WO2015102501A1

WO2015102501A1 - Method for industrial scale production of therapeutically active proteins of desired glycosylation pattern

Info

Publication number: WO2015102501A1
Application number: PCT/PL2014/000152
Authority: WO
Inventors: Michał LOWER
Original assignee: Remasters Sp. Z O.O.; Simab Sp. Z O.O.
Priority date: 2013-12-31
Filing date: 2014-12-22
Publication date: 2015-07-09
Also published as: PL406737A1

Abstract

Method for industrial scale production of therapeutically active proteins of stabile and desired glycosylation pattern using the reaction of deglycosilation and then glycosilation therapeutic protein in the presence of active derivative of desired glycan.

Description

Method for industrial scale production of therapeutically active proteins of desired glycosylation pattern

Therapeutic monoclonal antibodies have established its stable place in current pharmacological practice. Currently, there are almost 30 antibodies and their derivatives authorized for treatment of different conditions mainly neoplastic diseases, inflammatory and auto immunological diseases and for the graft rejection therapy. Antibodies exist in different isotypes of which the most suitable for therapeutic

applications is IgG isotype. IgG type antibody consists of four polypeptide chains, two heavy chains and two light chains connected with disulphide bonds. Asparagine N297 of heavy chain is the acceptor site of N-glycans. N-glycans are determining the therapeutic effects of recombinant antibody and lack of them or modification may cause lack of its effectiveness, may cause higher immunogenicity and negatively influence its pharmacokinetic properties.

N-glycosylation of IgG Fc region starts in endoplasmic reticulum (ER) and consecutively in Golgi apparatus (OA) where underlies its final modification.

Oligosaccharyltransferase enzyme transfers previously synthesized oligosaccharide Glc3Man9GlcNAc2 on N297 amino acid of each heavy chain. Then exo-glucosidase enzyme cuts out three glucose moieties from and after that mannosidase enzyme cuts out one mannose. In this moment the light chains and heavy chains are bound together and whole polypeptide complex is moved to the cis pole of AG. Further mannose moieties are cut out by mannosidase enzymes and the remaining oligosaccharide Man5GlcNAc2 becomes the backbone for further synthesis of complex and hybrid oligosaccharides . The latter are synthesized in the middle part of GA where the enzyme 1 , 2-N-acetylglucoseaminyltransferase I attaches N-acetyl glucosamine to the described above backbone and then further mannose moieties are cut out by 1, 2-mannosidase II enzyme. Next, enzyme 1, 2-N-acetylglucoseaminyltransferase I attaches the further GlcNAc moiety and the whole complex can be further modified by attaching galactose, branched GlcNAc, N- Acetylneuraminic acid and/or fucose.

As described above, the N-glycosylation process of' antibody polypeptides is a complex, multistage process which involves the multitude of enzymes and substrates localized in

different compartments of intracellular matrix. Moreover, it was determined in several experiments that the number of different factors can influence the consecutive stages of glycan synthesis which results in different modifications of oligosaccharide chain. The effects of those factors may take place in vivo where the conditions like inflammatory disease, pregnancy or aging may lead to the synthesis of different heterogenic glycosylation forms, and also in cell culture where even subtle changes in pH, temperature and/or culture media may result in the biologic drug product of different batch-to-batch glycosylation pattern characteristics.

To assure the safety of biological drug use in humans such a biological drug has to comply with the number of rigorous requirements. One of them is homogeneity of consecutive production batches. It concerns both internal batch

homogeneity and batch-to-batch homogeneity. This requirement is necessary for adequate dosing of drug, therefore is.

crucial for the safety of patient. However, there are

numerous data showing that different batches of the

biological drugs currently being present on market are not homogenous in an acceptable extent (see, for example

Schiestl, M. ; Stangler, T.; Torella, C Cepeljnik, T.; Toll, H.; Grau, R. Nat. Biotechnol . 2011, 29, 310-312.). The above confirms the difficulty in achieving the necessary

homogeneity of biological drugs manufactured currently.

Biological drugs like antibodies are manufactured in a biotechnological process which uses eukaryotic cells or prokaryotic cells. Generally, it depends on culturing of cell line transformed with suitable vector having nucleic acid sequence coding for desired protein introduced, in the suitable culture media providing the adequate conditions for the cell line, in the bioreactor. Not going into specific technical details characteristic for the particular

bioreactor type such a bioreactor usually consist of the vessel filled with suitable cell culture medium and the peripheral devices providing for the adequate culture

conditions. Those devices are controlling the temperature of medium, its pH, 02 and C02 and other gases partial pressure and other conditions. Through the multitude of sensors and valves which are dosing the buffers, gases and other

ingredients the control unit is expected to maintain stable conditions optimal for cell growth. However, when the cell culture is carried in high volume (i.e. 2000 L) even the most technically advanced bioreactors are not capable of

maintaining the stabile and homogenous conditions in whole culture volume which in turn results in differences in product properties in the single batch and differences between batches as well. The culture media and especially their biological ingredients like growth factors can also show the differences in activity or degree of purity. All the above contributes for the difficulties in maintaining stable, reproducible cell culture conditions which are crucial for the homogenous of the resulting biological product.

To achieve above mentioned homogeneity of biological product several different approaches have been proposed. One of them is genetic modification of the host cells. The genetic knockout of genes coding for the particular glycosylation pathway enzymes and/or introduction of coding sequences from unrelated organisms is expected to provide for modifies host cell line which are producing the biological product of desired glycosylation characteristics (e.g. Li, H., et al. 2006, Nature Biotechnology, 24, 210-215) . Such an experiments are underway, however the process of creation of such a mutants is tedious and the product is problematic from the marketing approval point of view. The biological product, for example therapeutic antibody is also not identical with the natural product in regard of glycosylation. Besides the problem with homogeneity there is at best only 10-15 percent of produced antibodies properly glycosylated (it means, in the way resembling normal glycosylation pattern of natural human antibodies).

Description of the invention

There ,is still not fulfilled need for homogenously

glycosylated therapeutic protein drugs. The established way to improve the glycosylation pattern of produced biological drugs relays on one hand on continuous improvement of bioreactors and the cell culture conditions and on the other hand on genetic modifications in host cell lines. The current invention is solving the problem of homogenous and almost complete glycosylation of whole biological drug produced in biotechnological process.

There are known in literature the enzymes from the organisms like Arthrobacter protophormiae, Mucor hiemalis and

Streptococcus pyogenes which have the activity of β-Ν- Acetylglucosaminidase (EndoS) . This activity, especially of the enzyme from S. pyogenes, provides for hydrolysis of N- glycans of IgG antibody Fc chains by the cutting of β-1,4- glycoside bond in chitobiose chain of N-glycans. The enzyme is deglycosylating of native glycans of the antibody with the remaining GlcNAc moiety on asparagine N297.

On the other hand, particular mutants of β-Ν- Acetylglucosaminidase, for example EndoS-D233A and EndoS- D233Q have the ability to attach the oxazoline derivatives of N-glycans to the GlcNAc moiety. There is known from

literature the transglycosilation of proteins also the antibodies in small amounts on the laboratory scale. Such a small scale reaction is not suitable for the industrially viable process in which large quantities of protein can be deglycosylated and subsequently glycosylated in suitable manner.

Present invention solves the problem of obtaining the significant amount of homogenously glycosylated protein in industrially acceptable manner.

The described below process offers several important

advantages over known methods. First of all, the

glycosylation status of the therapeutic protein obtained in biotechnological process is not important for the present method. It means that the quantity and quality of glycans attached to the raw protein being substrate of the process of the present invention is not relevant. The antibodies

produced by non-human related expression systems,, like yeast or insect expression systems, which are known from their glycosylation patterns different from the human are also suitable as a substrate according to present invention. Even very poor glycosylated or not glycosylated antibody produced by prokaryotic expression system is equally suitable to by glycosylated according to the invention in the manner

resembling the human natural glycosylation.

Moreover, if necessary it is possible to glycosylate proteins in the manner different from human glycosylation, for example the protein can be glycosylated according to the invention in the manner characteristic for the other species or

glycosylated with glycans not found naturally in any species or glycosylated with synthetic glycans or glycan derivatives designed in silico.

Another advantage offered by the present invention is that the method according to the invention is applicable in very convenient column format. It is possible to perform the present invention in any other suitable format, however column format is most convenient for the application in antibody and other biological drug production. The crucial advantage of the column format in pharmaceutical production is its full scalability, which means that the dynamics of the process is almost linear in very broad scale and can be carried out both in few millilitre column as well in few hundred litre column in the basically the same conditions. This is especially important in the pharmaceutical production because the validation of the process is not necessary.

Method of the invention is also very convenient, because it is possible, as described exemplary below, to use both the therapeutic protein immobilised on the solid phase, or in the liquid phase. The choice of particular design depends on the particular protein to be glycosylated and can be easily determined by the person which performs the method^' of the invention .

The protein glycosylated according to the invention or enzyme for the glycosylation can be immobilised in the column in several different ways. It is possible for immobilisation to use one of the known partner pairs like his-Tag + NiNTa- Agarose, strep-Tag + streptavidin column, intein + chitin column or protein covalently bound., with column bed or preferably using of glutathione S-transferase peptide and chromatographic glutathione-Agarose bed.

Antibody containing medium after the cell culture is purified in usual way by cell debris filtrating and filtering through columns containing immobilized antibody binding bacterial proteins. Commonly used bacterial proteins are protein A and G which are binding the Fc fragment of heavy chain and L protein which binds kappa fragment of light antibody chain. The process according to the invention was carried out using all of the mentioned proteins. Usually, the antibody

proteins in weak basic buffer of low ionic strength are immobilized on chromatographic column. Then the unbound contaminating proteins are eluted with excess of buffer and the purified bound antibody is eluted with high pH or high ionic strength buffer. Such an industrial purification method is used commonly for known therapeutic antibodies. Method according to the present invention is used as an extension of this known method. After initial washing off the

contaminating proteins the column is filled with the reaction buffer containing the deglycosidase enzyme and bound antibody is incubated in order to allow the deglycosylation reaction to occur. Thereafter, the reaction mixture with enzyme is washed out from column with buffer excess. Then the column is filled with the reaction buffer containing the

transglicosidase enzyme with the oxazoline derivative of the chosen glycan. The antibody is again incubated with this mixture to allow the reaction. The column is washed again and bound antibody with new glycan attached to it is eluted as described above. Antibody immobilisation offers some

advantages i.e. there is negligible loss of the protein associated with additional processing. The other advantage is scalability of the process and easy integration into existing procedures .

The oxazoline derivatives used in the present invention were delivered by Trimen, Lodz. Glycans were synthesized by usual click-chemistry method and modified with oxazoline by the method described in Huang, W.; Li, C; Li, B.; Umekawa, M.; Yamamoto, K.; Zhang, X.; Wang, L. X. J. Am. Chem. Soc. 2009, 131, 2214-2223 and/or Huang, W.; Yang, Q. ; Umekawa, 5 M.;

Yamamoto, K.; Wang, L. X. ChemBioChem 2010, 11, 1350-1355 with minor modifications. Endo- -N-acetylglucosaminidase enzyme used in reactions was synthesised by expression of protein sequence

(http : //www . ncbi . nlm. nih . gov/protein/AIQ01946.1 ) and it mutants were produced by site directed mutagenesis.

The sequence of mutagenic primers was as follows:

D233QF: TACAATCTGGATGGTCTGGATGTCCAGGTTGAA and

D233QR: AACCTGGACATCCAGACCATCCAGATTGTATT .

The enzyme (EndoS) originating from Streptococcus pyogenes has deglycosidase activity and its mutant (EndoSD233Q) has transglycosidase activity (EndoSQ) . Both non-mutated and mutated coding sequences were additionally fused with

Glutathione S-transferase peptide sequence (GST) to

facilitate its purification and immobilisation on column in further enzymatic reaction. The column bed used in enzymatic reactions was Glutathione-Agarose which has high affinity to GST sequence.

The suitable sequence was cloned to pJet402 vector and the E. coli ToplO with construct pJetEndoS or its sequence mutated with above mutagenic primers were grown overnight. After induction with 50 mM IPTG. and 6-8 hours of culture the cells were harvested and the protein was purified using

commercially available GST purification kit (Millipore) .

Analysis of enzymatic reactions was done by mass spectrometry (LC-MS, Bruker) according to the manufacturer's protocol.

The antibodies used in the experiments was derived from hybridoma proprietary cell line.

Example 1

Degycosylation and transglycosylation of the antibodies in column format wherein the enzyme is immobilised

The column was packed with 1 ml of Glutathione-Agarose bed, washed with triple volume of PBS buffer (50 mM phosphate buffer pH 7.2; 150 mM NaCl). Next, 50 mg of enzyme diluted in PBS 1:1 was added to the column and the column was washed thoroughly with PBS buffer until the stable absorbance A280 close to 0 was obtained. Such a column functionalization was performed with both EndoS and EndoSQ mutated enzymes and the columns were used for further experiments. To the column with immobilised deglycosylase (EndoS) about 50 mg of IgG was added diluted in PBS. When the peak of absorbance A280 was determined the flow was stopped and the column was incubated for 2 hours in 37°C. After that, the antibody was eluted from column with PBS. The fractions of highest absorbance A280 were pooled and used for further analysis. LC-MS analysis of this fractions revealed the shift of heterogenic population of differently glycosylated antibodies to the single form of lower molecular mass which proves deglycosylation of the antibody (Fig. 1).

Next, 5 mg of deglycosylated antibody was mixed in PBS with 5 mg of oxazoline derivative of tetrasaccharide GlcNacManGlc2, which is known to be the most biologically active antibody glycosylation form stimulating the cellular cytotoxic

reaction. This mixture was added to the column functionalized with transglycosilase enzyme. When the peak of absorbance A280 was determined the flow was stopped and the column was incubated for 4 hours in 37°C. After that, the antibody was eluted from column with PBS. Spectrometric analysis of pooled' fractions revealed the presence of two forms. The molecular mass of one form constituting about 20% was equal to deglycosylated antibody. The molecular mass of the other form (80%) was higher by the mass of tetrasaccharide (Fig. 2) .

Example 2

Degycosylation and transglycosilation of the antibodies in column format wherein the antibody is immobilised

In this format of the invention also the recombined enzyme EndoS from Streptococcus pyogenes ant its mutated form EndoSQ was used with fused Glutathione S-transferase peptide as in previous Example.

However, in this case the GST peptide was used for the purification of the recombinant enzymes only and not for binding with the column bed.

10 L of the culture media containing the antibody was filtered through 0,22 micrometre pore filter. Then, 1 L of 10X PBS buffer was added to the filtrate and applied on column containing 2 ml of Protein L - Agarose. The column was washed with 100 mL of IX PBS buffer until stable

absorbance A280 equal to 0 was observed. Then, 10 mg of the purified enzyme preparation in PBS buffer was added to the column and when the peak of absorbance at A280 was determined the flow was stopped. The column was incubated in 37°C for 2 hours. Next, the column was thoroughly washed with PBS buffer until the stable absorbance A280 was determined and then 10 mg of purified transglycosidase enzyme was added to the column with 10 mg of oxazoline derivative of tetrasaccharide GlcNacManGlC2. When the peak of absorbance at A280 was determined the flow was stopped and the column was incubated in 37°C for 4 hours. The column was eluted with 0,1 M glycine, pH 2,0. Then to the collected fractions 0,1 volume of 10 M Tris-HCl pH 7,2 was added. Spectrometric analysis of collected fractions revealed the presence of two forms of different molecular mass. One of them constituting about 20% was equal to deglycosylated antibody. The molecular mass of the other form (80%) was higher by the mass of

tetrasaccharide (Fig. 3) .

Claims

1. Industrial method for therapeutic protein production having stabile glycosylation pattern characterised in, that comprises the following steps:

a. producing of desired protein in cell culture;

b. purifying the protein to homogeneity;

c. deglycosilating of protein using endoglycosilase mutant; d. reacting the deglycosylated protein with the oxazoline derivative of desired glycan in presence of endoglycosilase; e. purifying ^"of glycosylated protein.

2. Method acoording to claim 1, characterised in that the protein is therapeutic protein.

3. Method according to claim 2, characterised in that the therapeutic protein is a therapeutic antibody.

4. Method according to the claim 1, characterised in that the endoglycosilase is endo- -N-acetylglucosaminidase (EndoS) .

5. Method according to the claim 1, characterised in that the glycan is Gal2GlcNAc2Man3GlcNAc2.

6. Method according to the claim 1, characterised in that the endoglycosilase mutant is EndoS-D233A or EndoS-D233Q.

7. Method according to any of the claims 1-6, characterised in that the process is carried out in the column format.

8. Method according to the claim 7, characterised in that on column bed the processed protein is immobilized and the enzyme endoglycosilase and its mutant is in the fluid phase.

9. Method according to the claim 7, characterised in that on column bed the enzyme endoglycosilase and its mutant is immobilized and the processed protein is in the fluid phase.