WO2015101609A1

WO2015101609A1 - Method for treating renal disorders

Info

Publication number: WO2015101609A1
Application number: PCT/EP2014/079398
Authority: WO
Inventors: Petrus Meinardus Theodorus DEEN; DE Antonius Isodorus Maria GROOT
Original assignee: Stichting Katholieke Universiteit
Priority date: 2013-12-31
Filing date: 2014-12-29
Publication date: 2015-07-09

Abstract

This invention is in the field of medical treatments. It provides means and methods for the prevention and treatment of cystic renal and liver diseases, in particular renal diseases caused by lithium. More in particular it provides a method for the treatment or prevention of nephrogenic diabetes insipidus by administering a specific carbonic anhydrase 9 and or 12 inhibitor to a subject in need of such a treatment.

Description

METHOD FOR TREATING RENAL DISORDERS.

Field of the invention

This invention is in the field of medical treatments. It provides means and methods for the prevention and treatment of renal diseases, in particular renal diseases caused by lithium.

Background of the invention

Lithium is the first-choice medication for treatment of bipolar disorders and is used by 0.1 % of the Western population [1 , 2]. 20% of the patients treated lithium will develop clinically relevant nephrogenic diabetes insipidus (NDI, [3-5], and as a consequence dehydration is a considerable risk. With dehydration comes the increased risk of lithium reaching toxic levels. Ceasing lithium treatment is not an option, because the symptoms of the bipolar disorders have a bigger impact on the quality of life than the NDI itself.

Lithium enters the principal cells in the collecting duct in the kidney via the epithelial sodium channel (ENaC) [6]. In the principal cells lithium causes

downregulation of aquaporin 2 (AQP2) [7, 8] and therewith causes the decreased ability to concentrate urine in the kidney.

Current treatment of lithium-induced NDI (Li-NDI) consists of low-sodium diet and amiloride in combination with hydrochlorothiazide (HCTZ) [9-1 1 ].

Amiloride blocks ENaC in the principal cells of the collecting duct, which also blocks the entry of lithium [6]. The mechanism behind the effect of thiazide is unclear, however, it is thought to function through the renin-aldosterone-angiotensin system (RAAS) [12-14].

Unfortunately, treatment with low-sodium diet and amiloride in combination with hydrochlorothiazide only partially alleviates Li-NDI and there is a need for a better treatment. Summary of the invention

We have found that an inhibitor of carbonic anhydrase 9 (CA9) may advantageously be used to counter the effect of lithium in principal cells and restore normal levels of AQP2 in such cells.

The invention therefore relates to a carbonic anhydrase 9 inhibitor for use in the treatment or prevention of nephrogenic diabetes insipidus.

In other terms, the invention provides a method for the treatment or prevention of nephrogenic diabetes insipidus in a subject wherein a therapeutic composition comprising an inhibitor of carbonic anhydrase 9 is administered to the subject. Detailed description of the invention

As used herein, the term carbonic anhydrase is used to refer to a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons (or vice versa), a reversible reaction that occurs rather slowly in the absence of a catalyst [21]. The active site of most carbonic anhydrases contains a zinc ion; they are therefore classified as metalloenzymes.

One of the functions of the enzyme in animals is to interconvert carbon dioxide and bicarbonate to maintain acid-base balance in blood and other tissues, and to help transport carbon dioxide out of tissues.

There are at least five distinct CA families (α, β, γ, δ and ε). These families have no significant amino acid sequence similarity and in most cases are thought to be an example of convergent evolution. The a-CAs are found in humans.

The CA enzymes found in mammals are divided into four broad subgroups [22] which, in turn consist of several isoforms: the cytosolic CAs (CA1 , CA2, CA3, CA7, CA13), the mitochondrial CAs (CA5A, CA5B), the secreted CAs (CA6) and the membrane-associated CAs (CA4, CA9, CA12, CA14).

Carbonic anhydrase 9 (CA9, EC 4.2.1.1 ) is an enzyme that in humans is encoded by the CA9 gene [23]. CA9 is a dimeric protein possessing very high catalytic activity for the hydration of carbon dioxide to protons and bicarbonate. Its quaternary structure is unique among members of this family of enzymes, allowing for structure- based drug design campaigns of selective inhibitors. CA9 is a transmembrane protein and is a tumor-associated carbonic anhydrase isoenzyme. It is over-expressed in VHL mutated clear-cell renal cell carcinoma (ccRCC) and hypoxic solid tumors, but is low- expressed in normal kidney and most other normal tissues. It has been suggested to be involved in cell proliferation and transformation. This gene is mapped to 9p13-p12.

CA9 is under development as a target for Autologous Cellular

Immunotherapy. Product candidates targeted at CA9 are in preclinical development for the treatment of kidney, colon, and cervical cancer. Moreover, CA9 is considered to be one of the best cellular biomarkers of hypoxia. Furthermore, recent studies examining the association between CA9 levels and various clinicopathological outcomes suggest that CA9 expression may also be a valuable prognostic indicator for overall survival [24].

Antibodies against CA9 are available and apart from being capable of inhibiting the CA9 enzyme activity, they serve as excellent biomarkers of hypoxic regions in many solid tumors.

Carbonic anhydrase inhibitors (CAI) are a class of pharmaceuticals that suppress the activity of carbonic anhydrase. Their clinical use has been established as antiglaucoma agents, diuretics, antiepileptics, in the management of mountain sickness, glaucoma, gastric and duodenal ulcers, neurological disorders, or osteoporosis [25 - 27].

Carbonic anhydrase inhibitors are well known in the art, Known examples of carbonic anhydrase inhibitors include sulfonamides such as acetazolamide, which is used for glaucoma, epilepsy (rarely), idiopathic intracranial hypertension, and altitude sickness. It can act as a mild diuretic by reducing NaCI and bicarbonate reabsorption in the proximal tubule. However, the distal segment partially compensates for the sodium loss, and the bicarbonaturia will produce a metabolic acidosis, further reducing the effect.

The carbonic anhydrase 9 enzyme is highly overexpressed in hypoxic tumors and shows very restricted expression in normal tissues. Inhibition of CA9 with sulfonamide and/or coumarin was recently shown to lead to a potent retardation for the growth of both primary tumors and metastases.

Some fluorescent sulfonamides were shown to accumulate only in hypoxic tumor cells overexpressing CA9, and might be used as diagnostic tools for imaging of hypoxic cancers. Sulfonamides were also more effective in inhibiting the growth of the primary tumors when associated with irradiation.

Coumarin (2H-chromen-2-one, or 1 -benzopyran-2-one, Cas number 91 - 64-5) is a fragrant organic chemical compound in the benzopyrone chemical class, which is a colorless crystalline substance in its standard state. It is a natural substance found in many plants.

Coumarins have shown some evidence of many biological activities, but they are approved for few medical uses as pharmaceuticals. Reported coumarin activity includes anti-HIV, anti-tumor, anti-hypertension, anti-arrhythmia, anti-inflammatory, anti- osteoporosis, antiseptic, and analgesic. It is also used in the treatment of asthma and lymphedema.

Coumarin and thiocoumarins were only recently discovered to act as CAIs, and their inhibition mechanism deciphered in detail [29, 30]. It was demonstrated that the natural product 6-(1 S-hydroxy-3-methylbutyl)-7-methoxy-2H-chromen-2-one5 as well as the simple, unsubstituted coumarin 6 are hydrolyzed within the CA active site with formation of the 2-hydroxy-cinnamic acids 7 and 8, respectively, which represent the de facto enzyme inhibitors. Some other interesting facts emerged during such studies: (1 ) this new class of carbonic anhydrase inhibitors (CAIs), the coumarins (which includes the thiocoumarins), bind in hydrolyzed form at the entrance of the CA active site and do not interact with the metal ion, constituting thus an entirely new category of mechanism-based inhibitors; and (2) it is possible to obtain highly isoforms-selective CAIs belonging to the coumarin/thiocoumarin class. Indeed, coumarins which selectively inhibit CA9 without inhibition of CA I and II (the main offtarget isoforms) have been reported. [29, 31].

CA9 is thus both a diagnostic and therapeutic validated target for the management of hypoxic tumors normally non-responsive to classical chemo- and radiotherapy [28].

The term "Nephrogenic diabetes insipidus" or NDI is a form of diabetes insipidus primarily due to pathology of the kidney. This is in contrast to central/neurogenic diabetes insipidus, which is caused by insufficient levels of antidiuretic hormone

(ADH)/Arginine Vasopressin (AVP). Nephrogenic diabetes insipidus is caused by an improper response of the kidney to ADH, leading to a decrease in the ability of the kidney to concentrate the urine by removing free water.

The clinical manifestation is similar to neurogenic diabetes insipidus, presenting with excessive thirst and excretion of a large amount of dilute urine.

Dehydration is common, and incontinence can occur secondary to chronic bladder distension. On investigation, there will be an increased plasma osmolarity and decreased urine osmolarity. As pituitary function is normal, ADH levels are likely to be normal or raised. Polyuria will continue as long as the patient is able to drink. If the patient is unable to drink and is still unable to concentrate the urine, then hypernatremia will ensue with its neurologic symptoms.

Differential diagnosis includes nephrogenic diabetes insipidus, neurogenic/central diabetes insipidus and psychogenic polydipsia. They may be differentiated by using the water deprivation test. Recently, lab assays for ADH are available and can aid in diagnosis.

Nephrogenic diabetes insipidus (NDI) is most common in its acquired forms, meaning that the defect was not present at birth. These acquired forms have numerous potential causes. The most obvious cause is a kidney or systemic disorder, including amyloidosis, polycystic kidney disease, electrolyte imbalance^ or some other kidney defect.

The major causes of acquired NDI that produce clinical symptoms (e.g. polyuria) in the adult are lithium toxicity and hypercalcemia. Chronic lithium ingestion appears to affect the tubules by entering the collecting tubule cells through sodium channels, accumulating and interfering with the normal response to ADH (ADH

Resistance) in a mechanism that is not yet fully understood.

We tested the effect of acetazolamide, a potent inhibitor of carbonic anhydrases, on urine output and urine osmolality in normal mice. We found that acetazolamide was capable of alleviating the symptoms of lithium-induced NDI. This effect occurred irrespective of the moment of administration, i.e. the effects were observed when the acetazolamide was administered together with lithium (or approximately at the same time) or when given after development of lithium-induced NDI. In both cases, we observed a significant decrease of urine output and a significant increase in urine osmolality upon treatment with acetazolamide. This response was even better than the response to the standard treatment with thiazide/amiloride.

We conclude that inhibitors of carbonic anhydrases are well suited for the treatment of NDI.

To investigate which carbonic anhydrases play a role in the rescue of lithium-induced NDI by acetazolamide, we employed small-interfering ribonucleic acids (siRNAs) to downregulate the endogenously expressed CAs in mpkCCD cells, a mouse cell model mimicking renal principal cells, as, when grown to polarization, these cells endogenously express the AQP2 water channel in response to ADH treatment [15].

First, we tested which CAs were expressed in mpkCCD cells treated with lithium. We therefore employed PCR using primersets as disclosed in table 1 .

Table 1. Details of primer sets used for CA detection.

Protein Forward primer (5 -3 ) SEQ Reverse primer (5 -3 ) SEQ cDNA of ID ID reference interest NO: NO: (genbank)

CA1 tgcaactgccaaagaaattg 1 gaaggaagcagactggatgg 18 NM_009799

CA2 accactggggatacagcaag 2 ccccatatttggtgttccag 19 NM_009801

CA3 tggctctgctaagaccatcc 3 gcatgatgggtcaaagtgtg 20 NM_007606

CA4 cccatcaacattgtcactgc 4 atactgggcagtgcttccac 21 NM_007607

CA5A ccaggtggagtttgacgatt 5 gcagacaagaggggtcaaag 22 NM_007608

CA5B gagcacaccgtggacagtaa 6 cggaagttgtccaccattct 23 NM_019513

CA6 cccctgagcttggtgaacta 7 gtggacgtccttaggcaaca 24 NM_009802

CA7 ctcagcatcaccaacaatgg 8 ctctcactgagtgggggtgt 25 NM_053070

CA8 cgatggacacaccattcaag 9 aggtaactccttcgctgcaa 26 NM_007592

CA9 ctgaagacaggatggagga 10 gcagagtgcggcagaatg 27 NM_139305 Protein Forward primer (5 -3 ) SEQ Reverse primer (5 -3 ) SEQ cDNA of ID ID reference interest NO: NO: (genbank)

CA10 ctgttttcccgtcgagtgat 1 1 gcggtgactgtatgtcatgg 28 NM_028296

CA1 1 tcaaccatgaaggcttctcc 12 accactgaggctctggaaga 29 NM_009800

CA12 ttgaacctgaccaatgatgg 13 atgttgaagcctgggatgag 30 NM_178396

CA13 acgttgactttgacgacacg 14 caagatgatggaagcaagca 31 NM_024495

CA14 ttggccaacctcttatcctg 15 ttctg ag ctg cctcactca a 32 NM_01 1797

CA15 tccagcgggactacactctt 16 ccagacacaatggcagagaa 33 NM_030558

Beta gtatgcctctggtcgtaccac 17 acgatttccctctcagctgtg 34 NM_007393 actin

We found that carbonic anhydrases 1 , 2, 5B, 6, 7, 1 1 , 12, 13, 14 and 15 were abundantly expressed in lithium treated mpkCCD cells and we found trace amounts of CA9 and 10.

Subsequently, we exposed Li-treated mpkCCD cells to specific siRNAs to test their effect on lithium-induced AQP2 downregulation. We surprisingly found that only CA9 silencing led to a significant increase of AQP2 abundance after lithium exposure (figure 1A and B).

It is therefore concluded that carbonic anhydrase 9 inhibitors may well be used in the treatment or prevention of nephrogenic diabetes insipidus.

CA12 downregulation seemed to also abolish lithium-induced AQP2 downregulation to some extent, (figure 1 B). The invention therefore also relates to the use of CA12 in the treatment or prevention of nephrogenic diabetes insipidus.

To determine whether pharmacological inhibition of CA9 would result in rescue of lithium-induced AQP2 downregulation, mpkCCD cells were treated with different coumarins and sulphonamides. Coumarins inhibit CA9 far more efficient than CA2, while sulfonamides are cell-impermeable, which only allows them to inhibit the extracellularly located carbonic anhydrases such as CA9. As shown in figure 2A, the level of AQP2 abundance was significantly increased after treatment with 10 uM 6-hydroxycoumarin or 10 uM 7-hydroxycoumarin. Moreover, the sulfonamide FC12-533A also fully rescued lithium-induced AQP2 downregulation (figure 2A).

It is therefore concluded that in a method according to the present invention, the carbonic anhydrase 9 inhibitor is preferably selected from the group consisting of sulphonamides and Coumarins. Preferred sulphonamides are selected from the group consisting of acetazolamide, FC5-208A, FC12-533A, FC5-207A and FC8-325B. Preferred coumarins are selected from the group consisting 7-hydroxycoumarin, 6- hydroxycoumarin and FO-61.

Table 2: chemical structure of preferred sulphonamides and coumarins

Chemical structure Name

FO-61

6-hydroxy coumarine

Without wanting to be bound by theory, we investigated the mechanism of action underlying the present invention. Importantly, CA9 and CA12 are well-known to be upregulated in expression in tumors of the Warburg syndrome, which is characterized by aerobic glycolysis.

In line with this it has been shown that lithium induces proliferation [16] of AQP2-expressing cells in vitro and in vivo [7, 8]. Moreover, urine of the Li-NDI mice described in this application, has elevated levels of lactate and succinate, metabolites released from cells that are proliferating due to aerobic glycolysis, which is completely gone in Li-NDI mice treated with acetazolamide.

To test involvement of aerobic glycolysis further, we tested whether proteins involved in aerobic glycolysis were upregulated in lithium-treated mpkCCD cells, and were downregulated following silencing of CA9 or CA12. CA2 silencing was taken along as a control. Indeed, while CA2 downregulation seemed to increase abundance of HIF1a, CA9 downregulation seemed to decrease it.

Since CA 9/12 is involved in the pH regulation of the principal cell, we further investigated whether inhibition of the sodium hydrogen exchanger 1 (NHE-1 ), a different pH regulator that facilitates the transport of hydrogen ions, also resulted in rescue of AQP2 abundance. Indeed, treatment with the NHE-1 inhibitors Zoniporide (25 uM) and Cariporide (75 uM) both rescued lithium-induced AQP2 downregulation (figure 2B).

Together, these data provide compelling evidence that lithium entry in renal principal cells induces Warburg-like cell proliferation and that the principal cell effect of acetazolamide is the inhibition of CA9, which is known to block Warburg-like

tumorigenesis.

These data also reveal that inhibiting CA9 is a novel therapeutic target in Li-NDI and thus that blocking CA9 is a promising mechanism for treating Li-NDI. New drugs may now be developed and used in the treatment of Li-NDI. CA9 inhibitors may be selected from compounds that inhibit the expression of CA9 as well as compounds that inhibit the enzymatic activity of CA9. Such compounds are known to the skilled person and may be selected from the group consisting of siRNAs, antibodies, small molecules, drugs, polypeptides, glycoproteins and carbohydrates.

The above findings may be extrapolated to other more severe/common renal disorders. Like Li-NDI, autosomal dominant polycystic kidney disease (ADPKD), which is the most common renal genetic disorder leading to chronic renal failure, develops in the renal collecting duct, starts with an increased diuresis [17] and is characterized on the cellular level by proliferation due to aerobic glycolysis. Moreover, 67% of long-term lithium users develop renal cysts and may end up having chronic kidney disease. Also, cysts in ADPKD patients and urine of ADPKD rats show elevated levels of lactate and succinate.

Another relevant and important renal disorder is Nephronophthisis (NPHP), the most common cause of chronic renal failure in children. Like ADPKD and Li- NDI, NPHP is a ciliopathy that starts with diuresis and that is characterized by microcysts. Though the basis is the loss of functional ciliairy proteins, it is at present unknown whether NPHP principal cells proliferate due to aerobic glycolysis. Analysis of urine of one NPHP patient, however, revealed strongly elevated lactate and succinate levels as compared to controls, suggesting that these three disorders have a common etiology and are likely all treatable with CA9 or CA12 inhibitors.

Another relevant disorder is polycystic liver disease (PLD), PLD is a group of genetic disorders characterized by progressive bile duct dilatation and/or cyst development. The large volume of hepatic cysts causes different symptoms and complications such as abdominal distension, local pressure with back pain, hypertension, gastro-oesophageal reflux and dyspnea as well as bleeding, infection and rupture of the cysts. Current therapeutic strategies are based on surgical procedures and

pharmacological management, which partially prevent or ameliorate the disease. However, as these treatments only show short-term and/or modest beneficial effects, liver transplantation is the only definitive therapy. As the molecular cause of PKD (polycystin mutations) also underlies most PLD and PKD is caused by aerobic glycolysis due to dysfunctional cilia, and our data reveal that CA9/12 inhibitors attenuate Li-NDI, it is concluded that specific inhibition of CA9 and/or CA12 will also attenuate PLD.

Hence, the invention also relates to a method for the treatment of a subject with renal disease selected from the group consisting of Nephronophthisis, Li- induced NDI and autosomal dominant polycystic kidney disease wherein an inhibitor of carbonic anhydrase 9 and/or a sodium hydrogen exchanger 1 is administered to the subject.

In a preferred embodiment of the invention, the CA inhibitors are specific for CA9 and/or CA12. This avoids the occurrence of unwanted side-effects. Treatment of patients with carbonic anhydrase inhibitors such as acetazolamide causes various undesired side effects such as bone numbness, gastrointestinal irritation, metabolic acidosis, renal calculi and transient myopia (33, 34). We ascribe the development of these side effects to the a-specific character of these CA inhibitors as these inhibitors do not discriminate between the 14 CA isoforms present in the human body (35).

The different CA isoforms can be divided in two groups, being the extracellular CA4, CA9 and CA12, and the intracellular CAs being all other forms. One of the most important CAs is the intracellular CA2, as it is widely expressed in humans (36) and has a very high enzymatic activity (37). More importantly, however, it has the highest expression of all CA isoforms in kidney(37), bone(38), eye(39) and alimentary tract (36), organs where side effects of acetazolamide are observed. Moreover CA2-deficient patients and knockout mice develop many of the symptoms related to acetazolamide treatment, such as metabolic acidosis, osteopetrosis, and cerebral calcification (40, 41 ). In addition, acetazolamide cannot reduce intraocular pressure in a CA2 deficient patient (42,43). Thus, many side effects observed with acetazolamide are related to its inhibitory effect on CA2.

CA inhibitors specific for CA9 and/or CA12 may belong to two distinct groups of inhibitors. As CA2 is an intracellular enzyme whereas CA9 and CA12 are extracellular CAs, specificity of CA9 and/or CA12 inhibitors as compared to CA2 can be due to higher ability to block the enzymatic activity (Group 1 ) or due to a reduced cell membrane permeability of the inhibitor (Group 2).

Group 1 inhibitors are herein defined as CA9 and/or CA12 inhibitors that have a 10 times lower IC50 for human CA9 and/or CA12 in vitro as compared to human CA2. This may be measured in an in vitro assay as described in Scozzafava et al., J. Med. Chem. (2000), 43: 292-300 (35). Preferably, the CA9 and/or CA12 inhibitors have a 50 or even a 100 times lower IC50 for human CA9 and/or CA12 as compared to human CA2.

In brief, the assay is performed as follows. Human CA2, CA9 and CA12 cDNAs are expressed in Escherichia coli and the enzymes are purified by affinity chromatography. Enzyme concentrations are determined spectrophotometrically at 280 nm. Initial rates of 4-nitrophenylacetate hydrolysis catalyzed by the different CA isozymes may be monitored spectrophotometrically, at 400 nm. Solutions of substrate may be prepared in anhydrous acetonitrile. Nonenzymatic hydrolysis rates should be subtracted from the observed rates. Experiments are preferably done in duplicate for each inhibitor concentration. Inhibitor and enzyme solutions are pre-incubated together for 10 min at room temperature prior to assay, to allow for the formation of the E-l complex.

Recently, CA inhibitors were developed, which inhibited the enzymatic activity of CA9, and/or 12 at an IC50 that was 100-fold lower than the IC50 of CA2 (45 - 48). Usage of these compounds has significant benefits above the use of acetazolamide in the disorders indicated herein, in particular in the treatment or prevention of nephrogrnic diabetes insipidus (NDI).

Compounds that do not have an at least 10 times lower IC50 for human CA9 and/or CA12 in vitro as compared to human CA2 in the above assay, may still be specific CA9 and/or CA12 inhibitors; they may belong to the second group of specific CA9 and/or CA12 inhibitors.

Inhibitors belonging to this Group 2 compounds are herein defined as CA9 and/or CA12 inhibitors that have at least a 10 times lower membrane permeability in vivo or in vitro as compared to acetazolamide. In other words, Group 2 inhibitors are specific inhibitors of CA9 and/or CA12 if they inhibit CA9 and/or CA12 and have a 10, preferably 50 or 100 times lower membrane permeability than acetozolamide (see figure 3 and table 4). This membrane permeability may be assessed using an assay as for instance described in Scozzafava et al., J. Med. Chem. (2000), 43: 292-300 (35).

In brief, the assay is performed as follows. An amount of 10 mL of freshly isolated human red blood cells thoroughly washed several times with Tris buffer (pH 7.40, 5mM) and centrifuged for 10 min is treated with 25 mL of a 2 mM solution of inhibitor. Incubation is performed at 37°C with gentle stirring, for periods of 30-120 min. After incubation times of 30, 60, and 120 min, the red blood cells are centrifuged again for 10 min, the supernatant discarded, and the cells washed three times with 10 mL of the above-mentioned buffer, to eliminate all unbound inhibitor. The cells are then lysed in 25 mL of distilled water and centrifuged for eliminating membranes and other insoluble impurities. The obtained solution is heated at 100 °C for 5 min (in order to denature CAs) and inhibitors possibly present may be assayed in each sample by several different methods, such as for example HPLC, spectrophotometrically, and enzymatically.

A non-limiting list of Group 1 compounds is provided herein in Table 3. Table 4 provides such a list for Group 2 inhibitors. Chemical structures of a selected number of compounds are provided in tables 5 and 6.

Table 3: Group 1 specific inhibitors of CA9 and/or CA12, selected chemical structures are provided in table 5.

* A selectivity above 10 indicates that the compound has an at least 10 times lower IC50 for CA9 and/or CA12 (Group 1 specific compound)

Table 4: Group 2 specific inhibitors of CA9 and/or CA12, selected chemical structures are provided in table 6.

Compound Reference Cell permeability in vitro (erys)

[nM] % of ACZ

Non-specific inhibitor

Acetozolamide (ACZ) Scozzafava 159 100

[35]

Specific inhibitors

2,4,6-trimethyl-1-(2-oxo-2((4-(N-(5-sulfamoyl-1 ,3,4-thiadizo-2- Scozzafava 0.6 0.38 yl)sulfamoyl)phenyl)amino)ethyl)pyridin-1-ium (compound A17) [35]

2,4,6-trimethyl-1-(2-oxo-2-((2sulfamoylbenzo[d]thiazol-6-yl)oxy)ethyl)pyridin-1-ium (compound Scozzafava 1.1 0.69 A23) [35]

1-(2-((2-fluoro-4-sulfamoylphenyl)amino)-2-oxoethyl)-2,6-dimethyl-4-phenylpyridin-1-ium Scozzafava 0.9 0.57 (compound B7) [35]

2,6-dimethyl-1-(2-oxo-2-((5-sulfamoyl-1 ,3,4-thiadiazol-2-yl)amino)ethyl)-4-phenylpyridin-1-ium Scozzafava 0.9 0.57 (compound B14) [35]

5-Perfluorophenylsulfonylamido-1 ,3,4-thiadiazole-2-sulfonamide (compound C13) Scozzafava 1.5 0.94

[35]

(E)-2,6-diethyl-1-(2-((4-(N-(3-methyl-5-sulfamoyl-1 ,3,4-thiadiazol-2(3H- Scozzafava 0.5 0.31 ylidene)sulphamoyl)phenyl)amino)-2-oxoethyl-4-phenylpyridin-1-ium (compound C18) [35]

Compound Reference Cell permeability in vitro (erys)

(E)-2,6-diisopropyl-1-(2-((3-methyl-5-sulfamoyl-1 ,3,4-thiadiazol-2(3H)-ylidene)amino)-2- Scozzafava 0.5 0.31 oxoethyl)-4-phenylpyridin-1-ium (compound D15) [35]

(4-Sulfamoylphenylmethyl)thioureido fluorescein (compound 5b) Checci 0.8 0.5

(4-Sulfamoylphenylethyl)thioureido fluorescein (compound 5c) Checci 0.6 0.4

1-N-(4-Sulfamoylphenyl)-2,4,5-trimethylpyridinium perchlorate (compound 8) Checci 0.4 0.3

Table 5 Chemical structures of selected Group 1 compounds.

Name Chemical structure

1 -(3-nitrophenyl)-3-phenylurea

1 -{3-nitrophenyl 3-phenylurea

7-hydroxy-2H-chromen-2-one

Χ

7- ydroxy-2H-chromen-2-one

Ethyl 6-(hydroxymethyl)-2-oxo-2H-chromene-3-carboxylate ethyl 8-(hydroxyniethyI)-2-oxo-2W-chromene-3-carboxyIate

6-(hydroxymethyl)-2H-chromen-2-one

6-(hydroxymethyl)-2W-chromei>2-one

Name Chemical structure

(3r,5r,7r)-1 -((2-oxo-2H-chromen-6-yl)methyl)-1 , 3,5,7- tetraazaadam antan- 1 - i um

{3r,5r,7r}-1 -((2-oxo-2H-chromeri-6-yl)meUiyl)-1 ,3,5,7 etraazaadamantan-1 -ium

Table 6 Chemical structures of selected Group 2 compounds.

Name Chemical structure

1-(2-((2-fluoro-4- compound B7

sulfamoylphenyl)amino)-2-oxoethyl)-2,6- dimethyl-4-phenylpyridin-1-ium

1-(2-((2-fluoro-4-$utfamoylphenyl)ammo)-2-oxo

2,6-dimethyl-1-(2-oxo-2-((5-sulfamoyl-

1,3,4-thiadiazol-2-yl)amino)ethyl)-4- compound B14

phenylpyridin-1-ium

2,6-clifTiethyl-1 -(2 wo-2-{(5-sulfernoyl-1 ^-Biiadiazd-2- l)amino)©thylH-ph0nylpyridin-1-ium

Name Chemical structure

(E)-2,6-diethyl-1-(2-((4-(N-(3-methyl-5- sulfamoyl-1 ,3,4-thiadiazol-2(3H- ylidene)sulphamoyl)phenyl)amino)-2- compound C18

oxoethyl-4-phenylpyridin-1-ium

(compound C18)

(E)-2,6-diethyl-1 -{2-{(4-( ftH3-methyl-5-$u!famoyl-1 ,3,4-thiadia2ol-2(3H)-ylidene)sulfamoyl)pheriyl)ami

oxoeihyl H -phenylpyrid i n - 1 -ium

(E)-2,6-diisopropyl-1-(2-((3-methyl-5- sulfamoyl-1 ,3,4-thiadiazol-2(3H)- compound D15

ylidene)amino)-2-oxoethyl)-4- phenylpyridin-1-ium (compound D15)

(E)-2,e-dteopropyH K2^(3-melh^»-sulfarnoyl-1 ,3,4 hfaKliazol-2 3H)^cleiie^miiio)-2^o^ yl)-

4-phenylpyridiri-1 -ium

Our data reveal that CA9 and CA12 are involved in lithium-induced NDI. We established that specific inhibitors of CA9 and/or CA12 are ideal therapeutics in Li- NDI, PKD, PCLD and NPHP, as they would be active on the prime CA involved in the disease, but their usage would preclude the occurrence of side effects observed with nonspecific inhibitors, such as acetazolamide. Hence, the invention relates to a Carbonic anhydrase (CA) inhibitor specific for CA9 and/or CA12 for use in the treatment or prevention of a disease selected from the group consisting of nephrogenic diabetes insipidus, PKD, NPHD and PLD. The treatment of nephrogenic diabetes insipidus is preferred.

A preferred group of specific inhibitors for use according to the invention are sulfonamide-based compounds, like acetazolamide, wherein a pyridinium moiety has been added in order to generate a new class of cell-impermeable carbonic anhydrase inhibitors. These pyridinium-containing compounds did not inhibit intracellular located carbonic anhydrases, but only plasma membrane-bound carbonic anhydrases, such as CA4 (35) and CA9 and CA12 (44).

In addition, while acetazolamide accumulated in red blood cells, the cell- impermeable pyridinium-containing compounds did not accumulate in these cells (35). Treatment of rats with the general inhibitor acetazolamide causes high bicarbonate excretion into the urine, indicative of metabolic acidosis, while treatment of rats with different pyridinium-containing compounds showed much less excretion of bicarbonate (35). This further demonstrated that the development of metabolic acidosis, a major side effect of acetazolamide treatment, is due to inhibition of intracellular CAs.

Legend to the figures- Figure 1 : CA9 downrequlation rescues lithium-induced AQP2 downrequlation.

MpkCCD cells were transfected with siRNAs targeting different CAs, seeded on Transwell filters and treated for the last 48 hours with lithium. Panel A: AQP2 abundance as assessed by immunoblotting. Panel B: quantification of multiple

experiments. CTR, control; NT, non-targeting; Li+, lithium; CA, carbonic anhydrase.

* p < 0.05 as compared to lithium.

Figure 2. Inhibition of CA 9/12 and NHE1 results in rescue of lithium-induced AQP2 down regulation.

AQP2 abundance and quantification after CA 9/12 inhibition with 6- hydroxycoumarin (10 uM), 7-hydroxycoumarin (10 uM) and sulphonamide FC12-533A (400 uM) (panel A) and with NHE1 inhibitors zoniporide (25 uM) and cariporide (75 uM) (panel B) as detected by immunoblotting. Data presented are mean ± SEM. ^* p < 0.05 as compared to CTR, # p < 0.05 as compared to lithium. Figure 3: Decision scheme for the selection of CA9 and/or CA12 specific compounds.

Group 1 and Group 2 specific CA9 and/or CA12 inhibitors may be selected according to this scheme.

Figure 4. FC12-533A reduces the development of lithium-induced NDI.

Mice were treated for 7 days with a control or lithium (40 mM LiCI/kg food) diet. In addition, mice received a daily injection of 0.025 mg FC12-533A (FC533)/g bodyweight. At day 5, mice were housed in metabolic cages and at day 7, 24-hr urine was collected. Urine volume (A) and urine osmolality (B) were analyzed.

Figure 5. Effect of acetazolamide and FC12-533A on renal H+-excretion in mice.

H+ levels were determined in mice on a control or lithium (40 mM/kg food) diet, which were treated with FC12-533A (A) or acetazolamide (B).

Figure 6. Effect of acetazolamide and FC12-533A on urinary pH in mice.

Urine pH levels were determined from mice on a control or lithium (40 mM/kg food) diet, which were treated with FC12-533A (A) or acetazolamide (B).

Examples Example 1 : Cell culture.

Mouse mpkCCD_Ci4 cells were grown in a modified defined medium (DMEM:Ham's F12 1 :1 vol/vol; 60 nM sodium selenate, 5 μg/ml transferrin, 2 mM glutamine, 50 nM dexamethasone, 1 nM triiodothyronine, 10 ng/ml epidermal growth factor, 5 μg/ml insulin, 20 mM D-glucose, 2% foetal calf serum, and 20 mM HEPES (pH 7.4)).

Exponentially growing cells were seeded on 1 .13 cm² semipermeable filters (0.4 μηη pore size, Transwell; Corning Costar, Cambridge, MA) with a density of 15 ^* 10⁴ cells/cm². On day 4, dDAVP (1 nM) (Sigma, St. Louis, MO, USA) was added to the basolateral side. On day 7, lithium was added to both the apical (10 mM) and basolateral (1 mM) side. Compounds were added to the apical and basolateral side of the filters for the last 48 hours at the indicated concentrations. On day 8, cells were harvested and lysed in Laemmli buffer for western blotting or stored in Trizol reagent (Invitrogen, Carlsbad, CA) at -80°C for RNA-isolation.

For siRNA knockdown in mpkCCD cells, siGENOME SMARTpool (Thermo Fisher Scientific, Lafayette, CO, USA) siRNAs were obtained against the indicated mouse CAs and a scrambled non-targeting siRNA as a control. The cells were seeded at 1.5^*10⁵ cells/cm² on 24-well (0.33 cm²) semi-permeable filters (Costar Corning Transwell®, 0.4 μηι pore size) and transfected with 20 pmol siRNA, combined with 1 μΙ MetafectenePro (Biontex, Martinsried, Germany) at day 1. For the last 72 hours, 1 nM dDAVP was added to the medium at the basolateral side, while cells were treated with lithium for the last 48 hours as describe above. After 4 days, cells were harvested and prepared for immunoblotting.

Example 2: RNA isolation.

RNA was precipitated in ethanol and DNAse treated before cDNA- construction using MMLV reverse transcriptase (RT, Invitrogen, Carlsbad, CA) and random primers. A control reaction using H₂0 instead of MMLV RT was conducted to exclude amplification of genomic DNA. Example 3: Primer design and polymerase chain reaction.

Intron-spanning primers were designed using primer3 primer design software on mouse cDNA sequences (table 1 ) (Rozen and Skaletsky, 2000), see http://frodo.wi.mit.edu/primer3/. Correct functioning of primers was verified by amplification of mouse cDNA from a tissue library (as indicated in table 1 ) as a positive control.

Amplification was performed using the cDNA equivalent of 5 ng of RNA in a total volume of 50 μί for 40 cycles (95°C 45 sec, 50°C 1 min, 72°C 1.30 min). Beta actin cDNA was amplified as a positive control for cDNA amplification.

To verify that the visible DNA-band was specific for the amplified gene, restriction enzyme control digestion was performed with the enzymes indicated in table 1 . DNA was visualized with ethidium bromide staining of agarose electrophoresis gels.

Example 4: Immunoblotting

MpkCCD cells were lysed in Laemmli buffer and sonicated. MpkCCD lysate and 5-10 μg (AQP2) in laemmli were denatured for 30 min at 37°C. Protein concentration was determined using the BioRad protein assay (Munich, Germany), according to manufacturer's instructions. SDS-PAGE, blotting and blocking of the PVDF membranes were done as described [18]. Membranes were incubated for 16 hrs at 4°C with 1 :2000-diluted affinity-purified rabbit pre-c-tail [19] or 1 :3000-diluted affinity purified rabbit-7 AQP2 antibodies [20], all diluted in Tris-Buffered Saline Tween-20 (TBS-T) supplemented with 1 % non-fat dried milk. After washing in TBS-T, blots were incubated for 1 hr with 1 :5000-diluted goat anti-rabbit IgG's coupled to horseradish peroxidase (Sigma, St. Louis, MO). Proteins were visualized using enhanced chemiluminescence (ECL, Pierce, Rockford, IL). Densitrometric analyses were performed using Biorad quantification equipment (Bio-Rad 690c densitometer, Chemidoc XRS) and software (QuantityOne).

Example 5: inhibition of CA9 and/or CA12 reduces the development of lithium-induced NDI in vivo.

We demonstrated that the rescuing effect of acetazolamide in lithium- induced NDI was mediated via CA9 and CA12 in vitro. To determine whether specific inhibition of CA9 and/or CA12 would reduce the development of lithium-induced NDI (i.e. in vivo), mice were fed a lithium diet and injected daily with 0.025 mg FC12-533A g bodyweight or saline as a control. FC12-533A is a group 2 specific pyridinium-containing sulfonamide. After 5 days, these mice were housed in metabolic cages for 48 hr and during the last 24 hr urine was collected. Lithium strongly increased urine production, while treatment with FC12-533A clearly attenuated this increase (Figure 1A). Consistent with a protective effect in Li-NDI, the urine osmolality in our FC12-533A-treated mice was increased as compared with the LI-NDI mice (Figure 1 B).

Example 6: effects of acetazolamide and FC12-533A on urinary H+-excretion in mice.

To analyse its specificity, we also determined the effects of acetazolamide and FC12-533A on urinary H⁺-excretion in our mice. By blocking CA2, acetazolamide increases urinary HC03^" and thus decreases H⁺ excretion. Indeed, as compared to lithium-treated mice, the renal proton excretion in FC12-533A-treated mice was much higher than in acetazolamide-treated mice (Fig. 5). Similarly, Acetazolamide increased the urine pH, a change that was not observed with FC12-533A (Fig. 6). These data indicated that in contrast to acetazolamide, treatment with FC12-533A does not result in a metabolic acidosis. As FC12-533A is specific for CA9 and/or CA12, these data show that CA9 and/or CA12-specific inhibitors attenuate LI-NDI without generating metabolic acidosis, as occurs with acetazolamide. Considering the effective reduction of Li-NDI and the absence of the metabolic acidosis side effect, these data reveal that CA9 and/or CA12-specific inhibitors are better drugs to treat Li-NDI than acetazolamide. SEQUENCE LISTING

<110> Stichting Katholieke Universiteit

<120> METHOD FOR TREATING RENAL DISORDERS

<130> 269 WO

<160> 34

<170> Patentln version 3.5

<210> 1

<211> 20

<212> DNA

<213> homo sapiens

<400> 1

tgcaactgcc aaagaaattg 20

<210> 2

<211> 20

<212> DNA

<213> homo sapiens

<400> 2

accactgggg atacagcaag 20

<210> 3

<211> 20

<212> DNA

<213> homo sapiens

<400> 3

tggctctgct aagaccatcc 20

<210> 4

<211> 20

<212> DNA

<213> homo sapiens

<400> 4

cccatcaaca ttgtcactgc 20

<210> 5

<211> 20

<212> DNA <213> homo sapiens

<400> 5

ccaggtggag tttgacgatt 20

<210> 6

<211> 20

<212> DNA

<213> homo sapiens

<400> 6

gagcacaccg tggacagtaa 20

<210> 7

<211> 20

<212> DNA

<213> homo sapiens

<400> 7

cccctgagct tggtgaacta 20

<210> 8

<211> 20

<212> DNA

<213> homo sapiens

<400> 8

ctcagcatca ccaacaatgg 20

<210> 9

<211> 20

<212> DNA

<213> homo sapiens

<400> 9

cgatggacac accattcaag 20

<210> 10

<211> 19

<212> DNA

<213> homo sapiens

<400> 10

ctgaagacag gatggagga

<210> 11 <211> 20

<212> DNA

<213> homo sapiens

<400> 11

ctgttttccc gtcgagtgat 20

<210> 12

<211> 20

<212> DNA

<213> homo sapiens

<400> 12

tcaaccatga aggcttctcc 20

<210> 13

<211> 20

<212> DNA

<213> homo sapiens

<400> 13

ttgaacctga ccaatgatgg 20

<210> 14

<211> 20

<212> DNA

<213> homo sapiens

<400> 14

acgttgactt tgacgacacg 20

<210> 15

<211> 20

<212> DNA

<213> homo sapiens

<400> 15

ttggccaacc tcttatcctg 20

<210> 16

<211> 20

<212> DNA

<213> homo sapiens

<400> 16

tccagcggga ctacactctt 20 <210> 17

<211> 21

<212> DNA

<213> homo sapiens

<400> 17

gtatgcctct ggtcgtacca

<210> 18

<211> 20

<212> DNA

<213> homo sapiens

<400> 18

gaaggaagca gactggatgg 20

<210> 19

<211> 20

<212> DNA

<213> homo sapiens

<400> 19

ccccatattt ggtgttccag 20

<210> 20

<211> 20

<212> DNA

<213> homo sapiens

<400> 20

gcatgatggg tcaaagtgtg 20

<210> 21

<211> 20

<212> DNA

<213> homo sapiens

<400> 21

atactgggca gtgcttccac 20

<210> 22

<211> 20

<212> DNA

<213> homo sapiens <400> 22 gcagacaaga ggggtcaaag

<210> 23

<211> 20

<212> DNA

<213> homo sapiens

<400> 23

cggaagttgt ccaccattct

<210> 24

<211> 20

<212> DNA

<213> homo sapiens

<400> 24

gtggacgtcc ttaggcaaca

<210> 25

<211> 20

<212> DNA

<213> homo sapiens

<400> 25

ctctcactga gtgggggtgt

<210> 26

<211> 20

<212> DNA

<213> homo sapiens

<400> 26

aggtaactcc ttcgctgcaa

<210> 27

<211> 18

<212> DNA

<213> homo sapiens

<400> 27

gcagagtgcg gcagaatg

<210> 28

<211> 20 <212> DNA

<213> homo sapiens

<400> 28

gcggtgactg tatgtcatgg

<210> 29

<211> 20

<212> DNA

<213> homo sapiens

<400> 29

accactgagg ctctggaaga

<210> 30

<211> 20

<212> DNA

<213> homo sapiens

<400> 30

atgttgaagc ctgggatgag

<210> 31

<211> 20

<212> DNA

<213> homo sapiens

<400> 31

caagatgatg gaagcaagca

<210> 32

<211> 20

<212> DNA

<213> homo sapiens

<400> 32

ttctgagctg cctcactcaa 20

<210> 33

<211> 20

<212> DNA

<213> homo sapiens

<400> 33

ccagacacaa tggcagagaa <210> 34

<211> 21

<212> DNA

<213> homo sapiens

<400> 34

acgatttccc tctcagctgt g

References

1. Manji, H.K., G.J. Moore, and G. Chen, Bipolar disorder: leads from the molecular and cellular mechanisms of action of mood stabilisers. Br J Psychiatry, 2001.

178(Suppl 41 ): p. S107-19.

2. Timmer, R.T. and J.M. Sands, Lithium intoxication. J Am Soc Nephrol, 1999. 10(3): p. 666-74.

3. Boton, R., M. Gaviria, and D.C. Batlle, Prevalence, pathogenesis, and treatment of renal dysfunction associated with chronic lithium therapy. Am J Kidney Dis, 1987. 10(5): p. 329-45.

4. Stone, K.A., Lithium-induced nephrogenic diabetes insipidus. J Am Board Fam

Pract, 1999. 12(1 ): p. 43-7.

5. Walker, R.G., Lithium nephrotoxicity. Kidney Int Suppl, 1993. 42: p. S93-8.

6. Kortenoeven, M.L., et al., Amiloride blocks lithium entry through the sodium channel thereby attenuating the resultant nephrogenic diabetes insipidus. Kidney Int, 2009.

76(1 ): p. 44-53.

7. Marples, D., et al., Lithium-induced downregulation of aquaporin-2 water channel expression in rat kidney medulla. J Clin Invest, 1995. 95(4): p. 1838-45.

8. Li, Y., et al., Development of lithium-induced nephrogenic diabetes insipidus is

dissociated from adenylyl cyclase activity. J Am Soc Nephrol, 2006. 17(4): p. 1063-

72.

9. Batlle, D.C, et al., Amelioration of polyuria by amiloride in patients receiving long- term lithium therapy. N Engl J Med, 1985. 312(7): p. 408-14.

10. Bedford, J. J., et al., Lithium-induced nephrogenic diabetes insipidus: renal effects of amiloride. Clin J Am Soc Nephrol, 2008. 3(5): p. 1324-31 .

1 1 . Bedford, J.J., et al., Amiloride restores renal medullary osmolytes in lithium-induced nephrogenic diabetes insipidus. Am J Physiol Renal Physiol, 2008. 294(4): p. F812- 20.

12. Gronbeck, L., et al., Mechanism of antidiuresis caused by bendroflumethiazide in conscious rats with diabetes insipidus. Br J Pharmacol, 1998. 123(4): p. 737-45.

13. Magaldi, A.J., New insights into the paradoxical effect of thiazides in diabetes

insipidus therapy. Nephrol Dial Transplant, 2000. 15(12): p. 1903-5. Janjua, N.R., et al., Role of sodium depletion in acute antidiuretic effect of bendroflumethiazide in rats with nephrogenic diabetes insipidus. J Pharmacol Exp Ther, 2001 . 299(1 ): p. 307-13.

Li, Y., et al., Development of lithium-induced nephrogenic diabetes insipidus is dissociated from adenylyl cyclase activity. J Am Soc Nephrol, 2006. 17(4): p. 1063-

1072.

Kling, M.A., et al., Effects of long-term lithium administration on renal structure and function in rats. A distinctive tubular lesion. Lab Invest, 1984. 50(5): p. 526-35. Krishnan, R., L. Eley, and J.A. Sayer, Urinary concentration defects and

mechanisms underlying nephronophthisis. Kidney Blood Press Res, 2008. 31 (3): p.

152-62.

Kamsteeg, E.J., et al., Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus. J. Cell Biol., 2003. 163(5): p. 1099-1 109. Trimpert, C, et al., Vasopressin increases S261 phosphorylation in AQP2-P262L, a mutant in recessive nephrogenic diabetes insipidus. Nephrol Dial Transplant, 2012. Deen, P.M.T., et al., Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine. Science, 1994. 264: p. 92-95.

Badger MR, Price GD (1994). "The role of carbonic anhydrase in photosynthesis". Annu. Rev. Plant Physiol. Plant Mol. Bio. 45: 369-392.

doi:10.1 146/annurev.pp.45.060194.002101 .

Breton S (2001 ). "The cellular physiology of carbonic anhydrases". JOP 2 (4 Suppl): 159-64. PMID 1 1875253.

Opavsky R, Pastorekova S, Zelnik V, Gibadulinova A, Stanbridge EJ, Zavada J, Kettmann R, Pastorek J (Sep 1996). "Human MN/CA9 gene, a novel member of the carbonic anhydrase family: structure and exon to protein domain relationships".

Genomics 33 (3): 480-7. doi:10.1006/geno.1996.0223. PMID 8661007.

Kirkpatrick JP, Rabbani, ZN, Bentley RC, Hardee ME, Karol S, Meyer J, Oosterwijk E, Havrilesky L, Secord AA, Vujaskovic Z, Dewhirst MW, Jones EL (Feb 2008). "Elevated CAIX Expression is Associated with an Increased Risk of Distant Failure in Early-Stage Cervical Cancer". Biomark Insights 3:45-55.

Supuran CT, Scozzafava A, Conway J, ed. (2004). Carbonic anhydrase: its inhibitors and activators. Boca Raton: CRC Press. ISBN 978-0-415-30673-7. 26. Supuran CT, Scozzafava A (2000). "Carbonic anhydrase inhibitors and their therapeutic potential". Expert Opinion on Therapeutic Patents 10 (5): 575-600. doi:10.1517/13543776.10.5.575.

27. Supuran CT, Scozzafava A, Casini A (March 2003). "Carbonic anhydrase inhibitors".

Med Res Rev 23 (2): 146-89. doi:10.1002/med.10025. PMID 12500287.

28. Supuran, C. World J. Clin. Oncol. 2012 3(7): 98 - 103.

29. Maresca A, Temperini C, Vu H, Pham NB, Poulsen SA, Scozzafava A, Quinn RJ, Supuran CT. Non-zinc mediated inhibition of carbonic anhydrases: coumarins are a new class of suicide inhibitors. J Am Chem Soc. 2009;131 :3057-3062.

30. Maresca A, Temperini C, Pochet L, Masereel B, Scozzafava A, Supuran CT.

Deciphering the mechanism of carbonic anhydrase inhibition with coumarins and thiocoumarins. J Med Chem. 2010;53:335-344.

31 . Lou Y, McDonald , PC , Oloumi A, Chia SK, Ostlund C, Ahmadi A, Kyle A, Auf dem Keller U, Leung S. Targeting Tumor Hypoxia: Suppression of Breast Tumor Growth and Metastasis by Novel Carbonic Anhydrase IX Inhibitors. Cancer Res.

201 1 ;71 :3364-3376.

32. Hasler U, et al., Long-term regulation of aquaporin-2 expression in vasopressin- responsive renal collecting duct principal cells. J Biol Chem 277: 10379-10386, 2002.

33. Mincione, F., Scozzafava, A., and Supuran, C. T. (2008) Curr Pharm Des 14, 649- 654

34. Hall, G. E., and Kenny, A. D. (1987) Calcif Tissue Int 40, 212-218

35. Scozzafava, A., Briganti, F., Mies, M. A., and Supuran, C. T. (2000) Journal of

medicinal chemistry 43, 292-300

36. Kivela, A. J., Kivela, J., Saarnio, J., and Parkkila, S. (2005) World J Gastroenterol 1 1 , 155-163

37. Purkerson, J. M., and Schwartz, G. J. (2007) Kidney Int. 71 , 103-1 15

38. Billecocq, A., Emanuel, J. R., Levenson, R., and Baron, R. (1990) Proc Natl Acad Sci U S A 87, 6470-6474

39. Ochrietor, J. D., Clamp, M. F., Moroz, T. P., Grubb, J. H., Shah, G. N., Waheed, A., Sly, W. S., and Linser, P. J. (2005) Exp Eye Res 81 , 492-500 40. Shah, G. N., Bonapace, G., Hu, P. Y., Strisciuglio, P., and Sly, W. S. (2004) Hum Mutat 24, 272

41 . Margolis, D. S., Szivek, J. A., Lai, L. W., and Lien, Y. H. (2008) Calcified tissue

international 82, 66-76

42. Granero, G. E., and Longhi, M. R. (2010) Expert Opin Drug Deliv 7, 943-953

43. Krupin, T., Sly, W. S., Whyte, M. P., and Dodgson, S. J. (1985) Am J Ophthalmol 99, 396-399

44. Pastorekova, S., Casini, A., Scozzafava, A., Vullo, D., Pastorek, J., and Supuran, C.

T. (2004) Bioorg Med Chem Lett 14, 869-873

45. Pacchiano, F., Carta, F., McDonald, P. C, Lou, Y., Vullo, D., Scozzafava, A.,

Dedhar, S., and Supuran, C. T. (201 1 ) J Med Chem 54, 1896-1902

46. Carta, F., Maresca, A., Scozzafava, A., and Supuran, C. T. (2012) Bioorganic & medicinal chemistry 20, 2266-2273

47. Touisni, N., Maresca, A., McDonald, P. C, Lou, Y., Scozzafava, A., Dedhar, S., Winum, J. Y., and Supuran, C. T. (201 1 ) Journal of medicinal chemistry 54, 8271 -

8277

48. Maresca, A., Temperini, C, Pochet, L., Masereel, B., Scozzafava, A., and Supuran, C. T. (2009) J Med Chem 53, 335-344

49. Supuran A., Nature 2008, doi:10.1038/nrd2467, Published online 2 January 2008; www. n atu re . com/revi ews/d ru gd isc.

50. Touisni et al., dx.doi.org/10.1021/jm200983e J. Med. Chem. 201 1 , 54, 8271-8277.

51 . Vullo et al., 2004; Bioorganic & Medicinal Chemistry Letters 14 (2004): 2351 - 2356.

52. Pachiano et al., J. Med. Chem. (201 1 ) dx.doi.org/10.1021/jm101541 x | J. Med.

Chem. 201 1 , 54, 1896-1902.

53. Pastorekova et al., Bioorganic & Medicinal Chemistry Letters 14 (2004) 869 - 873.

54. Carta et al., Bioorganic & Medicinal Chemistry 20 (2012) 2266 - 2273.

55. Checci et al., J. Med. Chem. (2005), 48, 4834-4841.

Claims

Carbonic anhydrase (CA) inhibitor specific for CA9 and/or CA12 for use in the treatment or prevention of nephrogenic diabetes insipidus.

Carbonic anhydrase inhibitor specific for CA9 and/or CA12 for use according to claim 1 , wherein the carbonic anhydrase 9 inhibitor is a group 1 inhibitor

Carbonic anhydrase inhibitor specific for CA9 and/or CA12 for use according to claim 1 , wherein the carbonic anhydrase 9 inhibitor is a group 2 inhibitor

Carbonic anhydrase inhibitor specific for CA9 and/or CA12 for use according to claim 2 wherein the inhibitor is selected from the group consisting 7-hydroxycoumarin, 6- hydroxycoumarin, FO-61 . 4-{([(40-Acetylphenyl)amino]carbonyl), amino}

benzenesulfonamide, 1-(3-nitrophenyl)-3-phenylurea, 6-(1 S-hydroxy-3-methylbutyl)-7- methoxy-2H-chromen-2-one, 7-hydroxy-2H-chromen-2-one, 6-(tert- butyldimethylsilyloxy)-2H-chromen-2-one, Umbelliferone (7-OH-Coumarine), 6 (7- mannosyl-4-methylumbelliferone), Thiocoumarin, Ethyl 6-(hydroxynethyl)2-oxo-2H- chromene-3-carboxylate, 6-(hydroxymethyl)-2H-chromen-2-one and (3r,5r,7r)-1-((2- oxo-2H-chromen-6-yl)methyl)-1 ,3,5,7-tetraazaadamantan-1-ium.

Carbonic anhydrase inhibitor specific for CA9 and/or CA12 for use according to claim 3 wherein the inhibitor is selected from the group consisting of FC5-208A, FC12- 533A, FC5-207A, FC8-325B, 2,4,6-trimethyl-1 -(2-oxo-2((4-(N-(5-sulfamoyl-1 ,3,4- thiadizo-2-yl)sulfamoyl)phenyl)amino)ethyl)pyridin-1 -ium, 2,4,6-trimethyl-1-(2-oxo-2- ((2sulfamoylbenzo[d]thiazol-6-yl)oxy)ethyl)pyridin-1-ium, 1-(2-((2-fluoro-4- sulfamoylphenyl)amino)-2-oxoethyl)-2,6-dimethyl-4-phenylpyridin-1-ium, 2,6-dimethyl- 1-(2-oxo-2-((5-sulfamoyl-1 ,3,4-thiadiazol-2-yl)amino)ethyl)-4-phenylpyridin-1 -ium, 5- Perfluorophenylsulfonylamido-1 ,3,4-thiadiazole-2-sulfonamide, (E)-2,6-diethyl-1-(2- ((4-(N-(3-methyl-5-sulfamoyl-1 ,3,4-thiadiazol-2(3H- ylidene)sulphamoyl)phenyl)amino)-2-oxoethyl-4-phenylpyridin-1-ium, (E)-2,6- diisopropyl-1-(2-((3-methyl-5-sulfamoyl-1 ,3,4-thiadiazol-2(3H)-ylidene)amino)-2- oxoethyl)-4-phenylpyridin-1 -ium, (4-Sulfamoylphenylmethyl)thioureido fluorescein (compound 5b), (4-Sulfamoylphenylethyl)thioureido fluorescein and 1-N-(4- Sulfamoylphenyl)-2,4,5-trimethylpyridinium perchlorate.