WO2015095047A1 - Séquences et leur utilisation pour la détection des espèces du genre listeria - Google Patents

Séquences et leur utilisation pour la détection des espèces du genre listeria Download PDF

Info

Publication number
WO2015095047A1
WO2015095047A1 PCT/US2014/070345 US2014070345W WO2015095047A1 WO 2015095047 A1 WO2015095047 A1 WO 2015095047A1 US 2014070345 W US2014070345 W US 2014070345W WO 2015095047 A1 WO2015095047 A1 WO 2015095047A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
probe
primer
nucleic acid
quencher
Prior art date
Application number
PCT/US2014/070345
Other languages
English (en)
Inventor
Timothy DAMBAUGH
Stephen Varkey
Daniel R. Demarco
Mark A. Jensen
Original Assignee
E. I. Du Pont De Nemours
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by E. I. Du Pont De Nemours filed Critical E. I. Du Pont De Nemours
Publication of WO2015095047A1 publication Critical patent/WO2015095047A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the field of invention relates to methods for detection and
  • characterization of genus Listeria species based on the presence of nucleic acid sequences, preferably PCR-based methods for detection, and to oligonucleotide molecules and reagents and kits useful therefor.
  • Listeria monocytogenes has also been responsible for food-borne outbreaks linked to cantaloupes and other food items not typically associated with Listeria monocytogenes contamination. Listeriosis in the elderly and young can be very deadly with mortality rates of up to 40%. Pregnant women are also susceptible with the resulting infection causing miscarriage, stillbirth or disease of the fetus.
  • One aspect is for a method for detecting the presence of genus Listeria species in a sample, said sample comprising nucleic acids, said method comprising: (a) providing a reaction mixture comprising suitable primer pairs for amplification of at least a portion of the genes (for example, cspA or cspL) encoding Listeria cold shock proteins , (b) performing PGR amplification or other nucleic acid amplification procedures such as ligase chain reaction (LCR) (EP 0 320 308; Carrino et a!., J. Microbiol.
  • LCR ligase chain reaction
  • nucleic acid sequence-based amplification (NASBA) (Carrino et a/., 1995, supra); and self-sustained sequence replication (3SR) and "Q-Beta repiicase amplification" (Pfeffer et a!., Vet Res. Commun. 19:375-407 (1995)) of said nucleic acids of said sample using the reaction mixture of step (a); and (c) detecting the amplification of step (b), whereby a positive detection of amplification indicates the presence of genus Listeria species in the sample.
  • NASBA nucleic acid sequence-based amplification
  • 3SR self-sustained sequence replication
  • Q-Beta repiicase amplification "Q-Beta repiicase amplification”
  • a primer comprising a polynucleotide sequence having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequence set forth in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:1 1 , SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14.
  • a primer comprising a polynucleotide sequence having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequence set forth in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NQ:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:1 1 , SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14.
  • SEQ ID NO:15 SEQ ID NO: 16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NQ:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:30
  • a further aspect is for a probe and quencher pair comprising
  • polynucleotide sequences having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in SEQ ID NO:5 and SEQ ID NO:7;
  • a further aspect is for a Scorpion probe and quencher comprising polynucleotide sequences having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in Table 1 , below.
  • SEQ ID NO: 6 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 18 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and, SEQ ID NO: 18 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 21 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 20 is the quencher.
  • SEQ ID NO: 23 is a Scorpion probe composed of SEQ ID NO: 22 (probe) and SEQ ID NO: 16 (primer), where SEQ ID NO: 24 is the quencher.
  • SEQ ID NO: 26 is a
  • Scorpion probe composed of SEQ ID NO: 25 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 27 is the quencher.
  • SEQ ID NO: 29 is a
  • Scorpion probe composed of SEQ ID NO: 28 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 30 is the quencher,
  • a further aspect is for a probe and quencher pair comprising
  • polynucleotide sequences having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in SEQ ID NO:5 and SEQ ID NQ:7;
  • a further aspect is for a Scorpion probe and quencher comprising polynucleotide sequences having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in Table 1 , below.
  • SEQ ID NO: 8 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 18 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and, SEQ ID NO: 16 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 21 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 20 is the quencher.
  • SEQ ID NO: 23 is a Scorpion probe composed of SEQ ID NO: 22 (probe) and SEQ ID NO: 16 (primer), where SEQ ID NO: 24 is the quencher.
  • SEQ ID NO: 26 is a
  • Scorpion probe composed of SEQ ID NO: 25 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 27 is the quencher.
  • SEQ ID NO: 29 is a
  • Scorpion probe composed of SEQ ID NO: 28 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 30 is the quencher.
  • An additional aspect is for a genus Listeria species detection sequence comprising a polynucleotide sequence having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequence set forth in SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NQ:22, SEQ ID NO:24. SEQ ID NO:25, SEQ ID NO:27, SEQ ID NQ:28, or
  • a further aspect is for a genus Listeria species detection sequence
  • Scorpion probe and quencher comprising polynucleotide sequences having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in Table 1 , below, SEQ ID NO: 6 is a
  • SEQ ID NO: 21 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ
  • SEQ ID NO: 20 is the quencher
  • SEQ ID NO: 23 is a Scorpion probe composed of SEQ ID NO: 22 (probe) and SEQ ID NO: 16 (primer), where SEQ ID NO: 24 is the quencher
  • SEQ ID NO: 26 is a Scorpion probe composed of SEQ ID NO: 25 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 27 is the quencher
  • SEQ ID NO: 29 is a Scorpion probe composed of SEQ ID NO: 28
  • a genus Listeria species detection sequence comprising a polynucleotide sequence having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequence set forth in SEQ ID NO:5,SEQ ID NO:7, SEQ ID NO: 19, SEQ ID NO:20, SEQ
  • a further aspect is for a genus Listeria species detection sequence Scorpion probe and quencher comprising polynucleotide sequences having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in Table 1 , below.
  • SEQ ID NO: 8 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 18 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and, SEQ ID NO: 18 (primer), where SEQ ID NO: 7 is the quencher, SEQ ID NO: 21 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 20 is the quencher.
  • SEQ ID NO: 23 is a Scorpion probe composed of SEQ ID NO: 22 (probe) and SEQ ID NO: 18 (primer), where SEQ ID NO: 24 is the quencher.
  • SEQ ID NO: 28 is a Scorpion probe composed of SEQ ID NO: 25 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 27 is the quencher.
  • SEQ ID NO: 29 is a Scorpion probe composed of SEQ ID NO: 28 (probe) and SEQ !D NO: 4 (primer), where SEQ ID NO: 30 is the quencher.
  • a further aspect is for an isolated polynucleotide comprising a polynucleotide sequence having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequence set forth in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ !D NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ !D NO:9, SEQ ID NO:10, SEQ ID NO:1 1 , SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14.
  • a further aspect is for an isolated polynucleotide Scorpion probe and quencher comprising polynucleotide sequences having at least 90% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in Table 1 , below.
  • SEQ ID NO: 6 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 18 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and, SEQ ID NO: 18 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 21 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 20 is the quencher.
  • SEQ ID NO: 23 is a Scorpion probe composed of SEQ ID NO: 22 (probe) and
  • SEQ ID NO: 16 is the quencher.
  • SEQ ID NO: 26 is a Scorpion probe composed of SEQ ID NO: 25 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 27 is the quencher.
  • SEQ ID NO: 29 is a Scorpion probe composed of SEQ ID NO: 28 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 30 is the quencher.
  • a further aspect is for an isolated polynucleotide comprising a
  • polynucleotide sequence having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequence set forth in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:1 1 , SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14.
  • SEQ ID NO:15 SEQ ID NO: 16, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:20., SEQ ID NO:22, SEQ ID NO:24, SEQ !D NO:25, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:30.
  • a further aspect is for an isolated polynucleotide Scorpion probe and quencher comprising polynucleotide sequences having at least 95% sequence identity based on the BLASTN method of alignment to the polynucleotide sequences set forth in Table 1 , below.
  • SEQ ID NO: 6 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 18 is a Scorpion probe composed of SEQ ID NO: 5 (probe) and, SEQ ID NO: 16 (primer), where SEQ ID NO: 7 is the quencher.
  • SEQ ID NO: 21 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 20 is the quencher.
  • SEQ ID NO: 23 is a Scorpion probe composed of SEQ ID NO: 22 (probe) and SEQ ID NO: 16 (primer), where SEQ ID NO: 24 is the quencher.
  • SEQ ID NO: 26 is a Scorpion probe composed of SEQ ID NO: 25 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 27 is the quencher.
  • SEQ ID NO: 29 is a Scorpion probe composed of SEQ ID NO: 28 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 30 is the quencher.
  • Table 1 is a Scorpion probe composed of SEQ ID NO: 19 (probe) and SEQ ID NO: 4 (primer), where SEQ ID NO: 20 is the quencher.
  • SEQ ID NO: 23 is
  • Another aspect is for a replication composition for use in performance of PGR amplification or other nucleic acid amplification procedures such as ligase chain reaction (LCR) (EP 0 320 308; Carrino et a!., J. Microbiol.
  • LCR ligase chain reaction
  • nucleic acid sequence-based amplification (NASBA) (Carrino et al., 1995, supra); and self-sustained sequence replication (3SR) and !, Q-Beta replicase amplification" (Pfeffer et a/., Vet. Res. Commun, 19:375-407 (1995)), comprising: (a) a set of primer pairs selected from the group consisting of: one or more primer pairs comprising nucleic acid sequences comprising
  • VV SEQ ID N0:1 1 and SEQ ID NO:20
  • WW SEQ ID N0:1 1 and SEQ ID NO:24
  • KKK SEQ ID N0:17 and SEQ ID NQ:24
  • LLL SEQ ID NG:17 and SEQ ID NO:27
  • the at least one DNA polymerase can thermostable DNA polymerase.
  • kits for detection of genus Listeria species in a sample comprising the aforementioned replication composition, wherein the kit comprises the one or more primer pairs of (a)(i) and the Scorpion probe and quencher pair of
  • SEQ ID NO:1 is the target gene sequence for genus Listeria species, cspA gene. The following is the sequence listing for SEQ ID NO:1 1 gtcgacgctt ttctgaacaa aagtacctat cccggattac tcacgcttga tggtgccaaa
  • SEQ ID NO:2 is a primer sequence for detection of genus Listeria species
  • SEQ ID NO:3 is a primer sequence for enhanced detection of Listeria grayi.
  • SEQ ID NO:4 is a primer for detection of genus Listeria species.
  • SEQ ID NO:5 is a probe for use in the detection of genus Listeria species. In one embodiment, the probe is 5'-iabeied with a fluorescent dye. In some embodiments such as SEQ ID NO:8 or SEQ ID NO:18, the 3' terminus of SEQ ID NO:5 is attached to the 5' terminus of one of the primers listed above, for example SEQ ID NO:4 or SEQ ID NO: 16, respectively via a suitable linker moiety,
  • HEG hexethylene glycol
  • SEQ ID NO:7 is a blocking oligonucleotide (quencher) capable of
  • this blocking oligonucleotide is 3'-labeled with a fluorescent dye.
  • SEQ ID NO 8 is a primer for detection of genus Listeria species.
  • SEQ ID NO 9 is a primer for detection of genus Listeria species.
  • 3EG ID NO 10 is a primer for detection of genus Listeria species.
  • SEQ ID NO 1 1 is a primer for detection of genus Listeria species.
  • 3EG ID NO 12 is a primer for detection of genus Listeria species.
  • SEQ ID NO 13 is a primer for detection of genus Listeria species.
  • 3EG ID NO 14 is a primer for detection of genus Listeria species.
  • SEQ ID NO 15 is a primer for detection of genus Listeria species.
  • 3EEG ID NO 16 is a primer for detection of genus Listeria species.
  • SEQ ID NO 17 is a primer for detection of genus Listeria species.
  • 3EEG ID NO 19 is a probe for use in the detection of genus Listeria species, !n one embodiment, the probe is S'-iabeied with a fluorescent dye.
  • the 3' terminus of SEQ ID NO: 19 is attached to the 5' terminus of one of the primers listed above, for example SEQ !D NO:4 or SEQ ID NO: 16, respectively via a suitable linker moiety, such as a hexethylene glycol (HEG) spacer consisting of 6 ethylene glycol units (C 2 H 4 0)e, or a Spacer 9 (PEG); Internal Modification for Custom Oligos, or a Spacer 3 (C3); Internal Modification for Custom Oligos, or a Spacer 6 (C6); Internal Modification for Custom Oligos.
  • HOG hexethylene glycol
  • C3 Spacer 3
  • C6 Internal Modification for Custom Oligos
  • SEQ ID NO:20 is a blocking oligonucleotide (quencher) capable of hybridizing to the probe of SEQ ID NO: 19.
  • this blocking oligonucleotide is 3'-labeled with a fluorescent dye.
  • SEQ ID N0:22 is a probe for use in the detection of genus Listeria species.
  • the probe is S'-iabeied with a fluorescent dye.
  • the 3' terminus of SEQ ID N022 is attached to the 5' terminus of one of the primers listed above, for example SEQ ID NO:4 or SEQ ID NO: 16, respectively via a suitable linker moiety, such a hexethylene glycol (HEG) spacer consisting of 6 ethylene glycol units (C 2 H 4 Q) 6 , or a Spacer 9 (PEG); Internal Modification for Custom Oligos, or a Spacer 3 (C3); internal Modification for Custom Oligos, or a Spacer 8 (C6); Internal Modification for Custom Oligos.
  • HOG hexethylene glycol
  • C3 Spacer 3
  • C6 Internal Modification for Custom Oligos
  • Internal Modification for Custom Oligos Internal Modification for Custom Oligos.
  • SEQ ID NO:24 is a blocking oligonucleotide (quencher) capable of hybridizing to the probe of SEQ ID NO:22.
  • this blocking oligonucleotide is 3'-labeled with a fluorescent dye.
  • SEQ ID NO:25 is a probe for use in the detection of genus Listeria species.
  • the probe is 5'-labeied with a fluorescent dye.
  • the 3' terminus of SEQ ID NO:25 is attached to the 5' terminus of one of the primers listed above, for example SEQ ID NO:4 or SEQ ID NO: 16, respectively via a suitable linker moiety, such as such a hexethylene glycol (HEG) spacer consisting of 6 ethylene glycol units (C 2 H 4 0)6, or a Spacer 9 (PEG); Internal Modification for Custom Oligos, or a Spacer 3 (03); Internal Modification for Custom Oligos, or a Spacer 6 (C6); Internal Modification for Custom Oligos
  • HOG hexethylene glycol
  • PEG Spacer 9
  • SEQ ID NO:27 is a blocking oligonucleotide (quencher) capable of hybridizing to the probe of SEQ ID NO:25.
  • this blocking oligonucleotide is 3 ! -labeled with a fluorescent dye.
  • SEQ ID NO:28 is a probe for use in the detection of genus Listeria species.
  • the probe is S'-iabeied with a fluorescent dye.
  • SEQ ID NO:29 the 3' terminus of SEQ ID NO:28 is attached to the 5 !
  • SEQ ID NO:4 is a blocking oligonucleotide (quencher) capable of hybridizing to the probe of SEQ ID NO:28. In one embodiment, this blocking oligonucleotide is 3'-labeied with a fluorescent dye.
  • the term “about” or “approximately” means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.
  • Genus Listeria species cspA gene refers to the region(s) of the genome of various Listeria species that encode members of the family of cold shock proteins.
  • the gene sequence (cspA) for the cold shock protein A is used as an example herein but other genes (i.e. cspL) in the family of cold shock proteins might be similarly considered.
  • GenBank: X91789.1 SEQ ID NO: 1
  • GenBank: X91789.1 SEQ ID NO: 1
  • PGR Polymerase chain reaction
  • isolated refers to materials, such as nucleic acid molecules and/or proteins, which are substantially free or otherwise removed from components that normally accompany or interact with the materials in a naturally occurring environment. Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.
  • nucleotide oligonucleotide
  • polynucleotide polynucleotide
  • nucleotide sequence As used interchangeably herein. These terms encompass nucleotide sequences and the like.
  • a polynucleotide may be a polymer of RNA or DNA that is single- or double-stranded, that optionally contains synthetic, non-natural, or altered nucleotide bases.
  • a polynucleotide may also consist of nucleotide sequences joined at the 3' end of one nucleotide sequence to the 5' end of another nucleotide sequence by a linker such as a hexethyiene glycol (HEG) spacer consisting of 6 ethylene glycol units (C 2 H 4 0) 6 , or a Spacer 9 (PEG); Internal Modification for Custom Oligos, or a Spacer 3 (C3); Internal Modification for Custom Oligos, or a Spacer 6 (C6); Internal
  • HOG hexethyiene glycol
  • a polynucleotide in the form of a polymer of DNA may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
  • amplification product refers to nucleic acid fragments
  • the replication composition may comprise the components for nucleic acid replication, for example: nucleotide
  • the nucleic acid replication compositions may comprise, for example: a thermostable iigase (e.g., Thermus aquaticus Iigase), two sets of adjacent oligonucleotides (wherein one member of each set is complementary to each of the target strands), Tris ⁇ HCi buffer, KG, EDTA, NAD, dithiothreitoi, and salmon sperm DNA. See, e.g., Tabor et a/., Proc. Natl. Acad. Sci. U.S.A. 82:1074-78 (1985).
  • a thermostable iigase e.g., Thermus aquaticus Iigase
  • two sets of adjacent oligonucleotides wherein one member of each set is complementary to each of the target strands
  • Tris ⁇ HCi buffer KG, EDTA, NAD, dithiothreitoi
  • Tabor et a/., Proc. Natl. Aca
  • primer refers to an oligonucleotide (synthetic or occurring naturally) that is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase.
  • a primer can further contain a detectable label, for example a 5' end label.
  • probe refers to an oligonucleotide (synthetic or occurring naturally) that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
  • a probe or primer- probe complex can further contain a detectable label.
  • a probe can either be an independent entity or compiexed with or otherwise attached to a primer, such as where a probe is connected via its 3' terminus to a primer's 5' terminus through a linker, which may be a nucleotide or non-nucleotide linker and which may be a non-amplifiable linker, such as a hexethylene glycol (HEG) spacer consisting of 8 ethylene glycol units (C 2 H 4 Q)6, or a Spacer 9 (PEG); Internal Modification for Custom Oligos, or a Spacer 3 (C3); internal Modification for Custom Oligos, or a Spacer 6 (C6); internal Modification for Custom Oligos.
  • a linker which may be a nucleotide or non-nucleotide linker and which may be a non-amplifiable linker, such as a hexethylene glycol (HEG) spacer consisting of 8 ethylene glycol units (C 2 H 4 Q)6, or
  • primer-probe complex This would be termed a "primer-probe complex".
  • a primer-probe complex can be found in U.S. Patent No. 8,326,145, incorporated herein by reference in its entirety, which are frequently referred to as “Scorpion probes” or “Scorpion primers”.
  • a detectable label can also include a combination of a reporter and a quencher.
  • reporter refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher.
  • the detectable signal of the reporter is, e.g., fluorescence in the detectable range.
  • quencher refers to a substance or portion thereof which is capable of blocking, suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter.
  • the reporter may be selected from fluorescent organic dyes modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3' carbon or terminal 5 ! carbon.
  • the quencher may also be selected from organic dyes, which may or may not be fluorescent, depending on the embodiment of the present invention. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching.
  • Non-fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
  • reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Beriman, Handbook of Fluorescence Spectra of Aromatic
  • Preferred reporter-quencher pairs may be selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide.
  • Another preferred group of fluorescent compounds for use as reporters are the naphthyiamines, having an amino group in the alpha or beta position. Included among such
  • naphthyiamino compounds are 1 -dimethylaminonaphthyi-5 sulfonate, 1 - aniiino-8-naphthalene sulfonate and 2-p-touidinyl-6-naphthaiene sulfonate.
  • Other dyes include 3-phenyl-7-isocyanatocoumarin; acridines such as 9- isothiocyanatoacridine; N-(p-(2-benzoxazoiyl)phenyl)maieimide;
  • the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art.
  • Suitable examples of quenchers may be selected from 6-carboxy- tetramethyl-rhodamine, 4-(4-dimethylaminophenyiazo) benzoic acid (DABYL), tetramethylrhodamine (TAMRA), BHG-0TM, BHQ-1TM, BHG-2TM, and BHQ- 3TM, each of which are available from Biosearch Technologies, Inc. of Novate, Calif., QSY-7TM, G8Y-9TM, GSY-21TM and QSY-35TM, each of which are available from Molecular Probes, Inc., and the like.
  • DABYL 4-(4-dimethylaminophenyiazo) benzoic acid
  • TAMRA tetramethylrhodamine
  • Suitable examples of reporters may be selected from dyes such as SYBR green, 5-carboxyfluorescein (5-FAMTM available from Applied Biotech).
  • 6-carboxyfluorescein (6-FAM), tetrachloro- 6-carboxyf!uorescein (TET), 2,7-dimethoxy-4,5-dich!oro-6-carboxyf!uorescein, hexach!oro-6-carboxyfiuorescein (HEX), 6-carboxy-2',4,7,7'- tetrachlorof!uorescein (8-TETTM available from Applied Biosystems), carboxy-
  • ROX 6-carboxy-4',5'-dichIoro-2",7'-dimethoxyfluorescein
  • VICTM dye products available from Molecular Probes, Inc.
  • NEDTM dye products available from available from Applied Biosystems
  • Cai Fluor” 3 dye products such as, e.g., Cal Fluor ® Gold 540, Orange 580, Red 590, Red 810, Red 835) available from Biosearch
  • Quasar dye products such as, e.g., Quasar 570, 670, 705 available from Biosearch Technologies, and the like.
  • a probe which contains a reporter and a quencher is a Scorpion probe in either a unimoiecuiar or bimoiecular conformation.
  • a unimoiecuiar Scorpion the probe portion of the primer-probe complex is flanked by self-complementary regions which allow the probe to form into a stem-loop structure when the probe is unbound from its target DNA.
  • a reporter is typically attached at or near one of the self-complementary regions, such as at the 5' terminus of the Scorpion probe, and a quencher is attached at or near the other self-complementary region, such as immediately 5' to the non-amplifiable linker, such that the quencher is in sufficiently close proximity to the reporter to cause quenching when the probe is in its stem-loop conformation.
  • self-complementary flanking regions are not typically employed, but rather a separate "blocking oligonucleotide” is employed in conjunction with the Scorpion probe. This blocking oligonucleotide is capable of hybridizing to the probe region of the Scorpion probe when the probe is unbound from its target DNA.
  • An example of a bimolecular Scorpion pair is SEQ ID NO:6 (the)
  • Scorpion probe and SEQ ID NO:7 (the blocking oligonucleotide).
  • the reporter is typically attached to the probe region of the Scorpion probe, such as at the 5 ! terminus of the Scorpion probe, while the quencher is attached to the blocking oligonucleotide, such as at the 3' terminus of the blocking oligonucleotide, such that the quencher is in sufficiently close proximity to the reporter to cause quenching when the probe is unbound from its target DNA and is instead hybridized to the blocking oligonucleotide.
  • a probe which contains a reporter and a quencher is a probe that is to be used in a 5 ! -exonuclease assay, such as the Taqman ⁇ ' real-time PGR technique.
  • the oligonucleotide probe will have a sufficient number of phosphodiester linkages adjacent to its 5' end so that the 5' to 3' nuclease activity employed can efficiently degrade the bound probe to separate the reporters and quenchers.
  • a probe which contains a reporter and quencher is a Molecular Beacon type probe, which contains a probe region flanked by self-complementary regions that allow the probe to form a stem-loop structure when unbound from the probe's target sequence.
  • Such probes typically have a reporter attached at or near one terminus and a quencher attached at or near the other terminus such that the quencher is in sufficiently close proximity to the reporter to cause quenching when the probe is in its unbound, and thus stem-loop, form.
  • the term "replication inhibitor moiety” refers to any atom, molecule or chemical group that is attached to the 3' terminal hydroxy!
  • an oligonucleotide that will block the initiation of chain extension for replication of a nucleic acid strand.
  • examples include, but are not limited to: 3 1 - deoxynucleotides (e.g., cordycepin), dideoxynucleotides, phosphate, iigands (e.g., biofin and dinitrophenol), reporter molecules (e.g., fluorescein and rhodamine), carbon chains (e.g., propanol), a mismatched nucleotide or polynucleotide, or peptide nucleic acid units.
  • 3 1 - deoxynucleotides e.g., cordycepin
  • dideoxynucleotides phosphate
  • iigands e.g., biofin and dinitrophenol
  • reporter molecules e.g., fluorescein and rhodamine
  • carbon chains e.g., propanol
  • non-participatory refers to the lack of participation of a probe or primer in a reaction for the amplification of a nucleic acid molecule. Specifically a non-participatory probe or primer is one that will not serve as a substrate for, or be extended by, a DNA or RNA polymerase. A "non-participatory probe” is inherently incapable of being chain extended by a polymerase, !t may or may not have a replication inhibitor moiety.
  • a nucleic acid molecule is "hybridizabie" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and
  • Moderate stringency hybridization conditions correspond to a higher Tm, e.g., 40% formamide, with 5x or 6x SSC.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although, depending on the stringency of the hybridization, mismatches between bases are possibie.
  • the appropriate stringency for hybridizing nucieic acids depends on the iength of the nucleic acids and the degree of
  • the Iength for a hybridizable nucleic acid is at least about 10 nucleotides
  • a minimum Iength for a hybridizable nucleic acid is at least about 1 1 nucleotides, at least about 12 nucleotides, at least about 13 nucleotides, at least about 14 nucleotides, at least about 15 nucleotides, at least about 16 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 21 nucleotides, at least about 22 nucleotides,
  • Applicants have solved the stated problem through a method that uses a genus Listeria species detection assay developed based on identification of the cspA gene.
  • the assay incorporates unlabeled primers and Scorpion probes for detection of genus Listeria species (and, in some embodiments, an infernal positive control (e.g., sSV40)),
  • the assay also contains a passive reference for fluorescence signal normalization and offset wel!-to-we!l signal variation.
  • the presently disclosed detection assay has an analytical sensitivity at 10 4 cfu/mL or lower with genus Listeria species in liquid cultures.
  • Inclusivity testing with approximately 97 strains of Listeria monocytogenes, L. innocua, L ivanovii, L rnarthii, L. seeiigeri, L. weishirneri and L. grayi showed that all were detected at comparable cell densities.
  • the present disclosure therefore relates to detection and identification of genus Listeria through the detection of the cspA gene sequences.
  • the present detection method finds utility in detection of genus Listeria species in any type of sample, for example in appropriate samples for food testing, environmental testing, or human or animal diagnostic testing. While examples of suitable methods for detecting the cspA gene sequences are included herein, it is to be understood that the invention is not limited to the methods described. Rather any suitable method can be employed to detect the cspA gene sequences and subsequently genus Listeria species in a sample.
  • Scorpion primers are fluorogenic primer/probe oligonucleotide hybrids whose design is such that they emit light only when incorporated into the PGR product during amplification. These primers incorporate two distinct structures: 1 ) a target-specific PGR primer and 2) a target-specific DNA probe sequence Target-specific Primer
  • the target-specific PGR primer is covIERly linked to the 3' end of the DNA probe sequence through a blocking moiety such as an a hexethyiene glycol (HEG) spacer consisting of 8 ethylene glycol units C 2 H 4 Q 6 , or a Spacer 9 (PEG); Internal Modification for Custom Oligos, or a Spacer 3 (C3); Infernal Modification for Custom Oligos, or a Spacer 6 (C6); Intemal Modification for Custom Oligos.
  • HOG hexethyiene glycol
  • PEG hexethyiene glycol
  • Internal Modification for Custom Oligos or a Spacer 3 (C3)
  • Infernal Modification for Custom Oligos or a Spacer 6 (C6)
  • Intemal Modification for Custom Oligos This moiety prevents polymerase extension into the probe element.
  • the primer sequence anneals to a complimentary target DNA sequence and, by the action of a DNA polymerase in the presence of nucleotides,
  • the DNA probe sequence of the Scorpion probe is complementary to target gene sequences synthesized by polymerase extension from the 3' end of the target-specific primer incorporated into the Scorpion probe.
  • the fluorescence quenching can be accomplished through either a bimo!ecu!ar or unimo!ecuiar mechanism.
  • the quencher oligonucleotide is also complimentary to the DNA probe sequence.
  • a fluorophore molecule is covendedly linked to the 5' end of the DNA Probe sequence while a quencher moiety such as a BHG (Black Hole
  • Quencher dye, is covIERly linked to the 3' end of the quencher
  • oligonucleotide In a unimolecuiar mechanism the probe sequence is bracketed by two complementary sequences. A fluorophore molecule is covendedly linked to the 5 ! end of the DNA probe sequence and the quencher is located between the 3' end of the complementary sequence and the . When the probe is not hybridized to the target gene sequences synthesized by polymerase extension, these complementary sequences will hybridize with each other. This brings the fiuorophore and quencher into dose proximity and results in quenching of the fiuorophore.
  • Oligonucleotides of the instant invention may be used as primers for PCR amplification]. Preferred primer pairs and their corresponding targets, blocking oligonucleotides, and probes are shown in Table 2.
  • SEQ ID NO:1 1 SEQ ID NO:25 SEQ ID NQ:27 SEQ ID N0:16
  • Sco pion (KEG linker) - NO: 23 Scorpion 4 AGTGTACGAATACATCGTCTCCACCTTCAC
  • oligonucleotide primers may also be useful for other nucleic acid amplification methods such as the ligase chain reaction (LCR) (EP 0 320 308; Carrino et al., J. Microbiol. Methods 23:3-20 (1995)); nucleic acid sequence- based amplification (NASBA) (Carrino et al., 1995, supra); and self-sustained sequence replication (3SR) and "Q-Beta repiicase amplification" (Pfeffer et al., Vet. Res. Commun. 19:375-407 (1995)).
  • LCR ligase chain reaction
  • NASBA nucleic acid sequence- based amplification
  • 3SR self-sustained sequence replication
  • Q-Beta repiicase amplification Pfeffer et al., Vet. Res. Commun. 19:375-407 (1995)
  • the oligonucleotide primers of the present invention can also contain a detectable label, for example a 5' end label.
  • oligonucleotides of the present invention also may be used as hybridization probes. Hybridization using DNA probes has been frequently used for the detection of pathogens in food, clinical and environmental samples, and the methodologies are generally known to one skilled in the art. If is generally recognized that the degree of sensitivity and specificity of probe hybridization is lower than that achieved through the previously described amplification techniques.
  • the nucleic acid probes of the present invention can also possess a detectable label, such as a reporter-quencher combination as are employed in Scorpion probe assays or in 5'-exonuclease detection assays, such as the Taqman® assay.
  • the 3' terminal nucleotide of the nucleic acid probe may be rendered incapable of extension by a nucleic acid polymerase in one embodiment of the invention.
  • the DNA polymerase can be a thermostable DNA polymerase. Such blocking may be carried out, for example by the attachment of a replication inhibitor moiety, such as a reporter or quencher, to the terminal 3' carbon of the nucleic acid probe by a linking moiety, or by making the 3'- terminai nucleotide a dideoxynucleotide.
  • at least one DNA polymerase is used.
  • the 3' end of the nucleic acid probe may be rendered impervious to the 3' to 5' extension activity of a polymerase by incorporating one or more modified internucleotide linkages onto the 3' end of the oligonucleotide.
  • the 3' terminal internucleotide linkage must be modified, however, additional internucleotide linkages may be modified.
  • Internucleotide modifications which prevent elongation from the 3' end of the nucleic acid probe and/or which block the 3' to 5' exonuclease activity of the DNA polymerase during PGR may include phosphorothioate linkages, methylphosphonate linkages, boranophosphate linkages, and other similar polymerase-resistant internucleotide linkages.
  • An alternative method to block 3 ! extension of the probe is to form an adduct at the 3' end of the probe using mitomycin C or other like antitumor antibiotics such as described in Basu et al., Biochemistry 32:4708-18 (1993).
  • mitomycin C or other like antitumor antibiotics such as described in Basu et al., Biochemistry 32:4708-18 (1993).
  • a nucleic acid probe sequence can also optionally be employed with the primer sequence pairs of the present invention in an amplification based detection technique, such as in the 3 ! -exonuclease assay.
  • Preferred primer/probe combinations are indicated in Table 1 .
  • SEQ ID NO:8 is 5' end-labeled with a Quasar870 reporter and its corresponding quencher (SEQ ID NO:7) possesses a BHQ-2 label at or near the 3' end (e.g., attached to nucleotide 30).
  • SEQ ID NO: 18., SEQ ID NO:21 , SEQ ID NO:23, SEQ ID NO:28, and SEQ ID NO:29 are 5' end- labeled with a Quasar870 reporter and their respective quenchers (SEQ ID NO:7, SEQ ID NG:20, SEQ ID NO:24, SEQ ID NO:27, and SEQ ID NO:30, respectively, see Table 1 , above) possesses a BHQ-2 label at or near the 3' end. Other reporter moieties and corresponding quenchers may be substituted.
  • Some oligonucleotides of the present invention contain both primer and probe regions, and thus can be employed as a primer-probe complex in an appropriate assay, such as a Scorpion probe assay.
  • primer probe complexes of the instant invention contain a non-amplifiable linker that connects the 3' terminus of the probe region to the 5' terminus of the primer region. This non-amplifiable linker stops extension of a complementary strand from proceeding into the probe region of the primer-probe complex.
  • non-amplifiable linkages examples include hexethylene glycol (HEG) spacer consisting of 8 ethylene glycol units (C 2 H 4 0) 6 , or a Spacer 9 (PEG); Internal Modification for Custom Oiigos, or a Spacer 3 (C3); Internal Modification for Custom Oiigos, or a Spacer 6 (C6); Internal Modification for Custom Oiigos.
  • HOG hexethylene glycol
  • PEG hexethylene glycol
  • Internal Modification for Custom Oiigos or a Spacer 3 (C3)
  • Internal Modification for Custom Oiigos Primer- probe complexes of the present invention can also contain a self- complementary region that allows the primer-probe complex to form a stem- loop structure when the probe is unbound from its target DNA, which may be useful, for example, in bringing the reporter and quencher into sufficiently close proximity to one another to cause the reporter
  • Preferred methods are primer-directed amplification methods and nucleic acid hybridization methods. These methods may be used to detect genus Listeria species in a sample that is either a complex matrix or a purified culture, e.g., from an animal,
  • a preferred embodiment of the instant invention comprises (1 ) culturing a complex sample mixture in a non-selective or selective growth media to resuscitate the target bacteria, (2) releasing total target bacterial DNA, and (3) subjecting the total DNA to an amplification protocol with a primer pair of the invention and optionally with a nucleic acid probe comprising a detectable label.
  • primer-directed nucleic acid amplification methods are known in the art which can be employed in the present invention, including thermal cycling methods (e.g., PGR, RT-PCR, and LCR), as well as isothermal methods and strand displacement amplification (SDA).
  • PGR thermal cycling methods
  • SDA strand displacement amplification
  • oligonucleotides and methods according to the instant invention may be used directly with any suitable clinical or environmental samples, without any need for sample preparation. In order to achieve higher sensitivity, and in situations where time is not a limiting factor, it is preferred that the samples be pre-treated and that pre-ampiification enrichment is performed.
  • bacterial pathogens is a method that will reliably detect the presence of one pathogen cell in 25 g of food matrix as described in Andrews et a/., 1984, "Food Sample and Preparation of Sample Homogenate", Chapter 1 in Bacteriological Analytical Manual, 8th Edition, Revision A, U.S. Food and Drug Administration. (Although other test standards have been defined— e.g one organism in 375 g of food matrix, United States Department of
  • a sample of the complex mixtures is removed for further analysis. This sampling procedure may be accomplished by a variety of means well known to those skilled in the art. !n a preferred embodiment, 5 ⁇ of the enrichment culture is removed and added to 200 ⁇ of lysis solution containing protease and/or mutano!ysin. The lysis solution is heated at 55° C for 30 min followed by protease inactivation at 95° C for 10 min, and cooled to 4° C as described in the BAX ® System User's Guide, DuPont Nutrition and Health, Wilmington, DE.
  • species in a sample comprises (a) performing PCR amplification using primer pairs listed in Table 1 to produce a PCR amplification result; and (b) detecting the amplification, whereby a positive detection of the amplification indicates the presence of genus Listeria species in the sample.
  • a step of preparing the sample may be carried out.
  • the preparing step may comprise at least one of the following processes: (1 ) bacterial enrichment, (2) separation of bacterial ceils from the sample, (3) cell lysis, and (4) total DNA extraction.
  • PGR conditions may be used for successfully detecting genus Listeria species using the oligonucleotides of the instant invention, and depending on the sample to be tested and other laboratory conditions, routine optimization for the PGR conditions may be necessary to achieve optimal sensitivity and specificity. Optimally, they achieve PGR amplification results from all of the intended specific target species while giving no PGR results for other, non- target species.
  • Primer-directed amplification products can be analyzed using various methods.
  • Homogenous detection refers to a preferred method for the detection of amplification products where no separation (such as by gel electrophoresis) of amplification products from template or primers is necessary.
  • Homogeneous detection is typically accomplished by measuring the level of fluorescence of the reaction mixture during or immediately following amplification, !n addition, heterogeneous detection methods, which involve separation of amplification products during or prior to detection, can be employed in the present invention.
  • Homogenous detection may be employed to cany out "real-time"
  • primer-directed nucleic acid amplification and detection using primer pairs of the instant invention (e.g., "real-time” PCR and “real-time” RT-PCR).
  • the Scorpion probe assay PGR amplification is performed using a Scorpion probe (either unimoiecular or bimoiecular) as a primer-probe complex, the Scorpion probe possessing an appropriate reporter-quencher pair to allow the detectable signal of the reporter to be quenched prior to elongation of the primer. Post-elongation, the quenching effect is eliminated and the amount of signal present is quanfitated. As the amount of amplification product increases, an equivalent increase in detectable signal will be observed, thus allowing the amount of amplification product present to be determined as a function of the amount of detectable signal measured. When more than one Scorpion probe is employed in a Scorpion probe assay each probe can have a different detectable label (e.g., reporter-quencher pair) attached, thus allowing each probe to be detected independently of the other probes.
  • a Scorpion probe either unimoiecular or bimoiecular
  • Another preferred "real-time" detection method is the S'-exonuciease detection method, as set forth in U.S. Patent Nos. 5,804,375, 5,538,848, 5,487,972, and 5,210,015, each of which is hereby incorporated by reference in its entirety.
  • S'-exonuclease detection assay a modified probe is employed during PCR which binds intermediate to or between the two members of the amplification primer pair.
  • the modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal.
  • the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases. As quenching is strongly dependent on the physical proximity of the reporter and quencher, the reporter and the quencher are preferably attached to the probe within a few
  • nucleotides of one another usually within 30 nucleotides of one another, more preferably with a separation of from about 8 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter-quencher pair to the 5' end of the probe and the other member to a nucleotide about 6 to 18 nucleotides away.
  • each probe can have a different detectable label (e.g., reporter-quencher pair) attached, thus allowing each probe to be detected independently of the other probes.
  • detectable label e.g., reporter-quencher pair
  • Another preferred method of homogenous detection involves the use of DNA melting curve analysis, particularly with the BAX 3 ⁇ 4' System hardware and reagent tablets from DuPont Nutrition and Health. The details of the system are given in U.S. Patent No. 6,312,930 and PCT Publication Nos. VVO
  • dsDNA double stranded nucleic acid molecule
  • target ampiicon target amplification product
  • a typical PGR cycle involves a denaturing phase where the target dsDNA is melted, a primer annealing phase where the temperature optimal for the primers to bind to the now-single-stranded target, and a chain elongation phase (at a temperature Te) where the temperature is optimal for DNA polymerase to function.
  • Tms should be higher than Te, and Tme should be lower (often substantially lower) than the temperature at which the DNA polymerase is heat-inactivated. Melting characteristics are affected by the intrinsic properties of a given dsDNA molecule, such as
  • deoxynucleotide composition and the length of the dsDNA.
  • Intercalating dyes will bind to double stranded DNA.
  • the dye/dsDNA complex will fluoresce when exposed to the appropriate excitation wavelength of light, which is dye dependent, and the intensity of the fluorescence may be proportionate to concentration of the dsDNA.
  • Methods taking advantage of the use of DNA intercalating dyes to detect and quantify dsDNA are known in the art. Many dyes are known and used in the art for these purposes. The instant methods also take advantage of such relationship.
  • intercalating dyes include, but are not limited to, SYBR Green-P, ethidium bromide, propidium iodide, TOTO ⁇ -1 ⁇ Quinolinium, 1 -1 '-[1 ,3-propanediyibis [(dimethyliminio)-3, 1 -propanediyl]]bis[4-[(3-methyl-
  • the present invention could be operated using a combination of these techniques, such as by having a Scorpion probe directed to one target region and a Taqman ® probe directed to a second target region. It should also be understood that the invention is not limited to the above described techniques. Rather, one skilled in the art would recognize that other techniques for detecting amplification as known in the art may also be used. For example, techniques such as PCR-based quantitative sequence detection (QSD) may be performed using nucleic acid probes which, when present in the single-stranded state in solution, are configured such that the reporter and quencher are sufficiently close to substantially quench the reporter's emission.
  • QSD quantitative sequence detection
  • the reporter and quenchers become sufficiently distant from each other. As a result, the quenching is substantially abated causing an increase in the fluorescence emission detected.
  • heterogeneous detection methods are known in the art which can be employed in the present invention, including standard non-denaturing gel electrophoresis (e.g., acry!amide or agarose), denaturing gradient gel electrophoresis, and temperature gradient gel electrophoresis.
  • standard non-denaturing gel electrophoresis e.g., acry!amide or agarose
  • denaturing gradient gel electrophoresis e.g., acry!amide or agarose
  • temperature gradient gel electrophoresis e.g., acry!amide or agarose
  • Standard non- denaturing gel electrophoresis is a simple and quick method of PGR
  • DGGE Denaturing Gradient Gel Electrophoresis
  • DGGE is primarily used to separate DNA fragments of the same size based on their denaturing profiles and sequence.
  • two strands of a DNA molecule separate, or melt, when heat or a chemical denaturant is applied.
  • the denaturation of a DNA duplex is influenced by two factors: 1 ) the hydrogen bonds formed between complimentary base pairs (since GC rich regions melt at higher denaturing conditions than regions that are AT rich); and 2) the attraction between neighboring bases of the same strand, or "stacking". Consequently, a DNA molecule may have several melting domains with each of their individual characteristic denaturing conditions determined by their nucleotide sequence.
  • DGGE exploits the fact that otherwise identical DNA molecules having the same length and DNA sequence, with the exception of only one nucleotide within a specific denaturing domain, will denature at different temperatures or Tm.
  • Tm temperature
  • the double-stranded ids DNA fragment is e!ectrophoresed through a gradient of increasing chemical denaturant it begins to denature and undergoes both a conformational and mobility change.
  • the dsDNA fragment will travel faster than a denatured single-stranded (ss) DNA fragment, since the branched structure of the single-stranded moiety of the molecule becomes entangled in the gel matrix.
  • the electrophoresis is conducted at a constant temperature (around 80 °C) and chemical
  • denaturants are used at concentrations that will result in 100% of the DNA molecules being denatured (i.e., 40% formamide and 7 M urea).
  • This variable denaturing gradient is created using a gradient maker, such that the
  • composition of each DGGE gei gradually changes from 0% denaturant up to 100% denaturant.
  • gradients containing a reduced range of denaturant e.g., 35% to 80% may also be poured for increased separation of DNA.
  • DGGE Temperature Gradient Gel Electrophoresis
  • primer design can be used to advantage in increasing the usefulness of DGGE for characterization and identification of the PCR products.
  • the level of fluorescence is preferably measured using a laser fluorometer such as, for example, BAX ® System Q7 machine (DuPont Nutrition and Health, Wilmington, DE).
  • a laser fluorometer such as, for example, BAX ® System Q7 machine (DuPont Nutrition and Health, Wilmington, DE).
  • BAX ® System Q7 machine DuPont Nutrition and Health, Wilmington, DE.
  • similar detection systems for measuring the level of fluorescence in a sample are included in the invention.
  • a typical replication composition for PCR amplification may comprise, for example, dATP, dCTP, dGTP, dTTP, target specific primers and at least one suitable polymerase.
  • suitable buffers known in the art may be used (Sambrook, J. et a/., supra).
  • replication composition is contained in a tablet form
  • typical tablefization reagents may be included such as stabilizers and binding agents.
  • Preferred tabletization technology is set forth in U.S. Patent
  • a preferred replication composition of the instant invention comprises (a) the primer pair from Table 1 and (b) thermostable DNA polymerase.
  • the detectable label comprises a reporter capable of emitting a detectable signal and a quencher capable of substantially quenching the reporter and preventing the emission of the detectable signal when the reporter and quencher are in sufficiently close proximity to one another.
  • a preferred kit of the instant invention comprises any one of the above replication compositions.
  • a preferred tablet of the instant invention comprises any one of the above replication compositions. More preferably, a kit of the instant invention comprises the foregoing preferred tablet.
  • an internal positive control can be included in the reaction.
  • the internal positive control can include control template nucleic acids (e.g. DNA or RNA), control primers, and control nucleic acid probe.
  • control template nucleic acids e.g. DNA or RNA
  • control primers e.g. DNA or RNA
  • control nucleic acid probe e.g. DNA or RNA
  • the advantages of an internal positive control contained within a PCR reaction have been previously described (U.S. Patent No. 6,312,930 and PCT
  • control may be amplified using a single primer; (ii) the amount of the control amplification product is independent of any target DNA or RNA contained in the sample: (iii) the control DNA can be tableted with other amplification reagents for ease of use and high degree of reproducibility in both manual and automated test procedures; (iv) the control can be used with homogeneous detection, i.e., without separation of product DNA from reactants; and (v) the internal control has a melting profile that is distinct from other potential amplification products in the reaction and/or a detectable label on the control nucleic acid that is distinct from the detectable label on the nucleic acid probe directed to the target.
  • Control DNA will be of appropriate size and base composition to permit amplification in a primer-directed amplification reaction.
  • the control template DNA sequence may be obtained from the genome of a genus Listeria species or from another source, but must be reproducibly amplified under the same conditions that permit the amplification of the target amplification product.
  • Preferred control sequences include, for example, those found in SV40.
  • SEQ ID NO: 31 is an example of a truncated SV40 sequence used herein.
  • the preferred concentration range of SV40, when used, is 10 1 to 10 7 copies per PGR reaction.
  • control reaction is useful to validate the amplification reaction.
  • Amplification of the control DNA occurs within the same reaction tube as the sample that is being tested, and therefore indicates a successful amplification reaction when samples are target negative, i.e. no target amplification product is produced.
  • a suitable number of copies of the control DNA template must be included in each amplification reaction.
  • the negative control replication composition will contain the same reagents as the replication composition but without the polymerase. The primary function of such a control is to monitor spurious background fluorescence in a homogeneous format when the method employs a fluorescent means of detection.
  • Replication compositions may be modified depending on whether they are designed to be used to amplify target DNA or the control DNA.
  • Replication compositions that will amplify the target DNA may include (i) a polymerase (generally thermostable), (ii) a primer pair capable of hybridizing to the target DNA and (iii) necessary buffers for the amplification reaction to proceed.
  • Replication compositions that will amplify the control DNA may include (i) a polymerase (generally thermostable) (ii) the control DNA; (iii) at least one primer capable of hybridizing to the control DNA; and (iv) necessary buffers for the amplification reaction to proceed.
  • the replication composition for either target DNA or control DNA amplification can contain a nucleic acid probe, preferably possessing a detectable label.
  • nucleic acid hybridization assay methods can be employed in the present invention for detection of genus Listeria species.
  • the basic components of a nucleic acid hybridization test include probe(s), a sample suspected of containing genus Listeria species, and a specific hybridization method.
  • the probe(s) length can vary from as few as five bases to the full length of the genus Listeria species diagnostic sequence and will depend upon the specific test to be done. Only part of the probe molecule need be complementary to the nucleic acid sequence to be detected. In addition, the complementarity between the probe(s) and the target sequence(s) need not be perfect. Hybridization does occur between imperfectly complementary molecules with the result that a certain fraction of the bases in the hybridized region(s) are not paired with the proper complementary base.
  • Probes particularly useful in nucleic acid hybridization methods are any of SEQ ID Nos: 2, 3, 4, 5, 7, 8, 9, 10, 1 1 12, 13, 14, 15, 18, 17, 19, 20, 22,
  • the sample may or may not contain genus Listeria species.
  • sample may take a variety of forms, however will generally be extracted from an animal, environmental or food source suspected of contamination.
  • the DNA may be detected directly but most preferably, the sample nucleic acid must be made available to contact the probe before any hybridization of probe(s) and target mo!ecule(s) can occur.
  • the organism's DNA is preferably free from the ceil and placed under the proper conditions before hybridization can occur. Methods of in-soiution hybridization necessitate the purification of the DNA in order to be able to obtain hybridization of the sample
  • DNA with the probe(s) This has meant that utilization of the in-solution method for detection of target sequences in a sample requires that the nucleic acids of the sample must first be purified to eliminate protein, lipids, and other cell components, and then contacted with the probe(s) under hybridization conditions. Methods for the purification of the sample nucleic acid are common and well known in the art (Sambrook et a/., supra).
  • hybridization assays may be conducted directly on cell iysates, without the need to extract the nucleic acids. This eliminates several steps from the sample-handling process and speeds up the assay.
  • a chaotropic agent is typically added to the ceil iysates prepared as described above. The chaotropic agent stabilizes nucleic acids by inhibiting nuclease activity.
  • the chaotropic agent allows sensitive and stringent hybridization of short oligonucleotide probes to DNA at room temperature (Van Ness & Chen, Nucleic Acids Res. 19:5143-51 (1991 )).
  • Suitable chaotropic agents include guanidinium chloride, guanidinium thiocyanate, sodium ihiocyanaie, lithium tetrachloroaceiate, sodium perchlorate, rubidium tetrachloroacetate, potassium iodide, and cesium trifluoroacetate, among others.
  • the chaotropic agent will be present at a final concentration of about 3 M. If desired, one can add formamide to the hybridization mixture, typically 30-50% (v/v).
  • a variety of methods are known to one of skill in the art (e.g., phenol-chloroform extraction, IsoQuick extraction (MicroProbe Corp., Bofhell, WA), and others).
  • Pre-hybridization purification is particularly useful for standard filter hybridization assays.
  • purification facilitates measures to increase the assay sensitivity by incorporating in vitro RNA amplification methods such as self-sustained sequence replication (see for example Fahy ef a/,, in PGR Methods and Applications, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1991 ), pp. 25-33) or reverse
  • Hybridization methods are well known in the art. Typically the probe and sample must be mixed under conditions which will permit nucleic acid hybridization. This involves contacting the probe and sample in the presence of an inorganic or organic salt under the proper concentration and
  • hybridization solutions can be employed. Typically, these comprise from about 20 to 60% volume, preferably 30%, of a polar organic solvent.
  • a common hybridization solution employs about 30-50% v/v formamide, about 0.15 to 1 M sodium chloride, about 0.05 to 0.1 M buffers, such as sodium citrate, Tris-HCi, PIPES or HEPES (pH range about 6-9), about 0.05 to 0.2% detergent, such as sodium dodecylsulfate, or between 0.5- 20 mM EDTA, FICOLL (Pharmacia Inc.) (about 300-500 kilodaltons), polyvinylpyrrolidone (about 250-500 kdal), and serum albumin. Also included in the typical hybridization solution will be unlabeled carrier nucleic acids from about 0.1 to 5 mg/mL.
  • fragmented nucleic DNA e.g., calf thymus or salmon sperm DNA, or yeast RNA
  • additives may also be included, such as volume exclusion agents which include a variety of polar water-soluble or swellable agents (e.g., polyethylene glycol), anionic polymers (e.g., poiyacryiate or
  • polymethylacrylate polymethylacrylate
  • anionic saccharidic polymers e.g., dextran sulfate
  • Nucleic acid hybridization is adaptable to a variety of assay formats.
  • sandwich assay format One of the most suitable is the sandwich assay format.
  • the sandwich assay is particularly adaptable to hybridization under non-denaturing conditions.
  • a primary component of a sandwich-type assay is a solid support.
  • the solid support has adsorbed to it or covalently coupled to it immobilized nucleic acid probe that is unlabeled and complementary to one portion of the DNA sequence.
  • the sandwich assay may be encompassed in an assay kit.
  • This kit would include a first component for the collection of samples suspected of contamination and buffers for the disbursement and lysis of the sample.
  • a second component would include media in either dry or liquid form for the hybridization of target and probe polynucleotides, as well as for the removal of undesirable and nondupiexed forms by washing.
  • a third component includes a solid support (dipstick) upon which is fixed (or to which is conjugated) unlabeled nucleic acid probe(s) that is (are) complementary to one or more of the sequences disclosed herein.
  • a fourth component would contain labeled probe that is complementary to a second and different region of the same DNA strand to which the immobilized, unlabeled nucleic acid probe of the third component is hybridized.
  • polynucleotide sequences disclosed herein or derivations thereof may be used as 3' blocked detection probes in either a homogeneous or heterogeneous assay format.
  • a probe generated from these sequences may be 3' blocked or non-participatory and will not be extended by, or participate in, a nucleic acid amplification reaction.
  • the probe incorporates a label that can serve as a reactive ligand that acts as a point of attachment for the immobilization of the probe/analyte hybrid or as a reporter to produce detectable signal.
  • genomic or cDNA isolated from a sample suspected of genus Listeria species may be used as 3' blocked detection probes in either a homogeneous or heterogeneous assay format.
  • a probe generated from these sequences may be 3' blocked or non-participatory and will not be extended by, or participate in, a nucleic acid amplification reaction.
  • the probe incorporates a label that can serve as a reactive ligand that acts as
  • the contamination is amplified by standard primer-directed amplification protocols in the presence of an excess of the 3' blocked detection probe(s) to produce amplification products. Because the probe(s) is 3 ! blocked, it does not participate or interfere with the amplification of the target. After the final amplification cycle, the detection probe(s) anneals to the relevant portion of the amplified DNA and the annealed complex is then captured on a support through the reactive ligand.
  • a ligand labeled dNTP with the label probe in the replication composition to facilitate immobilization of the PCR reaction product on a support and then detection of the immobilized product by means of the labeled probe reagent.
  • a biotin, digoxigenin, or digoxin labeled dNTP could be added to PCR reaction composition.
  • the biotin, digoxigenin, or digoxin incorporated in the PCR product could then be immobilized respectively on to a strepavidin, anti- dixogin or antidigoxigenin antibody support.
  • the immobilized PCR product could then be detected by the presence of the probe label.
  • Probe and quencher concentrations were also titrated from 25 nM to 400 nM for the probe, and 50 nM to 800 nM for the quencher. Based on the probe titration results, 200 nM probe with 400 nM quencher showed the best PCR and Scorpion performance in terms of cleavage kinetics and lower Ct values. Under the same condition, the genus Listeria assay was able to detect 10 4 cfu/rriL of for i, grayi, L. innocua, L, ivanovii, L. marihii, L
  • a total of 97 strains of genus Listeria species from the internal DuPont Nutrition & Health culture collection (designated as "DD") were grown in Brain- Heart Infusion Broth (BHI) overnight at 37°C. Cells were iysed using the standard BAX lysis protocol, and tested without dilution by the real-time multiplex genus Listeria species detection assay. All showed positive signals (Table 4). Among them, 53 strains (#23 to #75 listed in Table 4) were further diluted to approximately 10 4 cfu/mL and tested by the multiplexing assay. All strains were tested positive.
  • the assay showed a sensitivity of about 10 4 cfu/mL for each Listeria species enrichment iysate. No cross-reaction to the background microflora was found as all blank food enrichment lysates were tested negative by the assay.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé rapide et précis pour la détection et la caractérisation des espèces du genre Listeria basé sur la présence de séquences d'acide nucléique, en particulier, un procédé de détection à base de PCR, et des molécules d'oligonucléotides et des réactifs et des kits utiles pour ceux-ci. Ce procédé est de préférence utilisé pour détecter Listeria grayi, L. innocua, L ivanovii, L. marthii, L.monocytogenes, L. seeligeri or L. welshimeri dans des échantillons alimentaires et environnementaux. La présente invention concerne en outre des compositions et des kits de réplication pour conduire le procédé de la présente invention.
PCT/US2014/070345 2013-12-16 2014-12-15 Séquences et leur utilisation pour la détection des espèces du genre listeria WO2015095047A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361916565P 2013-12-16 2013-12-16
US61/916,565 2013-12-16

Publications (1)

Publication Number Publication Date
WO2015095047A1 true WO2015095047A1 (fr) 2015-06-25

Family

ID=52293237

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/070345 WO2015095047A1 (fr) 2013-12-16 2014-12-15 Séquences et leur utilisation pour la détection des espèces du genre listeria

Country Status (1)

Country Link
WO (1) WO2015095047A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018183865A1 (fr) * 2017-03-31 2018-10-04 Conagra Foods Rdm, Inc. Compositions d'amorces et procédés multiplex destinés à détecter la présence de listeria

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998003678A1 (fr) * 1996-07-24 1998-01-29 Biotec Laboratories Limited Detection du bacille psychrotrophe
GB2338301A (en) * 1998-06-13 1999-12-15 Zeneca Ltd Detection of target nucleic acid sequences and primers for use therein
WO2004092406A1 (fr) * 2003-04-18 2004-10-28 Warnex Research Inc. Polynucleotides pour la detection de listeria monocytogenes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998003678A1 (fr) * 1996-07-24 1998-01-29 Biotec Laboratories Limited Detection du bacille psychrotrophe
GB2338301A (en) * 1998-06-13 1999-12-15 Zeneca Ltd Detection of target nucleic acid sequences and primers for use therein
WO2004092406A1 (fr) * 2003-04-18 2004-10-28 Warnex Research Inc. Polynucleotides pour la detection de listeria monocytogenes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BUBERT A ET AL: "THE HOMOLOGOUS AND HETEROLOGOUS REGIONS WITHIN THE IAP GENE ALLOW GENUS- AND SPECIES-SPECIFIC IDENTIFICATION OF LISTERIA SPP. BY POLYMERASE CHAIN REACTION", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 58, no. 8, 1 August 1992 (1992-08-01), pages 2625 - 2632, XP001010399, ISSN: 0099-2240 *
K P FRANCIS ET AL: "Detection and speciation of bacteria through PCR using universal major cold-shock protein primer oligomers", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY, vol. 19, no. 4, 1 October 1997 (1997-10-01), pages 286 - 293, XP055006610, ISSN: 1367-5435, DOI: 10.1038/sj.jim.2900463 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018183865A1 (fr) * 2017-03-31 2018-10-04 Conagra Foods Rdm, Inc. Compositions d'amorces et procédés multiplex destinés à détecter la présence de listeria

Similar Documents

Publication Publication Date Title
AU2010276352B2 (en) Sequences and their use for detection and characterization of E. coli O157:H7
US9528162B2 (en) Sequences and their use for detection and characterization of STEC bacteria
EP2588628A1 (fr) Détection d'espèces listeria dans des échantillons alimentaires et environnementaux et procédés et compositions afférents
WO2014173963A1 (fr) Procédé d'amplification d'adn fondée sur l'invasion de brins
WO2011015356A1 (fr) Acides nucléiques et procédés pour la détection d'enterobacter sakazakii (cronobacter spp.)
EP3169802B1 (fr) Séquences et leur utilisation pour la détection de listeria monocytogenes
WO2015095047A1 (fr) Séquences et leur utilisation pour la détection des espèces du genre listeria
WO2020205491A1 (fr) Séquences et leur utilisation pour la détection et la caractérisation du genre cronobacter
WO2015026757A2 (fr) Séquences et leur utilisation pour la détection de salmonella enteritidis et/ou salmonella typhimurium
EP2959012B1 (fr) Séquences et leur utilisation en vue de la détection et de la caractérisation du sérotype o157:h7 d'e. coli
JP4766878B2 (ja) ハイブリダイゼーションアッセイを使用する真正細菌群の検出、同定および識別
WO2020051301A1 (fr) Séquences et leur utilisation pour la détection et la caractérisation de e. coli o157:h7
JP5873356B2 (ja) モニリエラ属真菌の検出方法
Ibekwe Burns (45) Date of Patent: Sep. 30, 2014

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14824675

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14824675

Country of ref document: EP

Kind code of ref document: A1