WO2015100180A1 - Compositions and methods for control of industrial scale production of bio-products - Google Patents

Compositions and methods for control of industrial scale production of bio-products Download PDF

Info

Publication number
WO2015100180A1
WO2015100180A1 PCT/US2014/071691 US2014071691W WO2015100180A1 WO 2015100180 A1 WO2015100180 A1 WO 2015100180A1 US 2014071691 W US2014071691 W US 2014071691W WO 2015100180 A1 WO2015100180 A1 WO 2015100180A1
Authority
WO
WIPO (PCT)
Prior art keywords
nitrate
gene
polypeptide
promoter
bacterial cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/071691
Other languages
French (fr)
Other versions
WO2015100180A8 (en
Inventor
Lori J. EULER
Dana M.W. POLLAK
Virgil A. RHODIUS
Tina K. Van Dyk
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Danisco US Inc
Original Assignee
Danisco US Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danisco US Inc filed Critical Danisco US Inc
Publication of WO2015100180A1 publication Critical patent/WO2015100180A1/en
Publication of WO2015100180A8 publication Critical patent/WO2015100180A8/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0044Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on other nitrogen compounds as donors (1.7)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y107/00Oxidoreductases acting on other nitrogenous compounds as donors (1.7)
    • C12Y107/99Oxidoreductases acting on other nitrogenous compounds as donors (1.7) with other acceptors (1.7.99)
    • C12Y107/99004Nitrate reductase (1.7.99.4)

Definitions

  • This invention provides compositions and methods for the control of industrial scale production of bio-products produced by genetically engineered microorganisms and methods to produce and/or to improve the production of bio-products by microorganisms.
  • Industrial scale production of bio-products can be improved using microorganisms genetically engineered to express one or more heterologous nucleic acids.
  • Production can be further improved if heterologous gene expression can be regulated so that bio-product production is "off when microorganisms are cultured as a seed stock under conditions suitable for initially establishing a population for large scale production.
  • Production can further be improved if heterologous gene expression can then be turned “on” once the seed stock has been placed into a suitable bioreactor to begin large-scale fermentation.
  • microorganisms are engineered for the production of bio-products using heterologous genes under the control of promoters activated by specific chemical compounds such as isopropyl thiogalactoside (IPTG), which can be added at the bioreactor stage to start the production process.
  • IPTG isopropyl thiogalactoside
  • compounds such as IPTG can be cost prohibitive. Therefore, alternative means for controlling gene regulation in engineered microorganisms during the industrial production of bio-products are desirable.
  • the present invention provides, inter alia, nitrate-inducible gene expression constructs useful for expressing heterologous polynucleotides in microorganisms for the production of one or more bio-products.
  • recombinant bacterial cells comprising a gene expression construct comprising a PnarG nitrate-dependent promoter operably linked to one or more nucleic acids encoding a gene of interest; and wherein said cell further comprises one or more modifications to increase the expression of one or more nitrate regulation genes.
  • said PnarG nitrate dependent promoter is a PnarG mutant. In some embodiments of any of the embodiments provided herein, said PnarG mutant is
  • said PnarG* is PnarG#.
  • said one or more nitrate regulation genes is operably linked to a strong promoter. In some embodiments of any of the embodiments provided herein, said one or more nitrate regulation genes is operably linked to a constitutive promoter. In some embodiments of any of the embodiments provided herein, said one or more nitrate regulation genes is selected from the group consisting of NarL, NarX or
  • said cell is further modified to comprise a down-regulation of one or more nitrate metabolism genes.
  • said one or more nitrate metabolism genes comprise a nitrate reductase gene or a nitrate transporter gene.
  • the nitrate reductase gene is one or more of narG, narZ, or napA.
  • the nitrate transporter gene is one or more of narK or narU.
  • said cell comprises a deletion of one or more nitrate metabolism genes.
  • said bacterial cell is a gram(-) bacteria. In some embodiments of any of the embodiments provided herein, said bacterial cell is E. coli. In some embodiments of any of the embodiments provided herein, said bacterial cell is E. coli B strain. In some embodiments of any of the embodiments provided herein, said gene of interest is selected from the upper MVA pathway. In some embodiments of any of the embodiments provided herein, said gene of interest is selected from the lower MVA pathway. In some embodiments of any of the embodiments provided herein, said gene of interest is an isoprene synthase.
  • nitrate-containing compound is a nitrate salt.
  • said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate.
  • nitrate- containing compound is a nitrate salt.
  • said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate.
  • nitrate-containing compound is a nitrate salt.
  • said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate.
  • nitrate-inducible promoters for expression of a gene of interest in a host cell comprising one or more nucleic acid substitutions at a nucleotide position located -10 bp and -35 bp from a transcriptional start site, wherein the nucleic acid sequence at the nucleotide position located -10 bp from the transcriptional start site comprises TATAAT.
  • the nucleic acid sequence at the nucleotide position located - 35 bp from the transcriptional start site comprises TTGCCA or TTCACA.
  • the promoter is capable of expressing the gene of interest in a host cell when cultured under aerobic and/or anaerobic conditions. In some embodiments of any of the embodiments disclosed herein, the promoter is capable of expressing a gene of interest in response to nitrate at levels at least about 50% higher in comparison to expression of the same gene of interest when operably linked to the PnarG* promoter. In some embodiments of any of the embodiments disclosed herein, the nucleotide sequence of the nitrate-inducible promoter comprises
  • the nitrate-inducible promoter is PnarG#.
  • vectors comprising the nitrate-inducible promoter of any of the embodiments disclosed herein.
  • FIG. 1 depicts an exemplary representation of a plasmid pDMWP170 for nitrate induction of gene expression comprising a mutant narG promoter.
  • FIG. 2 depicts MVA production following induction by nitrate.
  • FIG. 3 depicts nitrate-induced gene expression of mvaE and mvaS relative to samples cultured without nitrate.
  • FIG. 4 depicts real time qPCR data comparing the PnarG* and PnarG# promoters.
  • FIG. 5 depicts growth rate analysis for IPTG inducible control strain vs nitrate- inducible test strains.
  • FIG. 6 depicts IspS specific productivity analysis for IPTG inducible control strain vs nitrate-inducible test strains.
  • FIG.7 depicts cumulative yield of isoprene on glucose achieved in each 15 L fermentation over time; DP2165 induced at 800 ⁇ nitrate (closed triangles); DP2165 induced at 8,000 ⁇ nitrate (closed squares); DP2165 induced at 80,000 ⁇ nitrate (closed diamonds); DP2165 induced at 80,000 ⁇ nitrate (open diamonds); MCM2158 induced at 100 ⁇ IPTG (stars).
  • FIG. 8 depicts volumetric productivity achieved in each 15 L fermentation over time; DP2165 induced at 800 ⁇ nitrate (closed triangles); DP2165 induced at 8,000 ⁇ nitrate (closed squares); DP2165 induced at 80,000 ⁇ nitrate (closed diamonds); DP2165 induced at 80,000 ⁇ nitrate (open diamonds); MCM2158 induced at 100 ⁇ IPTG (stars).
  • FIG. 9 depicts cell performance index (CPI) achieved in each 15 L fermentation over time; DP2165 induced at 800 ⁇ nitrate (closed triangles); DP2165 induced at 8,000 ⁇ nitrate (closed squares); DP2165 induced at 80,000 ⁇ nitrate (closed diamonds); DP2165 induced at 80,000 ⁇ nitrate (open diamonds); MCM2158 induced at 100 ⁇ IPTG (stars).
  • CPI cell performance index
  • FIG. 10 depicts cumulative yield of isoprene on glucose achieved in each 15 L fermentation over time; DP2165 induced at 80,000 ⁇ nitrate (closed triangles); DP2165 induced at 80,000 ⁇ nitrate (closed squares); DP2166 induced at 80,000 ⁇ nitrate (closed diamonds); DP2166 induced at 80,000 ⁇ nitrate (open diamonds); MCM2158 induced at 100 ⁇ IPTG (stars).
  • FIG. 11 depicts overall volumetric productivity achieved in each 15 L fermentation over time; DP2165 induced at 80,000 ⁇ nitrate (closed triangles); DP2165 induced at 80,000 ⁇ nitrate (closed squares); DP2166 induced at 80,000 ⁇ nitrate (closed diamonds); DP2166 induced at 80,000 ⁇ nitrate (open diamonds); MCM2158 induced at 100 ⁇ IPTG (stars).
  • FIG. 12 depicts cell performance index (CPI) achieved in each 15 L fermentation over time; DP2165 induced at 80,000 ⁇ nitrate (closed triangles); DP2165 induced at 80,000 ⁇ nitrate (closed squares); DP2166 induced at 80,000 ⁇ nitrate (closed diamonds); DP2166 induced at 80,000 ⁇ nitrate (open diamonds); MCM2158 induced at 100 ⁇ IPTG (stars).
  • FIG. 13 depicts supernatant concentrations of nitrate (A) and nitrite (B).
  • FIG. 14 depicts growth plots with various nitrate induction.
  • FIG. 15 depicts MVA production with various nitrate induction as measured by HPLC.
  • FIG. 16 depicts a replot of nitrate induced MVA production at various fermentation time points.
  • FIG. 17 shows the classical and modified MVA pathways. 1, acetyl-CoA
  • acetyltransferase AACT
  • 2, HMG-CoA synthase HMGS
  • 3, HMG-CoA reductase HMGR
  • MVK mevalonate kinase
  • PMK phosphomevalonate kinase
  • MVD or DPMDC diphosphomevalonate decarboxylase
  • ID I isopentenyl diphosphate isomerase
  • the classical MVA pathway proceeds from reaction 1 through reaction 7 via reactions 5 and 6, while a modified MVA pathway goes through reactions 8 and 9.
  • P and PP in the structural formula are phosphate and pyrophosphate, respectively. This figure was taken from Koga and Morii, Microbiology and Mol. Biology Reviews, 71:97-120, 2007, which is incorporated by reference in its entirety, particularly with respect to nucleic acids and polypeptides of the modified MVA pathway.
  • the modified MVA pathway is present, for example, in some archaeal organisms, such as Methanosarcina mazei.
  • FIG. 18 shows a schematic representation of an obligate anaerobe expressing (a) a heterologous IspS polypeptide, (b) a heterologous DXS polypeptide, and (c) a heterologous IDI polypeptide to increase DXP pathway flux and isoprene production.
  • FIG. 19 shows a schematic representation of an obligate anaerobe engineered with mvaE and mvaS to express the upper MVA pathway.
  • FIG. 20 shows a schematic representation of expressing the lower MVA pathway in an obligate anaerobe including expressing (a) a heterologous MVK polypeptide, (b) a heterologous PMK polypeptide, and (c) a heterologous MVD polypeptide in the cells expressing heterologous IDI polypeptide and heterologous IspS polypeptide for the purpose of increasing isoprene production.
  • FIG. 20 shows a schematic representation of expressing the lower MVA pathway in an obligate anaerobe including expressing (a) a heterologous MVK polypeptide, (b) a heterologous PMK polypeptide, and (c) a heterologous MVD polypeptide in the cells expressing heterologous IDI polypeptide and heterologous IspS polypeptide for the purpose of increasing isoprene production.
  • 21 shows a schematic representation of expressing the entire MVA pathway in an obligate anaerobe by introducing mvaE and mvaS in the cells expressing (a) a heterologous MVK polypeptide, (b) a heterologous PMK polypeptide, (c) a heterologous MVD polypeptide, (d) a heterologous IDI polypeptide, and (e) a heterologous IspS polypeptide for the purpose of increasing isoprene production.
  • FIG. 22 shows a schematic representation of redirecting carbon flux away from acetate by reducing expression of ack and adhE to reduce loss of carbon to side products.
  • FIG. 23 shows exemplary pathways for production of butadiene from acetyl-CoA, glutaconyl-CoA, glutaryl-CoA, 3-aminobutyryl-CoA or 4-hydroxybutyryl-CoA via crotyl alcohol.
  • Enzymes for transformation of the identified substrates to products include: A. acetyl- CoA:acetyl-CoA acyltransferase, B. acetoacetyl-CoA reductase, C. 3-hydroxybutyryl-CoA dehydratase, D. crotonyl-CoA reductase (aldehyde forming), E.
  • crotonaldehyde reductase (alcohol forming)
  • F. crotyl alcohol kinase G. 2-butenyl-4-phosphate kinase, H. butadiene synthase, I. crotonyl-CoA hydrolase, synthetase, transferase, J. crotonate reductase, K. crotonyl- CoA reductase (alcohol forming),
  • L. glutaconyl-CoA decarboxylase M., glutaryl-CoA dehydrogenase, N. 3-aminobutyryl-CoA deaminase, O. 4-hydroxybutyryl-CoA dehydratase, P. crotyl alcohol diphosphokinase.
  • FIG. 24 shows exemplary pathways for production of butadiene from erythrose-4- phosphate.
  • Enzymes for transformation of the identified substrates to products include: A.
  • Erythrose-4-phosphate reductase B. Erythritol-4-phospate cytidylyltransferase, C. 4-(cytidine 5'- diphospho)-erythritol kinase, D. Erythritol 2,4-cyclodiphosphate synthase, E. l-Hydroxy-2- butenyl 4-diphosphate synthase, F. l-Hydroxy-2 -butenyl 4-diphosphate reductase, G. Butenyl 4- diphosphate isomerase, H. Butadiene synthase I. Erythrose-4-phosphate kinase, J. Erythrose reductase, K. Erythritol kinase.
  • FIG. 25 shows an exemplary pathway for production of butadiene from malonyl-CoA plus acetyl-CoA.
  • Enzymes for transformation of the identified substrates to products include: A. malonyl-CoA:acetyl-CoA acyltransferase, B. 3-oxoglutaryl-CoA reductase (ketone -reducing), C. 3-hydroxyglutaryl-CoA reductase (aldehyde forming), D. 3-hydroxy-5-oxopentanoate reductase, E. 3,5-dihydroxypentanoate kinase, F. 3H5PP kinase, G. 3H5PDP decarboxylase, H.
  • butenyl 4- diphosphate isomerase I. butadiene synthase, J. 3-hydroxyglutaryl-CoA reductase (alcohol forming), K. 3-oxoglutaryl-CoA reductase (aldehyde forming), L. 3, 5 -dioxopentanoate reductase (ketone reducing), M. 3, 5 -dioxopentanoate reductase (aldehyde reducing), N. 5- hydroxy-3-oxopentanoate reductase, O. 3-oxo-glutaryl-CoA reductase (CoA reducing and alcohol forming).
  • 3H5PP 3-Hydroxy-5- phosphonatooxypentanoate
  • 3H5PDP 3-Hydroxy-5- [hydroxy(phosphonooxy)phosphoryl]oxy pentanoate.
  • This invention provides, inter alia, nitrate-dependent or nitrate-regulated gene expression constructs useful for regulating the expression of endogenous and/or heterologous genes in microorganisms.
  • the inventors have discovered that the nitrate-inducible gene expression constructs described herein are ideal for controlling gene expression in engineered microorganisms during the industrial production of one or more bio-products. Gene expression and bio-product production can be readily turned "off ⁇ i.e. one or more genes of interest for the production of one or more bio-products are not expressed or expressed at decreased levels) when engineered microorganisms are cultured as a seed stock in the absence of a nitrate salt.
  • the seed stock can therefore be maintained under conditions suitable for initially establishing a population of microorganisms for large scale production of a bio-product without having to devote metabolic resources to producing that bio-product.
  • gene expression in the engineered microorganism can then be turned "on" to begin large-scale fermentation by addition of a nitrate salt to the culture media.
  • Control of gene expression using these nitrate-regulated gene expression constructs and associated nitrate-dependent promoters may be turned on under aerobic and/or anaerobic growth conditions.
  • Such a system is considerably more cost effective than current methods utilizing relatively expensive chemicals such as IPTG to turn on inducible promoters. /.
  • Nitrate reductase is used herein to describe any one of the respiratory nitrate reductase proteins, including active subunits of two nitrate reductase (NAR) complexes: narA, encoded by the narGHJI operon, and narZ, encoded by the narZYWV operon.
  • NAR protein references available on GenBankTM include narG (AP OO 1852), narZ, narY, narW, and narV incorporated herein by reference.
  • NAR protein references available on GenBankTM include narG (AP OO 1852), narZ, narY, narW, and narV incorporated herein by reference.
  • “Nitrate transporter” is used herein as in the art to describe any one of the nitrate transporter or nitrate/nitrite antiporter proteins including narK and narU.
  • Industrial bio-products can include, but are not limited to, isoprene, isoprenoids, isoprenoid precursors, butadiene and ethanol.
  • Industrial products can also include, but are not limited to, bio-products derived directly or indirectly from 2-keto acids, malonyl-CoA, and acetoacetyl-CoA.
  • Industrial bio-products can also include, but are not limited to, monoterpenes, diterpenes, triterpenes, tetraterpenes, sequiterpene, polyterpene, abietadiene, amorphadiene, carene, a-farnesene, ⁇ -farnesene, farnesol, geraniol, geranylgeraniol, linalool, limonene, myrcene, nerolidol, ocimene, patchoulol, ⁇ -pinene, sabinene, ⁇ -terpinene, terpindene, valencene.
  • Industrial bio-products can further include, but are not limited to, non-fermentative alcohols (e.g. , 1-propanol, 1-butanol, isobutanol, 2-methyl- l-butanol, 3-methyl- l-butanol, 3- methyl- 1-pentanol, 4-methtyl- l-pentanol and 1-hexanol), fatty acid-derived hydrocarbons (fatty alcohols, fatty esters, olefins, and alkanes), and fermentative alcohols (e.g. , butanol).
  • non-fermentative alcohols e.g. , 1-propanol, 1-butanol, isobutanol, 2-methyl- l-butanol, 3-methyl- l-butanol, 3- methyl- 1-pentanol, 4-methtyl- l-pentanol and 1-hexanol
  • fatty acid-derived hydrocarbons fatty
  • Industrial bio-products can also include, but are not limited to, enzyme products such as amylases, cellulases, glucyltransferases ("gtf '), lipases, xylanases, proteases, phytases, etc. or protein products such as aquaporins.
  • enzyme products such as amylases, cellulases, glucyltransferases ("gtf '), lipases, xylanases, proteases, phytases, etc. or protein products such as aquaporins.
  • Isoprene refers to 2-methyl-l,3-butadiene (CAS# 78-79-5). It can refer to the direct and final volatile C5 hydrocarbon product from the elimination of pyrophosphate from 3,3- dimethylallyl pyrophosphate (DMAPP). Isoprene is not limited by the method of its
  • nucleic acid or “polynucleotide” refers to two or more deoxyribonucleotides and/or ribonucleotides in either single or double- stranded form.
  • a "nucleic acid of interest” refers to a polynucleotide encoding a polypeptide that is a part of the synthetic pathway for any industrial product.
  • a “nucleic acid of interest” can refer to a polynucleotide encoding a polypeptide that is the desired product of a bio-process (e.g. , an industrial bio-product).
  • An "endogenous nucleic acid” is a nucleic acid whose nucleic acid sequence is naturally found in the host cell. In some aspects, an endogenous nucleic acid is identical to a wild-type nucleic acid that is found in the host cell in nature. In some aspects, one or more copies of endogenous nucleic acids are introduced into a host cell.
  • a "heterologous nucleic acid” can be a nucleic acid whose nucleic acid sequence is from another species than the host cell or another strain of the same species of the host cell. In some aspects, the sequence is not identical to that of another nucleic acid naturally found in the same host cell.
  • a heterologous nucleic acid is not identical to a wild-type nucleic acid that is found in the same host cell in nature.
  • a heterologous nucleic acid encodes for one or more polypeptide components of a biosynthetic pathway for the production of industrial bio-products.
  • Polypeptides includes polypeptides, proteins, peptides, fragments of polypeptides, fusion polypeptides and variants.
  • an "endogenous polypeptide” is a polypeptide whose amino acid sequence is naturally found in the host cell. In some aspects, an endogenous polypeptide is identical to a wild-type polypeptide that is found in the host cell in nature.
  • heterologous polypeptide is a polypeptide encoded by a heterologous nucleic acid.
  • sequence is not identical to that of another polypeptide encoded by a nucleic acid naturally found in the same host cell.
  • minimal medium refers to growth medium containing the minimum nutrients possible for cell growth, generally without the presence of amino acids.
  • Minimal medium typically contains: (1) a carbon source for bacterial growth; (2) various salts, which can vary among bacterial species and growing conditions; and (3) water.
  • the carbon source can vary significantly, from simple sugars like glucose to more complex hydrolysates of other biomass, such as yeast extract, as discussed in more detail below.
  • the salts generally provide essential elements such as magnesium, nitrogen, phosphorus, and sulfur to allow the cells to synthesize proteins and nucleic acids.
  • Minimal medium can also be supplemented with selective agents, such as antibiotics, to select for the maintenance of certain plasmids and the like.
  • isoprenoid refers to a large and diverse class of naturally- occurring class of organic compounds composed of two or more units of hydrocarbons, with each unit consisting of five carbon atoms arranged in a specific pattern. As used herein, “isoprene” is expressly excluded from the definition of "isoprenoid.”
  • terpenoid refers to a large and diverse class of organic molecules derived from five-carbon isoprenoid units assembled and modified in a variety of ways and classified in groups based on the number of isoprenoid units used in group members. Hemiterpenoids have one isoprenoid unit. Monoterpenoids have two isoprenoid units.
  • Sesquiterpenoids have three isoprenoid units.
  • Diterpenoids have four isoprene units.
  • Sesterterpenoids have five isoprenoid units. Triterpenoids have six isoprenoid units.
  • Tetraterpenoids have eight isoprenoid units. Polyterpenoids have more than eight isoprenoid units.
  • isoprenoid precursor refers to any molecule that is used by organisms in the biosynthesis of terpenoids or isoprenoids.
  • isoprenoid precursor molecules include, e.g., isopentenyl pyrophosphate (IPP) and dimethylallyl diphosphate (DMAPP).
  • mass yield refers to the mass of the product produced by the bacterial cells divided by the mass of the glucose consumed by the bacterial cells multiplied by 100.
  • specific productivity it is meant the mass of the product produced by the bacterial cell divided by the product of the time for production, the cell density, and the volume of the culture.
  • titer it is meant the mass of the product produced by the bacterial cells divided by the volume of the culture.
  • CPI cell productivity index
  • narGHJI operon which encodes nitrate reductase in microorganisms such as E. coli, is controlled by proteins encoded by the genes, far, narL, and narX.
  • the Fnr protein activates transcription of the narGHJI operon and a number of other genes important for anaerobic metabolism.
  • Fnr binds to a highly conserved palindromic DNA sequence (Fnr box) in the promoter region of the narGHJI operon centered at a position approximately 40 bp from the start site of transcription ("-40 bp"; Walker & DeMoss, 1992, J. Bacteriol, 174(4): 1119-23).
  • narL/narX two component regulatory system is a DNA binding protein that, in the presence of nitrate, is phosphorylated by narX, otherwise known as histidine kinase (Walker & DeMoss, 1993, J. Biol. Chem., 268(12):8391-93).
  • the narX-phosphorylated narL protein stimulates anaerobic transcription of the narGHJI promoter through interaction with a ds-acting sequence located approximately 200 bp upstream of the start site of transcription.
  • narG narG promoter
  • the -10 and -35 sequences are poorly conserved analogues of the -10 and -35 consensus sequences recognized by the ⁇ -RNA polymerase of E. coli (Newman & Cole, 1978, J. Gen. Microb., 106: 1-21).
  • Walker and DeMoss (1992, J. Bacteriol., 174(4): 1119-23) discovered that anaerobic expression of narG could be completely abolished by mutation of a single base in the -10 hexamer.
  • TTGGTCGTTATCAA SEQ ID NO:2
  • this modified narG promoter is known as "PnarG*.”
  • the inventors have created (and herein describe) polynucleotides, polypeptides, plasmids, vectors, expression systems, host cells, etc. based on the components of a nitrate-dependent expression control system, as well as methods of making and using these components to facilitate the genetic manipulation of microorganisms to produce one or more bio-products such as (but not limited to) isoprene, butadiene, isoprenoids, and ethanol.
  • bio-products such as (but not limited to) isoprene, butadiene, isoprenoids, and ethanol.
  • nucleic acids as components of the gene expression control system, or encoding components of the nitrate-dependent expression control system described herein, including nucleic acids comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP), nitrate-dependent promoters, one or more genes of interest and other polypeptides and nucleic acids can be used (either individually or in any combination) in the compositions and methods as described herein.
  • nitrate regulatory genes for example, narL, narX, narQ, or narP
  • nitrate-dependent promoters for example, nitrate-dependent promoters, one or more genes of interest and other polypeptides and nucleic acids can be used (either individually or in any combination) in the compositions and methods as described herein.
  • the nucleic acid has one or more mutations compared to the sequence of a wild-type ⁇ i.e., a sequence occurring in nature) nucleic acid comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP), nitrate-dependent promoters, or one or more genes of interest.
  • the nucleic acid has one or more mutations (e.g. , a silent mutation) that increase the transcription or translation of the nucleic acid.
  • the nucleic acid is a degenerate variant of any nucleic acid encoding an polynucleotide comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP), nitrate-dependent promoters, or one or more genes of interest.
  • nitrate regulatory genes for example, narL, narX, narQ, or narP
  • nitrate-dependent promoters for example, narL, narX, narQ, or narP
  • polynucleotide sequences of this invention can include genomic sequences, extra-genomic and plasmid-encoded sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, peptides and the like. Such segments may be naturally isolated, or modified synthetically by the hand of man.
  • Polynucleotides may be single- stranded (coding or antisense) or double-stranded, and may be DNA (genomic, cDNA or synthetic) or RNA molecules. Additional coding or non- coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.
  • Polynucleotides may comprise a native sequence (i.e. , an endogenous sequence) or may comprise a variant, or a biological functional equivalent of such a sequence.
  • Polynucleotide variants may contain one or more substitutions, additions, deletions and/or insertions.
  • the enzymatic activity of the encoded polypeptide is not substantially diminished relative to the unmodified polypeptide.
  • the enzymatic activity of the encoded polypeptide is improved (e.g., optimized) relative to the unmodified polypeptide.
  • the enzymatic activity of the encoded polypeptide is substantially diminished relative to the unmodified polypeptide. The effect on the enzymatic activity of the encoded polypeptide may generally be assessed as described herein.
  • nucleotide sequences possessing non-naturally occurring codons it may be advantageous in some instances to produce polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • Such nucleotides are typically referred to as "codon-optimized.” Any of the nucleotide sequences described herein may be utilized in such a "codon-optimized” form.
  • polynucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter polypeptide encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, expression and/or activity of the gene product.
  • Polynucleotides may comprise a "heterologous nucleic acid,” whose sequence is from another species than the host cell or another strain of the same species of host cell. In some embodiments, the sequence is not identical to that of another nucleic acid naturally found in the same host cell. In some embodiments, a heterologous nucleic acid is not identical to a wild-type nucleic acid that is found in the same host cell in nature.
  • polynucleotides of the present invention regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a polynucleotide fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
  • Polynucleotides and fusions thereof may be prepared, manipulated and/or expressed using any of a variety of well-established techniques known and available in the art.
  • polynucleotide sequences which encode polypeptides of the invention, or fusion proteins or functional equivalents thereof may be used in recombinant DNA molecules to direct expression of a selected enzyme in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences that encode substantially the same or a functionally equivalent amino acid sequence may be produced and these sequences may be used to clone and express a given polypeptide. a.
  • any of the microorganism host cells disclosed herein comprising any of the nitrate-dependent gene expression constructs disclosed herein can further comprise one or more nucleic acids encoding one or more nitrate -regulatory polypeptides.
  • Said one or more nucleic acids encoding one or more nitrate-regulatory polypeptides can be endogenous or heterologous.
  • the nitrate-regulatory polypeptides can be any polypeptide involved in the regulation and metabolism of nitrate in a host cell.
  • Non-limiting examples of nitrate-regulatory polypeptides include narX, narL, narP, and narQ.
  • any of the microorganism host cells disclosed herein are any of the microorganism host cells disclosed herein.
  • nitrate-dependent gene expression constructs disclosed herein further comprises a nucleic acid encoding a narL polypeptide.
  • the polypeptide encoded by the narL gene activates the expression of the nitrate reductase (narGHJI) and formate dehydrogenase-N (fdnGHI) operons and represses the transcription of the fumarate reductase (frdABCD) operon in response to a nitrate/nitrite induction signal transmitted by either the narX or narQ proteins.
  • the narL polypeptide encoded by the nucleic acid has a polypeptide sequence according to UniProt accession number P0AF28.
  • the nucleic acid encoding a narL polypeptide is a heterologous nucleic acid.
  • nucleic acid encoding a narL polypeptide is an additional copy of an endogenous nucleic acid.
  • nucleic acid encoding a narL polypeptide is operably linked to a high copy promoter.
  • the nucleic acid encoding a narL polypeptide is under the control of a constitutive promoter (for example, a constitutive glucose isomerase promoter PI.5).
  • the constitutive promoter is a strong promoter.
  • any of the microorganism host cells disclosed herein are any of the microorganism host cells disclosed herein.
  • nitrate-dependent gene expression constructs disclosed herein further comprises a nucleic acid encoding a narX polypeptide.
  • narX polypeptide encoded by the narX gene acts as a sensor for nitrate/nitrite and transduces signal of nitrate availability to the NarL protein and of both nitrate/nitrite to the narP protein.
  • narX activates narL and narP by phosphorylation in the presence of nitrate.
  • narX also plays a negative role in controlling narL activity, probably through dephosphorylation in the absence of nitrate.
  • the narX polypeptide encoded by the nucleic acid has a polypeptide sequence according to UniProt accession number P0AFA2.
  • the nucleic acid encoding a narX polypeptide is a heterologous nucleic acid. In other embodiments, nucleic acid encoding a narX polypeptide is an additional copy of an endogenous nucleic acid. In further embodiments, the nucleic acid encoding a narX polypeptide is operably linked to a high copy promoter. In another embodiment, the nucleic acid encoding a narX polypeptide is under the control of a constitutive promoter (for example, a constitutive glucose isomerase promoter PI.5). In a further embodiment, the constitutive promoter is a strong promoter.
  • a constitutive promoter for example, a constitutive glucose isomerase promoter PI.5
  • the constitutive promoter is a strong promoter.
  • any of the microorganism host cells disclosed herein are any of the microorganism host cells disclosed herein.
  • nitrate-dependent gene expression constructs disclosed herein further comprises a nucleic acid encoding a narK polypeptide.
  • the narK polypeptide encoded by the narK gene permits nitrate and nitrite transport into the host cell.
  • the narK polypeptide encoded by the nucleic acid has a polypeptide sequence according to UniProt accession number P71995.
  • the nucleic acid encoding a narK polypeptide is a heterologous nucleic acid.
  • nucleic acid encoding a narK polypeptide is an additional copy of an endogenous nucleic acid.
  • the nucleic acid encoding a narK polypeptide is operably linked to a high copy promoter.
  • the nucleic acid encoding a narK polypeptide is under the control of a constitutive promoter (for example, a constitutive glucose isomerase promoter PI.5).
  • a constitutive promoter for example, a constitutive glucose isomerase promoter PI.5
  • the constitutive promoter is a strong promoter.
  • the polypeptide is an isolated polypeptide.
  • an "isolated polypeptide” is not part of a library of polypeptides, such as a library of 2, 5, 10, 20, 50 or more different polypeptides and is separated from at least one component with which it occurs in nature.
  • An isolated polypeptide can be obtained, for example, by expression of a recombinant nucleic acid encoding the polypeptide.
  • the polypeptide is a heterologous polypeptide (such as a polypeptide encoded by a nitrate-regulatory gene, for example, a narX, narL, narP, and/or narQ polypeptide).
  • heterologous polypeptide it is meant a polypeptide whose amino acid sequence is not identical to that of another polypeptide naturally expressed in the same host cell.
  • a heterologous polypeptide is not identical to a wild-type polypeptide that is found in the same host cell in nature.
  • a nucleotide sequence encoding the polypeptide, or a functional equivalent may be inserted into appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • appropriate expression vector i.e., a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding a polypeptide of interest and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook et ah, Molecular Cloning, A Laboratory Manual (1989), and Ausubel et ah, Current Protocols in Molecular Biology (1989).
  • amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers.
  • Polypeptides include the polypeptides involved in the regulatable nitrate-dependent gene expression constructs as described herein, including genes of interests, such as enzymatic polypeptides, or "enzymes,” which typically catalyze (i.e., increase the rate of) various chemical reactions, such as the enzymes of metabolic pathways as described herein or polypeptides comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP).
  • genes of interests such as enzymatic polypeptides, or "enzymes,” which typically catalyze (i.e., increase the rate of) various chemical reactions, such as the enzymes of metabolic pathways as described herein or polypeptides comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP).
  • sequence identity refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison.
  • a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • the identical nucleic acid base e.g., A, T, C
  • references to describe sequence relationships between two or more polynucleotides or polypeptides include “reference sequence”, “comparison window”, “sequence identity”, “percentage of sequence identity” and “substantial identity”.
  • a “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length.
  • two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides
  • sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window” refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • the comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
  • standard sequence alignment and/or structure prediction programs can be used to identify additional genes of interest polypeptides and nucleic acids based on the similarity of their primary and/or predicted polypeptide secondary structure with that of a known gene of interest polypeptide and/or nucleic acid.
  • Standard databases such as the SwissProt- Trembl database (world-wide web at "expasy.org", Swiss Institute of Bioinformatics Swiss-Prot group CMU-1 rue Michel Servet CH-1211 Geneva 4, Switzerland) can also be used to identify polypeptides and nucleic acids of one or more genes of interest.
  • the secondary and/or tertiary structure of a polypeptide and/or nucleic acid of one or more genes of interest can be predicted using the default settings of standard structure prediction programs, such as PredictProtein.
  • standard structure prediction programs such as PredictProtein.
  • the actual secondary and/or tertiary structure of a polypeptide of a gene of interest can be determined using standard methods.
  • nitrate-regulated gene expression systems generally include a vector comprising one or more genes of interest and a narG nitrate-dependent promoter (PnarG) that drives expression of the gene(s) in the present of nitrate.
  • PnarG narG nitrate-dependent promoter
  • Any suitable gene capable of being expressed using a PnarG nitrate-dependent promoter may be included on the plasmid.
  • genes from the upper or lower MVA pathway and/or relating to the biological production of isoprene may be included.
  • the PnarG nitrate-dependent promoter can have a mutation in the -10 region of the narG promoter, a mutation in the -35 region of the narG promoter, or a mutation in both regions of the narG promoter. In other embodiments, additional promoter mutations to the narG promoter may also be provided.
  • the plasmid (pDMWP170) and exemplary PnarG nitrate-dependent promoter mutations are shown in Figure 1, and described in Examples 1 and 4.
  • any of the vectors disclosed herein contains a nitrate-dependent promoter (such as a PnarG nitrate-dependent promoter or a PnarG mutant promoter) operably linked to a nucleic acid encoding one or more genes of interest.
  • a nitrate-dependent promoter such as a PnarG nitrate-dependent promoter or a PnarG mutant promoter
  • operably linked refers to one or more genes that have been placed under the regulatory control of a promoter, which then controls the transcription and optionally the translation of those genes.
  • the gene from which the genetic sequence or promoter is derived As is known in the art, some variation in this distance can be accommodated without loss of function.
  • the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the gene from which it is derived.
  • the promoter has one or more mutations compared to the sequence of a wild-type ⁇ i.e., a sequence occurring in nature) promoter, for example, PnarG mutant promoters such as PnarG* or PnarG#.
  • the promoter has a mutation that allows gene expression under certain conditions, e.g., under aerobic conditions.
  • a "vector” means a construct that is capable of delivering, and desirably expressing, one or more nucleic acids of interest in a host cell.
  • vectors include, but are not limited to, plasmids, viral vectors, DNA or RNA expression vectors, cosmids, and phage vectors.
  • the vector contains a nucleic acid under the control of a PnarG nitrate-dependent promoter.
  • the PnarG nitrate-dependent promoter is PnarG*.
  • the PnarG nitrate-dependent promoter is PnarG#.
  • one or more nitrate regulation genes can be included in one or more vectors. Accordingly, also described herein are vectors with one more nucleic acids encoding any nitrate regulation polypeptides described herein.
  • the vector contains a nucleic acid under the control of an expression control sequence.
  • an "expression control sequence” means a nucleic acid sequence that directs transcription of a nucleic acid of interest.
  • An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer.
  • An "inducible promoter” is a promoter that is active under environmental or developmental regulation, such as a nitrate-inducible promoter.
  • the expression control sequence is operably linked to the nucleic acid segment to be transcribed.
  • the expression control sequence is a native expression control sequence. In some embodiments, the expression control sequence is a non-native expression control sequence. In some embodiments, the vector contains a selective marker or selectable marker.
  • Suitable vectors are those which are compatible with the host cell employed. Suitable vectors can be derived, for example, from a bacterium, a virus (such as bacteriophage T7 or an
  • M-13 derived phage M-13 derived phage
  • a cosmid a yeast
  • a plant a plant.
  • Suitable vectors can be maintained in low, medium, or high copy number in the host cell. Protocols for obtaining and using such vectors are known to those in the art (see, for example, Sambrook et ah, Molecular Cloning: A Laboratory
  • the vector contains a selective marker.
  • selective marker refers to a nucleic acid capable of expression in a host cell that allows for ease of selection of those host cells containing an introduced nucleic acid or vector.
  • selectable markers include, but are not limited to, antibiotic resistance nucleic acids (e.g., erythromycin, chloramphenicol, thiamphenicol, kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, streptomycin, phleomycin, bleomycin, spectinomycin, or neomycin,) and/or nucleic acids that confer a metabolic advantage, such as a nutritional advantage on the host cell.
  • antibiotic resistance nucleic acids e.g., erythromycin, chloramphenicol, thiamphenicol, kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, streptomycin, phleomycin, bleomycin, spectinomycin, or
  • any of the nucleic acids encoding a gene of interest may be operably linked to a PnarG nitrate-dependent promoter.
  • the promoter used as part of any of the gene expression constructs disclosed herein described herein may also be a nitrate-dependent inducible promoter, such as any of those described in Walker et al., "Role of Alternative Promoter Elements in Transcription from the Nar Promoter of
  • the PnarG nitrate-dependent promoter is a PnarG mutant promoter.
  • the PnarG mutant promoter is the PnarG* promoter.
  • the PnarG* mutant promoter contains a mutation at the -10 bp region of the narG gene comprising the nucleotide sequence TATAAT and a mutation in the Fnr binding site to create the sequence
  • the PnarG* mutant promoter comprises the nucleotide sequence
  • the PnarG mutant promoter is the PnarG# promoter.
  • This promoter carries an additional mutation at the -35 bp region of the narG gene.
  • the -35 region of the PnarG# promoter comprises the nucleotide sequence TTGCCA.
  • the -35 region of the PnarG# promoter comprises the nucleotide sequence TTCACA.
  • the PnarG# mutant promoter comprises the nucleotide sequence
  • the PnarG# mutant promoter comprises the nucleotide sequence
  • the PnarG# promoter can be used to induce expression of a gene of interest by nitrate under aerobic and/or anaerobic conditions.
  • the PnarG# promoter is capable of expressing a gene of interest in response to nitrate at levels at least about any of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 160%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 425%, 450%, 475%, 500%, 525%, 550%, 575%, 600%, 625%, 650%, 675%, 700%, 725%, 750%, 775%,
  • the promoter used in any of the vectors described herein may be a constitutive promoter or a strong promoter to express one or more nitrate regulation genes (such as, but not limited to, narL, narX, narQ or narP).
  • Constitutive promoters do not require induction by artificial means (such as IPTG for the induction of the lac operon) and hence can result in considerable cost reduction for large scale fermentations.
  • Constitutive promoters that function in anaerobes, aerobic microorganisms, or both anaerobic and aerobic microorganisms may be used. Any one of the promoters characterized or used in the Examples of the present disclosure may be used in accordance with the methods disclosed herein.
  • promoters known in the art that functions in a host cell can be used for expression of a target gene of interest in the host cell.
  • Initiation control regions or promoters, which are useful to drive expression of polypeptides in various host cells are numerous and familiar to those skilled in the art (see, for example, WO 2004/033646 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect to vectors for the expression of nucleic acids of interest).
  • Virtually any promoter capable of driving these nucleic acids is suitable for the present invention including, but not limited to, lac, trp, T7, tac, and trc, (useful for expression in E. coli).
  • under-express e.g. , mutate, inactivate, or delete
  • Suitable methods for over- or under- expressing nucleic acids compatible with cells and methods described herein are described in International Publication No. WO 2009/076676 A2 and U.S. Patent Application No. 12/335,071, the disclosures of which are incorporated by reference herein in their entireties.
  • a nucleic acid encoding a nitrate-dependent gene expression construct comprising a nitrate-dependent promoter and/or one or more genes of interest is contained in a low copy plasmid (e.g. , a plasmid that is maintained at about 1 to about 4 copies per cell), medium copy plasmid (e.g. , a plasmid that is maintained at about 10 to about 15 copies per cell), or high copy plasmid (e.g. , a plasmid that is maintained at about 50 or more copies per cell).
  • a low copy plasmid e.g. , a plasmid that is maintained at about 1 to about 4 copies per cell
  • medium copy plasmid e.g. , a plasmid that is maintained at about 10 to about 15 copies per cell
  • high copy plasmid e.g. , a plasmid that is maintained at about 50 or more copies per cell.
  • the vector is a replicating plasmid that does not integrate into a chromosome in the cells. In some embodiments, part of or the entire vector integrates into a chromosome in the cells. Additional examples of suitable expression and/or integration vectors are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 nd ed., Cold Spring Harbor, 1989, and Current Protocols in Molecular Biology (F. M. Ausubel et al. (eds) 1987, Supplement 30, section 7.7.18) which are both hereby incorporated by reference in their entirety, particularly with respect to vectors. Particularly useful vectors include pFB6, pBR322, PUC18, pUClOO, and pENTR/D. 4. Other Elements
  • the expression vector also includes a termination sequence. Termination control regions may also be derived from various genes native to the host cell. In some embodiments, the termination sequence and the promoter sequence are derived from the same source. In another embodiment, the termination sequence is endogenous to the host cell. Optionally, a termination site may be included.
  • DNA encoding the polypeptide are linked operably through initiation codons to selected expression control regions such that expression results in the formation of the appropriate messenger RNA.
  • origins of replication can be used.
  • One, two or more origins of replication can be used.
  • the origins of replication can be from different organisms and/or gram positive or gram negative organisms. Exemplary uses of origins of replication to practice the invention are further described in the Examples.
  • expression vectors are designed to contain certain components which optimize gene expression for certain host cell strains. Such optimization components include, but are not limited to origin of replication, promoters, and enhancers.
  • optimization components include, but are not limited to origin of replication, promoters, and enhancers.
  • the vectors and components referenced herein are described for exemplary purposes and are not meant to narrow the scope of the invention.
  • microorganism host cell or progeny thereof that can be used to heterologously express nucleic acids can be used with the methods and compositions to express any of the nitrate-dependent gene expression constructs disclosed herein.
  • the terms "microorganism” or "host cell” are interchangeable.
  • Exemplary host cells include, for example, yeasts, such as species of Saccharomyces (e.g., S. cerevisiae), bacteria, such as species of Escherichia (e.g., E.
  • coli coli
  • archaea such as species of Methanosarcina (e.g., Methanosarcina mazei)
  • plants such as kudzu or poplar (e.g., Populus alba or Populus alba x tremula
  • Bacteria cells including gram positive or gram negative bacteria can be used to express any of the nucleic acids or polypeptides described above.
  • the host cell is a gram-positive bacterium.
  • Non-limiting examples include strains of Streptomyces (e.g., S. lividans, S. coelicolor, S. rubiginosus, or S. griseus), Streptococcus, Bacillus (e.g., B. lichenjormis or B. subtilis or B. coagulans), Listeria (e.g., L. monocytogenes), Corynebacteria, or Lactobacillus (e.g., L. spp).
  • Streptomyces e.g., S. lividans, S. coelicolor, S. rubiginosus, or S. griseus
  • Streptococcus e.g., Bacillus (e.g., B. lichenjormis or B. subtilis
  • the host organism is a gram-negative bacterium.
  • Non-limiting examples include strains of Escherichia (e.g., E. coli), Pseudomonas (e.g., P. alcaligenes), Pantoea (e.g., P. citrea), Enterobacter, or Helicobacter (e.g., H. pylori).
  • Other host cells for use in the methods and gene expression-control systems disclosed above include in any one of P. citrea, B. subtilis, B. licheniformis, B. lentus, B. brevis, B.
  • B. alkalophilus B. amyloliquefaciens, B. clausii, B. halodurans, B.
  • anaerobic cells there are numerous types of anaerobic cells that can be used as host cells in the compositions and methods of the present invention.
  • the cells described in any of the compositions or methods described herein are obligate anaerobic cells and progeny thereof. Obligate anaerobes typically do not grow well, if at all, in conditions where oxygen is present. It is to be understood that a small amount of oxygen may be present, that is, there is some tolerance level that obligate anaerobes have for a low level of oxygen.
  • obligate anaerobes engineered to produce isoprene can serve as host cells for any of the methods and/or compositions described herein and are grown under substantially oxygen- free conditions, wherein the amount of oxygen present is not harmful to the growth,
  • the host cells described and/or used in any of the compositions or methods described herein are facultative anaerobic cells and progeny thereof. Facultative anaerobes can generate cellular ATP by aerobic respiration (e.g., utilization of the TCA cycle) if oxygen is present. However, facultative anaerobes can also grow in the absence of oxygen. This is in contrast to obligate anaerobes which die or grow poorly in the presence of greater amounts of oxygen. In one aspect, therefore, facultative anaerobes can serve as host cells for any of the compositions and/or methods provided herein and can be engineered to produce isoprene.
  • Facultative anaerobic host cells can be grown under substantially oxygen-free conditions, wherein the amount of oxygen present is not harmful to the growth, maintenance, and/or fermentation of the anaerobes, or can be alternatively grown in the presence of greater amounts of oxygen.
  • the host cells are cultured under aerobic conditions.
  • the host cell can additionally be a filamentous fungal cell and progeny thereof.
  • the filamentous fungal cell can be any of Trichoderma longibrachiatum, T. viride, T. koningii, T. harzianum, Penicillium sp., Humicola insolens, H. lanuginose, H. grisea, Chrysosporium sp., C. lucknowense, Gliocladium sp., Aspergillus sp., such as A. oryzae, A. niger, A sojae, A. japonicus, A. nidulans, or A. awamori, Fusarium sp., such as / ⁇ ' . roseum, F. graminum F. cerealis, F.
  • the fungus is A. nidulans, A.
  • plasmids or plasmid components for use herein include those described in U.S. Patent Pub. No. US 2011/0045563.
  • the host cell can also be a yeast, such as Saccharomyces sp., Schizosaccharomyces sp., Pichia sp., or Candida sp.
  • Saccharomyces sp. is Saccharomyces cerevisiae (See, e.g., Romanos et al., Yeast, 8(6):423-488 (1992)).
  • plasmids or plasmid components for use herein include those described in U.S. pat. No, 7,659,097 and U.S. Patent Pub. No. US 2011/0045563.
  • the host cell can also be a species of plant, such as a plant from the family Fabaceae, such as the Faboideae subfamily.
  • the host cell is kudzu, poplar (such as Populus alba x tremula CAC35696), aspen (such as Populus tremuloides), or Quercus robur.
  • the host cell can additionally be a species of algae, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates. (See, e.g., Saunders
  • plasmids or plasmid components for use herein include those described in U.S. Patent Pub. No. US 2011/0045563.
  • the host cell is a cyanobacterium, such as cyanobacterium classified into any of the following groups based on morphology: Chlorococcales, Pleurocapsales, Oscillatoriales, Nostocales, or Stigonematales (See, e.g., Lindberg et al., Metab. Eng., 12(l):70-79 (2010)).
  • plasmids or plasmid components for use herein include those described in U.S. Patent Pub. No.: US 2010/0297749; US 2009/0282545 and PCT Pat. Appl. No. WO
  • E. coli host cells can be used in any of the methods or systems for regulating the expression of a gene of interest disclosed herein.
  • the host cell is a recombinant cell of an Escherichia coli (E. coli) strain, or progeny thereof, capable of producing one or more bio- products.
  • the host cell can be a species of yeast other than S. cerevisiae such as, but not limited to, a Pichia spp., a Candida spp., a Hansenula spp., a Kluyveromyces spp., a Kluyveromyces spp., or a Schizosacchawmyces spp.
  • the host cell can be a species of bacterium including, but not limited to, an Arthrobacter spp., a Zymomonas spp., a Brevibacterium spp., a Clostridium spp., an Aerococcus spp., a Bacillus spp., an Actinobacillus spp. (such as, but not limited to, A. succinogens), a Carbobacterium spp., a Corynebacterium spp., an Enterococcus spp., an Erysipelothrix spp., a Gemella spp., a Geobacillus spp., a species of bacterium including, but not limited to, an Arthrobacter spp., a Zymomonas spp., a Brevibacterium spp., a Clostridium spp., an Aerococcus spp., a Bac
  • Globicatella spp. a Lactobacillus spp. (such as, but not limited to, L. lactis and L. rhammosus), a Lactococcus spp., a Leuconostoc spp., a Pediococcus spp., a Streptococcus spp., a
  • the fermenting organism can be a fungus such as, but not limited to, a Rhizopus spp.
  • the host cell can be a lactic acid bacterium, such as those of the genera Aerococcus, Bacillus, Carbobacterium, Enterococcus, Erysipelothrix, Gemella, Globicatella, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Tetragenococcus or Vagococcus.
  • lactic acid bacterium such as those of the genera Aerococcus, Bacillus, Carbobacterium, Enterococcus, Erysipelothrix, Gemella, Globicatella, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Tetragenococcus or Vagococcus.
  • other bacteria of the genus Lactobacillus which may be substituted include, but are not limited to, L. heiveticus, L. delbrueckii, L. casei
  • any of the host cells for use in the compositions and methods disclosed herein can be engineered to include mutations in one or more endogenous genes encoding the nitrate reductase enzyme complex.
  • Nitrate reductases are enzymes that reduce nitrate (NO —3 ) to nitrite (NO—2 ).
  • Prokaryotic nitrate reductases belong to the DMSO reductase family of molybdoenzymes and have been classified into three groups, assimilatory nitrate reductases (Nas), respiratory nitrate reductase (nar), and periplasmic nitrate reductases (nap).
  • nitrate reductases are encoded by the nitrate reductase (narGHJI) operon.
  • Endogenous nitrate reductase genes can include, without limitation, narG, napA, and/or narZ.
  • the mutations to any of the nitrate reductase genes disclosed herein are loss-of-function mutations.
  • the mutations to any of the nitrate reductase genes disclosed herein result in downregulation of nitrate reductase gene expression, though not complete loss of nitrate reductase protein expression.
  • downregulation of gene expression is caused by decreased mRNA or protein expression at the level of transcription or translation, respectively.
  • downregulation of gene expression is accomplished by RNAi or antisense oligonucleotides.
  • downregulation of gene expression is caused by replacement of the gene's endogenous promoter with a weak promoter.
  • the microorganism host cell contains one, two, or three or more mutations in endogenous genes encoding components of a nitrate reductase enzyme.
  • mutation of one or more genes encoding a nitrate reductase enzyme polypeptide results in any of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate reductase enzyme polypeptide.
  • mutation of one or more genes encoding a nitrate reductase enzyme polypeptide results in any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate reductase enzyme polypeptide.
  • any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narG polypeptide, which is the alpha subunit of the nitrate reductase enzyme.
  • the mutation is a loss of function mutation.
  • mutation of the gene encoding the narG polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narG polypeptide.
  • mutation of the gene encoding the narG polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narG polypeptide.
  • any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the napA polypeptide.
  • the mutation is a loss of function mutation.
  • mutation of the gene encoding the napA polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the napA polypeptide.
  • mutation of the gene encoding the napA polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the napA polypeptide.
  • any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narZ polypeptide, which is a nitrate reductase enzyme which can use nitrate as an electron acceptor during anaerobic growth.
  • the mutation is a loss of function mutation.
  • mutation of the gene encoding the narZ polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narZ polypeptide.
  • mutation of the gene encoding the narZ polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narZ polypeptide.
  • any of the host cells for use in the compositions and methods disclosed herein can be engineered to include mutations in one or more endogenous genes encoding nitrate transporter proteins.
  • Nitrate transporter proteins are proteins capable of transporting nitrate and/or nitrite out of a microorganism host cell.
  • Endogenous nitrate transporter genes can include, without limitation, narK and/or narU.
  • the mutations to any of the nitrate transporter genes disclosed herein are loss-of-function mutations.
  • the microorganism host cell contains one, two, or three or more mutations in endogenous genes encoding nitrate transporter polypeptides.
  • the mutations to any of the nitrate transporter genes disclosed herein result in downregulation of nitrate transporter gene expression, though not complete loss of nitrate transporter protein expression.
  • downregulation of gene expression is caused by decreased mRNA or protein expression at the level of transcription or translation, respectively.
  • downregulation of gene expression is accomplished by RNAi or antisense oligonucleotides.
  • downregulation of gene expression is caused by replacement of the gene's endogenous promoter with a weak promoter.
  • mutation of one or more genes encoding a nitrate transporter polypeptide results in any of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate transporter polypeptide.
  • mutation of one or more genes encoding a nitrate transporter polypeptide results in any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate transporter polypeptide.
  • the cell further comprises a mutation in the gene encoding a nitrate reductase (Nap) polypeptide (such as any of the nitrate reductase genes disclosed herein).
  • any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narK polypeptide, which catalyzes nitrate uptake, nitrite uptake and nitrite export across the cytoplasmic membrane.
  • the mutation is a loss of function mutation.
  • mutation of the gene encoding the narK polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narK polypeptide.
  • mutation of the gene encoding the narK polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narK polypeptide.
  • any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narU polypeptide, which catalyzes nitrate uptake, nitrite uptake and nitrite export across the cytoplasmic membrane.
  • the mutation is a loss of function mutation.
  • mutation of the gene encoding the narU polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narU polypeptide.
  • mutation of the gene encoding the narU polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narU polypeptide.
  • the host cells disclosed and compositions thereof can be engineered to produce industrial bio-product using the methods for regulating the expression of a gene of interest disclosed herein in a fermentation system.
  • the system is substantially free of oxygen.
  • the system is an oxygen-containing system.
  • the fermentation system contains a carbohydrate as the energy and/or carbon source.
  • the fermentation system contains carbohydrate and hydrogen as an energy and/or carbon source.
  • concentration of a nitrate salt present in the culture media that binds to a nitrate-dependent promoter operably linked to the gene of interest to induce gene expression.
  • the nitrate salt is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 g/L, 0.0004 g/L, 0.0006 g/L, 0.0008 g/L, 0.001 g/L, 0.0015 g/L, 0.002 g/L, 0.0025 g/L, 0.003 g/L, 0.0035 g/L, 0.004 g/L, 0.0045 g/L, 0.005 g/L, 0.006 g/L, 0.007 g/L, 0.008 g/L, 0.009 g/L, 0.01 g/L, 0.015 g/L, 0.02 g/L, 0.025 g/L, 0.03 g/L, 0.035 g/L, 0.04 g/L, 0.045 g/L, 0.05 g/L, 0.055 g/L, 0.06 g/L, 0.065 g/L, 0.
  • the nitrate salt is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 to 0.001 g/L, from about 0.00015 to 0.001 g/L, from about 0.0015 to about 0.01 g/L, from about 0.015 to about 0.1 g/L, from about 0.05 to about 0.15 g/L, from about 0.1 to about 0.3 g/L, from about 0.15 to about 0.5 g/L, from about 0.25 to about 0.75 g/L, from about 0.5 to about 1.25 g/L, from about 1.75 to about 3 g/L, from about 1.5 to about 5 g/L, from about 3 to about 7 g/L, from about 4 to about 8 g/L, from about 5 to about 9 g/L, or from about 6 to about 10 g/L.
  • the nitrate salt is not present or is present at concentrations of less than 0.0002 g/L when the microorganism host cells
  • nitrate salt compatible with the culture of microorganism host cells may be employed in the compositions and methods of the present invention.
  • appropriate nitrate salts for use according to the methods herein include, without limitation, ammonium nitrate, potassium nitrate, calcium nitrate, sodium nitrate, or magnesium nitrate.
  • the nitrate salt is potassium nitrate and is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 g/L, 0.0004 g/L, 0.0006 g/L, 0.0008 g/L, 0.001 g/L, 0.0015 g/L, 0.002 g/L, 0.0025 g/L, 0.003 g/L, 0.0035 g/L, 0.004 g/L, 0.0045 g/L, 0.005 g/L, 0.006 g/L, 0.007 g/L, 0.008 g/L, 0.009 g/L, 0.01 g/L, 0.015 g/L, 0.02 g/L, 0.025 g/L, 0.03 g/L, 0.035 g/L, 0.04 g/L, 0.045 g/L, 0.05 g/L, 0.055 g/L, 0.06 g/L,
  • the potassium nitrate is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 to 0.001 g/L, from about 0.00015 to 0.001 g/L, from about 0.0015 to about 0.01 g/L, from about 0.015 to about 0.1 g/L, from about 0.05 to about 0.15 g/L, from about 0.1 to about 0.3 g/L, from about 0.15 to about 0.5 g/L, from about 0.25 to about 0.75 g/L, from about 0.5 to about 1.25 g/L, from about 1.75 to about 3 g/L, from about 1.5 to about 5 g/L, from about 3 to about 7 g/L, from about 4 to about 8 g/L, from about 5 to about 9 g/L, or from about 6 to about 10 g/L.
  • the potassium nitrate is not present or is present at concentrations of less than 0.0002 g/L when the microorganism host cells
  • feedstock can be used for culturing the recombinant microbial cells described herein.
  • the feedstock can be a carbon source or syngas. Information regarding carbon sources available for use in exemplary feedstocks is provided below.
  • Any carbon source can be used to cultivate the host cells.
  • the term "carbon source” refers to one or more carbon-containing compounds capable of being metabolized by recombinant microbial cells described herein.
  • the cell medium used to cultivate the recombinant microbial cells described herein may include any carbon source suitable for maintaining the viability or growing the cells.
  • the carbon source is a carbohydrate (such as monosaccharide, disaccharide, oligosaccharide, or polysaccharide), invert sugar (e.g. , enzymatically treated sucrose syrup), glycerol, glycerine (e.g. , a glycerine byproduct of a biodiesel or soap-making process), dihydroxyacetone, one-carbon source, oil (e.g. , a plant or vegetable oil such as corn, palm, or soybean oil), animal fat, animal oil, fatty acid (e.g.
  • carbohydrate such as monosaccharide, disaccharide, oligosaccharide, or polysaccharide
  • invert sugar e.g. , enzymatically treated sucrose syrup
  • glycerol e.g. , a glycerine byproduct of a biodiesel or soap-making process
  • dihydroxyacetone e.g. a glycerine byproduct
  • the carbon source is a product of photosynthesis, including, but not limited to, glucose.
  • Exemplary monosaccharides include glucose and fructose; exemplary oligosaccharides include lactose and sucrose, and exemplary polysaccharides include starch and cellulose.
  • Exemplary carbohydrates include C6 sugars (e.g. , fructose, mannose, galactose, or glucose) and C5 sugars (e.g. , xylose or arabinose).
  • the cell medium includes a carbohydrate as well as a carbon source other than a carbohydrate (e.g. , glycerol, glycerine, dihydroxyacetone, one-carbon source, oil, animal fat, animal oil, fatty acid, lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, renewable carbon source, or a component from a yeast extract).
  • a carbon source other than a carbohydrate e.g. , glycerol, glycerine, dihydroxyacetone, one-carbon source, oil, animal fat, animal oil, fatty acid, lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, renewable carbon source
  • the cell medium includes a carbohydrate as well as a polypeptide (e.g. , a microbial or plant protein or peptide).
  • a polypeptide e.g. , a microbial or plant protein or peptide.
  • the microbial polypeptide is a polypeptide from yeast or bacteria.
  • the plant polypeptide is a polypeptide from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
  • the cells are cultured under limited glucose conditions.
  • limited glucose conditions it is meant that the amount of glucose that is added is less than or about 105% (such as about 100%) of the amount of glucose that is consumed by the cells.
  • the amount of glucose that is added to the culture medium is approximately the same as the amount of glucose that is consumed by the cells during a specific period of time.
  • the rate of cell growth is controlled by limiting the amount of added glucose such that the cells grow at the rate that can be supported by the amount of glucose in the cell medium.
  • glucose does not accumulate during the time the cells are cultured.
  • the cells are cultured under limited glucose conditions for greater than or about 1, 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, or 70 hours. In various embodiments, the cells are cultured under limited glucose conditions for greater than or about 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 95, or 100% of the total length of time the cells are cultured. While not intending to be bound by any particular theory, it is believed that limited glucose conditions may allow more favorable regulation of the cells.
  • the cells are cultured in the presence of an excess of glucose.
  • the amount of glucose that is added is greater than about 105% (such as about or greater than 110, 120, 150, 175, 200, 250, 300, 400, or 500%) or more of the amount of glucose that is consumed by the cells during a specific period of time.
  • glucose accumulates during the time the cells are cultured.
  • Exemplary lipids are any substance containing one or more fatty acids that are C4 and above or fatty acids that are saturated, unsaturated, or branched.
  • oils are lipids that are liquid at room temperature.
  • the lipid contains one or more C4 or above fatty acids (e.g. , contains one or more saturated, unsaturated, or branched fatty acid with four or more carbons).
  • the oil is obtained from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, linseed, oleagineous microbial cells, Chinese tallow, or any combination of two or more of the foregoing.
  • Exemplary fatty acids include compounds of the formula RCOOH, where "R” is a hydrocarbon.
  • Exemplary unsaturated fatty acids include compounds where "R” includes at least one carbon-carbon double bond.
  • Exemplary unsaturated fatty acids include, but are not limited to, oleic acid, vaccenic acid, linoleic acid, palmitelaidic acid, and arachidonic acid.
  • Exemplary polyunsaturated fatty acids include compounds where "R” includes a plurality of carbon-carbon double bonds.
  • Exemplary saturated fatty acids include compounds where "R" is a saturated aliphatic group.
  • the carbon source includes one or more C 12 -C22 fatty acids, such as a C 12 saturated fatty acid, a C 14 saturated fatty acid, a C 16 saturated fatty acid, a Cn saturated fatty acid, a C 2 o saturated fatty acid, or a C 22 saturated fatty acid.
  • the fatty acid is palmitic acid.
  • the carbon source is a salt of a fatty acid (e.g. , an unsaturated fatty acid), a derivative of a fatty acid (e.g., an unsaturated fatty acid), or a salt of a derivative of fatty acid (e.g., an unsaturated fatty acid).
  • Suitable salts include, but are not limited to, lithium salts, potassium salts, sodium salts, and the like.
  • Di- and triglycerols are fatty acid esters of glycerol.
  • the concentration of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is at least or about 1 gram per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, 400, or more g/L.
  • the concentration of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 10 and about 400 g/L, such as between about 25 and about 300 g/L, between about 60 and about 180 g/L, or between about 75 and about 150 g/L. In some embodiments, the concentration includes the total amount of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride that is added before and/or during the culturing of the host cells.
  • the carbon source includes both (i) a lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride and (ii) a carbohydrate, such as glucose. In some embodiments, the ratio of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or
  • triglyceride to the carbohydrate is about 1 : 1 on a carbon basis (i.e. , one carbon in the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride per carbohydrate carbon).
  • the amount of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 60 and 180 g/L, and the amount of the carbohydrate is between about 120 and 360 g/L.
  • Exemplary microbial polypeptide carbon sources include one or more polypeptides from yeast or bacteria.
  • Exemplary plant polypeptide carbon sources include one or more polypeptides from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
  • Exemplary renewable carbon sources include cheese whey permeate, cornsteep liquor, sugar beet molasses, barley malt, and components from any of the foregoing.
  • Exemplary renewable carbon sources also include glucose, hexose, pentose and xylose present in biomass, such as corn, switchgrass, sugar cane, cell waste of fermentation processes, and protein by- product from the milling of soy, corn, or wheat.
  • the biomass carbon source is a lignocellulosic, hemicellulosic, or cellulosic material such as, but are not limited to, a grass, wheat, wheat straw, bagasse, sugar cane bagasse, soft wood pulp, corn, corn cob or husk, corn kernel, fiber from corn kernels, corn stover, switch grass, rice hull product, or a by-product from wet or dry milling of grains (e.g., corn, sorghum, rye, triticate, barley, wheat, and/or distillers grains).
  • Exemplary cellulosic materials include wood, paper and pulp waste, herbaceous plants, and fruit pulp.
  • the carbon source includes any plant part, such as stems, grains, roots, or tubers. In some embodiments, all or part of any of the following plants are used as a carbon source: corn, wheat, rye, sorghum, triticate, rice, millet, barley, cassava, legumes, such as beans and peas, potatoes, sweet potatoes, bananas, sugarcane, and/or tapioca. In some embodiments, the carbon source is a biomass hydrolysate, such as a biomass hydrolysate that includes both xylose and glucose or that includes both sucrose and glucose.
  • the renewable carbon source (such as biomass) is pretreated before it is added to the cell culture medium.
  • the pretreatment includes enzymatic pretreatment, chemical pretreatment, or a combination of both enzymatic and chemical pretreatment (see, for example, Farzaneh et al, Bioresource Technology 96 (18): 2014-2018, 2005; U.S. Patent No. 6,176,176; U.S. Patent No. 6,106,888; which are each hereby incorporated by reference in their entireties, particularly with respect to the pretreatment of renewable carbon sources).
  • the renewable carbon source is partially or completely hydrolyzed before it is added to the cell culture medium.
  • the renewable carbon source (such as corn stover) undergoes ammonia fiber expansion (AFEX) pretreatment before it is added to the cell culture medium (see, for example, Farzaneh et ah, Bioresource Technology 96 (18): 2014-2018, 2005).
  • AFEX ammonia fiber expansion
  • a renewable carbon source is treated with liquid anhydrous ammonia at moderate temperatures (such as about 60 to about 100 °C) and high pressure (such as about 250 to about 300 psi) for about 5 minutes. Then, the pressure is rapidly released.
  • AFEX pretreatment has the advantage that nearly all of the ammonia can be recovered and reused, while the remaining serves as nitrogen source for microbes in downstream processes. Also, a wash stream is not required for AFEX pretreatment. Thus, dry matter recovery following the AFEX treatment is essentially 100%.
  • AFEX is basically a dry to dry process.
  • the treated renewable carbon source is stable for long periods and can be fed at very high solid loadings in enzymatic hydrolysis or fermentation processes.
  • Cellulose and hemicellulose are well preserved in the AFEX process, with little or no degradation.
  • Enzymatic hydrolysis of AFEX-treated carbon sources produces clean sugar streams for subsequent fermentation use.
  • the concentration of the carbon source (e.g. , a renewable carbon source) is equivalent to at least or about 0.1, 0.5, 1, 1.5 2, 3, 4, 5, 10, 15, 20, 30, 40, or 50% glucose (w/v).
  • the equivalent amount of glucose can be determined by using standard HPLC methods with glucose as a reference to measure the amount of glucose generated from the carbon source.
  • the concentration of the carbon source (e.g. , a renewable carbon source) is equivalent to between about 0.1 and about 20% glucose, such as between about 0.1 and about 10% glucose, between about 0.5 and about 10% glucose, between about 1 and about 10% glucose, between about 1 and about 5% glucose, or between about 1 and about 2% glucose.
  • the carbon source includes yeast extract or one or more components of yeast extract.
  • the concentration of yeast extract is at least 1 gram of yeast extract per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, or more g/L.
  • the concentration of yeast extract is between about 1 and about 300 g/L, such as between about 1 and about 200 g/L, between about 5 and about 200 g/L, between about 5 and about 100 g/L, or between about 5 and about 60 g/L.
  • the concentration includes the total amount of yeast extract that is added before and/or during the culturing of the host cells.
  • the carbon source includes both yeast extract (or one or more components thereof) and another carbon source, such as glucose.
  • the ratio of yeast extract to the other carbon source is about 1 :5, about 1 : 10, or about 1 :20 (w/w).
  • the carbon source may also be one-carbon substrates such as carbon dioxide, or methanol.
  • Glycerol production from single carbon sources e.g. , methanol, formaldehyde, or formate
  • methylotrophic yeasts Yamada et al. , Agric. Biol. Chem., 53(2) 541-543, 1989, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources
  • bacteria Hunter et. al. , Biochemistry, 24, 4148-4155, 1985, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources.
  • the pathway of carbon assimilation can be through ribulose monophosphate, through serine, or through xylulose- momophosphate (Gottschalk, Bacterial Metabolism, Second Edition, Springer- Verlag: New York, 1986, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources).
  • the ribulose monophosphate pathway involves the condensation of formate with ribulose- 5 -phosphate to form a six carbon sugar that becomes fructose and eventually the three carbon product glyceraldehyde-3-phosphate.
  • the serine pathway assimilates the one-carbon compound into the glycolytic pathway via methylenetetrahydrofolate.
  • Syngas (also referred to as synthesis gas) can be used as a source of energy and/or carbon for any of the recombinant host cells described herein.
  • Syngas can include CO and H 2 .
  • the syngas comprises CO, C0 2 , and H 2 .
  • the syngas further comprises H 2 0 and/or N 2 .
  • the syngas may comprise CO, H 2 , and H 2 0 (e.g., CO, H 2 , H 2 0 and N 2 ).
  • the syngas may comprise CO, H 2 , and N 2 .
  • the syngas may comprise CO, C0 2 , H 2 , and H 2 0 (e.g., CO, C0 2 , H 2 , H 2 0 and N 2 ).
  • the syngas may comprise CO, C0 2 , H 2 , and N 2 .
  • the CO and/or C0 2 in the syngas may be used as carbon source for cells.
  • the molar ratio of hydrogen to carbon monoxide in the syngas is about any of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 3.0, 4.0, 5.0, or 10.0.
  • the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume carbon monoxide.
  • the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume hydrogen.
  • the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume carbon dioxide. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume water. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume nitrogen. [0148]
  • the syngas of the present invention may be derived from natural or synthetic sources. In some aspects, the syngas is derived from biomass (e.g. , wood, switch grass, agriculture waste, municipal waste) or carbohydrates (e.g. , sugars).
  • the syngas is derived from coal, petroleum, kerogen, tar sands, oil shale, natural gas, or a mixture thereof.
  • the syngas is derived from rubber, such as from rubber tires.
  • the syngas is derived from a mixture (e.g. , blend) of biomass and coal.
  • the mixture has about or at least about any of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99% biomass.
  • the mixture has about or at least about any of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99% coal.
  • the ratio of biomass to coal in the mixture is about any of 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85: 15, 90: 10, or 95:5.
  • Syngas can be derived from a feedstock by a variety of processes, including methane reforming, coal liquefaction, co-firing, fermentative reactions, enzymatic reactions, and biomass gasification.
  • Biomass gasification is accomplished by subjecting biomass to partial oxidation in a reactor at temperatures above about 700 °C in the presence of less than a stoichiometric amount of oxygen. The oxygen is introduced into the bioreactor in the form of air, pure oxygen, or steam.
  • Gasification can occur in three main steps: 1) initial heating to dry out any moisture embedded in the biomass; 2) pyrolysis, in which the biomass is heated to 300-500 °C in the absence of oxidizing agents to yield gas, tars, oils and solid char residue; and 3) gasification of solid char, tars and gas to yield the primary components of syngas.
  • Co-firing is accomplished by gasification of a coal/biomass mixture.
  • the composition of the syngas such as the identity and molar ratios of the components of the syngas, can vary depending on the feedstock from which it is derived and the method by which the feedstock is converted to syngas.
  • Syngas can contain impurities, the nature and amount of which vary according to both the feedstock and the process used in production. Fermentations may be tolerant to some impurities, but there remains the need to remove from the syngas materials such as tars and particulates that might foul the fermentor and associated equipment. It is also advisable to remove compounds that might contaminate the isoprene product such as volatile organic compounds, acid gases, methane, benzene, toluene, ethylbenzene, xylenes, H 2 S, COS, CS 2 , HC1, 0 3 , organosulfur compounds, ammonia, nitrogen oxides, nitrogen-containing organic compounds, and heavy metal vapors. Removal of impurities from syngas can be achieved by one of several means, including gas scrubbing, treatment with solid-phase adsorbents, and purification using gas-permeable membranes.
  • WO2010/003007 WO2009/132220, WO2010/031062, WO2010/031068, WO2010/031076, WO2010/013077, WO2010/031079, WO2010/148150, WO2010/078457, and WO2010/148256, which are hereby incorporated in their entirety, particularly with respect to fermentation systems and culture conditions for any of the host cells disclosed herein.
  • the culture medium is prepared using anoxic techniques.
  • the culture medium comprises one or more of NH 4 C1, NaCl, KC1, KH 2 PO 4 ,
  • the culture medium contains, per liter, about 1.0 g NH 4 C1, about 0.8 g NaCl, about 0.1 g KC1, about 0.1 g KH 2 P0 4 , about 0.2 g MgS0 4 « 7H 2 0, about 0.02 g CaCl 2 *2H 2 0, about 1.0 g NaHC0 3 , about 1.0 g yeast extract, about 0.2 g cysteine hydrochloride, about 0.2 g Na 2 S*9H 2 0, about 10 mL trace metal solution, and about 10 mL vitamin solution.
  • the culture condition comprises mevalonate.
  • the growth conditions, carbon sources, energy sources, and culture media may be according to any of the growth conditions, carbon sources, energy sources, and culture media described in the Examples of the present disclosure.
  • the invention provides for microbial expression systems for the production of one or more industrial bio-products (e.g. , isoprene, butadiene, or ethanol).
  • the system can include one or more of: a regulatable gene expression construct comprising (i) a PnarG nitrate-dependent promoter (such as any of those disclosed herein) operably linked to one or more nucleic acids encoding a gene of interest (such as any of those described herein); and, optionally, (ii) one or more nucleic acids encoding one or more nitrate-regulatory genes.
  • the host cells can have one or more loss-of-function mutations in one or more genes encoding nitrate transporter proteins or nitrate reductase genes (such as any of those disclosed herein).
  • the system provides for the expression of one or more nucleic acids of interest (e.g., nucleic acids encoding isoprene synthase or enzymes involved in the production of ethanol from acetyl-CoA).
  • nucleic acids of interest e.g., nucleic acids encoding isoprene synthase or enzymes involved in the production of ethanol from acetyl-CoA.
  • microorganisms expressing one or more nucleic acids of interest can be engineered to produce various industrial bio-products under the control of a nitrate-dependent regulatable gene expression construct, such as any of those disclosed herein.
  • bio-products can include, but are not limited to, isoprene, butadiene, ethanol, propanediol (e.g., 1,2-propanediol, 1,3-propanediol), hydrogen, acetate, microbial fuels, non-fermentative alcohols, fatty alcohols, fatty acid esters, isoprenoid alcohols, alkenes, alkanes, terpenoids, isoprenoids, carotenoids or other C5, CIO, C15, C20, C25, C30, C35, or C40 product.
  • propanediol e.g., 1,2-propanediol, 1,3-propanediol
  • hydrogen acetate
  • microbial fuels e.g., 1,2-propanediol, 1,3-propanediol
  • non-fermentative alcohols e.g., fatty alcohols, fatty acid esters
  • the constructs, compositions, and methods for regulating and controlling gene expression can be used to engineer microorganism host cells responsive to nitrate.
  • heterologous nucleic acid expression is initiated and the engineered microorganism host cells (such as any of those disclosed herein) can produce various industrial bio-products, including but not limited to, isoprene, butadiene, ethanol, propanediol (e.g., 1,2-propanediol, 1,3-propanediol), hydrogen, acetate, microbial fuels, non-fermentative alcohols, fatty alcohols, fatty acid esters, isoprenoid alcohols, alkenes, alkanes, terpenoids, isoprenoids, carotenoids or other C5, CIO, C15, C20, C25, C30, C35, or C40 product.
  • the production of these industrial bio-products is described in further detail below
  • the host cells contain one or more pathways for the production of isoprene (e.g., microorganisms that contain the pathways illustrated in Figures Yl -22) with one or more heterologous polynucleotides encoding one or more isoprene pathway enzymes expressed in a sufficient amount to produce isoprene.
  • isoprene e.g., microorganisms that contain the pathways illustrated in Figures Yl -22
  • heterologous polynucleotides encoding one or more isoprene pathway enzymes expressed in a sufficient amount to produce isoprene.
  • the host cells can be transformed with polynucleotides encoding an isoprene synthase polypeptide.
  • Isoprene synthase polypeptides convert dimethylallyl diphosphate (DMAPP) into isoprene.
  • DMAPP dimethylallyl diphosphate
  • Exemplary isoprene synthase polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an isoprene synthase polypeptide.
  • Standard methods can be used to determine whether a polypeptide has isoprene synthase polypeptide activity by measuring the ability of the polypeptide to convert DMAPP into isoprene in vitro, in a cell extract, or in vivo (e.g., as described in Example 1 of US 8420360 B2, which is incorporated herein in its entirety, particularly with respect to methods for assessing isoprene synthase activity).
  • Isoprene synthase polypeptide activity in cell extracts can be measured, for example, as described in Silver et al., J. Biol. Chem. 270: 13010-13016, 1995 and references therein, which are each hereby incorporated by reference in their entireties, particularly with respect to assays for isoprene synthase polypeptide activity.
  • the isoprene synthase polypeptide or nucleic acid is from the family Fabaceae, such as the Faboideae subfamily.
  • the isoprene synthase polypeptide or nucleic acid is a naturally- occurring polypeptide or nucleic acid from Pueraria montana (kudzu) (Sharkey et al., Plant Physiology 137: 700-712, 2005), Pueraria lobata, poplar (such as Populus alba x tremula CAC35696) (Miller et al., Planta 213: 483-487, 2001) aspen (such as Populus tremuloides) (Silver et al, JBC 270(22): 13010-1316, 1995), or English Oak (Quercus robur) (Zimmer et al., WO 98/02550), which are each hereby incorporated by reference in their entireties, particularly with respect
  • Suitable isoprene synthases include, but are not limited to, those identified by Genbank Accession Nos. AY341431, AY316691, AY279379, AJ457070, and AY1 82241, which are each hereby incorporated by reference in their entireties, particularly with respect to sequences of isoprene synthase nucleic acids and polypeptides.
  • the isoprene synthase polypeptide or nucleic acid is not a naturally- occurring polypeptide or nucleic acid from Quercus robur (i.e., the isoprene synthase polypeptide or nucleic acid is an isoprene synthase polypeptide or nucleic acid other than a naturally- occurring polypeptide or nucleic acid from Quercus robur).
  • the isoprene synthase nucleic acid or polypeptide is not a naturally- occurring polypeptide or nucleic acid from poplar (such as Populus alba x tremula CAC35696).
  • Exemplary isoprene synthase nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an isoprene synthase polypeptide.
  • Exemplary isoprene synthase polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein. Additional isoprene synthase nucleic acids can also be found in U.S. Patent No. 8,173,410, U.S. Patent No. 8,735,134 and U.S. Patent Application Publication No. 20130045891, the disclosures of each of which are incorporated by reference in their entireties.
  • the cells described in any of the compositions or methods described herein further comprise one or more heterologous nucleic acids encoding a DXS polypeptide or other DXP pathway polypeptides.
  • the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding a DXS polypeptide or other DXP pathway polypeptides.
  • the cells further comprise one or more nucleic acids encoding an IDI polypeptide and a DXS polypeptide or other DXP pathway polypeptides.
  • one nucleic acid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or other DXP pathway polypeptides.
  • one plasmid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or other DXP pathway polypeptides.
  • multiple plasmids encode the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or other DXP pathway
  • Exemplary DXP pathways polypeptides include, but are not limited to any of the following polypeptides: DXS polypeptides, DXR polypeptides, MCT polypeptides, CMK polypeptides, MCS polypeptides, HDS polypeptides, HDR polypeptides, and polypeptides (e.g., fusion polypeptides) having an activity of one, two, or more of the DXP pathway polypeptides.
  • DXP pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXP pathway polypeptide.
  • Exemplary DXP pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a DXP pathway polypeptide.
  • Exemplary DXP pathway polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein. Exemplary DXP pathway polypeptides and nucleic acids and methods of measuring DXP pathway polypeptide activity are described in more detail in International Publication No. WO 2010/148150.
  • the host cells can be transformed with polynucleotides encoding l-deoxy-D-xylulose-5-phosphate synthase (DXS) polypeptides.
  • DXS polypeptides convert pyruvate and D-glyceraldehyde-3-phosphate into 1- deoxy-D-xylulose-5-phosphate.
  • Exemplary DXS polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXS polypeptide.
  • Standard methods can be used to determine whether a polypeptide has DXS polypeptide activity by measuring the ability of the polypeptide to convert pyruvate and D- glyceraldehyde-3-phosphate into l-deoxy-D-xylulose-5-phosphate in vitro, in a cell extract, or in vivo (see, e.g., US 8420360 B2, which is hereby incorporated herein in its entirety, particularly with respect to methods of assessing DXS polypeptide activity).
  • Exemplary DXS nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a DXS polypeptide.
  • Exemplary DXS polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
  • DXR polypeptides convert 1-deoxy-D-xylulose 5-phosphate (DXP) into 2-C-methyl- D-erythritol 4-phosphate (MEP). Standard methods can be used to determine whether a polypeptide has DXR polypeptides activity by measuring the ability of the polypeptide to convert DXP in vitro, in a cell extract, or in vivo.
  • MCT polypeptides convert 2-C-methyl-D-erythritol 4-phosphate (MEP) into 4- (cytidine 5'-diphospho)-2-methyl-D-erythritol (CDP-ME).
  • Standard methods can be used to determine whether a polypeptide has MCT polypeptides activity by measuring the ability of the polypeptide to convert MEP in vitro, in a cell extract, or in vivo.
  • CMK polypeptides convert 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP- ME) into 2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP-MEP).
  • Standard methods can be used to determine whether a polypeptide has CMK polypeptides activity by measuring the ability of the polypeptide to convert CDP-ME in vitro, in a cell extract, or in vivo.
  • MCS polypeptides convert 2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D- erythritol (CDP-MEP) into 2-C-methyl-D-erythritol 2, 4-cyclodiphosphate (ME-CPP or cMEPP). Standard methods can be used to determine whether a polypeptide has MCS polypeptides activity by measuring the ability of the polypeptide to convert CDP-MEP in vitro, in a cell extract, or in vivo.
  • HDS polypeptides convert 2-C-methyl-D-erythritol 2, 4-cyclodiphosphate into (E)-4- hydroxy-3-methylbut-2-en-l-yl diphosphate (HMBPP or HDMAPP). Standard methods can be used to determine whether a polypeptide has HDS polypeptides activity by measuring the ability of the polypeptide to convert ME-CPP in vitro, in a cell extract, or in vivo.
  • HDR polypeptides convert (E)-4-hydroxy-3-methylbut-2-en-l-yl diphosphate into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Standard methods can be used to determine whether a polypeptide has HDR polypeptides activity by measuring the ability of the polypeptide to convert HMBPP in vitro, in a cell extract, or in vivo.
  • the host cells can be transformed with polynucleotides encoding isopentenyl diphosphate isomerase polypeptides (isopentenyl-diphosphate delta-isomerase or IDI).
  • IDI catalyzes the interconversion of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) (e.g., converting IPP into DMAPP and/or converting DMAPP into IPP).
  • IPP isopentenyl diphosphate
  • DMAPP dimethylallyl diphosphate
  • Exemplary IDI polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an IDI polypeptide.
  • Standard methods can be used to determine whether a polypeptide has IDI polypeptide activity by measuring the ability of the polypeptide to interconvert IPP and DMAPP in vitro, in a cell extract, or in vivo (see, e.g., US 8420360 B2, which is hereby incorporated by reference in its entirety, particularly with respect to assays for IDI activity).
  • Exemplary IDI nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an IDI polypeptide.
  • Exemplary IDI polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
  • the host cells can be transformed with polynucleotides encoding MVA pathway polypeptides.
  • MVA pathway polypeptides include acetyl-CoA acetyltransferase (AA-CoA thiolase) polypeptides, 3-hydroxy- 3-methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides, 3-hydroxy-3- methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides, mevalonate kinase (MVK) polypeptides, phosphomevalonate kinase (PMK) polypeptides, diphosphomevalonte
  • AA-CoA thiolase acetyl-CoA acetyltransferase
  • HMG-CoA synthase 3-hydroxy- 3-methylglutaryl-CoA synthase
  • HMG-CoA reductase 3-hydroxy-3- methylgluta
  • VMD decarboxylase
  • MVA pathway polypeptides having an activity of two or more MVA pathway polypeptides.
  • PMDC phosphomevalonate decarboxylase
  • IPK isopentenyl phosphate kinase
  • MVA pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an MVA pathway polypeptide.
  • Exemplary MVA pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an MVA pathway polypeptide.
  • Exemplary MVA pathway polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
  • acetyl-CoA acetyltransferase polypeptides convert two molecules of acetyl-CoA into acetoacetyl-CoA.
  • Standard methods (such as those described herein) can be used to determine whether a polypeptide has AA-CoA thiolase polypeptide activity by measuring the ability of the polypeptide to convert two molecules of acetyl-CoA into acetoacetyl-CoA in vitro, in a cell extract, or in vivo.
  • HMG-CoA synthase or HMGS 3-hydroxy-3-methylglutaryl-CoA synthase
  • HMGS 3-hydroxy-3-methylglutaryl-CoA synthase
  • Standard methods can be used to determine whether a polypeptide has HMG-CoA synthase polypeptide activity by measuring the ability of the polypeptide to convert acetoacetyl- CoA into 3-hydroxy-3-methylglutaryl-CoA in vitro, in a cell extract, or in vivo.
  • HMG-CoA reductase or HMGR polypeptides convert 3-hydroxy-3-methylglutaryl-CoA into mevalonate.
  • Standard methods can be used to determine whether a polypeptide has HMG-CoA reductase polypeptide activity by measuring the ability of the polypeptide to convert 3-hydroxy- 3-methylglutaryl-CoA into mevalonate in vitro, in a cell extract, or in vivo.
  • Mevalonate kinase (MVK) polypeptides phosphorylate mevalonate to form
  • mevalonate-5-phosphate is mevalonate-5-phosphate.
  • Standard methods can be used to determine whether a polypeptide has MVK polypeptide activity by measuring the ability of the polypeptide to convert mevalonate into mevalonate-5-phosphate in vitro, in a cell extract, or in vivo.
  • Phosphomevalonate kinase (PMK) polypeptides phosphorylate mevalonate-5- phosphate to form mevalonate- 5 -diphosphate.
  • Standard methods can be used to determine whether a polypeptide has PMK polypeptide activity by measuring the ability of the polypeptide to convert mevalonate- 5 -phosphate into mevalonate-5-diphosphate in vitro, in a cell extract, or in vivo.
  • Diphosphomevalonte decarboxylase (MVD or DPMDC) polypeptides convert mevalonate-5-diphosphate into isopentenyl diphosphate polypeptides (IPP). Standard methods (such as those described) can be used to determine whether a polypeptide has MVD polypeptide activity by measuring the ability of the polypeptide to convert mevalonate-5-diphosphate into IPP in vitro, in a cell extract, or in vivo.
  • Phosphomevalonate decarboxylase (PMDC) polypeptides convert mevalonate-5- phosphate into isopentenyl phosphate (IP). Standard methods (such as those described) can be used to determine whether a polypeptide has PMDC polypeptide activity by measuring the ability of the polypeptide to convert mevalonate- 5 -phosphate into isopentenyl phosphate in vitro, in a cell extract, or in vivo.
  • Isopentenyl phosphate kinase (IPK) polypeptides convert isopentenyl phosphate into isopentenyl diphosphate.
  • Standard methods can be used to determine whether a polypeptide has IPK polypeptide activity by measuring the ability of the polypeptide to convert isopentenyl phosphate into isopentenyl diphosphate in vitro, in a cell extract, or in vivo.
  • the host cells (such as any of the host cells disclosed herein) can be transformed to produce isoprene from syngas and/or from carbohydrates or mixtures thereof.
  • Isoprene synthase, DXP pathway, IDI, or MVA pathway nucleic acids can be obtained from any organism that naturally contains isoprene synthase, DXP pathway, IDI, and/or MVA pathway nucleic acids.
  • isoprene is formed naturally by a variety of organisms, such as bacteria, yeast, plants, and animals.
  • Organisms contain the MVA pathway, DXP pathway, or both the MVA and DXP pathways for producing isoprene.
  • DXS, DXR, MCT, CMK, MCS, HDS, or HDR nucleic acids can be obtained, e.g., from any organism that contains the DXP pathway or contains both the MVA and DXP pathways.
  • IDI and isoprene synthase nucleic acids can be obtained, e.g., from any organism that contains the MVA pathway, DXP pathway, or both the MVA and DXP pathways.
  • MVA pathway nucleic acids can be obtained, e.g., from any organism that contains the MVA pathway or contains both the MVA and DXP pathways.
  • the nucleic acid sequence of the isoprene synthase, DXP pathway, IDI, or MVA pathway nucleic acid is identical to the sequence of a nucleic acid that is produced by any of the following organisms in nature.
  • the amino acid sequence of the isoprene synthase, DXP pathway, IDI, or MVA pathway polypeptide is identical to the sequence of a polypeptide that is produced by any of the following organisms in nature.
  • the isoprene synthase, DXP pathway, IDI, or MVA pathway nucleic acid or polypeptide is a mutant nucleic acid or polypeptide derived from any of the organisms described herein.
  • derived from refers to the source of the nucleic acid or polypeptide into which one or more mutations is introduced.
  • a polypeptide that is "derived from a plant polypeptide” refers to polypeptide of interest that results from introducing one or more mutations into the sequence of a wild-type (i.e., a sequence occurring in nature) plant polypeptide.
  • the source organism is a fungus, examples of which are species of Aspergillus such as A oryzae and A. niger, species of Saccharomyces such as S. cerevisiae, species of Schizosaccharomyces such as S. pombe, and species of Trichoderma such as T. reesei.
  • the source organism is a filamentous fungal cell.
  • filamentous fungi refers to all filamentous forms of the subdivision Eumycotina ⁇ see, Alexopoulos, C. J. (1962), Introductory Mycology, Wiley, New York).
  • filamentous fungal parent cell may be a cell of a species of, but not limited to, Trichoderma, ⁇ e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified as T.
  • Trichoderma or “Trichoderma sp.” or “Trichoderma spp.” refer to any fungal genus previously or currently classified as Trichoderma.
  • the fungus is A. nidulans, A. awamori, A. oryzae, A. aculeatus, A. niger, A. japonicus, T. reesei, T. viride, F. oxysporum, or F. solani.
  • Aspergillus strains are disclosed in Ward et al., Appl. Microbiol. Biotechnol. 39:738-743, 1993 and Goedegebuur et al., Curr Gene 41:89-98, 2002, which are each hereby incorporated by reference in their entireties, particularly with respect to fungi.
  • the fungus is a strain of
  • Trichoderma such as a strain of T. reesei.
  • Strains of T. reesei are known and non-limiting examples include ATCC No. 13631, ATCC No. 26921, ATCC No. 56764, ATCC No. 56765, ATCC No. 56767, and NRRL 15709, which are each hereby incorporated by reference in their entireties, particularly with respect to strains of T. reesei.
  • the host strain is a derivative of RL-P37.
  • RL-P37 is disclosed in Sheir-Neiss et ah, Appl. Microbiol.
  • the source organism is a yeast, such as Saccharomyces sp., Schizosaccharomyces sp. , Pichia sp., or Candida sp.
  • the source organism is a bacterium, such as strains of Bacillus such as B. lichenformis or B. subtilis, strains of Pantoea such as P. citrea, strains of
  • Pseudomonas such as P. alcaligenes, strains of Streptomyces such as S. lividans or S.
  • strains of Thermosynechococcus such as T. elongatus
  • strains of Sinorhizobium such as S. meliloti
  • strains of Helicobacter such as H. pylori
  • strains of Agrobacterium such as A. tumefaciens
  • strains of Deinococcus such as D. radiodurans
  • strains of Listeria such as L.
  • the source organism is a bacterium, such as strains of
  • Escherichia e.g., E. coli
  • Bacillus e.g., B. subtilis
  • the genus Escherichia includes all species within the genus
  • Escherichia as known to those of skill in the art, including but not limited to E. coli, E.
  • the genus "Escherichia” is defined as Gram-negative, non-spore forming, facultatively anaerobic, rod- shaped bacteria are classified as members of the Family Enterobacteriaceae, Order Enterobacteriales, Class Gamma Proteobacteria.
  • the genus Bacillus includes all species within the genus “Bacillus,” as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, and B. thuringiensis. It is recognized that the genus Bacillus continues to undergo taxonomical reorganization. Thus, it is intended that the genus include species that have been reclassified, including but not limited to such organisms as B. stearothermophilus, which is now named "Geobacillus
  • Brevibacillus Brevibacillus, Filobacillus, Gracilibacillus, Halobacillus, Paenibacillus, Salibacillus,
  • Thermobacillus Ureibacillus, and Virgibacillus.
  • the source organism is a gram-positive bacterium.
  • Non-limiting examples include strains of Streptomyces (e.g., S. lividans, S. coelicolor, or S. griseus), Bacillus, Listeria (e.g., L. monocytogenes) or Lactobacillus (e.g., L. spp).
  • the source organism is a gram-negative bacterium, such as E. coli, Pseudomonas sp, or H. pylori.
  • the source organism is a plant, such as a plant from the family Fabaceae, such as the Faboideae subfamily.
  • the source organism is kudzu, poplar (such as Populus alba x tremula CAC35696), aspen (such as Populus
  • tremuloides Quercus robur, Arabidopsis (such as A. thaliana), or Zea (such as Z. mays).
  • the source organism is an algae, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
  • an algae such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
  • the source organism is a cyanobacterium, such as cyanobacteria classified into any of the following groups based on morphology: Chroococcales,
  • the cyanobacterium is Thermosynechococcus elongates.
  • the host cells (such as any of the host cells disclosed herein) can be transformed with one or more polynucleotides encoding the polypeptides of one or more pathways for the production of butadiene (shown in Figures 23-25) such that butadiene synthetic enzymes are expressed in a sufficient amount to produce butadiene.
  • the butadiene pathway includes an acetyl-CoA:acetyl-CoA acyltransferase, an acetoacetyl-CoA reductase, a 3- hydroxybutyryl-CoA dehydratase, a crotonyl-CoA reductase (aldehyde forming), a
  • crotonaldehyde reductase (alcohol forming), a crotyl alcohol kinase, a 2-butenyl-4-phosphate kinase, a butadiene synthase, a crotonyl-CoA hydrolase, a crotonyl-CoA synthetase, a crotonyl- CoA transferase, a crotonate reductase, a crotonyl-CoA reductase (alcohol forming), a glutaconyl-CoA decarboxylase, a glutaryl-CoA dehydrogenase, an 3-aminobutyryl-CoA deaminase, a 4-hydroxybutyryl-CoA dehydratase or a crotyl alcohol diphosphokinase.
  • butadiene from bacteria is described in WO 2011/140171 A2, hereby incorporated by reference in its entirety, particularly with respect to the pathways for production of butadiene from acetyl-CoA (FIG. 23), from erythrose-4-phosphate (FIG. 24), and from malonyl-CoA plus acetyl-CoA (FIG. 25).
  • compositions and methods disclosed herein can be used to transform host cells (such as any of the host cells disclosed herein) that contain the ethanol pathway with one or more heterologous polynucleotides encoding one or more ethanol pathway enzymes expressed in sufficient amount to produce ethanol.
  • the pathway for production of ethanol from acetyl-CoA includes the aldehyde dehydrogenase enzyme and the alcohol dehydrogenase enzyme (see, e.g., FIG. 18).
  • any of the methods described herein may be used to produce products other than isoprene, butadiene, and ethanol. Such products may be excreted, secreted, or intracellular products. Any one of the methods described herein may be used to produce isoprene and/or one or more of the other products.
  • the products described herein may be, for example, propanediol (e.g., 1,2-propanediol, 1,3-propanediol), hydrogen, acetate, or microbial fuels.
  • Exemplary microbial fuels are fermentative alcohols (e.g., ethanol or butanol), non-fermentative alcohols (e.g., isobutanol, methyl butanol, 1-propanol, 1-butanol, methyl pentanol, or 1-hexanol), fatty alcohols, fatty acid esters, isoprenoid alcohols, alkenes, and alkanes.
  • the products described herein may also be a terpenoid, isoprenoid (e.g. , farnesene), carotenoid or other C5, CIO, C15, C20, C25, C30, C35, or C40 product.
  • the terpenoids are selected from the group consisting of
  • the hemiterpenoid is prenol, isoprenol, or isovaleric acid.
  • the monoterpenoid is geranyl pyrophosphate, eucalyptol, limonene, or pinene.
  • the sesquiterpenoid is farnesyl pyrophosphate, artemisinin, or bisabolol.
  • the diterpenoid is geranylgeranyl pyrophosphate, retinol, retinal, phytol, taxol, forskolin, or aphidicolin.
  • the triterpenoid is squalene or lanosterol.
  • the tetraterpenoid is lycopene or carotene.
  • the carotenoids are selected from the group consisting of xanthophylls and carotenes.
  • the xanthophyll is lutein or zeaxanthin.
  • the carotene is a- carotene, ⁇ -carotene, ⁇ -carotene, ⁇ -cryptoxanthin or lycopene.
  • the products described herein may be derived from Acetyl-CoA produced via syngas fermentation or via fermentation of other carbon sources such as fructose.
  • the cell is grown under conditions suitable for the production of the product(s) other than isoprene.
  • the products described herein may be naturally produced by the cell.
  • the cells naturally produce one or more products including excreted, secreted, or intracellular products.
  • the cells naturally produce ethanol, propanediol, hydrogen, or acetate.
  • production of a naturally occurring product is increased relative to wild-type cells. Any method known in the art to increase production of a metabolic cellular product may be used to increase the production of a naturally occurring product.
  • the nucleic acid encoding all or a part of the pathway for production of a product described herein is operably linked to a promoter such as a strong promoter.
  • the nucleic acid encoding all or a part of the pathway for production of a product described herein is operably linked to a constitutive promoter.
  • the cell is engineered to comprise additional copies of an endogenous nucleic acid encoding a polypeptide for the production of a product described herein.
  • the product described herein is not naturally produced by the cell.
  • the cell comprises one or more heterologous nucleic acids encoding one or more polypeptides for the production of a product described herein.
  • acetogens produce acetate and ethanol.
  • Acetate is produced in a 2-step reaction in which acetyl-CoA is firstly converted to acetyl-phosphate by phosphotransacetylase (pta), and then acetyl-phosphate is dephosphorylated by acetate kinase (ack) to form acetate.
  • Ethanol is formed by a two-step process in which acetyl-CoA is converted to acetaldehyde and then to ethanol by the multifunctional enzyme alcohol dehydrogenase (adhE).
  • acetate and ethanol may not be desirable in isoprene-producing cells, as it fluxes carbon away from isoprene and ultimately results in decreased yield of isoprene.
  • some or all of the genes coding for phosphotransacetylase (pta), acetate kinase (ack), and alcohol dehydrogenase (adhE) may be disrupted or the expressions thereof are reduced in anaerobic cells for the purpose of redirecting carbon flux away from acetate and/or ethanol and increasing the production of isoprene.
  • the cells are deficient in at least one polypeptide involved in production of acetate, ethanol, succinate, and/or glycerol.
  • one or more pathways for production of a metabolite other than isoprene e.g., lactate, acetate, ethanol (or other alcohol(s)), succinate, or glycerol
  • the production of a metabolite other than isoprene may be reduced by at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.
  • one or more of the pathways for production of lactate, acetate, ethanol, succinate, or glycerol is blocked, for example, the production for lactate, acetate, ethanol, succinate, and/or glycerol is reduced by at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.
  • the cells are deficient in at least one polypeptide in pathway(s) of producing acetate, ethanol, succinate, and/or glycerol. Polypeptides in pathway(s) of producing acetate, ethanol, succinate, and/or glycerol may have reduced activities or the expressions thereof are reduced.
  • Nucleic acids encoding polypeptides in pathway(s) of producing acetate, ethanol, succinate, and/or glycerol may be disrupted.
  • the polypeptides involved in various pathways are known to one skilled in the art, including, for example, those described in Misoph et al. 1996, Journal of Bacteriology, 178(11):3140-45, the contents of which are expressly
  • the cells are deficient in pta. In some aspects, the cells are deficient in ack. In some aspects, the cells are deficient in adhE. In some aspects, the cells are deficient in pta, ack, and/or adhE. In some aspects, the expressions of phosphotransacetylase, acetate kinase, and/or alcohol dehydrogenase are reduced. In some aspects, the activities of
  • the cells are deficient in polypeptide(s) having similar activities as
  • phosphotransacetylase acetate kinase, and/or alcohol dehydrogenase.
  • the expression of pta, ack, adhE, and/or polypeptide(s) having similar activities as phosphotransacetylase, acetate kinase, and/or alcohol dehydrogenase may be reduced by any of the methods known to one skilled in the art, for example, the expression may be reduced by antisense RNA(s) ⁇ e.g., antisense RNA driven by any of the promoters described herein such as any of the inducible promoters).
  • the antisense RNA(s) are operably linked to a suitable promoter such as any of the promoters described herein including inducible promoters.
  • isoprene and product(s) other than isoprene are both recovered from the gas phase.
  • isoprene is recovered from the gas phase ⁇ e.g. from the fermentation of gas), and the other product(s) are recovered from the liquid phase ⁇ e.g. from the cell broth).
  • a variety of different types of reactors can be used for production of isoprene or other industrial bio-products.
  • a carbohydrate is used as energy and/or carbon source.
  • a carbohydrate and hydrogen are used as energy and/or carbon source.
  • syngas is used as energy and/or carbon source.
  • Bioreactors for use in the present invention should be amenable to anaerobic conditions. The bioreactor can be designed to optimize the retention time of the cells, the residence time of liquid, and the sparging rate of syngas.
  • the cells are grown using any known mode of fermentation, such as batch, fed-batch, continuous, or continuous with recycle processes.
  • a batch method of fermentation is used.
  • Classical batch fermentation is a closed system where the composition of the media is set at the beginning of the fermentation and is not subject to artificial alterations during the fermentation.
  • the cell medium is inoculated with the desired host cells and fermentation is permitted to occur adding nothing to the system.
  • "batch" fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration.
  • the metabolite and biomass compositions of the system change constantly until the time the fermentation is stopped.
  • cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted.
  • cells in log phase are responsible for the bulk of the isoprene production.
  • cells in stationary phase produce isoprene.
  • Fed-Batch fermentation processes comprise a typical batch system with the exception that the carbon source (e.g. syngas, glucose, fructose) is added in increments as the fermentation progresses.
  • the carbon source e.g. syngas, glucose, fructose
  • Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of carbon source in the cell medium.
  • Fed-batch fermentations may be performed with the carbon source (e.g. , syngas, glucose, fructose) in a limited or excess amount.
  • Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing.
  • Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
  • Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or isoprene production.
  • one method maintains a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allows all other parameters to moderate.
  • a number of factors affecting growth can be altered continuously while the cell concentration (e.g. , the concentration measured by media turbidity) is kept constant.
  • Continuous systems strive to maintain steady state growth conditions. Thus, the cell loss due to media being drawn off is balanced against the cell growth rate in the fermentation.
  • a variation of the continuous fermentation method is the continuous with recycle method.
  • This system is similar to the continuous bioreactor, with the difference being that cells removed with the liquid content are returned to the bioreactor by means of a cell mass separation device.
  • Cross-filtration units, centrifuges, settling tanks, wood chips, hydrogels, and/or hollow fibers are used for cell mass separation or retention. This process is typically used to increase the productivity of the continuous bioreactor system, and may be particularly useful for anaerobes, which may grow more slowly and in lower concentrations than aerobes.
  • a membrane bioreactor can be used for the growth and/or fermentation of the anaerobic cells described herein, in particular, if the cells are expected to grow slowly.
  • a membrane filter such as a crossflow filter or a tangential flow filter, can be operated jointly with a liquid fermentation bioreactor that produces isoprene gas.
  • Such a membrane bioreactor can enhance fermentative production of isoprene gas by combining fermentation with recycling of select broth components that would otherwise be discarded.
  • the MBR filters fermentation broth and returns the non-permeating component (filter "retentate”) to the reactor, effectively increasing reactor concentration of cells, cell debris, and other broth solids, while maintaining specific productivity of the cells. This substantially improves titer, total production, and volumetric productivity of isoprene, leading to lower capital and operating costs.
  • the liquid filtrate (or permeate) is not returned to the reactor and thus provides a beneficial reduction in reactor volume, similar to collecting a broth draw-off.
  • the collected permeate is a clarified liquid that can be easily sterilized by filtration after storage in an ordinary vessel.
  • the permeate can be readily reused as a nutrient and/or water recycle source.
  • a permeate, which contains soluble spent medium, may be added to the same or another fermentation to enhance isoprene production.
  • any of the methods described herein further include recovering the industrial bio- product (e.g. , isoprene, butadiene, ethanol, etc.).
  • the isoprene produced using the compositions and methods of the invention can be recovered using standard techniques, such as gas stripping, membrane enhanced separation, fractionation, adsorption/desorption, evaporation, thermal or vacuum desorption of isoprene from a solid phase, or extraction of isoprene immobilized or absorbed to a solid phase with a solvent (see, for example, U.S. Patent Nos. 4,703,007 and 4,570,029).
  • the isoprene is recovered by absorption stripping (see, e.g.
  • extractive distillation with an alcohol is used to recover the isoprene.
  • an alcohol such as ethanol, methanol, propanol, or a combination thereof
  • the recovery of isoprene involves the isolation of isoprene in a liquid form (such as a neat solution of isoprene or a solution of isoprene in a solvent).
  • Gas stripping involves the removal of isoprene vapor from the fermentation off-gas stream in a continuous manner.
  • Such removal can be achieved in several different ways including, but not limited to, adsorption to a solid phase, partition into a liquid phase, or direct condensation (such as condensation due to exposure to a condensation coil or do to an increase in pressure).
  • the isoprene is compressed and condensed.
  • the recovery of isoprene may involve one step or multiple steps.
  • the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed simultaneously.
  • isoprene can be directly condensed from the off-gas stream to form a liquid.
  • the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed sequentially.
  • isoprene may be adsorbed to a solid phase and then extracted from the solid phase with a solvent.
  • any of the methods described herein further include a step of recovering the compounds produced. In some aspects, any of the methods described herein further include a step of recovering the isoprene. In some aspects, the isoprene is recovered by absorption stripping (See, e.g., U.S. Publ. No. 2011/0178261).
  • Isoprene compositions recovered from fermentations may contain impurities. The identities and levels of impurities in an isoprene composition can be analyzed by standard methods, such as GC/MS, GC/FID, and 1 H NMR. An impurity can be of microbial origin, or it can be a contaminant in the syngas feed or other fermentation raw materials.
  • the isoprene composition recovered from fermentation comprises one or more of the following impurities: hydrogen sulfide, carbonyl sulfide, carbon disulfide, ethanol, acetone, methanol, acetaldehyde, methacrolein, methyl vinyl ketone, 2-methyl-2-vinyloxirane, cis- and ira3 ⁇ 4s-3-methyl-l,3-pentadiene, a C5 prenyl alcohol (such as 3-methyl-3-buten-l-ol or 3- methyl-2-buten-l-ol), 2-heptanone, 6-methyl-5-hepten-2-one, 2,4,5-trimethylpyridine, 2,3,5- trimethylpyrazine, citronellal, methanethiol, ethanethiol, methyl acetate, 1-propanol, diacetyl, 2- butanone, 2-methyl-3-buten-2-ol, ethyl
  • any of the methods described herein further include purifying the isoprene.
  • the isoprene produced using the compositions and methods of the invention can be purified using standard techniques. Purification refers to a process through which isoprene is separated from one or more components that are present when the isoprene is produced. In some aspects, the isoprene is obtained as a substantially pure liquid. Examples of purification methods include (i) distillation from a solution in a liquid extractant and (ii) chromatography. As used herein, "purified isoprene” means isoprene that has been separated from one or more components that are present when the isoprene is produced.
  • the isoprene is at least about 20%, by weight, free from other components that are present when the isoprene is produced. In various aspects, the isoprene is at least or about 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, or 99%, by weight, pure. Purity can be assayed by any appropriate method, e.g., by column chromatography, HPLC analysis, or GC-MS analysis.
  • At least a portion of the gas phase remaining after one or more recovery steps for the removal of isoprene is recycled by introducing the gas phase into a cell culture system (such as a fermentor) for the production of isoprene.
  • a cell culture system such as a fermentor
  • recovery of industrial enzymes can use any method known to one of skill in the art and/or any of the exemplary protocols that are disclosed in U.S. Appl. Pub. Nos. 2009/0311764, 2009/0275080, 2009/0252828, 2009/0226569, 2007/0259397 and U.S. Patent Nos. 7,629,451; 7,604,974; 7,541,026; and 7,527,959 and for neutraceuticals (see, e.g., U.S. Patent No. 7,622,290), and for antimicrobials (see, e.g., U.S. Appl Pub. No.
  • Example 1 Construction of a plasmid with nitrate regulated expression of mvaE and mvaS
  • the purpose of this example is to describe construction of a plasmid with nitrate regulated expression of mvaE and mvaS and strains containing that plasmid.
  • a comparison strain containing a plasmid with a strong Ptrc promoter driving mvaE and mvaS expression is also described.
  • Nitrate salts are potentially inexpensive chemicals by which gene expression could be switched.
  • E. coli nitrate induction of gene expression requires anaerobic growth conditions. Frequently, it is desirable to control gene expression in aerobic growth conditions.
  • a mutation in the narG promoter that allowed induction of narG expression by nitrate under aerobic conditions has been described (Walker, W.S. and DeMoss, J. A. 1992. Role of
  • Plasmid pDMWP170 (pCL-PnarG*-mvaE-mvaS) is a spectinomycin-resistant medium copy plasmid with PnarG* driving expression of Enterococcus gallinarum mvaE and mvaS genes for mevalonic acid production. It was constructed as follows.
  • ODMWP279 TCACACAGGAAACAGCGCCGCTGAG (SEQ ID NO:5)
  • ODMWP281 GCTCATTTCAGAATCTGCATTAATG (SEQ ID NO:6)
  • the second fragment containing the narG promoter was amplified from template E. coli MG1655 chromosomal DNA using primers that would contain the desired mutations, ODMWP282 and ODMWP283.
  • ODMWP282 CAGATTCTGAAATGAGCAATACTCCTTAATACCCATCTGC (SEQ ID NO:7)
  • E. coli strain MD12-778 (BL21, GI1.2gltA, yhfSFRTPyddVIspAyhfS,
  • thiFRTtruncIspA was transformed with plasmid pDMWP170 with selection for spectinomycin resistance and the resultant strain was named DP2074.
  • E. coli strain LEI 023 carries plasmid pMCM1225, which has the trc promoter driving expression of mvaE and mvaS, in a host strain closely related to MD12-778 but with restored function of btuB.
  • Strain LE1023 was constructed as follows.
  • E. coli K12 btuB gene was used to replace the defective btuB gene in E. coli strain HMB (BL21 tpgl PL.2mKKDyl).
  • Plasmid pKD46 (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97, 6640-6645) encodes arabinose inducible lambda Red mediated recombination functions.
  • This plasmid was transformed into strain HMB and the resultant strain was induced with arabinose and transformed with a PCR product using E. coli K12 strain MG1655 chromosomal DNA as a template and primers ODMWP231 and ODMWP232.
  • ODMWP231 ATGATTAAAAAAGCTTCGCTGC (SEQ ID NO:9)
  • ODMWP232 GATGATATTCACCACCCCGC (SEQ ID NO: 10)
  • the media recipe was 5 g/L glycerol, 7 g/L K 2 HP0 4 , 3 g/L KH 2 P0 4 , 1 g/L Na 2 S0 4 , 0.1 g/L MgS0 4 « 7H 2 0, 1 g/L ethanolamine hydrochloride, 40 ⁇ g/L vitamin B12, and 2% agar. After incubation at 37 °C for 2 days, single colonies were streaked to LB Lennox plates. A purified single colony was then tested for growth on the glycerol/ethanolamine plates with vitamin B12. A strain that grew well was retained and named DP2035. PCR was done using DP2035 chromosomal DNA as a template and primers
  • ODMWP231/232 The PCR product was submitted for DNA sequencing and the sequence data showed that the TAG stop codon in BL21 btuB was changed.
  • Strain MD 12-778 was the recipient strain for PI mediated generalized transduction with donor strain DP2035, with selection for growth at 37 °C on minimal Glycerol Ethanolamine B12 plates.
  • a transductant colony was single colony purified on LB Lennox agar plates.
  • a colony that was positive for growth on minimal Glycerol Ethanolamine B12 plate was retained and named TV3011.
  • Strain TV3011 was transformed with plasmid pMCM1225 with selection for spectinomycin resistance and the resultant strain was named LEI 023.
  • Example 2 Nitrate induced MVA production and mvaE and mvaS mRNA expression
  • the purpose of this example is to describe data demonstrating nitrate-induced MVA production and nitrate induced mvaE and mvaS mRNA expression.
  • the flasks were incubated for 2 hours at 34 °C, 250 rpm, at which time potassium nitrate from a 250 g/L stock solution was added to the DP2074 flasks to final concentrations of 0, 0.002, 0.01, 0.05, 0.25, 1.25, or 6.25 g/L. At the same time, potassium nitrate was added to the LE1023 flasks to final concentrations of 0, 1.25 or 6.25 g/L.
  • samples were taken for RNA preparation. The rest of the cultures were incubated for a total of 24 hours. Samples were prepared for HPLC analyses by adding 54 ⁇ L ⁇ of 10% w/v sulfuric acid to a 300 ⁇ L ⁇ aliquot of flask broth.
  • strain DP2074 had very little MVA production in the absence of nitrate.
  • the lowest amount of nitrate tested, 0.002 g/L induced an 8 fold increase in MVA production in strain DP2074 ( Figure 2).
  • Increasing nitrate concentrations lead to increasing MVA production up to 0.25 g/L nitrate, with an 18-fold increase in MVA production as compared to the culture without nitrate.
  • Nitrate addition at 1.25 or 6.25 g/L to cultures of DP2074 yielded about the same MVA production as did the 0.25 g/L induction. Thus aerobic nitrate induction of MVA production was demonstrated.
  • RNA isolation was done using the Qiagen RNeasy Mini kit (Qiagen, Germantown, MD). Lysozyme was used to break up the cells. To TE buffer, 1 mg/mL lysozyme was added.
  • the pellets were then resuspended in 200 ⁇ ⁇ of the TE/lysozyme mix.
  • the samples were allowed to sit at room temperature for 10 min.
  • 7 ⁇ L ⁇ ⁇ - mercaptoethanol was added to 693 ⁇ ⁇ of RLT buffer supplied in the RNeasy kit and this mix was added to each sample.
  • 500 ⁇ ⁇ of 100% ethanol was added and mixed.
  • the samples were then applied to an RNeasy column, 700 ⁇ ⁇ at a time. They were spun for 1 min at 10,000 rpm and flow through was discarded. Another 700 ⁇ ⁇ of each sample was then added to the column, spun and again flow through was discarded.
  • RNA concentration was determined by measuring 2 ⁇ L ⁇ of sample on a NanoDrop spectrophotometer (Wilmington, DE). The RNA samples were then stored at -80 °C until qPCR was performed.
  • Quantitative Reverse Transcription PCR analysis was performed as follows. To remove any residual genomic DNA, 3 ⁇ g of total RNA was treated with RNase-free DNase (Qiagen, Hilden, Germany). The DNase was then inactivated by 1 mM EDTA and heating to 75 °C for 5 minutes. 1 ⁇ g of DNase-treated RNA was then converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) as per the manufacturer's instructions. cDNA was then diluted 1: 10 in water for qPCR analysis. [0241] qPCR was performed for the target genes.
  • Real-time PCR reactions included 10 pmoles each of forward and reverse primers, 2.5 pmoles of TaqMan probe, 10 ⁇ TaqMan Universal PCR Master Mix-No AmpErase ® Uracil-N- Glycosylase (UNG) (Catalog No. PN 4326614, Applied Biosystems), 1 ⁇ 1: 10 diluted cDNA, and 8.5 ⁇ RNase-/ DNase-free water for a total volume of 20 ⁇ per reaction. Reactions were run on the ABI PRISM 7900 Sequence Detection System under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 sec and annealing at 60 °C for 1 min.
  • UNG TaqMan Universal PCR Master Mix-No AmpErase ® Uracil-N- Glycosylase
  • Relative expression was calculated using Data Assist Software v3.01 and the AACt method (Applied Biosystems, Foster City, Ca). The rrsB gene was utilized for data normalization. Relative expression was then calculated by comparing the gene expression in the different strains and growth conditions. The gene expression in the table 2-2 below and in Figure 3 is relative to the sample from LEI 023 culture without nitrate.
  • strain DP2074 had low expression of mvaE and mvaS in the absence of nitrate.
  • Increasing nitrate concentrations lead to increasing mvaE and mvaS expression.
  • At 6.25 g/L nitrate there was a 14-fold increase in mvaE expression and 4.6-fold increase in mvaS expression.
  • aerobic nitrate induction of mvaE and mvaS mRNA was demonstrated.
  • Example 3 Improved MVA production with a strain that constitutively expressed the nitrate regulatory genes, narL and narX
  • the purpose of this example is to demonstrate improved MVA production with a strain that constitutively expressed the nitrate regulatory genes, narL and narX.
  • Nitrate activation of the narG promoter is regulated by two component signal transduction system encoded by narL and narX, which form an operon in E. coli. It was of interest to test altered expression of these regulatory genes by replacing the native promoter of the narXL operon with a moderate strength constitutive promoter.
  • E. coli strain DP2230 has the native chromosomal promoter for the narXL operon replaced with a constitutive glucose isomerase promoter PI.5. It was constructed in several steps as follows: A PCR reaction that amplified the chloroamphicol resistance cassette of pKD3 (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.
  • M034_C ctgtaatgacagctccagtagccctttcgggggcggatgagtgactcatagtgagcgattgtgtaggctggag (SEQ ID NO: 11)
  • M034_D gcaataaccttaatgaatgtgacgatacattctggaatggcagtattctcgaagtggttgaattatttgctcaggatgtggcat agtcaagggcatatgaatatcctccttagttc (SEQ ID NO: 12)
  • Strain MD114 which is E. coli BL21 carrying arabinose-inducible lambda Red recombinase genes on plasmid pRed-Et (Gene Bridges), was transformed with this PCR product following the Gene Bridges protocol for arabinose induction and transformation.
  • chloramphenicol-resistant colony was tested by PCR for the promoter replacement at narXL with primers ODMWP359 and ODMWP360; it was PCR positive and so was retained and named DP2223.
  • ODMWP359 GGTACATTGAGCAACTGACTGAAATG (SEQ ID NO: 13)
  • ODMWP360 CCAGTTGTCCGTCTCGTTCTGCTGC (SEQ ID NO: 14)
  • Strain DP2223 was used a donor for generalized transduction mediated by phage Plvir.
  • the recipient strain was E. coli strain MD12-778 (BL21, GI1.2gltA, yhfSFRTPyddVIspAyhfS, thiFRTtruncIspA).
  • a chloramphenicol-resistant transductant was single colony purified, was positive in a PCR with primers ODMWP359 and ODMWP360 (above), and was named strain DP2228.
  • strain DP2228 was transformed with plasmid pDMWP170 (described in Example 1) with selection for Spectinomycin-resistance to generate strain DP2230.
  • Samples were prepared for HPLC analyses by adding 54 ⁇ L ⁇ of 10% w/v sulfuric acid to a 300 ⁇ L ⁇ aliquot of flask broth.
  • the acidified tubes were held at 4 °C for 5 minute, then spun in a centrifuge tube filter (Costar, Spin-X, 0.22 ⁇ nylon) at 14,000 rpm for 5 minutes. The filtrate was put into HPLC vials.
  • the acidified supernate samples were analyzed for MVA by liquid chromatography.
  • the column was a crosslinked sulfonated polystyrene-divinylbenzene resin in the hydrogen form (Aminex HPX-87H, 300 x 7.8 mm, Bio-Rad Laboratories, Inc., Hercules, CA).
  • the mobile phase was 5 mM sulfuric acid at a flow rate of 0.6 mL/min and the column temperature was isothermal at 50 °C. Detection was ultraviolet absorbance at a wavelength of 210 nm.
  • Calibration standards were made by diluting mevalanolactone with 5 mM sulfuric acid. Calibration curves were constructed and results was calculated using linear regression. The results were reported as MVA equivalents. The results are shown in the table 3-1 below.
  • Table 3-1 MVA production in strains constitutively expressing narL and narX
  • Example 4 Nitrate-induced expression from the PnarG* promoter with an additional mutation in the -35 region
  • the purpose of this example is to demonstrate higher level nitrate-induced expression from the PnarG* promoter with an additional mutation in the -35 region.
  • the PnarG* promoter has the same -35 region as does the wild type PnarG, which has a 4 out of 6 base pair match to the sigma70 consensus -35 sequence. Thus, it was of interest to make changes in the -35 region that bring it to the consensus or closer to consensus to test if promoter strength could be improved while retaining nitrate regulated gene expression. The following promoter changes were constructed.
  • Full consensus -35 regionPlasmid pDMWP183 is a Spectinomycin resistant plasmid that carries the mvaE and mvaS genes under control of the PnarG* promoter with two additional changes to make a full consensus -35 region. It was constructed as follows.
  • Fragment #1 template was pMCM 1225 and the primers ODMWP279/281 ODMWP279/281 (see Example 1).
  • Fragment #2 template was E. coli MG1655 chromosomal DNA and primers were
  • ODMWP326 CTCAGCGGCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAA ACAGCGTGTCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 16)
  • Strain MD12-778 was transformed with pDMWP183[pCL-PnarG* consensus -35mvaE mvaS] with selection for Spectinomycin resistance to give strain DP2098.
  • the mobile phase was 5 mM sulfuric acid at a flow rate of 0.6 mL/min and the column temperature was isothermal at 50 °C. Detection was ultraviolet absorbance at a wavelength of 210 nm. Calibration standards were made by diluting
  • strain DP2074 with the PnarG* promoter driving mvaE and mvaS expression had increased MVA production upon nitrate induction.
  • strain DP2098 with the PnarG* promoter and a full consensus -35 region had much higher MVA production in the absence of nitrate than did strain DP2074.
  • the MVA production was not increased by addition of nitrate showing that changing the -35 region to the full consensus resulted in loss of nitrate regulation of gene expression.
  • a Gibson Assembly kit (New England Biolabs) was used following the manufacturer's protocol using two PCR products for each plasmid.
  • Plasmids pDMWP185, pDMWP186, pDMWP187, and pDMWP188 are
  • Spectinomycin-resistant plasmids that carry the mvaE and mvaS genes under control of the PnarG* promoter with changes to make various 5 of 6 matches to the consensus -35 region. They were constructed as follows.
  • the first fragment template was pMCM1225 and the primers were ODMWP279/281 (see Example 1).
  • the second fragments for each of the constructs were amplified from E. coli MG1655 chromosomal DNA with primers as follows.
  • pDMWP 185 TTCACA -35
  • the primers were primer ODMWP302 (listed above) and ODMWP329.
  • ODMWP329 CTCAGCGGCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAA ACAGCGTGTGAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 17)
  • primers were primer ODMWP302 (listed above) and ODMWP330.
  • ODMWP330 CTC AGCGGCGCTGTTTCCTGTGTG ATA AGGGC ATT ATACCGCTCTGA A ACAGCGTGGCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 18)
  • primers were primer ODMWP302 (listed above) and ODMWP331.
  • ODMWP331 CTCAGCGGCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAA ACAGCGCGTCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 19)
  • primers were primer ODMWP302 (listed above) and ODMWP332.
  • ODMWP332 CTC AGCGGCGCTGTTTCCTGTGTG ATA AGGGC ATT ATACCGCTCTGA A ACAGCGAGTCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO:20)
  • Plasmid pDMWP185 was transformed into MD12-778 with selection for
  • Plasmid pDMWP186 was transformed into MD 12-778 with selection for spectinomycin resistance to give strains DP2121 & DP2122. Plasmid pDMWP187 was transformed into MD12-778 with selection for spectinomycin resistance to give strains DP2123 & DP2124. Plasmid pDMWP188 was transformed into MD 12-778 with selection for spectinomycin resistance to give strains DP2125 & DP2126.
  • DP2074 with the original PnarG* promoter, were grown in LA medium with Spectinomycin 50 ⁇ g/mL at 34 °C, 250 rpm. The following day, each culture was diluted 1: 100 into two 125 mL plastic flasks with vented tops containing 25 mL TM3 medium with 8 mM MgS0 4 , 0.02% yeast extract, 10 g/L glucose, and 50 mg/L spectinomycin with or without 5 g/L of potassium nitrate.
  • strains DP2123 and DP2124 with plasmid pDMWP187 and strains DP2125 and DP2126 with plasmid pDMWP188 did not have nitrate induced MVA production.
  • LEI 021 carries plasmid pMCM1225, which has the trc promoter driving expression of mvaE and mvaS, in the same host strain, MD 12-778, used for the PnarG* and mutant promoter plasmids.
  • LEI 021 was made by transformation of MD 12-778 with plasmid pMCM1225 and selection for Spectinomycin resistance.
  • RNAprotect (Qiagen, Germantown, MD). They were left at room temp for 5 min. The samples were then spun for 10 min and the supernatant was discarded. The pellets were then frozen at - 80 °C until RNA isolation was performed. RNA isolation was done using the Qiagen RNeasy Mini kit (Qiagen, Germantown, MD). Lysozyme was used to break up the cells. To TE buffer, 1 mg/mL lysozyme was added. The pellets were then resuspended in 200 ⁇ ⁇ of the
  • RNA concentration was determined by measuring 2 ⁇ L ⁇ of sample on a NanoDrop spectrophotometer (Wilmington, DE). The RNA samples were then stored at -80 °C until qPCR was performed.
  • Quantitative Reverse Transcription PCR analysis was performed as follows. To remove any residual genomic DNA, 3 ⁇ g of total RNA was treated with RNase-free DNase (Qiagen, Hilden, Germany). The DNase was then inactivated by 1 mM EDTA and heating to 75 °C for 5 minutes. 1 ⁇ g of DNase-treated RNA was then converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) as per the manufacturer's instructions. cDNA was then diluted 1: 10 in water for qPCR analysis. [0278] qPCR was performed for the target genes.
  • Real-time PCR reactions included 10 pmoles each of forward and reverse primers, 2.5 pmoles of TaqMan probe, 10 ⁇ TaqMan Universal PCR Master Mix-No AmpErase® Uracil-N- Glycosylase (UNG) (Catalog No. PN 4326614, Applied Biosystems), 1 ⁇ 1: 10 diluted cDNA, and 8.5 ⁇ RNase-/ DNase-free water for a total volume of 20 ⁇ per reaction. Reactions were run on the ABI PRISM® 7900 Sequence Detection System under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 sec and annealing at 60 °C for 1 min.
  • UNG TaqMan Universal PCR Master Mix-No AmpErase® Uracil-N- Glycosylase
  • Relative expression was calculated using Data Assist Software v3.01 and the AACt method (Applied Biosystems, Foster City, Ca). The rrsB gene was utilized for data normalization. Relative expression was then calculated by comparing the gene expression in the different strains and growth conditions.
  • the gene expression in the table 4-3 below as well as in Figure 4 is relative to the sample from the first replicate LEI 021 culture without nitrate.
  • Strain DP2074 with the PnarG* promoter had low expression of mvaE and mvaS in the absence of nitrate and expression was induced by 5 g/L potassium nitrate.
  • Strains DP2119 and DP2120 with the TTCACA -35 region also had low expression of mvaE and mvaS in the absence of nitrate and expression was induced by 5 g/L potassium nitrate to a similar level as in DP2074.
  • Plasmid pDMWP193 has the PnarG# promoter driving expression of an isoprene synthase gene in a multicopy Ampicillin-resistant plasmid. It was constructed using a Gibson assembly kit (New England Biolabs) following the manufacturer's directions using two PCR fragments.
  • the template for fragment 1 was pMCM2149 (pTrcAlba(MEA-variant)-MVKdel2 (carb selection, IPTG-inducible)) and the primers were ODMWP345 and ODMWP346.
  • ODMWP345 ACATTCACCACCCTGAATTGACT (SEQ ID NO:21)
  • ODMWP346 TCACACAGGAAACAGCGCCGCTGAG (SEQ ID NO:5)
  • ODMWP347 GTCAATTCAGGGTGGTGAATGTAATACTCCTTAATACCCATC (SEQ ID NO:22)
  • ODMWP348 GCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTG (SEQ ID NO:23)
  • E. coli strain MCM2065 (BL21, Apgl PL.2mKKDyl, GI1.2gltA,
  • yhfSFRTPyddVIspAyhfS, thlFRTtruncIspA, bMVK was transformed with pDMWP170 [pCL- PnarG* mvaE mvaS] and pDMWP193 [PnarG# IspS] with selection for spectinomycin and carbenicillin resistance to construct strains DP2164 and DP2165.
  • strain MCM2065 was transformed with pDMWP186 [pCL-PnarG# mvaE mvaS] and pDMWP193 [PnarG# IspS] with selection for spectinomycin and carbenicillin resistance to construct strains DP2166 and DP2167.
  • the strains used for the small-scale isoprene production assays are shown in the Table 5-1 below.
  • LB media, TM3 media without Yeast extract and MgS0 4> 10% Yeast extract, 1 M MgS0 4 , 50% Glucose, 200 mM IPTG, 50 mg/mL Spectinomycin, 50 mg/mL CarbeniciUin, 10% Sulfuric acid and 100 mM Tris, 100 mM NaCl pH 7.6 buffer were prepared in-house.
  • Aluminum foil seal, 48-well sterile 5 mL block, breathe easier sealing membrane, aluminum foil seal, and 96-well microtiter plates were purchased from VWR.
  • 96-well glass block was purchased from Zinsser Analytic.
  • GC/MS was performed using an Agilent 6890 GC equipped with a 5973N Mass Spectrometer.
  • Supplemented TM3 media was prepared by combining TM media (without MgS0 4 and Yeast extract), 1% Glucose, 8mM MgS0 4 , 0.02% Yeast extract and appropriate antibiotics. 2 mL of day culture started in 48-well sterile block by inoculating overnight culture in
  • TM3 media at 0.2 optical density (OD). Blocks were sealed with breathe easier membrane and incubated for 2 hours at 34 °C, 600 rpm. After 2 hours of growth, OD was measured at 600 nm in the microtiter plate and cells were induced with various concentrations of IPTG or potassium nitrate. OD reading and isoprene specific productivity samples were taken from 2-24 hours post induction. OD measurement was done in the microtiter plate at appropriate dilution in the TM3 media at 600 nm using a SpectraMax Plus 190 (Molecular Devices).
  • the performance metrics of a control strain, MCM2158 (which uses IPTG) are compared here to experimental strains that express genes from the mevalonate pathway and isoprene synthase using the nitrate-inducible promoters PnarG* and PnarG#, DP2165 and DP2166.
  • the relevant performance metrics are cumulative isoprene yield on glucose, volumetric productivity of isoprene and cell performance index.
  • Table 5-2 Stains used in 14 L fermentation
  • Vitamin Solution (per liter): Thiamine hydrochloride 1.0 g, D-(+)-biotin 1.0 g, nicotinic acid 1.0 g, pyridoxine hydrochloride 4.0 g. Each component was dissolved one at a time in DI H 2 0, pH was adjusted to 3.0 with HCl/NaOH, and then the solution was q.s. to volume and filter sterilized with 0.22 micron filter.
  • Macro Salt Solution (per liter): MgS0 4 » 7H 2 0 296 g, citric acid monohydrate 296 g, ferric ammonium citrate 49.6 g. All components were dissolved in water, q.s. to volume and filter sterilized with 0.22 micron filter.
  • Feed solution (per kilogram): Glucose 0.590 kg, DI H 2 0 0.393 kg, K 2 HP0 4 7.4 g, and 100% Foam Blast 882 8.9 g. All components were mixed together and autoclaved. After autoclaving the feed solution, nutrient supplements are added to the feed bottle in a sterile hood. Post sterilization additions to the feed are (per kilogram of feed solution) Macro Salt Solution 5.54mL, Vitamin Solution 6.55 mL, and 1000X Modified Trace Metal Solution 0.82 mL.
  • IPTG solution Either IPTG solution or Potassium Nitrate is added depending on the strain being fed.
  • IPTG solution 1.87 mL of a sterile 10 mg/mL solution is added per kilogram of feed.
  • the inlet gas using to maintain bioreactor backpressure at 0.7 bar gauge and to provide the oxygen to the production organisms was supplied by in house facilities that dilute the inlet gas to a known concentration (7.3 to 8.3 vol oxygen).
  • the batched media had glucose batched in at 9.7 g/L. Induction was achieved by adding either isopropyl-beta-D-l-thiogalactopyranoside (IPTG) or a solution of potassium nitrate depending on the strain being run. A shot of IPTG or Potassium Nitrate was added to the tank to bring the concentration to a specified level when the cells were at an OD 550 of 6. Once the glucose was consumed by the culture, as signaled by a rise in pH, the glucose feed solution was fed to meet metabolic demands at rates less than or equal to 10 g/min. The fermentation was run long enough to determine the maximum cumulative isoprene mass yield on glucose, typically a total of 64 hrs elapsed fermentation time (EFT). Table 5-3: Process conditions
  • Isoprene, Oxygen, Nitrogen, and Carbon Dioxide levels in the off-gas were determined independently by two mass spectrometers, an iSCAN (Hamilton Sundstrand), and a Hiden HPR20 (Hiden Analytical) mass spectrometer.
  • iSCAN Halton Sundstrand
  • Hiden HPR20 Hiden Analytical mass spectrometer
  • citrate, glucose, acetate, and mevalonate concentrations in the fermentor broth were determined in broth samples taken at 4 hour intervals by an HPLC analysis. Concentration in broth samples were determined by comparison of the refractive index response versus a previously generated calibration curve using standard of a known concentration.
  • HPLC HPLC was performed using a Waters Alliance 2695 System and a BioRad - Aminex HPX-87H Ion Exclusion Column (300 mm x 7.8mm Catalog # 125-0140) having a column temperature of 50 °C.
  • the guard column used was a BioRad - Microguard Cation H refill (30 mm x 4.6mm Catalog # 125-0129).
  • the running buffer used was 0.01N H 2 S0 4 with a flow rate of 0.6 mL / min, an approximate running pressure of ⁇ 1100-1200 psi, and an injection volume of 20 microliters. These a Refractive Index reflector was employed (Knauer K-2301). The total runtime was 26 minutes.
  • volumetric productivity [ ⁇ (HGER(t)/1000*68.117)]/[t-t0]
  • DP2166 20130339, 20130397.
  • DP2166 yield is slightly better than DP2165 especially in 20130397 where the batched nitrate is removed, eliminating the inhibitory effect on growth.
  • the 64 hr points were used to populate Table 5-4 above.
  • DP2166 20130339, 20130397.
  • DP2166 production rate is slightly better than DP2165 especially in 20130397 where the batched nitrate is removed, eliminating the inhibitory effect on growth.
  • the 64 hr points were used to populate Table 5-4 above.
  • volumetric productivity [ ⁇ (HGER(t)/1000*68.117)]/[t-t 0 ], where the summation is from t 0 to t. Tank turnaround time is not factored in.
  • Example 6 Titration of nitrate induction of MVA production in 1 L fed batch fermentation
  • the purpose of this example is to describe MVA production by strain DP2074 in a DASGIP micro-reactor. In addition to usual expected induction of MVA production, there was non-specific utilization of nitrate.
  • the E. coli strain designated as DP2074 used in this study was a nitrate-inducible mevalonate (MVA) producing strain with pDMWP170 (pCL-PnarG*-upper-wo lacO)/CTO pgl-
  • each bioreactor vessels were induced with 10 mL each of different concentrations of potassium nitrate solution (Table 6-3) when OD at 600 nm reached approximately 8.
  • the feed solution was supplemented with the same amounts of nitrate solutions to avoid dilutions during the fermentations. Samples were collected periodically for the OD measurements as well as for HPLC analysis for the mevalonate (MVA) and other organic acids production.
  • the purpose of this example is to demonstrate that nitrate is degraded in 14 L fed batch fermentation and in small scale assays and that the degradation was not affected by single mutations in nitrate reductase genes.
  • Nitrate/Nitrite Assay 16 whole broth time point samples from the 14 liter
  • Example 5 The fermentation was performed on a full pathway strain with a nitrate-inducible upper and lower pathway (DP2165), which was induced with 80 mM potassium nitrate at 6.8 hours.
  • the glucose feed bottle also contained 80 mM potassium nitrate so that the concentration of nitrate was kept constant throughout the fermentation.
  • the whole broth samples were centrifuged and their supernatants analyzed via a slightly modified version of the Cayman nitrate/nitrite colorimetric assay kit. The amount of nitrite present in the supernatant was first analyzed.
  • a nitrite standard curve was created in order to quantitate the nitrite concentrations.
  • a 200 ⁇ nitrite standard stock was made by adding 0.1 mL of the reconstituted nitrite standard into 0.9 mL of Assay Buffer. This stock was used for the preparation of the nitrite standard curve, described in Table 7-1.
  • the supernatants for the fermentation time points were diluted 250-fold. A volume of 100 ⁇ ⁇ of each dilution was added to a 96-well plate, also containing the nitrite standard curve. Griess Reagents 1 and 2, which convert nitrite into a deep purple azo compound, were then added to the wells, 50 ⁇ ⁇ each. The color was allowed to develop at room temperature for 10 minutes, and then the absorbance was measured at 540 nm. The nitrite concentrations were then calculated from the nitrite standard curve regression equation.
  • a nitrate standard curve was then created in order to quantitate the total nitrate + nitrite concentrations.
  • a 200 ⁇ nitrate standard stock was made by adding 0.1 mL of the
  • the supernatants for the fermentation time points were diluted 5,000-fold. A volume of 80 ⁇ ⁇ was added to a 96-well plate, also containing the nitrate standard curve.
  • the first step to this assay is the conversion of nitrate to nitrite with nitrate reductase.
  • the Enzyme Cofactor Mixture was first added, 10 ⁇ ⁇ to each well, followed by 10 ⁇ ⁇ of the Nitrate Reductase Mixture. The plate was covered and incubated at room temperature for one hour.
  • the second step of the assay is the addition of the Griess Reagents, which convert nitrite into a deep purple azo compound.
  • This degradation of the inducer could be advantageous for some induction systems where transient induction is desirable.
  • the degradation of nitrate could also simplify downstream processing.
  • a small scale assay was established to test the effect of deletion of each nitrate reductase encoding gene on nitrate metabolism by E. coli BL21.
  • Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narG, encoding a subunit of a nitrate reductase. This deletion strain was retrieved from the Keio collection and the chromosomal
  • DNA was used as a template for PCR with the following primers:
  • M043_A ACTTCGGGTTACATGTGCTG (SEQ ID NO:24)
  • M043_B GAAGTTCTTGTCTTTCGCCA (SEQ ID NO:25)
  • the PCR product was used to transform strain BL21 (Novagen) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation.
  • a kanamycin-resistant transformant was retained and named DP2262.
  • the samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LA medium as the samples. The uninoculated medium blank was measured in this assay at 11.99 mM nitrate and 0.00 mM nitrite The average and standard deviation for the six measurements of each tested strains are shown in the table 7-4 below.
  • Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of nap A, encoding a subunit of the periplasmic nitrate reductase. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers:
  • M043_F GCTATTTTCTCCGCGCCACA (SEQ ID NO:26)
  • M043_G ACAAACATCGCAGCGCAGCC (SEQ ID NO:27)
  • the PCR product was used to transform strain BL21 (Novagen) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation.
  • a kanamycin-resistant transformant was retained and named DP2273.
  • Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narZ, encoding a subunit of an intracellular nitrate reductase. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers:
  • the PCR product was used to transform strain BL21 (Novagen) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation.
  • a kanamycin-resistant transformant was retained and named DP2277.
  • the samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LB medium as the samples. The uninoculated medium blank was measured in this assay at 10.47 mM nitrate and 0.00 mM nitrite The average and standard deviation for the six measurements of each tested strain are shown in the table 7-4 below.
  • Example 8 Nitrate degradation can be decreased by mutations in known nitrate transporters
  • the purpose of this example is to demonstrate that nitrate degradation can be decreased by mutations in both known nitrate transporters.
  • Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narK. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers:
  • M054_A GCGATCCCGCTTTGTTGATC (SEQ ID NO:30)
  • M054_B AGCGTGGGAATTGATAACGA (SEQ ID NO:31)
  • the PCR product was used to transform strain MCM2065 (BL21, Apgl PL.2mKKDyl, GI1.2gltA, yhfSFRTPyddVIspAyhfS, thiFRTtruncIspA, bMVK) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation.
  • a kanamycin-resistant transformant was retained and named DP2301.
  • Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narU. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers.
  • M054_C ATACACACTTACAAGACAGAGG (SEQ ID NO:32)
  • M054_D TCAGTCGTTTACGAATGAGC (SEQ ID NO:33)
  • the PCR product was used to transform strain MCM2065 BL21, Apgl PL.2mKKDyl, GI1.2gltA, yhfSFRTPyddVIspAyhfS, thiFRTtruncIspA, bMVK) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation.
  • a kanamycin-resistant transformant was retained and named DP2305.
  • Strain DP2305 was transformed with plasmid pCP20 encoding a FLP recombinase (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645) with selection for carbeniciUin resistance at 30 °C. A carbenicillin-resistant colony was streaked to an LB plate at 37 °C and individual single colonies were tested for kanamycin resistance at 37 °C and carbeniciUin resistance at 30 °C.
  • Strain DP2301 was used as a donor for generalized transduction mediated by phage Plvir.
  • the recipient strains were LE1213 and LE1214.
  • Kanamycin-resistant transductants were single colony purified and checked by PCR for the narU deletion using primers M054_C and M054_D (above) and for the kanamycin cassette in narK using primers M054_A (above) and ck_Keio_rev.
  • ck_Keio_rev ATAGCCTCTCCACCCAAGCG (SEQ ID NO:34)
  • nitrate+nitrite and nitrite concentrations of the supernatants were measured in triplicate using Cayman Chemical Company' s Nitrate/Nitrite Colorimetric Assay Kit.
  • the samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer.
  • the manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LB medium as the samples.
  • the assay was repeated on two separate days.
  • the uninoculated sample was measured at 14.66 mM nitrate and 0.00 mM nitrite.
  • the average and standard deviation for the six measurements of each tested strain for the two assays are shown tables 8-1 and 8-2 below.
  • strain MCM2065 metabolized most of the nitrate and accumulated substantial nitrite.
  • the double knock-out strains left much more nitrate and accumulated less nitrite.
  • nitrate degradation is substantially decreased, but not eliminated, by double deletion of the narK and narU. It is possible that knock out of the activity of the periplasmic nitrate reductase, Nap, would further decrease the nitrate metabolism.
  • Example 9 Nitrate degradation decrease in a triple mutant strain with deletions in genes encoding both known nitrate transporters and a periplasmic nitrate reductase.
  • the narK, narU double mutant strain DP2338 (example 8) was transformed with plasmid pDMWP208 encoding an arabinose inducible FLP recombinase from pCP20 (Datsenko, K. A. and Wanner, B. L. (2000).
  • pDMWP208 encoding an arabinose inducible FLP recombinase from pCP20 (Datsenko, K. A. and Wanner, B. L. (2000).
  • Proc Natl Acad Sci U S A 97, 6640-6645 with selection for carbenicillin resistance at 30 °C.
  • a single colony was inoculated into liquid culture in LA medium with carbenicillin and grown 30 °C overnight.
  • This culture was diluted and grown to log-phase then induced with arabinose for 1 hour and streaked to an LA plate at 37 °C. Individual single colonies were tested for kanamycin resistance at 37 °C and carbenicillin resistance at 30 °C. One kanamycin and carbenicillin sensitive isolate was retained and named DP2352.
  • the napA::Kan mutation was moved into strain DP2352 by phage Pl-mediated generalized transduction using donor strain DP2275 (napA::KanR CTO pgl- attB::FRT) with selection for Kanamycin resistance.
  • the resultant triple mutant strain was named TV3437.
  • Nitrate/Nitrite Colorimetric Assay Kit Chemical Company's Nitrate/Nitrite Colorimetric Assay Kit. The samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LB medium as the samples. The results are shown in the table 9-1 below.
  • strain MCM2065 metabolized a significant amount of nitrate and accumulated substantial nitrite.
  • the double and triple knock-out strains left more nitrate and accumulated less nitrite.
  • this data showed that the triple mutant is at least as effective as the double mutant in reducing the amount of nitrate degradation.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides compositions and methods for microorganisms that have been engineered to produce and/or to improve efficiency of production of bio-products using nitrate-dependent gene expression control constructs to control the expression of heterologously expressed nucleic acids.

Description

COMPOSITIONS AND METHODS FOR CONTROL OF INDUSTRIAL SCALE
PRODUCTION OF BIO-PRODUCTS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent Application No. 61/920,357, filed December 23, 2013; the disclosure of which is hereby incorporated herein by reference in its entirety.
SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE
[0002] The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 246252008040SeqList.txt, date recorded: December 16, 2014, size: 7 KB).
FIELD OF THE INVENTION
[0003] This invention provides compositions and methods for the control of industrial scale production of bio-products produced by genetically engineered microorganisms and methods to produce and/or to improve the production of bio-products by microorganisms.
BACKGROUND OF THE INVENTION
[0004] Industrial scale production of bio-products can be improved using microorganisms genetically engineered to express one or more heterologous nucleic acids. Production can be further improved if heterologous gene expression can be regulated so that bio-product production is "off when microorganisms are cultured as a seed stock under conditions suitable for initially establishing a population for large scale production. Production can further be improved if heterologous gene expression can then be turned "on" once the seed stock has been placed into a suitable bioreactor to begin large-scale fermentation. Currently, many
microorganisms are engineered for the production of bio-products using heterologous genes under the control of promoters activated by specific chemical compounds such as isopropyl thiogalactoside (IPTG), which can be added at the bioreactor stage to start the production process. Unfortunately, compounds such as IPTG can be cost prohibitive. Therefore, alternative means for controlling gene regulation in engineered microorganisms during the industrial production of bio-products are desirable.
[0005] Throughout this specification, various patents, patent applications and other types of publications (e.g., journal articles) are referenced. The disclosure of all patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety for all purposes.
BRIEF SUMMARY OF THE INVENTION
[0006] The present invention provides, inter alia, nitrate-inducible gene expression constructs useful for expressing heterologous polynucleotides in microorganisms for the production of one or more bio-products.
[0007] Accordingly, in some aspects, provided herein are recombinant bacterial cells comprising a gene expression construct comprising a PnarG nitrate-dependent promoter operably linked to one or more nucleic acids encoding a gene of interest; and wherein said cell further comprises one or more modifications to increase the expression of one or more nitrate regulation genes. In some embodiments, said PnarG nitrate dependent promoter is a PnarG mutant. In some embodiments of any of the embodiments provided herein, said PnarG mutant is
PnarG*. In some embodiments of any of the embodiments provided herein, said PnarG mutant is PnarG#. In some embodiments of any of the embodiments provided herein, said one or more nitrate regulation genes is operably linked to a strong promoter. In some embodiments of any of the embodiments provided herein, said one or more nitrate regulation genes is operably linked to a constitutive promoter. In some embodiments of any of the embodiments provided herein, said one or more nitrate regulation genes is selected from the group consisting of NarL, NarX or
NarK. In some embodiments of any of the embodiments provided herein, said cell is further modified to comprise a down-regulation of one or more nitrate metabolism genes. In some embodiments, said one or more nitrate metabolism genes comprise a nitrate reductase gene or a nitrate transporter gene. In some embodiments, the nitrate reductase gene is one or more of narG, narZ, or napA. In some embodiments, the nitrate transporter gene is one or more of narK or narU. In some embodiments of any of the embodiments provided herein, said cell comprises a deletion of one or more nitrate metabolism genes. In some embodiments of any of the embodiments provided herein, said bacterial cell is a gram(-) bacteria. In some embodiments of any of the embodiments provided herein, said bacterial cell is E. coli. In some embodiments of any of the embodiments provided herein, said bacterial cell is E. coli B strain. In some embodiments of any of the embodiments provided herein, said gene of interest is selected from the upper MVA pathway. In some embodiments of any of the embodiments provided herein, said gene of interest is selected from the lower MVA pathway. In some embodiments of any of the embodiments provided herein, said gene of interest is an isoprene synthase.
[0008] In other aspects, provided herein are methods for regulating the expression of a gene of interest comprising: culturing the recombinant bacterial cell of any of the embodiments of the recombinant bacterial cells provided herein in a culture media comprising a nitrate-containing compound, thereby activating the expression of said gene of interest. In some embodiments of any of the embodiments disclosed herein, said nitrate-containing compound is a nitrate salt. In some embodiments said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate.
[0009] In other aspects, provided herein are methods for producing an isoprenoid precursor, said method comprising culturing the recombinant bacterial cell of any of the embodiments of the recombinant bacterial cells provided herein in a culture media comprising a nitrate- containing compound, thereby activating the expression of a gene of interest selected from: (i) the upper MVA pathway and/or (ii) the lower MVA pathway and producing said isoprenoid precursor. In some embodiments of any of the embodiments disclosed herein, said nitrate- containing compound is a nitrate salt. In some embodiments said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate.
[0010] In other aspects, provided herein are methods for producing isoprene, said method comprising culturing the recombinant bacterial cell of any of the embodiments of the
recombinant bacterial cells provided herein in a culture media comprising a nitrate-containing compound, thereby activating the expression of a gene of interest selected from: (i) the upper MVA pathway; (ii) the lower MVA pathway; and (iii) isoprene synthase and producing said isoprene. In some embodiments of any of the embodiments disclosed herein, said nitrate- containing compound is a nitrate salt. In some embodiments, said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate. [0011] In another aspect, provided herein are nitrate-inducible promoters for expression of a gene of interest in a host cell comprising one or more nucleic acid substitutions at a nucleotide position located -10 bp and -35 bp from a transcriptional start site, wherein the nucleic acid sequence at the nucleotide position located -10 bp from the transcriptional start site comprises TATAAT. In some embodiments, the nucleic acid sequence at the nucleotide position located - 35 bp from the transcriptional start site comprises TTGCCA or TTCACA. In some
embodiments of any of the embodiments disclosed herein, the promoter is capable of expressing the gene of interest in a host cell when cultured under aerobic and/or anaerobic conditions. In some embodiments of any of the embodiments disclosed herein, the promoter is capable of expressing a gene of interest in response to nitrate at levels at least about 50% higher in comparison to expression of the same gene of interest when operably linked to the PnarG* promoter. In some embodiments of any of the embodiments disclosed herein, the nucleotide sequence of the nitrate-inducible promoter comprises
aatactccttaatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaacgtcttaatttacagtctgttatgtggtggctgttaa ttatcctaaaggggtatcttaggaatttactttatttttcatccccatcactcttggtcgttatcaattgccacgctgtttcagagcggtataatgccc tta (SEQ ID NO: l). In some embodiments of any of the embodiments disclosed herein, the nitrate-inducible promoter is PnarG#.
[0012] In other aspects, provided herein are vectors comprising the nitrate-inducible promoter of any of the embodiments disclosed herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1 depicts an exemplary representation of a plasmid pDMWP170 for nitrate induction of gene expression comprising a mutant narG promoter.
[0014] FIG. 2 depicts MVA production following induction by nitrate.
[0015] FIG. 3 depicts nitrate-induced gene expression of mvaE and mvaS relative to samples cultured without nitrate.
[0016] FIG. 4 depicts real time qPCR data comparing the PnarG* and PnarG# promoters.
[0017] FIG. 5 depicts growth rate analysis for IPTG inducible control strain vs nitrate- inducible test strains. [0018] FIG. 6 depicts IspS specific productivity analysis for IPTG inducible control strain vs nitrate-inducible test strains.
[0019] FIG.7 depicts cumulative yield of isoprene on glucose achieved in each 15 L fermentation over time; DP2165 induced at 800 μΜ nitrate (closed triangles); DP2165 induced at 8,000 μΜ nitrate (closed squares); DP2165 induced at 80,000 μΜ nitrate (closed diamonds); DP2165 induced at 80,000 μΜ nitrate (open diamonds); MCM2158 induced at 100 μΜ IPTG (stars).
[0020] FIG. 8 depicts volumetric productivity achieved in each 15 L fermentation over time; DP2165 induced at 800 μΜ nitrate (closed triangles); DP2165 induced at 8,000 μΜ nitrate (closed squares); DP2165 induced at 80,000 μΜ nitrate (closed diamonds); DP2165 induced at 80,000 μΜ nitrate (open diamonds); MCM2158 induced at 100 μΜ IPTG (stars).
[0021] FIG. 9 depicts cell performance index (CPI) achieved in each 15 L fermentation over time; DP2165 induced at 800 μΜ nitrate (closed triangles); DP2165 induced at 8,000 μΜ nitrate (closed squares); DP2165 induced at 80,000 μΜ nitrate (closed diamonds); DP2165 induced at 80,000 μΜ nitrate (open diamonds); MCM2158 induced at 100 μΜ IPTG (stars).
[0022] FIG. 10 depicts cumulative yield of isoprene on glucose achieved in each 15 L fermentation over time; DP2165 induced at 80,000 μΜ nitrate (closed triangles); DP2165 induced at 80,000 μΜ nitrate (closed squares); DP2166 induced at 80,000 μΜ nitrate (closed diamonds); DP2166 induced at 80,000 μΜ nitrate (open diamonds); MCM2158 induced at 100 μΜ IPTG (stars).
[0023] FIG. 11 depicts overall volumetric productivity achieved in each 15 L fermentation over time; DP2165 induced at 80,000 μΜ nitrate (closed triangles); DP2165 induced at 80,000 μΜ nitrate (closed squares); DP2166 induced at 80,000 μΜ nitrate (closed diamonds); DP2166 induced at 80,000 μΜ nitrate (open diamonds); MCM2158 induced at 100 μΜ IPTG (stars).
[0024] FIG. 12 depicts cell performance index (CPI) achieved in each 15 L fermentation over time; DP2165 induced at 80,000 μΜ nitrate (closed triangles); DP2165 induced at 80,000 μΜ nitrate (closed squares); DP2166 induced at 80,000 μΜ nitrate (closed diamonds); DP2166 induced at 80,000 μΜ nitrate (open diamonds); MCM2158 induced at 100 μΜ IPTG (stars). [0025] FIG. 13 depicts supernatant concentrations of nitrate (A) and nitrite (B).
[0026] FIG. 14 depicts growth plots with various nitrate induction.
[0027] FIG. 15 depicts MVA production with various nitrate induction as measured by HPLC.
[0028] FIG. 16 depicts a replot of nitrate induced MVA production at various fermentation time points.
[0029] FIG. 17 shows the classical and modified MVA pathways. 1, acetyl-CoA
acetyltransferase (AACT); 2, HMG-CoA synthase (HMGS); 3, HMG-CoA reductase (HMGR); 4, mevalonate kinase (MVK); 5, phosphomevalonate kinase (PMK); 6, diphosphomevalonate decarboxylase (MVD or DPMDC); 7, isopentenyl diphosphate isomerase (ID I); 8,
phosphomevalonate decarboxylase (PMDC); 9, isopentenyl phosphate kinase (IPK). The classical MVA pathway proceeds from reaction 1 through reaction 7 via reactions 5 and 6, while a modified MVA pathway goes through reactions 8 and 9. P and PP in the structural formula are phosphate and pyrophosphate, respectively. This figure was taken from Koga and Morii, Microbiology and Mol. Biology Reviews, 71:97-120, 2007, which is incorporated by reference in its entirety, particularly with respect to nucleic acids and polypeptides of the modified MVA pathway. The modified MVA pathway is present, for example, in some archaeal organisms, such as Methanosarcina mazei.
[0030] FIG. 18 shows a schematic representation of an obligate anaerobe expressing (a) a heterologous IspS polypeptide, (b) a heterologous DXS polypeptide, and (c) a heterologous IDI polypeptide to increase DXP pathway flux and isoprene production.
[0031] FIG. 19 shows a schematic representation of an obligate anaerobe engineered with mvaE and mvaS to express the upper MVA pathway.
[0032] FIG. 20 shows a schematic representation of expressing the lower MVA pathway in an obligate anaerobe including expressing (a) a heterologous MVK polypeptide, (b) a heterologous PMK polypeptide, and (c) a heterologous MVD polypeptide in the cells expressing heterologous IDI polypeptide and heterologous IspS polypeptide for the purpose of increasing isoprene production. [0033] FIG. 21 shows a schematic representation of expressing the entire MVA pathway in an obligate anaerobe by introducing mvaE and mvaS in the cells expressing (a) a heterologous MVK polypeptide, (b) a heterologous PMK polypeptide, (c) a heterologous MVD polypeptide, (d) a heterologous IDI polypeptide, and (e) a heterologous IspS polypeptide for the purpose of increasing isoprene production.
[0034] FIG. 22 shows a schematic representation of redirecting carbon flux away from acetate by reducing expression of ack and adhE to reduce loss of carbon to side products. The arrows next to Ack or AdhE used in the production of acetate and ethanol, respectively, indicate a reduction of activity or enzyme expression for pathways leading to fermentation products such as acetate, ethanol, or any other alcohol, or carbon containing end product. The purpose is to maximize carbon channeling to isoprene via genetic manipulation.
[0035] FIG. 23 shows exemplary pathways for production of butadiene from acetyl-CoA, glutaconyl-CoA, glutaryl-CoA, 3-aminobutyryl-CoA or 4-hydroxybutyryl-CoA via crotyl alcohol. Enzymes for transformation of the identified substrates to products include: A. acetyl- CoA:acetyl-CoA acyltransferase, B. acetoacetyl-CoA reductase, C. 3-hydroxybutyryl-CoA dehydratase, D. crotonyl-CoA reductase (aldehyde forming), E. crotonaldehyde reductase (alcohol forming), F. crotyl alcohol kinase, G. 2-butenyl-4-phosphate kinase, H. butadiene synthase, I. crotonyl-CoA hydrolase, synthetase, transferase, J. crotonate reductase, K. crotonyl- CoA reductase (alcohol forming), L. glutaconyl-CoA decarboxylase, M., glutaryl-CoA dehydrogenase, N. 3-aminobutyryl-CoA deaminase, O. 4-hydroxybutyryl-CoA dehydratase, P. crotyl alcohol diphosphokinase.
[0036] FIG. 24 shows exemplary pathways for production of butadiene from erythrose-4- phosphate. Enzymes for transformation of the identified substrates to products include: A.
Erythrose-4-phosphate reductase, B. Erythritol-4-phospate cytidylyltransferase, C. 4-(cytidine 5'- diphospho)-erythritol kinase, D. Erythritol 2,4-cyclodiphosphate synthase, E. l-Hydroxy-2- butenyl 4-diphosphate synthase, F. l-Hydroxy-2 -butenyl 4-diphosphate reductase, G. Butenyl 4- diphosphate isomerase, H. Butadiene synthase I. Erythrose-4-phosphate kinase, J. Erythrose reductase, K. Erythritol kinase.
[0037] FIG. 25 shows an exemplary pathway for production of butadiene from malonyl-CoA plus acetyl-CoA. Enzymes for transformation of the identified substrates to products include: A. malonyl-CoA:acetyl-CoA acyltransferase, B. 3-oxoglutaryl-CoA reductase (ketone -reducing), C. 3-hydroxyglutaryl-CoA reductase (aldehyde forming), D. 3-hydroxy-5-oxopentanoate reductase, E. 3,5-dihydroxypentanoate kinase, F. 3H5PP kinase, G. 3H5PDP decarboxylase, H. butenyl 4- diphosphate isomerase, I. butadiene synthase, J. 3-hydroxyglutaryl-CoA reductase (alcohol forming), K. 3-oxoglutaryl-CoA reductase (aldehyde forming), L. 3, 5 -dioxopentanoate reductase (ketone reducing), M. 3, 5 -dioxopentanoate reductase (aldehyde reducing), N. 5- hydroxy-3-oxopentanoate reductase, O. 3-oxo-glutaryl-CoA reductase (CoA reducing and alcohol forming). Compound abbreviations include: 3H5PP = 3-Hydroxy-5- phosphonatooxypentanoate and 3H5PDP = 3-Hydroxy-5- [hydroxy(phosphonooxy)phosphoryl]oxy pentanoate.
DETAILED DESCRIPTION OF THE INVENTION
[0038] This invention provides, inter alia, nitrate-dependent or nitrate-regulated gene expression constructs useful for regulating the expression of endogenous and/or heterologous genes in microorganisms. The inventors have discovered that the nitrate-inducible gene expression constructs described herein are ideal for controlling gene expression in engineered microorganisms during the industrial production of one or more bio-products. Gene expression and bio-product production can be readily turned "off {i.e. one or more genes of interest for the production of one or more bio-products are not expressed or expressed at decreased levels) when engineered microorganisms are cultured as a seed stock in the absence of a nitrate salt. The seed stock can therefore be maintained under conditions suitable for initially establishing a population of microorganisms for large scale production of a bio-product without having to devote metabolic resources to producing that bio-product. Following the establishment of a suitable population of microorganisms for large scale production of a bio-product, gene expression in the engineered microorganism can then be turned "on" to begin large-scale fermentation by addition of a nitrate salt to the culture media. Control of gene expression using these nitrate-regulated gene expression constructs and associated nitrate-dependent promoters may be turned on under aerobic and/or anaerobic growth conditions. Such a system is considerably more cost effective than current methods utilizing relatively expensive chemicals such as IPTG to turn on inducible promoters. /. General Techniques
[0039] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques),
microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Biotechnology: A Textbook of Industrial Microbiology (Brock, Sinauer Associates, Inc., Second Edition, 1989), Molecular Cloning: A Laboratory Manual (Sambrook et al., 1989, 2nd ed.); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Enzvmology (Academic Press, Inc.); Current Protocols in
Molecular Biology (F.M. Ausubel et al., eds., 1987, and periodic updates); PCR: The
Polymerase Chain Reaction (Mullis et al., eds., 1994), Dictionary of Microbiology and
Molecular Biology (Singleton et al., 2nd ed., J. Wiley and Sons, New York, NY, 1994); and
Advanced Organic Chemistry Reactions, Mechanisms and Structure (March, 4th ed., John Wiley and Sons, New York, NY, 1992), which provide one skilled in the art with a general guide to many of the terms and methods used in the present disclosure. Additional methods used in the Examples are described in manuals including Advanced Bacterial Genetics (Davis, Roth and Botstein, Cold Spring Harbor Laboratory, 1980), Experiments with Gene Fusions (Silhavy, Berman and Enquist, Cold Spring Harbor Laboratory, 1984), Experiments in Molecular Genetics (Miller, Cold Spring Harbor Laboratory, 1972) Experimental Techniques in Bacterial Genetics (Maloy, in Jones and Bartlett, 1990), and A Short Course in Bacterial Genetics (Miller, Cold Spring Harbor Laboratory 1992).
[0040] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
//. Definitions
[0041] Nitrate reductase (nar) is used herein to describe any one of the respiratory nitrate reductase proteins, including active subunits of two nitrate reductase (NAR) complexes: narA, encoded by the narGHJI operon, and narZ, encoded by the narZYWV operon. NAR protein references available on GenBank™ include narG (AP OO 1852), narZ, narY, narW, and narV incorporated herein by reference. [0042] "Nitrate transporter" is used herein as in the art to describe any one of the nitrate transporter or nitrate/nitrite antiporter proteins including narK and narU.
[0043] "Industrial bio-products" or "bio-products" can include, but are not limited to, isoprene, isoprenoids, isoprenoid precursors, butadiene and ethanol. Industrial products can also include, but are not limited to, bio-products derived directly or indirectly from 2-keto acids, malonyl-CoA, and acetoacetyl-CoA. Industrial bio-products can also include, but are not limited to, monoterpenes, diterpenes, triterpenes, tetraterpenes, sequiterpene, polyterpene, abietadiene, amorphadiene, carene, a-farnesene, β-farnesene, farnesol, geraniol, geranylgeraniol, linalool, limonene, myrcene, nerolidol, ocimene, patchoulol, β-pinene, sabinene, γ-terpinene, terpindene, valencene. Industrial bio-products can further include, but are not limited to, non-fermentative alcohols (e.g. , 1-propanol, 1-butanol, isobutanol, 2-methyl- l-butanol, 3-methyl- l-butanol, 3- methyl- 1-pentanol, 4-methtyl- l-pentanol and 1-hexanol), fatty acid-derived hydrocarbons (fatty alcohols, fatty esters, olefins, and alkanes), and fermentative alcohols (e.g. , butanol). Industrial bio-products can also include, but are not limited to, enzyme products such as amylases, cellulases, glucyltransferases ("gtf '), lipases, xylanases, proteases, phytases, etc. or protein products such as aquaporins.
[0044] "Isoprene" refers to 2-methyl-l,3-butadiene (CAS# 78-79-5). It can refer to the direct and final volatile C5 hydrocarbon product from the elimination of pyrophosphate from 3,3- dimethylallyl pyrophosphate (DMAPP). Isoprene is not limited by the method of its
manufacture.
[0045] A "nucleic acid" or "polynucleotide" refers to two or more deoxyribonucleotides and/or ribonucleotides in either single or double- stranded form.
[0046] A "nucleic acid of interest" refers to a polynucleotide encoding a polypeptide that is a part of the synthetic pathway for any industrial product. Alternatively, a "nucleic acid of interest" can refer to a polynucleotide encoding a polypeptide that is the desired product of a bio-process (e.g. , an industrial bio-product).
[0047] An "endogenous nucleic acid" is a nucleic acid whose nucleic acid sequence is naturally found in the host cell. In some aspects, an endogenous nucleic acid is identical to a wild-type nucleic acid that is found in the host cell in nature. In some aspects, one or more copies of endogenous nucleic acids are introduced into a host cell. [0048] A "heterologous nucleic acid" can be a nucleic acid whose nucleic acid sequence is from another species than the host cell or another strain of the same species of the host cell. In some aspects, the sequence is not identical to that of another nucleic acid naturally found in the same host cell. In some aspects, a heterologous nucleic acid is not identical to a wild-type nucleic acid that is found in the same host cell in nature. In various embodiments of the invention, a heterologous nucleic acid encodes for one or more polypeptide components of a biosynthetic pathway for the production of industrial bio-products.
[0049] "Polypeptides" includes polypeptides, proteins, peptides, fragments of polypeptides, fusion polypeptides and variants.
[0050] An "endogenous polypeptide" is a polypeptide whose amino acid sequence is naturally found in the host cell. In some aspects, an endogenous polypeptide is identical to a wild-type polypeptide that is found in the host cell in nature.
[0051] A "heterologous polypeptide" is a polypeptide encoded by a heterologous nucleic acid. In some aspects, the sequence is not identical to that of another polypeptide encoded by a nucleic acid naturally found in the same host cell.
[0052] As used herein, the terms "minimal medium" or "minimal media" refer to growth medium containing the minimum nutrients possible for cell growth, generally without the presence of amino acids. Minimal medium typically contains: (1) a carbon source for bacterial growth; (2) various salts, which can vary among bacterial species and growing conditions; and (3) water. The carbon source can vary significantly, from simple sugars like glucose to more complex hydrolysates of other biomass, such as yeast extract, as discussed in more detail below. The salts generally provide essential elements such as magnesium, nitrogen, phosphorus, and sulfur to allow the cells to synthesize proteins and nucleic acids. Minimal medium can also be supplemented with selective agents, such as antibiotics, to select for the maintenance of certain plasmids and the like. For example, if a microorganism is resistant to a certain antibiotic, such as ampicillin or tetracycline, then that antibiotic can be added to the medium in order to prevent cells lacking the resistance from growing. Medium can be supplemented with other compounds as necessary to select for desired physiological or biochemical characteristics, such as particular amino acids and the like. [0053] As used herein, the term "isoprenoid" refers to a large and diverse class of naturally- occurring class of organic compounds composed of two or more units of hydrocarbons, with each unit consisting of five carbon atoms arranged in a specific pattern. As used herein, "isoprene" is expressly excluded from the definition of "isoprenoid."
[0054] As used herein, the term "terpenoid" refers to a large and diverse class of organic molecules derived from five-carbon isoprenoid units assembled and modified in a variety of ways and classified in groups based on the number of isoprenoid units used in group members. Hemiterpenoids have one isoprenoid unit. Monoterpenoids have two isoprenoid units.
Sesquiterpenoids have three isoprenoid units. Diterpenoids have four isoprene units.
Sesterterpenoids have five isoprenoid units. Triterpenoids have six isoprenoid units.
Tetraterpenoids have eight isoprenoid units. Polyterpenoids have more than eight isoprenoid units.
[0055] As used herein, "isoprenoid precursor" refers to any molecule that is used by organisms in the biosynthesis of terpenoids or isoprenoids. Non-limiting examples of isoprenoid precursor molecules include, e.g., isopentenyl pyrophosphate (IPP) and dimethylallyl diphosphate (DMAPP).
[0056] As used herein, the term "mass yield" refers to the mass of the product produced by the bacterial cells divided by the mass of the glucose consumed by the bacterial cells multiplied by 100.
[0057] By "specific productivity," it is meant the mass of the product produced by the bacterial cell divided by the product of the time for production, the cell density, and the volume of the culture.
[0058] By "titer," it is meant the mass of the product produced by the bacterial cells divided by the volume of the culture.
[0059] As used herein, the term "cell productivity index (CPI)" refers to the mass of the product produced by the bacterial cells divided by the mass of the bacterial cells produced in the culture. [0060] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0061] As used herein, the singular terms "a," "an," and "the" include the plural reference unless the context clearly indicates otherwise.
[0062] It is intended that every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
///. Nitrate-sensitive gene expression constructs
[0063] Expression of the narGHJI operon, which encodes nitrate reductase in microorganisms such as E. coli, is controlled by proteins encoded by the genes, far, narL, and narX. The Fnr protein activates transcription of the narGHJI operon and a number of other genes important for anaerobic metabolism. Fnr binds to a highly conserved palindromic DNA sequence (Fnr box) in the promoter region of the narGHJI operon centered at a position approximately 40 bp from the start site of transcription ("-40 bp"; Walker & DeMoss, 1992, J. Bacteriol, 174(4): 1119-23).
[0064] Gene expression in microorganisms such as E. coli in response to the presence of nitrate is mediated by the narL/narX two component regulatory system. NarL is a DNA binding protein that, in the presence of nitrate, is phosphorylated by narX, otherwise known as histidine kinase (Walker & DeMoss, 1993, J. Biol. Chem., 268(12):8391-93). In response to the presence of nitrate, the narX-phosphorylated narL protein stimulates anaerobic transcription of the narGHJI promoter through interaction with a ds-acting sequence located approximately 200 bp upstream of the start site of transcription.
[0065] In the narG promoter (PnarG), as generally found for positively-regulated promoters, the -10 and -35 sequences are poorly conserved analogues of the -10 and -35 consensus sequences recognized by the σ -RNA polymerase of E. coli (Newman & Cole, 1978, J. Gen. Microb., 106: 1-21). On the basis of promoter reconstruction studies, Walker and DeMoss (1992, J. Bacteriol., 174(4): 1119-23) discovered that anaerobic expression of narG could be completely abolished by mutation of a single base in the -10 hexamer. However, they also determined that a 3 base change in this region to create a consensus TATAAT σ 70 -RNA polymerase sequence and a mutation in the Fnr binding site to create the sequence
TTGGTCGTTATCAA (SEQ ID NO:2) resulted in strong anaerobic as well as aerobic gene expression in response to the presence of nitrate. As used herein, this modified narG promoter is known as "PnarG*."
[0066] It is to be understood that compositions and/or systems, methods of making and using these aspects and/or embodiments are encompassed within the scope of the invention.
A. Exemplary Nucleic Acids and Polypeptides
[0067] The inventors have created (and herein describe) polynucleotides, polypeptides, plasmids, vectors, expression systems, host cells, etc. based on the components of a nitrate- dependent expression control system, as well as methods of making and using these components to facilitate the genetic manipulation of microorganisms to produce one or more bio-products such as (but not limited to) isoprene, butadiene, isoprenoids, and ethanol.
1. Nucleic Acids
[0068] Various nucleic acids as components of the gene expression control system, or encoding components of the nitrate-dependent expression control system described herein, including nucleic acids comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP), nitrate-dependent promoters, one or more genes of interest and other polypeptides and nucleic acids can be used (either individually or in any combination) in the compositions and methods as described herein.
[0069] In some embodiments, the nucleic acid has one or more mutations compared to the sequence of a wild-type {i.e., a sequence occurring in nature) nucleic acid comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP), nitrate-dependent promoters, or one or more genes of interest. In some embodiments, the nucleic acid has one or more mutations (e.g. , a silent mutation) that increase the transcription or translation of the nucleic acid. In some embodiments, the nucleic acid is a degenerate variant of any nucleic acid encoding an polynucleotide comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP), nitrate-dependent promoters, or one or more genes of interest.
[0070] As will be understood by those skilled in the art, the polynucleotide sequences of this invention can include genomic sequences, extra-genomic and plasmid-encoded sequences and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, peptides and the like. Such segments may be naturally isolated, or modified synthetically by the hand of man.
[0071] Polynucleotides may be single- stranded (coding or antisense) or double-stranded, and may be DNA (genomic, cDNA or synthetic) or RNA molecules. Additional coding or non- coding sequences may, but need not, be present within a polynucleotide of the present invention, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.
[0072] Polynucleotides may comprise a native sequence (i.e. , an endogenous sequence) or may comprise a variant, or a biological functional equivalent of such a sequence.
Polynucleotide variants may contain one or more substitutions, additions, deletions and/or insertions. In some embodiments, the enzymatic activity of the encoded polypeptide is not substantially diminished relative to the unmodified polypeptide. In some embodiments, the enzymatic activity of the encoded polypeptide is improved (e.g., optimized) relative to the unmodified polypeptide. In other embodiments, the enzymatic activity of the encoded polypeptide is substantially diminished relative to the unmodified polypeptide. The effect on the enzymatic activity of the encoded polypeptide may generally be assessed as described herein.
[0073] As will be understood by those of skill in the art, it may be advantageous in some instances to produce polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence. Such nucleotides are typically referred to as "codon-optimized." Any of the nucleotide sequences described herein may be utilized in such a "codon-optimized" form. Moreover, the polynucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter polypeptide encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, expression and/or activity of the gene product.
[0074] Polynucleotides may comprise a "heterologous nucleic acid," whose sequence is from another species than the host cell or another strain of the same species of host cell. In some embodiments, the sequence is not identical to that of another nucleic acid naturally found in the same host cell. In some embodiments, a heterologous nucleic acid is not identical to a wild-type nucleic acid that is found in the same host cell in nature.
[0075] The polynucleotides of the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a polynucleotide fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
[0076] Polynucleotides and fusions thereof may be prepared, manipulated and/or expressed using any of a variety of well-established techniques known and available in the art. For example, polynucleotide sequences which encode polypeptides of the invention, or fusion proteins or functional equivalents thereof, may be used in recombinant DNA molecules to direct expression of a selected enzyme in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences that encode substantially the same or a functionally equivalent amino acid sequence may be produced and these sequences may be used to clone and express a given polypeptide. a. Nitrate-regulatory genes
[0077] In some aspects, any of the microorganism host cells disclosed herein comprising any of the nitrate-dependent gene expression constructs disclosed herein can further comprise one or more nucleic acids encoding one or more nitrate -regulatory polypeptides. Said one or more nucleic acids encoding one or more nitrate-regulatory polypeptides can be endogenous or heterologous. The nitrate-regulatory polypeptides can be any polypeptide involved in the regulation and metabolism of nitrate in a host cell. Non-limiting examples of nitrate-regulatory polypeptides include narX, narL, narP, and narQ.
[0078] In some embodiments, any of the microorganism host cells disclosed herein
comprising any of the nitrate-dependent gene expression constructs disclosed herein further comprises a nucleic acid encoding a narL polypeptide. In many microorganisms, the
polypeptide encoded by the narL gene activates the expression of the nitrate reductase (narGHJI) and formate dehydrogenase-N (fdnGHI) operons and represses the transcription of the fumarate reductase (frdABCD) operon in response to a nitrate/nitrite induction signal transmitted by either the narX or narQ proteins. In some embodiments, the narL polypeptide encoded by the nucleic acid has a polypeptide sequence according to UniProt accession number P0AF28. In some embodiments, the nucleic acid encoding a narL polypeptide is a heterologous nucleic acid. In other embodiments, nucleic acid encoding a narL polypeptide is an additional copy of an endogenous nucleic acid. In further embodiments, the nucleic acid encoding a narL polypeptide is operably linked to a high copy promoter. In another embodiment, the nucleic acid encoding a narL polypeptide is under the control of a constitutive promoter (for example, a constitutive glucose isomerase promoter PI.5). In a further embodiment, the constitutive promoter is a strong promoter.
[0079] In some embodiments, any of the microorganism host cells disclosed herein
comprising any of the nitrate-dependent gene expression constructs disclosed herein further comprises a nucleic acid encoding a narX polypeptide. In many microorganisms, the
polypeptide encoded by the narX gene acts as a sensor for nitrate/nitrite and transduces signal of nitrate availability to the NarL protein and of both nitrate/nitrite to the narP protein. narX activates narL and narP by phosphorylation in the presence of nitrate. narX also plays a negative role in controlling narL activity, probably through dephosphorylation in the absence of nitrate. In some embodiments, the narX polypeptide encoded by the nucleic acid has a polypeptide sequence according to UniProt accession number P0AFA2. In some embodiments, the nucleic acid encoding a narX polypeptide is a heterologous nucleic acid. In other embodiments, nucleic acid encoding a narX polypeptide is an additional copy of an endogenous nucleic acid. In further embodiments, the nucleic acid encoding a narX polypeptide is operably linked to a high copy promoter. In another embodiment, the nucleic acid encoding a narX polypeptide is under the control of a constitutive promoter (for example, a constitutive glucose isomerase promoter PI.5). In a further embodiment, the constitutive promoter is a strong promoter.
[0080] In some embodiments, any of the microorganism host cells disclosed herein
comprising any of the nitrate-dependent gene expression constructs disclosed herein further comprises a nucleic acid encoding a narK polypeptide. In many microorganisms, the
polypeptide encoded by the narK gene permits nitrate and nitrite transport into the host cell. In some embodiments, the narK polypeptide encoded by the nucleic acid has a polypeptide sequence according to UniProt accession number P71995. In some embodiments, the nucleic acid encoding a narK polypeptide is a heterologous nucleic acid. In other embodiments, nucleic acid encoding a narK polypeptide is an additional copy of an endogenous nucleic acid. In further embodiments, the nucleic acid encoding a narK polypeptide is operably linked to a high copy promoter. In another embodiment, the nucleic acid encoding a narK polypeptide is under the control of a constitutive promoter (for example, a constitutive glucose isomerase promoter PI.5). In a further embodiment, the constitutive promoter is a strong promoter.
2. Polypeptides
[0081] In some embodiments, the polypeptide is an isolated polypeptide. As used herein, an "isolated polypeptide" is not part of a library of polypeptides, such as a library of 2, 5, 10, 20, 50 or more different polypeptides and is separated from at least one component with which it occurs in nature. An isolated polypeptide can be obtained, for example, by expression of a recombinant nucleic acid encoding the polypeptide.
[0082] In some embodiments, the polypeptide is a heterologous polypeptide (such as a polypeptide encoded by a nitrate-regulatory gene, for example, a narX, narL, narP, and/or narQ polypeptide). By "heterologous polypeptide" it is meant a polypeptide whose amino acid sequence is not identical to that of another polypeptide naturally expressed in the same host cell. In particular, a heterologous polypeptide is not identical to a wild-type polypeptide that is found in the same host cell in nature.
[0083] In order to express a desired polypeptide, a nucleotide sequence encoding the polypeptide, or a functional equivalent, may be inserted into appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding a polypeptide of interest and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook et ah, Molecular Cloning, A Laboratory Manual (1989), and Ausubel et ah, Current Protocols in Molecular Biology (1989).
[0084] "Polypeptide," "polypeptide fragment," "peptide" and "protein" are used
interchangeably herein to refer to a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers. Polypeptides include the polypeptides involved in the regulatable nitrate- dependent gene expression constructs as described herein, including genes of interests, such as enzymatic polypeptides, or "enzymes," which typically catalyze (i.e., increase the rate of) various chemical reactions, such as the enzymes of metabolic pathways as described herein or polypeptides comprising one or more nitrate regulatory genes (for example, narL, narX, narQ, or narP).
[0085] "Sequence identity," as used herein, refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity" may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
[0086] Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
[0087] Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et ah, 1997, Nucl. Acids Res. 25:3389. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et ah, "Current Protocols in Molecular Biology", John Wiley & Sons Inc., 1994-1998, Chapter 15.
[0088] Additionally, standard sequence alignment and/or structure prediction programs can be used to identify additional genes of interest polypeptides and nucleic acids based on the similarity of their primary and/or predicted polypeptide secondary structure with that of a known gene of interest polypeptide and/or nucleic acid. Standard databases such as the SwissProt- Trembl database (world-wide web at "expasy.org", Swiss Institute of Bioinformatics Swiss-Prot group CMU-1 rue Michel Servet CH-1211 Geneva 4, Switzerland) can also be used to identify polypeptides and nucleic acids of one or more genes of interest. The secondary and/or tertiary structure of a polypeptide and/or nucleic acid of one or more genes of interest can be predicted using the default settings of standard structure prediction programs, such as PredictProtein. Alternatively, the actual secondary and/or tertiary structure of a polypeptide of a gene of interest can be determined using standard methods.
B. Exemplary Vectors, Promoters and Other Elements
[0089] As disclosed herein, nitrate-regulated gene expression systems generally include a vector comprising one or more genes of interest and a narG nitrate-dependent promoter (PnarG) that drives expression of the gene(s) in the present of nitrate. Any suitable gene capable of being expressed using a PnarG nitrate-dependent promoter may be included on the plasmid. For example, genes from the upper or lower MVA pathway and/or relating to the biological production of isoprene may be included. The PnarG nitrate-dependent promoter can have a mutation in the -10 region of the narG promoter, a mutation in the -35 region of the narG promoter, or a mutation in both regions of the narG promoter. In other embodiments, additional promoter mutations to the narG promoter may also be provided. The plasmid (pDMWP170) and exemplary PnarG nitrate-dependent promoter mutations are shown in Figure 1, and described in Examples 1 and 4.
[0090] In some embodiments, any of the vectors disclosed herein contains a nitrate-dependent promoter (such as a PnarG nitrate-dependent promoter or a PnarG mutant promoter) operably linked to a nucleic acid encoding one or more genes of interest. "Operably linked" refers to one or more genes that have been placed under the regulatory control of a promoter, which then controls the transcription and optionally the translation of those genes. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position the genetic sequence or promoter at a distance from the gene transcription start site that is approximately the same as the distance between that genetic sequence or promoter and the gene it controls in its natural setting; i.e. the gene from which the genetic sequence or promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the gene from which it is derived.
[0091] In some embodiments, the promoter has one or more mutations compared to the sequence of a wild-type {i.e., a sequence occurring in nature) promoter, for example, PnarG mutant promoters such as PnarG* or PnarG#. In some embodiments, the promoter has a mutation that allows gene expression under certain conditions, e.g., under aerobic conditions.
1. Vectors
[0092] Any of the genes of interest and mutant narG nitrate-dependent promoters described herein (alone or in any combination) can be included in one or more vectors. As used herein, a "vector" means a construct that is capable of delivering, and desirably expressing, one or more nucleic acids of interest in a host cell. Examples of vectors include, but are not limited to, plasmids, viral vectors, DNA or RNA expression vectors, cosmids, and phage vectors. In some embodiments, the vector contains a nucleic acid under the control of a PnarG nitrate-dependent promoter. In one embodiment, the PnarG nitrate-dependent promoter is PnarG*. In another embodiment, the PnarG nitrate-dependent promoter is PnarG#.
[0093] In other embodiments, one or more nitrate regulation genes (such as, but not limited to, narL, narX, narQ, or narP) can be included in one or more vectors. Accordingly, also described herein are vectors with one more nucleic acids encoding any nitrate regulation polypeptides described herein. In some embodiments, the vector contains a nucleic acid under the control of an expression control sequence. As used herein, an "expression control sequence" means a nucleic acid sequence that directs transcription of a nucleic acid of interest. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. An "inducible promoter" is a promoter that is active under environmental or developmental regulation, such as a nitrate-inducible promoter. The expression control sequence is operably linked to the nucleic acid segment to be transcribed. In some
embodiments, the expression control sequence is a native expression control sequence. In some embodiments, the expression control sequence is a non-native expression control sequence. In some embodiments, the vector contains a selective marker or selectable marker.
[0094] Suitable vectors are those which are compatible with the host cell employed. Suitable vectors can be derived, for example, from a bacterium, a virus (such as bacteriophage T7 or an
M-13 derived phage), a cosmid, a yeast, or a plant. Suitable vectors can be maintained in low, medium, or high copy number in the host cell. Protocols for obtaining and using such vectors are known to those in the art (see, for example, Sambrook et ah, Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor, 1989). Suitable vectors compatible with the cells and methods described herein are described in International Publication No. WO 2009/076676 A2 and U.S. Patent Application No. 12/335,071.
[0095] In some embodiments, the vector contains a selective marker. The term "selective marker" refers to a nucleic acid capable of expression in a host cell that allows for ease of selection of those host cells containing an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, antibiotic resistance nucleic acids (e.g., erythromycin, chloramphenicol, thiamphenicol, kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, streptomycin, phleomycin, bleomycin, spectinomycin, or neomycin,) and/or nucleic acids that confer a metabolic advantage, such as a nutritional advantage on the host cell.
2. Promoters
[0096] Any of the nucleic acids encoding a gene of interest (such as any of the genes of interest disclosed herein) may be operably linked to a PnarG nitrate-dependent promoter. The promoter used as part of any of the gene expression constructs disclosed herein described herein may also be a nitrate-dependent inducible promoter, such as any of those described in Walker et al., "Role of Alternative Promoter Elements in Transcription from the Nar Promoter of
Escherichia coli." Journal of Bacteriology, Vol. 174: 1119-1123 (February 1992), which is hereby incorporated by reference in its entirety.
[0097] In another aspect, the PnarG nitrate-dependent promoter is a PnarG mutant promoter. In one embodiment, the PnarG mutant promoter is the PnarG* promoter. The PnarG* mutant promoter contains a mutation at the -10 bp region of the narG gene comprising the nucleotide sequence TATAAT and a mutation in the Fnr binding site to create the sequence
TTGGTCGTTATCAA (SEQ ID NO:2) and is capable of nitrate-dependent expression of a gene of interest in microorganisms under aerobic and/or anaerobic culture conditions. In another embodiment, the PnarG* mutant promoter comprises the nucleotide sequence
aatactccttaatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaacgtcttaatttacagtctgttatgtggtggctgttaa ttatcctaaaggggtatcttaggaatttactttatttttcatccccatcactcttggtcgttatcaattcccacgctgtttcagagcggtataatgccc tta (SEQ ID NO:3). In another embodiment, the PnarG mutant promoter is the PnarG# promoter. This promoter carries an additional mutation at the -35 bp region of the narG gene. In one embodiment, the -35 region of the PnarG# promoter comprises the nucleotide sequence TTGCCA. In another embodiment, the -35 region of the PnarG# promoter comprises the nucleotide sequence TTCACA. In a further embodiment, the PnarG# mutant promoter comprises the nucleotide sequence
aatactccttaatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaacgtcttaatttacagtctgttatgtggtggctgttaa ttatcctaaaggggtatcttaggaatttactttatttttcatccccatcactcttggtcgttatcaattgccacgctgtttcagagcggtataatgccc tta (SEQ ID NO: 1). In another embodiment, the PnarG# mutant promoter comprises the nucleotide sequence
aatactccttaatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaacgtcttaatttacagtctgttatgtggtggctgttaa ttatcctaaaggggtatcttaggaatttactttatttttcatccccatcactcttggtcgttatcaattcacacgctgtttcagagcggtataatgccc tta (SEQ ID NO:4). The PnarG# promoter can be used to induce expression of a gene of interest by nitrate under aerobic and/or anaerobic conditions. In some embodiments, the PnarG# promoter is capable of expressing a gene of interest in response to nitrate at levels at least about any of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 160%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 425%, 450%, 475%, 500%, 525%, 550%, 575%, 600%, 625%, 650%, 675%, 700%, 725%, 750%, 775%, or 800% higher (inclusive, including values falling in between these percentages) in comparison to expression of the same gene of interest when operably linked to the PnarG* promoter.
[0098] In other aspects, the promoter used in any of the vectors described herein may be a constitutive promoter or a strong promoter to express one or more nitrate regulation genes (such as, but not limited to, narL, narX, narQ or narP). Constitutive promoters do not require induction by artificial means (such as IPTG for the induction of the lac operon) and hence can result in considerable cost reduction for large scale fermentations. Constitutive promoters that function in anaerobes, aerobic microorganisms, or both anaerobic and aerobic microorganisms may be used. Any one of the promoters characterized or used in the Examples of the present disclosure may be used in accordance with the methods disclosed herein.
[0099] Additionally, other promoters known in the art that functions in a host cell can be used for expression of a target gene of interest in the host cell. Initiation control regions or promoters, which are useful to drive expression of polypeptides in various host cells are numerous and familiar to those skilled in the art (see, for example, WO 2004/033646 and references cited therein, which are each hereby incorporated by reference in their entireties, particularly with respect to vectors for the expression of nucleic acids of interest). Virtually any promoter capable of driving these nucleic acids is suitable for the present invention including, but not limited to, lac, trp, T7, tac, and trc, (useful for expression in E. coli).
[0100] In some embodiments, it may be desirable to over-express a gene of interest at levels far higher than currently found in naturally-occurring cells. In some embodiments, it may be desirable to under-express (e.g. , mutate, inactivate, or delete) a gene of interest at levels far below that those currently found in naturally- occurring cells. Suitable methods for over- or under- expressing nucleic acids compatible with cells and methods described herein are described in International Publication No. WO 2009/076676 A2 and U.S. Patent Application No. 12/335,071, the disclosures of which are incorporated by reference herein in their entireties.
3. Plasmids
[0101] In various embodiments, a nucleic acid encoding a nitrate-dependent gene expression construct comprising a nitrate-dependent promoter and/or one or more genes of interest is contained in a low copy plasmid (e.g. , a plasmid that is maintained at about 1 to about 4 copies per cell), medium copy plasmid (e.g. , a plasmid that is maintained at about 10 to about 15 copies per cell), or high copy plasmid (e.g. , a plasmid that is maintained at about 50 or more copies per cell).
[0102] In some embodiments, the vector is a replicating plasmid that does not integrate into a chromosome in the cells. In some embodiments, part of or the entire vector integrates into a chromosome in the cells. Additional examples of suitable expression and/or integration vectors are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, 1989, and Current Protocols in Molecular Biology (F. M. Ausubel et al. (eds) 1987, Supplement 30, section 7.7.18) which are both hereby incorporated by reference in their entirety, particularly with respect to vectors. Particularly useful vectors include pFB6, pBR322, PUC18, pUClOO, and pENTR/D. 4. Other Elements
[0103] Other molecular biology elements may also be used, such as termination sequence, origins of replication, and the like.
[0104] In some embodiments, the expression vector also includes a termination sequence. Termination control regions may also be derived from various genes native to the host cell. In some embodiments, the termination sequence and the promoter sequence are derived from the same source. In another embodiment, the termination sequence is endogenous to the host cell. Optionally, a termination site may be included. For effective expression of the polypeptides, DNA encoding the polypeptide are linked operably through initiation codons to selected expression control regions such that expression results in the formation of the appropriate messenger RNA.
[0105] Different types of origins of replication can be used. One, two or more origins of replication can be used. The origins of replication can be from different organisms and/or gram positive or gram negative organisms. Exemplary uses of origins of replication to practice the invention are further described in the Examples.
IV. Host Cells for Production of Industrial Bio-Products
[0106] One of skill in the art will recognize that expression vectors are designed to contain certain components which optimize gene expression for certain host cell strains. Such optimization components include, but are not limited to origin of replication, promoters, and enhancers. The vectors and components referenced herein are described for exemplary purposes and are not meant to narrow the scope of the invention.
[0107] Any microorganism host cell or progeny thereof that can be used to heterologously express nucleic acids can be used with the methods and compositions to express any of the nitrate-dependent gene expression constructs disclosed herein. As used herein, the terms "microorganism" or "host cell" are interchangeable. Exemplary host cells include, for example, yeasts, such as species of Saccharomyces (e.g., S. cerevisiae), bacteria, such as species of Escherichia (e.g., E. coli), archaea, such as species of Methanosarcina (e.g., Methanosarcina mazei), plants, such as kudzu or poplar (e.g., Populus alba or Populus alba x tremula
CAC35696) or aspen (e.g., Populus tremuloides).
[0108] Bacteria cells, including gram positive or gram negative bacteria can be used to express any of the nucleic acids or polypeptides described above. In some embodiments, the host cell is a gram-positive bacterium. Non-limiting examples include strains of Streptomyces (e.g., S. lividans, S. coelicolor, S. rubiginosus, or S. griseus), Streptococcus, Bacillus (e.g., B. lichenjormis or B. subtilis or B. coagulans), Listeria (e.g., L. monocytogenes), Corynebacteria, or Lactobacillus (e.g., L. spp). In some embodiments, the host organism is a gram-negative bacterium. Non-limiting examples include strains of Escherichia (e.g., E. coli), Pseudomonas (e.g., P. alcaligenes), Pantoea (e.g., P. citrea), Enterobacter, or Helicobacter (e.g., H. pylori). Other host cells for use in the methods and gene expression-control systems disclosed above include in any one of P. citrea, B. subtilis, B. licheniformis, B. lentus, B. brevis, B.
stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B.
megaterium, B. coagulans, B. circulans, B. lautus, B. thuringiensis, S. albus, S. lividans, S. coelicolor, S. griseus, Pseudomonas sp., and P. alcaligenes cells.
[0109] There are numerous types of anaerobic cells that can be used as host cells in the compositions and methods of the present invention. In one aspect of the invention, the cells described in any of the compositions or methods described herein are obligate anaerobic cells and progeny thereof. Obligate anaerobes typically do not grow well, if at all, in conditions where oxygen is present. It is to be understood that a small amount of oxygen may be present, that is, there is some tolerance level that obligate anaerobes have for a low level of oxygen. In one aspect, obligate anaerobes engineered to produce isoprene can serve as host cells for any of the methods and/or compositions described herein and are grown under substantially oxygen- free conditions, wherein the amount of oxygen present is not harmful to the growth,
maintenance, and/or fermentation of the anaerobes.
[0110] In another aspect of the invention, the host cells described and/or used in any of the compositions or methods described herein are facultative anaerobic cells and progeny thereof. Facultative anaerobes can generate cellular ATP by aerobic respiration (e.g., utilization of the TCA cycle) if oxygen is present. However, facultative anaerobes can also grow in the absence of oxygen. This is in contrast to obligate anaerobes which die or grow poorly in the presence of greater amounts of oxygen. In one aspect, therefore, facultative anaerobes can serve as host cells for any of the compositions and/or methods provided herein and can be engineered to produce isoprene. Facultative anaerobic host cells can be grown under substantially oxygen-free conditions, wherein the amount of oxygen present is not harmful to the growth, maintenance, and/or fermentation of the anaerobes, or can be alternatively grown in the presence of greater amounts of oxygen.
[0111] In other aspects of the invention, the host cells are cultured under aerobic conditions.
[0112] The host cell can additionally be a filamentous fungal cell and progeny thereof. (See, e.g., Berka & Barnett, Biotechnology Advances, 7(2): 127-154 (1989)). In some aspects, the filamentous fungal cell can be any of Trichoderma longibrachiatum, T. viride, T. koningii, T. harzianum, Penicillium sp., Humicola insolens, H. lanuginose, H. grisea, Chrysosporium sp., C. lucknowense, Gliocladium sp., Aspergillus sp., such as A. oryzae, A. niger, A sojae, A. japonicus, A. nidulans, or A. awamori, Fusarium sp., such as /■'. roseum, F. graminum F. cerealis, F.
oxysporuim, or F. venenatum, Neurospora sp., such as N. crassa, Hypocrea sp., Mucor sp., such as M. miehei, Rhizopus sp. or Emericella sp. In some aspects, the fungus is A. nidulans, A.
awamori, A. oryzae, A. aculeatus, A. niger, A. japonicus, T. reesei, T. viride, F. oxysporum, or F. solani. In certain embodiments, plasmids or plasmid components for use herein include those described in U.S. Patent Pub. No. US 2011/0045563.
[0113] The host cell can also be a yeast, such as Saccharomyces sp., Schizosaccharomyces sp., Pichia sp., or Candida sp. In some aspects, the Saccharomyces sp. is Saccharomyces cerevisiae (See, e.g., Romanos et al., Yeast, 8(6):423-488 (1992)). In certain embodiments, plasmids or plasmid components for use herein include those described in U.S. pat. No, 7,659,097 and U.S. Patent Pub. No. US 2011/0045563.
[0114] The host cell can also be a species of plant, such as a plant from the family Fabaceae, such as the Faboideae subfamily. In some aspects, the host cell is kudzu, poplar (such as Populus alba x tremula CAC35696), aspen (such as Populus tremuloides), or Quercus robur.
[0115] The host cell can additionally be a species of algae, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates. (See, e.g., Saunders
& Warmbrodt, "Gene Expression in Algae and Fungi, Including Yeast," (1993), National
Agricultural Library, Beltsville, MD). In certain embodiments, plasmids or plasmid components for use herein include those described in U.S. Patent Pub. No. US 2011/0045563. In some aspects, the host cell is a cyanobacterium, such as cyanobacterium classified into any of the following groups based on morphology: Chlorococcales, Pleurocapsales, Oscillatoriales, Nostocales, or Stigonematales (See, e.g., Lindberg et al., Metab. Eng., 12(l):70-79 (2010)). In certain embodiments, plasmids or plasmid components for use herein include those described in U.S. Patent Pub. No.: US 2010/0297749; US 2009/0282545 and PCT Pat. Appl. No. WO
2011/034863.
[0116] E. coli host cells can be used in any of the methods or systems for regulating the expression of a gene of interest disclosed herein. In one aspect, the host cell is a recombinant cell of an Escherichia coli (E. coli) strain, or progeny thereof, capable of producing one or more bio- products.
[0117] In other aspects, the host cell can be a species of yeast other than S. cerevisiae such as, but not limited to, a Pichia spp., a Candida spp., a Hansenula spp., a Kluyveromyces spp., a Kluyveromyces spp., or a Schizosacchawmyces spp. In still other aspects, the host cell can be a species of bacterium including, but not limited to, an Arthrobacter spp., a Zymomonas spp., a Brevibacterium spp., a Clostridium spp., an Aerococcus spp., a Bacillus spp., an Actinobacillus spp. (such as, but not limited to, A. succinogens), a Carbobacterium spp., a Corynebacterium spp., an Enterococcus spp., an Erysipelothrix spp., a Gemella spp., a Geobacillus spp., a
Globicatella spp., a Lactobacillus spp. (such as, but not limited to, L. lactis and L. rhammosus), a Lactococcus spp., a Leuconostoc spp., a Pediococcus spp., a Streptococcus spp., a
Tetragenococcus spp., an Actinobacillus spp., or a Vagococcus spp., In other aspects, the fermenting organism can be a fungus such as, but not limited to, a Rhizopus spp.
[0118] In other aspects, the host cell can be a lactic acid bacterium, such as those of the genera Aerococcus, Bacillus, Carbobacterium, Enterococcus, Erysipelothrix, Gemella, Globicatella, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Tetragenococcus or Vagococcus. For example, other bacteria of the genus Lactobacillus which may be substituted include, but are not limited to, L. heiveticus, L. delbrueckii, L. casei, L. acidophilus, L.
amylovorus, L. leichmanii, L. bulgaricus, L. amylovorus, or L. pentosus. 1. Host cell mutations in nitrate reductase genes
[0119] In some aspects, any of the host cells for use in the compositions and methods disclosed herein can be engineered to include mutations in one or more endogenous genes encoding the nitrate reductase enzyme complex. Nitrate reductases are enzymes that reduce nitrate (NO —3 ) to nitrite (NO—2 ). Prokaryotic nitrate reductases belong to the DMSO reductase family of molybdoenzymes and have been classified into three groups, assimilatory nitrate reductases (Nas), respiratory nitrate reductase (nar), and periplasmic nitrate reductases (nap). In some microorganisms (for example, E. coli) nitrate reductases are encoded by the nitrate reductase (narGHJI) operon. Endogenous nitrate reductase genes can include, without limitation, narG, napA, and/or narZ. In some embodiments, the mutations to any of the nitrate reductase genes disclosed herein are loss-of-function mutations. In other embodiments, the mutations to any of the nitrate reductase genes disclosed herein result in downregulation of nitrate reductase gene expression, though not complete loss of nitrate reductase protein expression. In some embodiments, downregulation of gene expression is caused by decreased mRNA or protein expression at the level of transcription or translation, respectively. In one embodiment, downregulation of gene expression is accomplished by RNAi or antisense oligonucleotides. In another embodiment, downregulation of gene expression is caused by replacement of the gene's endogenous promoter with a weak promoter. In some embodiments, the microorganism host cell contains one, two, or three or more mutations in endogenous genes encoding components of a nitrate reductase enzyme. In other embodiments, mutation of one or more genes encoding a nitrate reductase enzyme polypeptide results in any of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate reductase enzyme polypeptide. In another embodiment, mutation of one or more genes encoding a nitrate reductase enzyme polypeptide results in any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate reductase enzyme polypeptide.
[0120] In some embodiments, any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narG polypeptide, which is the alpha subunit of the nitrate reductase enzyme. In some embodiments, the mutation is a loss of function mutation. In other embodiments, mutation of the gene encoding the narG polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narG polypeptide. In another embodiment, mutation of the gene encoding the narG polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narG polypeptide.
[0121] In other embodiments, any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the napA polypeptide. In some embodiments, the mutation is a loss of function mutation. In other embodiments, mutation of the gene encoding the napA polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the napA polypeptide. In another embodiment, mutation of the gene encoding the napA polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the napA polypeptide.
[0122] In another embodiment, any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narZ polypeptide, which is a nitrate reductase enzyme which can use nitrate as an electron acceptor during anaerobic growth. In some embodiments, the mutation is a loss of function mutation. In other embodiments, mutation of the gene encoding the narZ polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narZ polypeptide. In another embodiment, mutation of the gene encoding the narZ polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narZ polypeptide.
1. Host cell mutations in nitrate transporter genes
[0123] In some aspects, any of the host cells for use in the compositions and methods disclosed herein can be engineered to include mutations in one or more endogenous genes encoding nitrate transporter proteins. Nitrate transporter proteins are proteins capable of transporting nitrate and/or nitrite out of a microorganism host cell. Endogenous nitrate transporter genes can include, without limitation, narK and/or narU. In some embodiments, the mutations to any of the nitrate transporter genes disclosed herein are loss-of-function mutations. In some embodiments, the microorganism host cell contains one, two, or three or more mutations in endogenous genes encoding nitrate transporter polypeptides. In other embodiments, the mutations to any of the nitrate transporter genes disclosed herein result in downregulation of nitrate transporter gene expression, though not complete loss of nitrate transporter protein expression. In some embodiments, downregulation of gene expression is caused by decreased mRNA or protein expression at the level of transcription or translation, respectively. In one embodiment, downregulation of gene expression is accomplished by RNAi or antisense oligonucleotides. In another embodiment, downregulation of gene expression is caused by replacement of the gene's endogenous promoter with a weak promoter. In other embodiments, mutation of one or more genes encoding a nitrate transporter polypeptide results in any of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate transporter polypeptide. In another embodiment, mutation of one or more genes encoding a nitrate transporter polypeptide results in any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in one or more genes encoding a nitrate transporter polypeptide. In another embodiment, the cell further comprises a mutation in the gene encoding a nitrate reductase (Nap) polypeptide (such as any of the nitrate reductase genes disclosed herein). [0124] In some embodiments, any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narK polypeptide, which catalyzes nitrate uptake, nitrite uptake and nitrite export across the cytoplasmic membrane. In some embodiments, the mutation is a loss of function mutation. In other embodiments, mutation of the gene encoding the narK polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narK polypeptide. In another embodiment, mutation of the gene encoding the narK polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narK polypeptide.
[0125] In some embodiments, any of the host cells for use in the compositions and methods disclosed herein are engineered to include mutations in the gene encoding the narU polypeptide, which catalyzes nitrate uptake, nitrite uptake and nitrite export across the cytoplasmic membrane. In some embodiments, the mutation is a loss of function mutation. In other embodiments, mutation of the gene encoding the narU polypeptide results in any of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, inclusive (including any percentages in between these values) decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narU polypeptide. In another embodiment, mutation of the gene encoding the narU polypeptide results in any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 fold or greater decreased nitrate degradation in comparison to host cells that do not have a mutation in the gene encoding the narU polypeptide.
V. Growth and/or Production Parameters
[0126] The host cells disclosed and compositions thereof, can be engineered to produce industrial bio-product using the methods for regulating the expression of a gene of interest disclosed herein in a fermentation system. In one embodiment the system is substantially free of oxygen. In another embodiment, the system is an oxygen-containing system. In some embodiments, the fermentation system contains a carbohydrate as the energy and/or carbon source. In some embodiments, the fermentation system contains carbohydrate and hydrogen as an energy and/or carbon source.
A. Nitrate Concentrations/Sources in Media for Expression Control
[0127] In some embodiments of the host cells and methods for using the same disclosed herein, regulation of the expression of a gene of interest depends on the presence and
concentration of a nitrate salt present in the culture media that binds to a nitrate-dependent promoter operably linked to the gene of interest to induce gene expression. In some
embodiments, the nitrate salt is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 g/L, 0.0004 g/L, 0.0006 g/L, 0.0008 g/L, 0.001 g/L, 0.0015 g/L, 0.002 g/L, 0.0025 g/L, 0.003 g/L, 0.0035 g/L, 0.004 g/L, 0.0045 g/L, 0.005 g/L, 0.006 g/L, 0.007 g/L, 0.008 g/L, 0.009 g/L, 0.01 g/L, 0.015 g/L, 0.02 g/L, 0.025 g/L, 0.03 g/L, 0.035 g/L, 0.04 g/L, 0.045 g/L, 0.05 g/L, 0.055 g/L, 0.06 g/L, 0.065 g/L, 0.07 g/L, 0.075 g/L, 0.08 g/L, 0.085 g/L, 0.09 g/L, 0.095 g/L, 0.1 g/L, 0.15 g/L, 0.2 g/L, 0.25 g/L, 0.3 g/L, 0.35 g/L, 0.4 g/L, 0.45 g/L, 0.5 g/L, 0.55 g/L, 0.6 g/L, 0.65 g/L, 0.7 g/L, 0.75 g/L, 0.8 g/L, 0.85 g/L, 0.9 g/L, 0.95 g/L, 1.0 g/L, 1.1 g/L, 1.2 g/L, 1.3 g/L, 1.4 g/L, 1.5 g/L, 1.6 g/L, 1.7 g/L, 1.8 g/L, 1.9 g/L, 2.0 g/L, 2.1 g/L, 2.2 g/L, 2.3 g/L, 2.4 g/L, 2.5 g/L, 3 g/L, 3.5 g/L, 4 g/L, 4.5 g/L, 5 g/L, 5.5 g/L, 6 g/L, 6.5 g/L, 7 g/L, 7.5 g/L, 8 g/L, 8.5 g/L, 9 g/L, 9.5 g/L, 10 g/L, or more, including concentrations falling in between these values. In some embodiments, the nitrate salt is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 to 0.001 g/L, from about 0.00015 to 0.001 g/L, from about 0.0015 to about 0.01 g/L, from about 0.015 to about 0.1 g/L, from about 0.05 to about 0.15 g/L, from about 0.1 to about 0.3 g/L, from about 0.15 to about 0.5 g/L, from about 0.25 to about 0.75 g/L, from about 0.5 to about 1.25 g/L, from about 1.75 to about 3 g/L, from about 1.5 to about 5 g/L, from about 3 to about 7 g/L, from about 4 to about 8 g/L, from about 5 to about 9 g/L, or from about 6 to about 10 g/L. In some embodiments, the nitrate salt is not present or is present at concentrations of less than 0.0002 g/L when the microorganism host cells are grown as an initial seed culture.
[0128] Any nitrate salt compatible with the culture of microorganism host cells (such as any host cell described herein) may be employed in the compositions and methods of the present invention. Examples of appropriate nitrate salts for use according to the methods herein include, without limitation, ammonium nitrate, potassium nitrate, calcium nitrate, sodium nitrate, or magnesium nitrate. In some embodiments, the nitrate salt is potassium nitrate and is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 g/L, 0.0004 g/L, 0.0006 g/L, 0.0008 g/L, 0.001 g/L, 0.0015 g/L, 0.002 g/L, 0.0025 g/L, 0.003 g/L, 0.0035 g/L, 0.004 g/L, 0.0045 g/L, 0.005 g/L, 0.006 g/L, 0.007 g/L, 0.008 g/L, 0.009 g/L, 0.01 g/L, 0.015 g/L, 0.02 g/L, 0.025 g/L, 0.03 g/L, 0.035 g/L, 0.04 g/L, 0.045 g/L, 0.05 g/L, 0.055 g/L, 0.06 g/L, 0.065 g/L, 0.07 g/L, 0.075 g/L, 0.08 g/L, 0.085 g/L, 0.09 g/L, 0.095 g/L, 0.1 g/L, 0.15 g/L, 0.2 g/L, 0.25 g/L, 0.3 g/L, 0.35 g/L, 0.4 g/L, 0.45 g/L, 0.5 g/L, 0.55 g/L, 0.6 g/L, 0.65 g/L, 0.7 g/L, 0.75 g/L, 0.8 g/L, 0.85 g/L, 0.9 g/L, 0.95 g/L, 1.0 g/L, 1.1 g/L, 1.2 g/L, 1.3 g/L, 1.4 g/L, 1.5 g/L, 1.6 g/L, 1.7 g/L, 1.8 g/L, 1.9 g/L, 2.0 g/L, 2.1 g/L, 2.2 g/L, 2.3 g/L, 2.4 g/L, 2.5 g/L, 3 g/L, 3.5 g/L, 4 g/L, 4.5 g/L, 5 g/L, 5.5 g/L, 6 g/L, 6.5 g/L, 7 g/L, 7.5 g/L, 8 g/L, 8.5 g/L, 9 g/L, 9.5 g/L, 10 g/L, or more, including concentrations falling in between these values. In some embodiments, the potassium nitrate is present in the culture media or production- scale bioreactor at a concentration of about 0.0002 to 0.001 g/L, from about 0.00015 to 0.001 g/L, from about 0.0015 to about 0.01 g/L, from about 0.015 to about 0.1 g/L, from about 0.05 to about 0.15 g/L, from about 0.1 to about 0.3 g/L, from about 0.15 to about 0.5 g/L, from about 0.25 to about 0.75 g/L, from about 0.5 to about 1.25 g/L, from about 1.75 to about 3 g/L, from about 1.5 to about 5 g/L, from about 3 to about 7 g/L, from about 4 to about 8 g/L, from about 5 to about 9 g/L, or from about 6 to about 10 g/L. In other embodiments, the potassium nitrate is not present or is present at concentrations of less than 0.0002 g/L when the microorganism host cells are grown as an initial seed culture.
B. Feedstock
[0129] Various types of feedstock can be used for culturing the recombinant microbial cells described herein. The feedstock can be a carbon source or syngas. Information regarding carbon sources available for use in exemplary feedstocks is provided below.
C. Carbon Source
[0130] Any carbon source can be used to cultivate the host cells. The term "carbon source" refers to one or more carbon-containing compounds capable of being metabolized by recombinant microbial cells described herein. For example, the cell medium used to cultivate the recombinant microbial cells described herein may include any carbon source suitable for maintaining the viability or growing the cells.
[0131] In some embodiments, the carbon source is a carbohydrate (such as monosaccharide, disaccharide, oligosaccharide, or polysaccharide), invert sugar (e.g. , enzymatically treated sucrose syrup), glycerol, glycerine (e.g. , a glycerine byproduct of a biodiesel or soap-making process), dihydroxyacetone, one-carbon source, oil (e.g. , a plant or vegetable oil such as corn, palm, or soybean oil), animal fat, animal oil, fatty acid (e.g. , a saturated fatty acid, unsaturated fatty acid, or polyunsaturated fatty acid), lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, polypeptide (e.g., a microbial or plant protein or peptide), renewable carbon source (e.g. , a biomass carbon source such as a hydrolyzed biomass carbon source), yeast extract, component from a yeast extract, polymer, acid, alcohol, aldehyde, ketone, amino acid, succinate, lactate, acetate, ethanol, or any combination of two or more of the foregoing. In some embodiments, the carbon source is a product of photosynthesis, including, but not limited to, glucose.
[0132] Exemplary monosaccharides include glucose and fructose; exemplary oligosaccharides include lactose and sucrose, and exemplary polysaccharides include starch and cellulose.
Exemplary carbohydrates include C6 sugars (e.g. , fructose, mannose, galactose, or glucose) and C5 sugars (e.g. , xylose or arabinose). In some embodiments, the cell medium includes a carbohydrate as well as a carbon source other than a carbohydrate (e.g. , glycerol, glycerine, dihydroxyacetone, one-carbon source, oil, animal fat, animal oil, fatty acid, lipid, phospholipid, glycerolipid, monoglyceride, diglyceride, triglyceride, renewable carbon source, or a component from a yeast extract). In some embodiments, the cell medium includes a carbohydrate as well as a polypeptide (e.g. , a microbial or plant protein or peptide). In some embodiments, the microbial polypeptide is a polypeptide from yeast or bacteria. In some embodiments, the plant polypeptide is a polypeptide from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
[0133] In some embodiments, the cells are cultured under limited glucose conditions. By "limited glucose conditions" it is meant that the amount of glucose that is added is less than or about 105% (such as about 100%) of the amount of glucose that is consumed by the cells. In particular embodiments, the amount of glucose that is added to the culture medium is approximately the same as the amount of glucose that is consumed by the cells during a specific period of time. In some embodiments, the rate of cell growth is controlled by limiting the amount of added glucose such that the cells grow at the rate that can be supported by the amount of glucose in the cell medium. In some embodiments, glucose does not accumulate during the time the cells are cultured. In various embodiments, the cells are cultured under limited glucose conditions for greater than or about 1, 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, or 70 hours. In various embodiments, the cells are cultured under limited glucose conditions for greater than or about 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 95, or 100% of the total length of time the cells are cultured. While not intending to be bound by any particular theory, it is believed that limited glucose conditions may allow more favorable regulation of the cells.
[0134] In some embodiments, the cells are cultured in the presence of an excess of glucose. In particular embodiments, the amount of glucose that is added is greater than about 105% (such as about or greater than 110, 120, 150, 175, 200, 250, 300, 400, or 500%) or more of the amount of glucose that is consumed by the cells during a specific period of time. In some embodiments, glucose accumulates during the time the cells are cultured.
[0135] Exemplary lipids are any substance containing one or more fatty acids that are C4 and above or fatty acids that are saturated, unsaturated, or branched.
[0136] Exemplary oils are lipids that are liquid at room temperature. In some embodiments, the lipid contains one or more C4 or above fatty acids (e.g. , contains one or more saturated, unsaturated, or branched fatty acid with four or more carbons). In some embodiments, the oil is obtained from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, linseed, oleagineous microbial cells, Chinese tallow, or any combination of two or more of the foregoing.
[0137] Exemplary fatty acids include compounds of the formula RCOOH, where "R" is a hydrocarbon. Exemplary unsaturated fatty acids include compounds where "R" includes at least one carbon-carbon double bond. Exemplary unsaturated fatty acids include, but are not limited to, oleic acid, vaccenic acid, linoleic acid, palmitelaidic acid, and arachidonic acid. Exemplary polyunsaturated fatty acids include compounds where "R" includes a plurality of carbon-carbon double bonds. Exemplary saturated fatty acids include compounds where "R" is a saturated aliphatic group. In some embodiments, the carbon source includes one or more C12-C22 fatty acids, such as a C12 saturated fatty acid, a C14 saturated fatty acid, a C16 saturated fatty acid, a Cn saturated fatty acid, a C2o saturated fatty acid, or a C22 saturated fatty acid. In an exemplary embodiment, the fatty acid is palmitic acid. In some embodiments, the carbon source is a salt of a fatty acid (e.g. , an unsaturated fatty acid), a derivative of a fatty acid (e.g., an unsaturated fatty acid), or a salt of a derivative of fatty acid (e.g., an unsaturated fatty acid). Suitable salts include, but are not limited to, lithium salts, potassium salts, sodium salts, and the like. Di- and triglycerols are fatty acid esters of glycerol.
[0138] In some embodiments, the concentration of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is at least or about 1 gram per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, 400, or more g/L. In some embodiments, the concentration of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 10 and about 400 g/L, such as between about 25 and about 300 g/L, between about 60 and about 180 g/L, or between about 75 and about 150 g/L. In some embodiments, the concentration includes the total amount of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride that is added before and/or during the culturing of the host cells. In some embodiments, the carbon source includes both (i) a lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride and (ii) a carbohydrate, such as glucose. In some embodiments, the ratio of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or
triglyceride to the carbohydrate is about 1 : 1 on a carbon basis (i.e. , one carbon in the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride per carbohydrate carbon). In particular embodiments, the amount of the lipid, oil, fat, fatty acid, monoglyceride, diglyceride, or triglyceride is between about 60 and 180 g/L, and the amount of the carbohydrate is between about 120 and 360 g/L.
[0139] Exemplary microbial polypeptide carbon sources include one or more polypeptides from yeast or bacteria. Exemplary plant polypeptide carbon sources include one or more polypeptides from soy, corn, canola, jatropha, palm, peanut, sunflower, coconut, mustard, rapeseed, cottonseed, palm kernel, olive, safflower, sesame, or linseed.
[0140] Exemplary renewable carbon sources include cheese whey permeate, cornsteep liquor, sugar beet molasses, barley malt, and components from any of the foregoing. Exemplary renewable carbon sources also include glucose, hexose, pentose and xylose present in biomass, such as corn, switchgrass, sugar cane, cell waste of fermentation processes, and protein by- product from the milling of soy, corn, or wheat. In some embodiments, the biomass carbon source is a lignocellulosic, hemicellulosic, or cellulosic material such as, but are not limited to, a grass, wheat, wheat straw, bagasse, sugar cane bagasse, soft wood pulp, corn, corn cob or husk, corn kernel, fiber from corn kernels, corn stover, switch grass, rice hull product, or a by-product from wet or dry milling of grains (e.g., corn, sorghum, rye, triticate, barley, wheat, and/or distillers grains). Exemplary cellulosic materials include wood, paper and pulp waste, herbaceous plants, and fruit pulp. In some embodiments, the carbon source includes any plant part, such as stems, grains, roots, or tubers. In some embodiments, all or part of any of the following plants are used as a carbon source: corn, wheat, rye, sorghum, triticate, rice, millet, barley, cassava, legumes, such as beans and peas, potatoes, sweet potatoes, bananas, sugarcane, and/or tapioca. In some embodiments, the carbon source is a biomass hydrolysate, such as a biomass hydrolysate that includes both xylose and glucose or that includes both sucrose and glucose.
[0141] In some embodiments, the renewable carbon source (such as biomass) is pretreated before it is added to the cell culture medium. In some embodiments, the pretreatment includes enzymatic pretreatment, chemical pretreatment, or a combination of both enzymatic and chemical pretreatment (see, for example, Farzaneh et al, Bioresource Technology 96 (18): 2014-2018, 2005; U.S. Patent No. 6,176,176; U.S. Patent No. 6,106,888; which are each hereby incorporated by reference in their entireties, particularly with respect to the pretreatment of renewable carbon sources). In some embodiments, the renewable carbon source is partially or completely hydrolyzed before it is added to the cell culture medium.
[0142] In some embodiments, the renewable carbon source (such as corn stover) undergoes ammonia fiber expansion (AFEX) pretreatment before it is added to the cell culture medium (see, for example, Farzaneh et ah, Bioresource Technology 96 (18): 2014-2018, 2005). During AFEX pretreatment, a renewable carbon source is treated with liquid anhydrous ammonia at moderate temperatures (such as about 60 to about 100 °C) and high pressure (such as about 250 to about 300 psi) for about 5 minutes. Then, the pressure is rapidly released. In this process, the combined chemical and physical effects of lignin solubilization, hemicellulose hydrolysis, cellulose decrystallization, and increased surface area enables near complete enzymatic conversion of cellulose and hemicellulose to fermentable sugars. AFEX pretreatment has the advantage that nearly all of the ammonia can be recovered and reused, while the remaining serves as nitrogen source for microbes in downstream processes. Also, a wash stream is not required for AFEX pretreatment. Thus, dry matter recovery following the AFEX treatment is essentially 100%.
AFEX is basically a dry to dry process. The treated renewable carbon source is stable for long periods and can be fed at very high solid loadings in enzymatic hydrolysis or fermentation processes. Cellulose and hemicellulose are well preserved in the AFEX process, with little or no degradation. There is no need for neutralization prior to the enzymatic hydrolysis of a renewable carbon source that has undergone AFEX pretreatment. Enzymatic hydrolysis of AFEX-treated carbon sources produces clean sugar streams for subsequent fermentation use.
[0143] In some embodiments, the concentration of the carbon source (e.g. , a renewable carbon source) is equivalent to at least or about 0.1, 0.5, 1, 1.5 2, 3, 4, 5, 10, 15, 20, 30, 40, or 50% glucose (w/v). The equivalent amount of glucose can be determined by using standard HPLC methods with glucose as a reference to measure the amount of glucose generated from the carbon source. In some embodiments, the concentration of the carbon source (e.g. , a renewable carbon source) is equivalent to between about 0.1 and about 20% glucose, such as between about 0.1 and about 10% glucose, between about 0.5 and about 10% glucose, between about 1 and about 10% glucose, between about 1 and about 5% glucose, or between about 1 and about 2% glucose.
[0144] In some embodiments, the carbon source includes yeast extract or one or more components of yeast extract. In some embodiments, the concentration of yeast extract is at least 1 gram of yeast extract per liter of broth (g/L, wherein the volume of broth includes both the volume of the cell medium and the volume of the cells), such as at least or about 5, 10, 15, 20, 30, 40, 50, 60, 80, 100, 150, 200, 300, or more g/L. In some embodiments, the concentration of yeast extract is between about 1 and about 300 g/L, such as between about 1 and about 200 g/L, between about 5 and about 200 g/L, between about 5 and about 100 g/L, or between about 5 and about 60 g/L. In some embodiments, the concentration includes the total amount of yeast extract that is added before and/or during the culturing of the host cells. In some embodiments, the carbon source includes both yeast extract (or one or more components thereof) and another carbon source, such as glucose. In some embodiments, the ratio of yeast extract to the other carbon source is about 1 :5, about 1 : 10, or about 1 :20 (w/w).
[0145] Additionally the carbon source may also be one-carbon substrates such as carbon dioxide, or methanol. Glycerol production from single carbon sources (e.g. , methanol, formaldehyde, or formate) has been reported in methylotrophic yeasts (Yamada et al. , Agric. Biol. Chem., 53(2) 541-543, 1989, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources) and in bacteria (Hunter et. al. , Biochemistry, 24, 4148-4155, 1985, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources). These organisms can assimilate single carbon compounds, ranging in oxidation state from methane to formate, and produce glycerol. The pathway of carbon assimilation can be through ribulose monophosphate, through serine, or through xylulose- momophosphate (Gottschalk, Bacterial Metabolism, Second Edition, Springer- Verlag: New York, 1986, which is hereby incorporated by reference in its entirety, particularly with respect to carbon sources). The ribulose monophosphate pathway involves the condensation of formate with ribulose- 5 -phosphate to form a six carbon sugar that becomes fructose and eventually the three carbon product glyceraldehyde-3-phosphate. Likewise, the serine pathway assimilates the one-carbon compound into the glycolytic pathway via methylenetetrahydrofolate.
D. Syngas
[0146] Syngas (also referred to as synthesis gas) can be used as a source of energy and/or carbon for any of the recombinant host cells described herein. Syngas can include CO and H2. In some aspects, the syngas comprises CO, C02, and H2. In some aspects, the syngas further comprises H20 and/or N2. For example, the syngas may comprise CO, H2, and H20 (e.g., CO, H2, H20 and N2). The syngas may comprise CO, H2, and N2. The syngas may comprise CO, C02, H2, and H20 (e.g., CO, C02, H2, H20 and N2). The syngas may comprise CO, C02, H2, and N2. The CO and/or C02 in the syngas may be used as carbon source for cells.
[0147] In some aspects, the molar ratio of hydrogen to carbon monoxide in the syngas is about any of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 3.0, 4.0, 5.0, or 10.0. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume carbon monoxide. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume hydrogen. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume carbon dioxide. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume water. In some aspects, the syngas comprises about any of 10, 20, 30, 40, 50, 60, 70, 80, or 90% by volume nitrogen. [0148] The syngas of the present invention may be derived from natural or synthetic sources. In some aspects, the syngas is derived from biomass (e.g. , wood, switch grass, agriculture waste, municipal waste) or carbohydrates (e.g. , sugars). In other aspects, the syngas is derived from coal, petroleum, kerogen, tar sands, oil shale, natural gas, or a mixture thereof. In other aspects, the syngas is derived from rubber, such as from rubber tires. In some aspects, the syngas is derived from a mixture (e.g. , blend) of biomass and coal. In some aspects, the mixture has about or at least about any of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99% biomass. In some aspects, the mixture has about or at least about any of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, or 99% coal. In some aspects, the ratio of biomass to coal in the mixture is about any of 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85: 15, 90: 10, or 95:5.
[0149] Syngas can be derived from a feedstock by a variety of processes, including methane reforming, coal liquefaction, co-firing, fermentative reactions, enzymatic reactions, and biomass gasification. Biomass gasification is accomplished by subjecting biomass to partial oxidation in a reactor at temperatures above about 700 °C in the presence of less than a stoichiometric amount of oxygen. The oxygen is introduced into the bioreactor in the form of air, pure oxygen, or steam. Gasification can occur in three main steps: 1) initial heating to dry out any moisture embedded in the biomass; 2) pyrolysis, in which the biomass is heated to 300-500 °C in the absence of oxidizing agents to yield gas, tars, oils and solid char residue; and 3) gasification of solid char, tars and gas to yield the primary components of syngas. Co-firing is accomplished by gasification of a coal/biomass mixture. The composition of the syngas, such as the identity and molar ratios of the components of the syngas, can vary depending on the feedstock from which it is derived and the method by which the feedstock is converted to syngas.
[0150] Syngas can contain impurities, the nature and amount of which vary according to both the feedstock and the process used in production. Fermentations may be tolerant to some impurities, but there remains the need to remove from the syngas materials such as tars and particulates that might foul the fermentor and associated equipment. It is also advisable to remove compounds that might contaminate the isoprene product such as volatile organic compounds, acid gases, methane, benzene, toluene, ethylbenzene, xylenes, H2S, COS, CS2, HC1, 03, organosulfur compounds, ammonia, nitrogen oxides, nitrogen-containing organic compounds, and heavy metal vapors. Removal of impurities from syngas can be achieved by one of several means, including gas scrubbing, treatment with solid-phase adsorbents, and purification using gas-permeable membranes.
[0151] Examples of other fermentation systems and culture conditions which can be used are described in International Patent Application Publication Nos. WO2009/076676,
WO2010/003007, WO2009/132220, WO2010/031062, WO2010/031068, WO2010/031076, WO2010/013077, WO2010/031079, WO2010/148150, WO2010/078457, and WO2010/148256, which are hereby incorporated in their entirety, particularly with respect to fermentation systems and culture conditions for any of the host cells disclosed herein.
[0152] In some aspects, the culture medium is prepared using anoxic techniques. In some aspects, the culture medium comprises one or more of NH4C1, NaCl, KC1, KH2PO4,
MgS04'7H20, CaCl2'2H20, NaHC03, yeast extract, cysteine hydrochloride, Na2S»9H20, trace metals, and vitamins. In some aspects, the culture medium contains, per liter, about 1.0 g NH4C1, about 0.8 g NaCl, about 0.1 g KC1, about 0.1 g KH2P04, about 0.2 g MgS04 «7H20, about 0.02 g CaCl2*2H20, about 1.0 g NaHC03, about 1.0 g yeast extract, about 0.2 g cysteine hydrochloride, about 0.2 g Na2S*9H20, about 10 mL trace metal solution, and about 10 mL vitamin solution. In some aspects, the culture condition comprises mevalonate.
[0153] The growth conditions, carbon sources, energy sources, and culture media may be according to any of the growth conditions, carbon sources, energy sources, and culture media described in the Examples of the present disclosure.
VI. Methods for Using Microorganisms Comprising a Nitrate-dependent Gene Expression Construct for Production of Industrial Bio-Products
[0154] The invention provides for microbial expression systems for the production of one or more industrial bio-products (e.g. , isoprene, butadiene, or ethanol). In some embodiments, the system can include one or more of: a regulatable gene expression construct comprising (i) a PnarG nitrate-dependent promoter (such as any of those disclosed herein) operably linked to one or more nucleic acids encoding a gene of interest (such as any of those described herein); and, optionally, (ii) one or more nucleic acids encoding one or more nitrate-regulatory genes. In other embodiments, the host cells can have one or more loss-of-function mutations in one or more genes encoding nitrate transporter proteins or nitrate reductase genes (such as any of those disclosed herein).
[0155] In some embodiments, the system provides for the expression of one or more nucleic acids of interest (e.g., nucleic acids encoding isoprene synthase or enzymes involved in the production of ethanol from acetyl-CoA). As described herein, microorganisms expressing one or more nucleic acids of interest can be engineered to produce various industrial bio-products under the control of a nitrate-dependent regulatable gene expression construct, such as any of those disclosed herein. These bio-products can include, but are not limited to, isoprene, butadiene, ethanol, propanediol (e.g., 1,2-propanediol, 1,3-propanediol), hydrogen, acetate, microbial fuels, non-fermentative alcohols, fatty alcohols, fatty acid esters, isoprenoid alcohols, alkenes, alkanes, terpenoids, isoprenoids, carotenoids or other C5, CIO, C15, C20, C25, C30, C35, or C40 product. The production of these industrial bio-products is described in further detail below and herein.
[0156] As described herein, the constructs, compositions, and methods for regulating and controlling gene expression can be used to engineer microorganism host cells responsive to nitrate. When cultured in the presence of a nitrate salt, heterologous nucleic acid expression is initiated and the engineered microorganism host cells (such as any of those disclosed herein) can produce various industrial bio-products, including but not limited to, isoprene, butadiene, ethanol, propanediol (e.g., 1,2-propanediol, 1,3-propanediol), hydrogen, acetate, microbial fuels, non-fermentative alcohols, fatty alcohols, fatty acid esters, isoprenoid alcohols, alkenes, alkanes, terpenoids, isoprenoids, carotenoids or other C5, CIO, C15, C20, C25, C30, C35, or C40 product. The production of these industrial bio-products is described in further detail below and herein.
A. Isoprene Production
[0157] In some embodiments, the host cells contain one or more pathways for the production of isoprene (e.g., microorganisms that contain the pathways illustrated in Figures Yl -22) with one or more heterologous polynucleotides encoding one or more isoprene pathway enzymes expressed in a sufficient amount to produce isoprene. 1. Exemplary Isoprene Synthase Polypeptides and Nucleic Acids
[0158] In some embodiments, the host cells (such as any of the host cells disclosed herein) can be transformed with polynucleotides encoding an isoprene synthase polypeptide. Isoprene synthase polypeptides convert dimethylallyl diphosphate (DMAPP) into isoprene. Exemplary isoprene synthase polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an isoprene synthase polypeptide.
Standard methods can be used to determine whether a polypeptide has isoprene synthase polypeptide activity by measuring the ability of the polypeptide to convert DMAPP into isoprene in vitro, in a cell extract, or in vivo (e.g., as described in Example 1 of US 8420360 B2, which is incorporated herein in its entirety, particularly with respect to methods for assessing isoprene synthase activity). Isoprene synthase polypeptide activity in cell extracts can be measured, for example, as described in Silver et al., J. Biol. Chem. 270: 13010-13016, 1995 and references therein, which are each hereby incorporated by reference in their entireties, particularly with respect to assays for isoprene synthase polypeptide activity.
[0159] In some embodiments, the isoprene synthase polypeptide or nucleic acid is from the family Fabaceae, such as the Faboideae subfamily. In some embodiments, the isoprene synthase polypeptide or nucleic acid is a naturally- occurring polypeptide or nucleic acid from Pueraria montana (kudzu) (Sharkey et al., Plant Physiology 137: 700-712, 2005), Pueraria lobata, poplar (such as Populus alba x tremula CAC35696) (Miller et al., Planta 213: 483-487, 2001) aspen (such as Populus tremuloides) (Silver et al, JBC 270(22): 13010-1316, 1995), or English Oak (Quercus robur) (Zimmer et al., WO 98/02550), which are each hereby incorporated by reference in their entireties, particularly with respect to isoprene synthase nucleic acids and the expression of isoprene synthase polypeptides. Suitable isoprene synthases include, but are not limited to, those identified by Genbank Accession Nos. AY341431, AY316691, AY279379, AJ457070, and AY1 82241, which are each hereby incorporated by reference in their entireties, particularly with respect to sequences of isoprene synthase nucleic acids and polypeptides. In some embodiments, the isoprene synthase polypeptide or nucleic acid is not a naturally- occurring polypeptide or nucleic acid from Quercus robur (i.e., the isoprene synthase polypeptide or nucleic acid is an isoprene synthase polypeptide or nucleic acid other than a naturally- occurring polypeptide or nucleic acid from Quercus robur). In some embodiments, the isoprene synthase nucleic acid or polypeptide is not a naturally- occurring polypeptide or nucleic acid from poplar (such as Populus alba x tremula CAC35696).
[0160] Exemplary isoprene synthase nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an isoprene synthase polypeptide. Exemplary isoprene synthase polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein. Additional isoprene synthase nucleic acids can also be found in U.S. Patent No. 8,173,410, U.S. Patent No. 8,735,134 and U.S. Patent Application Publication No. 20130045891, the disclosures of each of which are incorporated by reference in their entireties.
2. Exemplary DXP Pathway Polypeptides and Nucleic Acids
[0161] In some aspects of the invention, the cells described in any of the compositions or methods described herein further comprise one or more heterologous nucleic acids encoding a DXS polypeptide or other DXP pathway polypeptides. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding a DXS polypeptide or other DXP pathway polypeptides. In some aspects, the cells further comprise one or more nucleic acids encoding an IDI polypeptide and a DXS polypeptide or other DXP pathway polypeptides. In some aspects, one nucleic acid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or other DXP pathway polypeptides. In some aspects, one plasmid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or other DXP pathway polypeptides. In some aspects, multiple plasmids encode the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or other DXP pathway
polypeptides.
[0162] Exemplary DXP pathways polypeptides include, but are not limited to any of the following polypeptides: DXS polypeptides, DXR polypeptides, MCT polypeptides, CMK polypeptides, MCS polypeptides, HDS polypeptides, HDR polypeptides, and polypeptides (e.g., fusion polypeptides) having an activity of one, two, or more of the DXP pathway polypeptides.
In particular, DXP pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXP pathway polypeptide. Exemplary DXP pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a DXP pathway polypeptide. Exemplary DXP pathway polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein. Exemplary DXP pathway polypeptides and nucleic acids and methods of measuring DXP pathway polypeptide activity are described in more detail in International Publication No. WO 2010/148150.
[0163] In some embodiments, the host cells (such as any of the host cells disclosed herein) can be transformed with polynucleotides encoding l-deoxy-D-xylulose-5-phosphate synthase (DXS) polypeptides. DXS polypeptides convert pyruvate and D-glyceraldehyde-3-phosphate into 1- deoxy-D-xylulose-5-phosphate. Exemplary DXS polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXS polypeptide. Standard methods can be used to determine whether a polypeptide has DXS polypeptide activity by measuring the ability of the polypeptide to convert pyruvate and D- glyceraldehyde-3-phosphate into l-deoxy-D-xylulose-5-phosphate in vitro, in a cell extract, or in vivo (see, e.g., US 8420360 B2, which is hereby incorporated herein in its entirety, particularly with respect to methods of assessing DXS polypeptide activity). Exemplary DXS nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a DXS polypeptide. Exemplary DXS polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
[0164] DXR polypeptides convert 1-deoxy-D-xylulose 5-phosphate (DXP) into 2-C-methyl- D-erythritol 4-phosphate (MEP). Standard methods can be used to determine whether a polypeptide has DXR polypeptides activity by measuring the ability of the polypeptide to convert DXP in vitro, in a cell extract, or in vivo.
[0165] MCT polypeptides convert 2-C-methyl-D-erythritol 4-phosphate (MEP) into 4- (cytidine 5'-diphospho)-2-methyl-D-erythritol (CDP-ME). Standard methods can be used to determine whether a polypeptide has MCT polypeptides activity by measuring the ability of the polypeptide to convert MEP in vitro, in a cell extract, or in vivo. [0166] CMK polypeptides convert 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP- ME) into 2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP-MEP). Standard methods can be used to determine whether a polypeptide has CMK polypeptides activity by measuring the ability of the polypeptide to convert CDP-ME in vitro, in a cell extract, or in vivo.
[0167] MCS polypeptides convert 2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D- erythritol (CDP-MEP) into 2-C-methyl-D-erythritol 2, 4-cyclodiphosphate (ME-CPP or cMEPP). Standard methods can be used to determine whether a polypeptide has MCS polypeptides activity by measuring the ability of the polypeptide to convert CDP-MEP in vitro, in a cell extract, or in vivo.
[0168] HDS polypeptides convert 2-C-methyl-D-erythritol 2, 4-cyclodiphosphate into (E)-4- hydroxy-3-methylbut-2-en-l-yl diphosphate (HMBPP or HDMAPP). Standard methods can be used to determine whether a polypeptide has HDS polypeptides activity by measuring the ability of the polypeptide to convert ME-CPP in vitro, in a cell extract, or in vivo.
[0169] HDR polypeptides convert (E)-4-hydroxy-3-methylbut-2-en-l-yl diphosphate into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Standard methods can be used to determine whether a polypeptide has HDR polypeptides activity by measuring the ability of the polypeptide to convert HMBPP in vitro, in a cell extract, or in vivo.
3. Exemplary IDI Polypeptides and Nucleic Acids
[0170] In some embodiments, the host cells (such as any of the host cells disclosed herein) can be transformed with polynucleotides encoding isopentenyl diphosphate isomerase polypeptides (isopentenyl-diphosphate delta-isomerase or IDI). IDI catalyzes the interconversion of isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) (e.g., converting IPP into DMAPP and/or converting DMAPP into IPP). Exemplary IDI polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an IDI polypeptide. Standard methods can be used to determine whether a polypeptide has IDI polypeptide activity by measuring the ability of the polypeptide to interconvert IPP and DMAPP in vitro, in a cell extract, or in vivo (see, e.g., US 8420360 B2, which is hereby incorporated by reference in its entirety, particularly with respect to assays for IDI activity). Exemplary IDI nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an IDI polypeptide. Exemplary IDI polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
4. Exemplary MVA Pathway Polypeptides and Nucleic Acids
[0171] In some embodiments, the host cells (such as any of the host cells disclosed herein) can be transformed with polynucleotides encoding MVA pathway polypeptides. MVA pathway polypeptides include acetyl-CoA acetyltransferase (AA-CoA thiolase) polypeptides, 3-hydroxy- 3-methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides, 3-hydroxy-3- methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides, mevalonate kinase (MVK) polypeptides, phosphomevalonate kinase (PMK) polypeptides, diphosphomevalonte
decarboxylase (MVD) polypeptides, IDI polypeptides, and polypeptides (e.g., fusion
polypeptides) having an activity of two or more MVA pathway polypeptides. In a modified MVA pathway, phosphomevalonate decarboxylase (PMDC) and isopentenyl phosphate kinase (IPK) are included in place of phosphomevalonate kinase (PMK) and diphosphomevalonate decarboxylase (MVD). In particular, MVA pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an MVA pathway polypeptide. Exemplary MVA pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of an MVA pathway polypeptide. Exemplary MVA pathway polypeptides and nucleic acids include naturally- occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids derived from any of the source organisms described herein.
[0172] In particular, acetyl-CoA acetyltransferase polypeptides (AA-CoA thiolase or AACT) convert two molecules of acetyl-CoA into acetoacetyl-CoA. Standard methods (such as those described herein) can be used to determine whether a polypeptide has AA-CoA thiolase polypeptide activity by measuring the ability of the polypeptide to convert two molecules of acetyl-CoA into acetoacetyl-CoA in vitro, in a cell extract, or in vivo. [0173] 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase or HMGS) polypeptides convert acetoacetyl-CoA into S-hydroxy-S-methylglutaryl-CoA. Standard methods (such as those described herein) can be used to determine whether a polypeptide has HMG-CoA synthase polypeptide activity by measuring the ability of the polypeptide to convert acetoacetyl- CoA into 3-hydroxy-3-methylglutaryl-CoA in vitro, in a cell extract, or in vivo.
[0174] 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase or HMGR) polypeptides convert 3-hydroxy-3-methylglutaryl-CoA into mevalonate. Standard methods (such as those described herein) can be used to determine whether a polypeptide has HMG-CoA reductase polypeptide activity by measuring the ability of the polypeptide to convert 3-hydroxy- 3-methylglutaryl-CoA into mevalonate in vitro, in a cell extract, or in vivo.
[0175] Mevalonate kinase (MVK) polypeptides phosphorylate mevalonate to form
mevalonate-5-phosphate. Standard methods (such as those described herein) can be used to determine whether a polypeptide has MVK polypeptide activity by measuring the ability of the polypeptide to convert mevalonate into mevalonate-5-phosphate in vitro, in a cell extract, or in vivo.
[0176] Phosphomevalonate kinase (PMK) polypeptides phosphorylate mevalonate-5- phosphate to form mevalonate- 5 -diphosphate. Standard methods (such as those described herein) can be used to determine whether a polypeptide has PMK polypeptide activity by measuring the ability of the polypeptide to convert mevalonate- 5 -phosphate into mevalonate-5-diphosphate in vitro, in a cell extract, or in vivo.
[0177] Diphosphomevalonte decarboxylase (MVD or DPMDC) polypeptides convert mevalonate-5-diphosphate into isopentenyl diphosphate polypeptides (IPP). Standard methods (such as those described) can be used to determine whether a polypeptide has MVD polypeptide activity by measuring the ability of the polypeptide to convert mevalonate-5-diphosphate into IPP in vitro, in a cell extract, or in vivo.
[0178] Phosphomevalonate decarboxylase (PMDC) polypeptides convert mevalonate-5- phosphate into isopentenyl phosphate (IP). Standard methods (such as those described) can be used to determine whether a polypeptide has PMDC polypeptide activity by measuring the ability of the polypeptide to convert mevalonate- 5 -phosphate into isopentenyl phosphate in vitro, in a cell extract, or in vivo. [0179] Isopentenyl phosphate kinase (IPK) polypeptides convert isopentenyl phosphate into isopentenyl diphosphate. Standard methods (such as those described) can be used to determine whether a polypeptide has IPK polypeptide activity by measuring the ability of the polypeptide to convert isopentenyl phosphate into isopentenyl diphosphate in vitro, in a cell extract, or in vivo.
[0180] In some embodiments, the host cells (such as any of the host cells disclosed herein) can be transformed to produce isoprene from syngas and/or from carbohydrates or mixtures thereof.
5. Exemplary Source Organisms
[0181] Isoprene synthase, DXP pathway, IDI, or MVA pathway nucleic acids (and their encoded polypeptides) can be obtained from any organism that naturally contains isoprene synthase, DXP pathway, IDI, and/or MVA pathway nucleic acids. As noted above, isoprene is formed naturally by a variety of organisms, such as bacteria, yeast, plants, and animals.
Organisms contain the MVA pathway, DXP pathway, or both the MVA and DXP pathways for producing isoprene. Thus, DXS, DXR, MCT, CMK, MCS, HDS, or HDR nucleic acids can be obtained, e.g., from any organism that contains the DXP pathway or contains both the MVA and DXP pathways. IDI and isoprene synthase nucleic acids can be obtained, e.g., from any organism that contains the MVA pathway, DXP pathway, or both the MVA and DXP pathways. MVA pathway nucleic acids can be obtained, e.g., from any organism that contains the MVA pathway or contains both the MVA and DXP pathways.
[0182] In some embodiments, the nucleic acid sequence of the isoprene synthase, DXP pathway, IDI, or MVA pathway nucleic acid is identical to the sequence of a nucleic acid that is produced by any of the following organisms in nature. In some embodiments, the amino acid sequence of the isoprene synthase, DXP pathway, IDI, or MVA pathway polypeptide is identical to the sequence of a polypeptide that is produced by any of the following organisms in nature. In some embodiments, the isoprene synthase, DXP pathway, IDI, or MVA pathway nucleic acid or polypeptide is a mutant nucleic acid or polypeptide derived from any of the organisms described herein. As used herein, "derived from" refers to the source of the nucleic acid or polypeptide into which one or more mutations is introduced. For example, a polypeptide that is "derived from a plant polypeptide" refers to polypeptide of interest that results from introducing one or more mutations into the sequence of a wild-type (i.e., a sequence occurring in nature) plant polypeptide.
[0183] In some embodiments, the source organism is a fungus, examples of which are species of Aspergillus such as A oryzae and A. niger, species of Saccharomyces such as S. cerevisiae, species of Schizosaccharomyces such as S. pombe, and species of Trichoderma such as T. reesei. In some embodiments, the source organism is a filamentous fungal cell. The term "filamentous fungi" refers to all filamentous forms of the subdivision Eumycotina {see, Alexopoulos, C. J. (1962), Introductory Mycology, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic. The filamentous fungal parent cell may be a cell of a species of, but not limited to, Trichoderma, {e.g., Trichoderma reesei, the asexual morph of Hypocrea jecorina, previously classified as T. longibrachiatum, Trichoderma viride, Trichoderma koningii, Trichoderma harzianum) (Sheir-Neirs et al., Appl. Microbiol. Biotechnol 20: 46-53, 1984; ATCC No. 56765 and ATCC No. 26921); Penicillium sp., Humicola sp. {e.g., H. insolens, H. lanuginose, or H. grisea); Chrysosporium sp. {e.g., C. lucknowense), Gliocladium sp., Aspergillus sp. {e.g., A. oryzae, A. niger, A sojae, A. japonicus, A. nidulans, or A. awamori) (Ward et al, Appl. Microbiol. Biotechnol. 39: 7380743, 1993 and Goedegebuur et al, Genet 41: 89-98, 2002), Fusarium sp., (e.g., F. roseum, F. graminum F. cerealis, F. oxysporuim, or F. venenatum), Neurospora sp., (e.g., N. crassa), Hypocrea sp., Mucor sp., (e.g., M. miehei), Rhizopus sp. and Emericella sp. (see also, Innis et al, Sci. 228: 21-26, 1985). The term
"Trichoderma" or "Trichoderma sp." or "Trichoderma spp." refer to any fungal genus previously or currently classified as Trichoderma.
[0184] In some embodiments, the fungus is A. nidulans, A. awamori, A. oryzae, A. aculeatus, A. niger, A. japonicus, T. reesei, T. viride, F. oxysporum, or F. solani. Aspergillus strains are disclosed in Ward et al., Appl. Microbiol. Biotechnol. 39:738-743, 1993 and Goedegebuur et al., Curr Gene 41:89-98, 2002, which are each hereby incorporated by reference in their entireties, particularly with respect to fungi. In particular embodiments, the fungus is a strain of
Trichoderma, such as a strain of T. reesei. Strains of T. reesei are known and non-limiting examples include ATCC No. 13631, ATCC No. 26921, ATCC No. 56764, ATCC No. 56765, ATCC No. 56767, and NRRL 15709, which are each hereby incorporated by reference in their entireties, particularly with respect to strains of T. reesei. In some embodiments, the host strain is a derivative of RL-P37. RL-P37 is disclosed in Sheir-Neiss et ah, Appl. Microbiol.
Biotechnology 20:46-53, 1984, which is hereby incorporated by reference in its entirety, particularly with respect to strains of T. reesei.
[0185] In some embodiments, the source organism is a yeast, such as Saccharomyces sp., Schizosaccharomyces sp. , Pichia sp., or Candida sp.
[0186] In some embodiments, the source organism is a bacterium, such as strains of Bacillus such as B. lichenformis or B. subtilis, strains of Pantoea such as P. citrea, strains of
Pseudomonas such as P. alcaligenes, strains of Streptomyces such as S. lividans or S.
rubiginosus, strains of Thermosynechococcus such as T. elongatus, strains of Sinorhizobium such as S. meliloti, strains of Helicobacter such as H. pylori, strains of Agrobacterium such as A. tumefaciens, strains of Deinococcus such as D. radiodurans, strains of Listeria such as L.
monocytogenes, strains of Lactobacillus such as L. spp, or strains of Escherichia such as E. coli.
[0187] In some embodiments, the source organism is a bacterium, such as strains of
Escherichia (e.g., E. coli), or strains of Bacillus (e.g., B. subtilis).
[0188] As used herein, "the genus Escherichia" includes all species within the genus
"Escherichia," as known to those of skill in the art, including but not limited to E. coli, E.
adecarboxylata, E. albertii, E. blattae, E. fergusonii, E. hermannii, E. senegalensis, and E.
vulneris. The genus "Escherichia" is defined as Gram-negative, non-spore forming, facultatively anaerobic, rod- shaped bacteria are classified as members of the Family Enterobacteriaceae, Order Enterobacteriales, Class Gamma Proteobacteria.
[0189] As used herein, "the genus Bacillus" includes all species within the genus "Bacillus," as known to those of skill in the art, including but not limited to B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. megaterium, B. coagulans, B. circulans, B. lautus, and B. thuringiensis. It is recognized that the genus Bacillus continues to undergo taxonomical reorganization. Thus, it is intended that the genus include species that have been reclassified, including but not limited to such organisms as B. stearothermophilus, which is now named "Geobacillus
stearothermophilus." The production of resistant endospores in the presence of oxygen is considered the defining feature of the genus Bacillus, although this characteristic also applies to the recently named Alicyclobacillus, Amphibacillus, Aneurinibacillus, Anoxy bacillus,
Brevibacillus, Filobacillus, Gracilibacillus, Halobacillus, Paenibacillus, Salibacillus,
Thermobacillus, Ureibacillus, and Virgibacillus.
[0190] In some embodiments, the source organism is a gram-positive bacterium. Non-limiting examples include strains of Streptomyces (e.g., S. lividans, S. coelicolor, or S. griseus), Bacillus, Listeria (e.g., L. monocytogenes) or Lactobacillus (e.g., L. spp). In some embodiments, the source organism is a gram-negative bacterium, such as E. coli, Pseudomonas sp, or H. pylori.
[0191] In some embodiments, the source organism is a plant, such as a plant from the family Fabaceae, such as the Faboideae subfamily. In some embodiments, the source organism is kudzu, poplar (such as Populus alba x tremula CAC35696), aspen (such as Populus
tremuloides), Quercus robur, Arabidopsis (such as A. thaliana), or Zea (such as Z. mays).
[0192] In some embodiments, the source organism is an algae, such as a green algae, red algae, glaucophytes, chlorarachniophytes, euglenids, chromista, or dinoflagellates.
[0193] In some embodiments, the source organism is a cyanobacterium, such as cyanobacteria classified into any of the following groups based on morphology: Chroococcales,
Pleurocapsales, Oscillatoriales, Nostocales, or Stigonematales. In some embodiments, the cyanobacterium is Thermosynechococcus elongates.
B. Method for Using Engineered cells for Butadiene Production
[0194] In some embodiments, the host cells (such as any of the host cells disclosed herein) can be transformed with one or more polynucleotides encoding the polypeptides of one or more pathways for the production of butadiene (shown in Figures 23-25) such that butadiene synthetic enzymes are expressed in a sufficient amount to produce butadiene. The butadiene pathway includes an acetyl-CoA:acetyl-CoA acyltransferase, an acetoacetyl-CoA reductase, a 3- hydroxybutyryl-CoA dehydratase, a crotonyl-CoA reductase (aldehyde forming), a
crotonaldehyde reductase (alcohol forming), a crotyl alcohol kinase, a 2-butenyl-4-phosphate kinase, a butadiene synthase, a crotonyl-CoA hydrolase, a crotonyl-CoA synthetase, a crotonyl- CoA transferase, a crotonate reductase, a crotonyl-CoA reductase (alcohol forming), a glutaconyl-CoA decarboxylase, a glutaryl-CoA dehydrogenase, an 3-aminobutyryl-CoA deaminase, a 4-hydroxybutyryl-CoA dehydratase or a crotyl alcohol diphosphokinase. The production of butadiene from bacteria is described in WO 2011/140171 A2, hereby incorporated by reference in its entirety, particularly with respect to the pathways for production of butadiene from acetyl-CoA (FIG. 23), from erythrose-4-phosphate (FIG. 24), and from malonyl-CoA plus acetyl-CoA (FIG. 25).
C. Method of Using Engineered cells for Ethanol Production
[0195] Several microorganisms are known to produce ethanol through the acetyl-CoA pathway, which can utilize both carbon monoxide and hydrogen as carbon sources and as energy sources. For example, the production of ethanol from microorganisms such as Clostridial bacteria is described in Kopke et al., 2011, Fermentative production of ethanol from carbon monoxide, Current Opinion in Biotechnology, Vol. 22:320-323, and in Wilkins et al., 2011, Microbial production of ethanol from carbon monoxide, Current Opinion in Biotechnology, Vol. 22:326-330, both of which are hereby incorporated in their entirety.
[0196] In some embodiments, the compositions and methods disclosed herein can be used to transform host cells (such as any of the host cells disclosed herein) that contain the ethanol pathway with one or more heterologous polynucleotides encoding one or more ethanol pathway enzymes expressed in sufficient amount to produce ethanol. In some embodiments, the pathway for production of ethanol from acetyl-CoA includes the aldehyde dehydrogenase enzyme and the alcohol dehydrogenase enzyme (see, e.g., FIG. 18).
D. Method of Using Engineered cells for Production of Other Industrial Bio-Products
[0197] In some aspects of the invention, any of the methods described herein may be used to produce products other than isoprene, butadiene, and ethanol. Such products may be excreted, secreted, or intracellular products. Any one of the methods described herein may be used to produce isoprene and/or one or more of the other products. The products described herein may be, for example, propanediol (e.g., 1,2-propanediol, 1,3-propanediol), hydrogen, acetate, or microbial fuels. Exemplary microbial fuels are fermentative alcohols (e.g., ethanol or butanol), non-fermentative alcohols (e.g., isobutanol, methyl butanol, 1-propanol, 1-butanol, methyl pentanol, or 1-hexanol), fatty alcohols, fatty acid esters, isoprenoid alcohols, alkenes, and alkanes. The products described herein may also be a terpenoid, isoprenoid (e.g. , farnesene), carotenoid or other C5, CIO, C15, C20, C25, C30, C35, or C40 product.
[0198] In some aspects, the terpenoids are selected from the group consisting of
hemiterpenoids, monoterpenoids, sesquiterpenoids, diterpenoids, sesterterpenoids, triterpenoids, tetraterpenoids, and higher polyterpenoids. In some aspects, the hemiterpenoid is prenol, isoprenol, or isovaleric acid. In some aspects, the monoterpenoid is geranyl pyrophosphate, eucalyptol, limonene, or pinene. In some aspects, the sesquiterpenoid is farnesyl pyrophosphate, artemisinin, or bisabolol. In some aspects, the diterpenoid is geranylgeranyl pyrophosphate, retinol, retinal, phytol, taxol, forskolin, or aphidicolin. In some aspects, the triterpenoid is squalene or lanosterol. In some aspects, the tetraterpenoid is lycopene or carotene. In some aspects, the carotenoids are selected from the group consisting of xanthophylls and carotenes. In some aspects, the xanthophyll is lutein or zeaxanthin. In some aspects, the carotene is a- carotene, β-carotene, γ-carotene, β-cryptoxanthin or lycopene.
[0199] The products described herein may be derived from Acetyl-CoA produced via syngas fermentation or via fermentation of other carbon sources such as fructose. In some aspects, the cell is grown under conditions suitable for the production of the product(s) other than isoprene.
[0200] The products described herein may be naturally produced by the cell. In some aspects, the cells naturally produce one or more products including excreted, secreted, or intracellular products. In some aspects, the cells naturally produce ethanol, propanediol, hydrogen, or acetate. In some aspects, production of a naturally occurring product is increased relative to wild-type cells. Any method known in the art to increase production of a metabolic cellular product may be used to increase the production of a naturally occurring product. In some aspects, the nucleic acid encoding all or a part of the pathway for production of a product described herein is operably linked to a promoter such as a strong promoter. In some aspects, the nucleic acid encoding all or a part of the pathway for production of a product described herein is operably linked to a constitutive promoter. In some aspects, the cell is engineered to comprise additional copies of an endogenous nucleic acid encoding a polypeptide for the production of a product described herein. In some aspects, the product described herein is not naturally produced by the cell. In some aspects, the cell comprises one or more heterologous nucleic acids encoding one or more polypeptides for the production of a product described herein.
[0201] Under normal growth conditions, acetogens produce acetate and ethanol. Acetate is produced in a 2-step reaction in which acetyl-CoA is firstly converted to acetyl-phosphate by phosphotransacetylase (pta), and then acetyl-phosphate is dephosphorylated by acetate kinase (ack) to form acetate. Ethanol is formed by a two-step process in which acetyl-CoA is converted to acetaldehyde and then to ethanol by the multifunctional enzyme alcohol dehydrogenase (adhE). The production of acetate and ethanol may not be desirable in isoprene-producing cells, as it fluxes carbon away from isoprene and ultimately results in decreased yield of isoprene. Thus, some or all of the genes coding for phosphotransacetylase (pta), acetate kinase (ack), and alcohol dehydrogenase (adhE) may be disrupted or the expressions thereof are reduced in anaerobic cells for the purpose of redirecting carbon flux away from acetate and/or ethanol and increasing the production of isoprene.
[0202] In some aspects, the cells are deficient in at least one polypeptide involved in production of acetate, ethanol, succinate, and/or glycerol. In some aspects, one or more pathways for production of a metabolite other than isoprene (e.g., lactate, acetate, ethanol (or other alcohol(s)), succinate, or glycerol) are blocked, for example, the production of a metabolite other than isoprene may be reduced by at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some aspects, one or more of the pathways for production of lactate, acetate, ethanol, succinate, or glycerol is blocked, for example, the production for lactate, acetate, ethanol, succinate, and/or glycerol is reduced by at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some aspects, the cells are deficient in at least one polypeptide in pathway(s) of producing acetate, ethanol, succinate, and/or glycerol. Polypeptides in pathway(s) of producing acetate, ethanol, succinate, and/or glycerol may have reduced activities or the expressions thereof are reduced. Nucleic acids encoding polypeptides in pathway(s) of producing acetate, ethanol, succinate, and/or glycerol may be disrupted. The polypeptides involved in various pathways (e.g., pathways for producing ethanol and/or acetate) are known to one skilled in the art, including, for example, those described in Misoph et al. 1996, Journal of Bacteriology, 178(11):3140-45, the contents of which are expressly
incorporated by reference in its entirety with respect to the polypeptides involved in pathways of producing succinate, acetate, lactate, and/or ethanol. [0203] In some aspects, the cells are deficient in pta. In some aspects, the cells are deficient in ack. In some aspects, the cells are deficient in adhE. In some aspects, the cells are deficient in pta, ack, and/or adhE. In some aspects, the expressions of phosphotransacetylase, acetate kinase, and/or alcohol dehydrogenase are reduced. In some aspects, the activities of
phosphotransacetylase, acetate kinase, and/or alcohol dehydrogenase are reduced. In some aspects, the cells are deficient in polypeptide(s) having similar activities as
phosphotransacetylase, acetate kinase, and/or alcohol dehydrogenase. The expression of pta, ack, adhE, and/or polypeptide(s) having similar activities as phosphotransacetylase, acetate kinase, and/or alcohol dehydrogenase may be reduced by any of the methods known to one skilled in the art, for example, the expression may be reduced by antisense RNA(s) {e.g., antisense RNA driven by any of the promoters described herein such as any of the inducible promoters). In some aspects, the antisense RNA(s) are operably linked to a suitable promoter such as any of the promoters described herein including inducible promoters.
[0204] In some aspects, isoprene and product(s) other than isoprene are both recovered from the gas phase. In some aspects, isoprene is recovered from the gas phase {e.g. from the fermentation of gas), and the other product(s) are recovered from the liquid phase {e.g. from the cell broth).
VII. Bioreactors
[0205] A variety of different types of reactors can be used for production of isoprene or other industrial bio-products. In some embodiments, a carbohydrate is used as energy and/or carbon source. In some embodiments, a carbohydrate and hydrogen are used as energy and/or carbon source. In some embodiments, syngas is used as energy and/or carbon source. There are a large number of different types of fermentation processes that are used commercially. Bioreactors for use in the present invention should be amenable to anaerobic conditions. The bioreactor can be designed to optimize the retention time of the cells, the residence time of liquid, and the sparging rate of syngas.
[0206] In various aspects, the cells are grown using any known mode of fermentation, such as batch, fed-batch, continuous, or continuous with recycle processes. In some aspects, a batch method of fermentation is used. Classical batch fermentation is a closed system where the composition of the media is set at the beginning of the fermentation and is not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the cell medium is inoculated with the desired host cells and fermentation is permitted to occur adding nothing to the system. Typically, however, "batch" fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems, the metabolite and biomass compositions of the system change constantly until the time the fermentation is stopped. Within batch cultures, cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. In some aspects, cells in log phase are responsible for the bulk of the isoprene production. In some aspects, cells in stationary phase produce isoprene.
[0207] In some aspects, a variation on the standard batch system is used, such as the Fed-Batch system. Fed-Batch fermentation processes comprise a typical batch system with the exception that the carbon source (e.g. syngas, glucose, fructose) is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of carbon source in the cell medium. Fed-batch fermentations may be performed with the carbon source (e.g. , syngas, glucose, fructose) in a limited or excess amount. Measurement of the actual carbon source concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen, and the partial pressure of waste gases such as C02. Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Brock, Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc.
[0208] In some aspects, continuous fermentation methods are used. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned medium is removed simultaneously for processing.
Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
[0209] Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or isoprene production. For example, one method maintains a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allows all other parameters to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration (e.g. , the concentration measured by media turbidity) is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, the cell loss due to media being drawn off is balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., which is hereby incorporated by reference in its entirety, particularly with respect to cell culture and fermentation conditions.
[0210] A variation of the continuous fermentation method is the continuous with recycle method. This system is similar to the continuous bioreactor, with the difference being that cells removed with the liquid content are returned to the bioreactor by means of a cell mass separation device. Cross-filtration units, centrifuges, settling tanks, wood chips, hydrogels, and/or hollow fibers are used for cell mass separation or retention. This process is typically used to increase the productivity of the continuous bioreactor system, and may be particularly useful for anaerobes, which may grow more slowly and in lower concentrations than aerobes.
[0211] In one aspect, a membrane bioreactor can be used for the growth and/or fermentation of the anaerobic cells described herein, in particular, if the cells are expected to grow slowly. A membrane filter, such as a crossflow filter or a tangential flow filter, can be operated jointly with a liquid fermentation bioreactor that produces isoprene gas. Such a membrane bioreactor can enhance fermentative production of isoprene gas by combining fermentation with recycling of select broth components that would otherwise be discarded. The MBR filters fermentation broth and returns the non-permeating component (filter "retentate") to the reactor, effectively increasing reactor concentration of cells, cell debris, and other broth solids, while maintaining specific productivity of the cells. This substantially improves titer, total production, and volumetric productivity of isoprene, leading to lower capital and operating costs.
[0212] The liquid filtrate (or permeate) is not returned to the reactor and thus provides a beneficial reduction in reactor volume, similar to collecting a broth draw-off. However, unlike a broth draw-off, the collected permeate is a clarified liquid that can be easily sterilized by filtration after storage in an ordinary vessel. Thus, the permeate can be readily reused as a nutrient and/or water recycle source. A permeate, which contains soluble spent medium, may be added to the same or another fermentation to enhance isoprene production. VIII. Recovery Methods
[0213] Any of the methods described herein further include recovering the industrial bio- product (e.g. , isoprene, butadiene, ethanol, etc.). For example, the isoprene produced using the compositions and methods of the invention can be recovered using standard techniques, such as gas stripping, membrane enhanced separation, fractionation, adsorption/desorption, evaporation, thermal or vacuum desorption of isoprene from a solid phase, or extraction of isoprene immobilized or absorbed to a solid phase with a solvent (see, for example, U.S. Patent Nos. 4,703,007 and 4,570,029). In one aspect, the isoprene is recovered by absorption stripping (see, e.g. , International Patent Application No. PCT/US2010/060552 (WO 2011/075534)). In particular aspects, extractive distillation with an alcohol (such as ethanol, methanol, propanol, or a combination thereof) is used to recover the isoprene. In some aspects, the recovery of isoprene involves the isolation of isoprene in a liquid form (such as a neat solution of isoprene or a solution of isoprene in a solvent). Gas stripping involves the removal of isoprene vapor from the fermentation off-gas stream in a continuous manner. Such removal can be achieved in several different ways including, but not limited to, adsorption to a solid phase, partition into a liquid phase, or direct condensation (such as condensation due to exposure to a condensation coil or do to an increase in pressure). In some aspects, membrane enrichment of a dilute isoprene vapor stream above the dew point of the vapor resulting in the condensation of liquid isoprene. In some aspects, the isoprene is compressed and condensed.
[0214] The recovery of isoprene may involve one step or multiple steps. In some aspects, the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed simultaneously. For example, isoprene can be directly condensed from the off-gas stream to form a liquid. In some aspects, the removal of isoprene vapor from the fermentation off-gas and the conversion of isoprene to a liquid phase are performed sequentially. For example, isoprene may be adsorbed to a solid phase and then extracted from the solid phase with a solvent.
[0215] In some aspects, any of the methods described herein further include a step of recovering the compounds produced. In some aspects, any of the methods described herein further include a step of recovering the isoprene. In some aspects, the isoprene is recovered by absorption stripping (See, e.g., U.S. Publ. No. 2011/0178261). [0216] Isoprene compositions recovered from fermentations may contain impurities. The identities and levels of impurities in an isoprene composition can be analyzed by standard methods, such as GC/MS, GC/FID, and 1H NMR. An impurity can be of microbial origin, or it can be a contaminant in the syngas feed or other fermentation raw materials.
[0217] In some aspects, the isoprene composition recovered from fermentation comprises one or more of the following impurities: hydrogen sulfide, carbonyl sulfide, carbon disulfide, ethanol, acetone, methanol, acetaldehyde, methacrolein, methyl vinyl ketone, 2-methyl-2-vinyloxirane, cis- and ira¾s-3-methyl-l,3-pentadiene, a C5 prenyl alcohol (such as 3-methyl-3-buten-l-ol or 3- methyl-2-buten-l-ol), 2-heptanone, 6-methyl-5-hepten-2-one, 2,4,5-trimethylpyridine, 2,3,5- trimethylpyrazine, citronellal, methanethiol, ethanethiol, methyl acetate, 1-propanol, diacetyl, 2- butanone, 2-methyl-3-buten-2-ol, ethyl acetate, 2-methyl- 1-propanol, 3-methyl-l-butanal, 3- methyl-2-butanone, 1-butanol, 2-pentanone, 3 -methyl- 1-butanol, ethyl isobutyrate, 3-methyl-2- butenal, butyl acetate, 3-methylbutyl acetate, 3-methyl-3-buten-l-yl acetate, 3-methyl-2-buten-l- yl acetate, (E)-3,7 -dimethyl- 1,3,6-octatriene, (Z)-3,7-dimethyl-l,3,6-octatriene, (E,E)-3,7,11- trimethyl-l,3,6,10-dodecatetraene, (E)-7,l l-dimethyl-3-methylene-l,6,10-dodecatriene, 3- hexen-l-ol, 3-hexen-l-yl acetate, limonene, geraniol (trans-3,7-dimethyl-2,6-octadien-l-ol), citronellol (3,7-dimethyl-6-octen-l-ol), (E)-3-methyl-l,3-pentadiene, (Z)-3-methyl-l,3- pentadiene, thiol(s), mono and disulfide(s), or gas(es) such as CS2 and COS. In one embodiment, the isoprene composition recovered from syngas fermentation under anaerobic conditions may comprise one or more of the components described in Rimbault A et al. 1986, J of
Chromatography, 375: 11-25, the contents of which are expressly incorporated herein by reference in its entirety.
[0218] In some aspects, any of the methods described herein further include purifying the isoprene. For example, the isoprene produced using the compositions and methods of the invention can be purified using standard techniques. Purification refers to a process through which isoprene is separated from one or more components that are present when the isoprene is produced. In some aspects, the isoprene is obtained as a substantially pure liquid. Examples of purification methods include (i) distillation from a solution in a liquid extractant and (ii) chromatography. As used herein, "purified isoprene" means isoprene that has been separated from one or more components that are present when the isoprene is produced. In some aspects, the isoprene is at least about 20%, by weight, free from other components that are present when the isoprene is produced. In various aspects, the isoprene is at least or about 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, or 99%, by weight, pure. Purity can be assayed by any appropriate method, e.g., by column chromatography, HPLC analysis, or GC-MS analysis.
[0219] In some aspects, at least a portion of the gas phase remaining after one or more recovery steps for the removal of isoprene is recycled by introducing the gas phase into a cell culture system (such as a fermentor) for the production of isoprene.
[0220] In some embodiments, recovery of industrial enzymes can use any method known to one of skill in the art and/or any of the exemplary protocols that are disclosed in U.S. Appl. Pub. Nos. 2009/0311764, 2009/0275080, 2009/0252828, 2009/0226569, 2007/0259397 and U.S. Patent Nos. 7,629,451; 7,604,974; 7,541,026; and 7,527,959 and for neutraceuticals (see, e.g., U.S. Patent No. 7,622,290), and for antimicrobials (see, e.g., U.S. Appl Pub. No.
2009/0275103).
[0221] The following examples have been provided for illustrative purposes only and are not intended to limit the invention.
EXAMPLES
Example 1: Construction of a plasmid with nitrate regulated expression of mvaE and mvaS
[0222] The purpose of this example is to describe construction of a plasmid with nitrate regulated expression of mvaE and mvaS and strains containing that plasmid. A comparison strain containing a plasmid with a strong Ptrc promoter driving mvaE and mvaS expression is also described.
[0223] Nitrate salts are potentially inexpensive chemicals by which gene expression could be switched. However, in E. coli nitrate induction of gene expression requires anaerobic growth conditions. Frequently, it is desirable to control gene expression in aerobic growth conditions. A mutation in the narG promoter that allowed induction of narG expression by nitrate under aerobic conditions has been described (Walker, W.S. and DeMoss, J. A. 1992. Role of
Alternative Promoter Elements in Transcription from the nar Promoter of Escherichia coli. J. Bacteriol. 174: 1119-1123) Thus, to test if nitrate could be used to induce heterologous gene expression in aerobic growth conditions this mutant promoter was tested for regulation of mvaE and mvaS expression.
A. Construction ofpDMWP170 with PnarG*
[0224] The mutant narG promoter described by Walker and DeMoss had the following sequence:
aatactccttaatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaacgtcttaatttacagtctgttatgtggtggctgtt aattatcctaaaggggtatcttaggaatttactttatttttcatccccatcactcttggtcgttatcaattcccacgctgtttcagagcggtataat gccctta (SEQ ID NO:3)
For convenience, we named this promoter PnarG*.
[0225] Plasmid pDMWP170 (pCL-PnarG*-mvaE-mvaS) is a spectinomycin-resistant medium copy plasmid with PnarG* driving expression of Enterococcus gallinarum mvaE and mvaS genes for mevalonic acid production. It was constructed as follows.
[0226] A Gibson Assembly (New England Biolabs) kit was used following the manufacturer's protocol.
[0227] A vector containing the mvaE and mvaS genes, pMCM1225 (pCL-Ptrc mvaE mvaS), was amplified with primers ODMWP279 and ODMWP281.
ODMWP279: TCACACAGGAAACAGCGCCGCTGAG (SEQ ID NO:5)
ODMWP281: GCTCATTTCAGAATCTGCATTAATG (SEQ ID NO:6)
[0228] The second fragment containing the narG promoter was amplified from template E. coli MG1655 chromosomal DNA using primers that would contain the desired mutations, ODMWP282 and ODMWP283.
ODMWP282: CAGATTCTGAAATGAGCAATACTCCTTAATACCCATCTGC (SEQ ID NO:7)
ODMWP283:
CGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAAACAGCGTGGGAATTGA TAACGACCAAGAGTGATGG (SEQ ID NO: 8) B. Test strain for nitrate induction
[0229] E. coli strain MD12-778 (BL21, GI1.2gltA, yhfSFRTPyddVIspAyhfS,
thiFRTtruncIspA) was transformed with plasmid pDMWP170 with selection for spectinomycin resistance and the resultant strain was named DP2074.
C. Construction of comparison strain LE1023
[0230] E. coli strain LEI 023 carries plasmid pMCM1225, which has the trc promoter driving expression of mvaE and mvaS, in a host strain closely related to MD12-778 but with restored function of btuB. Strain LE1023 was constructed as follows.
[0231] The E. coli K12 btuB gene was used to replace the defective btuB gene in E. coli strain HMB (BL21 tpgl PL.2mKKDyl). Plasmid pKD46 (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97, 6640-6645) encodes arabinose inducible lambda Red mediated recombination functions. This plasmid was transformed into strain HMB and the resultant strain was induced with arabinose and transformed with a PCR product using E. coli K12 strain MG1655 chromosomal DNA as a template and primers ODMWP231 and ODMWP232.
ODMWP231: ATGATTAAAAAAGCTTCGCTGC (SEQ ID NO:9)
ODMWP232: GATGATATTCACCACCCCGC (SEQ ID NO: 10)
[0232] Selection was for growth on minimal medium plates with vitamin B12 and
ethanolamine as the sole nitrogen source. The media recipe was 5 g/L glycerol, 7 g/L K2HP04, 3 g/L KH2P04, 1 g/L Na2S04, 0.1 g/L MgS04 «7H20, 1 g/L ethanolamine hydrochloride, 40 μg/L vitamin B12, and 2% agar. After incubation at 37 °C for 2 days, single colonies were streaked to LB Lennox plates. A purified single colony was then tested for growth on the glycerol/ethanolamine plates with vitamin B12. A strain that grew well was retained and named DP2035. PCR was done using DP2035 chromosomal DNA as a template and primers
ODMWP231/232. The PCR product was submitted for DNA sequencing and the sequence data showed that the TAG stop codon in BL21 btuB was changed.
[0233] Strain MD 12-778 was the recipient strain for PI mediated generalized transduction with donor strain DP2035, with selection for growth at 37 °C on minimal Glycerol Ethanolamine B12 plates. A transductant colony was single colony purified on LB Lennox agar plates. A colony that was positive for growth on minimal Glycerol Ethanolamine B12 plate was retained and named TV3011.
[0234] Strain TV3011 was transformed with plasmid pMCM1225 with selection for spectinomycin resistance and the resultant strain was named LEI 023.
Example 2: Nitrate induced MVA production and mvaE and mvaS mRNA expression
[0235] The purpose of this example is to describe data demonstrating nitrate-induced MVA production and nitrate induced mvaE and mvaS mRNA expression.
A. Demonstration of MVA production induced by nitrate
[0236] Overnight cultures of strains DP2074 and LEI 023 (described in Example 1) were grown in LA medium with Spectinomycin 50 μg/mL at 34 °C. For aerobic shake flask growth, the overnight cultures were diluted 1: 100 into 25 mL TM3 medium with 8 mM MgS04, 0.02% yeast extract, 10 g/L glucose, Spectinomycin 50 μg/mL in 125 mL plastic flasks with vented tops. Seven flasks were inoculated with DP2074 and three flasks were inoculated with LE1023. The flasks were incubated for 2 hours at 34 °C, 250 rpm, at which time potassium nitrate from a 250 g/L stock solution was added to the DP2074 flasks to final concentrations of 0, 0.002, 0.01, 0.05, 0.25, 1.25, or 6.25 g/L. At the same time, potassium nitrate was added to the LE1023 flasks to final concentrations of 0, 1.25 or 6.25 g/L. Four hours after induction, samples were taken for RNA preparation. The rest of the cultures were incubated for a total of 24 hours. Samples were prepared for HPLC analyses by adding 54 μL· of 10% w/v sulfuric acid to a 300 μL· aliquot of flask broth. The acidified tubes were held at 4 °C for 5 minute, then spun in a centrifuge tube filter (Costar, Spin-X, 0.22 μιη nylon) at 14,000 rpm for 5 minutes. The filtrate was put into HPLC vials. HPLC analysis was done on a Waters e2695 HPLC, using refractive index (RI) detection. Chromatographic separation was achieved using a Shodex SH-1011 column and 0.01 N (0.005 M) H2S04 as the mobile phase with a flow rate of 0.5 mL/min and a column temperature of 50 °C. Eluted compounds were quantified by refractive index detection with reference to a standard curve prepared from commercially purchased pure compounds dissolved to known concentrations. Results of MVA production in the presence and absence of nitrate are shown in the table 2-1 below. Table 2-1: MVA production in presence and absence of nitrate
Figure imgf000069_0001
[0237] As expected the comparison strain LEI 023 had high level MVA production in the absence of nitrate with very similar MVA production in the presence of 1.25 or 6.25 g/L potassium nitrate.
[0238] In contrast, strain DP2074 had very little MVA production in the absence of nitrate. The lowest amount of nitrate tested, 0.002 g/L induced an 8 fold increase in MVA production in strain DP2074 (Figure 2). Increasing nitrate concentrations lead to increasing MVA production up to 0.25 g/L nitrate, with an 18-fold increase in MVA production as compared to the culture without nitrate. Nitrate addition at 1.25 or 6.25 g/L to cultures of DP2074 yielded about the same MVA production as did the 0.25 g/L induction. Thus aerobic nitrate induction of MVA production was demonstrated.
B. RNA preparation and qRT-PCR
[0239] The cultures of strains DP2074 and LEI 023 described above were sampled for RNA at 4 hours after nitrate addition by adding 5 mL into 10 mL RNAprotect (Qiagen, Germantown, MD). They were left at room temp for 5 min. The samples were then spun for 10 min and the supernatant was discarded. The pellets were then frozen at -80 °C until RNA isolation was performed. RNA isolation was done using the Qiagen RNeasy Mini kit (Qiagen, Germantown, MD). Lysozyme was used to break up the cells. To TE buffer, 1 mg/mL lysozyme was added. The pellets were then resuspended in 200 μΐ^ of the TE/lysozyme mix. The samples were allowed to sit at room temperature for 10 min. To help inhibit RNase activity, 7 μL· β- mercaptoethanol was added to 693 μΐ^ of RLT buffer supplied in the RNeasy kit and this mix was added to each sample. After complete mixing, 500 μΐ^ of 100% ethanol was added and mixed. The samples were then applied to an RNeasy column, 700 μΐ^ at a time. They were spun for 1 min at 10,000 rpm and flow through was discarded. Another 700 μΐ^ of each sample was then added to the column, spun and again flow through was discarded. To each column, 700 μΐ^ of RW1 buffer was added and the columns were spun for 1 min. An on-column DNase treatment was then performed. The RNase-free DNase kit from Qiagen (Germantown, MD) was used to perform this treatment. To each column, a mix of 10 μΐ^ of DNase and 70 μΐ^ of RDD buffer was added. The columns were allowed to stand at room temperature for 15 min. After DNase treatment, the columns were cleaned by adding 500 μΐ^ of RW1 buffer and spun for 1 min at 15,000 G. The filtrate was discarded. The RNeasy column was transferred to a new 2 mL collection tube and 500 μΐ^ of RPE buffer was added. After it was spun for 1 min and the filtrate discarded, this wash step was repeated but was centrifuged for 2 min. The column was again transferred to a new 2 mL collection tube and spun for 1 min to remove any residual buffer. Finally, the column was placed in a 1.5 mL collection tube and 50 μΐ^ of RNase free water was pipetted directly onto the RNeasy membrane. The samples were allowed to sit at room temperature for 5 min, after which they were spun for 1 min to elute the RNA. The RNA concentration was determined by measuring 2 μL· of sample on a NanoDrop spectrophotometer (Wilmington, DE). The RNA samples were then stored at -80 °C until qPCR was performed.
[0240] Quantitative Reverse Transcription PCR (qRT-PCR) analysis was performed as follows. To remove any residual genomic DNA, 3 μg of total RNA was treated with RNase-free DNase (Qiagen, Hilden, Germany). The DNase was then inactivated by 1 mM EDTA and heating to 75 °C for 5 minutes. 1 μg of DNase-treated RNA was then converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) as per the manufacturer's instructions. cDNA was then diluted 1: 10 in water for qPCR analysis. [0241] qPCR was performed for the target genes. All primers and probes were designed utilizing Primer Express v 3.0.1 software (Applied Biosystems, Foster City, CA). The 5' end of the TaqMan fluorogenic probes have the 6-FAM™ (6-carboxyfluorescein) fluorescent reporter dye bound, while the 3' end includes the TAMRA™ (Carboxytetramethylrhodamine) quencher dye. All primers and probes were obtained from Sigma-Genosys (Woodlands, TX). Primers were evaluated for specificity utilizing BLAST analysis (genolevures.org/yali.html) and validated for quantitation utilizing genomic DNA. Primers with PCR efficiencies between 0.85 - 1.15 were validated for quantitation (data not shown).
[0242] Real-time PCR reactions included 10 pmoles each of forward and reverse primers, 2.5 pmoles of TaqMan probe, 10 μΐ TaqMan Universal PCR Master Mix-No AmpErase® Uracil-N- Glycosylase (UNG) (Catalog No. PN 4326614, Applied Biosystems), 1 μΐ 1: 10 diluted cDNA, and 8.5 μΐ RNase-/ DNase-free water for a total volume of 20 μΐ per reaction. Reactions were run on the ABI PRISM 7900 Sequence Detection System under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 sec and annealing at 60 °C for 1 min. Real time data was collected automatically during each cycle by monitoring 6-FAM™ fluorescence. Relative expression (RQ) was calculated using Data Assist Software v3.01 and the AACt method (Applied Biosystems, Foster City, Ca). The rrsB gene was utilized for data normalization. Relative expression was then calculated by comparing the gene expression in the different strains and growth conditions. The gene expression in the table 2-2 below and in Figure 3 is relative to the sample from LEI 023 culture without nitrate.
Table 2-2: Gene expression with and without nitrate
Figure imgf000071_0001
6 DP2074 1.25 g/L 0.42 0.02 0.51 0.03
7 DP2074 6.25 g/L 0.57 0.05 0.64 0.02
8 LE1023 0 g/L 1.00 0.08 1.00 0.10
9 LE1023 1.25 g/L 0.98 0.05 0.73 0.05
10 LE1023 6.25 g/L 0.96 0.04 0.81 0.11
[0243] As expected, expression of mvaE or mvaS in the comparison strain LEI 023 was not substantially affected by the presence of 1.25 or 6.25 g/L potassium nitrate.
[0244] In contrast, strain DP2074 had low expression of mvaE and mvaS in the absence of nitrate. The lowest amount of nitrate tested, 0.002 g/L, induced a 4.5-fold increase in mvaE expression and a 2-fold increase in mvaS expression. Increasing nitrate concentrations lead to increasing mvaE and mvaS expression. At 6.25 g/L nitrate, there was a 14-fold increase in mvaE expression and 4.6-fold increase in mvaS expression. Thus, aerobic nitrate induction of mvaE and mvaS mRNA was demonstrated. These data also show that the PnarG* promoter in strain DP2074 was not as active as the Ptrc promoter in strain LEI 023.
Example 3: Improved MVA production with a strain that constitutively expressed the nitrate regulatory genes, narL and narX
[0245] The purpose of this example is to demonstrate improved MVA production with a strain that constitutively expressed the nitrate regulatory genes, narL and narX. Nitrate activation of the narG promoter is regulated by two component signal transduction system encoded by narL and narX, which form an operon in E. coli. It was of interest to test altered expression of these regulatory genes by replacing the native promoter of the narXL operon with a moderate strength constitutive promoter.
A. Construction ofE. coli strains DP2074 and DP2230
[0246] E. coli strain DP2230 has the native chromosomal promoter for the narXL operon replaced with a constitutive glucose isomerase promoter PI.5. It was constructed in several steps as follows: A PCR reaction that amplified the chloroamphicol resistance cassette of pKD3 (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645) with primers that had the Pgil.5promoter sequence and regions of homology to direct integration such that the native narXL promoter would be replaced but leaving the native ribosome binding site intact was done using the following primers:
M034_C: ctgtaatgacagctccagtagccctttcgggggcggatgagtgactcatagtgagcgattgtgtaggctggag (SEQ ID NO: 11)
M034_D: gcaataaccttaatgaatgtgacgatacattctggaatggcagtattctcgaagtggttgaattatttgctcaggatgtggcat agtcaagggcatatgaatatcctccttagttc (SEQ ID NO: 12)
[0247] Strain MD114, which is E. coli BL21 carrying arabinose-inducible lambda Red recombinase genes on plasmid pRed-Et (Gene Bridges), was transformed with this PCR product following the Gene Bridges protocol for arabinose induction and transformation. A
chloramphenicol-resistant colony was tested by PCR for the promoter replacement at narXL with primers ODMWP359 and ODMWP360; it was PCR positive and so was retained and named DP2223.
ODMWP359: GGTACATTGAGCAACTGACTGAAATG (SEQ ID NO: 13)
ODMWP360: CCAGTTGTCCGTCTCGTTCTGCTGC (SEQ ID NO: 14)
[0248] Strain DP2223 was used a donor for generalized transduction mediated by phage Plvir. The recipient strain was E. coli strain MD12-778 (BL21, GI1.2gltA, yhfSFRTPyddVIspAyhfS, thiFRTtruncIspA). A chloramphenicol-resistant transductant was single colony purified, was positive in a PCR with primers ODMWP359 and ODMWP360 (above), and was named strain DP2228.
[0249] Finally strain DP2228 was transformed with plasmid pDMWP170 (described in Example 1) with selection for Spectinomycin-resistance to generate strain DP2230.
[0250] Strain DP2074 with native, unaltered narXL operon and plasmid pDMWP170 with nitrate regulated mvaE and mvaS was described in Example 1. Thus, DP2230 and DP2074 are isogenic with the exception of the Choloramphenicol-resistance cassette and the constitutive promoter driving narXL in strain DP2230. B. MVA production using DP2074 and DP2230
[0251] Overnight cultures of strains DP2074 and DP2230 were grown in LA medium with Spectinomycin 50 μg/mL at 34 °C. The following day, the cultures were diluted 1: 100 into 25 mL minimal MOPS medium (Teknova) with 10 g/L glucose, or into the same medium but with extra phosphate (13.6 g/L K2P04 + 13.6 g/L KH2P04) in glass baffled flasks. Two hours after inoculation, potassium nitrate was added from a 250 g/L stock solution to the DP2074 flasks to final concentrations of 0, 0.2, or 5 g/L. The flasks were incubated for 24 hours at 34 °C.
Samples were prepared for HPLC analyses by adding 54 μL· of 10% w/v sulfuric acid to a 300 μL· aliquot of flask broth. The acidified tubes were held at 4 °C for 5 minute, then spun in a centrifuge tube filter (Costar, Spin-X, 0.22 μιη nylon) at 14,000 rpm for 5 minutes. The filtrate was put into HPLC vials. The acidified supernate samples were analyzed for MVA by liquid chromatography. The column was a crosslinked sulfonated polystyrene-divinylbenzene resin in the hydrogen form (Aminex HPX-87H, 300 x 7.8 mm, Bio-Rad Laboratories, Inc., Hercules, CA). The mobile phase was 5 mM sulfuric acid at a flow rate of 0.6 mL/min and the column temperature was isothermal at 50 °C. Detection was ultraviolet absorbance at a wavelength of 210 nm. Calibration standards were made by diluting mevalanolactone with 5 mM sulfuric acid. Calibration curves were constructed and results was calculated using linear regression. The results were reported as MVA equivalents. The results are shown in the table 3-1 below.
Table 3-1: MVA production in strains constitutively expressing narL and narX
MVA g/L Pgil .5 narXL vs wt
Growth condition DP2074 (wt narXL) DP2230 (Pgil .5 narXL) % improvement
0 nitrate/low phosphate 0.135 0.103
0.2 g/L nitrate/low phosphate 0.614 0.714 16%
5 g/L nitrate/low phosphate 0.760 0.854 12%
0 nitrate/high phosphate 0.313 0.235
0.2 g/L nitrate/high phosphate 1.198 1.257 5%
5 g/L nitrate/high phosphate 1.157 1.300 12% [0252] The uninduced level of MVA production was not increased in strain DP2230 as compared with strain DP2074. However, strain DP2230 with constitutive expression of the narXL operon had greater nitrate-induced MVA production as compared to strain DP2074 with the wt narXL promoter in both the low phosphate and high phosphate media. These results demonstrate improved MVA production with a strain that constitutively expressed the nitrate regulatory genes, narL and narX.
Example 4: Nitrate-induced expression from the PnarG* promoter with an additional mutation in the -35 region
[0253] The purpose of this example is to demonstrate higher level nitrate-induced expression from the PnarG* promoter with an additional mutation in the -35 region.
[0254] The PnarG* promoter has the same -35 region as does the wild type PnarG, which has a 4 out of 6 base pair match to the sigma70 consensus -35 sequence. Thus, it was of interest to make changes in the -35 region that bring it to the consensus or closer to consensus to test if promoter strength could be improved while retaining nitrate regulated gene expression. The following promoter changes were constructed.
TTCCCA -35 region in PnarG* 4/6 match to consensus.
TTGACA consensus -35
TTCACA 5/6 match to consensus retaining one of original mismatched sequence
TTGCCA 5/6 match to consensus retaining the other of original mismatched sequence TTGACG 5/6 match to consensus
TTGACT 5/6 match to consensus
A. Construction of the PnarG* and PnarG# promoters
[0255] 1. Full consensus -35 regionPlasmid pDMWP183 is a Spectinomycin resistant plasmid that carries the mvaE and mvaS genes under control of the PnarG* promoter with two additional changes to make a full consensus -35 region. It was constructed as follows.
[0256] A Gibson Assembly kit (New England Biolabs) was used following the manufacturer's protocol using two PCR products. [0257] Fragment #1 template was pMCM 1225 and the primers ODMWP279/281 ODMWP279/281 (see Example 1).
[0258] Fragment #2 template was E. coli MG1655 chromosomal DNA and primers were
ODMWP302 and ODMWP326.
ODMWP302:
CATTAATGCAGATTCTGAAATGAGCAATACTCCTTAATACCCATCTGC (SEQ ID NO: 15)
ODMWP326:CTCAGCGGCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAA ACAGCGTGTCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 16)
[0259] Strain MD12-778 was transformed with pDMWP183[pCL-PnarG* consensus -35mvaE mvaS] with selection for Spectinomycin resistance to give strain DP2098.
[0260] Overnight cultures of strains DP2074 and DP2098 were grown in LA medium with Spectinomycin 50 μg/mL at 34 °C, 250 rpm. The following day, the cultures were each diluted 1: 100 into two 125 mL plastic flasks with vented tops containing 25 mL TM3 medium with 8 mM MgS04, 0.02% yeast extract, 10 g/L glucose, and 50 mg/L spectinomycin and were incubated at 34 °C, 250 rpm. Two hours after inoculation, potassium nitrate was added from a 250 g/L stock solution to final concentrations of 0 or 5 g/L. The flasks were incubated for 24 hours at 34 °C. Samples were prepared for HPLC analyses by adding 54 μL· of 10% w/v sulfuric acid to a 300 μΐ^ aliquot of flask broth. The acidified tubes were held at 4 °C for 5 minute, then spun in a centrifuge tube filter (Costar, Spin-X, 0.22 μιη nylon) at 14,000 rpm for 5 minutes. The filtrate was put into HPLC vials. The acidified supernate samples were analyzed for MVA by liquid chromatography. The column was a crosslinked sulfonated polystyrene - divinylbenzene resin in the hydrogen form (Aminex HPX-87H, 300 x 7.8 mm, Bio-Rad
Laboratories, Inc., Hercules, CA). The mobile phase was 5 mM sulfuric acid at a flow rate of 0.6 mL/min and the column temperature was isothermal at 50 °C. Detection was ultraviolet absorbance at a wavelength of 210 nm. Calibration standards were made by diluting
mevalanolactone with 5 mM sulfuric acid. Calibration curves were constructed and results was calculated using linear regression. The results were reported as MVA equivalents. The results are shown in the table 4-1 below. Table 4-1: Production of MVA
Figure imgf000077_0001
[0261] Strain DP2074, with the PnarG* promoter driving mvaE and mvaS expression had increased MVA production upon nitrate induction. In contrast, strain DP2098 with the PnarG* promoter and a full consensus -35 region had much higher MVA production in the absence of nitrate than did strain DP2074. The MVA production was not increased by addition of nitrate showing that changing the -35 region to the full consensus resulted in loss of nitrate regulation of gene expression.
2. Partial consensus -35 regions
[0262] A Gibson Assembly kit (New England Biolabs) was used following the manufacturer's protocol using two PCR products for each plasmid.
[0263] Plasmids pDMWP185, pDMWP186, pDMWP187, and pDMWP188 are
Spectinomycin-resistant plasmids that carry the mvaE and mvaS genes under control of the PnarG* promoter with changes to make various 5 of 6 matches to the consensus -35 region. They were constructed as follows.
[0264] For each of the four constructs, the first fragment template was pMCM1225 and the primers were ODMWP279/281 (see Example 1). The second fragments for each of the constructs were amplified from E. coli MG1655 chromosomal DNA with primers as follows.
[0265] For pDMWP 185 (TTCACA -35) the primers were primer ODMWP302 (listed above) and ODMWP329. ODMWP329:CTCAGCGGCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAA ACAGCGTGTGAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 17)
[0266] For pDMWP 186 (TTGCCA -35) the primers were primer ODMWP302 (listed above) and ODMWP330.
ODMWP330 : CTC AGCGGCGCTGTTTCCTGTGTG ATA AGGGC ATT ATACCGCTCTGA A ACAGCGTGGCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 18)
[0267] For pDMWP 187 (TTGACG -35) the primers were primer ODMWP302 (listed above) and ODMWP331.
ODMWP331 :CTCAGCGGCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTGAA ACAGCGCGTCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO: 19)
[0268] For pDMWP188 (TTGACT-35) the primers were primer ODMWP302 (listed above) and ODMWP332.
ODMWP332 : CTC AGCGGCGCTGTTTCCTGTGTG ATA AGGGC ATT ATACCGCTCTGA A ACAGCGAGTCAATTGATAACGACCAAGAGTGATGG (SEQ ID NO:20)
[0269] Plasmid pDMWP185 was transformed into MD12-778 with selection for
spectinomycin resistance to give strains DP2119 & DP2120. Plasmid pDMWP186 was transformed into MD 12-778 with selection for spectinomycin resistance to give strains DP2121 & DP2122. Plasmid pDMWP187 was transformed into MD12-778 with selection for spectinomycin resistance to give strains DP2123 & DP2124. Plasmid pDMWP188 was transformed into MD 12-778 with selection for spectinomycin resistance to give strains DP2125 & DP2126.
[0270] Overnight cultures of strains DP2119 through DP2126, with modified -35 regions, and
DP2074, with the original PnarG* promoter, were grown in LA medium with Spectinomycin 50 μg/mL at 34 °C, 250 rpm. The following day, each culture was diluted 1: 100 into two 125 mL plastic flasks with vented tops containing 25 mL TM3 medium with 8 mM MgS04, 0.02% yeast extract, 10 g/L glucose, and 50 mg/L spectinomycin with or without 5 g/L of potassium nitrate.
The flasks were incubated at 34 °C, 250 rpm for 24 hours. Samples were prepared for HPLC analyses by adding 54 μL· of 10% w/v sulfuric acid to a 300 μΐ^ aliquot of flask broth. The acidified tubes were held at 4 °C for 5 minute, then spun in a centrifuge tube filter (Costar, Spin-
X, 0.22 μιη nylon) at 14,000 rpm for 5 minutes. The filtrate was put into HPLC vials. The acidified supernate samples were analyzed for MVA by liquid chromatography. The column was a crosslinked sulfonated polystyrene-divinylbenzene resin in the hydrogen form (Aminex HPX-87H, 300 x 7.8 mm, Bio-Rad Laboratories, Inc., Hercules, CA). The mobile phase was 5 mM sulfuric acid at a flow rate of 0.6 mL/min and the column temperature was isothermal at 50 °C. Detection was ultraviolet absorbance at a wavelength of 210 nm. Calibration standards were made by diluting mevalanolactone with 5 mM sulfuric acid. Calibration curves were constructed and results was calculated using linear regression. The results were reported as MVA equivalents. The results are shown in the table 4-2 below.
Table 4-2: Nitrate-induced MVA production
Figure imgf000079_0001
[0271] Strains DP2119 and DP2120 with plasmid pDMWP185 had nitrate induced MVA production, but to a somewhat lower level than did strain DP2074. This indicates that the mutant promoter in plasmid pDMWP185 retained nitrate inducibility, but is not stronger than PnarG*.
[0272] Strains DP2121 and DP2122 with plasmid pDMWP186 had nitrate induced MVA production to 50% higher levels than in the strain DP2074, with the PnarG* promoter. This indicates that the mutant promoter in plasmid pDMWP186 with a TTGCCA -35 region retained nitrate inducibility and was substantially stronger than PnarG*. This new promoter was given the name PnarG#.
[0273] In contrast, strains DP2123 and DP2124 with plasmid pDMWP187 and strains DP2125 and DP2126 with plasmid pDMWP188 did not have nitrate induced MVA production.
[0274] This data shows that the strength of the PnarG* promoter can be increased while retaining nitrate inducibility by one specific change in the -35 region.
B. RNA preparation and qRT-PCR
[0275] A comparison strain, LEI 021 carries plasmid pMCM1225, which has the trc promoter driving expression of mvaE and mvaS, in the same host strain, MD 12-778, used for the PnarG* and mutant promoter plasmids. LEI 021 was made by transformation of MD 12-778 with plasmid pMCM1225 and selection for Spectinomycin resistance.
[0276] Overnight cultures of strains LE1021, DP2074, DP2119, DP2120, DP2121, and DP2122 were grown in LA medium with Spectinomycin 50 μg/mL at 34 °C, 250 rpm. The following day, each culture was diluted 1: 100 into two 125 mL plastic flasks with vented tops containing 25 mL TM3 medium with 8 mM MgS04, 0.02% yeast extract, 10 g/L glucose, and 50 mg/L spectinomycin with or without 5 g/L of potassium nitrate. Biological replicate flasks were set up for strains LEI 021 and DP2074. The flasks were incubated at 34 °C, 250 rpm. The cultures were sampled for RNA at 6 hours after inoculation by adding 5 mL into 10 mL
RNAprotect (Qiagen, Germantown, MD). They were left at room temp for 5 min. The samples were then spun for 10 min and the supernatant was discarded. The pellets were then frozen at - 80 °C until RNA isolation was performed. RNA isolation was done using the Qiagen RNeasy Mini kit (Qiagen, Germantown, MD). Lysozyme was used to break up the cells. To TE buffer, 1 mg/mL lysozyme was added. The pellets were then resuspended in 200 μΐ^ of the
TE/lysozyme mix. The samples were allowed to sit at room temperature for 10 min. To help inhibit RNase activity, 7 μL· β-mercaptoethanol was added to 693 μΐ^ of RLT buffer supplied in the RNeasy kit and this mix was added to each sample. After complete mixing, 500 μΐ^ of 100% ethanol was added and mixed. The samples were then applied to a RNeasy column, 700 μΐ^ at a time. They were spun for 1 min at 10,000 rpm and flow through was discarded. Another 700 μΐ^ of each sample was then added to the column, spun and again flow through was discarded. To each column, 700 μΐ^ of RW1 buffer was added and the columns were spun for 1 min. An on- column DNase treatment was then performed. The RNase-free DNase kit from Qiagen
(Germantown, MD) was used to perform this treatment. To each column, a mix of 10 μΐ^ of DNase and 70 μΐ^ of RDD buffer was added. The columns were allowed to stand at room temperature for 15 min. After DNase treatment, the columns were cleaned by adding 500 μΐ^ of RW1 buffer and spun for 1 min at 15,000 G. The filtrate was discarded. The RNeasy column was transferred to a new 2 mL collection tube and 500 μΐ^ of RPE buffer was added. After it was spun for 1 min and the filtrate discarded, this wash step was repeated but was centrifuged for 2 min. The column was again transferred to a new 2 mL collection tube and spun for 1 min to remove any residual buffer. Finally, the column was placed in a 1.5 mL collection tube and 50 μΐ^ of RNase free water was pipetted directly onto the RNeasy membrane. The samples were allowed to sit at room temperature for 5 min, after which they were spun for 1 min to elute the RNA. The RNA concentration was determined by measuring 2 μL· of sample on a NanoDrop spectrophotometer (Wilmington, DE). The RNA samples were then stored at -80 °C until qPCR was performed.
[0277] Quantitative Reverse Transcription PCR (qRT-PCR) analysis was performed as follows. To remove any residual genomic DNA, 3 μg of total RNA was treated with RNase-free DNase (Qiagen, Hilden, Germany). The DNase was then inactivated by 1 mM EDTA and heating to 75 °C for 5 minutes. 1 μg of DNase-treated RNA was then converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) as per the manufacturer's instructions. cDNA was then diluted 1: 10 in water for qPCR analysis. [0278] qPCR was performed for the target genes. All primers and probes were designed utilizing Primer Express v 3.0.1 software (Applied Biosystems, Foster City, CA). The 5' end of the TaqMan fluorogenic probes have the 6-FAM™ (6-carboxyfluorescein) fluorescent reporter dye bound, while the 3' end includes the TAMRA™ (Carboxytetramethylrhodamine) quencher dye. All primers and probes were obtained from Sigma-Genosys (Woodlands, TX). Primers were evaluated for specificity utilizing BLAST analysis (http://genolevures.org/yali.html) and validated for quantitation utilizing genomic DNA. Primers with PCR efficiencies between 0.85 - 1.15 were validated for quantitation (data not shown).
[0279] Real-time PCR reactions included 10 pmoles each of forward and reverse primers, 2.5 pmoles of TaqMan probe, 10 μΐ TaqMan Universal PCR Master Mix-No AmpErase® Uracil-N- Glycosylase (UNG) (Catalog No. PN 4326614, Applied Biosystems), 1 μΐ 1: 10 diluted cDNA, and 8.5 μΐ RNase-/ DNase-free water for a total volume of 20 μΐ per reaction. Reactions were run on the ABI PRISM® 7900 Sequence Detection System under the following conditions: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 sec and annealing at 60 °C for 1 min. Real time data was collected automatically during each cycle by monitoring 6-FAM™ fluorescence. Relative expression (RQ) was calculated using Data Assist Software v3.01 and the AACt method (Applied Biosystems, Foster City, Ca). The rrsB gene was utilized for data normalization. Relative expression was then calculated by comparing the gene expression in the different strains and growth conditions. The gene expression in the table 4-3 below as well as in Figure 4 is relative to the sample from the first replicate LEI 021 culture without nitrate.
Table 4-3: Gene expression
Figure imgf000082_0001
none
LE1021 1.22 0.06 1.05 0.03 5 g/L nitrate
DP2074 pDMWP170 (pCL-PnarG*mvaE mvaS) 0.02 0.00 0.11 0.01 none
DP2074 0.40 0.03 0.54 0.03 5 g/L nitrate
DP2074 pDMWP170 (pCL-PnarG*mvaE mvaS) 0.03 0.00 0.11 0.01 none
DP2074 0.42 0.01 0.54 0.02 5 g/L nitrate
DP2119 pDMWP185 (PnarG* [TTCAC A -35] mvaE 0.05 0.00 0.20 0.01 mvaS)
none
DP2119 0.47 0.04 0.57 0.09 5 g/L nitrate
DP2120 pDMWP185 (PnarG* [TTCAC A -35] mvaE 0.06 0.01 0.18 0.02 mvaS)
none
DP2120 0.43 0.02 0.52 0.06 5 g/L nitrate
DP2121 pDMWP186 (PnarG* [TTGCC A -35] mvaE 0.11 0.02 0.25 0.03 mvaS)
none
DP2121 1.70 0.07 1.78 0.11 5 g/L nitrate
DP2122 pDMWP186 (PnarG* [TTGCC A -35 ]mvaE 0.09 0.00 0.29 0.03 mvaS)
none
DP2122 1.61 0.13 1.71 0.17 5 g/L nitrate [0280] As expected, expression of mvaE or mvaS in the comparison strain LEI 021 was not substantially affected by the presence of 5 g/L potassium nitrate.
[0281] Strain DP2074, with the PnarG* promoter had low expression of mvaE and mvaS in the absence of nitrate and expression was induced by 5 g/L potassium nitrate. Strains DP2119 and DP2120 with the TTCACA -35 region also had low expression of mvaE and mvaS in the absence of nitrate and expression was induced by 5 g/L potassium nitrate to a similar level as in DP2074. Strains DP2121 and DP2122 with the TTGCCA -35 region (PnarG#) had a somewhat more expression of mvaE and mvaS in the absence of nitrate, thus the PnarG# promoter is leakier than the PnarG* promoter. The mvaE and mvaS mRNA transcribed from the PnarG# promoter were very strongly induced by 5 g/L potassium nitrate; the resulting mRNA levels were substantially higher than from the PnarG* promoter and as high or higher than from the Ptrc promoter. Thus the qRT-PCR data shows that PnarG# is stronger than the PnarG* promoter.
Example 5: Nitrate-induced isoprene production
[0282] The purpose of this example is to demonstrate nitrate induced isoprene production.
A. Construction of plasmid pDMWP193
[0283] Plasmid pDMWP193 has the PnarG# promoter driving expression of an isoprene synthase gene in a multicopy Ampicillin-resistant plasmid. It was constructed using a Gibson assembly kit (New England Biolabs) following the manufacturer's directions using two PCR fragments.
[0284] The template for fragment 1 was pMCM2149 (pTrcAlba(MEA-variant)-MVKdel2 (carb selection, IPTG-inducible)) and the primers were ODMWP345 and ODMWP346.
ODMWP345: ACATTCACCACCCTGAATTGACT (SEQ ID NO:21)
ODMWP346: TCACACAGGAAACAGCGCCGCTGAG (SEQ ID NO:5)
[0285] The template for fragment 2 was pDMWP186 and the primers were ODMWP347 and ODMWP348. ODMWP347: GTCAATTCAGGGTGGTGAATGTAATACTCCTTAATACCCATC (SEQ ID NO:22)
ODMWP348: GCGCTGTTTCCTGTGTGATAAGGGCATTATACCGCTCTG (SEQ ID NO:23)
[0286] E. coli strain MCM2065 (BL21, Apgl PL.2mKKDyl, GI1.2gltA,
yhfSFRTPyddVIspAyhfS, thlFRTtruncIspA, bMVK) was transformed with pDMWP170 [pCL- PnarG* mvaE mvaS] and pDMWP193 [PnarG# IspS] with selection for spectinomycin and carbenicillin resistance to construct strains DP2164 and DP2165. Likewise, E. coli strain MCM2065 was transformed with pDMWP186 [pCL-PnarG# mvaE mvaS] and pDMWP193 [PnarG# IspS] with selection for spectinomycin and carbenicillin resistance to construct strains DP2166 and DP2167. The strains used for the small-scale isoprene production assays are shown in the Table 5-1 below.
Table 5-1: Strains used in isoprene production assay
Figure imgf000085_0001
B. Small-scale isoprene production assay [0287] LB media, TM3 media without Yeast extract and MgS04> 10% Yeast extract, 1 M MgS04, 50% Glucose, 200 mM IPTG, 50 mg/mL Spectinomycin, 50 mg/mL CarbeniciUin, 10% Sulfuric acid and 100 mM Tris, 100 mM NaCl pH 7.6 buffer were prepared in-house. Aluminum foil seal, 48-well sterile 5 mL block, breathe easier sealing membrane, aluminum foil seal, and 96-well microtiter plates were purchased from VWR. 96-well glass block was purchased from Zinsser Analytic. GC/MS was performed using an Agilent 6890 GC equipped with a 5973N Mass Spectrometer.
[0288] Overnight cultures were prepared directly from glycerol culture stocks in 3 mL of LB media with appropriate antibiotics in 10 mL plastic test tubes. Overnight cultures were grown at 30 °C, 220 rpm.
[0289] Supplemented TM3 media was prepared by combining TM media (without MgS04 and Yeast extract), 1% Glucose, 8mM MgS04, 0.02% Yeast extract and appropriate antibiotics. 2 mL of day culture started in 48-well sterile block by inoculating overnight culture in
supplemented TM3 media at 0.2 optical density (OD). Blocks were sealed with breathe easier membrane and incubated for 2 hours at 34 °C, 600 rpm. After 2 hours of growth, OD was measured at 600 nm in the microtiter plate and cells were induced with various concentrations of IPTG or potassium nitrate. OD reading and isoprene specific productivity samples were taken from 2-24 hours post induction. OD measurement was done in the microtiter plate at appropriate dilution in the TM3 media at 600 nm using a SpectraMax Plus 190 (Molecular Devices).
[0290] 100 μΐ^ of isoprene samples were collected in a 96 well glass block every hour after IPTG induction for 4 hours. Glass block was sealed with aluminum foil and incubated at 34 °C while shaking at 450 rpm, for 30 minutes on the thermomixer. After 30 minutes, the block was kept at 70 °C water bath for 2 minutes and isoprene headspace measurement was done by GC/MS.
[0291] Growth rate analysis for IPTG inducible control strain versus the nitrate-inducible test strains are shown in Figure 5, while isoprene specific productivity analysis for IPTG inducible control strain versus nitrate-inducible test strains are shown in Figure 6.
C. 14 L fed-batch fermentation [0292] This experiment was performed to evaluate isoprene production using a modified E. coli host (BL21 derived production host MCM2065) which expresses introduced genes from the mevalonate pathway and isoprene synthase and is grown in fed-batch culture at the 15 L scale. Isoprene producing strains were run in a standard production process, described below, for the most part only varying the type and amount of inducer used. The performance metrics of a control strain, MCM2158 (which uses IPTG) are compared here to experimental strains that express genes from the mevalonate pathway and isoprene synthase using the nitrate-inducible promoters PnarG* and PnarG#, DP2165 and DP2166. For strain details see Table 5-2 below. The relevant performance metrics are cumulative isoprene yield on glucose, volumetric productivity of isoprene and cell performance index.
Table 5-2: Stains used in 14 L fermentation
Figure imgf000087_0001
(pDMWP186, Spec (pDMWP193, Carb50)
50)
1. Method
[0293] Medium Recipe (per liter fermentation medium): K9HPO4 7.5 g, MgS04 »7H20 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, yeast extract 0.5 g, 50% sulfuric acid 1.6 inL, 1000X Modified Trace Metal Solution 1 mL. All of the components were added together and dissolved in DI H20. This solution was heat sterilized (123°C for 20 minutes). The pH was adjusted to 7.0 with ammonium hydroxide (28%) and q.s. to volume. Glucose 10 g, Vitamin Solution 8 mL, and antibiotics were added after sterilization and pH adjustment.
[0294] 1000X Modified Trace Metal Solution (per liter): Citric Acids«H20 40 g, MnS04'H20 30 g, NaCl 10 g, FeS04 «7H20 1 g, CoCl2 «6H20 1 g, ZnSO7H20 1 g, CuS04 «5H20 100 mg, H3BO3 100 mg, NaMo04*2H20 100 mg. Each component was dissolved one at a time in DI H20, pH was adjusted to 3.0 with HCl/NaOH, and then the solution was q.s. to volume and filter sterilized with a 0.22 micron filter.
[0295] Vitamin Solution (per liter): Thiamine hydrochloride 1.0 g, D-(+)-biotin 1.0 g, nicotinic acid 1.0 g, pyridoxine hydrochloride 4.0 g. Each component was dissolved one at a time in DI H20, pH was adjusted to 3.0 with HCl/NaOH, and then the solution was q.s. to volume and filter sterilized with 0.22 micron filter.
[0296] Macro Salt Solution (per liter): MgS04 »7H20 296 g, citric acid monohydrate 296 g, ferric ammonium citrate 49.6 g. All components were dissolved in water, q.s. to volume and filter sterilized with 0.22 micron filter.
[0297] Feed solution (per kilogram): Glucose 0.590 kg, DI H20 0.393 kg, K2HP04 7.4 g, and 100% Foam Blast 882 8.9 g. All components were mixed together and autoclaved. After autoclaving the feed solution, nutrient supplements are added to the feed bottle in a sterile hood. Post sterilization additions to the feed are (per kilogram of feed solution) Macro Salt Solution 5.54mL, Vitamin Solution 6.55 mL, and 1000X Modified Trace Metal Solution 0.82 mL.
[0298] Either IPTG solution or Potassium Nitrate is added depending on the strain being fed. [0299] For a target of 100 μΜ IPTG: 1.87 mL of a sterile 10 mg/mL solution is added per kilogram of feed.
[0300] For a target of 80 mM Nitrate: 39.7 mL of a sterile 163 mg/mL solution is added per kilogram of feed.
[0301] For a target of 8 mM Nitrate: 3.97 mL of a sterile 163 mg/mL solution is added per kilogram of feed.
[0302] For a target of 0.8 mM Nitrate: 0.397 mL of a sterile 163 mg/mL solution is added per kilogram of feed.
[0303] This experiment was carried out to monitor isoprene production from glucose at the desired fermentation pH (7.0) and temperature (34 °C). To start each experiment, the appropriate frozen vial of the E. coli production strain was thawed and inoculated into a flask with tryp tone- yeast extract (LB) medium and the appropriate antibiotics. After the inoculum grew to an optical density of approximately 1.0, measured at 550 nm (OD550), 500 mL was used to inoculate a 15 L bioreactor and bring the initial tank volume to 5 L.
[0304] The inlet gas using to maintain bioreactor backpressure at 0.7 bar gauge and to provide the oxygen to the production organisms was supplied by in house facilities that dilute the inlet gas to a known concentration (7.3 to 8.3 vol oxygen).
[0305] The batched media had glucose batched in at 9.7 g/L. Induction was achieved by adding either isopropyl-beta-D-l-thiogalactopyranoside (IPTG) or a solution of potassium nitrate depending on the strain being run. A shot of IPTG or Potassium Nitrate was added to the tank to bring the concentration to a specified level when the cells were at an OD550 of 6. Once the glucose was consumed by the culture, as signaled by a rise in pH, the glucose feed solution was fed to meet metabolic demands at rates less than or equal to 10 g/min. The fermentation was run long enough to determine the maximum cumulative isoprene mass yield on glucose, typically a total of 64 hrs elapsed fermentation time (EFT). Table 5-3: Process conditions
Figure imgf000090_0001
2. Analysis
[0306] Isoprene, Oxygen, Nitrogen, and Carbon Dioxide levels in the off-gas were determined independently by two mass spectrometers, an iSCAN (Hamilton Sundstrand), and a Hiden HPR20 (Hiden Analytical) mass spectrometer. [0307] Dissolved Oxygen in the fermentation broth is measured by sanitary, sterilizable probe with an optical sensor provided Hamilton Company.
[0308] The citrate, glucose, acetate, and mevalonate concentrations in the fermentor broth were determined in broth samples taken at 4 hour intervals by an HPLC analysis. Concentration in broth samples were determined by comparison of the refractive index response versus a previously generated calibration curve using standard of a known concentration.
[0309] HPLC: HPLC was performed using a Waters Alliance 2695 System and a BioRad - Aminex HPX-87H Ion Exclusion Column (300 mm x 7.8mm Catalog # 125-0140) having a column temperature of 50 °C. The guard column used was a BioRad - Microguard Cation H refill (30 mm x 4.6mm Catalog # 125-0129). The running buffer used was 0.01N H2S04 with a flow rate of 0.6 mL / min, an approximate running pressure of ~1100-1200 psi, and an injection volume of 20 microliters. These a Refractive Index reflector was employed (Knauer K-2301). The total runtime was 26 minutes.
3. Results
[0310] The isoprene productivity metrics calculated from the 14 L fermentation are shown in the table 5-4 below.
Table 5-4: Isoprene productivity
Figure imgf000091_0001
DP2166 / 13.0 1.51 128.8 1.5 37.0 15.5 96.7 20130397 /
80,000
Nitrate (but 0
batched
nitrate)
DP2166 / 12.4 1.16 118.2 1.5 26.4 14.2 74.4 20130339 /
80,000
Nitrate
DP2165 / 12.9 1.41 106.7 1.8 23.7 15.5 90.5 20130295 /
80,000
Nitrate
MCM2158 / 17.6 2.09 106.7 3.2 36.3 20.7 133.6 20130213 /
100 IPTG
[0311] Cumulative Yield of Isoprene on glucose achieved in each 15 L fermentation over time is shown in Figure 7. The strain expressing the pathway genes using the Ptrc/ IPTG system (MCM2158: 20130213) achieved a higher cumulative % yield of isoprene on glucose than the strains expressing the pathway genes using the PnarG*/PnarG#/nitrate system (DP2165:
20130295, 20130492, 20130493, 20130494). A clear titratable effect is seen in the DP2165 run when different amounts of nitrate inducer are used. The 64 hr points were used to populate Table 5-4 above.
[0312] Overall yield was calculated using the following formula:
%wt Yield on glucose = Isoprene total (t)/[(Feed Wt(0)-Feed Wt(t)+83.5)*0.59)],
where 0.59 is the wt of glucose in the glucose feed solution and 83.5 is the grams of this feed batched into the fermentor at t=0. Each feed had its weight % measured independently.
[0313] Volumetric productivity achieved in each 15 L fermentation over time is shown in Figure 8. The strain expressing the pathway genes using the Ptrc/ IPTG system (MCM2158: 20130213) achieved a higher volumetric productivity than the strains expressing the pathway genes using the PnarG*/PnarG#/nitrate system (DP2165: 20130295, 20130492, 20130493, 20130494). A clear titratable effect is seen in the DP2165 run when different amounts of nitrate inducer are used. The 64 hr points were used to populate Table 5-4 above. [0314] Volumetric Productivity was calculated using the following formula:
Volumetric productivity (g/L/hr) = [∑ (HGER(t)/1000*68.117)]/[t-t0],
where the summation is from tO to t. Tank turnaround time is not factored in.
[0315] Cell Performance Index (CPI) achieved in each 15 L fermentation over time is shown in Figure 9. The strain expressing the pathway genes using the Ptrc/ IPTG system (MCM2158: 20130213) achieved a higher cell productivity index than the strains expressing the pathway genes using the PnarG*/PnarG#/nitrate system (DP2165: 20130295, 20130492, 20130493, 20130494). A clear titratable effect is seen in the DP2165 run when different amounts of nitrate inducer are used. The 64 hr points were used to populate Table 5-4 above.
[0316] Cell Performance Index was calculated using the following formula: CPI = total grams Isoprene / total grams dry cell weight.
[0317] Cumulative Yield of Isoprene on glucose achieved in each 15 L fermentation over time is shown in Figure 10. The strain expressing the pathway genes using the Ptrc/ IPTG system (MCM2158: 20130213) achieved a higher cumulative % yield of isoprene on glucose than the strains expressing the pathway genes using the PnarG*Upper/PnarG#IspS/nitrate system
(DP2165: 20130295, 20130492) and the strains expressing the pathway genes using the
PnarG#Upper/PnarG#IspS/nitrate system (DP2166: 20130339, 20130397). DP2166 yield is slightly better than DP2165 especially in 20130397 where the batched nitrate is removed, eliminating the inhibitory effect on growth. The 64 hr points were used to populate Table 5-4 above.
[0318] Overall yield was calculated using the following formula:
%wt Yield on glucose = Isoprene total (t)/[(Feed Wt(0)-Feed Wt(t)+83.5)*0.59)], where 0.59 is the wt of glucose in the glucose feed solution and 83.5 is the grams of this feed batched into the fermentor at t=0. Each feed had its weight % measured independently.
[0319] Overall Volumetric productivity achieved in each 15 L fermentation over time is shown in Figure 11. The strain expressing the pathway genes using the Ptrc/ IPTG system (MCM2158: 20130213) achieved a higher volumetric productivity of isoprene than the strains expressing the pathway genes using the PnarG*Upper/PnarG#IspS/nitrate system (DP2165: 20130295, 20130492) and the strains expressing the pathway genes using the
PnarG#Upper/PnarG#IspS/nitrate system (DP2166: 20130339, 20130397). DP2166 production rate is slightly better than DP2165 especially in 20130397 where the batched nitrate is removed, eliminating the inhibitory effect on growth. The 64 hr points were used to populate Table 5-4 above.
[0320] Volumetric Productivity was calculated using the following formula:
Volumetric productivity (g/L/hr) = [∑ (HGER(t)/1000*68.117)]/[t-t0], where the summation is from t0 to t. Tank turnaround time is not factored in.
[0321] Cell Performance Index (CPI) achieved in each 15 L fermentation over time is shown in Figure 12. The strain expressing the pathway genes using the Ptrc/ IPTG system (MCM2158: 20130213) achieved a higher cell productivity index than the strains expressing the pathway genes using the PnarG*Upper/PnarG#IspS/nitrate system (DP2165: 20130295, 20130492) and the strains expressing the pathway genes using the PnarG#Upper/PnarG#IspS/nitrate system (DP2166: 20130339, 20130397). DP2166 cell productivity index is slightly better than DP2165 especially in 20130397 where the batched nitrate is removed, eliminating the inhibitory effect on growth. The 64 hr points were used to populate Table 5-4 above.
[0322] Cell Performance Index was calculated using the following formula: CPI = total grams Isoprene / total grams dry cell weight.
Example 6: Titration of nitrate induction of MVA production in 1 L fed batch fermentation
[0323] The purpose of this example is to describe MVA production by strain DP2074 in a DASGIP micro-reactor. In addition to usual expected induction of MVA production, there was non-specific utilization of nitrate.
[0324] The E. coli strain designated as DP2074 used in this study was a nitrate-inducible mevalonate (MVA) producing strain with pDMWP170 (pCL-PnarG*-upper-wo lacO)/CTO pgl-
[0325] Fully aerated fed-batch fermentation was carried out in 1.5 L DasGip bioreactor vessels (Eppendorf, Juelich, Deutschland) with TM3 media (Table 6-1) supplemented with vitamins and spectinomycin at 34 °C and 1400 rpm. 50% glucose syrup supplemented with phosphate (Table 6-2) was used as the feed. The pH was controlled at 7 with 5% ammonium hydroxide. Each vessel was inoculated with 40 mL of the overnight starter culture grown from the frozen glycerol stock in 200 mL of LB supplemented with 200 μΐ^ of spectinomycin in 500 mL shake flasks at 30°C and 200 rpm until the OD at 600 nm reached between 3 and 5. Then, each bioreactor vessels were induced with 10 mL each of different concentrations of potassium nitrate solution (Table 6-3) when OD at 600 nm reached approximately 8. The feed solution was supplemented with the same amounts of nitrate solutions to avoid dilutions during the fermentations. Samples were collected periodically for the OD measurements as well as for HPLC analysis for the mevalonate (MVA) and other organic acids production.
Figure imgf000095_0001
Figure imgf000095_0002
Foam Blast 882 8.3
Water 167
Total 1095
Figure imgf000096_0001
[0326] The initial growth during the exponential phase (0-15 hours) appears to be independent of nitrate induction concentration (Figure 14). After 15 hours, however, the OD values at 600 nm for all four nitrate induced fermentation vessels begin to deviate from each other. The vessel with highest nitrate addition (2 g/L) showed the OD values stabilizing around 80 whereas the other vessels showed continued decrease in OD.
[0327] In order to investigate the effects of nitrate, MVA production was measured by HPLC as is shown in Figure 15. The results indicate that addition of nitrate even at low amounts (0.01 g/L), achieves MVA production but continues to increase with further addition. To achieve high MVA yield, significant total amounts of potassium nitrate had to be added. At 2 g/L of nitrate added, fermentation vessel produced close to 70 g/L of MVA at 50 hours, approximately 3-fold higher than the amount of MVA produced by the 0.2 g/L nitrate tank.
[0328] Re-plot of MVA production versus initial nitrate concentration (Figure 16) further revealed biphasic behavior, indicating complex metabolic effects of nitrate in the MVA production. The initial rapid increase in MVA production shows saturation around 0.2 grams per liter nitrate added. Such saturation is typically expected for specific binding events. Upon further addition of nitrate, MVA production linearly increases consistent with non-specific utilization of nitrate. Example 7: Nitrate degradation is not affected by single mutations in nitrate reductase genes
[0329] The purpose of this example is to demonstrate that nitrate is degraded in 14 L fed batch fermentation and in small scale assays and that the degradation was not affected by single mutations in nitrate reductase genes.
A. Nitrate degradation and nitrite formation in 14 L
[0330] Nitrate/Nitrite Assay: 16 whole broth time point samples from the 14 liter
fermentation (as described in Example 5) were collected. This fermentation was performed on a full pathway strain with a nitrate-inducible upper and lower pathway (DP2165), which was induced with 80 mM potassium nitrate at 6.8 hours. The glucose feed bottle also contained 80 mM potassium nitrate so that the concentration of nitrate was kept constant throughout the fermentation. The whole broth samples were centrifuged and their supernatants analyzed via a slightly modified version of the Cayman nitrate/nitrite colorimetric assay kit. The amount of nitrite present in the supernatant was first analyzed.
[0331] A nitrite standard curve was created in order to quantitate the nitrite concentrations. A 200 μΜ nitrite standard stock was made by adding 0.1 mL of the reconstituted nitrite standard into 0.9 mL of Assay Buffer. This stock was used for the preparation of the nitrite standard curve, described in Table 7-1.
Table 7-1: Nitrite standard curve
Figure imgf000097_0001
[0332] The supernatants for the fermentation time points were diluted 250-fold. A volume of 100 μΐ^ of each dilution was added to a 96-well plate, also containing the nitrite standard curve. Griess Reagents 1 and 2, which convert nitrite into a deep purple azo compound, were then added to the wells, 50 μΐ^ each. The color was allowed to develop at room temperature for 10 minutes, and then the absorbance was measured at 540 nm. The nitrite concentrations were then calculated from the nitrite standard curve regression equation.
[0333] A nitrate standard curve was then created in order to quantitate the total nitrate + nitrite concentrations. A 200 μΜ nitrate standard stock was made by adding 0.1 mL of the
reconstituted nitrate standard into 0.9 mL of Assay Buffer. This stock was used for the preparation of the nitrate standard curve, described in Table 7-2.
Table 7-2: Nitrate Standard Curve
Figure imgf000098_0001
[0334] The supernatants for the fermentation time points were diluted 5,000-fold. A volume of 80 μΐ^ was added to a 96-well plate, also containing the nitrate standard curve. The first step to this assay is the conversion of nitrate to nitrite with nitrate reductase. The Enzyme Cofactor Mixture was first added, 10 μΐ^ to each well, followed by 10 μΐ^ of the Nitrate Reductase Mixture. The plate was covered and incubated at room temperature for one hour. The second step of the assay is the addition of the Griess Reagents, which convert nitrite into a deep purple azo compound. After the incubation, 50 μΐ^ of Griess Reagent 1 was added to each well, immediately followed by 50 μΐ^ of Griess Reagent 2. The color was allowed to develop for 10 minutes at room temperature, and then the absorbance was read at 540 nm. The total nitrate + nitrite concentrations were then calculated from the nitrate standard curve regression equation. The concentration of nitrate was then calculated from the difference of the nitrite concentration from the total nitrate + nitrite concentration.
[0335] An empirically derived correction factor was applied to the assay data to account for packed cell volume and so to normalize the measured supernatant nitrate concentration back to a whole broth nitrate concentration. (Correction Factor = [1 - (ODA55O/750)] ; Whole broth Nitrate concentration = Supernatant nitrate concentration * Factor).
[0336] Supernatant concentrations of nitrate and nitrite in the fermentation are depicted in Table 7-3 and in Figure 13.
Table 7-3: Supernatant concentrations of nitrate and nitrite
Figure imgf000099_0001
40 22.34 79.7 0.8936 19.97 4.196
44 17.72 96.1 0.8718 15.45 2.533
48 13.37 91.2 0.8782 11.74 2.684
52 10.94 94.1 0.8744 9.57 2.352
56 8.98 96.1 0.8718 7.83 2.013
60 11.19 98.9 0.8680 9.71 2.154
64 3.33 102.8 0.8628 2.88 2.462
B. Deletion of nitrate reductase genes
[0337] The decrease in nitrate with appearance of nitrite in 14 L fed-batch fermentation suggest that nitrate is being metabolized by nitrate reductases. This result was unexpected because nitrate reductases are expressed under anaerobic conditions but the 14 L fed-batch fermentation was aerobic. Furthermore, E. coli BL21, the original parent strain of DP2165, has a nonsense mutation in fnr, a gene the product of which is required for expression of two nitrate reductases, nitrate reductase A, encoded by narGHI, and Nap, encoded by napFDA. A third nitrate reductase, encoded by narZYV is a minor nitrate reductase in E. coli K12.
[0338] This degradation of the inducer could be advantageous for some induction systems where transient induction is desirable. The degradation of nitrate could also simplify downstream processing. However, in other induction systems, it would be important to have stable levels of the inducing compound. Thus, it was of interest to delete the gene encoding the subunit with site of nitrate reduction for each of the nitrate reductases to determine if one was principally responsible for the observed nitrate degradation. A small scale assay was established to test the effect of deletion of each nitrate reductase encoding gene on nitrate metabolism by E. coli BL21.
C. Deletion ofnarG
[0339] The Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narG, encoding a subunit of a nitrate reductase. This deletion strain was retrieved from the Keio collection and the chromosomal
DNA was used as a template for PCR with the following primers:
M043_A: ACTTCGGGTTACATGTGCTG (SEQ ID NO:24)
M043_B: GAAGTTCTTGTCTTTCGCCA (SEQ ID NO:25)
[0340] The PCR product was used to transform strain BL21 (Novagen) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation. A kanamycin-resistant transformant was retained and named DP2262.
[0341] Overnight cultures of strain DP2262 and the comparison strain, BL21, were grown in LA medium at 37 °C. After approximately 18 hours, each culture was diluted 1:20 in two wells of a 24 deep well plate containing 2 mL LA medium with 8 mM potassium nitrate. These cultures were grown anaerobically overnight at 37 °C, 250 rpm, by tightly sealing the 24- well plate with a foil seal. The cultures and uninoculated medium were harvested after 24 hours of growth. The nitrate+nitrite and nitrite concentrations of the supernatants were measured in triplicate using Cayman Chemical Company's Nitrate/Nitrite Colorimetric Assay Kit. The samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LA medium as the samples. The uninoculated medium blank was measured in this assay at 11.99 mM nitrate and 0.00 mM nitrite The average and standard deviation for the six measurements of each tested strains are shown in the table 7-4 below.
Table 7-4: Nitrate and nitrite concentrations of the supernatants
Figure imgf000101_0001
[0342] The Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strain. D. Deletion ofnarZ and nap A
[0343] The Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of nap A, encoding a subunit of the periplasmic nitrate reductase. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers:
M043_F: GCTATTTTCTCCGCGCCACA (SEQ ID NO:26)
M043_G: ACAAACATCGCAGCGCAGCC (SEQ ID NO:27)
[0344] The PCR product was used to transform strain BL21 (Novagen) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation. A kanamycin-resistant transformant was retained and named DP2273.
[0345] The Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narZ, encoding a subunit of an intracellular nitrate reductase. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers:
M043_H: TTTTTATGGCGATTTTCAGTGC (SEQ ID NO:28)
M043_I: TTTTGCATGGCCTCGAAGTT (SEQ ID NO:29)
[0346] The PCR product was used to transform strain BL21 (Novagen) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation. A kanamycin-resistant transformant was retained and named DP2277.
[0347] Overnight cultures of strains DP2273 and DP2277 and the comparison strain, BL21, were grown in LB medium at 37 °C. After approximately 18 hours, each culture was diluted 1:20 in two wells of a 24 deep well plate containing 2 mL LB medium with 8 mM potassium nitrate. These cultures were grown anaerobically overnight at 37 °C, 250 rpm, by tightly sealing the 24- well plate with a foil seal. The cultures and uninoculated medium were harvested after 24 hours of growth. The nitrate+nitrite and nitrite concentrations of the supernatants were measured in triplicate using Cayman Chemical Company's Nitrate/Nitrite Colorimetric Assay Kit. The samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LB medium as the samples. The uninoculated medium blank was measured in this assay at 10.47 mM nitrate and 0.00 mM nitrite The average and standard deviation for the six measurements of each tested strain are shown in the table 7-4 below.
Table 7-4: Nitrate and nitrite concentrations of the supernatants
Figure imgf000103_0001
[0348] This data shows that deletion of napA, encoding a subunit of the periplasmic nitrate reductase, or deletion of narZ, encoding a subunit of nitrate reductase Z, did not result in substantially decreased nitrate degradation in E. coli BL21. It is possible that a double or triple mutant strain with deletions in two or more of the genes napA, narG, or narZ would be required to eliminate or substantially reduce nitrate metabolism in E. coli BL21 or strains derived from BL21.
Example 8: Nitrate degradation can be decreased by mutations in known nitrate transporters
[0349] The purpose of this example is to demonstrate that nitrate degradation can be decreased by mutations in both known nitrate transporters.
[0350] Deletion of each of the known nitrate reductases individually did not substantially affect nitrate metabolism (see Example 7). If nitrate needs to be intracellular to be degraded, then knock out of the nitrate transport proteins is a potential alternative route to reduce nitrate degradation. Transport should not be required for the two component systems regulatory systems used for nitrate signally and so nitrate induction of gene expression is not expected to be affected by loss of nitrate transporters. E. coli has two known nitrate uptake transporters encoded by narK and narU. A. Deletion of narK
[0351] The Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narK. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers:
M054_A: GCGATCCCGCTTTGTTGATC (SEQ ID NO:30)
M054_B: AGCGTGGGAATTGATAACGA (SEQ ID NO:31)
[0352] The PCR product was used to transform strain MCM2065 (BL21, Apgl PL.2mKKDyl, GI1.2gltA, yhfSFRTPyddVIspAyhfS, thiFRTtruncIspA, bMVK) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation. A kanamycin-resistant transformant was retained and named DP2301.
B. Deletion of narU
[0353] The Keio collection (Baba, T. et al. 2006. Construction of Escherichia coli K-12 in- frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. Epub 2006 Feb 21) of E. coli K12 deletion strains includes a deletion of narU. This deletion strain was retrieved from the Keio collection and the chromosomal DNA was used as a template for PCR with the following primers.
M054_C: ATACACACTTACAAGACAGAGG (SEQ ID NO:32)
M054_D: TCAGTCGTTTACGAATGAGC (SEQ ID NO:33)
[0354] The PCR product was used to transform strain MCM2065 BL21, Apgl PL.2mKKDyl, GI1.2gltA, yhfSFRTPyddVIspAyhfS, thiFRTtruncIspA, bMVK) carrying plasmid pRed-ET (Gene Bridges) using the Gene Bridges protocol for arabinose induction and transformation. A kanamycin-resistant transformant was retained and named DP2305.
C. Construction of the double mutant
[0355] Strain DP2305 was transformed with plasmid pCP20 encoding a FLP recombinase (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645) with selection for carbeniciUin resistance at 30 °C. A carbenicillin-resistant colony was streaked to an LB plate at 37 °C and individual single colonies were tested for kanamycin resistance at 37 °C and carbeniciUin resistance at 30 °C. Two kanamycin and carbeniciUin sensitive isolates were retained and named LE1213 and LE1214. Removal of the kanamycin cassette from narU was confirmed by PCR with primers M054C and M054D (above), which gave a product of about 1000 bp as expected.
[0356] Strain DP2301 was used as a donor for generalized transduction mediated by phage Plvir. The recipient strains were LE1213 and LE1214. Kanamycin-resistant transductants were single colony purified and checked by PCR for the narU deletion using primers M054_C and M054_D (above) and for the kanamycin cassette in narK using primers M054_A (above) and ck_Keio_rev.
ck_Keio_rev: ATAGCCTCTCCACCCAAGCG (SEQ ID NO:34)
[0357] One strain from each transduction that was positive with both sets of PCR primers was retained and named DP2337 and DP2338, respectively.
D. Small scale assay for nitrate degradation
[0358] Overnight cultures of the double transporter knock out strains, DP2337 and DP2338, and the comparison strain, MCM2065 with wt narK and wt narU, were grown in LB medium at 37 °C. After approximately 18 hours, each culture was diluted 1:20 in two wells of a 24 deep well plate containing 2 mL LB medium with 8 mM potassium nitrate. These cultures were grown anaerobically overnight at 37 °C, 250 rpm, by tightly sealing the 24- well plate with a foil seal. The cultures and uninoculated medium were harvested after 24 hours of growth. The nitrate+nitrite and nitrite concentrations of the supernatants were measured in triplicate using Cayman Chemical Company' s Nitrate/Nitrite Colorimetric Assay Kit. The samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LB medium as the samples.
[0359] The assay was repeated on two separate days. For the second assay, the uninoculated sample was measured at 14.66 mM nitrate and 0.00 mM nitrite. The average and standard deviation for the six measurements of each tested strain for the two assays are shown tables 8-1 and 8-2 below.
Table 8-1: Nitrate and nitrite concentrations of the supernatants 1st assay
Figure imgf000106_0001
Table 8-2: Nitrate and nitrite concentrations of the supernatants 2nd assay
Figure imgf000106_0002
[0360] In both assays, strain MCM2065 metabolized most of the nitrate and accumulated substantial nitrite. In contrast, the double knock-out strains left much more nitrate and accumulated less nitrite. Thus, this data demonstrated that nitrate degradation is substantially decreased, but not eliminated, by double deletion of the narK and narU. It is possible that knock out of the activity of the periplasmic nitrate reductase, Nap, would further decrease the nitrate metabolism. Example 9: Nitrate degradation decrease in a triple mutant strain with deletions in genes encoding both known nitrate transporters and a periplasmic nitrate reductase.
[0361] Deletion of each of the known nitrate uptake transporters did substantially reduce nitrate metabolism (see Example 8), yet the double mutant strain retained some ability to metabolize nitrate. If the periplasmic nitrate reductase encoded by napA is active, it may be responsible for nitrate metabolism in the absence of nitrate transport.
A. Deletion of napA in a nark narU double mutant strain
[0362] To remove the kanamycin-resistance cassette, the narK, narU double mutant strain DP2338 (example 8) was transformed with plasmid pDMWP208 encoding an arabinose inducible FLP recombinase from pCP20 (Datsenko, K. A. and Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645) with selection for carbenicillin resistance at 30 °C. A single colony was inoculated into liquid culture in LA medium with carbenicillin and grown 30 °C overnight. This culture was diluted and grown to log-phase then induced with arabinose for 1 hour and streaked to an LA plate at 37 °C. Individual single colonies were tested for kanamycin resistance at 37 °C and carbenicillin resistance at 30 °C. One kanamycin and carbenicillin sensitive isolate was retained and named DP2352.
[0363] The napA::Kan mutation was moved into strain DP2352 by phage Pl-mediated generalized transduction using donor strain DP2275 (napA::KanR CTO pgl- attB::FRT) with selection for Kanamycin resistance. The resultant triple mutant strain was named TV3437.
B. Small scale assay for nitrate degredation
[0364] Overnight cultures of the triple mutant strain, TV3437, double transporter knock out strains, DP2338 and DP2352, and the comparison strain, MCM2065 with wt narK, wt narU, and wt nap A were grown in LB medium at 37 °C. After approximately 18 hours, each culture was diluted in triplicate into 1:20 glass GC vials with 2 mL LB medium with 8 mM potassium nitrate. These cultures were sealed and grown anaerobically overnight at 37 °C, 250 rpm. The cultures and uninoculated medium were harvested after 24 hours of growth. The nitrate+nitrite and nitrite concentrations of the supernatants were measured in triplicate using Cayman
Chemical Company's Nitrate/Nitrite Colorimetric Assay Kit. The samples were diluted 1:500 in Nitrate/Nitrite Assay Buffer. The manufacturer's protocol was followed for the assay. Standard curves were measured in the same dilution of LB medium as the samples. The results are shown in the table 9-1 below.
Table 9-1: Nitrate and nitrite concentrations of the supernatants
Figure imgf000108_0001
[0365] In this assay, strain MCM2065 metabolized a significant amount of nitrate and accumulated substantial nitrite. In contrast, the double and triple knock-out strains left more nitrate and accumulated less nitrite. Thus, this data showed that the triple mutant is at least as effective as the double mutant in reducing the amount of nitrate degradation.

Claims

CLAIMS What is claimed is:
1. A recombinant bacterial cell comprising a gene expression construct comprising a PnarG nitrate-dependent promoter operably linked to one or more nucleic acids encoding a gene of interest; and wherein said cell further comprises one or more modification(s) to increase the expression of one or more nitrate regulation genes.
2. The recombinant bacterial cell of claim 1, wherein said PnarG nitrate dependent promoter is a PnarG mutant.
3. The recombinant bacterial cell of claim 2, wherein said PnarG mutant is PnarG*.
4. The recombinant bacterial cell claim 2, wherein said PnarG mutant is PnarG#.
5. The recombinant bacterial cell of any one of claims 1-4, wherein said one or more nitrate regulation gene(s) is operably linked to a strong promoter.
6. The recombinant bacterial cell of any one of claims 1-4, wherein said one or more nitrate regulation gene(s) is operably linked to a constitutive promoter.
7. The recombinant bacterial cell of any one of claims 1-6, wherein said nitrate regulation gene(s) is selected from the group consisting of narL, narX. narQ, and narP.
8. The recombinant bacterial cell of any one of claim 1-7, wherein said cell is further modified to comprise a down-regulation of one or more nitrate metabolism gene(s).
9. The recombinant bacterial cell of claim 8, wherein said one or more nitrate metabolism gene(s) comprise(s) a nitrate reductase gene or a nitrate transporter gene.
10. The recombinant bacterial cell of claim 9, wherein the nitrate reductase gene(s) is one or more of narG, narZ, or napA.
11. The recombinant bacterial cell of claim 9, wherein the nitrate transporter gene(s) is one or more of narK or narU.
12. The recombinant bacterial cell of any one of claims 8-11, wherein said cell comprises a deletion of one or more nitrate metabolism gene(s).
13. The recombinant bacterial cell of any one of claims 1-12, wherein said bacterial cell is a gram(-) bacteria.
14. The recombinant bacterial cell of any one of claims 1-13, wherein said bacterial cell is E. coli.
15. The recombinant bacterial cell of any one of claims 1-14, wherein said bacterial cell is E. coli B strain.
16. The recombinant bacterial cell of any one of claim 1-15, wherein said gene of interest is selected from the upper MVA pathway.
17. The recombinant bacterial cell of any one of claim 1-16, wherein said gene of interest is selected from the lower MVA pathway.
18. The recombinant bacterial cell of any one of claim 1-17, wherein said gene of interest is an isoprene synthase.
19. A method for regulating the expression of a gene of interest comprising:
culturing the recombinant bacterial cell of any of claims 1-18 in a culture media comprising a nitrate-containing compound, thereby activating the expression of said gene of interest.
20. A method of producing an isoprenoid precursor, said method comprising culturing said bacterial cell of any one of claims 16-17 in a culture media comprising a nitrate-containing compound, thereby activating the expression of a gene of interest selected from: (i) the upper MVA pathway and/or (ii) the lower MVA pathway and producing said isoprenoid precursor.
21. A method of producing an isoprene, said method comprising culturing said bacterial cell of any one of claims 16-18 in a culture media comprising a nitrate-containing compound, thereby activating the expression of a gene of interest selected from: (i) the upper MVA pathway; (ii) the lower MVA pathway; and (iii) isoprene synthase and producing said isoprene.
22. The method of any one of claims 19-21, wherein said nitrate-containing compound is a nitrate salt.
23. The method of claim 22, wherein said nitrate salt is potassium nitrate, sodium nitrate, ammonium nitrate, calcium nitrate, or magnesium nitrate.
24. A nitrate-inducible promoter for expression of a gene of interest in a host cell comprising one or more nucleic acid substitutions at a nucleotide position located -10 bp and -35 bp from a transcriptional start site, wherein the nucleic acid sequence at the nucleotide position located -10 bp from the transcriptional start site comprises TATAAT.
25. The nitrate-inducible promoter of claim 24, wherein the nucleic acid sequence at the nucleotide position located -35 bp from the transcriptional start site comprises TTGCCA or TTCACA.
26. The nitrate-inducible promoter of claim 24 or 25, wherein the promoter is capable of expressing the gene of interest in a host cell when cultured under aerobic and/or anaerobic conditions.
27. The nitrate-inducible promoter of any one of claims 24-26, wherein the promoter is capable of expressing a gene of interest in response to nitrate at levels at least about 50% higher in comparison to expression of the same gene of interest when operably linked to the PnarG* promoter.
28. The nitrate-inducible promoter of any one of claims 24-27, wherein the nucleotide sequence of the nitrate-inducible promoter comprises SEQ ID NO: l.
29. The nitrate-inducible promoter of any one of claims 24-28, wherein the nitrate-inducible promoter is PnarG#.
30. A vector comprising the nitrate-inducible promoter of any one of claims 24-29.
PCT/US2014/071691 2013-12-23 2014-12-19 Compositions and methods for control of industrial scale production of bio-products Ceased WO2015100180A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361920357P 2013-12-23 2013-12-23
US61/920,357 2013-12-23

Publications (2)

Publication Number Publication Date
WO2015100180A1 true WO2015100180A1 (en) 2015-07-02
WO2015100180A8 WO2015100180A8 (en) 2015-09-17

Family

ID=53479589

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/071691 Ceased WO2015100180A1 (en) 2013-12-23 2014-12-19 Compositions and methods for control of industrial scale production of bio-products

Country Status (1)

Country Link
WO (1) WO2015100180A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10662415B2 (en) 2017-12-07 2020-05-26 Zymergen Inc. Engineered biosynthetic pathways for production of (6E)-8-hydroxygeraniol by fermentation
US10696991B2 (en) 2017-12-21 2020-06-30 Zymergen Inc. Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone
CN115948444A (en) * 2022-10-21 2023-04-11 江南大学 A method for improving the anaerobic activity of Bacillus licheniformis by using nitrate and the global anaerobic regulator Fnr

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100196956A1 (en) * 2007-03-22 2010-08-05 Bioleaders Corporation Novel constitutive strong promoter and use thereof
US7790958B2 (en) * 1999-07-20 2010-09-07 Monsanto Technology Llc Genomic plant sequences and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7790958B2 (en) * 1999-07-20 2010-09-07 Monsanto Technology Llc Genomic plant sequences and uses thereof
US20100196956A1 (en) * 2007-03-22 2010-08-05 Bioleaders Corporation Novel constitutive strong promoter and use thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DONG ET AL.: "Upstream Sequence Elements Required for NarL-mediated Activation of Transcription from the narGHJI Promoter of Escherichia coli", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, 1992, pages 14122 - 14128 *
WALKER ET AL.: "Role of Alternative Promoter Elements in Transcription from the nar Promoter of Escherichia coli", JOURNAL OF BACTERIOLOGY, vol. 174, no. 4, 1992, pages 1119 - 1123 *
WANG ET AL.: "The napF and narG Nitrate Reductase Operons in Escherichia coli Are Differentially Expressed in Response to Submicromolar Concentrations of Nitrate but Not Nitrite", JOURNAL OF BACTERIOLOGY, vol. 181, no. 17, 1999, pages 5303 - 5308 *
ZUMFT ET AL.: "Cell Biology and Molecular Basis of Denitrification", MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, vol. 61, 1997, pages 533 - 616 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10662415B2 (en) 2017-12-07 2020-05-26 Zymergen Inc. Engineered biosynthetic pathways for production of (6E)-8-hydroxygeraniol by fermentation
US10696991B2 (en) 2017-12-21 2020-06-30 Zymergen Inc. Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone
US11193150B2 (en) 2017-12-21 2021-12-07 Zymergen Inc. Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone
CN115948444A (en) * 2022-10-21 2023-04-11 江南大学 A method for improving the anaerobic activity of Bacillus licheniformis by using nitrate and the global anaerobic regulator Fnr

Also Published As

Publication number Publication date
WO2015100180A8 (en) 2015-09-17

Similar Documents

Publication Publication Date Title
US20140234926A1 (en) Recombinant anaerobic acetogenic bacteria for production of isoprene and/or industrial bio-products using synthesis gas
US10113185B2 (en) Utilization of phosphoketolase in the production of mevalonate, isoprenoid precursors, and isoprene
US11371035B2 (en) Phosphoketolases for improved production of acetyl coenzyme A-derived metabolites, isoprene, isoprenoid precursors, and isoprenoid
US10138498B2 (en) Recombinant microorganisms for enhanced production of mevalonate, isoprene, and isoprenoids
CA2748887A1 (en) Methods of producing isoprene and a co-product
US20120276603A1 (en) Production of mevalonate, isoprene, and isoprenoids using genes encoding polypeptides having thiolase, hmg-coa synthase and hmg-coa reductase enzymatic activities
US9163263B2 (en) Identification of isoprene synthase variants with improved properties for the production of isoprene
US9315831B2 (en) Direct starch to fermentable sugar as feedstock for the production of isoprene, isoprenoid precursor molecules, and/or isoprenoids
WO2014193473A1 (en) Recombinant anaerobic acetogenic bacteria for production of isoprene and/or industrial bio-products using synthesis gas
US10364436B2 (en) Compositions and methods for clostridial transformation
WO2015100180A1 (en) Compositions and methods for control of industrial scale production of bio-products
WO2015100168A1 (en) Composition and methods for control of industrial scale production of bio-products

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14873653

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14873653

Country of ref document: EP

Kind code of ref document: A1