosing cancer and method for isolating cancer cell using the same
KR101439856B1 (en) A marker comprising anti-ATIC autoantibodies and a composition comprising antigen thereof for diagnosing liver cancer
CN107709362B (en) IGF-1R antibodies and their use in cancer diagnosis
JP2023516705A (en) Novel methods and compounds for diagnosing prostate cancer
US9127054B2 (en) Immunoassay of cofilin 1 protein
HK1225791B (en) Cell surface prostate cancer antigen for diagnosis
HK40073614A (en) Compositions and methods for assessing the risk of cancer occurrence
CN119101156A (en) Antibodies binding to nectin-4 and uses thereof
HK1262633A1 (en) Compositions and methods for assessing the risk of cancer occurrence

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15737205

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2936805

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016564354

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15111973

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2015207665

Country of ref document: AU

Date of ref document: 20150116

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20167022084

Country of ref document: KR

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2015737205

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015737205

Country of ref document: EP