WO2015101342A1 - Kit and method of in vitro auxiliary diagnosis of pancreatic cancer - Google Patents

Abstract

Provided are a kit and method of in vitro auxiliary diagnosis of pancreatic cancer. Particularly, provided is an application of human serum miR-25 as a test target in preparing a pancreatic cancer diagnostic reagent. Also provided is a kit for in vitro auxiliary diagnosis of pancreatic cancer, the kit comprising primers and probes for real-time fluorescent quantitative PCR detection of human serum miR-25.

Description

Kit and method for assisting diagnosis of pancreatic cancer in vitro Technical field

The invention belongs to the field of biological diagnostic detection and relates to a kit and a method for assisting diagnosis of pancreatic cancer in vitro.

Background technique

Pancreatic carcinoma mainly refers to pancreatic exocrine adenocarcinoma, which is the most common type of pancreatic malignant tumor, accounting for 1%-2% of common tumors and 8%-10% of digestive tract tumors. The global incidence of pancreatic cancer is about 9/100,000, and the mortality rate is close to 9/100,000. According to the statistics of the American Society of Clinical Oncology, in 2005, there were 32,180 new cases of pancreatic cancer in the United States, and the number of deaths was 31,800, ranking fourth in the mortality rate of malignant tumors. In the incidence and mortality of pancreatic cancer, the situation in China is similar to that in the United States. At present, the incidence of pancreatic cancer in China is estimated to be 10/10 million, and there is a trend of increasing year by year. The overall survival rate of patients is 0.5% to 1%. .

Because the early symptoms of pancreatic cancer are hidden, early diagnosis is very difficult. When typical symptoms appear, it is advanced, the treatment effect is not satisfactory, and the mortality rate is very high. The 5-year survival rate is only 4%, so pancreatic cancer is highly malignant. One of the tumors that progress rapidly and seriously endanger human health.

Currently, diagnostic methods for pancreatic cancer include endoscopy, imaging, and tumor marker detection.

Endoscopic and imaging methods include B-ultrasound, computed tomography (CT), magnetic resonance (MRI), magnetic resonance cholangiopancreatography (MRCP), positron emission tomography (PET), positron emission tomography Scanning (PET) and endoscopic ultrasonography (EUS), oral pancreaticoscopic (POPS), intrapancreatic ultrasonography (PIDUS), and the like. However, due to the concealed position of the pancreas, the diagnostic effects of endoscopy and imaging techniques are limited.

At present, there are more than 10 kinds of tumor markers for the diagnosis and follow-up of pancreatic cancer, but so far no tumor markers have been found which are very satisfactory for the diagnosis and specificity of pancreatic cancer. Therefore, the use of each indicator alone has little value in the early diagnosis of pancreatic cancer, and can be used to determine whether there are residual lesions and recurrence after pancreatic cancer resection.

Commonly used tumor markers include CA19-9, CEA (carcinoembryonic antigen). However, the sensitivity and specificity of the above tumor markers are relatively low, and their detection results are not yet an indicator for the diagnosis of pancreatic cancer.

The early diagnosis of pancreatic cancer is the most critical factor in improving the survival rate of patients with pancreatic cancer. However, any of the above tumor markers is difficult to meet the needs of early diagnosis of pancreatic cancer. Some traditional medical methods, such as tissue cell testing, have inherent defects, improper access to materials, insufficient tissue specimens, or lack of human experience can lead to misdiagnosis. At the same time, some invasive methods such as retrograde cholangiopancreatography (ERCP) can even cause serious complications such as bleeding, secondary pancreatitis, bile leakage, and shock. Although imaging has been widely used in the examination and diagnosis of cancer, However, there are still great limitations in the qualitative nature of the disease. Therefore, it is now very necessary to find new, sensitive and convenient disease detection markers that can make up for existing diagnostic methods.

MicroRNAs are a class of single-stranded small RNA (RNA) molecules of about 19-23 nucleotides in length. They are located in the non-coding region of the genome and are highly conserved in evolution. They can regulate gene expression by inhibiting the translation process of target genes. Adjustment. MicroRNAs are involved in normal physiological activities, such as biological individual development, tissue differentiation, apoptosis, and energy metabolism, and are also closely related to the occurrence and development of many diseases. The inventors were the first to discover that microRNAs in serum are highly stable in various environments and are highly correlated with the occurrence and development of various diseases. Together with their convenience, serum microRNAs have become excellent biomarkers. Potential, with good development and application prospects.

Summary of the invention

The object of the present invention is to provide a novel pancreatic cancer serum marker human serum miR-25 as a detection target for the preparation of a pancreatic cancer diagnostic reagent, in view of the above-mentioned deficiencies of the prior art.

Another object of the present invention is to provide the use of primers and/or probes for qualitatively or quantitatively detecting human serum miR-25 for the preparation of diagnostic reagents for pancreatic cancer.

It is still another object of the present invention to provide a kit for assisting diagnosis of pancreatic cancer in vitro.

In a first aspect of the invention, there is provided the use of human serum miR-25 as a detection target for the preparation of a diagnostic reagent for pancreatic cancer, wherein the sequence of miR-25 is: AGGCGGAGACUUGGGCAAUUG (SEQ ID NO.: 1). In another preferred embodiment, the primer comprises a primer pair that specifically amplifies human miR-25.

In another preferred embodiment, the probe contains a complementary binding region that is complementary to the human miR-25 sequence.

In another preferred embodiment, the primer or probe contains a detectable label.

In another preferred embodiment, the detectable label is selected from the group consisting of a fluorescent group, a quenching group, biotin, or a combination thereof.

In a second aspect of the invention, there is provided the use of a primer and/or probe for qualitatively or quantitatively detecting human serum miR-25 for the preparation of a diagnostic reagent for pancreatic cancer.

In another preferred embodiment, the diagnostic reagent is a diagnostic reagent for blood testing or serum testing.

In another preferred embodiment, the diagnostic reagents include primers, probes, chips, and/or standards.

Preferably, the present invention provides the use of primers and probes for detecting human serum miR-25 by real-time fluorescent quantitative PCR in the preparation of diagnostic reagents for pancreatic cancer.

In another preferred embodiment, the primers and probes are primers for detecting human serum miR-25 by real-time fluorescent quantitative PCR. And probes.

More preferably, the diagnostic kit further comprises a reverse transcription primer for human serum miR-25.

In a third aspect of the invention, there is provided a method of in vitro diagnostic (especially assisted diagnosis) of pancreatic cancer comprising the steps of:

(a) providing a test sample which is blood or serum from the test subject;

(b) determining the level of miR25 in the sample, recorded as the measured value A1;

(c) comparing the measured value A1 of the previous step with the standard value A0 or the standard curve in the same sample in the normal population, wherein when A1 is significantly higher than A0, the risk of pancreatic cancer in the subject is higher than normal. crowd.

In another preferred embodiment, the above is significantly higher than indicating A1 > 50000 copies / microliter of serum; or A1/A0 ≥ 1.5, preferably ≥ 2.0, more preferably ≥ 3.0 or ≥ 5.0.

In another preferred embodiment, when A1 is equal to or lower than A0, it indicates that the risk of pancreatic cancer in the subject is indistinguishable from that of the normal population.

In another preferred embodiment, in step (b), the assay is performed by real-time fluorescent quantitative PCR.

In another preferred embodiment, in step (b), the kit of claim 5 is used for detection.

In a fourth aspect of the invention, there is provided a method of detecting the amount of miR25 in a sample in vitro, comprising the steps of:

(a) providing a test sample which is blood or serum from the test subject;

(b) determining the level of miR25 and the internal reference in the sample to obtain a measured value A1 of miR25 in the sample;

(c) Optionally, the measured value A1 value is compared to a threshold of 50,000 copies/μl.

In another preferred embodiment, in step (b), the assay is performed by real-time fluorescent quantitative PCR.

In a fifth aspect of the invention, a kit for in vitro assisted diagnosis of pancreatic cancer comprising primers and probes for detecting human serum miR-25 by real-time fluorescent quantitative PCR is provided.

In another preferred embodiment, the kit further comprises a reverse transcription primer for human serum miR-25.

In another preferred embodiment, the kit further contains an internal control, and the preferred internal control is selected from the group consisting of let7d, let7g or let7i or a combination thereof.

In another preferred embodiment, the kit further comprises a reverse transcription primer for the internal control, and a primer and probe for detecting the internal control by real-time fluorescent quantitative PCR.

In another preferred embodiment, the kit further comprises a non-human RNA solution of different copy number of miR-25 as a standard, and a mixture of synthetic products containing a specific copy number of miR-25 and an internal control is positive. A control product containing a specific copy number of miR-25 and an internal control synthetic mixture as a negative control containing no miR-25 The internal control RNA solution was used as a blank control. The range of miR-25 copy number in positive control, negative control and blank control is shown in Table 1.

Table 1

In another preferred embodiment, the kit further comprises reverse transcriptase, dNTPs, RT buffer, DEPC water, a buffer of DNA polymerase, MgCl ₂ , DNA polymerase, and/or a reference fluorescent dye.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

The composition of the kit most preferably includes the components shown in Table 2:

Table 2

Serial number	label	Ingredients	specification		Quantity
						1	Standard S4	Non-human RNA solution containing miR-25 10 6 copies/μl	100μl / support	1
2	Standard S3	Non-human RNA solution containing miR-25 10 5 copies/μl	100μl / support	1
					3	Standard S2	Non-human RNA solution containing miR-25 10 4 copies/μl	100μl / support	1
4	Standard S1	Non-human RNA solution containing miR-25 10 3 copies/μl	100μl / support	1
					5	Positive control	miR-25 and internal control synthetic liquid mixture	350μl / support	1
6	Negative control	miR-25 and internal control synthetic liquid mixture	350μl / support	1
					7	Blank control	RNA solution without miR-25 and internal control	50μl / support	1
8	Reverse transcriptase	Reverse transcriptase	44μl / support	1

9	dNTPs	dATP, dTTP, dCTP, dGTP mixture	85μl / support	1
					10	RT buffer	Reverse transcriptase buffer	200μl / support	1
11	RP-miR-25	Reverse transcription primer for miR-25	25μl / support	1
					12	RP-internal control	Internal control reverse transcription primer	19μl/piece	1
13	DEPC water	RNase-free ultrapure water	360μl / support	1
					14	qPCR buffer	DNA polymerase buffer	200μl / support	1
15	MgCl 2	MgCl 2 solution	150μl / support	1
					16	dNTPs	dATP, dTTP, dCTP, dGTP mixture	35μl / support	1
17	DNA polymerase	DNA polymerase	27μl / support	1
					18	ROX	Reference fluorescent dye	19μl/piece	1
19	PP-miR-25	Positive and reverse primers and probes for miR-25	25μl / support	1
					20	PP-internal control	Internal and reverse primers and probes	19μl/piece	1
twenty one	DEPC water	RNase-free ultrapure water	900μl / support	1

Note: The range of miR-25 copy number in positive control, negative control and blank control is shown in Table 1.

Kit

In one embodiment of the invention, the operation of the kit includes the following steps:

1. Test sample preparation: collect blood, separate and collect serum, and extract RNA from serum;

2. Reverse transcription: Reverse transcription of RNA from serum into cDNA under specific reaction conditions using reverse transcriptase and other starting materials;

3. PCR amplification: The reverse transcription product (cDNA) is subjected to polymerase chain reaction (PCR) under specific reaction conditions using DNA polymerase and other starting materials. By setting the threshold, it is worth the value of miR-25 and the Ct value of each concentration of the standard;

4. Statistical analysis and interpretation of the test results.

The storage conditions of the kit are as follows: the reagent is stored at -18 ° C or less in the dark, and can be stored for 12 months from the date of packaging; stored at 4 ° C - 8 ° C for 8 days in the dark, the quality is stable; transported by dry ice for 3 days The quality is stable; after 3 freeze-thaw cycles, the quality is stable, it is recommended to use immediately after opening, to avoid repeated freezing and thawing.

This kit is suitable for ABI-7500, ABI-7300, Roche and other real-time PCR instruments.

The detection principle of the kit is: qualitative detection kit, using real-time fluorescent quantitative PCR system to detect the content of miR-25 in human serum for the auxiliary diagnosis of pancreatic cancer. It is not recommended as a basis for diagnosis or diagnosis of malignant tumors, and is not suitable for tumor screening in the general population. The so-called auxiliary diagnosis means that the indication population of the present invention is a high-risk group of pancreatic cancer, and may specifically include, but is not limited to: 1) an age greater than 40 years old, a patient with non-specific symptoms of upper abdomen, accompanied by fatigue and progressive wasting; The upper abdominal discomfort is deeper and wider. It is often difficult for patients to indicate the location of abdominal discomfort by hand. Most patients cannot clearly describe the discomfort. The discomfort is not closely related to diet. 3) Family history of pancreatic cancer 4) patients with chronic pancreatitis; 5) patients with familial adenomatous polyposis; 6) sudden onset of diabetes; 7) upper abdominal pain or back pain with multiple venous thrombosis or thrombophlebitis; 8) long-term smoking, alcoholism and Long-term exposure to hazardous chemicals.

Determination of the content of miR-25 in human serum is a conventional technique in the art, and the invention of the present invention is to find that miR-25 in human serum has a correlation with pancreatic cancer, based on the findings that serum miR-25 can be used as a New pancreatic cancer detection targets, not specific primer and probe sequences. Reverse transcription primers, fluorescent quantitative PCR primers and probes designed to amplify miR-25 cDNA designed for miR-25 can be adapted to the present invention, and these primers and probes can be designed by existing computer software in accordance with methods well known in the art. And chemical synthesis, can also be ordered from the manufacturer. Table 3 is a set of three primer compositions designed by the inventors, but the following primer compositions are merely illustrative of the technical solutions of the present invention and are not intended to limit the scope of the present invention.

table 3

chip

The invention also provides a chip, including a miRNA chip, that can be used to aid in the diagnosis of pancreatic cancer. The miRNA chip of the present invention comprises a solid phase carrier and an oligonucleotide probe immobilized on the solid phase carrier, the oligonucleotide probe specifically binding to SEQ ID NO.: 1 The miR-25 sequence shown.

MicroRNA expression profiling chips typically contain up to several hundred probes covering a wide range of microRNAs, using the principle of DNA double-stranded homology to detect the levels of various microRNAs contained in samples (such as serum samples) at the genome-wide level. Therefore, the transcription level of the whole genome-wide microRNA in the sample to be tested can be detected at the same time.

Using the miRNA sequence of the present invention, the corresponding miRNA chip can also be prepared, and the expression profile and the regulation mode of the miRNAs can be studied.

In another aspect, the present invention also provides a chip for analyzing a miRNA expression profile, which can be used to distinguish between a sample having a high risk of pancreatic cancer and a normal sample.

Beneficial effects:

The present invention has found that there is a correlation between miR-25 in human serum and pancreatic cancer through a large number of experimental studies. It was found that serum miR-25 can be used as a new target for detection of pancreatic cancer and is used in the preparation of diagnostic reagents for pancreatic cancer. Furthermore, by designing a reverse transcription system of miR-25 and a qualitative/or quantitative detection system, a kit for assisting diagnosis of pancreatic cancer in vitro is prepared, which has good sensitivity and specificity.

Compared with the prior application of the subject, 1. The probe library of the present application is greatly simplified, which greatly reduces the manufacturing and use cost, while still ensuring high detection accuracy and specificity. The kit of the invention fills the blank of the pancreatic cancer marker; 2. the detection accuracy is not lower than the prior art, the operation is simple, the sample is convenient to store, and is not affected by the sampling position and the method, so the overall effect is better than the prior art; 3. The test sample is serum, non-invasive, reducing patient suffering.

DRAWINGS

Figure 1 is a graph of receiver operating characteristics (ROC) in one embodiment of the invention.

Figure 2 is a schematic diagram of the sample type ratio.

Fig. 3 Frequency statistics of the control group, the test group and the interference group according to the level of miR-25 expression, wherein the ordinate represents the number of samples in which the detected value satisfies the specific concentration interval (unit: example), and the abscissa is the concentration interval (unit) : Copy / μl). The results of frequency statistics can visually show the sample distribution and the proportion of samples with weak positives, near medical decision levels, and strong positive samples.

4 is a receiver operating characteristic (ROC) curve in another embodiment of the present invention.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. Experimental methods in which the specific conditions are not indicated in the following examples are generally carried out according to the conditions described in conventional conditions, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. The conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight and parts by weight.

detailed description

The reverse transcription primers of miR-25 and the internal control Let-7d used in the following examples, as well as Q-PCR primers and probes are shown in Sequence Design 1 of Table 3. However, the sequence used is merely illustrative of the technical solutions of the present invention, and should not be construed as limiting the scope of the present invention. The preparation of the reagents and the primer compositions of the other sequence design groups in Table 3 can also achieve the same functions as the following examples.

Example 1 sample requirements and sample processing methods

1. Sample requirements

1) Sample type: serum.

Serum is separated by fresh collection. Serum must be separated, collected, and serum transferred to a single-use RNase-free sterile microcentrifuge tube within 6 hours of blood collection.

2) Serum samples can be stored stably for 24 hours at room temperature, stable for 7 days at 2 °C-8 °C, and stable for 6 months at -18 °C.

3) The RNA solution extracted from the serum sample can be stably stored for 12 hours at room temperature, stable for 3 days at 2°C-8°C, and stable for 3 months at -18°C.

2. Treatment method:

1) Treat whole blood samples into serum: collect 2 ml of venous blood in a 5 ml clean centrifuge tube without anticoagulation. After standing for 30 minutes, it was centrifuged at 5000 rpm for 5 minutes, and the supernatant was taken. If the sample is not used immediately, it should be stored below -18 °C. The serum sample volume required for this kit is 300 μl.

2) RNA extraction from serum samples: Use the Qiagenmi RNeasy Mini Kit and follow the manufacturer's instructions. At the same time as the serum samples were extracted, positive control products (such as Table 2) and negative control products (such as Table 2) were also extracted.

Example 2 Reverse Transcription Procedure

1. The reverse transcription system is shown in Table 4:

Table 4

name	volume
		RT buffer	2μl
Reverse transcriptase	0.5μl
		dNTPs	1μl
Reverse transcription primer (RP-miR-25, RP-internal control)	0.5μl
		RNA	2μl
DEPC water	4μl
		total capacity	10μl

2. Experimental operation:

1) Calculate the reaction system: calculate the miR-25 and the internal control for the reverse transcription reaction according to the sample size. The amount of the system.

2) Preparation of reaction mixture: DEPC water, RT buffer, dNTPs, reverse transcriptase, reverse transcription primer (RP-miR-25, RP-internal control) were added in order, and mixed.

3) Distribution of the reaction mixture: 8 μl/well of the mixture obtained in the step 2) was distributed in the corresponding 96-well PCR plate.

4) Adding samples: 1 sample of each sample miR-25 and internal control; take blank control, standard S4-S1, negative control substance after extraction, positive control substance and RNA2ul to be tested to step 3) In a 96-well PCR plate, the membrane was applied.

5) Mixing: The 96-well PCR plate was vortexed on a vortexer for about 5 s, and then placed in a plate centrifuge (1500 rpm, 30 s) for centrifugation.

3. Reaction procedure:

A 96-well plate was placed in a PCR machine, and a program was set up to perform a reverse transcription reaction.

Reaction procedure: 16 ° C, 30 min - 42 ° C, 30 min - 85 ° C, 5 min - 4 ° C

Example 3 PCR operation process

1. The experimental system is shown in Table 5:

table 5

name	volume
		qPCR buffer	2μl
MgCl 2	1.2μl
		dNTPs	0.4μl
DNA polymerase	0.3μl
		Primer probe (PP-miR-25, pp-internal control)	0.5μl
ROX	0.2μl
		cDNA	5μl
DEPC water	10.4μl
		total capacity	20μl

2. Experimental operation:

1) Calculate the reaction system: Calculate the amount of system required for each qRCR primer according to the experimental requirements.

2) Preparation of reaction mixture: DEPC water, qRCR buffer, MgCl ₂ , dNTPs, DNA polymerase, ROX, primer probe (PP-miR-25, PP-internal control) were added in order, and mixed.

3) Distribution of the reaction mixture: 15 μl/well of the mixture obtained in the step 2) was distributed in the corresponding 96-well PCR plate.

4) Add cDNA: Add 5 μl/well of the sample cDNA obtained by reverse transcription reaction to step 3) 96-well PCR In the board, the film.

5) Mixing: The 96-well PCR plate was vortexed on a vortexer for about 5 s, and then placed in a plate centrifuge (1500 rpm, 30 s) for centrifugation.

3. Reaction procedure:

The 96-well plate was placed in an ABI 7300 or 7500 real-time PCR instrument, and the program was set up to perform a qPCR reaction.

Reaction procedure: 95 ° C, 5 min - (95 ° C, 15 s - 60 ° C, 1 min) × 40 cycles - 4 ° C.

The fluorescent signal was collected in the second step of each cycle: 60 ° C for 1 min.

Example 4 product quality requirements

1. The linear range of the miR-25 standard in the kit is: 10 ⁶ ~ 10 ³ copies / μl.

Linear correlation coefficient: -r - ≥ 0.990.

2. Accuracy: Accuracy is the positive coincidence rate. The miR-25 is determined by using 10 positive reference products P1～P10 (the concentration of miR-25 >20000 copy/μl) in the enterprise quality control panel. Positive, that is, 10/10; the internal control is measured, the test results should be consistent with Ct < 26.5.

3. Analytical specificity: Analytical specificity, ie, negative coincidence rate, the miR-25 was determined by using 10 negative reference products N1～N10 (the concentration of miR-25 was ≤20000 copy/μl) in the enterprise control panel. Both should be negative, that is, 10/10; the internal control is measured, and the test results should be consistent with Ct<26.5.

4. Detection limit: The kit miR-25 the detection limit is not higher than 10 ³ copies / μl, detection of miR-25 10 ³ copies / μl (standard S1) 20 times, at least 17 times higher than a detection result The minimum detection limit is judged.

5. Kit requirements for positive control, negative control and blank control

5.1 using the kit to detect the extracted positive control should meet: 10 ⁵ copies / μl ≤ miR-25 relative copy number ≤ 10 ⁶ copies / μl, internal control Ct <26.5;

5.2 Using the kit to detect the extracted negative control should meet: 10 ³ copies / μl ≤ miR-25 relative copy number ≤ 10 ⁴ copies / μl, internal control Ct <26.5;

5.3 Detection of the blank control with the kit should be satisfied: the relative copy number of miR-25 <10 ³ copies / μl, the internal control Ct ≥ 26.5.

6. Precision:

In-batch precision measurement method: using the positive control product and the negative control product for parallel detection 10 times, the miR-25 test should meet the coefficient of variation of relative copy number (CV,%) ≤ 5%, internal control test Should comply with Ct coefficient of variation (CV,%) ≤ 5%.

7. After systematic study of clinically high concentrations of triglyceride, bilirubin, and hemoglobin serum samples, such samples do not affect the qualitative test results of this kit.

Example 5 Determination of miR-25 as a detection target for pancreatic cancer

This example utilizes a kit product based on Examples 1-4 for a small sample trial to verify the clinical efficacy of miR-25 as a detection target for pancreatic cancer. The invention provides auxiliary diagnosis for pancreatic cancer by detecting the content of miR-25 in serum. Through independent testing in three medical institutions, 78 clinical samples were tested. The preliminary results showed that miR-25, as a target for detection of pancreatic cancer, has certain diagnostic value for pancreatic cancer.

1. Sample size and sample type

Table 6 Summary of sample types and sample size for each type

Group	Sample type	Number of samples (example)
			test group	Pancreatic cancer	36
Control group	Normal person	36
			Interference group	Chronic pancreatitis	6
total		78

The sample requirements and sample processing methods are as described in Example 1.

2. Reverse transcription

The reverse transcription reaction system and specific procedures are as described in Example 2.

3. PCR operation process

The PCR procedure was as described in Example 3.

The specific results are shown in Figure 1. Figure 1 is a graph of the operational characteristics (ROC) of a test sample. Test result variable: miR25. The results showed that let7, miR-25 positive control, negative control and blank control all met the corresponding requirements. When miR-25 takes a reference value of 20000, the sensitivity is 72.22% and the specificity is 78.57%. It is preliminarily verified that the clinical effect of miR-25 as a detection target for pancreatic cancer is feasible and can be used for further quality studies.

Example 6. Analysis and interpretation of test results

This embodiment discloses how to analyze the detection result and determine whether the source of the sample is sick or not;

1. Result analysis condition setting:

After determining that the amplification curve is normal, that is, after the S-type is present, the baseline and the threshold are set. Baseline setting, Take the auto mode, that is, the fluorescence signal of 3-15; the threshold setting should be based on the highest point of the noise line exceeding 3-15 cycles.

2. Quality control standards:

The present invention uses three different batches of kits for the following items on the ABI-7300 instrument: detection limit, system linearity (standard linearity, sample linearity), accuracy, specificity, and positive control of the kit components. The requirements and repeatability of the product/negative control/blank control effectiveness were evaluated to obtain the quality control standard for the experimental operation.

The reference value (range) refers to the fluctuation range of various indicators such as anatomy, physiology, and biochemistry of normal people, and is the range of normalization and abnormality. The reference value was determined by detecting the expression of miR-25 in 175 serum samples excluding pancreatic cancer, and the reference value (range) of miR-25 was given by data statistics.

Detection of microRNA in serum was performed using a real-time PCR system. First, reverse transcriptase and other starting materials are used to reverse transcribe RNA from the serum into cDNA under appropriate reaction conditions. Thereafter, the reverse transcription product (cDNA) is subjected to polymerase chain reaction (PCR) under suitable reaction conditions using DNA synthetase and other starting materials. The Ct values of the respective concentrations of the microRNA and the standard were obtained by setting threshold values. Finally, a standard curve was prepared based on the Ct value of the standard, and the relative copy number of miR-25 in serum was calculated.

Analytical method used:

Single-sample K-S test: Use non-parametric methods to test whether the observed empirical distribution of data obeys a known theoretical distribution. This document is used to verify that the data is subject to a normal distribution.

For data subject to a normal distribution, a normal distribution method is used to establish a reference range.

For data that does not follow a normal distribution, the reference range is established using the percentile method.

Combine the results of the small clinical data ROC curve in the research and development phase, and formulate the final reference range to ensure the specificity is better.

According to the following quality control indicators, judge by article, after all the indicators are qualified, the quality control is qualified.

1) The correlation coefficient of the standard curve—r—should be ≥0.990, otherwise the experiment is invalid.

2) positive control materials should satisfy: ¹⁰⁵ copies / μl≤miR-25 ≤10 ⁶ relative copy number of copies / μl, endogenous control Ct <26.5, or the test is invalid.

3) The negative control should satisfy: 10 ³ copies / μl ≤ miR-25 relative copy number ≤ 10 ⁴ copies / μl, internal control Ct < 26.5, otherwise the experiment is invalid.

4) The blank control should satisfy: the relative copy number of miR-25 ≤ 10 ³ copies / μl, the internal control Ct ≥ 26.5, otherwise the experiment is invalid.

5) The internal control of the sample should meet: Ct<26.5, otherwise the experiment is invalid.

3. Draw the standard curve of miR-25 according to the Ct value of the standard and the corresponding copy number, substitute the Ct value obtained by the sample test into the standard curve, and calculate the relative copy number of the sample miR-25.

The interpretation of the test results of this kit is:

2) The relative copy number of the sample miR-25 is ≥50000 copies/μl, and the diagnosis result can be directly reported as positive.

3) The test sample is 20,000 copies/μl <miR-25 relative copy number <50000 copies/μl, and the diagnosis result can be directly reported as positive, and it is recommended to carefully track the sample.

4) The relative copy number of the sample miR-25 is ≤20000 copies/μl, and the diagnosis result is directly reported as negative.

Example 7. Verification of the validity of test results

This example compares the invention to the gold standard (i.e., pathological diagnosis of pancreatic cancer). The invention provides auxiliary diagnosis for pancreatic cancer by detecting the content of miR-25 in serum. Through the independent detection of 1,063 clinical samples in three medical institutions, the sensitivity and specificity reached 75.58% and 93.03%, respectively. The preliminary results prove that the invention has certain diagnostic value for pancreatic cancer.

1. Sample size, sample type and sample source

1) Sample size and sample type

Table 7 Summary of sample types and sample size for each type

The test group samples used in this embodiment are evenly distributed, and contain not only strong positive samples but also a large number of weak positives. And samples near the medical decision level. The frequency distribution method can be used to visually show the distribution of samples (Figure 2).

Using the kit of the present invention for detection, it can be seen from statistics that most of the samples in the test group are distributed near the reference value (20,000 copies/μl), which is weakly positive or critically positive, and a few samples are strongly positive, as shown in Table 8, for example. :

Table 8 Distribution ratio of samples in the test group

Figure 3 is a graph showing frequency statistics based on the level of miR-25 expression in the control, test, and interference groups. The results of frequency statistics can visually show the sample distribution and the proportion of samples with weak positives, near medical decision levels, and strong positive samples. The ordinate represents the number of samples in which the detected value satisfies the specific concentration interval (unit: example), and the abscissa is the concentration interval (unit: copy/μl).

Table 9 sample test results four table statistics table

Sensitivity*: Se=P(T+|D+)=a/(a+c)=229/303=75.58%

Specificity** (Specificity): Sp=P(T-|D-)=d/(b+d)=707/760=93.03%

False-negative rate: FNR=P(T-|D+)=c/(a+c)=74/303=24.42%

False-positive rate: FPR=P(T+|D-)=b/(b+d)=53/760=6.97%

Positive prediCtive value: PPV=P(D+|T+)=a/(a+b)=229/282=81.21%

Negative prediCtive value: NPV=P(D-|T-)=d/(c+d)=707/781=90.52%

Total coincidence rate: (a+d)/N=(229+707)/1063=88.05%

Youden Index: YI=Se+Sp-1=75.58%+93.03%-1=0.69

Positive likelihood ratio:

Negative likelihood ratio:

*Note: The sensitivity here refers only to the sensitivity of the reagents to be evaluated in the current sample compared with the gold standard, which is obtained in the case of non-large samples.

**Note: The specificity here refers only to the specificity of the reagents to be tested in the current sample compared with the gold standard, which is obtained in the case of non-large samples.

a) Confidence intervals for sensitivity, specificity, and total coincidence rate

95% confidence interval for sensitivity:

95% confidence interval for specificity:

95% confidence interval for total compliance:

b) Consistency test (Kappa value analysis) is shown in Table 10:

Table 10 consistency test

a. Do not assume a null hypothesis.

The Kappa value = 0.701, indicating that the reagents and gold standards are in good agreement.

c) Receiver operating characteristic (ROC) curve analysis (Figure 4):

Table 11 Area under the curve

Test result variable: miR25

a. Under non-parametric assumptions

b. Zero hypothesis: real area = 0.5

The area under the curve (AUC) = 0.921, the 95% confidence interval is [0.901, 0.941], and the p value = 0.000.

The above test results show that in the method of the present invention, not only the probe library for detection is greatly simplified, but also the manufacturing and use cost is greatly reduced, and at the same time, high detection accuracy and specificity are ensured.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims (10)

1. The application of human serum miR-25 as a detection target in the preparation of a diagnostic reagent for pancreatic cancer, wherein the sequence of miR-25 is: AGGCGGAGACUUGGGCAAUUG (SEQ ID NO.: 1).
2. The use of primers and/or probes for qualitative or quantitative detection of human serum miR-25 for the preparation of diagnostic reagents for pancreatic cancer.
3. The use according to claim 2, wherein the primers and probes are primers and probes for detecting human serum miR-25 by real-time fluorescent quantitative PCR.
4. A kit for assisting diagnosis of pancreatic cancer in vitro, characterized in that the kit comprises primers and probes for detecting human serum miR-25 by real-time fluorescent quantitative PCR.
5. The kit according to claim 4, further comprising a reverse transcription primer for human serum miR-25.
6. The kit according to claim 5, wherein said kit further comprises an internal control, preferably said internal control is selected from the group consisting of let7d, let7g, let7i or a combination thereof.
7. The kit according to claim 6, wherein said kit further comprises a reverse transcription primer for an internal control, and a primer and a probe for detecting an internal control by real-time fluorescent quantitative PCR.
8. The kit according to claim 6, wherein said kit further comprises a different copy number of miR-25 and an internal control non-human RNA solution as a standard, containing a specific copy number of miR-25 and The internal control synthetic liquid mixture is used as a positive control substance, and contains a specific copy number of miR-25 and an internal control synthetic product mixture as a negative control substance, and contains an RNA solution containing no miR-25 and an internal control. Blank control; the range of miR-25 copy number in the positive control, negative control and blank control is as follows:

   Table 1

   Quality control Reference range Positive control 10 ⁵ copies / μl ≤ miR-25 relative copy number ≤ 10 ⁶ copies / μl Negative control 10 ³ copies / μl ≤ miR-25 relative copy number ≤ 10 ⁴ copies / μl Blank control Relative copy number of miR-25 ≤ 10 ³ copies / μl

   .
9. A method for assisting diagnosis of pancreatic cancer in vitro, comprising the steps of:

   (a) providing a test sample which is blood or serum from the test subject;

   (b) determining the level of miR25 in the sample, recorded as the measured value A1;

   (c) comparing the measured value A1 of the previous step with the standard value A0 or the standard curve in the same sample in the normal population, wherein when A1 is significantly higher than A0, the risk of pancreatic cancer in the subject is higher than normal. crowd.
10. A method for detecting the amount of miR25 in a sample in vitro, comprising the steps of:

    (a) providing a test sample which is blood or serum from the test subject;

    (b) determining the level of miR25 and the internal reference in the sample to obtain a measured value A1 of miR25 in the sample;

    (c) Optionally, the measured value A1 value is compared to a threshold of 50,000 copies/μl.

Images