WO2015082414A1 - Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate - Google Patents

Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate Download PDF

Info

Publication number
WO2015082414A1
WO2015082414A1 PCT/EP2014/076139 EP2014076139W WO2015082414A1 WO 2015082414 A1 WO2015082414 A1 WO 2015082414A1 EP 2014076139 W EP2014076139 W EP 2014076139W WO 2015082414 A1 WO2015082414 A1 WO 2015082414A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
prostate cancer
sample
nucleic acid
diagnosis
Prior art date
Application number
PCT/EP2014/076139
Other languages
English (en)
Inventor
Friedemann Horn
Jörg Hackermüller
Sabina Christ
Kristin Reiche
Manfred Wirth
Michael Fröhner
Susanne FÜSSEL
Original Assignee
Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. filed Critical Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V.
Priority to US15/100,943 priority Critical patent/US10196695B2/en
Priority to EP14825105.1A priority patent/EP3077530A1/fr
Publication of WO2015082414A1 publication Critical patent/WO2015082414A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention is in the field of biology and chemistry.
  • the invention is in the field of molecular biology. More particularly, the invention relates to the analysis of R A transcripts. Most particularly, the invention is in the field of diagnosing prostate cancer.
  • Prostate cancer is the most frequently diagnosed cancer in men. In 2012, the annual number of newly diagnosed prostate cancer cases was reported as approximately 240,000 cases in the United States and approximately 360,000 in the European Union, 68,000 of which in Germany. In the United States, lifetime risks for prostate cancer diagnosis and for dying of prostate cancer are currently estimated at 15.9% and 2.8%, respectively. Despite widespread screening for prostate cancer and major advances in the treatment of metastatic disease, prostate cancer remains the second most common cause of cancer death for men with over 250,000 deaths each year in the Western world.
  • PSA prostate-specific antigen
  • RNA biomarkers which had not so far been found to be suitable for use in the diagnosis of prostate cancer.
  • the invention relates to a method for the diagnosis of prostate cancer comprising the steps of analysing the expression level of a nucleic acid selected from the group of SEQ ID NO: 1 to 42, wherein, if at least one of said nucleic acids is present and/or the expression level of at least one of said nucleic acids is above a threshold value, the sample is designated as prostate cancer positive.
  • the invention relates to a method for the diagnosis of prostate cancer comprising the steps of analysing in a sample from a patient the expression level of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, wherein, if the expression level of said nucleic acid is above a threshold value, the sample is designated as prostate cancer positive.
  • the invention relates to a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or any part thereof.
  • the invention also relates to the use of a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 for the diagnosis of prostate cancer.
  • the invention relates to a probe or primer, wherein the probe or primer is specific for a sequence of the group of SEQ ID NO: 1 to 42, preferably for a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.
  • the invention relates to a nucleic acid with a sequence from the group of SEQ ID NO: 1 to 42, or the reverse complement thereof, or a nucleic acid that shares preferably at least 85%, 90%, 95% or 99%) sequence identity with a nucleic acid according to any one of the nucleic acids according to SEQ ID NO: 1 to 42.
  • the invention relates to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or the reverse complement thereof, or a nucleic acid that shares preferably at least 85%, 90%, 95%) or 99%o sequence identity with the selected nucleic acid.
  • the invention relates to the use of a nucleic acid with a sequence from the group of SEQ ID NO: 1 to 42 for the diagnosis of prostate cancer.
  • the invention relates to the use of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, for the diagnosis of cancer.
  • the invention also relates to a kit for the diagnosis of prostate cancer comprising a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, and reagents for nucleic acid amplification and/or quantification and/or detection.
  • a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, and reagents for nucleic acid amplification and/or quantification and/or detection.
  • nucleic acid(s) or “nucleic acid molecule” generally refers to any ribonucleic acid or deoxyribonucleic acid, which may be unmodified or modified.
  • Nucleic acids include, without limitation, single- and double-stranded nucleic acids.
  • nucleic acid(s) also includes nucleic acids as described above that contain one or more modified bases. Thus, a nucleic acid with one or several backbone modifications for stability or for other reasons is a "nucleic acid”.
  • nucleic acids encompasses such chemically, enzymatically or metabolically modified forms of nucleic acids, as well as the chemical forms of nucleic acids characteristic of viruses and cells, including for example, simple and complex cells.
  • level or "expression level” in the context of the present invention relate to the level at which a biomarker is present in a sample from a patient.
  • the expression level of a biomarker is generally measured by comparing its expression level to the expression level of one or several housekeeping genes in a sample for normalisation.
  • the sample from the patient is designated as prostate cancer positive if the expression level of the biomarker exceeds the expression level of the same biomarker in an appropriate control (for example a healthy tissue) by a set threshold value.
  • RNA can also be analysed for example by northern blot, next generation sequencing or after amplification by using spectrometric techniques that include measuring the absorbance at 260 and 280 nm.
  • the term "amplified”, when applied to a nucleic acid sequence, refers to a process whereby one or more copies of a particular nucleic acid sequence is generated from a nucleic acid template sequence, preferably by the method of polymerase chain reaction.
  • Other methods of amplification include, but are not limited to, ligase chain reaction (LCR), polynucleotide-specific based amplification (NSBA), or any other method known in the art.
  • correlating refers to comparing the presence or amount of the marker(s) in a sample from a patient to its presence or expression level in a sample from a person known to suffer from, or is at risk of suffering from, a given condition.
  • a marker expression level in a patient sample can be compared to a level known to be associated with a specific diagnosis.
  • the term "diagnosis” refers to the identification of the disease, in this case prostate cancer, at any stage of its development, and also includes the determination of predisposition of a subject to develop the disease.
  • the term "Ensembl gene ID ENSG00000245750.3” relates to a gene ID sequence annotation by Ensembl. Transcripts that belong to the same gene ID may differ in splice events, exons, and can give rise to very different proteins. These are isoforms, arising from alternative splicing.
  • the Ensembl gene ID has several equivalents in other annotation systems such as for example RP11-279F6.1, or locus (hgl9) Chrl5: 69,755,365- 69,863,775 (+). Any equivalent to this Ensembl annotation can be used in its place.
  • splice variant refers to the product of an alternative splicing event.
  • Alternative splicing events include exon skipping or inclusion, alternative 5 ' or 3 ' splice site usage, or intron retention.
  • fluorescent dye refers to any chemical that absorbs light energy of a specific wavelength and re-emits light at a different wavelength.
  • Fluorescent dyes suitable for labelling nucleic acids include for example FAM (5-or 6-carboxyfluorescein), VIC, NED, Fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor, PET and the like.
  • isolated when used in reference to a nucleic acid means that a naturally occurring sequence has been removed from its normal cellular (e.g. chromosomal) environment or is synthesised in a non-natural environment (e.g. artificially synthesised). Thus, an "isolated" sequence may be in a cell-free solution or placed in a different cellular environment.
  • a “kit” is a packaged combination optionally including instructions for use of the combination and/or other reactions and components for such use. If the kit contains nucleic acids, the kit may also comprise synthetic or non-natural variants of said nucleic acids.
  • a synthetic or non-natural nucleic acid is to be understood as a nucleic acid comprising any chemical, biochemical or biological modification, such that the nucleic acid does not appear in nature in this form.
  • modifications include, but are not limited to, labelling with a fluorescent dye or a quencher moiety, a biotin tag, as well as modification(s) in the backbone of a nucleic acid, or any other modification that distinguishes the nucleic acid from its natural counterpart.
  • patient refers to a living human or non-human organism that is receiving medical care or that should receive medical care due to a disease, or is suspected of having a disease. This includes persons with no defined illness who are being investigated for signs of pathology. Thus the methods and assays described herein are applicable to both, human and veterinary disease.
  • primer refers to an nucleic acid, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH.
  • the primer may be either single- stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and the method used.
  • primers have a length of from about 15-100 bases, more preferably about 20-50, most preferably about 20-40 bases.
  • the primer can be a synthetic element, in the sense that it comprises a chemical, biochemical or biological modification. Such modifications include, but are not limited to, labelling with a fluorescent dye or a quencher moiety, or a modification in the backbone of a nucleic acid, or any other modification that distinguishes the primer from its natural nucleic acid counterpart.
  • probe refers to any element that can be used to specifically detect a biological entity, such as a nucleic acid, a protein or a lipid.
  • the probe also comprises at least one modification that allows its detection in an assay.
  • modifications include, but are not limited to labels such as fluorescent dyes, a specifically introduced radioactive element, or a biotin tag.
  • the probe can also comprise a modification in its structure, such as a locked nucleic acid.
  • sample refers to a sample of bodily fluid or tissue obtained for the purpose of diagnosis, prognosis, or evaluation of a subject of interest, such as a patient.
  • Preferred test samples include blood, serum, plasma, cerebrospinal fluid, urine, saliva, sputum, and pleural effusions.
  • a fractionation or purification procedure for example, separation of whole blood into serum or plasma components.
  • the sample is selected from the group comprising a blood sample, a serum sample, a plasma sample, a cerebrospinal fluid sample, a saliva sample and a urine sample or an extract of any of the aforementioned samples as well as circulating tumour cells in blood or lymph, any tissue suspected to contain metastases as well as any source that may contain prostate tumour cells or parts thereof, including vesicles like exosomes, micro vesicles, and others as well as free or protein-bound RNA molecules derived from prostate tumour cells.
  • the sample is a blood sample, most preferably a serum sample or a plasma sample.
  • urine (particularly after digital rectal examination) and ejaculate belong to the most preferable samples.
  • Tissue samples may also be biopsy material or tissue samples obtained during surgery.
  • AUC area under the curve
  • ROC receiver operating characteristic
  • p-value relate to the probability of obtaining the observed sample results (or a more extreme result) when the null hypothesis is actually true, i.e. there are no differences between means for groups. The smaller the p-value, the higher the likelihood that the alternative hypothesis explains the observed results better than the null hypothesis.
  • adjusted p-value refers to p-values which have been adjusted for multiple comparisons (number of genes/probes tested). The method applied is detailed in the experimental section.
  • the invention describes a method of diagnosis of prostate cancer.
  • This method comprises analysing a sample taken from a patient and specifically determining the level of a biomarker or a combination of biomarkers in said patient sample. The result is then correlated to a threshold value and in the case where it is above that threshold value, said patient sample is designated as prostate cancer positive.
  • the invention relates to a group of sequences comprising SEQ ID NOs 1 to 42.
  • the sequences are listed below. Due to space constraints, only the first 100 nucleotides are listed. The remaining part of the sequence can be found in the sequence protocol.
  • transcripts are known sequences that are already annotated in relevant databases. They are identified by their respective annotations.
  • new transcripts were identified that are not yet annotated. They are designated here as follows: XLOC_ followed by a number. These designations provide information about the genomic origins of the transcripts, but may not necessarily represent the whole sequence of a given transcript. The sequences as detected may in some cases be longer or shorter. In the case of XLOC transcripts, if fragments are detected, these fragments may be as small as 1000, 500, 400, 300, 200, 150, 100, 50, 40, 30, 20, 10, 9, 8, 7, 6 or 5 nucleotides.
  • Retro-RPL7 ggtgttgaagagaagaagaagg
  • ANKRD34B agctgctggcccccctgggtcc
  • Table 1 List of SEQ ID NOs. SEQ ID NOs 1 to 42 are listed together with the corresponding transcript and gene annotations. The first 100 nucleotides of each SEQ ID NO are shown.
  • PCA3 prostate carcinoma
  • Retro-RPL7 SEQ ID NO: 1
  • AUC area under the ROC curve
  • the differential expression of SEQ ID NOs: 4 to 10 could be validated by custom array analysis of 256 tissue samples (Fig. 5).
  • the invention relates to a method for the diagnosis of prostate cancer comprising the steps of analysing the expression level of the nucleic acid according to SEQ ID NO: 1 to 42, wherein, if at least one of said nucleic acids is present and/or the expression level of at least one of said nucleic acids is above a threshold value, the sample is designated as prostate cancer positive.
  • the invention relates to a method for the diagnosis of prostate cancer comprising the steps of analysing in a sample from a patient the expression level of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, wherein, if the expression level of said nucleic acid is above a threshold value, the sample is designated as prostate cancer positive.
  • the invention relates to a method for the diagnosis of prostate cancer comprising the steps of analysing in a sample from a patient the expression level of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, wherein, if the expression level of said nucleic acid is above a threshold value, the sample is designated as prostate cancer positive.
  • analysing the expression level of a nucleic acid means analysing the reverse complement or the cDNA of the nucleic acid.
  • the sample is selected from the group comprising prostate tissue, biopsy material, lymph nodes, urine, ejaculate, blood, blood serum, blood plasma, circulating tumour cells in blood or lymph, any tissue suspected of containing metastases as well as any source that may contain prostate tumour cells or parts thereof, including vesicles like exosomes, micro vesicles, and others as well as free or protein-bound RNA molecules derived from prostate tumour cells or parts thereof. More preferably, the sample is urine, and most preferably, the sample is urine obtained from a patient after a digital rectal examination.
  • the expression level of a transcript of the nucleic acids according to SEQ ID NO: 1 to 42 is compared to the expression level of one or several other gene transcripts in the sample, such as of housekeeping genes. Examples of suitable housekeeping genes are shown below in Table 2:
  • TBP Tata box binding protein Table 2 Examples of suitable housekeeping genes
  • the threshold value is the minimal expression difference between the test sample and the control sample at which the sample is designated as cancer-positive. Ideally the threshold value for the biomarker expression level difference between the test sample and the control sample is 1.5 fold ( ⁇ 20%), 2 fold ( ⁇ 20%), 3 fold( ⁇ 20%), 4 fold ( ⁇ 20%) and most preferably 5 fold ( ⁇ 20%) or more.
  • the p-value (T test) is ⁇ 2xl0 "5 .
  • the FDR is preferably ⁇ 5xl0 "4 .
  • the threshold is preferably a 2 fold expression level increase between the test sample and the control sample to designate a sample as prostate cancer positive.
  • the invention is concerned with the quantification of the expression level of RNA biomarkers. After amplification, quantification is straightforward and can be accomplished by a number of methods. In the case when primers are used wherein at least one primer has a fluorescent dye attached, quantification is possible using the fluorescent signal from the dye.
  • primer systems and dyes are available, such as SYBR green, Multiplex probes, TaqMan probes, molecular beacons and Scorpion primers. These are suitable for instance to carry out PCR-based methods such as quantitative reverse transcription PCR (qRT-PCR). Other possible means of quantification are for example northern blotting, next generation sequencing or absorbance measurements at 260 and 280 nm.
  • any suitable method for the quantification of nucleic acids may be used to analyse the expression levels of the nucleic acids.
  • the analysis in the method is performed by a fluorescence based assay.
  • the analysis is done by measuring the fluorescence of a labelled primer, labelled probe or a fluorescent detection agent (such as SYBR green). More preferably, this analysis of the expression level is performed by qRT-PCR.
  • the sample is mixed with a forward and a reverse primer specific for at least one nucleic acid selected from the group of SEQ ID NO: 1 to 42, preferably a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, followed by amplification.
  • Probes or primers are designed such that they hybridize under stringent conditions to said target sequence.
  • the analysis of the expression level is performed by next generation sequencing.
  • the protein product of one of SEQ ID NO: 1 to 42 is analysed and/or quantified.
  • the invention also relates to a primer or probe that hybridizes under stringent conditions to one of the nucleic acids according to SEQ ID NO: 1 to 42.
  • the invention relates to a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or any part thereof, wherein said primer or a probe is preferably a labelled probe.
  • the primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, is about 5 to 500 nt in length, more preferably, 10 to 200 nt, even more preferably 10 to 100 nt.
  • said nucleic acid is 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nt in length.
  • the primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, comprises a detectable label.
  • the primer or probe that hybridizes und stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 additionally comprises a quencher moiety.
  • the invention also relates to the use of a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 for the diagnosis of prostate cancer.
  • the invention relates to a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or any part thereof, wherein said primer or a probe is preferably a labelled probe.
  • the invention further relates to a nucleic acid with a sequence from the group of SEQ ID NO: 1 to 42, or the reverse complement thereof, or a nucleic acid that shares preferably at least 85%, 90%>, 95% or 99% sequence identity with a nucleic acid according to any one of the nucleic acids according to SEQ ID NO: 1 to 42.
  • the invention relates to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 or the reverse complement thereof, or a nucleic acid that shares preferably at least 85%, 90%, 95%) or 99%) sequence identity with the selected nucleic acid.
  • the invention relates to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 or the reverse complement thereof, or a nucleic acid that shares preferably at least 85%, 90%), 95%) or 99%o sequence identity with the selected nucleic acid.
  • the invention further relates to the use of a nucleic acid with a sequence from the group of SEQ ID NO: 1 to 42 for the diagnosis of prostate cancer.
  • the invention relates to the use of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or its revers complement for the diagnosis of cancer.
  • the invention relates to the use of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or its revers complement for the diagnosis of cancer.
  • the invention also relates to a kit for the screening and/or diagnosis of prostate cancer comprising a primer or probe that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.
  • the kit may contain more than one nucleic acid.
  • the kit additionally comprises reagents for nucleic acid amplification and/or quantification and/or detection.
  • the kit comprises control samples.
  • the invention relates to a kit for the screening and/or diagnosis of prostate cancer comprising a probe or primer that hybridizes under stringent conditions to a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.
  • the kit may contain more than one nucleic acid.
  • the kit additionally comprises reagents for nucleic acid amplification and/or quantification and/or detection.
  • the kit comprises control samples.
  • the invention relates to a method for the treatment and diagnosis of prostate cancer comprising the steps of analysing in a sample from a patient the expression level of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group comprising SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, wherein, if the expression level of said nucleic acid is above a threshold value, the sample is designated as prostate cancer positive; and administering to the patient one or more Prostate Cancer Therapeutic Agents.
  • the invention relates to a method for the treatment and diagnosis of prostate cancer comprising the steps of analysing in a sample from a patient the expression level of a splice variant of Ensembl gene ID ENSG00000245750.3 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, wherein, if the expression level of said nucleic acid is above a threshold value, the sample is designated as prostate cancer positive; and administering to the patient one or more Prostate Cancer Therapeutic Agents.
  • the Prostate Cancer Therapeutic Agents comprises: Docetaxel (Taxotere®); Cabazitaxel (Jevtana®); Mitoxantrone (Novantrone®); Estramustine (Emcyt®); Doxorubicin (Adriamycin®); Etoposide (VP- 16); Vinblastine (Velban®); Paclitaxel (Taxol®); Carbop latin (Paraplatin®); Abiraterone acetate, Bicalutamide, Casodex, Degarelix, Enzalutamide, Goserelin acetate, Leuprolide acetate, Prednisone, Sipuleucel-T, Radium 223 dichloride and/or Vinorelbine (Navelbine®).
  • the invention discloses biomarkers for prostate cancer, which allow a more accurate and sensitive diagnosis of the disease than current biomarkers.
  • PCa Prostate carcinoma (PCa) patients who underwent radical prostatectomy (RPE) or surgery to remove a benign prostate hyperplasia (BPH) at the University Hospital of Dresden were included in a retrospective clinical cohort aiming at identifying novel biomarkers for PCa. Approval from the local ethics committee as well as informed consent from the patients were obtained according to the legal regulations. Data on the clinical follow-up were collected for at least five years for the PCa patients.
  • RPE radical prostatectomy
  • BPH benign prostate hyperplasia
  • Prostate tissue samples from a cohort of 40 PCa patients and 8 BPH patients were used for identification of diagnostically relevant biomarkers by genome-wide RNA sequencing.
  • PCa groups were defined based on staging according to Gleason (The Veteran's Administration Cooperative Uro logic Research Group: histologic grading and clinical staging of prostatic carcinoma; in Tannenbaum, M. Urologic Pathology: The Prostate, Philadelphia: Lea and Febiger. Pp. 171-198) as well as the presence of metastases in the adjacent lymph nodes upon RPE (see Table 3).
  • the control group (C) consists of BPH samples.
  • Selected biomarker candidates were further validated by custom microarrays and quantitative reverse-transcription real-time PCR (qRT-PCR) on cohorts comprising 256 (40 control BPH, 216 tumour samples) and 56 patients (16 control BPH samples, 40 tumour samples), respectively.
  • qRT-PCR quantitative reverse-transcription real-time PCR
  • Prostate tissue samples Prostate tissue samples were obtained from surgery carried out at the Dept. of Urology of the University Hospital of Dresden and stored in liquid nitrogen at the Comprehensive Cancer Centre of Dresden University. Prostate tissue samples obtained from radical prostatectomies (RPEs) of prostate carcinoma (PCa) patients were divided into tumour and tumour-free samples. Prostate tissue samples from patients with benign prostate hyperplasia (BPH) were used as controls. Patient consent was always given.
  • RPEs radical prostatectomies
  • PCa prostate carcinoma
  • BPH benign prostate hyperplasia
  • Agilent Bioanalyzer 2100 Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA)
  • RNA sequencing was performed using a subset of the retrospective PCa cohort comprising 8 prostate tissue samples from benign prostate hyperplasia (BPH) as a control and 56 samples from patients with prostate cancer (including tumour and tumour-free tissue pairs from samples with Gleason score >7).
  • 1 ⁇ g of total RNA was depleted of ribosomal RNA using the Ribo-Zero rRNA Removal Kit (Epicentre).
  • Sequencing libraries were prepared from 50 ng of rRNA-depleted RNA using ScriptSeq v2 RNA-Seq Library Preparation Kit (Epicentre).
  • the di-tagged cDNA was purified using the Agencourt AMPure XP System Kit (Beckman Coulter).
  • PCR was carried out through 10 cycles to incorporate index barcodes for sample multiplexing and amplify the cDNA libraries.
  • the quality and concentration of the amplified libraries were determined using a DNA High Sensitivity Kit on an Agilent Bioanalyzer (Agilent Technologies). 4 ng each of 8 samples were pooled and size-selected on 2% agarose gels using agarose gel electrophoresis. The sample range between 150 bp and 600 bp was gel-excised and purified with the MinElute Gel Extraction Kit (Qiagen), according to manufacturer's instructions. The purified libraries were quantified on an Agilent Bioanalyzer using a DNA High Sensitivity Chip (Agilent Technologies).
  • Raw sequencing data comprising base call files (BCL files) was processed with CASAVA vl .8.1 (Illumina) resulting in FASTQ files.
  • FASTQ files contain for each clinical sample all sequenced RNA fragments, in the following referred to as "reads”. Specific adapter sequences were removed by using cutadapt (http://code.google.eom/p/cutadapt/).
  • Genome mapping and transcript assembling Reads were mapped to the human genome (assembly hgl9) using segemehl vO.1.4-382 and TopHat v2.0.9. Novel transcripts, i.e. transcripts not annotated in Gencode vl7, were assembled using Cufflinks v2.1.1 and Cuffmerge v2.1.1. All novel transcripts and all known Gencode vl7 transcripts were combined into a comprehensive annotation set. Analysis of sequencing data: Statistical analysis
  • Htseq-count v0.5.4pl http://www-huber.embl.de/users/anders/HTSeq/doc/count.html
  • Htseq-count v0.5.4pl http://www-huber.embl.de/users/anders/HTSeq/doc/count.html
  • cDNA was synthesized from 100 ng total RNA using the High- Capacity Reverse transcription kit (Applied Biosystems) and random primers according to manufacturer's instructions. Subsequent PCR assays were run using 4 ⁇ of the diluted cDNA. Quantitative real-time PCR was performed using custom- and pre-designed TaqMan Gene Expression Assays (Applied Biosystems) for housekeeping and target transcripts on an Applied Biosystems 7900HT Real-Time PCR System. Housekeeping/Target name TaqMan Assay ID
  • Table 4 IDs of the Applied Biosystems TaqMan Gene Expression Assays used for qRT- PCR validation in prostate tissue samples.
  • ROC Receiver-operating characteristic
  • Urine samples were collected after digital rectal examination (DRE) of the prostate (DRE urine). This routinely performed examination method allows getting urine samples that contain a certain amount of prostate cells.
  • the DRE urine samples were centrifuged and washed two times using PBS. The resulting cell pellet was resuspended in 700 ⁇ 1 Qiazol.
  • Total RNA was isolated using the miRNeasy Mini Kit on the QIAcube (all from Qiagen) with manual subsequent DNase I digestion. RNA concentration was determined using a Nanodrop 1000 (Peqlab). RNA integrity was verified on an Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA).
  • Quantitative real-time PCR screening of DRE urine samples cDNA was synthesized from 2x50 ng total RNA using the Superscript III Reverse transcriptase (Applied Biosystems) and random primers according to manufacturer's instructions. Subsequent PCR assays were run using 4 ⁇ of cDNA. Quantitative real-time PCR was performed using custom and pre-designed TaqMan Gene Expression Assays (Applied Biosystems) for housekeeping (PSA) and target transcripts on an Applied Biosystems 7900HT Real-Time PCR System. All samples were measured in duplicate and the means of these measurements were used for further calculations.
  • RNA sequencing total RNA from 7 DRE urine samples was precipitated using ethanol to concentrate the RNA amount and resuspended in ⁇ RNase free water.
  • the rRNA removal was performed with 4ng of total RNA using the Low input Ribo-Zero rRNA Removal Kit (Epicentre, modified by Clontech), resulting in ⁇ rRNA depleted RNA.
  • Sequencing libraries were prepared from 8 ⁇ 1 rRNA-depleted RNA using the SMARTER stranded RNAseq Kit (Clontech).
  • the di-tagged cDNA was purified using the Agencourt AMPure XP System Kit (Beckman Coulter).
  • PCR was carried out through 18 cycles to incorporate index barcodes for sample multiplexing and amplify the cDNA libraries.
  • the quality and concentration of the amplified libraries were determined using a DNA High Sensitivity Kit on an Agilent Bioanalyzer (Agilent Technologies). Samples were pooled and cluster generation was performed using 15pmol/l of the pooled library and the TruSeq PE Cluster Kit v4 (Illumina Inc.) in an Illumina cBOT instrument following the manufacturer's protocol. Sequencing was performed using the HiSeq SBS v4 sequencing reagents (250 cycles) on an Illumina HiSeq2500 sequencing machine (Illumina, Inc.). The details of the sequencing run were as follows: paired-end sequencing strategy; 126 cycles for Readl, 7 cycles for index sequences, and 126 cycles for Read2. Statistical analysis of the qRT-PCR results from DRE urines
  • PSA prostate specific antigen
  • Table 5 IDs of the Applied Biosystems TaqMan Gene Expression Assays used for qRT- PCR validation in DRE urine samples.
  • the transcriptomes of 40 PCa tumour samples and 16 tumour- free samples obtained upon RPE and 8 BPH prostate tissue samples as benign, non-tumour controls were analysed using strand- specific, paired-end long R A next generation sequencing (NGS). Approximately 150 cryosections per sample in at least three segments were prepared, aiming at an optimal data quality and robustness of the analysis. Upon pathological evaluation, only segments satisfying a maximal and minimal tumour cell count of 60% and 5% in tumour and tumour free samples, respectively, were retained for further analysis.
  • the transcriptome sequencing (RNAseq) approach aimed at a comprehensive identification and quantification of RNAs expressed in normal or cancer prostate tissue. All classes of coding and long non-coding transcripts independent of polyadenylation status were sequenced.
  • Table 6 Number of differentially expressed genes for diverse contrasts and Gencode biotypes.
  • assays can be set up based on the measurement of these newly discovered biomarkers alone or in combination (or in combination with other markers) in all sources that may contain prostate tumour cells or parts thereof (including vesicles like exosomes, micro vesicles, and others as well as free or protein-bound RNA molecules deriving from prostate tumour cells) to be used for the diagnosis of PCa.
  • sources include (but are not limited to) prostate tissue, biopsy material, lymph nodes, urine, ejaculate, blood, blood serum, blood plasma, circulating tumour cells in blood or lymph, as well as any tissue suspected to contain PCa metastases.
  • RNA biomarkers can be done by any method suited to specifically estimate RNA levels, e.g. PCR-based methods like qRT-PCR.
  • the assays can be applied for early diagnosis (screening) of PCa, for predicting the aggressiveness of the tumours (prognosis), and/or for aiding the choice of therapy.
  • Fig. l Verification of tissue sample quality: to determine the tumour cell content of the tissue samples, cryosections were prepared from the frozen samples as shown.
  • HE hematoxylin/eosin
  • IHC immunohistochemistry.
  • Verification of tissue sample quality cryosections of 4 ⁇ were prepared from the frozen samples as shown for HE staining (to ensure tumour cell content of the tissue samples), for RNA and DNA isolation and for IHC.
  • HE hematoxylin/eosin
  • IHC immunohistochemistry.
  • Fig.2 Box plot of RNA-seq data for transcript PCA3.
  • Fig.3 ROC curves of Retro -RPL7 (SEQ ID NO 1) and PCA3 obtained by qRT-PCR analysis of 56 prostate tissue samples.
  • Fig.4 RNA Next-Generation Sequencing data for SEQ ID NO: 4 to 10 from 64 tissue samples.
  • Fig.5 Custom microarray data for SEQ ID NO: 4 to 10 from 256 tissue samples.
  • Fig.6 Urine samples of patients with prostate cancer (Tumour) and healthy patients (Control) were obtained after digital rectal examination by a urologist. RNA isolated from these samples was subjected to transcriptome-wide RNA sequencing using an Illumina HiSeq2500 next-generation sequencer. Reads were mapped to the genome by standard algorithms. Reads mapping to the genomic loci of the transcript SEQ ID NOs shown were counted and normalized to reads derived from the gene locus of prostate-specific antigen as a measure for the presence of prostate epithelium cells in the urine for normalisation. Read numbers (million) are shown as log2 values.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne l'identification et la sélection de produits de transcription (biomarqueurs) exprimés de manière différente dans des cellules tumorales. La détermination spécifique de la concentration de ces biomarqueurs peut être utilisée pour le criblage et le diagnostic du cancer de la prostate. L'application clinique de dosages basés sur ces biomarqueurs favorise la diminution du nombre élevé de faux positifs de dosages de criblage standard actuels.
PCT/EP2014/076139 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate WO2015082414A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/100,943 US10196695B2 (en) 2013-12-02 2014-12-01 RNA-biomarkers for diagnosis of prostate cancer
EP14825105.1A EP3077530A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13195377.0 2013-12-02
EP13195377.0A EP2878678A1 (fr) 2013-12-02 2013-12-02 Biomarqueurs d'ARN pour le diagnostic du cancer de la prostate

Publications (1)

Publication Number Publication Date
WO2015082414A1 true WO2015082414A1 (fr) 2015-06-11

Family

ID=49680912

Family Applications (5)

Application Number Title Priority Date Filing Date
PCT/EP2014/076147 WO2015082420A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate
PCT/EP2014/076141 WO2015082416A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate
PCT/EP2014/076139 WO2015082414A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate
PCT/EP2014/076145 WO2015082418A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour diagnostiquer le cancer de la prostate
PCT/EP2014/076143 WO2015082417A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate

Family Applications Before (2)

Application Number Title Priority Date Filing Date
PCT/EP2014/076147 WO2015082420A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate
PCT/EP2014/076141 WO2015082416A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate

Family Applications After (2)

Application Number Title Priority Date Filing Date
PCT/EP2014/076145 WO2015082418A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour diagnostiquer le cancer de la prostate
PCT/EP2014/076143 WO2015082417A1 (fr) 2013-12-02 2014-12-01 Nouveaux biomarqueurs d'arn pour le diagnostic du cancer de la prostate

Country Status (4)

Country Link
US (5) US10196696B2 (fr)
EP (6) EP2878678A1 (fr)
ES (3) ES2784246T3 (fr)
WO (5) WO2015082420A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10196696B2 (en) 2013-12-02 2019-02-05 Fraunhofer-Gesellschaft Zur Förderung Der Angewand RNA-biomarkers for diagnosis of prostate cancer
US11299786B2 (en) 2018-07-05 2022-04-12 Rutgers, The State University Of New Jersey Gene panel to predict response to androgen deprivation in prostate cancer

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3227460B1 (fr) * 2014-12-01 2021-01-27 Fraunhofer-Gesellschaft zur Förderung der Angewandten Forschung e.V. Nouvelle signature de biomarqueur rna pour le diagnostic du cancer de la prostate
US20200102618A1 (en) * 2017-03-17 2020-04-02 Nantomics, Llc LIQUID BIOPSY FOR cfRNA
CN112226511B (zh) * 2020-10-19 2022-06-07 南方医科大学珠江医院 一种前列腺癌circRNA标志物及其应用
WO2022229647A1 (fr) * 2021-04-28 2022-11-03 Enara Bio Limited Nouveaux antigènes cancéreux et procédés
EP4332240A1 (fr) 2022-09-05 2024-03-06 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Biomarqueurs d'arn pour le diagnostic du cancer de la prostate

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060860A2 (fr) * 2000-02-17 2001-08-23 Millennium Predictive Medicine, Inc. Genes, compositions, kits, et procedes d'identification, d'evaluation, de prevention, et de traitement du cancer de la prostate
WO2005007830A2 (fr) * 2003-07-14 2005-01-27 Mayo Foundation For Medical Education And Research Procedes et compositions pour diagnostic, stadage et pronostic du cancer de la prostate
WO2013028788A1 (fr) * 2011-08-22 2013-02-28 Exosome Diagnostics, Inc. Marqueurs biologiques d'urine

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US20050118625A1 (en) * 2003-10-02 2005-06-02 Mounts William M. Nucleic acid arrays for detecting gene expression associated with human osteoarthritis and human proteases
CA2539681A1 (fr) * 2003-10-02 2005-04-21 Merck & Co., Inc. Molecules d'acides nucleiques codant de nouvelles proteines humaines de canaux calciques actives par une basse tension appelees alpha 1i-1 et alpha 1i-2, proteines codees et procedes d'utilisation correspondants
US7374927B2 (en) * 2004-05-03 2008-05-20 Affymetrix, Inc. Methods of analysis of degraded nucleic acid samples
CA2586201A1 (fr) 2004-11-03 2006-05-11 Almac Diagnostics Limited Technologie de micro-reseaux de transcriptome et procedes d'utilisation de celle-ci
US9365049B2 (en) 2009-09-22 2016-06-14 Correlated Magnetics Research, Llc Magnetizing inductor and a method for producing a magnetizing inductor
WO2012174256A2 (fr) * 2011-06-17 2012-12-20 The Regents Of The University Of Michigan Profils de méthylation de l'adn dans le cancer
EP2878678A1 (fr) 2013-12-02 2015-06-03 Fraunhofer-Gesellschaft zur Förderung der Angewandten Forschung e.V. Biomarqueurs d'ARN pour le diagnostic du cancer de la prostate

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060860A2 (fr) * 2000-02-17 2001-08-23 Millennium Predictive Medicine, Inc. Genes, compositions, kits, et procedes d'identification, d'evaluation, de prevention, et de traitement du cancer de la prostate
WO2005007830A2 (fr) * 2003-07-14 2005-01-27 Mayo Foundation For Medical Education And Research Procedes et compositions pour diagnostic, stadage et pronostic du cancer de la prostate
WO2013028788A1 (fr) * 2011-08-22 2013-02-28 Exosome Diagnostics, Inc. Marqueurs biologiques d'urine

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416804.2 (RP11-279F6.1 gene), lincRNA", XP002736946, retrieved from EBI accession no. EM_STD:HG507175 Database accession no. HG507175 *
DATABASE EMBL [Online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416805.13 (RP11-279F6.1 gene), lincRNA", XP002736951, retrieved from EBI accession no. EM_STD:HG507180 Database accession no. HG507180 *
DATABASE EMBL [Online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416807.2 (RP11-279F6.1 gene), lincRNA", XP002736952, retrieved from EBI accession no. EM_STD:HG507181 Database accession no. HG507181 *
DATABASE EMBL [Online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416816.1 (RP11-279F6.1 gene), lincRNA", XP002736947, retrieved from EBI accession no. EM_STD:HG507174 Database accession no. HG507174 *
DATABASE EMBL [Online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416818.1 (RP11-279F6.1 gene), lincRNA", XP002736948, retrieved from EBI accession no. EM_STD:HG507177 Database accession no. HG507177 *
DATABASE EMBL [Online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416819.1 (RP11-279F6.1 gene), lincRNA", XP002736949, retrieved from EBI accession no. EM_STD:HG507178 Database accession no. HG507178 *
DATABASE EMBL [Online] 23 October 2013 (2013-10-23), "TPA: Homo sapiens long non-coding RNA OTTHUMT00000416820.1 (RP11-279F6.1 gene), lincRNA", XP002736950, retrieved from EBI accession no. EM_STD:HG507179 Database accession no. HG507179 *
J. HARROW ET AL: "GENCODE: The reference human genome annotation for The ENCODE Project", GENOME RESEARCH, vol. 22, no. 9, 1 September 2012 (2012-09-01), pages 1760 - 1774, XP055174460, ISSN: 1088-9051, DOI: 10.1101/gr.135350.111 *
JOHN R PRENSNER ET AL: "Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression", NATURE BIOTECHNOLOGY, vol. 29, no. 8, 31 July 2011 (2011-07-31), pages 742 - 749, XP055106101, ISSN: 1087-0156, DOI: 10.1038/nbt.1914 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10196696B2 (en) 2013-12-02 2019-02-05 Fraunhofer-Gesellschaft Zur Förderung Der Angewand RNA-biomarkers for diagnosis of prostate cancer
US10196695B2 (en) 2013-12-02 2019-02-05 Fraunhofer-Gesellschaft Zur Förderung Der Angewandten Forschung RNA-biomarkers for diagnosis of prostate cancer
US10287634B2 (en) 2013-12-02 2019-05-14 Fraunhofer-Gesellschaft Zur Förderung Der Angewand RNA-biomarkers for diagnosing prostate cancer
US10301683B2 (en) 2013-12-02 2019-05-28 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. RNA-biomarkers for diagnosis of prostate cancer
US11299786B2 (en) 2018-07-05 2022-04-12 Rutgers, The State University Of New Jersey Gene panel to predict response to androgen deprivation in prostate cancer

Also Published As

Publication number Publication date
EP3077531B1 (fr) 2020-06-24
EP3077535B1 (fr) 2020-01-08
WO2015082417A1 (fr) 2015-06-11
US20160312291A1 (en) 2016-10-27
EP3077535A1 (fr) 2016-10-12
ES2732371T3 (es) 2019-11-22
US20160304966A1 (en) 2016-10-20
WO2015082416A1 (fr) 2015-06-11
US20160304967A1 (en) 2016-10-20
US10301683B2 (en) 2019-05-28
EP2878678A1 (fr) 2015-06-03
EP3077536A1 (fr) 2016-10-12
US10196696B2 (en) 2019-02-05
WO2015082418A1 (fr) 2015-06-11
EP3077530A1 (fr) 2016-10-12
EP3077531A1 (fr) 2016-10-12
WO2015082420A1 (fr) 2015-06-11
US20160304965A1 (en) 2016-10-20
WO2015082416A8 (fr) 2016-09-15
ES2784246T3 (es) 2020-09-23
ES2726667T3 (es) 2019-10-08
US10196695B2 (en) 2019-02-05
US10287634B2 (en) 2019-05-14
US20160298199A1 (en) 2016-10-13
EP3077537B1 (fr) 2019-03-27
EP3077536B1 (fr) 2019-02-13
EP3077537A1 (fr) 2016-10-12

Similar Documents

Publication Publication Date Title
US10301683B2 (en) RNA-biomarkers for diagnosis of prostate cancer
EP2640854B1 (fr) ARNnc PCAT1 ET UTILISATIONS DE CELUI-CI
EP2481805A2 (fr) Procédés de différenciation entre le cancer du pancréas d'une fonction pancréatique normale et/ou de la pancréatite chronique
EP2971177B1 (fr) Compositions et procédés pour détecter et déterminer un pronostic de cancer de la prostate
CN108949992B (zh) 一种与食管鳞癌及其分级相关的生物标志物
AU2020208787A1 (en) Biomarkers for renal cell carcinoma
EP3227460B1 (fr) Nouvelle signature de biomarqueur rna pour le diagnostic du cancer de la prostate
KR102096498B1 (ko) 대장암 진단 또는 재발 예측을 위한 마이크로RNA-4732-5p 및 이의 용도
WO2015137406A1 (fr) Méthode de différenciation entre un carcinome pulmonaire à cellules squameuses et un adénocarcinome pulmonaire
EP4332240A1 (fr) Biomarqueurs d'arn pour le diagnostic du cancer de la prostate
KR102096499B1 (ko) 대장암 진단 또는 재발 예측을 위한 마이크로rna-3960 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14825105

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15100943

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2014825105

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014825105

Country of ref document: EP