WO2015099850A1 - Multiplex guide rnas - Google Patents
Multiplex guide rnas Download PDFInfo
- Publication number
- WO2015099850A1 WO2015099850A1 PCT/US2014/056416 US2014056416W WO2015099850A1 WO 2015099850 A1 WO2015099850 A1 WO 2015099850A1 US 2014056416 W US2014056416 W US 2014056416W WO 2015099850 A1 WO2015099850 A1 WO 2015099850A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- seq
- csy4
- dna molecule
- promoter
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
Definitions
- RNA Polymerase II and III promoters optionally in mammalian cells.
- the Cas9 nuclease forms the basis of a programmable RNA-guided clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system (Wiedenheft et al, Nature 482, 331-338 (2012); Horvath et al, Science 327, 167-170 (2010); Terns et al, Curr Opin Microbiol 14, 321-327 (2011)) that can be used to create site-specific breaks in target DNA sequences in vitro, in mammalian cells, and in living model organisms such as zebrafish (Wang et al, Cell 153, 910-918 (2013); Shen et al, Cell Res (2013);
- a short -100 nt guide RNA (gRNA) complexes with Cas9 and directs the nuclease to a specific target DNA site; targeting is mediated by a sequence of at least 17-20 nucleotides (nts) at the 5' end of the gRNA, which are designed to be complementary to and interact via simple base pair complementarity between the first 17-20 nucleotides of an engineered gRNA and the complementary strand of a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG (Shen et al, Cell Res (2013); Dicarlo et al, Nucleic Acids Res (2013); Jiang et al, Nat Biotechnol 31, 233-239 (2013); Jinek et al, Elife 2, e00471 (2013); Hwang et al, Nat Biotechnol 31, 227-229 (2013); Cong et al, Science 339, 819-823
- gRNAs can also direct catalytically inactivated Cas9 proteins (known as dCas9, see Jinek et al, Science 337:816-821 (2012)) that are in turn fused to effector domains (e.g., a transcriptional activation domain) see, e.g., USSN 61/799,647, filed on March 15, 2013, and 61/838,148, filed on June 21, 2013, both of which are incorporated herein by reference. These latter systems enable RNA-guided recruitment of heterologous effector domains to genomic loci of interest.
- Cas9 catalytically inactivated Cas9 proteins
- effector domains e.g., a transcriptional activation domain
- the present invention is based, at least in part, on the discovery that Csy4, an endoribonuclease that recognizes a short RNA hairpin sequence, can be used to cleave out multiple functional gRNAs encoded on a single longer RNA transcript (produced from an RNA pol II or III promoter) in which the individual gRNAs are separated by Csy4 cleavage sites.
- the invention provides deoxyribonucleic acid (DNA) molecules comprising a plurality of sequences encoding guide RNAs (gRNAs), wherein each gRNA is flanked by at least one Csy4 cleavage sequence comprising or consisting of the sequence GTTCACTGCCGTATAGGCAG (SEQ ID NO: 1) or
- the DNA molecule is operably linked to a promoter sequence.
- the DNA molecule includes two, three, or more gRNA sequences, each flanked by at least one Csy4 cleavage sequence.
- the promoter sequence is a RNA Polymerase II (Pol II) promoter or Pol III promoter, preferably a RNA Pol II promoter.
- the Pol II promoter is selected from the group consisting of CAG, EF1A, CAGGS, PGK, UbiC, CMV, B29, Desmin, Endoglin, FLT-1, GFPA, and SYN1 promoters.
- the invention provides a DNA molecule comprising a promoter sequence linked with one, two, three or more cassettes comprising: a sequence encoding a guide RNA, i.e., a sequence of about 100 nts, e.g., 95-300 nts, e.g., 95-105 nts for an S. Pyogenes-based system, linked to a Csy4 cleavage site, e.g., SEQ ID NO: 1 or 2.
- the DNA molecule comprises a Pol II promoter, operably linked to a first sequence encoding a first guide RNA linked to a Csy4 cleavage site, linked to a second sequence encoding a second guide RNA linked to a Csy4 cleavage site, linked to a third sequence encoding a third guide RNA linked to a Csy4 cleavage site.
- further guide RNAs linked to Csy4 cleavage sites are included.
- the DNA molecule can have the following structure:
- C4 is a sequence encoding a Csy4 RNA cleavage site and gRNA is a sequence encoding a guide RNA.
- the Cas9 sgRNA comprises the sequence:
- X17-20 is a sequence complementary to the complementary strand of 17-20 consecutive nucleotides of a target sequence, preferably a target sequence immediately 5 Of a protospacer adjacent motif (PAM), and XN is any sequence that does not interfere with the binding of the ribonucleic acid to Cas9.
- a sequence of X17-20 is exemplified herein with the S. pyogenes Cas9 system, longer sequences can also be used, e.g., as appropriate for other systems.
- the DNA molecule also includes a sequence encoding a functional Csy4 enzyme.
- vectors comprising the DNA molecules described herein, e.g., optionally comprising a sequence encoding a functional Csy4 enzyme. Also provided herein are the multiplex transcripts produced by the DNA molecules, e.g., intact RNAs that have not yet been cleaved with Csy4.
- kits for producing a plurality of guide RNAs in a cell include expressing the DNA molecules described herein in the cell.
- the cell is a mammalian cell, and the cell also expresses an exogenous functional Csy4 enzyme sequence, or the method further comprises administering a functional Csy4 enzyme or nucleic acid encoding a functional Csy4 enzyme.
- the invention provides methods for altering expression of one or a plurality of target genes in a cell.
- the methods include expressing a DNA molecule as described herein, e.g., a DNA molecule comprising a plurality of sequences encoding guide RNAs (gRNAs), wherein each gRNA comprises a variable sequence that is complementary to at least 17-20 nts of the one or more target genes, and each gRNA is flanked by at least one Csy4 cleavage sequence comprising or consisting of the sequence
- the gRNA can be either a single guide RNA comprising a fused tracrRNA and crRNA, as described herein, or can include just a crRNA, and the tracrRNA can be expressed from the same or a different DNA molecule.
- the DNA molecules described herein also include a sequence encoding a tracrRNA.
- the methods include expressing in the cells a separate tracrRNA, e.g., contacting the cells with a vector or DNA molecule that expresses a tracrRNA. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
- Figure 1 is a schematic illustrating constructs used in initial multiplex experiments, as follows:
- Figure 2 is a bar graph showing the results of experiments in cells expressing the constructs shown in Figure 1.
- the Csy4 site + full gRNA (constructs 5 and 6) was the most efficient multiplex framework.
- FIG 3 is a schematic overview and comparison of exemplary standard and multiplex Csy4-based gRNA frameworks, and the transcripts they produce. Note that Csy4 enables the use of RNA Pol II promoters (e.g., CAG) as an alternative to U6, an RNA Pol III promoter.
- RNA Pol II promoters e.g., CAG
- Figure 4 is a bar graph showing that Csy4 cleaves a truncated recognition site producing gRNAs with higher activity in human cells. Processing of the truncated site also leaves a clean 5' end, effectively removing the 5' G restriction on gRNA target sequences imposed by the U6 promoter.
- Figures 5A-C are sequences showing evidence of 2-target multiplex editing in single human cells. Individual deletions are observed at intended site 2 or 3. Multiple deletions on the same sequence are observed for sites 2 and 3. Deletions spanning sites 2 and 3 are also observed.
- Figure 6 is a schematic showing successful multiplex expression of three gRNAs using the Csy4-based system.
- Figure 7 is a bar graph showing gRNAs excised by Csy4 from RNA Pol II-transcribed mRNA can efficiently recruit Cas9 nuclease to specific targets in human cells. In these experiments, gRNAs were expressed in longer mRNA transcripts made from the RNA Pol II CAG promoter.
- RNA polymerase III promoters e.g., U6 promoter
- U6 promoter e.g., U6 promoter
- RNA polymerase II promoters that are inducible and/or tissue-specific have been previously described.
- Cas9 or dCas9 proteins could be expressed from such RNA pol II promoters, short, defined gRNAs cannot be expressed in this way as the start and stop sites of transcription from RNA pol II are imprecise. Indeed, to date, all gRNAs have been expressed from RNA polymerase III promoters, which are ideally suited for expression of short RNAs.
- Csy4 an endoribonuclease that recognizes a short RNA hairpin sequence
- Csy4 can be used to cleave out multiple functional gRNAs encoded on a single longer RNA transcript (produced from an RNA pol III promoter) cassette in which the individual gRNAs are separated by Csy4 cleavage sites.
- Functional gRNAs can be successfully cleaved from longer RNA transcripts expressed from an RNA pol II promoter.
- DNA molecules that encode longer RNA transcripts referred to herein as multimeric cassettes, which include two or more gRNA sequences, wherein each gRNA is flanked by a Csy4 cleavage sequence.
- the DNA molecules can also include a promoter, and can optionally include one or more other transcription regulatory sequences, e.g., enhancers, silencers, insulators, and polyA sequences. See, e.g., Xu et al, Gene. 2001 Jul 1 l;272(l-2): 149-56.
- the promoter is a PolII or Pol III promoter, preferably a Pol II promoter.
- Various Pol II promoters have been described and can be used in the present compositions and methods, including the CAG promoter (see, e.g., Alexopoulou et al, BMC Cell Biology 9: 2, 2008; Miyazaki et al, Gene 79 (2): 269-77 (1989); Niwa et al, Gene 108 (2): 193-9 (1991); additional promoters include the EF1A, CAGGS, PGK, UbiC and CMV promoters, as well as tissue-specific promoters such as B29, Desmin, Endoglin, FLT-1, GFPA, SY 1, among others; sequences of numerous promoters are known in the art.
- the CMV and PGK promoters can be amplified from pSicoR and pSicoR PGK respectively (Ventura et al, Proc Natl Acad Sci U S A 101 : 10380-10385 (2004)), the UbiC promoter can be amplified from pDSL hpUGIH (ATCC), the CAGGS promoter can be amplified from pCAGGS (BCCM), and the EF1A promoter can be amplified from the pEF6 vector (Invitrogen).
- the Pol II core promoter is described in Butler and Kadonaga, Genes & Dev. 16: 2583-2592 (2002).
- Cleavage of the gRNAs out of a larger transcript driven by Pol II expression enables one to produce gRNAs that have any nucleotide at the 5'-most position (standard expression from a U6 or other RNA polymerase III promoter places restrictions on the identity of this nucleotide).
- tissue-specific promoter is used, and a short, defined gRNA sequence can be processed out of the RNA-Pol II transcript.
- Pol III promoters include the U6 small nuclear (sn) RNA promoter, 7SK promoter, and the HI promoter. See, e.g., Ro et al,
- Cas9 nuclease can be guided to specific genomic targets of at least 17-20 nts bearing an additional proximal protospacer adjacent motif (P AM) of sequence NGG by using a single gRNA bearing at least 17-20 nts at its 5 ' end that are complementary to the genomic DNA target site.
- P AM proximal protospacer adjacent motif
- compositions described herein can include a sequence encoding a single guide RNA (sgRNRA) comprising a crRNA fused to a normally trans-encoded tracrRNA, e.g., a single Cas9 guide RNA as described in Mali et al, Science 2013 Feb 15;
- sgRNRA single guide RNA
- nts nucleotides of a target sequence immediately 5' of a protospacer adjacent motif (P AM), e.g., NGG, NAG, or NGG.
- P AM protospacer adjacent motif
- Guide RNAs generally speaking come in two different systems: 1) System 1 uses separate crRNA and tracrRNAs that function together to guide cleavage by Cas9; and 2) System 2 uses a chimeric crRNA-tracrRNA hybrid that combines the two separate guide RNAs in a single system (Jinek et al. 2012).
- the tracr-RNA can be variably truncated and a range of lengths has been shown to function in both the separate system (system 1) and the chimeric gRNA system (system 2). See, e.g., Jinek et al, Science 2012; 337:816-821; Mali et al, Science.
- the gRNAs are complementary to a region that is within about 100-800 bp upstream of the transcription start site, e.g., is within about 500bp upstream of the transcription start site, includes the transcription start site, or within about 100-800 bp, e.g., within about 500 bp, downstream of the transcription start site.
- vectors e.g., plasmids
- plasmids encoding more than one gRNA are used, e.g., plasmids encoding, 2, 3, 4, 5, or more gRNAs directed to different sites in the same region of the target gene. Additional guide RNAs, and methods of increasing the specificity of genome editing, are described in Provisional Patent Application Serial No. 61/838,178, entitled INCREASING SPECIFICITY FOR RNA-GUIDED GENOME EDITING
- the gRNA comprises or consists of the sequence:
- complementarity region may be longer than 20 nts, e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more nts, e.g., 17-30 nts), preferably a target sequence immediately 5' of a protospacer adjacent motif (PAM), e.g., NGG, NAG, or NNGG XN is any sequence, wherein N (in the RNA) can be 0-300 or 0-200, e.g., 0-100, 0-50, or 0-20, that does not interfere with the binding of the ribonucleic acid to Cas9.
- PAM protospacer adjacent motif
- the RNA includes one or more U, e.g., 1 to 8 or more Us (e.g., U, UU, UUU, UUUU, UUUUU, UUUUU, UUUUUU, UUUUUU, UUUUUU, UUUUUUU, UUUUUUUUUUUUUU) at the 3' end of the molecule, as a result of the optional presence of one or more Ts used as a termination signal to terminate RNA PolIII transcription.
- the RNA includes one or more, e.g., up to 3, e.g., one, two, or three, or more additional nucleotides at the 5' end of the RNA molecule that is not complementary to the target sequence.
- one or more of the RNA nucleotides is modified, e.g., locked (2'-0-4'-C methylene bridge), is 5'-methylcytidine, is 2'-0-methyl-pseudouridine, or in which the ribose phosphate backbone has been replaced by a polyamide chain, e.g., one or more of the nucleotides within the sequence X17-20, one or more of the nucleotides within the sequence XN, or one or more of the nucleotides within any sequence of the gRNA
- chimeric guide RNAs described in Jinek et al. can be used, e.g.,
- the guide RNA includes one or more Adenine (A) or Uracil (U) nucleotides on the 3 ' end.
- RNAs e.g., the crRNA and tracrRNA found in naturally occurring systems.
- a single tracrRNA would be used in conjunction with multiple different crRNAs expressed using the present system, e.g., the following (note that for RNAs, T's are understood herein to be U's):
- the crRNA is used as the guide RNA in the methods and molecules described herein, and the tracrRNA can be expressed from the same or a different DNA molecule.
- guide RNAs having a sequence of 17-20 nucleotides of complementarity are exemplified herein, in some embodiments longer sequences can be used, e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more nts, e.g., 17-30 nts in place of 17-20 nts.
- a Csy4 cleavage sequence is inserted into the DNA molecule such that each guide RNA is flanked by a cleavage sequence, with one or at least one cleavage sequence between each guide RNA.
- Exemplary Cys4 cleavage sequences include GTTCACTGCCGTATAGGCAG (truncated 20 nt) (SEQ ID NO: l) and GTTCACTGCCGTATAGGCAGCTAAGAAA (full 28 nt) (SEQ ID NO:2).
- SEQ ID NO: 1 is more efficient in human cells than use of the standard site. To the best of the present inventors' knowledge, this is the first demonstration of Csy4 activity being utilized in human cells.
- a functional Csy4 enzyme that is capable of cleaving the transcripts at the Csy4 cleavage sites, is also expressed in the cell.
- the Csy4 is from Pseudomonas aeruginosa.
- the Csy4 is also used to covalently link heterologous effector domains to the gRNAs.
- Csy4 is believed to be a single-turnover enzyme and remains bound to its target hairpin sequence after cleavage (Sternberg et al, RNA. 2012 Apr; 18(4):661-72).
- Csy4 is thus expected to remain bound to the 3' end of each cleaved gRNA. Since as demonstrated herein the cleaved gRNAs appear to be functional in human cells, the presence of this Csy4 protein on the 3' end of the gRNA does not appear to affect the ability of the gRNA to complex with and direct Cas9 activity.
- gRNA-Csy4 fusions would also be able to direct Cas9 mutants that bear mutations that inactivate its catalytic nuclease activity (dCas9 proteins). Therefore, one could fuse heterologous functional domains (HFD) to Csy4 (Csy4-HFD), and a dCas9:sgRNA:Csy4-HFD complex could then direct such domains to a specific genomic locus.
- HFD heterologous functional domains
- HFD heterologous functional domains
- Csy4-HFD Csy4
- a dCas9:sgRNA:Csy4-HFD complex could then direct such domains to a specific genomic locus.
- HFD could include other nuclease domains such as that from Fokl, transcriptional activator or repressor domains, or other domains that modify histones or DNA methylation status.
- the Csy4-HFD are created by fusing a heterologous functional domain (e.g., a transcriptional activation domain, e.g., from VP64 or NF- ⁇ p65), to the N-terminus or C- terminus of a Csy4 protein, with or without an intervening linker, e.g., a linker of about 5-20 or 13-18 nucleotides.
- a heterologous functional domain e.g., a transcriptional activation domain, e.g., from VP64 or NF- ⁇ p65
- the transcriptional activation domains can be fused on the N or C terminus of the Csy4.
- heterologous functional domains e.g., transcriptional repressors (e.g., KRAB, SID, and others) or silencers such as Heterochromatin Protein 1 (HP1, also known as swi6), e.g., HP la or ⁇ ⁇ ; proteins or peptides that could recruit long non-coding RNAs (lncRNAs) fused to a fixed RNA binding sequence such as those bound by the MS2 coat protein, endoribonuclease Csy4, or the lambda N protein; enzymes that modify the methylation state of DNA (e.g., DNA methyltransferase (DNMT) or TET proteins); or enzymes that modify histone subunits (e.g., histone acetyltransferases (HAT), histone deacetylases (HDAC), histone methyltransferases (e.g., for methylation of lysine or arginine residue
- HAT histone acety
- domains A number of sequences for such domains are known in the art, e.g., a domain that catalyzes hydroxylation of methylated cytosines in DNA.
- Exemplary proteins include the Ten-Eleven- Translocation (TET)l-3 family, enzymes that converts 5-methylcytosine (5-mC) to 5- hydroxymethylcytosine (5-hmC) in DNA. See, e.g., WO/2014/144761.
- Variant (1) represents the longer transcript and encodes the longer isoform (a).
- Variant (2) differs in the 5' UTR and in the 3' UTR and coding sequence compared to variant 1.
- the resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a.
- all or part of the full-length sequence of the catalytic domain can be included, e.g., a catalytic module comprising the cysteine-rich extension and the 20GFeDO domain encoded by 7 highly conserved exons, e.g., the Tetl catalytic domain comprising amino acids 1580-2052, Tet2 comprising amino acids 1290-1905 and Tet3 comprising amino acids 966-1678. See, e.g., Fig. 1 of Iyer et al., Cell Cycle. 2009 Jun 1 ;8(11): 1698-710.
- the sequence includes amino acids 1418- 2136 of Tetl or the corresponding region in Tet2/3.
- catalytic modules can be, e.g., from the proteins identified in Iyer et al, 2009.
- the fusion proteins include a linker between the Csy4 and the heterologous functional domains.
- Linkers that can be used in these fusion proteins (or between fusion proteins in a concatenated structure) can include any sequence that does not interfere with the function of the fusion proteins.
- the linkers are short, e.g., 2-20 amino acids, and are typically flexible (i.e., comprising amino acids with a high degree of freedom such as glycine, alanine, and serine).
- the linker comprises one or more units consisting of GGGS (SEQ ID NO:3) or GGGGS (SEQ ID NO:3) or GGGGS (SEQ ID NO:3)
- linker sequences can also be used, e.g., GGS, GGSG (SEQ ID NO:22), SGSETPGTSESA (SEQ ID NO:23), SGSETPGTSESATPES (SEQ ID NO:24), or SGSETPGTSESATPEGGSGGS (SEQ ID NO:25).
- Cas9 is also expressed in the cells.
- a number of bacteria express Cas9 protein variants.
- the Cas9 from Streptococcus pyogenes is presently the most commonly used; some of the other Cas9 proteins have high levels of sequence identity with the S. pyogenes Cas9 and use the same guide RNAs.
- Others are more diverse, use different gRNAs, and recognize different PAM sequences as well (the 2-5 nucleotide sequence specified by the protein which is adjacent to the sequence specified by the RNA). Chylinski et al.
- RNA Biology 10:5, 1-12; 2013 classified Cas9 proteins from a large group of bacteria (RNA Biology 10:5, 1-12; 2013), and a large number of Cas9 proteins are listed in supplementary figure 1 and supplementary table 1 thereof, which are incorporated by reference herein.
- the constructs and methods described herein can include the use of any of those Cas9 proteins, and their corresponding guide RNAs or other guide RNAs that are compatible.
- the Cas9 from Streptococcus thermophilus LMD-9 CRISPR1 system has also been shown to function in human cells in Cong et al (Science 339, 819 (2013)). Additionally, Jinek et al. showed in vitro that Cas9 orthologs from S. thermophilus and L. innocua, (but not from N. meningitidis or C. jejuni, which likely use a different guide RNA), can be guided by a dual S. pyogenes gRNA to cleave target plasmid DNA, albeit with slightly
- the present system utilizes the Cas9 protein from S. pyogenes, either as encoded in bacteria or codon-optimized for expression in mammalian cells.
- An exemplary sequence of Streptococcus pyogenes Cas9 (residues 1-1368) fused to an HA epitope (amino acid sequence DAYPYDVPDYASL (SEQ ID NO: 18)) and a nuclear localization signal (amino acid sequence PKKKRKVEDPKKKRKVD (SEQ ID NO: 19)) is as follows:
- a Cas9 sequence is used that contains either of the DIOA and H840A mutations to render the nuclease a nickase, or both the DIOA and H840A mutations to render the nuclease portion of the protein catalytically inactive.
- the sequence of a catalytically inactive S. pyogenes Cas9 (dCas9) that can be used in the methods and compositions described herein is as follows; the mutations are in bold and underlined.
- PAAFKYFDTT IDRKRYTSTK EVLDATLIHQ SITGLYETRI DLSQLGGD (SEQ ID NO::
- the Cas9 can be a dCas9-hetero functional domain fusion (dCas9-HFD) as described in U.S. Provisional Patent Application entitled RNA-GUIDED TARGETING OF GENETIC AND
- the Cas9 can be expressed from an expression vector, as described herein, e.g., an extrachromosomal plasmid or viral vector comprising a sequence encoding Cas9, e.g., a Cas9 cDNA or gene; can be expressed from an exogenous Cas9 cDNA or gene that has integrated into the genome of the cell; an mRNA encoding Cas9; the actual Cas9 protein itself; or, in the case of non-mammalian cells, can be an exogenous Cas9.
- an expression vector as described herein, e.g., an extrachromosomal plasmid or viral vector comprising a sequence encoding Cas9, e.g., a Cas9 cDNA or gene
- an exogenous Cas9 cDNA or gene that has integrated into the genome of the cell
- an mRNA encoding Cas9 the actual Cas9 protein itself
- non-mammalian cells can be an exogenous Cas9.
- Nucleic acid molecules comprising expression vectors can be used, e.g., for in vivo or in vitro expression of the Csy4/guide RNA constructs described herein.
- Vectors for expressing multiple gRNAs can be used for research and therapeutic applications.
- a nucleic acid encoding a guide RNA cassette or Csy4 or Cas9 protein can be cloned into an intermediate vector for transformation into prokaryotic or eukaryotic cells for replication and/or expression.
- Intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of the nucleic acid encoding the fusion protein or for production of the fusion protein.
- the nucleic acid encoding the guide RNA or fusion protein can also be cloned into an expression vector, for administration to a plant cell, animal cell, preferably a mammalian cell or a human cell, fungal cell, bacterial cell, or protozoan cell.
- a sequence encoding a guide RNA or fusion protein is typically subcloned into an expression vector that contains a promoter to direct transcription.
- Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al, Molecular Cloning, A Laboratory Manual (3d ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al, eds., 2010).
- Bacterial expression systems for expressing the engineered protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (Palva et al, 1983, Gene 22:229-235). Kits for such expression systems are commercially available.
- Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
- viral vectors including recombinant retroviruses, lentivirus, adenovirus, adeno-associated virus, and herpes simplex virus 1, adenovirus-derived vectors, or recombinant bacterial or eukaryotic plasmids.
- the expression construct can include: a coding region; a promoter sequence, e.g., a promoter sequence that restricts expression to a selected cell type, a conditional promoter, or a strong general promoter; an enhancer sequence; untranslated regulatory sequences, e.g., a 5 'untranslated region (UTR), a 3'UTR; a polyadenylation site; and/or an insulator sequence.
- a promoter sequence e.g., a promoter sequence that restricts expression to a selected cell type, a conditional promoter, or a strong general promoter
- an enhancer sequence e.g., untranslated regulatory sequences, e.g., a 5 'untranslated region (UTR), a 3'UTR; a polyadenylation site; and/or an insulator sequence.
- UTR 5 'untranslated region
- polyadenylation site e.g., adenylation site
- expression can be restricted to a particular cell type, using a tissue-specific promoter as is known in the art.
- the vectors for expressing the guide RNAs can include RNA Pol II or Pol III promoters to drive expression of the guide RNAs.
- These human promoters allow for expression of gRNAs in mammalian cells following plasmid transfection.
- a T7 promoter may be used, e.g., for in vitro transcription, and the RNA can be transcribed in vitro and purified.
- the promoter used to direct expression of the nucleic acid depends on the particular application.
- a strong constitutive promoter is typically used for expression and purification of fusion proteins.
- a constitutive or an inducible promoter can be used, depending on the particular use of the fusion protein.
- a preferred promoter for administration of the fusion protein can be a weak promoter, such as HSV TK or a promoter having similar activity.
- the promoter can also include elements that are responsive to trans activation, e.g., hypoxia response elements, Gal4 response elements, lac repressor response element, and small molecule control systems such as tetracycline-regulated systems and the RU-486 system (see, e.g., Gossen & Bujard, 1992, Proc. Natl. Acad. Sci. USA, 89:5547; Oligino et al, 1998, Gene Ther., 5:491-496; Wang et al, 1997, Gene Ther., 4:432- 441; Neering et al, 1996, Blood, 88: 1147-55; and Rendahl et al, 1998, Nat. Biotechnol., 16:757-761).
- elements that are responsive to trans activation e.g., hypoxia response elements, Gal4 response elements, lac repressor response element, and small molecule control systems such as tetracycline-regulated systems and the RU-486 system (see,
- the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic.
- a typical expression cassette thus contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the fusion protein, and any signals required, e.g., for efficient
- Additional elements of the cassette may include, e.g., enhancers, and heterologous spliced intronic signals.
- the particular expression vector used to transport the genetic information into the cell is selected with regard to the intended use of the fusion protein, e.g., expression in plants, animals, bacteria, fungus, protozoa, etc.
- Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and commercially available tag- fusion expression systems such as GST and LacZ.
- a preferred tag-fusion protein is the maltose binding protein (MBP).
- MBP maltose binding protein
- Such tag-fusion proteins can be used for purification of the engineered TALE repeat protein.
- Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, for monitoring expression, and for monitoring cellular and subcellular localization, e.g., c-myc or FLAG.
- Expression vectors containing regulatory elements from eukaryotic viruses are often used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
- eukaryotic vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- Some expression systems have markers for selection of stably transfected cell lines such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
- High yield expression systems are also suitable, such as using a baculovirus vector in insect cells, with the fusion protein encoding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.
- the elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences.
- Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of protein, which are then purified using standard techniques (see, e.g., Colley et al, 1989, J. Biol. Chem., 264: 17619-22; Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, 1977, J. Bacteriol. 132:349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101 :347-362 (Wu et al, eds, 1983).
- Any of the known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well- known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the protein of choice.
- the Cas9 or Csy4 protein includes a nuclear localization domain which provides for the protein to be translocated to the nucleus.
- nuclear localization sequences are known, and any suitable NLS can be used.
- many NLSs have a plurality of basic amino acids, referred to as a bipartite basic repeats (reviewed in Garcia-Bustos et al, 1991, Biochim. Biophys. Acta, 1071 :83-101).
- An NLS containing bipartite basic repeats can be placed in any portion of chimeric protein and results in the chimeric protein being localized inside the nucleus.
- a nuclear localization domain is incorporated into the final fusion protein, as the ultimate functions of the fusion proteins described herein will typically require the proteins to be localized in the nucleus. However, it may not be necessary to add a separate nuclear localization domain in cases where the protein has intrinsic nuclear translocation function.
- the present invention includes the vectors and cells comprising the vectors.
- combinatorial libraries of gRNAs e.g., in inducible, tissue- or cell-type specific multiplex vectors for research applications, e.g., for screening for potential drug targets or to define interactions at a genetic level.
- the methods described can include expressing in a cell, or contacting the cell with, the multimeric cassettes as described herein, plus a nuclease that can be guided by the shortened gRNAs, e.g., a Cas9 nuclease as described above, and a Csy4 nuclease, as described above.
- a nuclease that can be guided by the shortened gRNAs e.g., a Cas9 nuclease as described above, and a Csy4 nuclease, as described above.
- the described system is a useful and versatile tool for modifying the expression of multiple endogenous genes simultaneously, or for targeting multiple parts of a single gene.
- Current methods for achieving this require the use of a separate gRNA-encoding transcript for each site to be targeted.
- Separate gRNAs are not optimal for multiplex genome editing of cell populations as it is impossible to guarantee that each cell will express each gRNA; with multiple transcripts, cells get a complex and non-uniform random mixture of gRNAs.
- the present system allows expression of multiple gRNAs from a single transcript, which allows targeting of multiple sites in the genome by expression of multiple gRNAs.
- each cell should express all gRNAs with similar stoichiometry.
- This system could therefore easily be used to simultaneously alter expression of a large number of genes or to recruit multiple Cas9s or HFDs to a single gene, promoter, or enhancer.
- This capability will have broad utility, e.g., for basic biological research, where it can be used to study gene function and to manipulate the expression of multiple genes in a single pathway, and in synthetic biology, where it will enable researchers to create circuits in cell that are responsive to multiple input signals.
- the relative ease with which this technology can be implemented and adapted to multiplexing will make it a broadly useful technology with many wide-ranging applications.
- the methods described herein include contacting cells with a nucleic acid encoding the multimeric gR A cassettes described herein directed to one or more genes, and nucleic acids encoding Csy4 and Cas9, to thereby modulate expression of the one or more genes.
- CRISPR/Cas9 from arrays of either crRNAs or sgRNAs expressed from a single transcript, as follows:
- sgRNAs full-length single guide RNAs
- FIG. 3 A schematic overview of an exemplary strategy for cleaving gRNAs out from longer transcripts using the Csy4 nuclease is shown in Figure 3.
- two versions of the Csy4-cleaved RNA hairpin site were tested for cleavage in human cells.
- gRNAs flanked by one of two Csy4 cleavage sites were expressed:
- the level of targeted Cas9 activity observed was comparable to (albeit somewhat lower than) what is observed when these gRNAs are expressed singly using a standard RNA Pol III promoter or as a Csy4- flanked transcript from an RNA Pol III promoter ( Figure 7).
- gRNAs up to three functional gRNAs can be produced from a single RNA pol III transcript when separated by Csy4 cleavage sites and in the presence of Csy4 in human cells
- multiple Csy4-processed gRNAs can be used to direct Cas9 nuclease to introduce multiplex changes in a single human cell
- a functional gRNA flanked by Csy4 cleavage sites can be excised by Csy4 nuclease from a longer mRNA transcript made from an RNA polymerase II promoter.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (11)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2014370416A AU2014370416B2 (en) | 2013-12-26 | 2014-09-18 | Multiplex guide RNAs |
CA2935032A CA2935032C (en) | 2013-12-26 | 2014-09-18 | Multiplex guide rnas |
EP14875819.6A EP3090044B1 (en) | 2013-12-26 | 2014-09-18 | Multiplex guide rnas |
US15/107,550 US10526589B2 (en) | 2013-03-15 | 2014-09-18 | Multiplex guide RNAs |
EP21191144.1A EP3985124A1 (en) | 2013-12-26 | 2014-09-18 | Multiplex guide rnas |
CN201480076396.6A CN106103706B (en) | 2013-12-26 | 2014-09-18 | Multiple guide RNAs |
KR1020167020111A KR20160102056A (en) | 2013-12-26 | 2014-09-18 | Multiplex guide rnas |
JP2016542968A JP6721508B2 (en) | 2013-12-26 | 2014-09-18 | Multiple guide RNA |
US16/735,146 US20200165587A1 (en) | 2013-12-26 | 2020-01-06 | Multiplex Guide RNAS |
AU2021203309A AU2021203309B2 (en) | 2013-12-26 | 2021-05-23 | Multiplex guide RNAs |
AU2023258349A AU2023258349A1 (en) | 2013-12-26 | 2023-10-31 | Multiplex guide RNAs |
Applications Claiming Priority (12)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201361921007P | 2013-12-26 | 2013-12-26 | |
US61/921,007 | 2013-12-26 | ||
US201461930782P | 2014-01-23 | 2014-01-23 | |
US61/930,782 | 2014-01-23 | ||
US14/211,117 | 2014-03-14 | ||
PCT/US2014/029068 WO2014144592A2 (en) | 2013-03-15 | 2014-03-14 | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
USPCT/2014/028630 | 2014-03-14 | ||
US14/211,117 US10760064B2 (en) | 2013-03-15 | 2014-03-14 | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
USPCT/2014/029304 | 2014-03-14 | ||
USPCT/US2014/029068 | 2014-03-14 | ||
PCT/US2014/035162 WO2014204578A1 (en) | 2013-06-21 | 2014-04-23 | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing |
USPCT/US2014/035162 | 2014-04-23 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US14/211,117 Continuation US10760064B2 (en) | 2013-03-15 | 2014-03-14 | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US15/107,550 A-371-Of-International US10526589B2 (en) | 2013-03-15 | 2014-09-18 | Multiplex guide RNAs |
US16/735,146 Continuation US20200165587A1 (en) | 2013-12-26 | 2020-01-06 | Multiplex Guide RNAS |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2015099850A1 true WO2015099850A1 (en) | 2015-07-02 |
Family
ID=57018733
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2014/056416 WO2015099850A1 (en) | 2013-03-15 | 2014-09-18 | Multiplex guide rnas |
Country Status (8)
Country | Link |
---|---|
US (1) | US20200165587A1 (en) |
EP (2) | EP3090044B1 (en) |
JP (2) | JP6721508B2 (en) |
KR (1) | KR20160102056A (en) |
CN (2) | CN106103706B (en) |
AU (3) | AU2014370416B2 (en) |
CA (1) | CA2935032C (en) |
WO (1) | WO2015099850A1 (en) |
Cited By (62)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105039309A (en) * | 2015-07-16 | 2015-11-11 | 深圳市盛捷生物技术有限公司 | Preparation method of gRNA (guide RNA) with 5' end not limited by bases |
US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
JP2016103986A (en) * | 2014-12-01 | 2016-06-09 | 国立大学法人 東京大学 | Method for manufacturing dna cassette in which a plurality of units are coupled in a multiple manner, and vector including the cassette |
US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
US9567603B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
WO2017040348A1 (en) | 2015-08-28 | 2017-03-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
CN106520824A (en) * | 2016-09-30 | 2017-03-22 | 北京大北农科技集团股份有限公司 | Multi-target-point editing system and application thereof |
WO2017083722A1 (en) * | 2015-11-11 | 2017-05-18 | Greenberg Kenneth P | Crispr compositions and methods of using the same for gene therapy |
WO2017083274A1 (en) * | 2015-11-09 | 2017-05-18 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Novel rna-based vector system for transient and stable gene expression |
WO2017106414A1 (en) * | 2015-12-18 | 2017-06-22 | Danisco Us Inc. | Methods and compositions for polymerase ii (pol-ii) based guide rna expression |
EP3219799A1 (en) | 2016-03-17 | 2017-09-20 | IMBA-Institut für Molekulare Biotechnologie GmbH | Conditional crispr sgrna expression |
US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
WO2018054911A1 (en) | 2016-09-23 | 2018-03-29 | Bayer Cropscience Nv | Targeted genome optimization in plants |
US9938521B2 (en) | 2014-03-10 | 2018-04-10 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10) |
WO2018071892A1 (en) | 2016-10-14 | 2018-04-19 | Joung J Keith | Epigenetically regulated site-specific nucleases |
US10011850B2 (en) | 2013-06-21 | 2018-07-03 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing |
WO2018130830A1 (en) * | 2017-01-11 | 2018-07-19 | Oxford University Innovation Limited | Crispr rna |
CN108384784A (en) * | 2018-03-23 | 2018-08-10 | 广西医科大学 | A method of knocking out Endoglin genes using CRISPR/Cas9 technologies |
US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
WO2018218166A1 (en) | 2017-05-25 | 2018-11-29 | The General Hospital Corporation | Using split deaminases to limit unwanted off-target base editor deamination |
US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
WO2019217146A1 (en) * | 2018-05-10 | 2019-11-14 | Syngenta Participations Ag | Methods and compositions for targeted editing of polynucleotides |
US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
US10526589B2 (en) | 2013-03-15 | 2020-01-07 | The General Hospital Corporation | Multiplex guide RNAs |
WO2020114893A1 (en) * | 2018-12-05 | 2020-06-11 | Dsm Ip Assets B.V. | Crispr guide-rna expression strategies for multiplex genome engineering |
WO2020163396A1 (en) | 2019-02-04 | 2020-08-13 | The General Hospital Corporation | Adenine dna base editor variants with reduced off-target rna editing |
US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
US20210163913A1 (en) * | 2018-02-23 | 2021-06-03 | Shanghaitech University | Fusion proteins for base editing |
US11028388B2 (en) | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
EP3889259A1 (en) | 2020-03-30 | 2021-10-06 | IMBA-Institut für Molekulare Biotechnologie GmbH | Internal standard for crispr guide rna |
US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
US11180793B2 (en) | 2015-04-24 | 2021-11-23 | Editas Medicine, Inc. | Evaluation of Cas9 molecule/guide RNA molecule complexes |
EP3765612A4 (en) * | 2018-03-12 | 2022-01-05 | Nanjing Bioheng Biotech Co., Ltd | Engineered chimeric guide rna and uses thereof |
US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11466271B2 (en) | 2017-02-06 | 2022-10-11 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
US11566263B2 (en) | 2016-08-02 | 2023-01-31 | Editas Medicine, Inc. | Compositions and methods for treating CEP290 associated disease |
US11643672B2 (en) * | 2021-10-01 | 2023-05-09 | The Florida International University Board Of Trusters | Inducible CRISPR system expression and applications thereof |
US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
EP4198124A1 (en) | 2021-12-15 | 2023-06-21 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK2800811T3 (en) | 2012-05-25 | 2017-07-17 | Univ Vienna | METHODS AND COMPOSITIONS FOR RNA DIRECTIVE TARGET DNA MODIFICATION AND FOR RNA DIRECTIVE MODULATION OF TRANSCRIPTION |
EP3126503A1 (en) * | 2014-04-03 | 2017-02-08 | Massachusetts Institute Of Technology | Methods and compositions for the production of guide rna |
CN108291218B (en) * | 2015-07-15 | 2022-08-19 | 新泽西鲁特格斯州立大学 | Nuclease-independent targeted gene editing platform and application thereof |
BR112019009725A2 (en) * | 2016-11-14 | 2019-11-19 | Toolgen Incorporated | artificially manipulated sc function control system |
EA201991455A1 (en) * | 2016-12-22 | 2020-01-15 | Интеллиа Терапьютикс, Инк. | COMPOSITIONS AND METHODS FOR TREATING ALPHA-1-ANTITRIPSIN DEFICIENCY |
CN110520163A (en) | 2017-01-05 | 2019-11-29 | 新泽西鲁特格斯州立大学 | Independently of the target gene editing platform and application thereof of DNA double chain fracture |
EP3601561A2 (en) * | 2017-03-22 | 2020-02-05 | Novartis AG | Compositions and methods for immunooncology |
CN108977442B (en) * | 2017-06-05 | 2023-01-06 | 广州市锐博生物科技有限公司 | System for DNA editing and application thereof |
CN114574467B (en) * | 2022-01-21 | 2023-05-23 | 华南农业大学 | Gene expression regulation and control system and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011143124A2 (en) * | 2010-05-10 | 2011-11-17 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
WO2013176772A1 (en) * | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
WO2014152432A2 (en) * | 2013-03-15 | 2014-09-25 | The General Hospital Corporation | Rna-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20030198627A1 (en) * | 2001-09-01 | 2003-10-23 | Gert-Jan Arts | siRNA knockout assay method and constructs |
US10760064B2 (en) * | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
EP3126503A1 (en) * | 2014-04-03 | 2017-02-08 | Massachusetts Institute Of Technology | Methods and compositions for the production of guide rna |
-
2014
- 2014-09-18 CA CA2935032A patent/CA2935032C/en active Active
- 2014-09-18 JP JP2016542968A patent/JP6721508B2/en active Active
- 2014-09-18 EP EP14875819.6A patent/EP3090044B1/en active Active
- 2014-09-18 KR KR1020167020111A patent/KR20160102056A/en not_active Application Discontinuation
- 2014-09-18 AU AU2014370416A patent/AU2014370416B2/en active Active
- 2014-09-18 EP EP21191144.1A patent/EP3985124A1/en active Pending
- 2014-09-18 WO PCT/US2014/056416 patent/WO2015099850A1/en active Application Filing
- 2014-09-18 CN CN201480076396.6A patent/CN106103706B/en active Active
- 2014-09-18 CN CN202110920229.7A patent/CN113684205A/en active Pending
-
2019
- 2019-12-02 JP JP2019218086A patent/JP7005580B2/en active Active
-
2020
- 2020-01-06 US US16/735,146 patent/US20200165587A1/en active Pending
-
2021
- 2021-05-23 AU AU2021203309A patent/AU2021203309B2/en active Active
-
2023
- 2023-10-31 AU AU2023258349A patent/AU2023258349A1/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011143124A2 (en) * | 2010-05-10 | 2011-11-17 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
WO2013176772A1 (en) * | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
WO2014152432A2 (en) * | 2013-03-15 | 2014-09-25 | The General Hospital Corporation | Rna-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
Non-Patent Citations (10)
Title |
---|
ALEXOPOULOU ET AL., BMC CELL BIOLOGY, vol. 9, 2008, pages 2 |
BUTLER; KADONAGA, GENES & DEV., vol. 16, 2002, pages 2583 - 2592 |
HAURWITZ, R.: "The CRISPR endoribonuclease Csy4 utilizes unusual sequenceand structure- specific mechanisms to recognize and process crRNAs", THESIS., 8 May 2012 (2012-05-08), UNIVERSITY OF CALIFORNIA, BERKELEY, pages 1 - 120, XP055293745, Retrieved from the Internet <URL:http://escholarship.org/uc/item/0rh5940p> * |
MIYAZAKI ET AL., GENE, vol. 79, no. 2, 1989, pages 269 - 77 |
NISSIM ET AL.: "Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells", MOLECULAR CELL, vol. 54, 22 May 2014 (2014-05-22), pages 698 - 710, XP029028594 * |
NIWA ET AL., GENE, vol. 108, no. 2, 1991, pages 193 - 9 |
RO ET AL., BIOTECHNIQUES, vol. 38, no. 4, 2005, pages 625 - 627 |
See also references of EP3090044A4 |
VENTURA ET AL., PROC NATL ACAD SCI U S A, vol. 101, 2004, pages 10380 - 10385 |
XU ET AL., GENE, vol. 272, no. 1-2, 11 July 2001 (2001-07-11), pages 149 - 56 |
Cited By (122)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
US11634731B2 (en) | 2013-03-15 | 2023-04-25 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US10544433B2 (en) | 2013-03-15 | 2020-01-28 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US10844403B2 (en) | 2013-03-15 | 2020-11-24 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
US12065668B2 (en) | 2013-03-15 | 2024-08-20 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US10138476B2 (en) | 2013-03-15 | 2018-11-27 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US9567603B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US9567604B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US11098326B2 (en) | 2013-03-15 | 2021-08-24 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
US10378027B2 (en) | 2013-03-15 | 2019-08-13 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US11920152B2 (en) | 2013-03-15 | 2024-03-05 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
US10526589B2 (en) | 2013-03-15 | 2020-01-07 | The General Hospital Corporation | Multiplex guide RNAs |
US11168338B2 (en) | 2013-03-15 | 2021-11-09 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US9885033B2 (en) | 2013-03-15 | 2018-02-06 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
US10760064B2 (en) | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
US10119133B2 (en) | 2013-03-15 | 2018-11-06 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US10415059B2 (en) | 2013-03-15 | 2019-09-17 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
US10011850B2 (en) | 2013-06-21 | 2018-07-03 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing |
US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
US9340800B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | Extended DNA-sensing GRNAS |
US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
US11390887B2 (en) | 2013-11-07 | 2022-07-19 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US10640788B2 (en) | 2013-11-07 | 2020-05-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAs |
US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
US11028388B2 (en) | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
US10253312B2 (en) | 2014-03-10 | 2019-04-09 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10) |
US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
US9938521B2 (en) | 2014-03-10 | 2018-04-10 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10) |
US11268086B2 (en) | 2014-03-10 | 2022-03-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10) |
US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
JP2016103986A (en) * | 2014-12-01 | 2016-06-09 | 国立大学法人 東京大学 | Method for manufacturing dna cassette in which a plurality of units are coupled in a multiple manner, and vector including the cassette |
US11180793B2 (en) | 2015-04-24 | 2021-11-23 | Editas Medicine, Inc. | Evaluation of Cas9 molecule/guide RNA molecule complexes |
CN105039309A (en) * | 2015-07-16 | 2015-11-11 | 深圳市盛捷生物技术有限公司 | Preparation method of gRNA (guide RNA) with 5' end not limited by bases |
US10093910B2 (en) | 2015-08-28 | 2018-10-09 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
EP4036236A1 (en) | 2015-08-28 | 2022-08-03 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US11060078B2 (en) | 2015-08-28 | 2021-07-13 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US10633642B2 (en) | 2015-08-28 | 2020-04-28 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US10526591B2 (en) | 2015-08-28 | 2020-01-07 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
WO2017040348A1 (en) | 2015-08-28 | 2017-03-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
WO2017083274A1 (en) * | 2015-11-09 | 2017-05-18 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Novel rna-based vector system for transient and stable gene expression |
WO2017083722A1 (en) * | 2015-11-11 | 2017-05-18 | Greenberg Kenneth P | Crispr compositions and methods of using the same for gene therapy |
JP2018537106A (en) * | 2015-12-18 | 2018-12-20 | ダニスコ・ユーエス・インク | Methods and compositions for polymerase II (Pol-II) based guide RNA expression |
AU2016370726B2 (en) * | 2015-12-18 | 2022-12-08 | Danisco Us Inc. | Methods and compositions for polymerase II (Pol-II) based guide RNA expression |
KR102698595B1 (en) | 2015-12-18 | 2024-08-23 | 다니스코 유에스 인크. | Methods and compositions for expression of guide RNA based on polymerase II (POL-II) |
KR20180086430A (en) * | 2015-12-18 | 2018-07-31 | 다니스코 유에스 인크. | Methods and compositions for the expression of guide RNA based on Polymerase II (POL-II) |
WO2017106414A1 (en) * | 2015-12-18 | 2017-06-22 | Danisco Us Inc. | Methods and compositions for polymerase ii (pol-ii) based guide rna expression |
WO2017158153A1 (en) | 2016-03-17 | 2017-09-21 | Imba - Institut Für Molekulare Biotechnologie Gmbh | Conditional crispr sgrna expression |
EP3219799A1 (en) | 2016-03-17 | 2017-09-20 | IMBA-Institut für Molekulare Biotechnologie GmbH | Conditional crispr sgrna expression |
US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
US11566263B2 (en) | 2016-08-02 | 2023-01-31 | Editas Medicine, Inc. | Compositions and methods for treating CEP290 associated disease |
US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
WO2018054911A1 (en) | 2016-09-23 | 2018-03-29 | Bayer Cropscience Nv | Targeted genome optimization in plants |
CN106520824A (en) * | 2016-09-30 | 2017-03-22 | 北京大北农科技集团股份有限公司 | Multi-target-point editing system and application thereof |
US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
WO2018071892A1 (en) | 2016-10-14 | 2018-04-19 | Joung J Keith | Epigenetically regulated site-specific nucleases |
US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
WO2018130830A1 (en) * | 2017-01-11 | 2018-07-19 | Oxford University Innovation Limited | Crispr rna |
US11466271B2 (en) | 2017-02-06 | 2022-10-11 | Novartis Ag | Compositions and methods for the treatment of hemoglobinopathies |
US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
WO2018218206A1 (en) | 2017-05-25 | 2018-11-29 | The General Hospital Corporation | Bipartite base editor (bbe) architectures and type-ii-c-cas9 zinc finger editing |
WO2018218166A1 (en) | 2017-05-25 | 2018-11-29 | The General Hospital Corporation | Using split deaminases to limit unwanted off-target base editor deamination |
US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
US11884947B2 (en) * | 2018-02-23 | 2024-01-30 | Shanghaitech University | Fusion proteins for base editing |
US20210163913A1 (en) * | 2018-02-23 | 2021-06-03 | Shanghaitech University | Fusion proteins for base editing |
EP3765612A4 (en) * | 2018-03-12 | 2022-01-05 | Nanjing Bioheng Biotech Co., Ltd | Engineered chimeric guide rna and uses thereof |
US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
CN108384784A (en) * | 2018-03-23 | 2018-08-10 | 广西医科大学 | A method of knocking out Endoglin genes using CRISPR/Cas9 technologies |
WO2019217146A1 (en) * | 2018-05-10 | 2019-11-14 | Syngenta Participations Ag | Methods and compositions for targeted editing of polynucleotides |
WO2020114893A1 (en) * | 2018-12-05 | 2020-06-11 | Dsm Ip Assets B.V. | Crispr guide-rna expression strategies for multiplex genome engineering |
WO2020163396A1 (en) | 2019-02-04 | 2020-08-13 | The General Hospital Corporation | Adenine dna base editor variants with reduced off-target rna editing |
US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
EP3889259A1 (en) | 2020-03-30 | 2021-10-06 | IMBA-Institut für Molekulare Biotechnologie GmbH | Internal standard for crispr guide rna |
WO2021198233A1 (en) | 2020-03-30 | 2021-10-07 | Imba - Institut Für Molekulare Biotechnologie Gmbh | Internal standard for crispr guide rna |
US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
US11643672B2 (en) * | 2021-10-01 | 2023-05-09 | The Florida International University Board Of Trusters | Inducible CRISPR system expression and applications thereof |
EP4198124A1 (en) | 2021-12-15 | 2023-06-21 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
Also Published As
Publication number | Publication date |
---|---|
AU2021203309A1 (en) | 2021-06-17 |
AU2023258349A1 (en) | 2023-11-23 |
CN106103706B (en) | 2021-08-24 |
JP7005580B2 (en) | 2022-01-21 |
CN113684205A (en) | 2021-11-23 |
AU2021203309B2 (en) | 2023-08-10 |
AU2014370416B2 (en) | 2021-03-11 |
JP2020062018A (en) | 2020-04-23 |
KR20160102056A (en) | 2016-08-26 |
US20200165587A1 (en) | 2020-05-28 |
CA2935032A1 (en) | 2015-07-02 |
JP6721508B2 (en) | 2020-07-15 |
EP3090044A4 (en) | 2017-07-05 |
EP3090044B1 (en) | 2021-11-03 |
CA2935032C (en) | 2024-01-23 |
EP3985124A1 (en) | 2022-04-20 |
JP2017505117A (en) | 2017-02-16 |
EP3090044A1 (en) | 2016-11-09 |
AU2014370416A1 (en) | 2016-07-07 |
CN106103706A (en) | 2016-11-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2021203309B2 (en) | Multiplex guide RNAs | |
US10526589B2 (en) | Multiplex guide RNAs | |
US12065668B2 (en) | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci | |
JP7100057B2 (en) | Systems and methods for genome editing | |
CN113015798B (en) | CRISPR-Cas12a enzymes and systems | |
CA3130135A1 (en) | Enzymes with ruvc domains | |
GB2617658A (en) | Class II, type V CRISPR systems | |
JP7138712B2 (en) | Systems and methods for genome editing | |
CN107922949A (en) | Compounds and methods for for the genome editor based on CRISPR/CAS by homologous recombination | |
CA3177828A1 (en) | Enzymes with ruvc domains | |
US20220298494A1 (en) | Enzymes with ruvc domains | |
JP7361109B2 (en) | Systems and methods for C2c1 nuclease-based genome editing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ENP | Entry into the national phase |
Ref document number: 2935032 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 15107550 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: 2016542968 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2014370416 Country of ref document: AU Date of ref document: 20140918 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 20167020111 Country of ref document: KR Kind code of ref document: A |
|
REEP | Request for entry into the european phase |
Ref document number: 2014875819 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2014875819 Country of ref document: EP |