WO2015057919A1

WO2015057919A1 - Transgenic hepatitis b virus (hbv): a new model of hbv infection identifies uqcr10 as a viral replication factor

Info

Publication number: WO2015057919A1
Application number: PCT/US2014/060821
Authority: WO
Inventors: Michael TORBENSON; Hubert D-J DANIEL
Original assignee: The Johns Hopkins University
Priority date: 2013-10-18
Filing date: 2014-10-16
Publication date: 2015-04-23

Abstract

The present invention relates to the field of virology. More specifically, the present invention provides compositions and methods directed to transgenic hepatitis B virus (HBV). In one embodiment, a transgenic hepatitis B virus (HBV) construct comprises (a) a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding HBV pgRNA.

Description

TRANSGENIC HEPATITIS B VIRUS (HBV): A NEW MODEL OF HBV INFECTION IDENTIFIES UQCR10 AS A VIRAL REPLICATION FACTOR

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 61/892,532, filed October 18, 2013, which is incorporated herein by reference in its entirety.

STATEMENT OF GOVERNMENTAL INTEREST

This invention was made with government support under grant no. R01DK078686, awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates to the field of virology. More specifically, the present invention provides compositions and methods directed to transgenic hepatitis B virus (HBV).

INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED

ELECTRONICALLY

This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCII text file entitled "P12616-02_Sequence_Listing_ST25.txt." The sequence listing is 7,394 bytes in size, and was created on October 16, 2014. It is hereby incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

Hepatitis B virus (HBV) infection is a global public health problem with over 350 million individuals infected worldwide. In the United States, 1.25 to 2 million individuals have chronic HBV. The substantial morbidity and mortality caused by chronic HBV are well known in the medical and scientific communities and include the development of liver cirrhosis, liver decompensation, and liver cancer. Current treatments are limited and provide few individuals with a sustained, long term reduction in viral replication. Even fewer individuals achieve sustained viral clearance. Thus, new treatments are needed for chronic HBV. New treatment approaches are most likely to be successful when they are firmly grounded in scientific understandings of viral biology. In this regard, one of the great mysteries remaining in HBV biology is which cellular proteins and related molecules are critical to the initial steps of viral entry and sustained viral replication. While several decades of work have attempted to identify HBV receptor, the receptor remains unknown. However, the data generally supports the presence of a low affinity receptor for initial viral attachment and a high affinity receptor for specific viral recognition. Also of note, the viral kinetics of entry require a relatively long exposure of up to 16 hours, at least for duck HBV. Current evidence suggests the cellular receptor for HBV binds to the HBV S protein via determinants on the pre-Sl component. Candidates for the HBV receptors included apoliprotein H, endonexin II (now called annexin 5), and caroboxypeptidase D, amongst others. However, none of these candidates have been proven to be essential for viral entry.

HepG2 and Huh7 liver cell lines are widely used to study viral replication and viral protein production. These cell lines are not susceptible to sustained infection by intact HBV virions, but they will transiently produce viral proteins and secrete fully packaged viral particles after full length viral DNA is forced into the cells by transfection. However, the viral replication quickly wanes and is essentially lost after several days of cell culture. Of note, some studies suggest that liver cell lines like HepG2 actually have the viral receptor and that unmodified virions can enter the cells under certain culture conditions, but normal infection does not reliably proceed further, presumably because the cells lack necessary factors critical for sustained viral replication. The question remains unsettled of whether intact virions can enter HepG2 cells in the same manner that they infect normal hepatocytes. For this reasons, we pursued a functional approach to identifying key viral entry factors/early replication factors, choosing an approach that was solely based on viral entry and replication in cells and was not dependent on a prior knowledge of whether the cell lines lacked a receptor versus other post-receptor factors necessary for sustained infectivity.

SUMMARY OF THE INVENTION

The present invention is based, at least in part, on the development of transgenic hepatitis B viruses that express foreign or heterologous proteins. The present invention allows insertion of a foreign gene into the viral genome, while still allowing viral replication and packaging of infectious virions. The present invention can be used as a model for drug development in HBV, as well as to study HBV virology, replication, cell entry, integration into the human genome, and cccDNA persistence. In other embodiments, the present invention can be used to introduce genes into human cells, more specifically, genes and DNA segments containing multiple genes into the human genome.

Thus, in one aspect, the present invention provides transgenic HBV constructions. In one embodiment, a transgenic hepatitis B virus (HBV) construct comprises (a) a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding HBV pgRNA. In certain embodiments, the R region is the 5' R region. In a specific embodiment, the foreign gene is inserted at the 1852 bp of the 5' R region, as numbered from the EcoRI digestion site. In another embodiment, the foreign gene is inserted at the 1901 bp of the 5' R region, as numbered from the EcoRI digestion site. A heterologous gene can be inserted between the 1852 and the 1901 bp sites of the 5' R region. In fact, the foreign gene can be inserted at any bp of the 5' region. In a particular embodiment, the foreign gene is an antibiotic resistance gene. In another embodiment, the foreign gene encodes a fluorescent protein.

The present invention also provides vectors comprising a transgenic HBV construct. The present invention also provides a virus comprising the transgenic HBV construct. In one embodiment, a vector comprises a transgenic HBV construct, wherein the HBV construct comprises a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding HBV pgRNA.

In a further embodiment, a transgenic HBV construct comprises (a) a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a gene encoding a selectable marker inserted into the 5' R region of the nucleotide sequence encoding HBV pgRNA. The present invention also provides a transgenic viral covalently closed circular DNA (cccDNA) comprising (a) a nucleotide sequence encoding viral pgRNA and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding viral pgRNA.

In another aspect, the compositions of the present invention can be used in high throughput screening of HBV drugs. In a specific embodiment, potential drug candidates are contacted with cells transfected with a composition described herein (e.g., a vector comprising a transgenic HBV construct). In particular embodiments, the foreign gene inserted into the R region comprises a reporter gene, which can be used to identify promising HBV drug candidates.

In yet another aspect, the present invention provides methods and compositions useful for treating or preventing HBV. In a specific embodiment, a method for treating or preventing HBV in a patient in need thereof comprises administering an effective amount of a UQCR10 modulator. In particular embodiments, the UQCR10 modulator is an inhibitor or antagonist. In certain embodiments, the modulator is selected from the group consisting of a small molecule, an antibody, an aptamer, and an inhibitory nucleic acid molecule. In a specific embodiment, the modulator is a small molecule. In other embodiments, the inhibitory nucleic acid molecule is an antisense oligonucleotide, a short interfering RNA (siRNA), or a short hairpin RNA (shRNA).

BRIEF DESCRIPTION OF THE FIGURES FIG. 1. Transgenic HBV maps. FIG. 1A. Map of the "front" transgenic HBV, where the foreign gene is inserted within the first R region. Sequence numbering is from the traditional EcoRl digestion site in the hepatitis B genome. FIG. IB. Map of the "back" transgenic HBV, where the foreign gene is inserted within the first R region.

FIG. 2. Experimental outline. Assay used to identify viral entry/replication factors.

FIG. 3 A. Western blot for UQCRIO protein. Lane 1 : Positive control consisting of mitochondrial protein extracted from human heart (MitoSciences, Eugene, Oregon, USA); Lane 2: representative normal liver; Lane 3; second case of representative normal liver; Lane 3: HepG2 cell line permanently expressing UQCRIO; Lane 4, wild type HepG2; Lane 5: Huh7 cell line permanently expressing UQCRIO; Lane 6, wild type Huh7; Lane 7, HepG2 cell line selected out by assay experiment. FIG. 3B. Densitometry of lanes in FIG. 3A. Protein levels were normalized to the control in lane 1. Two independent blots were analyzed. The average ratio of the test/control (+standard deviation) is shown.

FIG. 4. Immunohistochemistry for UQCRIO expression. FIG. 4A (original magnification, 160X), Non-neoplastic hepatocytes express UQCRIO; FIG. 4B (160X), Hepatocellular carcinoma expresses UQCRIO; FIG. 4C (160X), Wild type Huh7 cell lines have little or no UQCRIO expression; FIG. 4D (100X), Wild type HepG2 cell lines have little or no UQCRIO expression; FIG. 4E (160X), HepG2 cells obtained at the end of the assay express UQCRIO; FIG. 4F (400X), Higher magnification from same cells in panel E showing granular cytoplasmic staining.

FIG. 5. Transgenic confirmation studies. Experimental outline and results, which demonstrates that permanent UQCRIO Huh7 cell lines are permissive for sustained infection by transgenic HBV.

FIG. 6. Diagram of assay for missing receptor/replication factor.

FIG. 7. Immunohistochemistry for hepatitis B surface antigen. FIG. 7A (original magnification 260X). Wild type HepG2 cells are negative for HBsAg; FIG. 7B (original magnification 260X). Wild type Huh7 cells are negative for HBsAg; FIG. 7C (original magnification 160X). Fully selected HepG2 cells from the assay Sc20 are strongly positive for HBsAg; FIG. 7D (original magnification 260X). Higher magnification image from cells in panel C showing strong cytoplasmic staining.

FIG. 8. ELISA and IHC on TG HBV and UQ confirmation.

FIG. 9. Experimental design to investigate whether UQCRIO enhances sustained viral replication. A low-producing UQCRIO permanent cell line is exposed to transgenic virus. Permanent cell lines typically have a range of vector expression levels at the individual cell level. In this experiment, transgenic HBV can enter any cell within the low-producing UQCRIO permanent cell line, but when Blasticidin antibiotic pressure is added, those cell lines that can best support sustained viral replication are enriched. Western blots demonstrate that these cells have increased UQCR10 expression levels.

FIG. 10. Hepatitis B binds to the cellular receptors via the viral pre-Sl surface antigen protein. This experiment was performed in triplicate and demonstrates that transgenic HBV entry into UQCR10 permanent cell lines is dependent on pre-Sl protein because it can be blocked by pre-S 1 antibody. Transgenic HBV encoding GFP were transfected into cells growing in the cell inserts. After 24 hours, the insert was placed into a well containing UQCR10 permanent cell HepG2 cells. After various times (48 hours, 96 hours) the inserts were removed, cells were washed, and analyzed by flow cytometry. The flow sorted cells in the no antibody control were then combined and grown in a 6 well plate for 48 hours and the supernatant analyzed to confirm HBsAg expression (x O.D).

FIG. 1 1. Low but persistent HBsAg after exposure to human serum with unmodified HBV virions. Wild type HepG2 and UQCR10 permanent HepG2 cell lines were seeded in 6 well plates and exposed for 72 hours to 6 log copies of unmodified HBV virions from human serum pools. After this, cells were washed and split and HBsAg levels measured every 3-4 days, prior to splitting. Wild type control HepG2 cells (not shown) showed higher levels of HBsAg in the supernatant then UQCR10 for the first 2 splits, consistent with viral binding and slow release by the wild type cells, a finding also noted by others in other experimental models(2). By split 5, controls were negative.

FIG. 12. pgRNA in transgenic virus/plasmid constructs. The transgenic viral-vector construct can serve as a template for multiple pgRNA transcripts. Because pgRNA is a greater than full length transcript of cccDNA, it has two terminal redundancies, which both contain a pgRNA start site as well as a polyA signal. The 1.3X length of transgenic HBV that is cloned into the vector serves the role of cccDNA and also has two terminal redundancies, which both contain a pgRNA start site as well as a polyA signal. Thus, multiple transcripts are possible. Transcript 1 (diamond) was the anticipated transcript given our HBV DNA construct and is the same size of the wild type pgRNA plus the transgene. Transcript 1 was directly detected using 5' race, which showed pgRNA transcripts that included the transgene. Transcript 2 (diamond) encodes the entire transgenic virus as well as the entire plasmid. For methodological reasons, transcript 2 is difficult to directly demonstrate but is inferred based on the results of the assays, including the negative controls that rule out nonspecific uptake of 1.3x transgenic HBV-plasmid constructs that might be released by dying cells in the inserts (FIG. 2) or left over from transfection. Transcript 3 (diamond) encodes a "defective virus" that contains all of the vector and transgene but is missing most of the HBV DNA. This transcript was demonstrated by temporary transfection of the full 1.3X transgenic virus-plasmid constructs into HepG2 cells, followed by addition of Gentamicin, which adds selective pressure to retain the Gentamicm antibiotic resistance gene encoded by the vector. After several passages, cells were harvested, episomal DNA harvested by miniprep, and electroporated into bacteria. Clones that correlated with transcript 3 were easily found.

DETAILED DESCRIPTION OF THE INVENTION

It is understood that the present invention is not limited to the particular methods and components, etc., described herein, as these may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a "protein" is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.

All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. In addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention.

Transgenic HBV: A new model of HBV infection. As a first step, a new model of hepatitis B was developed and implemented: transgenic hepatitis B viruses that express foreign proteins. Transgenic hepatitis B viruses were created with antibiotic resistance genes or green fluorescent protein genes. The foreign gene contained by the transgenic hepatitis B virus allows selection for subgroups of cells that have become infected by the transgenic virus.

Insertion of a foreign gene into the HBV genome without disrupting viral gene expression is challenging because the HBV genome has overlapping open reading frames. Thus, insertion at a given location may avoid disrupting one gene, but likely will disrupt other genes coded in overlapping reading frames. However, based on analysis of the HBV genome and empirical observations, we successfully inserted foreign genes at nucleotide sites 1852 base pair (bp) or 1901bp (FIG. 1). Consideration of the known HBV genetic map reveals the following: (1) insertion of new genes at 1852 bp or 1901 bp locations does not interrupt the P, S, X, or C open reading frames; (2) DR1 and DR2 are not affected and the epsilon region is not affected (1901 insertion site) or affected only at the outer edge of the Epsilon coding region (1852 insertion site). Epsilon is a segment of the pgR A that forms a hairpin secondary structure that is necessary for pgRNA encapsidation and for DNA replication; (3) pgRNA is affected and increases in length because of the transgene; (4) the HBeAg open reading frame is affected by both insertion sites, although the affected part is normally cleaved off in the Golgi prior to secretion of HBeAg for the 1852 insertion site (11). Nonetheless, transgenic hepatitis B genomes with both insertion sites secrete HBeAg (Table 5).

In order to create packaged, infectious, transgenic virions, we constructed greater-than full length transgenic viruses (1.3X full length) and cloned them into a mammalian expression vector (pcDNA3.1). This 1.3X unit length of transgenic HBV DNA serves the function of covalently closed circular DNA (cccDNA). cccDNA is the form of viral DNA that allows production of infectious virions by serving as the template for the production of pre-genomic RNA (pgRNA). pgRNA is a greater-than-full-length transcription of cccDNA that is packaged into virions and subsequently reverse transcribed into viral DNA. Because the pgRNA is created by transcribing the entire circular loop of cccDNA, plus an extension beyond the initial start point, pgRNA contains two terminal redundancies, denoted as "R," which are located at both the 5' and 3' end of the pgRNA. The R contains key viral DNA regulatory sequences including DR1 as well as the epsilon region. In normal HBV replication, the 5' R will be incorporated into the viral cccDNA while most of the 3' R will not. Of note, the transgene insertions sites of 1852 and 1901 are both in the R region. Thus, there are two ways to construct the 1.3X transgenic viral genomes. In the first construct, the transgene is inserted in the 5' R (FIG. 1A), while in the second, the transgenes is inserted in the 3'R (FIG. IB). In the second model, the transgene is included in the pgRNA but not in the fully reverse transcribed viral DNA. These designs have different outcomes: the first construct produces fully packaged transgenic HBV, while the second construct packages wild type virus. The first transgenic HBV design was used in subsequent assays for viral entry factors. A new functional assay identifies UQCR10. We designed a functional assay to identify viral entry/persistent replication factors based on the assumption that HepG2 and Huh7 cell lines do not sufficiently express a protein(s) needed for viral entry, initial replication, or sustained maintenance of viral replication (FIG. 2 and FIG. 6). In this assay, this unknown protein(s) is restored to the liver cell lines HepG2 or Huh7 by transfection of a gene expression library that was made from mRNA extracted from histologically normal human liver tissue. After this transfection, a random subset of the HepG2 or Huh7 cells are anticipated to express the missing factor(s) needed for viral entry/early replication. In the next step of the assay, these library-transfected cells are exposed to infectious transgenic virions for 3 days. The cell lines in the cell culture well inserts (FIG. 2) secrete transgenic virus into the media, which is shared by the cells that were transfected with the full liver expression library. Physical barriers keep the cells completely separated. The long exposure was chosen because published data suggests relatively slow viral entry. After this, antibiotics are added to select for those cells that have become infected with transgenic hepatitis B virions. Most cells die (>99%), but cells will survive if they express factors from the expression library that permitted entry or sustained replication of the transgenic virus encoding the antibiotic resistance gene. After the cells are fully selected in antibiotics, cellular DNA is harvested and the library vector identified by PCR and sequencing.

To estimate the percent of cells that would pick up transgenic virus in this assay, the experiment was first performed in Huh7 cells in duplicate with transgenic virus encoding a green fluorescent protein. Flow cytometry at 72 hours, demonstrated a small percentage of library transfected cells (0.6+0.2%) that were strongly GFP positive. This data encouraged us by providing evidence for the infectivity of the transgenic virus and provided an estimate of the percent of cells that express either the receptor or factors necessary for sustained replication.

The assay (FIG. 2) was then repeated on 4 separate occasions using transgenic viruses encoding antibiotic resistance genes and both HepG2 and Huh7 cell lines. In each experiment, the fully selected cells at the end of the assay contained a library vector with DNA encoding the UQCR10 gene (Supplemental Tables 2, 3). The fully selected cells were also positive for HBsAg (FIG. 7). Examination of the original liver gene expression library by real time PCR showed that UQCR10 made up 0.5% of the original library.

Control conditions ruled out nonspecific uptake of transgenic viral DNA by the library-expressing cells (Supplemental Tables 2). To rule out UQCR10 selection that was independent of viral infection, additional experiments were performed in which the library alone was transfected into wild type cell lines, followed by months of selection in Gentamicin (the library vector encodes the antibiotic resistance gene for Gentamicin): no enrichment for UQCRIO was seen.

UQCRIO codes for the protein ubiquinol-cytochrome c reductase, subunit 10, of mitochondrial complex III. Mitochondrial complex III forms the middle segment of the respiratory chain of the inner mitochondrial membrane (12). A mitochondrial associated gene was a surprise result; we had anticipated finding a gene associated with the cell membrane that would potentially be part of the HBV receptor complex or a gene linked to cell signaling pathways known to be important in HBV replication . However, the result had indirect support in the literature. First, reduced UQCRIO levels in hepatocellular carcinoma cell lines HepG2 and Huh7 was not implausible, as complex III proteins can be reduced in hepatocellular carcinoma tissue compared to normal livers. Secondly, glucocorticoids are known to increase HBV replication in HepG2 cells and a prior study showed that glucocorticoids increase mitochondrial complex III activity in HepG2 cells. Thirdly, ddC reduces all mitochondrial proteins, including complex III, and inhibits HBV replication in a HepG2 model.

Confirmation of UQCRIO as a viral replication factor. To directly determine a role for UQCRIO in HBV infection, we analyzed UQCRIO levels in human tissues and HepG2 and Huh7 cell lines and tested whether restoration of UQCRIO protein levels in these cell lines would make them susceptible to sustained infection. First, UQCRIO mRNA was measured in HepG2 and Huh7 cell lines: surprisingly, the levels were similar to normal liver tissues (Table 8). However, protein levels were significantly lower in HepG2 and Huh7 cell lines than in human liver tissues (FIG. 3), suggesting a post transcriptional inhibitor of UQCRIO expression. Protein levels were not restored by temporary transfection but were partially restored by creating permanent cell lines containing UQCRIO cloned into an expression vector (FIG. 3, lanes 4 and 6). In addition, one of the cell lines that grew from one of the assay replicates (laboratory designation sc20 Z3) was also tested and expressed high levels of UQCRIO protein (FIG. 3, lane 8). Immunohistochemistry confirmed these findings: UQCRIO protein expression was seen in both the cytoplasm of non-neoplastic liver tissues (FIG. 4A) and in the cytoplasm of hepatocellular carcinoma (FIG. 4B), but showed low to absent expression in HepG2 and Huh7 cell lines (FIG. 4, panels C, D). UQCRIO protein expression levels were also positive in cell line sc20 Z3 (FIG. 4, panels E, F).

We next investigated whether HepG2 and Huh7 cell lines with permanent expression of UQCRIO protein could be infected by transgenic hepatitis B particles. After exposing Huh7 cells to transgenic virions, transgenic virus was able to enter and replicate in cells that express UQCR10 but not in wild type cell lines (FIG. 5). HBsAg was also detectable by ELISA in the cell culture supernatant and in the cell cytoplasm by immunohistochemistry, confirming viral entry and subsequent protein production (FIG. 8). These results demonstrate successful infection of replicating liver cell lines using infectious virions. Control wells were exposed to plasmid constructs with the 1.3X transgenic viral DNA instead of the secreted transgenic virions and all of these died in the presence of antibiotic, demonstrating that entry of transgenic viral DNA into the permanent UQCR10 cell lines required the association of viral proteins, presumably containing the peptides that interact with the cellular receptor(s). Without the presence of antibiotic pressure (FIG. 5), viral protein expression levels were low in the UQCR10 cell lines (FIG. 8). This observation suggests that viral infection does not necessarily lead to long term viral retention in rapidly dividing cell lines without the presence of selective pressure to retain the virus. Also of note, the control wild type Huh7 cell lines (FIG. 5) were clearly HBsAg and HBV DNA positive at the end of the experiment (Table 9), indicating that the viral receptor is expressed on wild type cell lines. However, without UQCR10, the HBV DNA levels consistently fell, split-over-split until they were nearly absent by the experimental end (Table 9).

This new observation indicating that transgenic virus can infect wild type cells raised the question of the role played by UQCR10. To examine this question further, we tested whether transgenic viral infection and sustained replication was supported by UQCR10. In this experiment (FIG. 9), a permanent UQCR10 HepG2 cell line was used, but instead of a wild type control, we used a second UQCR10 cell line that was previously created but showed low expression of UQCR10 by western blot. Most permanent cell lines have heterogeneity at the individual cell level for expression of the vector encoded gene, in this case UQCR10, and we reasoned that this could be exploited to study the role of UQCR10. If UQCR10 plays an important role in sustaining persistent viral replication, we hypothesized that transgenic virus should enter many different cells within the low-UQCRlO producing cell line, but should replicate better in those cells with higher levels of UQCR10 expression. Thus, HBV sustained infection should preferentially occur in the subpopulation of cells within the low-UQCRlO producing cell line that have relatively more UQCR10 expression. It then follows that daughter cells selected at the end of the experiment should produce more UQCR10. The experimental results were as predicted; indicating UQCR10 enhanced viral replication (FIG. 9). Prior research has firmly established a role for the viral preS 1 protein in binding the cell receptor. Given this, we studied whether the entry of transgenic virus into UQCRIO positive cell lines was also dependent on the viral pre-Sl protein. Blocking studies with pre- Sl antibodies strongly inhibited transgenic infection of cell lines (FIG. 10).

Lastly, to confirm a role for UQCRIO with infection from natural hepatitis B virions,

UQCRIO permanent cell lines were exposed to unmodified human serum from individuals infected with chronic hepatitis B. Low but persistent viral protein production was observed for as long as 12 splits (FIG. 11). However, viral DNA, as measured by real time PCR, was barely detectable in both cell culture supematants and cellular extracts. The lack of infection with robust DNA levels supports the hypothesis that additional pressure is required for cells to retain the virus, but could also be explained by insufficient infectious viral particles in the human serum or other unknown factors.

Functional studies of UQCRIO. The reduction in UQCRIO protein expression in both cell lines may represent cellular adaptation to cell culture conditions. The location of the UQCRIO in the cell cytoplasm is most consistent with a no direct physical role in viral entry to the cell cytoplasm. However, it is possible that UQCRIO expression may stimulate downstream targets that do have a role in physical entry of the virus or in early replication. To explore this further, genome wide expression studies were performed to compare the gene expression patterns of UQCRIO permanent HepG2 and Huh7 cell lines to their respective wild type controls. Analysis of changes in individual genes and in expression pathways did not identify any strong candidates for a receptor, consistent with UQCRIO playing a role in sustained viral replication after viral entry into the cell (Table 10).

We next proceeded with additional functional studies to evaluate the effect of UQCRIO protein expression. Prior studies have suggested that "maturation" of cell lines increases HBV replication. To investigate if UQCRIO affected cellular maturation, mRNA levels of 6 different genes associated with a mature hepatocyte phenotype were measured. Interestingly, UQCRIO had opposite effects on the two studied cell lines, leading to increased expression of genes associated with a mature hepatocyte phenotype in Huh7 but not in HepG2 (Table 11). UQCRIO expression also did not affect ATP production, apoptosis, phagocytic activity, or proliferation (Table 12). However, UQCRIO expression clearly enhanced HBsAg secretion into the supernatant after temporary transfection in HepG2 cells (Table 12). Together, these data suggest that UQCRlO's role in HBV infection does not primarily involve non-specific functions such as increasing the maturation of the cell lines, increasing energy production, increasing phagocytic activity, or changing the balance of apoptosis and proliferation in these cell lines. UQCRIO expression increases the level of viral protein secretion.

Additional unique aspects of the transgenic HBV model. Analysis of miniprep DNA from fully selected cells in the Scl6 assay (supplemental methods) revealed an additional surprise. Sequencing of clones obtained from electroporation of bacteria showed that most were positive for UQCRIO. However, a subset of the clones contained unexpected configurations of the transgenic HBV and its vector, whose DNA sequence indicated that in some instances pgRNA had started at the second pgRNA start site and extended around the full length of the vector to end at the first stop sequence in the HBV genome (FIG. 12, transcript No. 3). This DNA molecule was designated "partial virus-full vector" and could be reproduced by temporary transfection of the full 1.3X vector-plasmid construct into HepG2 cells, followed by selection in geneticin, for which the vector has an antibiotic resistance gene. Gentamicin provides pressure to retain vector DNA and sequencing of plasmids obtained by miniprep under these conditions showed the exact partial virus-full vector sequence predicted by use of this alternative start and end site of pgRNA. These viral-vector configurations would be unable to self-replicate through the normal HBV pathways due to the absence any complete viral proteins and are thus "dead-end" or "defective" viruses.

Further analysis of the fully selected cell lines from the Scl6 assay (Table 6) was also surprising because the fully selected cells had high levels of both transgenic viral DNA as well as the plasmid DNA in which the transgenic virus had been cloned (pcDNA3.1). This finding raised the possibility that the assay result represented nonspecific uptake of the plasmid released from dying cells or plasmid that had not been fully washed away prior to putting the insert into the wells (FIG. 2). However, repeat experiments showed the same result, with cell lines growing out of the subsequent experiments being positive for UQCRIO as well as high levels of HBV DNA and pcDNA3.1 plasmid DNA. The repeated finding of UQCRIO in multiple assays and in two different cell lines is inconsistent with random or nonspecific uptake of the transgenic virus-plasmid construct. Furthermore, additional controls with high levels of naked plasmid- 1.3X transgenic viral DNA overlaid on the cells with the liver expression library failed to grow out cells (Table 6), ruling out nonspecific uptake of naked DNA. Based on our experience with alternative viral transcripts leading to "partial virus-full vector" molecules, we hypothesized that this reflects full packaging of the 1.3X virus and the full vector (FIG. 12, transcript 2). These novel transcripts are likely explained by the transgene having a repressive effect on the 5 ' epsilon in the transgenic HBV-plasmid construct, leading to preferential usage of the second pgRNA start site and the second unmodified epsilon for viral nucleic acid packaging (FIG. 12, transcripts 2, 3). Prior studies have shown that disruption of the 5' epsilon substantially impairs pgRNA

encapsidation. Regardless of the mechanism, taken together these results indicate an unanticipated ability of HBV replication machinery to reverse transcribe large segments of foreign nucleic acid that have been packaged into viral capsids as part of transgenic pgRNA molecules.

We also sought to create cell lines that would more closely mimic wild type infection by containing non-integrated viral cccDNA as the template for producing virions. These were created by amplify full length virus using previously described methods. Transfection of these full length transgenic viral DNAs into HepG2 and Huh7, followed by selection with the transgenic antibiotic, created permanent cell lines with transgenic viral cccDNA but no plasmid. High levels of antibiotic caused rapid viral integration and within 4 splits little non- integrated virus was detected by miniprep of cell extracts. In contrast, lowered antibiotic pressure and lower fetal calf serum (to slow growth) led to high levels of secreted viral particles (Table 13)

Perspective. Transgenic hepatitis B represents a new model of hepatitis B infection. The usefulness of this model is demonstrated by the identification of UQCRIO as a key factor for sustained viral replication. The use of this model has also clarified a key question in viral biology by demonstrating that HepG2 and Huh7 cell lines have the receptor necessary for viral entry. The transgenic HBV model also provides an explanation for the lack of persistent infection when HepG2 and Huh7 cell lines are exposed to wild type virus: viral protein expression is insufficiently high because of the lack of UQCRIO and viral DNA is quickly lost in the rapidly dividing cell lines. Transgenic hepatitis B models overcome this latter limitation by allowing antibiotic selection pressure that forces cell lines to retain the virus.

As an unanticipated result, this model has further illustrated the ability of HBV to package relatively large DNA sequences using the second epsilon as a start site. In addition, modifications of this model can uniquely produce virions in the same manner as natural HBV infections— using viral cccDNA as the template, without the need for plasmids. The high viral loads achieved by this method also represent a significant advantage. We anticipate this model will be useful in dissecting the molecular biology of viral replication and in screening for new drugs. This model is further enhanced by the substantial flexibility in that a wide variety of genes can be inserted into the viral genome and, through infection, into

hepatocytes. Without further elaboration, it is believed that one skilled in the art, using the preceding description, can utilize the present invention to the fullest extent. The following examples are illustrative only, and not limiting of the remainder of the disclosure in any way whatsoever.

EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component

concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.

Materials and Methods

Section 1: Creation of Transgenic HBV.

Overview. Insertion of a foreign gene into the HBV genome is challenging without disrupting viral gene expression because the viral genes are coded in overlapping open reading frames and there are no introns. Guided by the genetic map of HBV, we created transgenic viruses by inserting trans genes at sites 1852 and 1901 (all numbering is from traditional ECOR1 digestion site). Of note, both the 1852 and 1901 sites are at ATG sites in the HBV genome, but they are not known to be the start site for mRNA transcripts that are transcribed into proteins, though possible native viral RNA transcripts starting at one these sites have been reported.¹

Careful consideration of the known HBV genetic map shows the following:

(1) insertion of new genes at 1852 and 1901 sites do not interrupt the P, S, X, or C open reading frames; (2) DR1 and DR2 are not affected and the epsilon region is not affected (1901 insertion site) or affected only at the outer edge of the Epsilon coding region (1852 insertion site). Epsilon is a segment of the pgRNA that forms a hairpin secondary structure that is necessary for pgRNA encapsidation and for DNA replication; (3) pgRNA is affected and increases in length because of the transgene; (4) the HBeAg is affected by both insertion sites, but for the 1852 insertion site, the affected part is normally cleaved off in the Golgi prior to secretion of HBeAg. Both insertion sites secrete HBeAg, but the 1901 insertion site secretes HBeAg at a reduced level.

In order to create packaged transgenic virus, we constructed greater-than full length virus (1.3X full length) that contained the transgene and cloned them into an expression vector with a CMV promoter (pcDNA3.1/V5-His TOPO TA Expression kit, Invitrogen). This 1.3X clone of HBV DNA serves the function of cccDNA in the permanent cell line.

Careful study of the HBV life cycle indicated two different ways to create transgenic HBV constructs. In both cases, transgenes are inserted in the R regions, which are located at the 5' and 3 ' end of pgRNA. In the first construct, the transgene is inserted in the 5' R, while in the second, the transgenes is inserted in the 3 'R (FIG. 1 A, B). These designs have very different theoretical outcomes: the first construct produces fully packaged transgenic HBV, while the second construct should package only wild type virus. In the second model, the transgene is in the 3' R region and is included in the pgRNA but not in the fully reverse transcribed virus.

Creation of Transgenic Vector.

Source of HBV DNA: A full length genotype D HBV genome was used to create the transgenic viruses. The internal laboratory designation for this cloned HBV DNA is HR90. The HBV genome was isolated from the de-identified serum of an individual who was HBeAg positive and had a high viral load (7.4 log HBV DNA /ml). We have used this same full length virus in previous studies investigating the role of methylation in viral replication.^2"4 Thus, we have experience with transfection of the full length wild type virus into HepG2 and Huh7 cells and the subsequent replication patterns, viral protein production patterns, and viral protein secretion patterns of this wild type virus.

The HBV virus was originally amplified with PI and P2 primers⁵ and cloned into a cloning vector (pSC-A, Stratagene). Two clones were selected, validated, and stored and are used in subsequent studies.^2"4 They are called HR90 clone 3 and HR90 clone 4. They have minor differences in their nucleotide sequence. HR90 clone 4 was used for these studies.

Transgenes used:

1. Zeocin (source: pDONR/Zeo, Invitrogen )

2. Blasticidin (source: pcDNA6.2/V5-DEST, Invitrogen)

3. Enhanced GFP (source: pRSET/EmGFP, Invitrogen)

4. CMV promoter (source: pcDNA3.1/V5-His TOPO TA Expression kit, Invitrogen) Expression vector used to clone in 1.3X transgenic HBV: Invitrogen, pcDNA3.1/V5- His TOPO TA Expression kit

Transgenic HBV DNA constructs that were created:

Transgenic HBV with the transgene in the forward position

1. HR90, 1852, Zeocin

2. HR90, 1852, GFP

3. HR90, 1901, Zeocin

4. HR90, 1901, Blasticidin

5. HR90, 1901, GFP

Transgenic HBV with the transgene in the back position

1. HR90, 1852, Zeocin

2. HR90, 1852, GFP

3. HR90, 1901, Zeocin

4. HR90, 1901, Blasticidin

5. HR90, 1901, GFP

Transgenic HBV with the transgenes in both locations

1. HR90, 1901 CMV promoter; 1852 GFP

Protocol to Place Transgene in Forward Position. The transgenic HBV is constructed in four segments.

Segment 1 : from 1227 to 1901 or 1852; approximate size: 674 bp (1901) or 625 bp (1852) Segment 2: Transgenes; size varies by gene length

Blasticidin: 399 bp

Zeocin: 375 bp

GFP: 720 bp

CMV promoter: 652 bp

Segment 3 : from 1901 or 1852 to 2329; approximate size: 430 bp (1901) or 480 bp (1852) Segment 4: from 2333 to 211 1 approximate size: 3100 bp

Total length: approximately 4.3 kb of HBV DNA

A. Form circular HBV DNA to use as templates for PCR

1. Grow vector with HR90 clone 4 in bacteria. HR90 is the full length HBV DNA amplified using "PI " and " 2 " primers and cloned into a cloning vector. 2. Do a miniprep (Qiagen).

3. Digest the HBV DNA out using BspQI (NEB, R0712)

4. Gel purify the full length HBV DNA. Do not use ethidium bromide or UV on the actual sample.

Note: To do this, run in parallel another lane. Cut this lane out of the gel and stain with ethidium bromide and visualize with UV. Notch the band that you see on UV with a razor blade. Next, put the gel back together and your notch will then tell you where your band is on the unstained gel. This method should always be used when there is a need to gel purify.

5. Check the DNA quality and quantity of the band (e.g., check gel, real time PCR, nanodrop).

6. Ligate the two ends of the HBV DNA to form circular DNA. Use T4 DNA ligase (Invitrogen).

B. Create segment 1

7. Perform PCR for 25 cycles using pfu polymerase, DNA from step No. 6, and primers "island 2 cut and paste IF" and "HBV TG 1852 TG R " (or "island 2 cut and paste IF" and "HBV TG 1901 R ").

Note: For all PCR steps throughout this protocol, pfu polymerase should be used and PCR should be limited to 25 cycles.

8. Gel purify. Alternatively, this can be cloned

C. Create the transgene.

9. Using the transgene specific primers (Table 1), PCR with pfu and 25 cycles of PCR, using vector as template. Gel purify as above.

10. Clone this into a cloning vector. Sequence and confirm.

11. Do a miniprep and purify the DNA. Check DNA quantity and quality.

12. Digest out the transgene DNA with BspQI (NEB, R0712) and gel purify.

Note: An alternative is to amplify for 25 cycles with pfu using primers from step 9. Still need to gel purify and digest.

D. Ligate segment 1 to the transgene (Segment 2).

13. Digest the DNA from step 8 (segment 1) with BspQI (NEB, R0712). Gel purify.

14. Ligate the DNA fragments from steps 12 (transgene) and 13 (segment 1) with T4 DNA ligase.

15. Gel purify the ligated DNA without exposure to ethidium bromide or UV. 16. Clone the DNA from step 15. Use this as template to re-amplify using "island 2 cut and paste IF" (same primer as in step 7) and the transgene specific R primer.

17. Digest the PCR product DNA from step 16 with BspQI (NEB, R0712) and gel purify without exposure to ethidium bromide and UV.

E. Create and ligate segment 3.

18. Amplify segment 3 using DNA from step No. 6 as template and the primers "HBV TG1852F" or "HBV TG1901 IF" as forward primers and "transgenic IS2 2R" as the reverse primer.

19. Digest DNA from step 18 with BspQI (NEB, R0712) and gel purify without exposure to ethidium bromide and UV.

20. Ligate the DNA from steps 17 and 19.

21. Clone the ligated product (you should now have segments 1, 2 and 3 all ligated in the proper orientation).

22. Using DNA from step 21 as template (or alternatively, DNA from step 20), re-amplify using pfu, 25 cycles of PCR and primers "island 2 cut and paste IF" and "transgenic IS2

2R". Digest with BspEI (NEB, R0540L). Gel purify the larger fragment (enzyme cuts at bp 2329; the smaller fragment that you will discard should be approximately 450 bp )

F. Create segment 4 and ligate to create the full 1.3X length transgenic HBV

23. Use "HBV 2111 Sapl F" and "HBV 2111 Sapl R " to amplify a full length HBV DNA fragment using the DNA from step No.6 with pfu and 25 cycles of PCR. Clone into a cloning vector.

24. Digest the DNA from step 24 using with BspEI (NEB, R0540L). This will give a 3.1 kb product and a 222 bp product. Gel purify the 3.1 kb product.

Note: Instead of using cloned DNA, an alternative is to use the PCR product from step 23, digest, and gel purify.

25. Ligate DNAs from step 22 and 24.

26. Clone into expression vector (pcDNA3.1/V5-His TOPO TA Expression kit, Invitrogen). 26. Select clones and verify insert size. Sequence.

Protocol to Place Transgene in Back Position. The transgenic HBV is constructed in four segments:

Segment 1 : from 1527 to 1244; approximate size: 2967 bp Segment 2: from 1227 to 1901 or 1852; approximate size: 675 bp (1901) or 625 bp (1852) Segment 3 : Transgenes; size varies by gene length

Blasticidin: 399 bp

Zeocin: 375 bp

GFP: 720 bp

CMV promoter: 652 bp

Segment 4: 1901 or 1852 to 2950: approximate size: 1098bp (1852) or 1049bp (1901) Total length: approximately 5.3 kb

A. Form circular HBV DNA to use as templates for PCR

1. Grow vector with HR90 clone 4 in bacteria. HR90 is the full length HBV DNA amplified using "PI " and "P2 " primers and cloned into a cloning vector.

2. Do a miniprep (Qiagen).

3. Digest the HBV DNA out using BspQI (NEB, R0712)

B. Create segment 1

7. Use primers "Transgenic IS2 IF" and "LP2 cut and paste 1R " to amplify a HBV DNA fragment using the DNA from No. 6 above.

8. Gel purify without UV or ethidium bromide. Clone if desired.

C. Create the transgene.

9. Using the transgene specific primers (Table 2), PCR with pfu and 25 cycles of PCR, using vector as template. Gel purify as above.

10. Clone this into a cloning vector. Sequence and confirm.

11. Do a miniprep and purify the DNA. Check DNA quantity and quality.

12. Digest out the transgene DNA with BspQI (NEB, R0712) and gel purify. Note: An alternative is to amplify for 25 cycles with pfu using primers from step 9. Still need to gel purify and digest.

D. Ligate segment 2 to the transgene (Segment 3).

13. Amplify segment 2 using pfu, 25 cycles PCR, DNA from No.6 as template and the primers "IS2 cut and paste IF " with "HB VTG 1901 R " or "HB VTG 1852 R ".

14. Gel purify without UV or ethidium bromide. Alternatively, this can be cloned.

15. Digest the DNA from step 12 (transgene, segment 2) and step 14 (segment 3) with BspQI (NEB, R0712).

16. Ligate the DNA fragments from step 15 with T4 DNA ligase.

17. Gel purify the ligated DNA without exposure to ethidium bromide or UV.

18. Clone the DNA from step 17. Use this as template to re-amplify using "1S2 cut and paste IF" and the transgene specific R primer. You should now have segments 2 and 3 joined.

E. Create and ligate segment 4.

19. Amplify segment 4 using pfu, 25 cycles PCR, DNA from No.6 as template and primers "HBV TG1852F" or "HBV TG1901 IF" as forward primers and "transgenic IS2 Pstl 1R" as the reverse primer.

20. Separately digest DNA from steps 18 and 19 with BspQI (NEB, R0712) and gel purify without exposure to ethidium bromide and UV.

21. Ligate the DNA from step 20.

22. Clone the ligated product (you should now have segments 2, 3 and 4 ligated in the proper orientation).

23. Use this as template to re-amplify using "IS2 cut and paste IF" and the "transgenic IS2 Pstl 1R " primer.

F. Ligate segment 1

24. Digest the PCR product DNA from step 23 with Sphl (NEB, R0182S) and gel purify without exposure to ethidium bromide and UV.

25. Digest DNA from step 8 with Sphl (NEB, R0182S) and gel purify without exposure to ethidium bromide and UV.

26. Ligate DNA from steps 24 and 25.

27. Clone into expression vector (pcDNA3.1/V5-His TOPO TA Expression kit, Invitrogen).

28. Select clones and verify insert size. Sequence.

Note: If there is problems cloning, primer "Transgenic island 2 EcoRI IF' can also be use (same primer as Transgenic 1S2 IF" but with a digestion site to help in cloning. Table 1. Primers used in HBV transgenic constructs with transgene in the forward position

Table 2. Primers used in HBV transgenic constructs with transgene in the back position

Section 2. Assay To Identify Entry/ Replication Factors

Overview. The main experimental assay (outlined in FIG. 6) is a functional assay based on the premise that HepG2 and Huh7 cells lack a molecule necessary for viral entry/ persistent replication. If this molecule is replaced, then the cells should be able to support natural infection by intact HBV virions. Relevant to this, there is strong scientific evidence that HBV virions can be produced once HBV DNA gets into the nucleus, for example by transfection.

In order to have the cell lines produce the molecule necessary for HBV viral entry/replication, etc., an expression library was made from normal human liver tissue; the library is anticipated to express all mRNA in the normal liver, including the missing molecule. After transfection of this library into the HepG2 and Huh7 cell lines, some fraction of the cells will now express the missing molecule necessary for viral entry/persistent post- entry replication— but how to identify which cells have this missing molecule?

We decided on a functional approach wherein the final assay "signal' would be virus that entered and replicated within the cell lines, allowing the cells to be identified either by flow cytometry or by selection in antibiotic. A functional approach has the strong advantage of being able to identify the molecule regardless of whether it is part of the receptor or needed for persistent post-entry replication of the virus.

This approach has several particular strengths. First, expression libraries can have a bias towards smaller genes; thus, if the receptor or replication factor is large, it may not be well represented in the library. However this risk is mitigated by our approach which identifies both the receptor/persistent replication factors as well as any protein that upregulates these molecules. Second, the assay is not a binding assay but instead is a functional assay; by its very nature, our assay identifies only those candidates that lead, in the end, to the complete cycle of viral entry and persistent viral replication. This gives our assay substantial power to screen out false positives— proteins that may bind nonspecifically to the viral proteins but are not the true receptors/replication factors. Third, this assay can be easily used in a variety of cell lines. This provides greater assurance of a positive result when two different cell lines lead to the same molecule or molecules in a shared pathway.

Outline of the Experimental Assay Wild type HepG2 and Huh7 cell lines are first transfected with a liver expression library in 6 well plates (FIG. 2 and FIG. 6). A small proportion of these cells will now express the molecule(s) necessary to support viral infection.

Next, cell culture well inserts are placed into the well and these inserts contain Huh7 cells or HepG2 expressing the transgenic virus. There are now two cell populations that share the media, but they are physically separated. The bottom cell population is expressing an unknown molecule that is needed for viral infection, while the other cell population, growing in the insert, is secreting transgenic virus.

After 3 days of co-culture with the inserts, the inserts are removed and antibiotic added to the cell culture media. Separate antibiotics are added for both the library

(Geneticin)— to ensure that the expression vector containing the receptor or replication factor is retained— and either Zeocin or Blasticidin to select those cells that have taken up HBV. Only those cells that are able to pick up the HBV virions and have persistent viral replication and have a library expression vector can survive.

After a clone of stable cells has grown in the presence of antibiotics (this takes many weeks because, as expected, there are <1% of cells that survive the initial selection), the cells are harvested, DNA extracted, and PCR performed with primers directed against the insert in the library expression vector.

As a second approach for analysis of cells selected out by the assay, there is a somewhat narrow window during the selection process where the cells are fully selected but the vectors have not yet become integrated into the hepatocyte genomic DNA (eventually all vectors used in this study will likely become integrated when under antibiotic selection pressure). We take cells during this window period, perform a modified mini-prep to isolate the plasmids,⁶ and then transform bacteria and identify genes by routine colony selection and sequencing.

Normal liver library. An expression library was made using de-identified fresh frozen liver tissue from a 35 year old woman with no underlying liver disease (liver resection for benign liver tumor).

1. mRNA was isolated (MAG mRNA Isolation, Invitrogen) and a cDNA library constructed as per the manufacturer's instructions.

2. The library was then transferred to an expression vector (pT-REex-Dest30, Invitrogen), as per the manufacturer's instructions.

3. The library was validated at every step as per the manufacturer's protocol. The average size insert was 1.4 Kb, range 0.6 to 4.2 Kb, based on sizing of 25 random clones.

4. A random sequencing of clones revealed genes typical of hepatocytes, such as APOA1 and APOC2.

Kill Curves. Cell line specific kill curves were used to identify the appropriate antibiotic concentrations by seeding cells at 50% confluence in 6 well plates and growing in various concentrations of antibiotics. The lowest concentration that killed all cells was chosen for subsequent use.

Protocol for Assay Looking for Viral Entry/Early Replication Factors. An overview of the assay is shown in FIG. 6.

1. Day 0. Seed Huh7 or HepG2 cells at a density of 3x10⁵ cells into wells of a 6 well plate.

2. Day 0. Seed Huh7 or HepG2 cells at a density of 3xl0⁵ cells into the insert (BD biosciences, San Jose, California). Grow the cells on the inserts in a 6 well plate with no cells growing on the bottom of the well.

3. Day 1. The next day (approximately 12 hours later), transfect 4 μg of the library DNA (lipofectamine) into the 6 well plates.

4. At the same time, transfect 1.6 ug transgenic HBV into the inserts (unless using a permanent transgenic HBV cell line).

5. Day 1. Six hours after transfection, wash the cells to remove the transfected material in both the 6 well plate and in the inserts. Wash well.

6. Day 1. Place the inserts into the 6 well plates.

7. Day 4. Remove the insert. Add geneticin (concentration for HepG2: 125 μg/mL ; Huh7: 75 μg/mL ). 8. Day 5. Split each 6 well into a separate T25 flask. They need to be split to approximately 25% or less cellularity or the antibiotic selection won't work well. The cells will initially undergo a significant cell die off (varies, but typically 40-80%) in the presence of the antibiotic, but should recover and grow to confluence in the T25 flask, (geneticin concentration for HepG2: 250 μg/mL ; Huh7: 150 μg/mL ).

Note 1: The antibiotic added in step 7 is half concentration. The concentration is left at half concentration for 24 hours, and then is increased to full concentration after the split.

Note 2: All subsequent splits are made based on the cell cellularity and are not based strictly on experimental days. Approximate days between the subsequent splits for typical experiments are shown in FIG. 6, but there can be significant variation.

Note 3. Change the media and add fresh antibiotic every two to 3 days.

9. After 4 days in the full concentration of geneticin, add Blasticidin or Zeocin (concentration for HepG2: Zeocin_50 ug/mL, Blasticidin 0.25 ug/mL; Huh7: Zeocin 35 ug/mL, Blasticidin 0.25 ug/mL ).

Note 1: The transgenic antibiotic is added at half concentration at first.

10. The cells will slowly grow to confluence. When they are ready to split, add in full concentration of transgenic antibiotic about 24 hours before the split and then split into a T75 flask (each T25 goes to a T75). Also keep geneticin at full concentrations. Geneticin concentration for HepG2: 250ug/mL; for Huh7: 150ug/mL. Transgenic antibiotic concentrations for HepG2 are as follows: Zeocin lOOug/mL, Blasticidin 0.75ug/mL.

Transgenic antibiotic concentrations for Huh7 are as follows: Zeocin 50ug/mL, Blasticidin 0.5ug/mL).

Note 1: The cells will again undergo a significant cell die off (typically >90% of cells) after the split to a T75. The Huh7 cells are very fragile at this stage (when there are very few cells remaining) and sometimes benefit from splitting back into a very small sized container such as a 6 well plate. Sometimes they just don't make it. The HepG2 cells seem to be sturdier at very low cellularity and will slowly recover and grow to confluence.

Note 2. Zeocin selection tends to take longer.

11. Once the cells form clones (can take several weeks), split them again back into a single T25. They will typically have some noticeable cell death at this step too (20-

30%).

12. Once the cells are confluent, split them again.

a. Take half for DNA extraction. The DNA can be extracted both by routine methods as well as with a miniprep protocol. b. Perform HBsAg ELISA on the supernatant extract to make sure it is

HBV positive.

c. Analyze the extracted DNA by real time PCR for HBV DNA levels. d. Use destination primers and perform PCR using DNA from step 12. a . Gel purify and sequence the DNA amplicon.

Note 1. There should be a single or a few bright bands. If there is a smear, the cells did not select out or the PCR conditions need to be optimized.

e. Create real time primers that target the DNA identified in step 12.c. General Notes.

1. The antibiotic concentrations should be confirmed in your lab conditions with a kill curve before starting the experiments.

2. The media is DMEM with high glucose and 10% FCS for all steps.

3. Transfection is with lipofectamine 2000 (Invitrogen).

4. After step 8, all of the steps are performed based on the flask/well cellularity and not on a strict date.

5. Antibiotics should not be old. If there is any uncertainty, i.e., approaching expiration date, get new ones. If the reconstitution date is more than a month or two old, make up new stock.

6. Analysis from DNA extracts from the early splits will show a smear on Dest PCR as the cells are not fully selected. If the PCR shows a smear in step 12, then the cells were not fully selected.

7. The supernatants from permanent cell lines used to seed the inserts contain approximately 5xl0⁴ to 5xl0⁵ copies of HBV DNA per ml, as determined by real time PCR. The 6 well plates are seeded with approximately 3xl0⁵ cells for the assay, giving a "MOI" of approximately 0.5 to 1.3. This MOI is probably on the low side for optimal performance of the assay, but the assay works satisfactorily at this MOI.

Table 3. Primers.

Section 3: Materials And Methods For Standard Laboratory Techniques cDNA Synthesis. Total RNA was extracted from cells using TRIzol (Invitrogen life technologies, Carlsbad, CA, USA) followed by precipitation with isopropyl alcohol as per manufacture's protocol. Two μg of RNA was used and cDNA was synthesized with oligo-dT primers using the Superscript First -Strand synthesis system for RT-PCR (Invitrogen) according to the manufacturer's instructions in a 20 μΐ reaction. Two μΐ of cDNA was then used as input for real time PCR. Primers were designed using the Genebank gene data and were designed to cross exons. None of the primer sets (Table 4) amplified genomic DNA.

5 ' and 3 ' RACE. RNA was extracted using TRIzol (Invitrogen) and was further purified using RNAeasy (Qiagen, Valencia, CA, USA). RACE was performed as per the manufacturer's instructions (GeneRACER,). After cloning, samples were sequenced and aligned using BioEdit.

Real time PCR. Real time PCR was performed with the SmartCycler system

(Cepheid, Sunnyvale, California, USA) using the Fast Start SYBR green master mix (Roche, Indianapolis, IN) with 2μ1 of cDNA or μΐ of DNA and cycling conditions of 95°C for 10 minutes followed by 35 cycles of 95°C for 20 seconds, 55°C 30 seconds, and 72°C for 30 seconds. The specificity of PCR products were ascertained by melt curve analysis. Expression levels were normalized to beta-glucuronidase for gene expression. To quantify HBV DNA levels, an absolute standard curve was used.

Affymetrix. Western blots were performed on cellular extracts to confirm the over- expression of UCQR10 in each UQCR10 cell line compared to its wild type mate. These cell lines were then used for gene expression analysis. RNA was extracted using TRIzol

(Invitrogen life technologies, Carlsbad, CA, USA) and was further purified using RNAeasy (Qiagen, Valencia, CA, USA). Gene expression was analyzed using the Illumina HT12 Expression array and was performed at the Johns Hopkins Sidney Kimmel Cancer CORE Facility. The core facility performed all of the labeling, hybridization, and scanning and provided analysis assistance. The wild type cell lines were compared to the same cell line with permanent UCQR10 expression.

For Affymetrix, each cell line was tested in duplicate. The PCA score and heat maps were used to assess data quality. The replicates where also checked using scatter plots to ensure similar transcript levels. The non-normalized sample data was used to generate box plots of the log AVG signal to ensure even distribution of the data. Ambiguous florescent signal data was removed and the remaining data was averaged and used to analyze the expression levels in both UQCR10 positive cell lines and in wild type cell lines. The data was analyzed using Genespring. Gene over-expression was defined using a signal log ratio 2, which correlates to a 4-fold increase in expression. Gene under-expression was defined using a signal log ratio -2.

Tran faction. Huh7 or HepG2 cells (American Type Culture Collection) were seeded at a density of 5.5 log cells in standard 6 well plates and grown overnight in Dulbecco's modified Eagle's Medium (DMEM with high glucose) with 10% fetal bovine serum (FBS) and transfected (Lipofectamine, Invitrogen, Carlsbad, CA) with 2 μg of DNA. The cells were washed and the growth medium replaced at 24 hours after transfection.

Miniprep on Cells. Plasmid DNA was isolated from cells using the Qiagen Mini-prep kit with modifications. After the addition of N3 neutralization buffer, the sample is incubated on ice for 5 minutes and then centrifuged at 13000 rpm for 10 minutes. The sample is then incubated for 5 minutes at 37°C and centrifuged for 1 minute. Plasmid DNA is Eluted in lOOuL of TE buffer.

Cell proliferation Assay using WST-1 (Roche Applied Sciences). HepG2 and Huh7 cell lines were grown in tissue culture plates in MEM with 10% FBS. The cells were trypsinized after reaching 80% confluence and 5 xlO⁴ cells were plated in wells of 96 micro titer plates. The plates were incubated at 37°C for 24 hour and the reagent used as per the manufacturer's instructions. The percentage of dye uptake, a measure of the number of viable cells, was determined spectrophotometrically at 450 nm and 600 nm wavelength at 0.5, 1, and 2 hours.

Western Blot. Total protein was extracted from cells as per the manufacturer's instructions using RIPA buffer (Sigma- Aldrich) with the addition of complete protease inhibitor cocktail tablets (Roche). Protein concentrations were determined by nanodrop. For immunoblot assays, liver proteins (50 μg/lane) in Lamelli buffer were separated by polyacrylamide gel electrophoresis and transferred to PVDF membranes. The membranes were blocked by 5% nonfat milk powder for 60 minutes and treated with primary antibody for one hour. Subsequently, the membranes were washed and incubated with anti-rabbit IgG conjugate coupled with horseradish peroxidase for 1 hour. The membranes were again washed and the protein antibody complex detected using the ECL Advance Western Bot Detection Kit (GE healthcare). UQCR10 primary antibody (Abeam, AM34909) was used according to manufacturer's directions at a 1 : 10,000 dilution.

Immunohistochemistry on Paraffin Embedded Tissues. Five micron sections were de- paraffinized, rehydrated, and steamed in citrate buffer for 45 minutes. The slides were then incubated with the primary antibody for 1 hour at room temperature. For UQCR10 (Cat # 17779-1-AP, Proteintech) the antibody was used at a 1 : 100 dilution. The HBsAg (DAKO, Carpinteria, California, USA) is prediluted and was used neat. Following the primary antibody, the sections were incubated for 30 minutes in Dako EnVision+ Peroxidase, a labeled-dextran polymer, followed by incubation with diaminobenzidine (DAB). Color development was monitored and stopped after 2-3 minutes.

Immunohistochemistry on cells grown in cell culture wells. Cells were grown on glass slides until they were about 80% confluent. The medium was removed and the slides washed with IXPBS and fixed overnight in formalin and then washed with IX PBS. Antigen retrieval was performed by steaming in sodium citrate buffer for 45 minutes and the cells were then permeabilized with Triton X-100 for 20 minutes, followed by blocking in hydrogen peroxide for 20 minutes. Primary antibody (UCRC Antibody, 17779-1-AP, Proteintech, dilution 1 : 100) or Dako (neat) for HBsAg was then added to the slides for 1 hour at room temperature followed by washing and the secondary HRP conjugated antibody incubated for 1 hour. After incubation with secondary antibody the slides were washed and detection performed using DAB substrate. ELISA. HBsAg and HBeAg ELISA assays (ETI-MAK-2 plus and ETI-EBK plus) were pre-formed on cell culture supernatant after centrifugation at 2,000 rpm for 5 minutes using the manufacturer's protocol without modifications.

DNA protection Assay. To determine whether viral DNA was protected from DNAse digestion, which would be anticipated if viral DNA is packaged into virions, supernatant from cell culture transfection experiments were studied. If the viral DNA is unpackaged, then it will be digested readily with DNAase. 48 hour supernatants were collected after temporary transfection of 1.3X vector-trans genic viral DNA constructs or from 1.0 transgenic viral DNA constructs. 100 ul of supernatant was digested with DNAase or was mock digested, with glycerol added instead of DNAase. After digestion, both the digested samples underwent DNA extraction (Qiagen) and real time PCR for viral DNA. If the viral DNA is packaged into a virion, the anticipated result is that there will be no difference in viral DNA levels by real time PCR between the mock and DNAse digested samples. If there is no protection of the viral DNA by a viral capsid, then a 2-3 Ct difference by real time PCR is anticipated, with the mock digested sample having more DNA than the DNAse digested sample.

Strand Bias PCR. Because of the unique replication strategy of HBV, packaged viral particles contain partially double stranded DNA. To determine whether the viral DNA in viral particles was in fact partially double stranded, we used strand-bias real time PCR. In this assay, three parallel PCR amplifications are performed: first round PCRs containing only the forward primer, only the reverse primer, or both primers. Next, second round PCR is performed using both forward and reverse primers and template from each of the three first round PCRs. If the HBV DNA is single stranded, there will be significant bias strand bias in the Cts between the PCR reactions.

1. DNA was extracted following the protection assay from samples that were positive, indicating the presence of viral coat or other structure protecting the DNA from digestion.

2. Perform real time PCR using 4 ul input of the DNA from step 1. Perform 15 rounds of PCR. Set up three separate PCR reactions. Primers are from Zanella et al.⁷ .

a. Forward only primer (For4)

b. Reverse only primer (Rev7)

c. Both forward and reverse primers (For4 and Rev7).

3. Set up the second round of real time PCR using 2 ul DNA input from round 1. Set up a separate PCR reaction for each of the PCR reactions in step 2. The input for this step can be adjusted depending on the amount of viral DNA in the original extract. The goal is to have the 2c PCR become positive in approximately the 12 to 20 Ct range.

Flow Cytometry. Flow cytometry was performed using the Flow Cytometry Core at Johns Hopkins School of Public Health. All samples were analyzed by the staff of the flow cytometry core using standard procedures.

Blocking studies. HepG2 cells were grown in cell culture inserts and temporarily transfected with transgenic HBV 1.3X constructs containing GFP. Separately, HepG2 cells with permanent expression of UQCR10 were seeded in 6 well plates and incubated with varying concentrations of Pre-Sl antibody (sc-57761, Santa Cruz Biotechnology). 24 hours after transfection of the cells in the inserts, the inserts were thoroughly washed and place in 6 well plates containing HepG2 cells with permanent expression of UQCR10 and varying concentrations of antibody. Cells were harvested for flow cytometry analysis at 37 and 72 hours of exposure to transgenic virus (produced by the cells in the inserts).

Table 4. Transgenic hepatitis B produces both HBsAg and HBeAg 24 hours after transfection of 1.3X viral-plasmid constructs into HepG2 or Huh7 cell lines.

Each transfection was preformed the same day and in duplicate. HepG2 cells generally produce more HBsAg while Huh7 cell lines generally produce more HBeAg. The 1901 Blasticidin and 1901 Zeocin produce the best HBsAg overall, and so where used in the main experimental assay for the missing viral entery/replication factor.

Table 5. Transgenic hepatitis B assay results.

Sc20 3 HepG2 Library transfection All cells die

Infectous transgenic hepatitis B virions were produced in the well inserts (see figure IB) either by permanent transgenic hepatitis B cell lines, or by separately transfecting transgenic HBV DNA into the wild type cell lines 24 hours prior to starting the experiment.

Table 6. Full coding of the UQCRIO gene from the expression vectors obtained at the end of the assay.

ATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTTCCGCAGGACCTCCACCTTCGCCCTCACCATCATCGTG

GGCGTCATGTTCTTCGAGCGCGCCTTCGATCAAGGCGCGGACGCTATCTACGACCACATCAACGAGGGGAAGCTGTGGA

AACACATCAAGCACAAGTATGAGAACAAGTAGTTCCTTGGAGGCCCCCATCCAGGCCAGAAGGACCAGGTCCACCCAGC

AGCTGTTTGCCCAGAGCTGGAGCCTCAGCTTGAAGATGATGCTCAAGGTACTCTTCATGGACCACCATTCGCTGTTGGCAA

GAAACGGCTTTACTTACAAAACAGACTCTTTACCTTCTGCTGTGTTTGAAGTATGTTTAGTCAGCATGCTCAGGAAATAAG

TGTGAATTGCCCTTGAAAAAAAAAAAAAAAAAAA (SEQ ID NO:35)

Table 7. UQCRIO mRNA levels were measured by real time PCR in cell lines and in fresh frozen human hepatocellular carcinoma tissues.

The expression levels are normalized to normal human liver for the cell lines and to the paired non-neoplastic tissues for the human hepatocellular carcinomas.

Table 8. HBV DNA levels are maintained in the presence of antibiotic pressure, but quickly lost if no pressure is applied.

supernatant

(ELISA O.D.)

Split 4 0.46+0.08 0.15+0.04 0.36+0.18 not detected

HBeAg in

supernatant

(ELISA O.D.)

Split 4 0.08+0.01 not detected 0.03+0.02 not detected

The antibiotic resistance gene for Blasticidin is encoded within the transgenic virus and adding the antibiotic encourages the cells to retain the virus. Data is mean and standard deviation for 3 replicates. HBeAg for split 4 is also shown.

Table 9. Top 10 genes over and under expressed in both HepG2 and Huh7 permanent cell lines, normalized to their respective wild type cell lines.

sgna-n uce pro eraton-assocate e - ; -

Table 10. mRNA expression levels of genes associated with hepatocyte maturation were measured by real time PCR.

Fold change in mRNA (Log2) is shown. The UQCRIO permanent cell lines were normalized to their paired wild type cell lines.

Table 11. Functional studies of the effect of UQCRIO on cell lines.

Each experiment was performed in duplicate, with two replicates each. The HBsAg levels were measured 24 hours after trans fection. Table 12. Characterization of cell culture supernatant for cell lines with permanent 1.0 transgenic viral cccDNA.

Each experiment was performed in duplicate on wild type cells that underwent temporary transfection, were split after 4 days, and supernatant collected after another 4 days.

References

1. Chen A, Kao YF, Brown CM. Translation of the first upstream ORF in the hepatitis B virus pregenomic RNA modulates translation at the core and polymerase initiation codons. Nucleic Acids Res 2005; 33: 1 169-81.

2. Vivekanandan P, Daniel HD, Kannangai R, Martinez-Murillo F, Torbenson M. Hepatitis B virus replication induces methylation of both host and viral DNA. J Virol

2010; 84:4321-9.

3. Vivekanandan P, Thomas D, Torbenson M. Hepatitis B viral DNA is methylated in liver tissues. J Viral Hepat 2008; 15: 103-7.

4. Vivekanandan P, Thomas D, Torbenson M. Methylation regulates hepatitis B viral protein expression. J Infect Dis 2009; 199: 1286-91.

5. Gunther S, Li BC, Miska S, et al. A novel method for efficient amplification of whole hepatitis B virus genomes permits rapid functional analysis and reveals deletion mutants in immunosuppressed patients. J Virol 1995; 69:5437-44.

6. Siebenkotten G, Leyendeckers H, Christine R, Radbruch A. Isolation of plasmid DNA from mammalian cells with QIAprep. Qiagen News and Product Application 1995; 2: 1 1-3.

7. Zanella I, Rossini A, Domenighini D, Albertini A, Cariani E. Quantitative analysis of hepatitis B virus DNA by real-lime amplification. Eur J Clin Microbiol Infect Dis 2002; 21 :22-6.

Claims

We claim:

1. A transgenic hepatitis B virus (HBV) construct comprising (a) a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding HBV pgRNA.

2. The transgenic HBV construct of claim 1, wherein the R region is the 5' R region.

3. The transgenic HBV construct of claim 2, wherein the foreign gene is inserted at the 1852 bp of the 5' R region, as numbered from the EcoRI digestion site.

4. The transgenic HBV construct of claim 2, wherein the foreign gene is inserted at the 1901 bp of the 5' R region, as numbered from the EcoRI digestion site.

5. The transgenic HBV construct of claim 1, wherein the foreign gene is an antibiotic resistance gene.

6. The transgenic HBV construct of claim 1, wherein the foreign gene encodes a fluorescent protein.

7. A vector comprising the transgenic HBV construct of claim 1.

8. A virus comprising the transgenic HBV construct of claim 1.

9. A vector comprising a transgenic HBV construct, wherein the HBV construct comprises a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding HBV pgRNA.

10. A transgenic HBV construct comprising (a) a nucleotide sequence encoding HBV pre-genomic RNA (pgRNA) and (b) a gene encoding a selectable marker inserted into the 5'

R region of the nucleotide sequence encoding HBV pgRNA.

11. A transgenic viral covalently closed circular DNA (cccDNA) comprising (a) a nucleotide sequence encoding viral pgRNA and (b) a foreign gene inserted into the R region of the nucleotide sequence encoding viral pgRNA.

12. A vector comprising the transgenic viral cccDNA of claim 11.

13. The transgenic viral cccDNA of claim 1 1 or 12, wherein the foreign gene is a reporter gene.

14. A method for treating or preventing HBV in a patient in need thereof comprising administering an effective amount of UQCR10 modulator.

15. The method of claim 14, wherein the modulator is selected from the group consisting of a small molecule, an antibody, an aptamer, and an inhibitory nucleic acid molecule.

16. The method of claim 15, wherein the modulator is a small molecule.

17. The method of claim 15, wherein the inhibitory nucleic acid molecule is an antisense oligonucleotide, a short interfering RNA (siRNA), or a short hairpin RNA (shRNA).