WO2015083731A1 - Nucleic acid aptamer for microvesicle - Google Patents

Abstract

Provided is a nucleic acid aptamer exhibiting binding capacity with respect to a microvesicle. Also provided are: a microvesicle detection/isolation method using said aptamer exhibiting binding capacity with respect to the microvesicle; and a drug delivery system. This nucleic acid aptamer includes: 5'-X₁-M_s-X₂-3' (M_s represents a base sequence which is at least 80% identical to YRCGGNGGWGTWGGGGR (SED IQ NO: 209)), and X₁ and X₂ bind complementarily to form stems of 0-50 base pairs); or 5'-X₃-(N)_m-M_k-(N)_n-X₄-3' (M_k represents a base sequence which is at least 80% identical to either RRRDDRNDRGRKW (SED ID NO: 208) or RVDDGGGHTCTAC (SEQ ID NO: 211), m and n each represent an integer from 0 to 20, and X₃ and X₄ bind complementarily to form stems of 0-50 base pairs).

Description

Nucleic acid aptamers for microvesicles

The present invention relates to a nucleic acid aptamer having an ability to bind to microvesicles. In particular, the present invention provides a method for detecting a microvesicle using a nucleic acid aptamer capable of binding to a microvesicle, a method for isolating a microvesicle, and a nucleic acid aptamer capable of binding to a microvesicle. Containing drug delivery system.

Microvesicles are vesicles having a diameter of about 10 nm to about 1000 nm that are secreted from cells. Among them, exosomes have a diameter of about 30 to 100 nm and are derived from endosomes. The exosome is composed of a lipid membrane containing a large amount of ceramide and has a very hard structure. Exosomes are produced in multivesicular endosomes and secreted out of the cell by fusing with the plasma membrane. Therefore, an endosome specific marker such as CD63 is included on the membrane.

Microvesicles typified by exosomes are secreted from various cells and are observed in body fluids such as blood, urine and saliva. In recent years, it has been reported that various biomolecules such as mRNA, microRNA, DNA, and protein derived from cells that secrete microvesicles are contained in microvesicles, and microvesicles are important for communication between cells. The possibility of playing a role is pointed out. For this reason, research is being actively conducted to isolate microvesicles from body fluids and analyze biomolecular information contained in the microvesicles, thereby applying them to disease diagnosis.

For example, an ultracentrifugation method is known as a conventional method for detecting and isolating microvesicles. However, when microvesicles are separated by the ultracentrifugation method, it is necessary to prepare a large amount of samples containing microvesicles, and thus there is a problem that time and labor are required. Moreover, equipment for carrying out ultracentrifugation is required, which is costly. As a conventional method for detecting and isolating exosomes, a method using an antibody that recognizes an antigen specific to exosomes is known. However, there is a problem that antigens specific to exosome are limited such as CD63, and it takes a lot of time and money to produce antibodies.

In recent years, drug delivery systems that control the distribution of drugs in the body quantitatively, spatially, and temporally, act only on tissues and cells to be treated, and maximize the effects of the drug ( Drug delivery systems (DDS) are being researched. As a conventional drug delivery system, for example, a method using a liposome (Non-Patent Document 1), a method using nanoparticles (Non-Patent Document 2), and the like are known. However, in these approaches, the drug is mainly delivered to the liver and difficult to deliver to the target tissue of interest. Furthermore, since artificial lipids are used, cytotoxicity becomes a problem.

On the other hand, microvesicles are membrane vesicles that have a stable structure and are not cytotoxic because they are composed of biological materials, and are suitable for drug delivery systems. Therefore, if a drug can be bound to the microvesicle, it is considered that the drug can be delivered to a target target tissue, a disease site, a cancer tumor, or the like (Non-Patent Document 3). There are expectations for the development of drug delivery systems.

The present invention has been made to solve such problems of the prior art, has an excellent binding ability to microvesicles, has high stability, and has processability for various applications. The object is to provide an excellent nucleic acid aptamer.

As a result of intensive studies, the present inventors have succeeded in obtaining a nucleic acid aptamer having a binding ability to microvesicles.

That is, according to one embodiment of the present invention, the base sequence: 5′-X ₁ -M _s -X ₂ -3 ′ (where M _s is 80% or more identical to YRCGGHGWRWGGGGRN (SEQ ID NO: 207)). Y is C or T or U, R is independently A or G, H is A, C or T or U, and W is independent A, T, or U, K is G, T, or U, N is each independently A, C, G, T, or U, and X ₁ and X ₂ are each 0 to Providing a nucleic acid aptamer having the ability to bind to microvesicles, comprising 50 nucleotides, and X ₁ and X ₂ bind complementarily to form a 0-50 base pair stem) It is.

The M _s is preferably a base sequence having 90% or more identity with SEQ ID NO: 207.

The M _s is preferably a base sequence represented by SEQ ID NO: 207.

According to one embodiment of the present invention, the base sequence: 5′-X _3- (N) _m -M _k- (N) _n -X ₄ -3 ′ (where M _k is RRRDDRNDRGRKW ( SEQ ID NO: 208) or RVDDGGGHTCTAC (SEQ ID NO: 211), a base sequence having 80% or more identity, R is independently A or G, and D is independently A, G or T Or U, N is A, C, G or T or U, K is G or T or U, W is A or T or U, and V is A, C or G H is A, C or T or U, m is any integer from 0 to 20, n is any integer from 0 to 20, X ₃ and X _4, each from 0 to 50 nucleotides And, and, X ₃ and X ₄ includes a stem to form) 0-50 base pairs complementarily bound, there is provided a nucleic acid aptamer capable of binding to the microvesicle.

The _Mk is preferably a nucleotide sequence having 90% or more identity with SEQ ID NO: 208 or SEQ ID NO: 211.

The M _k is preferably a base sequence represented by SEQ ID NO: 208 or SEQ ID NO: 211.

The stem can contain mismatches or bulges.

The M _s or the M _k preferably forms a G quartet structure.

Further, according to one embodiment of the present invention, (a) a base sequence selected from the group consisting of SEQ ID NOs: 107 to 206, or (b) a base sequence selected from the group consisting of SEQ ID NOs: 107 to 206 The present invention provides a nucleic acid aptamer having binding ability to a base sequence or microvesicle in which 1 to 5 bases are substituted, deleted, inserted or added.

The nucleic acid aptamer is preferably modified at the 3 'and / or 5' end.

The micro vesicle preferably has a diameter of 10 to 200 nm.

The microvesicle is preferably an exosome.

According to another embodiment, the present invention provides a method for detecting a microvesicle using the nucleic acid aptamer, a method for isolating the microvesicle, and a drug delivery system including the nucleic acid aptamer. is there.

The nucleic acid aptamer capable of binding to the microvesicle according to the present invention has a binding ability equal to or higher than that of the existing anti-microvesicle antibody, and can be used as a substitute for the existing anti-microvesicle antibody. It is. In addition, since nucleic acid is used as a raw material, (1) chemical synthesis is easy and a large amount can be prepared at low cost, (2) aptamer itself has low antigenicity and high safety, (3) It is superior to antibodies in that it is highly stable and can be stored for a long period of time, and (4) it is easy to further improve aptamers by using modified nucleic acids. Furthermore, in the case of a nucleic acid aptamer, it is possible to prepare a nucleic acid aptamer having a binding ability superior to that of an existing anti-microvesicle antibody because it can be prepared by targeting an epitope with low antigenicity that cannot produce an antibody. .

Also, the nucleic acid aptamer having binding ability to the microvesicle according to the present invention can be used for detection and isolation of microvesicles and drug delivery systems. In addition, the nucleic acid aptamer having binding ability to the microvesicle according to the present invention can be used as a blocking agent when further screening is performed for a novel nucleic acid aptamer having binding ability to the microvesicle.

It is a figure which shows the result of having searched the preserve | saved motif arrangement | sequence about the aptamer selected by SELEX method by MEME Suite. FIG. 4 shows sequence alignment of aptamers enriched from S pool. FIG. 4 shows sequence alignment of aptamers enriched from K pool. It is a figure which shows the result of having predicted the secondary structure about the aptamer of sequence number 114. It is a figure which shows the result of having predicted secondary structure about the aptamer of sequence number 159. FIG. It is a figure which shows the result of the filter binding assay which confirmed the coupling | bonding of S motif aptamer or K motif aptamer, and a micro vesicle. It is a figure which shows the result of the dot blot which evaluated the binding ability with respect to the micro vesicle of S motif aptamer. It is a sensorgram which shows the coupling | bonding of the S motif aptamer and the microvesicle derived from 293T cell. It is a sensorgram which shows the coupling | bonding of the S motif aptamer and the micro vesicle derived from HeLa S3 cell. It is a sensorgram which shows the coupling | bonding of a K motif aptamer and the microvesicle derived from 293T cell. It is a sensorgram which shows the coupling | bonding of K motif aptamer and the micro vesicle derived from HeLa S3 cell. It is a CD spectrum of an S motif aptamer when various amounts of potassium chloride are added to a tris / sodium / calcium / magnesium buffer. It is a CD spectrum of a K motif aptamer when various amounts of potassium chloride are added to a tris / sodium / calcium / magnesium buffer. It is a CD spectrum of an S motif aptamer when various amounts of potassium chloride are added to Tris buffer. It is a CD spectrum of a K motif aptamer when various amounts of potassium chloride are added to a tris buffer. It is a figure which shows the result of the melting temperature measurement test of S motif aptamer in a tris / sodium / calcium / magnesium / potassium buffer. It is a figure which shows the result of the melting temperature measurement test of a K motif aptamer in a tris / sodium / calcium / magnesium / potassium buffer. It is a figure which shows the result of the melting temperature measurement test of S motif aptamer in a tris / potassium buffer. It is a figure which shows the result of the melting temperature measurement test of a K motif aptamer in a tris / potassium buffer. It is the figure which confirmed the influence of the potassium ion with respect to the binding ability of an S motif aptamer or a K motif aptamer, and the microvesicle derived from 293T cell. It is a prediction figure of the three-dimensional structure of the nucleic acid aptamer which has a binding ability with respect to a micro vesicle.

Hereinafter, the present invention will be described in detail, but the present invention is not limited to the embodiments described in the present specification.

According to the first aspect, the present invention is a nucleic acid aptamer having binding ability to microvesicles. Hereinafter, in the present specification, a nucleic acid aptamer capable of binding to a microvesicle is referred to as a “microvesicle-binding nucleic acid aptamer”.

“Nucleic acid aptamer” means an oligonucleic acid that can specifically bind to a target molecule with high affinity. The length of the oligonucleic acid is not particularly limited, but is preferably 10 to 200 bases, more preferably 17 to 100 bases. A short nucleic acid aptamer is preferable because it can be easily and inexpensively produced and has high stability. However, if the length of the nucleic acid aptamer is shorter than 10 bases, the ability to bind to microvesicles may not be maintained.

Examples of nucleic acids constituting aptamers include DNA, RNA, LNA (Locked Nucleic Acid), peptide nucleic acids (PNA), artificial nucleic acids (Kimoto, M., et al., Nat. Biotechnol., Vol. 31, No. 5). , Pp. 453-457, 2013), modified nucleic acids (for example, those added with amino acid side chains), or a mixture of these nucleic acids partially. Each nucleic acid may contain a base modified with fluorine or a methyl group, if necessary, or may contain a modification such as thiolation in the phosphate moiety. In this specification, the nucleic acid constituting the aptamer is described as RNA, but can be appropriately read as other nucleic acid such as DNA. At that time, thymine (T) and uracil (U) can be appropriately substituted for each other.

“Microvesicle” means a lipid bilayer vesicle secreted from a cell having a diameter of about 10 nm to about 1000 nm. The microvesicle may be, for example, one secreted from a cultured cell into a culture solution or one secreted from a cell in a living body into a body fluid such as blood. Cells that secrete microvesicles are not particularly limited. For example, dendritic cells, T cells, B cells, epithelial cells, epithelial cells, nerve cells, brain blood barrier epithelial cells, tumor cells, tumor stem cells, iPS cells, ES cells Or stem cells. These cells may be derived from any animal species.

The microvesicle-binding nucleic acid aptamer of the first embodiment has a base sequence: 5′-X ₁ -M _s -X ₂ -3 ′ (where M _s is YRCGGHGGWRWKGGGRN (SEQ ID NO: 207) and 80% or more) Is a nucleotide sequence having identity, Y is C or T or U, R is independently A or G, H is A, C or T or U, and W is each Independently, A or T or U, K is G or T or U, N is independently A, C, G or T or U, and X ₁ and X ₂ are each 0 Represents 1-50 nucleotides, and X ₁ and X ₂ bind complementarily to form a 0-50 base pair stem). The aptamer has a structure in which M _s is a loop part, and has a high binding affinity for microvesicles. In general, a sequence obtained as a nucleic acid aptamer having a high binding affinity for a target molecule can be introduced with mutation to further optimize the base sequence. That is, a nucleic acid aptamer in which a mutation is introduced in a range having 80% or more identity with respect to M _s and a base sequence is optimized is equivalent to or more than an aptamer having M _s as a loop portion. Has a high binding affinity for. “80% or more identity” means at least 80%, for example at least 80%, 85%, 90%, 95%, 97%, 98%, 99%, when comparing two base sequences It means a base sequence in which 100% of bases are identical. The microvesicle-binding nucleic acid aptamer of the present embodiment includes a base sequence having preferably 80%, more preferably 90%, particularly preferably 100% identity with the base sequence shown in SEQ ID NO: 207. Note that the mutation introduced for optimization may include deletion or insertion of 1 to several bases. The number of bases to be deleted or inserted by optimization is not particularly limited, but is preferably within 5 bases, within 4 bases, within 3 bases, and particularly preferably with 2 bases or 1 base.

An arbitrary base sequence having a length of 0 to 50 nucleotides can be used for X ₁ and X ₂ of the microvesicle-binding nucleic acid aptamer of the first embodiment. In general, a nucleic acid aptamer forms a three-dimensional structure such as a stem-loop structure, a guanine (G) quartet structure, or a pseudoknot structure, and this specific three-dimensional structure determines the recognition ability and binding ability of a nucleic acid aptamer to a target molecule. As long as the three-dimensional structure of the nucleic acid aptamer is maintained, it is well known that the ability of the nucleic acid aptamer to recognize and bind to the target molecule is maintained. That is, in order to maintain the recognition ability and binding ability of a nucleic acid aptamer to a microvesicle, the structure of the loop portion of M _s needs to be maintained, and at the same time, X ₁ and X ₂ have a specific base sequence. It is understood that is not limited.

X ₁ and X ₂ are arbitrary base sequences each having a length of 0 to 50 nucleotides, and X ₁ and X ₂ are complementarily bound to form a stem of 0 to 50 base pairs. X ₁ and X ₂ may be the same length or different lengths. X ₁ and X ₂ may be completely complementary or partially complementary. The length of the stem portion can be freely changed. Furthermore, even in the absence of the stem portion, ie, when X ₁ or X ₂ is 0 nucleotides in length, the loop portion of M _s can be maintained, and the ability of nucleic acid aptamers to recognize microvesicles and Binding ability can be maintained. The length of the stem of the microvesicle-binding nucleic acid aptamer of the present embodiment is not particularly limited, but is preferably 5 to 45, 10 to 40, 10 to 35, or 10 to 30 base pairs, more preferably 5 It can be ˜25 base pairs.

The microvesicle-binding nucleic acid aptamer of the second embodiment has a base sequence: 5′-X _3- (N) _m -M _k- (N) _n -X ₄ -3 ′ (where M _k is RRRDDRNDRGRKW (SEQ ID NO: 208) or RVDDGGGHTCTAC (SEQ ID NO: 211) and a nucleotide sequence having 80% or more identity, R is independently A or G, and D is independently A, G or Is T or U, N is A, C, G or T or U, K is G or T or U, W is A or T or U, and V is A, C or G, H is A, C or T or U, m is any integer from 9 to 15, n is any integer from 0 to 4, X ₃ and X _4, respectively 0 to 50 Represent nucleotides, and, X ₃ and X ₄ includes a stem to form) 0-50 base pairs complementarily bound. The aptamer has a structure in which (N) _m -M _k- (N) _n is a loop portion, and has a high binding affinity for microvesicles. In addition, a nucleic acid aptamer in which a mutation is introduced in a range having 80% or more identity with respect to M _k and the base sequence is optimized is equivalent to or more than an aptamer including M _k in the loop part. Has a high binding affinity for. The microvesicle-binding nucleic acid aptamer of the present embodiment has a base sequence having preferably 80%, more preferably 90%, particularly preferably 100% identity with the base sequence shown in SEQ ID NO: 208 or SEQ ID NO: 211. Including. Note that the mutation introduced for optimization may include deletion or insertion of 1 to several bases. The number of bases to be deleted or inserted by optimization is not particularly limited, but is preferably within 5 bases, within 4 bases, within 3 bases, and particularly preferably with 2 bases or 1 base.

The loop portion of the microvesicle-binding nucleic acid aptamer of the second embodiment includes _Mk, and includes (N) _m and (N) _n consisting of an arbitrary base sequence at both ends thereof. (N) The length of _m is 0 to 20 nucleotides, preferably 7 to 17 nucleotides. (N) The length of _n is 0 to 20 nucleotides, preferably 0 to 10 nucleotides. Of the loop portion consisting of (N) _m -M _k- (N) _n , the structure of M _k is important for the ability to recognize and bind to this microvesicle, and if the structure of M _k is maintained, a nucleic acid aptamer The ability to recognize and bind to microvesicles can be maintained. That, (N) _m and (N) _n is equivalent to a linker with the stem portion formed by the X ₃ and X _4, it is not limited to nucleotide chain consisting of a specific nucleotide sequence. In addition, (N) _m and (N) _n may be non-nucleotide chains. The non-nucleotide chain may be composed of an organic group such as a substituted or unsubstituted linear alkyl chain, an ethylene glycol chain, an amino linker, a peptide chain, and a sugar chain.

An arbitrary base sequence having a length of 0 to 50 nucleotides can be used for X ₃ and X ₄ of the microvesicle-binding nucleic acid aptamer of the second embodiment. The structure of the loop part consisting of (N) _m -M _k- (N) _n is important for the ability of the nucleic acid aptamer of the present embodiment to recognize and bind to the microvesicle, and X ₃ and X ₄ are specific nucleotide sequences. It is understood that this is not a limitation.

X ₃ and X ₄ are arbitrary base sequences each having a length of 0 to 50 nucleotides, and X ₃ and X ₄ are complementarily bonded to form a stem of 0 to 50 base pairs. X ₃ and X ₄ may have the same length or different lengths. X ₃ and X ₄ may be completely complementary or partially complementary. The length of the stem portion can be freely changed. Furthermore, the structure of M _k can be maintained even in the absence of a stem portion, ie, when X ₃ or X ₄ is 0 nucleotides in length, and the recognition ability and binding of nucleic acid aptamers to microvesicles Performance can be maintained. The length of the stem of the microvesicle-binding nucleic acid aptamer of the present embodiment is not particularly limited, but is preferably 5 to 45, 10 to 40, 10 to 35, or 10 to 30 base pairs, more preferably 5 It can be ˜25 base pairs.

The stem portion of the microvesicle-binding nucleic acid aptamer of this embodiment can contain a mismatch or a bulge. In general, it is well known that the stem portion has a small influence on the recognition ability and binding ability of the nucleic acid aptamer to the target molecule, and the base sequence of the stem portion has a small number of nucleotides, such as, but not limited to, 1, 2, 3 It is well known that there may be deletions, insertions, substitutions of up to 4, or 5 nucleotides. The recognition ability and binding ability of the nucleic acid aptamer of the present embodiment to the microvesicle are determined by the structure of the loop portion of M _s and (N) _m -M _k- (N) _n , and depend on the structure of the stem portion. Is not affected. That is, X ₁ and X ₂ or X ₃ and X ₄ of the microvesicle-binding nucleic acid aptamer of the present embodiment do not have to be completely complementary and contain mismatches or bulges. It's okay.

In the microvesicle-binding nucleic acid aptamer of the present embodiment, preferably, M _s or M _k forms a G quartet structure. The G quartet structure is a square planar structure in which four guanines are formed as tetramers, and two or more planes overlap to form a guanine quadruplex structure (G-quadruplex). A nucleic acid aptamer in which M _s or M _k forms a G quartet structure can have a recognition ability and a high binding ability to a microvesicle.

The microvesicle-binding nucleic acid aptamer of the third embodiment includes any base sequence selected from the group consisting of SEQ ID NOs: 107 to 206. An aptamer containing any base sequence selected from the group consisting of SEQ ID NOs: 107 to 206 has a high binding affinity for microvesicles.

In the microvesicle-binding nucleic acid aptamer of the present embodiment, preferably, 1 to 5 bases are substituted, deleted, inserted or added in any base sequence selected from the group consisting of SEQ ID NOs: 107 to 206. Base sequence. Generally, for a sequence obtained as a nucleic acid aptamer having a high binding affinity for a target molecule, it is possible to introduce a mutation and further optimize the base sequence. That is, for a microvesicle-binding nucleic acid aptamer containing any one of the nucleotide sequences of SEQ ID NOs: 107 to 206, a nucleic acid aptamer optimized by substitution, deletion, insertion or addition of one to several bases is also available. It can have a high binding affinity for vesicles. The number of bases substituted, deleted, inserted or added by optimization is not particularly limited, but is preferably within 5 bases, within 4 bases, within 3 bases, and particularly preferably with 2 bases or 1 base.

Note that the microvesicle-binding nucleic acid aptamer of the present embodiment is not limited to a nucleic acid consisting only of the specific base sequence. That is, it may be a nucleic acid to which an arbitrary base sequence is added as long as it contains the specific base sequence and has a binding ability to microvesicles. In addition, the nucleic acid constituting the aptamer may be, for example, DNA, RNA, LNA, PNA, artificial nucleic acid, modified nucleic acid (for example, with an amino acid side chain added), or a mixture of these nucleic acids. It may be. Each nucleic acid may contain a base modified with fluorine or a methyl group as necessary, or may contain a modification such as thiolation in the phosphate moiety.

In the nucleic acid aptamer according to the present invention, either one or both of the 3 'end and the 5' end may be modified. This is to improve the stability of the nucleic acid. As described above, since the binding affinity of a nucleic acid aptamer to a target substance is generally provided by the nucleic acid aptamer three-dimensional structure, as long as the three-dimensional structure is maintained, another base sequence or a modifying substance is added to the end of the nucleic acid aptamer. Even so, it is well known that the binding affinity of the nucleic acid aptamer to the target substance is maintained. Examples of terminal modifications include biotin, polyethylene glycol (PEG), fluorescent materials, luminescent materials, carboxyfluorescein (FAM), peptides, amino acids, lipids and the like. Moreover, the said modification may be couple | bonded with respect to a nucleic acid aptamer through a spacer sequence. The spacer sequence can be of any length, but can preferably be 0-20 bases.

The nucleic acid aptamer according to the present invention can be obtained by, for example, the Systematic Evolution of Ligands by the exponential enrichment (SELEX) method (Tuerk, C. and Gold, L., Science, Vol. 249, p. 249, p. 249, p. 249, p. 249). 1990). In the SELEX method, only a nucleic acid that binds to a target molecule with high affinity is selected by repeating a cycle of selecting and amplifying a nucleic acid that binds to the target molecule from a nucleic acid library containing random sequences, for example, 5 to 20 times. It is a method of sorting. That is, the microvesicle-binding nucleic acid aptamer of this embodiment can be obtained by performing the SELEX method using the microvesicle as a target molecule.

The microvesicle used as the target molecule can be obtained from a biological sample or a cell culture solution. As the microvesicles, those obtained by ultrafiltration, density gradient centrifugation, size exclusion chromatography, ultracentrifugation, immunoprecipitation, liquid chromatography and the like can be used.

The microvesicle targeted by the nucleic acid aptamer according to the present invention preferably has a diameter of 10 to 200 nm, particularly preferably an exosome. The “exosome” means a lipid bilayer vesicle secreted from a cell that is derived from an endosome and has a diameter of about 30 to 100 nm.

The nucleic acid aptamer obtained by the SELEX method can be prepared by various conventionally known synthetic methods after determining its base sequence. For example, nucleic acid aptamers can be prepared by chemical synthesis methods. The chemical synthesis method is preferable in that the same nucleic acid aptamer can be prepared in large quantities.

The microvesicle-binding nucleic acid aptamer of this embodiment has a binding affinity for microvesicles that is equivalent to that of existing anti-microvesicle antibodies. Therefore, it is useful for applications such as detection and isolation of microvesicles.

According to the second aspect, the present invention is a method for detecting a microvesicle using a microvesicle-binding nucleic acid aptamer.

The detection method of the present embodiment can be performed by the same method as the immunological method except that a microvesicle-binding nucleic acid aptamer is used instead of the antibody. Therefore, by using a microvesicle-binding nucleic acid aptamer instead of the existing anti-microvesicle antibody, for example, enzyme immunoassay (EIA), radioimmunoassay (RIA), western blotting, immunohistochemical staining method The micro vesicle can be detected by the same procedure as the above method. It can also be performed by a method using a combination of microchannels or a method using surface plasmon resonance.

According to the third aspect, the present invention is a method for isolating a microvesicle using a microvesicle-binding nucleic acid aptamer.

The isolation method of the present embodiment can be performed by the same method as the immunological method except that a microvesicle-binding nucleic acid aptamer is used instead of the antibody. Therefore, microvesicles can be isolated by, for example, immunoprecipitation, affinity column purification, flow cytometry sorting, etc., by using a microvesicle-binding nucleic acid aptamer instead of the existing anti-microvesicle antibody. it can.

According to the fourth aspect, the present invention is a drug delivery system comprising a microvesicle-binding nucleic acid aptamer and a drug. The drug delivery system of this embodiment contains a microvesicle-binding nucleic acid aptamer conjugated with one or more drugs. The drug delivery system of the present embodiment improves the stability and retention of the drug in the living body of the subject to which the drug delivery system is administered, for example, the microvesicle in the blood, and improves the in vivo stability and retention. The drug is specifically delivered only to cells targeted by the vesicle.

The drug contained in the drug delivery system of the present embodiment may be a normal drug component, for example, an anticancer drug, an anti-inflammatory drug, or a therapeutic drug for infectious diseases, immune diseases, neurological diseases or degenerative diseases. Can be mentioned. The drug delivery system of this embodiment can include one or more drugs conjugated to a microvesicle-binding nucleic acid aptamer. When the drug is composed of, for example, a nucleic acid drug such as siRNA or antisense nucleic acid, it may be directly linked to the nucleic acid aptamer. The microvesicle-binding nucleic acid aptamer and the drug can be bound at a molar ratio of 1: 1 to 1: 100.

The drug delivery system of this aspect may include a foreign microvesicle in advance. In this case, an exogenous microvesicle derived from a preferable cell type can be appropriately selected according to the tissue or cell that is the target of drug delivery. As the exogenous microvesicle, a microvesicle derived from any animal species or cell type can be used.

Since the drug delivery system of this embodiment can improve the stability and retention of the drug in vivo by combining with the microvesicle, the dose and frequency of the drug can be reduced, and side effects can be reduced. Also useful. In addition, by binding to microvesicles selected according to the tissue or cell targeted for drug delivery, the drug can be selectively delivered only to the cells targeted by the microvesicles. It is useful because it can only act on drugs.

Hereinafter, the present invention will be further described with reference to examples. In addition, these do not limit this invention at all.

<Example 1: Purification of microvesicles>
Microvesicles in the culture medium were prepared with some modifications based on the method of Sokolova et al. (Sokolova, V., et al., Colloids Surf B Biointerfaces, Vol. 87, pp. 146-150, 2011). The culture solution (10% FBS / DMEM) of 293T cells cultured in a 10 cm petri dish was replaced with serum-free Advanced DMEM (manufactured by Life Technologies) and cultured for 3 days, and then the culture supernatant was collected. The collected culture supernatant was filtered with a filter having a pore size of 0.22 μm to remove substances of 200 nm or more. Subsequently, using an ultrafiltration filter (Amicon Ultra, manufactured by Millipore) having a pore size of 10 kDa, buffer exchange was performed three times with 40 ml of PBS (−), and then the amount of the sample solution was concentrated to about 1 ml. Thereafter, buffer exchange was performed three times with 500 μl of PBS (−) using an ultrafiltration filter (VIVACON 500, manufactured by Sartorius Stedim) with a pore size of 100 kDa. The obtained sample was fractionated with a column packed with Sepharose 2B (manufactured by GE Healthcare Japan) to obtain a microvesicle fraction. From the protein amount profile and the results of dot blots with anti-CD63 antibody, it was confirmed that most of the obtained microvesicles were exosomes (FIG. 5).

<Example 2: Screening of microvesicle-binding nucleic acid aptamer by SELEX method>
A microvesicle-binding nucleic acid aptamer was produced by the SELEX method. The SELEX method is based on the method of Ellington et al. (Ellington, AD. And Szostak, JW., Nature, Vol. 346, pp. 818-822, 1990) and the method of Gold et al. (Tuerk, C. and Gold, L., Science). , Vol. 249, pp. 505-510, 1990) (Murakami, K., Nishikawa, F., Noda, K., Yokoyama, T., and Nishikawa, S., Prion, Vol. 2, pp. 73-80, 2008).

The RNA pool used in the first round was prepared by performing in vitro transcription using chemically synthesized DNA as a template and using DuraScribe ^™ T7 Transcription Kit (manufactured by Epicenter Technologies). The RNA pool is a DNA template containing a 21-mer region at each end of the _55- mer randomized region (n ₅₅ ) (S pool), and a 15-mer region at each end of the _30- mer randomized region (n ₃₀ ). Two types were prepared using DNA containing DNA as a template (K pool).

The template DNA and primer sequences are as follows.
(S pool)
Template DNA (S): 5′-gggagggtggaactgaaggaga-n ₅₅ -actctgcaatcgctctacgca-3 ′ (SEQ ID NO: 1)
Forward (Fwd) primer (S): 5′-tgtatacatgactcactatagggagggtggaactgaagga-3 ′ (SEQ ID NO: 2)
Reverse (Rev) primer (S): 5'-tgcgttagagcgattgcgaagt-3 '(SEQ ID NO: 3)
(K pool)
Template DNA (K): 5'-ggtagatacgaggga-n ₃₀ -catgacgggcaccca-3 '(SEQ ID NO: 4)
Forward (Fwd) primer (K): 5′-tgtatacatgactcactataggtagatacgatagga-3 ′ (SEQ ID NO: 5)
Reverse (Rev) primer (K): 5'-tggctgcgcgtcatg-3 '(SEQ ID NO: 6)
n represents a, c, g, or t. The Fwd primer contains the promoter sequence for T7 RNA polymerase.

To the template DNA and primer, a buffer attached to the DuraScript ^™ T7 Transcription Kit, a final concentration of 10 mM DTT, a final concentration of 5 mM each of rATP, rGTP, 2′-F-rCTP and 2′-F-rUTP, and reverse transcriptase And reacted at 37 ° C. for 6 hours. Thereafter, DNase attached to the Kit was added and reacted at 37 ° C. for 15 minutes to decompose the template DNA. The obtained RNA product was purified with a biogel P-30 packed micro bio spin column (manufactured by Bio-Rad).

The obtained RNA is one in which the 2 ′ position of ribose of pyrimidine nucleotides (c and u) is fluorinated. Moreover, the variation of RNA contained in the obtained RNA pool is 1 × 10 ³³ for the S pool and 1 × 10 ¹⁸ for the K pool.

Subsequently, a binding reaction between the microvesicle prepared in Example 1 and the RNA pool was performed. For the binding reaction, a binding buffer (20 mM Tris hydrochloride (pH 7.5), 150 mM sodium chloride, 5 mM potassium chloride, 0.5 mM magnesium chloride, 1.5 mM calcium chloride) is used. In the presence, the test was carried out at room temperature under the conditions shown in Table 1 below. After the reaction, the microvesicle-RNA complex was recovered on the membrane by filtering through a 0.45 μm pore size nitrocellulose membrane (Millipore). This membrane was placed in a 7M urea / 10 mM EDTA solution and heated at 98 ° C. for 5 minutes, and then the solution was recovered and RNA was purified by ethanol precipitation.

The purified RNA was subjected to a reverse transcription reaction using PrimeScript II single-stranded cDNA synthesis kit (manufactured by Takara Bio Inc.). Specifically, 1.25 μmol of dNTP, 25 pmol each of Fwd primer and Rev primer were added to the purified RNA (˜several tens μg), reacted at 65 ° C. for 5 minutes, and then cooled to 4 ° C. Then, the buffer, RNase inhibitor, and reverse transcriptase (100 U) attached to the kit were added, 10 minutes at 30 ° C., 10 minutes at 37 ° C., 40 minutes at 42 ° C., 30 minutes at 52 ° C., 5 minutes at 98 ° C. Reacted.

The obtained reverse transcription product was subjected to PCR reaction to amplify DNA. Specifically, to the reverse transcription product (up to several tens of μg), a buffer attached to TaKaRa Ex Taq (manufactured by Takara Bio Inc.), a final concentration of 0.8 mM dNTP, a final concentration of 1.25 μM Fwd primer and a Rev primer, 0.5 U Ex Taq was added, and after 94 ° C. for 60 seconds, a PCR reaction was performed by repeating a cycle of 98 ° C. for 10 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 60 seconds. The number of cycles was determined by confirming the amplification product by agarose gel electrophoresis.

The obtained PCR product was purified by ethanol precipitation. From the purified PCR product, reverse transcribed RNA was obtained by in vitro transcription using the DuraScribe ^™ T7 Transcription Kit. The obtained RNA product was purified with a biogel P-30 packed micro bio spin column (manufactured by Bio-Rad).

In order to remove undesired nitrocellulose membrane-bound RNA from the purified RNA product, the purified RNA product was passed through a nitrocellulose membrane (negative selection).

The above process was regarded as one round, and 10 screening rounds were repeated. Detailed reaction conditions in each screening round are shown in Table 1 below.

For the DNA pool obtained by repeating 10 screening rounds, the base sequence was comprehensively analyzed using the next-generation sequencer MiSeq (manufactured by Illumina) and its kit MiSeq Reagent Kit v2.

The obtained base sequences are shown in Table 2 and Table 3.

The actual aptamer sequence is an Fwd primer sequence (however, a sequence upstream from the transcription start point of the T7 promoter: except for UGUAAAUACGAUCACACUAUA) -randomized region sequence-reverse primer complementary sequence. In the aptamer, all base sugars are ribose, t is 2'-FU, and c is 2'-FC.

Tables 4 and 5 show the base sequences of actual RNA aptamers.

<Example 3: Motif search>
Motif search was performed on the top 50 aptamer sequences obtained from the S pool and K pool using MEME Suite (http://meme.nbcr.net/meme/).

The results are shown in FIG. FIG. 1 is a display conforming to MEME, in which the vertical axis indicates the appearance frequency (bit score) of the base at each position of the motif sequence, and the horizontal axis indicates the base sequence. FIG. 1 (a) shows the analysis results for the top 50 sequences of aptamers obtained from the S pool. FIG. 1 (b) to FIG. 1 (d) show the analysis results for the top 50 sequences of aptamers obtained from the K pool. From this result, the motif M _s : YRCGGHGGWRWGGGRN (SEQ ID NO: 207) conserved in both the aptamer enriched from the S pool and the aptamer enriched from the K pool, and the motif conserved only in the aptamer enriched from the K pool It was revealed that M _k : RRRRDDRNDRGRKW (SEQ ID NO: 208) or RVDDGGGHTCTAC (SEQ ID NO: 211) was present.

Based on the results of FIG. 1 (a), the aptamers concentrated from the S pool are aligned and aligned. FIG. 2 shows the results of alignment and aptamers concentrated from the K pool based on the results of FIG. 1 (c). FIG. 3 shows the result of alignment and alignment. From this result, it was confirmed that aptamers obtained from the S pool have the motif M _s in common, and aptamers concentrated from the K pool have the motif M _{k in} common.

<Example 4: Prediction of secondary structure of motif>
Subsequently, secondary structure prediction of the above-described motifs M _s and M _k was performed. The CentroidFold program (Nucl. Acids Res., Vol. 37 (Suppl. 2), pp. W277-W280) is used for the aptamer having the motif M _s , SEQ ID NO: 114, and the aptamer having the motif M _k , SEQ ID NO: 159. , 2009) to predict secondary structure.

The results are shown in FIG. 4 and FIG. It was shown that the aptamers of SEQ ID NO: 114 and SEQ ID NO: 159 all form a stem loop structure, and both the motif M _s and the motif M _k form a loop structure.

Based on the results of Examples 3 and 4, the structure of the aptamer estimated is as follows.
Aptamers with a motif _{M s:}
5′-X ₁ -M _s -X ₂ -3 ′ (where M _s is YRCGGHGWRWGGGGRN (SEQ ID NO: 207), R is independently A or G, and Y is C or T Or U, W is each independently A or T or U, N is each independently A, C, G or T or U, and X ₁ and X ₂ are each 0 to 50 Represents X nucleotides, and X ₁ and X ₂ bind complementarily to form a 0-50 base pair stem)
Aptamers with motif _Mk :
5′-X _3- (N) _m -M _k- (N) _n -X ₄ -3 ′ (where M _k is RRRDDRNDRGRKW (SEQ ID NO: 208), and each R is independently A or G, D are each independently A, G or T or U; N is A, C, G or T or U; K is G or T or U; W is A or T or U, m is any integer from 9 to 15, n is any integer from 0 to 4, and X ₃ and X ₄ are each 0 to 50 And X ₃ and X ₄ bind complementarily to form a 0-50 base pair stem)

<Example 5: Evaluation of binding ability of motif to microvesicle>
Of the motifs predicted from the results of Examples 3 and 4, the following aptamers with the stem structure portion shortened were synthesized in order to analyze in more detail the loop structure portion important for the microvesicle binding ability. A biotin label was introduced at the 5 ′ end.
S-motif aptamer: 5′-ggccACGA CGCGGGAGGUGUGGGGGA UCGUggcc-3 ′ (SEQ ID NO: 209)
K motif aptamer: 5′-GGUAGAUACGAUGGAAGAG GGAAAGGGAGGGGU UCUACC-3 ′ (SEQ ID NO: 210)
(Here, lowercase letters represent DNA, uppercase letters represent RNA. U and C are modified with fluorine. Underlined motif M _s (SEQ ID NO: 207) or motif M _k (SEQ ID NO: 208)) (The part corresponding to is shown.)

The binding ability of the aptamer to microvesicles was evaluated by a filter binding assay. A buffer in which 0.1% Tween 20 is added to the binding buffer used in Example 2 (hereinafter referred to as “0”), the S motif aptamer or K motif aptamer (100 pmol each) and the microvesicle (10 mg) prepared in Example 1. In 1% Tween20-containing binding buffer) for 2 hours at room temperature. Thereafter, the reaction solution was filtered through a 0.45 μm pore size nitrocellulose membrane (Millipore). The filter was then washed by passing through 5 ml of a binding buffer containing 0.1% Tween20. The washed filter was blocked with a binding buffer containing 3% BSA / 0.1% Tween 20 containing 100 μg / ml tRNA and washed once with 4.5 ml of a binding buffer containing 0.1% Tween 20 for 10 minutes. Thereafter, the reaction was carried out at room temperature for 1 hour with horseradish peroxidase (HRP) -labeled avidin (Thermo Scientific) diluted 1/1000 with a binding buffer containing 0.3% BSA / 0.1% Tween20. Thereafter, chemiluminescence reaction was performed using an ECL kit (manufactured by GE Healthcare Japan) to detect binding.

The results are shown in FIG. Both the S motif aptamer and the K motif aptamer were shown to have the ability to bind to microvesicles.

<Example 6: Comparison of binding ability of motif and anti-microvesicle antibody to microvesicle>
In order to compare the binding ability of the S motif aptamer and the commercially available anti-microvesicle antibody to microvesicles, a dot blot was performed. An anti-CD63 antibody (MX-49.129.5, manufactured by Santa Cruz Biotechnology) was used as the anti-microvesicle antibody. CD63 is known as an exosome marker protein, and anti-CD63 antibodies are generally used for detection and isolation of exosomes.

2 μl of the microvesicle fraction obtained in Example 1 (fractions 3 to 10) was dropped on the nitrocellulose membrane and air-dried at room temperature for 30 minutes to fix the microvesicle, and then 100 μg / ml tRNA. 1% BSA / 0.1% Tween20-containing binding buffer (hereinafter referred to as “blocking buffer”) was used for blocking at room temperature for 1 hour. Then, the binding reaction was performed by incubating the nitrocellulose membrane in an S motif aptamer / blocking buffer (final concentration 200 nM) at room temperature for 1 hour. After the reaction, the nitrocellulose membrane was washed with a binding buffer containing 0.1% Tween 20, and then the S motif aptamer bound to the microvesicle was immobilized by UV crosslinking. Thereafter, the mixture was reacted with HRP-labeled avidin (Thermo Scientific) diluted 1/4000 with a binding buffer containing 0.1% Tween 20 at room temperature for 1 hour. After washing three times with a binding buffer containing 0.1% Tween 20, a chemiluminescence reaction was performed using an ECL kit (manufactured by GE Healthcare Japan) to detect binding.

For the binding reaction between the microvesicle and the anti-CD63 antibody, after blocking for 1 hour at room temperature with 3% BSA / 0.1% Tween20 / TBS, the above-mentioned anti-CD63 antibody was used as the primary antibody (1: 1000 dilution / 1 % BSA / 0.1% Tween 20 / TBS) and incubation at room temperature for 1 hour to perform the binding reaction. After washing with 0.1% Tween 20 / TBS three times for 15 minutes, HRP-labeled anti-mouse IgG (manufactured by GE Healthcare Japan) was used as the secondary antibody (1: 2000 dilution / 1% BSA / 0.1% Tween 20). / TBS), the binding reaction was carried out by incubation at room temperature for 1 hour. After washing with 0.1% Tween20 / TBS three times for 15 minutes, the binding of the anti-CD63 antibody to the microvesicle was detected by chemiluminescence in the same manner as the S motif aptamer.

The result is shown in FIG. The detection sensitivity of the S motif aptamer to microvesicles was equivalent to that of a commercially available anti-CD63 antibody.

In order to further confirm that the S motif aptamer was bound to the microvesicle, a dot blot was performed on the denaturated microvesicle sample. As denatured microvesicle samples, the microvesicles prepared in Example 1 were boiled for 2 minutes in (1) binding buffer and (2) boiled for 2 minutes in 2% SDS-containing sample buffer. did. The microvesicles can be denatured partially according to the condition (1) and completely according to the condition (2). The dot blot was performed by the same procedure as described above.

The result is shown in FIG. Compared with the microvesicle sample (lane 1) that was not subjected to denaturation treatment, in the sample in which the microvesicle was gently denatured (above (1), lane 2), the binding of the S motif aptamer was reduced, and the microvesicle was completely removed. In the sample denatured in (Section (2), lane 3), the binding of the S motif aptamer completely disappeared. From this result, it was confirmed that the S motif aptamer specifically bound to the microvesicle.

<Example 7: Evaluation of binding ability of aptamer to microvesicle by surface plasmon resonance method>
The binding ability of the S motif aptamer (SEQ ID NO: 209) and the K motif aptamer (SEQ ID NO: 210) to microvesicles was evaluated by the surface plasmon resonance method. Specifically, a surface plasmon resonance measuring apparatus BIACORE X (manufactured by GE Healthcare Japan) and a sensor chip coated with streptavidin (sensor chip SA, manufactured by GE Healthcare Japan) were used. About 150 RU of S motif aptamer or K motif aptamer was bound to the chip. The 293T cell-derived or HeLa S3 cell-derived microvesicles used as the analyte were prepared by the same procedure as in Example 1, and about 1 mg / ml, 1/40, 1/80, 1/120, Concentrations of 1/140 and 1/160 were prepared and used to measure binding levels. As the running buffer, 0.005% Tween 20 / binding buffer was used (flow rate 10 μl / ml).

The results are shown in FIGS. The dissociation constant (Kd) determined from the binding reaction curve is as follows: the Kd between the S motif aptamer and the 293T cell-derived microvesicle is 2.37 × 10 ² μg / ml, and the S motif aptamer and the HeLa S3 cell-derived microvesicle. Kd is 1.23 × 10 ² μg / ml, Kd between K motif aptamer and 293T cell-derived microvesicle is 1.38 × 10 ² μg / ml, Kd between K motif aptamer and HeLa S3 cell-derived microvesicle Was 0.57 × 10 ² μg / ml. From this value, it was revealed that both the S motif aptamer and the K motif aptamer have a very high binding affinity for microvesicles over that of a general antibody.

<Example 8: Structural analysis of aptamer by circular dichroism spectrum measurement>
The three-dimensional structure of the motif was analyzed by measuring the circular dichroism (CD) spectrum of the S motif aptamer (SEQ ID NO: 209) and the K motif aptamer (SEQ ID NO: 210). Specifically, measurement was performed at 25 ° C. and 220 to 320 nm using a quartz cell having an optical path length of 0.1 cm by J-820 (manufactured by JASCO Corporation). The buffer is based on 20 mM Tris hydrochloride (pH 7.5), 150 mM sodium chloride, 0.5 mM magnesium chloride, 1.5 mM calcium chloride, with potassium chloride at a final concentration of 0.0, 0.1, 0.3, 1 Add to 0.0, 5.0, 10.0, 50.0 and 100 mM. The buffer is 20 mM Tris hydrochloride (pH 7.5), and the potassium chloride is adjusted to a final concentration of 0.0, 0.1, 0.3, 1.0, 5.0, 10.0, 50.0 and 100 mM. The case where it added so was evaluated.

Next, melting temperatures of the S motif aptamer and the K motif aptamer were determined. Specifically, in a buffer (20 mM Tris hydrochloride (pH 7.5), 150 mM sodium chloride, 0.5 mM magnesium chloride, 1.5 mM calcium chloride, 100 mM potassium chloride) while changing the temperature from 25 ° C. to 95 ° C. It was determined by measuring the fluorescence intensity at 270 nm. The same measurement was performed when the buffer was 20 mM Tris hydrochloride (pH 7.5) and 100 mM potassium chloride.

CD measurement results are shown in FIGS. As shown in FIGS. 12 and 14, the structure of the S motif aptamer changed depending on the potassium ion concentration, and the maximum value of ellipticity θ (around 260 to 280 nm) increased as the potassium ion concentration increased. As for the K motif aptamer, the same potassium ion concentration-dependent structural change as that of the S motif aptamer was observed (FIGS. 13 and 15). Further, from the results of FIG. 15, it has been clarified that when the potassium ion concentration is 0.1 mM or more, the maximum ellipticity θ shifts to the longer wavelength side. From these results, it was suggested that both the S motif aptamer and the K motif aptamer form a parallel guanine quadruplex structure (Parallel G-quadruplex) in a potassium ion-dependent manner.

Results of melting temperature measurement are shown in FIGS. Both the S motif aptamer and the K motif aptamer have a minimum ellipticity θ at a high temperature of 70 to 80 ° C., which means that the motif forms a highly stable structure that is not a simple double-stranded structure. (J. Phys. Chem. B, Vol. 177 (23), pp. 6896-6905). That is, from this result, it was suggested that both the S motif aptamer and the K motif aptamer form a parallel quadruplex structure. Moreover, since the maximum was observed in the low temperature range, it was predicted that the base sequences at both ends of the aptamer formed a double chain structure in both the S motif aptamer and the K motif aptamer.

<Example 9: Effect of potassium ion concentration on aptamer binding ability to microvesicles>
Subsequently, whether the binding ability of the S motif aptamer (SEQ ID NO: 209) and the K motif aptamer (SEQ ID NO: 210) to the microvesicle changes depending on the potassium ion concentration was analyzed by a surface plasmon resonance method. Measurement was performed under the same conditions as in Example 7, using 293T cell-derived microvesicles (81 mg / ml) prepared by the same procedure as in Example 1 and a binding buffer with or without 10 mM potassium chloride. .

The results are shown in FIG. A binding reaction curve in the presence of potassium ions is indicated by a solid line, and a binding reaction curve in the absence of potassium ions is indicated by a broken line. It was shown that both the S motif aptamer (the upper part of FIG. 20) and the K motif aptamer (the lower part of FIG. 20) increase the binding ability to microvesicles in a potassium ion-dependent manner. From this result, both the S motif aptamer and the K motif aptamer form a parallel guanine quadruplex structure, and the parallel guanine quadruplex structure is stabilized in a potassium ion concentration-dependent manner. It was suggested that the binding ability was enhanced.

FIG. 21 shows the three-dimensional structure of the microvesicle-binding nucleic acid aptamer according to the present invention, which is assumed from the above results. The arrow indicates the 5 ′ → 3 ′ direction of the nucleic acid, and the two-dot chain line indicates a tetramer plane (G quartet structure) formed by four guanines. The motif portion of the microvesicle-binding nucleic acid aptamer according to the present invention has a parallel guanine quadruplex structure in which two G quartet structures overlap each other, and binds to the microvesicle via this parallel guanine quadruplex structure.

Thus, it was confirmed that the microvesicle-binding nucleic acid aptamer according to the present invention has a high binding affinity for microvesicles and can capture microvesicles. In addition, it was suggested that by using the microvesicle-binding nucleic acid aptamer according to the present invention, a microvesicle detection method and isolation method, and a drug delivery system can be provided.

Claims (16)

1. The following base sequence:
   5'-X ₁ -M _s -X ₂ -3 '
   (Here, M _s is a base sequence having 80% or more identity with YRCGGHGGWRWKGGGRN (SEQ ID NO: 207), Y is C or T or U, and R is independently A or G. H is A, C or T or U; W is independently A or T or U; K is G or T or U; N is each independently A; C, G or T or U,
   X ₁ and X ₂ each represent 0-50 nucleotides, and X ₁ and X ₂ bind complementarily to form a 0-50 base pair stem)
   A nucleic acid aptamer having binding ability to microvesicles.
2. The nucleic acid aptamer according to claim 1, wherein the M _s is a base sequence having 90% or more identity with SEQ ID NO: 207.
3. The nucleic acid aptamer according to claim 1, wherein the M _s is a base sequence represented by SEQ ID NO: 207.
4. The following base sequence:
   5'-X _3- (N) _m -M _k- (N) _n -X ₄ -3 '
   (Here, M _k is a base sequence having 80% or more identity with RRRDDRNDRGRKW (SEQ ID NO: 208) or RVDDGGGHTCTAC (SEQ ID NO: 211), R is independently A or G, and D is Each independently A, G or T or U, N is A, C, G or T or U, K is G or T or U, and W is A or T or U. Yes, V is A, C or G, H is A, C or T or U;
   m is any integer from 0 to 20,
   n is any integer from 0 to 20,
   X ₃ and X ₄ each represent 0-50 nucleotides, and X ₃ and X ₄ bind complementarily to form a 0-50 base pair stem)
   A nucleic acid aptamer having binding ability to microvesicles.
5. The nucleic acid aptamer according to claim 4, wherein the _Mk is a base sequence having 90% or more identity with SEQ ID NO: 208 or SEQ ID NO: 211.
6. The nucleic acid aptamer according to claim 4, wherein _Mk is a base sequence represented by SEQ ID NO: 208 or SEQ ID NO: 211.
7. The nucleic acid aptamer according to any one of claims 1 to 6, wherein the stem contains a mismatch or a bulge.
8. The nucleic acid aptamer according to any one of claims 1 to 7, wherein the M _s or the M _k forms a G quartet structure.
9. (A) a base sequence selected from the group consisting of SEQ ID NOs: 107 to 206, or
   (B) a base sequence selected from the group consisting of SEQ ID NOs: 107 to 206, having a binding ability to microvesicles, including base sequences in which 1 to 5 bases are substituted, deleted, inserted or added; Nucleic acid aptamer.
10. The nucleic acid aptamer according to any one of claims 1 to 9, wherein the 3 'and / or 5' end is modified.
11. The nucleic acid aptamer according to any one of claims 1 to 10, wherein the microvesicle has a diameter of 10 to 200 nm.
12. The nucleic acid aptamer according to claim 11, wherein the microvesicle is an exosome.
13. A method for detecting a microvesicle using the nucleic acid aptamer according to any one of claims 1 to 12.
14. A method for isolating a microvesicle using the nucleic acid aptamer according to any one of claims 1 to 12.
15. A drug delivery system comprising the nucleic acid aptamer according to any one of claims 1 to 12 and a drug.
16. The drug delivery system of claim 15 further comprising a microvesicle.
    

Images