WO2015054293A1 - Anticorps anti-il-6 pour le traitement de la polyarthrite psoriasique - Google Patents

Anticorps anti-il-6 pour le traitement de la polyarthrite psoriasique Download PDF

Info

Publication number
WO2015054293A1
WO2015054293A1 PCT/US2014/059543 US2014059543W WO2015054293A1 WO 2015054293 A1 WO2015054293 A1 WO 2015054293A1 US 2014059543 W US2014059543 W US 2014059543W WO 2015054293 A1 WO2015054293 A1 WO 2015054293A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
seq
foregoing
subject
polypeptide
Prior art date
Application number
PCT/US2014/059543
Other languages
English (en)
Inventor
Jeffrey T.L. Smith
Original Assignee
Alder Biopharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alder Biopharmaceuticals, Inc. filed Critical Alder Biopharmaceuticals, Inc.
Publication of WO2015054293A1 publication Critical patent/WO2015054293A1/fr
Priority to US14/876,376 priority Critical patent/US20160130340A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244—Interleukins [IL]
    • C07K16/248—IL-6
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
    • C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41—Glycosylation, sialylation, or fucosylation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance

Definitions

  • Anti-IL-6 antibodies and antigen-binding fragments thereof are used to reduce C-reactive protein ("CRP levels") and inflammation and in methods and compositions for the treatment and prevention of psoriatic arthritis (PsA).
  • CRP levels C-reactive protein
  • PsA psoriatic arthritis
  • Interleukin-6 IL-6
  • Interleukin-6 is a multifunctional cytokine involved in numerous biological processes such as the regulation of the acute inflammatory response, the modulation of specific immune responses including B- and T-cell differentiation, bone metabolism, thrombopoiesis, epidermal proliferation, menses, neuronal cell differentiation, neuroprotection, aging, cancer, and the inflammatory reaction occurring in Alzheimer's disease. See Papassotiropoulos, et al. (2001 )
  • IL-6 is a pleiotropic pro-inflammatory cytokine, which regulates the acute phase response and the transition from the innate to the adaptive immune response. IL-6 increases hepatic synthesis of proteins that are involved in the 'acute phase response' leading to symptoms such as fever, chills, and fatigue. It stimulates B cell differentiation and secretion of antibodies and prevents apoptosis of activated B cells. IL-6 activates and induces proliferation of T cells and in the presence of IL-2, induces differentiation of mature and immature CD8 T cells into cytotoxic T cells. IL-6 is also involved in the differentiation of Thl 7 cells and IL-17 production and inhibits regulatory T cells (Treg) differentiation.
  • Treg regulatory T cells
  • IL-6 also activates osteoclasts, synoviocytes, neutrophils, and other hematopoietic cells.
  • IL-6 is a member of a family of cytokines that promote cellular responses through a receptor complex consisting of at least one subunit of the signal-transducing glycoprotein gpl30 and the IL-6 receptor ("IL-6R") (also known as gp80).
  • the IL-6R may also be present in a soluble form (“sIL-6R”).
  • IL-6 binds to IL-6R, which then dimerizes the signal-transducing receptor gpl30. See Jones (2005) Immunology 175: 3463-3468.
  • IL-6 In humans, the gene encoding IL-6 is organized in five exons and four introns, and maps to the short arm of chromosome 7 at 7p21. Translation of IL-6 RNA and post-translational processing result in the formation of a 21 to 28 kDa protein with 184 amino acids in its mature form. See Papassotiropoulos, et al. (2001) Neurobiology of Aging 22:863-871.
  • IL-6 The function of IL-6 is not restricted to the immune response as it acts in hematopoiesis, thrombopoiesis, osteoclast formation, elicitation of hepatic acute phase response resulting in the elevation of C-reactive protein (CRP) and serum amyloid A (SAA) protein. It is known to be a growth factor for epidermal keratinocytes, renal mesangial cells, myeloma and plasmacytoma cells.
  • CRP C-reactive protein
  • SAA serum amyloid A
  • IL-6 is produced by a wide range of cell types including monocytes/macrophages, fibroblasts, epidermal keratinocytes, vascular endothelial cells, renal messangial cells, glial cells, condrocytes, T and B-cells and some tumor cells.
  • monocytes/macrophages including monocytes/macrophages, fibroblasts, epidermal keratinocytes, vascular endothelial cells, renal messangial cells, glial cells, condrocytes, T and B-cells and some tumor cells.
  • Elevated IL-6 levels have been observed in many types of cancer, including breast cancer, leukemia, ovarian cancer, prostate cancer, pancreatic cancer, lymphoma, lung cancer, renal cell carcinoma, colorectal cancer, and multiple myeloma (e.g., Chopra et al. (2004) MJAFI 60:45 ⁇ 49; Songur et al. (2004) Tumori 90: 196-200; Blay et al. (1992) Cancer Research 52: 3317-3322;
  • IL-6 stimulates the hepatic acute phase response, resulting in increased production of CRP and elevated serum CRP levels.
  • CRP C-reactive protein
  • elevated IL-6 activity can be detected through measurement of serum CRP.
  • effective suppression of IL-6 activity e.g., through administration of a neutralizing anti-IL-6 antibody, can be detected by the resulting decrease in serum CRP levels.
  • Psoriatic arthritis is a chronic inflammatory arthritis that occurs in individuals with psoriasis. It is estimated that about 1-3% of the general population and approximately 4.5 million patients in the United States have psoriasis. Between 10 and 30% of the psoriatic patients develop arthritis. PsA is a chronic inflammatory disease. The pathogenesis of PsA is not fully understood. Both genetic predisposition and environmental triggers are implicated in the deregulation of immune functions involved in PsA.
  • a number of inflammatory cytokines including Interferon ⁇ (INF ⁇ ), Tumor Necrosis Factor a (TNF a), IL-6, IL-8, IL-12, IL- 17, and IL-18 are involved in the pathogenesis of psoriasis and PsA. Spadaro, et al. (1996) Clinical and Experimental Rheumatology 14: 413—416; Neuner, et al. (1991) The Journal of Investigative Dermatology 97(1): 27-33; Arican, et al. (2005) Mediators of Inflammation 5: 273-279; and Goodman, et al. (2009) The Journal of Immunology.
  • INF ⁇ Interferon ⁇
  • TNF a Tumor Necrosis Factor a
  • IL-6, IL-8, IL-12, IL- 17, and IL-18 are involved in the pathogenesis of psoriasis and PsA.
  • Psoriatic arthritis a seronegative spondyloarthropathy is a complex disease involving peripheral and axial joints, periarticular structures ⁇ e.g., enthesitis and other soft tissues, resulting in dactylitis) as well as the skin and nails. Mease (2006) Bulletin of the NYU Hospital for Joint Diseases. 65( 1-2): 25-31. Without appropriate management, the number of joints affected by PsA and the severity of joint damage increase over time, which can lead to marked restrictions of the daily activities and to substantially compromised quality of life. Evidence has shown that accelerated atherosclerosis, obesity, metabolic syndrome and cardiovascular disease are associated with active PsA.
  • Anti-tumor necrosis factor (TNF) therapies are efficacious for both skin and joint diseases but approximately 40% of patients treated with anti-TNF agents do not show at least minimal improvement and a large portion of patients do not achieve substantial relief. Mease (2006) Bulletin of the NYU Hospital for Joint Diseases. 65(1-2): 25-31 ; Weger (2010) British Journal of Pharmacology. 160: 810-820;
  • DMARDs disease-modifying antirheumatic drugs
  • New medications that block an inflammatory protein called tumor necrosis factor (TNF) are becoming the treatment of choice for psoriatic arthritis including Adalimumab (Humira), Etanercept (Enbrel), Golimumab (Simponi), Infliximab (Remicade).
  • TNF tumor necrosis factor
  • Circulating IL-6 levels were significantly higher in PsA patients and correlated highly with ESR and CRP. IL-6 levels also strongly correlated with disease activities such as the number of painful and swollen joints, physician's assessments as well as psoriasis area and severity index (PASI). Spadaro, et al. (1996) Clinical and Experimental
  • Rheumatology 14: 413-416 The histopathology of psoriatic skin lesions is characterized by epidermal hyperplasia and inflammation. Studies have shown IL-6 mRNA and protein levels are elevated in psoriatic plaques. IL-6 was also shown to stimulate keratinocyte proliferation in vitro and contribute to the plaque formation. IL-6 signaling in psoriasis was also shown to prevent immune suppression by regulatory T cells. Neuner, et al. (1991 ) The Journal of Investigative Dermatology 97(1): 27-33. Arican, et al. (2005) Mediators of Inflammation 5: 273-279. Goodman, et al. (2009) The Journal of Immunology. Grossman, et al. ( 1989) Medical Sciences, Proc. Natl. Acad. Sci. USA. 86: 6367-6371. Alenius, et al. (2009) Clinical and Experimental Rheumatology 27: 120-123.
  • blocking IL-6 may provide therapeutic benefits in PsA.
  • compositions comprising humanized monoclonal antibodies that selectively bind IL-6 and methods of treating psoriatic arthritis.
  • anti-IL-6 antibodies e.g., ALD518 antibodies
  • anti-IL-6 antibody or antibody fragment are administered prophylactically to patients at significant risk of developing psoriatic arthritis.
  • the subject technology also provides for humanized monoclonal anti-IL-6 antibodies which are used in the treatment of psoriatic arthritis.
  • the present subject technology further includes the prevention or treatment of inflammatory conditions by administration of anti-IL-6 antibodies according to the subject technology.
  • the subject technology provides a method of treating or preventing psoriatic arthritis comprising administration of a composition comprising an effective amount of an Abl, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1, Abl 2, Abl 3, Abl 4, Abl 5, Abl 6, Abl 7, Abl 8, Abl 9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology also provides a method of treating psoriatic arthritis comprising administration of a composition comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1, Abl2, Abl3, Abl4, Abl 5, Abl6, Abl 7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology further provides a method of preventing psoriatic arthritis comprising administration of a composition comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1 , Abl2, Abl 3, Abl4, Abl 5, Abl6, Abl 7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology provides a composition for the treatment or prevention of psoriatic arthritis comprising an effective amount of an Abl, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl l , Abl2, Abl3, Abl4, Abl5, Abl6, Abl7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen- binding fragment thereof, specifically binds to IL-6.
  • the subject technology also provides a composition for the treatment of psoriatic arthritis comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl 1 , Abl2, Abl3, Abl4, Abl5, Abl6, Abl 7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology further provides a composition for the prevention of psoriatic arthritis comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1, Abl2, Abl3, Abl4, Abl5, Abl6, Abl 7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen- binding fragment thereof, specifically binds to IL-6.
  • the subject technology provides a composition comprising an effective amount of an Abl, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl 1, Abl2, Abl3, Abl4, Abl 5, Abl 6, Abl 7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology also provides for a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1 , Abl2, Abl 3, Abl 4, Abl 5, Abl 6, Abl7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology provides for the use of a composition comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl 1 , Abl2, Abl3, Abl4, Abl 5, Abl 6, Ab l 7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6, for the manufacture of a medicament for the treatment or prevention of psoriatic arthritis.
  • said composition may be formulated for subcutaneous administration.
  • the subject technology also provides for the use of a composition
  • a composition comprising an effective amount of an Ab l, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1, Abl 2, Abl 3, Abl 4, Abl 5, Abl6, Abl7, Abl 8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6, for the manufacture of a medicament for the treatment of psoriatic arthritis.
  • said composition may be formulated for subcutaneous administration.
  • compositions comprising an effective amount of an Abl, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl 1, Abl2, Abl3, Abl4, Abl5, Abl 6, Abl 7, Abl8, Abl9, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6, for the manufacture of a medicament for the prevention of psoriatic arthritis.
  • said composition may be formulated for subcutaneous administration.
  • the antibody includes at least one light chain amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 20, 21 , 37, 53, 69, 85, 101 , 1 19, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, 298, 314, 330, 346, 362, 378, 394, 410, 426, 442, 458, 474, 490, 506, 522, 538, 554, 570, 647, 648, 649, 650, 651 , 655, 660, 666, 667, 671, 675, 679, 683, 687, 693, 699, 702, 706, and 709.
  • the antibody may comprise at least one light chain of nucleic acid sequences with at least 50% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 10,
  • nucleic acid sequence encodes said light chain.
  • the antibody includes at least one heavy chain amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 18, 19, 22, 38, 54, 70, 86, 102, 1 17, 1 18, 123, 139, 155, 171, 187, 203, 219, 235, 251 , 267, 283, 299, 315, 331 , 347, 363, 379, 395, 41 1 , 427, 443, 459, 475, 491 , 507, 523, 539, 555, 571, 652, 653, 654, 655, 656, 657, 658, 661 , 664, 665, 668, 672, 676, 680, 684, 688, 691 , 692, 704, and 708.
  • the antibody includes at least one heavy chain nucleic acid sequences with at least 50% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 1 ,
  • nucleic acid sequence encodes said heavy chain.
  • the antibody includes at least one CDR amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 7, 23, 26, 39, 42, 55, 58, 71 , 74, 87, 90, 103, 106, 124, 127, 140, 143, 156, 159, 172, 175, 188, 191, 204, 207, 220, 223, 236, 239, 252, 255, 268, 271, 284, 287, 300, 303, 316, 319, 332, 335, 348, 351, 364, 367, 380, 383, 396, 399, 412, 415, 428, 431, 444, 447, 460, 463, 476, 479, 492, 495, 508, 51 1, 524, 527, 540, 543, 556, 559, 572, 575, 710, 71 1 , 712, 716, 5, 8, 24, 27, 40, 43, 56,
  • the antibody includes at least one CDR nucleic acid sequences with at least 50% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 12, 15, 31, 34, 47, 50, 63,66, 79, 82, 95,98, 111, 114, 132, 135, 148, 151, 164, 167, 180, 183, 196, 199,212,215,228,231, 244, 247, 260, 263, 276, 279, 292, 295, 308, 311, 324, 327, 340, 343, 356, 359, 372, 375, 388, 391, 404, 407, 420, 423, 436, 439, 452, 455, 468, 471, 484, 487, 500, 503, 516, 519, 532, 535, 548, 551, 564,567,580,583,694, 13, 16,32,35, 48,51,64, 67, 80, 83,96, 99, 112, 115,
  • the antibody or antigen-binding fragment thereof includes at least one light chain CDR amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 23, 39, 55, 71, 74, 87, 103, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396, 412, 428, 444, 460, 476, 492, 508, 524, 540,556,572,710,711,712,5,6, 24, 40, 56, 72, 88, 104, 125, 141, 157, 173, 189,205,
  • the antibody or antigen-binding fragment thereof includes at least one light chain CDR1 amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 23, 39, 55, 71, 74, 87, 103, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396, 412, 428, 444, 460, 476, 492, 508, 524, 540, 556, 572, 710, 711, and 712.
  • the antibody or antigen-binding fragment thereof includes at least one light chain CDR2 amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 24, 40, 56, 72, 88, 104, 125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, 429, 445, 461,7477, 493, 509, 525, 541, 557, 573, 713, 714, 715, and 718.
  • the antibody or antigen-binding fragment thereof includes at least one light chain CDR3 amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 6, 25, 41, 57, 73, 89, 105, 126, 142, 158, 174, 190, 206,
  • the antibody or antigen-binding fragment thereof includes at least two light chain CDR polypeptides. In another embodiment, the antibody or antigen-binding fragment thereof may comprise three light chain CDR polypeptides.
  • the antibody or antigen-binding fragment thereof includes at least one heavy chain CDR amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 26, 42, 58, 74, 90, 106, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511, 527, 543, 559, 575, 716, 8, 27, 43, 59, 75, 91, 107, 120, 121 , 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288, 304, 320, 336, 352, 368, 384, 400, 416, 432, 448, 464, 480, 496, 512, 528, 544, 560, 576, 659
  • the antibody or antigen-binding fragment thereof includes at least one heavy chain CDR1 amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 26, 42, 58, 74, 90, 106, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319, 335, 351 , 367, 383, 399, 415, 431 , 447, 463, 479, 495, 51 1, 527, 543, 559, 575, and 716.
  • the antibody or antigen-binding fragment thereof includes at least one heavy chain CDR2 amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 27, 43, 59, 75, 91 , 107, 120, 121 , 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288, 304, 320, 336, 352, 368, 384, 400, 416, 432, 448, 464, 480, 496, 512, 528, 544, 560, 576, 659, 717, and 718.
  • the antibody or antigen-binding fragment thereof includes at least one heavy chain CDR3 amino acid sequence with at least about 50% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 28, 44, 60, 76, 92, 108, 129, 145, 161, 177, 193, 209, 225, 241 , 257, 273, 289, 305, 321 , 337, 353, 369, 385, 401 , 417, 433, 449, 465, 481 , 497, 513, 529, 545, 561 , and 577.
  • the antibody or antigen-binding fragment thereof includes at least two heavy chain CDR amino acid sequences.
  • the antibody or antigen- binding fragment thereof includes three heavy chain CDR amino acid sequences.
  • the light chain of said antibody is selected from the amino acid sequences of light chains listed in TABLE 1. In one embodiment, the light chain of said antibody is selected from the amino acid sequences of heavy chains listed in TABLE 1. In one embodiment, at least one CDR of said antibody is selected from the amino acid sequences of CDRs listed in TABLE 1. In another embodiment, the light chain has at least 80% identity to an amino acid sequence listed in TABLE 1. In another embodiment, the light chain has at least 90% identity to an amino acid sequence listed in TABLE 1. In another embodiment, the light chain includes an amino acid sequence listed in TABLE 1. In further embodiment, the heavy chain has at least 80%) identity to an amino acid sequence listed in TABLE 1.
  • the heavy chain has at least 90% identity to an amino acid sequence listed in TABLE 1. In further embodiment, the heavy chain includes an amino acid sequence listed in TABLE 1. In a still further embodiment, the CDR sequence of the antibody has at least 80% identity to an amino acid sequence listed in TABLE 1. In a still further embodiment, the CDR sequence of the antibody has at least 90% identity to an amino acid sequence listed in TABLE 1. In a still further embodiment, the CDR sequence of the antibody includes an amino acid sequence listed in TABLE 1.
  • the antibody or antigen-binding fragment thereof includes at least one of the CDRs contained in the V H polypeptide sequences comprising: SEQ ID NO: 3, 18, 19, 22, 38, 54, 70, 86, 102, 1 17, 1 18, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299, 315, 331, 347, 363, 379, 395, 41 1, 427, 443, 459, 475, 491, 507, 523, 539, 555, 571 , 652, 656, 657, 658, 661 , 664, 665, 668, 672, 676, 680, 684, 688, 691, 692, 704, or 708 and/or at least one of the CDRs contained in the V L polypeptide sequence consisting of: 2, 20, 21 , 37, 53, 69, 85, 101 , 1 19, 122, 138, 154, 170, 186, 202,
  • the antibody is an Abl antibody.
  • the antibody includes a light chain comprising the amino acid sequence of SEQ ID NO: 2, 20, 647, 648, 649, 650, 651 , 660, 666, 699, 702, 706, or 709.
  • the antibody includes a humanized light chain comprising the amino acid sequence of SEQ ID NO: 648, 649, and 650.
  • the antibody includes at least one light chain CDR comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 4, 5, 6, 710, 71 1, 712, 713, 714, and 715.
  • the antibody includes at least one humanized light chain CDR comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 710, 71 1, 712, 713, 714, and 715.
  • the antibody includes a heavy chain comprising the amino acid sequence of SEQ ID NO: 3, 18, 19, 652, 653, 654, 655, 656, 657, 658, 661, 664, 665, 704, 708.
  • the antibody includes a humanized heavy chain comprising the amino acid sequence of SEQ ID NO: 653, 654, and 655.
  • the antibody includes at least one heavy chain CDR comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 7, 9, 74, 716, 8, 120, 659, 717, and 718. In another embodiment, the antibody includes at least one humanized heavy chain CDR comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 74, 716, 717, and 718.
  • the antibody or antigen-binding fragment thereof includes a Fab, Fab', F(ab')2, Fv, scFv, IgNAR, SMIP, camelbody, or nanobody.
  • the antibody or antigen-binding fragment thereof may have an in vivo half-life of at least about 30 days in a healthy human subject.
  • the antibody or antigen-binding fragment thereof may have a binding affinity (Kd) for IL-6 of less than about 50 picomolar, or a rate of dissociation (K off ) from IL- 6 of less than or equal to 10 "4 S "1 .
  • the antibody or antigen-binding fragment thereof may specifically binds to the same linear or conformational epitope(s) and/or competes for binding to the same linear or conformational epitope(s) on an intact human IL-6 polypeptide or fragment thereof as an anti-IL-6 antibody comprising the polypeptides of SEQ ID NO: 702 and SEQ ID NO: 704 or the polypeptides of SEQ ID NO: 2 and SEQ ID NO: 3.
  • the binding to the same linear or conformational epitope(s) and/or competition for binding to the same linear or conformational epitope(s) on an intact human IL-6 polypeptide or fragment thereof is ascertained by epitopic mapping using overlapping linear peptide fragments which span the full length of the native human IL-6 polypeptide and includes at least one residues comprised in IL-6 fragments selected from those respectively encompassing amino acid residues 37-51, amino acid residues 70- 84, amino acid residues 169-183, amino acid residues 3 1— 45 and/or amino acid residues 58-72 of SEQ ID NO: 1.
  • the antibody, or antigen-binding fragment thereof may be any suitable antibody, or antigen-binding fragment thereof.
  • the antibody, or antigen-binding fragment thereof contains an Fc region that has been modified to alter effector function, half-life, proteolysis, and/or glycosylation.
  • the antibody, or antigen-binding fragment thereof is a human, humanized, single chain, or chimeric antibody.
  • the antibody, or antigen-binding fragment thereof includes a Fab, Fab', F(ab') 2 , Fv, or scFv.
  • the antibody, or antigen-binding fragment thereof further comprises a human F c .
  • the F c is derived from IgGl , IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgGlO, IgG l 1 , IgG12, IgG13, IgG14, IgG15, IgG 16, IgG 17, IgG18, or IgG19.
  • the composition includes at least about 25, 80, 100, 160, 200, or 320 mg. In one embodiment, the effective amount is between about 0.1 and 100 mg/kg of body weight of the subject. In one embodiment, the subject is administered at least 1 , 2, 3, 4, 5, 7, 8, 9 or 10 doses. In one embodiment, composition is administered every 4 weeks. In one embodiment, the subject is administered 25 mg every 4 weeks. In one embodiment, the subject is administered 80 mg every 4 weeks. In one embodiment, the subject is administered 100 mg every 4 weeks. In one embodiment, the subject is administered 160 mg every 4 weeks. In one embodiment, the subject is administered 200 mg every 4 weeks. In one embodiment, the subject is administered 320 mg every 4 weeks. In another embodiment, the composition is administered every 4 weeks for at least 16 weeks. In another embodiment, the composition is administered every 4 weeks for at least 24 weeks.
  • the patient to whom the methods and compositions of the subject technology are applied may have an elevated C-reactive protein ("CRP").
  • CRP C-reactive protein
  • the patient may have an elevated IL-6 serum level.
  • the patient may have an elevated IL-6 level in the joints.
  • the patient may have had an inadequate response to nonsteroidal anti-inflammatory drugs (NSAIDs).
  • NSAIDs nonsteroidal anti-inflammatory drugs
  • DMARDs non-biologic Disease Modifying Anti-Rheumatic Drugs
  • the antibody, or antigen-binding fragment thereof inhibits at least one activity associated with IL-6.
  • the at least one activity associated with IL-6 is W an in vitro activity comprising stimulation of proliferation of Tl 165 cells; binding of IL-6 to IL-6R; activation (dimerization) of the gpl30 signal-transducing glycoprotein; formation of IL-6/IL- 6R/gpl30 multimers; stimulation of haptoglobin production by HepG2 cells modified to express human IL-6 receptor; or any combination thereof.
  • the subject prior to administration of the antibody, or antigen-binding fragment thereof, has exhibited or is at risk for developing at least one of the following symptoms: elevated serum C-reactive protein ("CRP"); elevated erythrocyte sedimentation rate; or a combination thereof.
  • CRP serum C-reactive protein
  • the antibody or antigen-binding fragment is directly or indirectly coupled to a detectable label, cytotoxic agent, therapeutic agent, or an immunosuppressive agent.
  • the detectable label includes a fluorescent dye, bioluminescent material, radioactive material, chemiluminescent moietie, streptavidin, avidin, biotin, radioactive material, enzyme, substrate, horseradish peroxidase, acetylcholinesterase, alkaline phosphatase, ⁇ -galactosidase, luciferase, rhodamine, fluorescein, fluorescein isothiocyanate, umbelliferone, dichlorotriazinylamine, phycoerythrin, dansyl chloride, luminol, luciferin, aequorin, Iodine 125 ( 125 I), Carbon 14 ( 14 C), Sulfur 35 ( 35 S), Tritium ( 3 H), Phosphorus 32 (
  • the antibody or antigen-binding fragment is co-administered with another therapeutic agent selected from the group consisting of analgesics, antibiotics, anti-cachexia agents, anti-coagulants, anti-cytokine agents, antiemetic agents, anti-fatigue agent, anti-fever agent, anti-inflammatory agents, anti-nausea agents, antipyretics, antiviral agents, anti-weakness agent, chemotherapy agents, cytokine antagonist, cytokines, cytotoxic agents, gene therapy agents, growth factor, IL-6 antagonists, immunosuppressive agents, statins, and any combination thereof.
  • another therapeutic agent selected from the group consisting of analgesics, antibiotics, anti-cachexia agents, anti-coagulants, anti-cytokine agents, antiemetic agents, anti-fatigue agent, anti-fever agent, anti-inflammatory agents, anti-nausea agents, antipyretics, antiviral agents, anti-weakness agent, chemotherapy agents, cytokine antagonist, cytokines,
  • the cytokine antagonist is an antagonist of a factor comprising tumor necrosis factor- alpha, interferon gamma, interleukin 1 alpha, interleukin 1 beta, interleukin 6, or any combination thereof.
  • the cytokine antagonist is an antagonist of TNF-a, IL-la, IL- ⁇ ⁇ , IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN- , IFN- ⁇ , BAFF, CXCL13, IP-10, leukemia-inhibitoty factor, or a combination thereof.
  • tiie growth factor is VEGF, EPO, EGF, HRG, Hepatocyte Growth Factor (HGF), Hepcidin, or any combination thereof.
  • the IL- 6 antagonist includes an anti-IL-6 antibodies or antigen-binding fragments thereof, antisense nucleic acids, polypeptides, small molecules, or any combination thereof.
  • the antisense nucleic acid includes at least approximately 10 nucleotides of a sequence encoding IL-6, IL-6 receptor alpha, gpl30, p38 MAP kinase, JAK1, JAK2, JAK3, or SYK.
  • the antisense nucleic acid includes DNA, RNA, peptide nucleic acid, locked nucleic acid, morpholino (phosphorodiamidate morpholino oligo), glycerol nucleic acid, threose nucleic acid, or any combination thereof.
  • the IL-6 antagonist polypeptide includes a fragment of a polypeptide having a sequence selected from the group consisting IL-6, IL-6 receptor alpha, gpl30, p38 MAP kinase, JAK1 , JAK2, JAK3, and SYK. In another embodiment, the fragment is at least about 40 amino acids in length.
  • the IL-6 antagonist includes a soluble IL-6, IL-6 receptor alpha, gpl30, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any combination thereof.
  • the IL-6 antagonist may be coupled to a half-life increasing moiety.
  • the antibody or antigen-binding fragment thereof is administered to the subject in the form of at least one nucleic acids that encode the antibody.
  • the light chain of said antibody or antigen-binding fragment thereof is encoded by at least one of the following nucleic acid sequences of SEQ ID NOs: 10, 29, 45, 61, 77, 93, 109, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, 290, 306, 322, 338, 354, 370, 386, 402, 418, 434, 450, 466, 482, 498, 514, 530, 546, 562, 578, 662, 669, 673, 677, 681, 685, 689, 698, 701, 705, 720, 721 , 722, or 723.
  • the heavy chain of said antibody or antigen-binding fragment thereof is encoded by at least one of the following nucleic acid sequences of SEQ ID NOs: 1 1, 30, 46, 62, 78, 94, 1 10, 131 , 147, 163, 179, 195, 21 1 , 227, 243, 259, 275, 291 , 307, 323, 339, 355, 371 , 387, 403, 419, 435, 451, 467, 483, 499, 515, 531 , 547, 563, 579, 663, 670, 674, 678, 682, 686, 690, 700, 703, 707, 724, or 725.
  • At least one of the CDRs of said antibody or antigen-binding fragment thereof is encoded by at least one of the following nucleic acid sequences of SEQ ID NOs: 12, 15, 31 , 34, 47, 50, 63, 66, 79, 82, 95, 98, 1 1 1, 1 14, 132, 135, 148, 1 51, 164, 167, 180, 183, 196, 199, 212, 215, 228, 231, 244, 247, 260, 263, 276, 279, 292, 295, 308, 31 1 , 324, 327, 340, 343, 356, 359, 372, 375, 388, 391, 404, 407, 420, 423, 436, 439, 452, 455, 468, 471, 484, 487, 500, 503, 516, 519, 532, 535, 548, 551, 564, 567, 580, 583, 694, 13, 16, 32, 35, 48, 51, 64, 67, 80, 83
  • At least one nucleic acids includes the heavy and light chain polynucleotide sequences of SEQ ID NO: 723 and SEQ ID NO: 700; SEQ ID NO: 701 and SEQ ID NO: 703; SEQ ID NO: 705 and SEQ ID NO: 707; SEQ ID NO: 720 and SEQ ID NO: 724; and SEQ ID NO: 10 and SEQ ID NO: 1 1.
  • the composition is administered subcutaneously.
  • the composition is a pharmaceutical composition.
  • the composition is formulated for subcutaneous administration.
  • the antibody or antigen-binding fragment thereof is asialated. In one embodiment, the antibody or antigen-binding fragment thereof is humanized. In one embodiment, the antibody or antigen-binding fragment thereof has a half-life of at least about 30 days. In one embodiment, the antibody or antigen-binding fragment thereof includes the humanized variable light sequence of amino acid sequence of SEQ ID NO: 20. In one embodiment, the antibody or antigen- binding fragment thereof includes humanized variable heavy sequence of amino acid sequence of SEQ ID NO: 19. In another embodiment, the antibody or antigen-binding fragment thereof includes at least one light chain CDRs as set forth in the amino acid sequence of SEQ ID NOs: 4, 5, or 6.
  • the antibody or antigen-binding fragment thereof includes at least one heavy chain CDRs as set forth in the amino acid sequence of SEQ ID NOs: 7, 120, 8, or 9.
  • the antibody or antigen-binding fragment thereof is an asialated, humanized anti-IL-6 monoclonal antibody with a half-life of -30 days comprising the humanized variable light and heavy sequences as set forth in SEQ ID NO: 20 and 19 or 702 and 704, respectively.
  • One embodiment encompasses specific humanized antibodies and fragments and variants thereof for treatment or prevention of psoriatic arthritis capable of binding to IL-6 and/or the IL-6/IL- 6R complex. These antibodies bind to soluble IL-6 or cell surface expressed IL-6. Also, these antibodies inhibit the formation or the biological effects of at least one of IL-6, IL-6/IL-6R complexes, IL-6/IL-6R/gpl 30 complexes and/or multimers of IL-6/IL-6R/gpl30.
  • the present subject technology relates to novel therapies and therapeutic protocols using anti-IL-6 antibodies, preferably those described herein.
  • this is effected by the administration of the antibodies described herein, comprising the sequences of the V H , VL and CDR polypeptides described in Table 1 , or humanized or chimeric or single chain versions thereof containing at least one of the CDRs of the exemplified anti-IL-6 antibody sequences and the polynucleotides encoding them.
  • these antibodies will be aglycosylated.
  • these antibodies will block gpl 30 activation and/or possess binding affinities (Kds) less than 50 picomolar and/or ⁇ 0 , ⁇ values less than or equal to 10 4 S " 1 .
  • binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv and scFv fragments.
  • the anti-IL-6 antibodies block the effects of IL-6.
  • the anti-IL-6 antibody is a humanized monoclonal antibody that binds to free human IL- 6 and soluble IL-6R/IL-6 complex with an affinity of at least about 4 pM.
  • the anti-IL-6 antibody has a serum half-life about at least 30 days.
  • the anti-IL-6 antibody is based on a consensus human IgGl kappa framework that had asparagines modified to alanine to eliminate N-glycosylation sites.
  • the antibodies and humanized versions are derived from rabbit immune cells (B lymphocytes) and are selected based on their homology (sequence identity) to human germ line sequences. These antibodies may require minimal or no sequence modifications, thereby facilitating retention of functional properties after humanization.
  • the humanized antibodies include human frameworks which are highly homologous (possess high level of sequence identity) to that of a parent (e.g. rabbit) antibody.
  • the anti-IL-6 antibody or antibody fragment or variant thereof specifically bind to the same linear or conformational epitopes on an intact IL-6 polypeptide or fragment thereof which may include at least fragments selected from those encompassing amino acid residues 37-51 , amino acid residues 70-84, amino acid residues 169-183, amino acid residues 31— 5 and/or amino acid residues 58-72.
  • the anti-IL-6 antibody comprises at least one of the CDRs in listed in Table 1.
  • the anti-IL-6 antibody comprises the variable heavy and light chain sequences in SEQ ID NO: 657 and SEQ ID NO: 709, or variants thereof.
  • the humanized anti-IL-6 antibody comprises the variable heavy and variable light chain sequences respectively set forth in SEQ ID NO: 657 and SEQ ID NO: 709, respectively, and preferably further comprising the heavy chain and light chain constant regions respectively set forth in SEQ ID NO: 588 and SEQ ID NO: 586, and variants thereof comprising at least one amino acid substitutions or deletions that do not substantially affect IL-6 binding and/or desired effector function.
  • This embodiment also contemplates polynucleotides comprising, or alternatively consisting of, at least one of the nucleic acids encoding the variable heavy chain (SEQ ID NO: 700) and variable light chain (SEQ ID NO: 723) sequences and the constant region heavy chain (SEQ ID NO: 589) and constant region light chain (SEQ ID NO: 587) sequences.
  • This embodiment further contemplates nucleic acids encoding variants comprising at least one amino acid substitutions or deletions to the variable heavy and variable light chain sequences respectively set forth in SEQ ID NO: 657 and SEQ ID NO: 709 and the heavy chain and light chain constant regions respectively set forth in SEQ ID NO: 588 and SEQ ID NO: 586, that do not substantially affect IL-6 binding and/or desired effector function.
  • the anti-IL-6 antibody or antibody fragment or variant thereof is aglycosylated or substantially aglycosylated, e.g., as a result of one or more modifications in the Fc region of the antibody.
  • the anti-IL-6 antibody or antibody fragment or variant thereof contain an Fc region that has been modified to alter effector function, half-life, proteolysis, and/or glycosylation.
  • the Fc region is modified to eliminate glycosylation.
  • the anti-IL-6 antibody or antibody fragment or variant thereof is a human, humanized, single chain or chimeric antibody.
  • the anti-IL-6 antibody or antibody fragment or variant thereof is a humanized antibody derived from a rabbit (parent) anti-IL-6 antibody.
  • the framework regions (FRs) in the variable light region and the variable heavy regions of said anti-IL-6 antibody or antibody fragment or variant thereof respectively is human FRs which are unmodified or which have been modified by the substitution of at most 2 or 3 human FR residues in the variable light or heavy chain region with the corresponding FR residues of the parent rabbit antibody, and the human FRs have been derived from human variable heavy and light chain antibody sequences which have been selected from a library of human germline antibody sequences based on their high level of homology to the corresponding rabbit variable heavy or light chain regions relative to other human germline antibody sequences contained in the library.
  • the antibody will comprise human FRs which are selected based on their high level of homology (degree of sequence identity) to that of the parent antibody that is
  • the anti-IL-6 antibody or antibody fragment or variant thereof includes a heavy chain polypeptide sequence comprising: SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, or 708; and may further comprise a VL polypeptide sequence comprising: SEQ ID NO: 2, 20, 647, 651 , 660, 666, 699, 702, 706, or 709 or a variant thereof wherein at least one of the framework residues (FR residues) in said VH or VL polypeptide may have been substituted with another amino acid residue resulting in an anti-IL-6 antibody or antibody fragment or variant thereof that specifically binds human IL-6, or includes a polypeptide wherein the CDRs therein are incorporated into a human framework homologous to said sequence.
  • the variable heavy and light sequences comprise those in SEQ ID NO: 657 and 709, respectively.
  • At least one of said FR residues may be substituted with an amino acid present at the corresponding site in a parent rabbit anti-IL-6 antibody from which the complementarity determining regions (CDRs) contained in said VH or VL polypeptides have been derived or by a conservative amino acid substitution.
  • CDRs complementarity determining regions
  • said anti-IL-6 antibody, or antibody fragment or variant thereof is humanized.
  • said anti-IL-6 antibody, or antibody fragment or variant thereof is chimeric.
  • said anti-IL-6 antibody, or antibody fragment or variant thereof further includes a human Fc, e.g., an Fc region comprised of the variable heavy and light chain constant regions set forth in SEQ ID NO: 704 and 702.
  • said human Fc may be derived from IgG l , IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgGl O, IgGl 1 , IgG 12, IgG 13, IgG 14, IgG15, IgG 16, IgG 17, IgG 18 or IgG 19.
  • the anti-IL-6 antibody or antibody fragment or variant thereof includes a polypeptide having at least about 90% sequence homology to at least one of the polypeptide sequences of SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, 708, 2, 20, 647, 651, 660, 666, 699, 702, 706, or 709.
  • the anti-IL-6 antibody or antibody fragment or variant thereof has an elimination half-life of at least about 30 days.
  • the subject technology also contemplates the administration of conjugates of anti-IL-6 antibodies and humanized, chimeric or single chain versions thereof and other binding fragments and variants thereof conjugated to at least one functional or detectable moieties.
  • the anti-IL-6 antibody or antibody fragment or variant thereof is directly or indirectly attached to a detectable label or therapeutic agent.
  • the IL-6 antagonist is an antisense nucleic acid.
  • the IL-6 antagonist is an antisense nucleic acid, for example comprising at least approximately 10 nucleotides of a sequence encoding IL-6, IL-6 receptor alpha, gp l30, p38 MAP kinase, JAK1 , JAK2, JAK3, or SYK.
  • the antisense nucleic acid includes DNA, RNA, peptide nucleic acid, locked nucleic acid, morpholino (phosphorodiamidate morpholino oligo), glycerol nucleic acid, threose nucleic acid, or any combination thereof.
  • the IL-6 antagonist includes Actemra® (Tocilizumab), Remicade®, Zenapax® (daclizumab), or any combination thereof.
  • the IL-6 antagonist includes a polypeptide having a sequence comprising a fragment of IL-6, IL-6 receptor alpha, gpl 30, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any combination thereof, such as a fragment or full-length polypeptide that is at least 40 amino acids in length.
  • the IL-6 antagonist includes a soluble IL-6, IL-6 receptor alpha, gpl 30, p38 MAP kinase, JAK1, JAK2, JAK3, SYK, or any combination thereof.
  • the IL-6 antagonist is coupled to a half-life increasing moiety.
  • the subject technology provides novel pharmaceutical compositions and their use in novel combination therapies and comprising administration of an anti-IL-6 antibody, such as any one of Abl-Ab36 antibodies described in Table 1 or a fragment or variant thereof, and at least one other therapeutic compound such as an anti-cytokine agent.
  • an anti-IL-6 antibody such as any one of Abl-Ab36 antibodies described in Table 1 or a fragment or variant thereof
  • at least one other therapeutic compound such as an anti-cytokine agent.
  • the IL-6 antagonist may target IL-6, IL-6 receptor alpha, gpl 30, p38 MAP kinase, JAK1 , JAK2, JAK3, SYK, or any combination thereof.
  • the IL-6 antagonist includes an antibody, an antibody fragment, a peptide, a glycoalkoid, an antisense nucleic acid, a ribozyme, a retinoid, an avemir, a small molecule, or any combination thereof.
  • the IL-6 antagonist includes an anti-IL-6R, anti-gpl30, anti-p38 MAP kinase, anti-JAKl , anti-JAK2, anti-JAK3, or anti-SYK antibody or antibody fragment.
  • the antagonist includes an anti-IL-6 antibody (e.g., any one of Abl-Ab36 antibodies described in Table 1) or antibody fragment or variant thereof.
  • the present subject technology also pertains to methods of improving survivability or quality of life of a patient having or at risk of developing psoriatic arthritis comprising administering to the patient an anti-IL-6 antibody (e.g. , ALD518 antibody) or antibody fragment or variant thereof, whereby the patient's C-reactive protein (“CRP”) level is lowered.
  • an anti-IL-6 antibody e.g. , ALD518 antibody
  • CRP C-reactive protein
  • the anti-IL-6 antibody or antibody fragment or variant thereof is administered to the patient with a frequency at most once per period of approximately 4, 8, 12, 16, 20, or 24 weeks.
  • the patient's quality of life is improved.
  • an anti-IL-6 antibody is any one of Abl-Ab36 antibodies described in Table 1 , which includes rabbit or humanized forms thereof, as well as heavy chains, light chains, fragments, variants, and CDRs thereof, or an antibody or antibody fragment that specifically binds to the same linear or conformational epitope(s) on an intact human IL-6 polypeptide fragment thereof as Abl .
  • the subject application pertains in particular to preferred formulations and therapeutic uses of an exemplary humanized antibody referred to herein as any one of Abl-Ab36 antibodies described in Table 1 and variants thereof.
  • the anti-IL-6 antibody has an in vivo half-life of at least about 30 days, has an in vivo effect of lowering C-reactive protein, possesses a binding affinity (Kd) for IL-6 of less than about 50 picomolar, and/or has a rate of dissociation (K off ) from IL-6 of less than or equal to 10 "4 S ⁇ 1 .
  • this subject technology pertains to methods of improving survivability or quality of life of a patient in need thereof, comprising administering to a patient with or at risk of developing psoriatic arthritis as a result of disease or a therapeutic regimen comprising the administration of an anti-IL-6 antibody, such as any one of Abl -Ab36 antibodies described in Table 1 antibody or a fragment or variant thereof (e.g., Abl).
  • an anti-IL-6 antibody such as any one of Abl -Ab36 antibodies described in Table 1 antibody or a fragment or variant thereof (e.g., Abl).
  • anti-IL-6 antibodies, or antigen-binding fragments thereof is administered at effective doses to less inflammation, pain, and loss of mobility experienced from psoriatic arthritis, e.g., dosages ranging from about 25-500 mg, preferably at least about 25, 80, 100, 120, 160, 200, 240, or 320 mg dosages. In an embodiment, the effective dosage ranges between about 25 to 160 mg/ 4 weeks, per person, delivered to a subject in need thereof by a subcutaneous injection.
  • Another embodiment relates to methods of improving survivability or quality of life of a patient diagnosed with psoriatic arthritis, comprising administering to the patient an anti-IL-6 antibody or antigen-binding fragment or variant thereof, whereby the patient's serum C-reactive protein (“CRP") level is stabilized and preferably reduced, and monitoring the patient to assess the reduction in the patient's serum CRP level.
  • the patient has an elevated C-reactive protein (CRP) level prior to treatment.
  • the patient may have an elevated serum CRP level prior to treatment.
  • the patient's serum CRP level remains decreased for an entire period intervening two consecutive anti-IL-6 antibody administrations.
  • the patient may have been diagnosed psoriatic arthritis.
  • the antibody, or antigen-binding fragment thereof is engineered, e.g., produced by genetic engineering methods such as having been expressed from a recombinant cell.
  • the cell may be selected from a mammalian, yeast, bacterial, and insect cell.
  • the cell may be a yeast cell.
  • the cell is a diploidal yeast cell.
  • the yeast cell is a Pichia yeast.
  • the anti-IL-6 antibody is produced in a yeast based ⁇ Pichia pastoris) expression system using conventional fermentation processes and downstream purification.
  • the antibodies and antibody fragments described herein is expressed in yeast cells.
  • the mating competent yeast is a member of the Saccharomycetaceae family, which includes the genera Arxiozyma;
  • yeast Ascobotryozyma; Citeromyces; Debaryomyces; Dekkera; Eremothecium; Issatchenkia; Kazachstania; Kluyveromyces; Kodamaea; Lodderomyces; Pachysolen; Pichia; Saccharomyces; Saturnispora; Tetrapisispora; Torulaspora; Williopsis; and Zygosaccharomyces .
  • Other types of yeast potentially useful in the subject technology include Yarrowia, Rhodosporidium, Candida, Hansenula,
  • the mating competent yeast may a member of the genus Pichia.
  • the mating competent yeast of the genus Pichia is one of the following species: Pichia pastoris, Pichia methanolica, and Hansenula polymorpha ⁇ Pichia angusta).
  • the mating competent yeast of the genus Pichia may the species Pichia pastoris.
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis, or managing one or more of the symptoms of psoriatic arthritis comprising administration of a composition comprising an effective amount of an anti-IL-6 antibody or antibody fragment thereof to a subject in need thereof, wherein the anti-IL-6 antibody or antibody fragment thereof comprises a variable light (VL) chain polypeptide comprising a CDR1 sequence of SEQ ID NO:4, a CDR2 sequence of SEQ ID NO:5, and a CDR3 sequence of SEQ ID NO:6, and a variable heavy (VH) chain polypeptide comprising a CDR1 sequence of SEQ ID NO:7, a CDR2 sequence of SEQ ID NOs:8 or 120, and a CDR3 sequence of SEQ ID NO:9.
  • VL variable light
  • VH variable heavy chain polypeptide comprising a CDR1 sequence of SEQ ID NO:7, a CDR2 sequence of SEQ ID NOs:8 or 120, and a CDR3 sequence of SEQ
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an effective amount of an anti-IL-6 antibody or antibody fragment thereof to a subject in need thereof, wherein the anti-IL-6 antibody or antibody fragment thereof comprises a variable light (V L ) chain polypeptide comprising the amino acid sequence in SEQ ID NO:20, 702 or 709, and a variable heavy (V H ) chain polypeptide comprising the amino acid sequence in SEQ ID NO: 18, 19, 657 or 704.
  • V L variable light
  • V H variable heavy chain polypeptide
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis of claim 1 , comprising administration of a composition comprising an effective amount of an anti-IL-6 antibody or antibody fragment thereof to a subject in need thereof, wherein the anti-IL-6 antibody or antibody fragment thereof comprises a variable light (VL) chain polypeptide comprising the amino acid sequence in SEQ ID NO:20 or 709, and a variable heavy (VH) chain polypeptide comprising the amino acid sequence in SEQ ID NO: 18, 19, or 657.
  • VL variable light
  • VH variable heavy chain polypeptide
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an effective amount of an anti-IL-6 antibody or antibody fragment thereof to a subject in need thereof, wherein the anti-IL-6 antibody or antibody fragment thereof comprises a light chain polypeptide comprising the polypeptide having the amino acid sequence in SEQ ID NO:702 and a heavy chain comprising the polypeptide having the amino acid sequence of SEQ ID NO:704.
  • said antibody fragment may e.g., be a Fab fragment, a Fab' fragment, a F(ab')2 fragment, an scFv, a camelbody, a nanobody, a MetMab like monovalent agent, or an IgNAR (single-chain antibodies derived from sharks).
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an anti-IL-6 antibody or antibody fragment thereof comprises a VL chain polypeptide at least 80% identical to the amino acid sequence of SEQ ID NO:709, and/or a VH chain polypeptide at least 80% identical to the amino acid sequence of SEQ ID NO:657.
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an anti-IL-6 antibody or antibody fragment thereof which comprises a VL chain polypeptide at least 95% identical to the amino acid sequence of SEQ ID NO: 709, and/or a VH chain polypeptide at least 95% identical to the amino acid sequence of SEQ ID NO:657.
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an anti-IL-6 antibody or antibody fragment thereof which comprises a VL chain polypeptide at least 95% identical to the amino acid sequence of SEQ ID NO:709, and/or a VH chain polypeptide at least 95% identical to the amino acid sequence of SEQ ID NO:657.
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an anti-IL-6 antibody or antibody fragment thereof which comprises a VL chain polypeptide identical to the amino acid sequence of SEQ ID NO: 709, and/or a VH chain polypeptide identical to the amino acid sequence of SEQ ID NO:657.
  • the invention comprises or consists of a method for treating or preventing psoriatic arthritis or managing one or more of the symptoms of psoriatic arthritis, comprising administration of a composition comprising an anti-IL-6 antibody or antibody fragment thereof which comprises a light chain polypeptide at least 90, 95 or 99% identical to the amino acid sequence of SEQ ID NO: 702, and/or a heavy chain polypeptide at least 90, 95 or 99% identical to the amino acid sequence of SEQ ID NO:704.
  • said anti-IL-6 antibody or antibody fragment thereof is aglycosylated.
  • said antibody or antibody fragment comprises an Fc region that has been modified to alter effector function, half-life, proteolysis, and/or glycosylation.
  • said antibody or antibody fragment comprises a human Fc derived from IgGl, IgG2, IgG3, or IgG4.
  • said antibody or antibody fragment thereof is a human, humanized, single chain or chimeric antibody.
  • said antibody or antibody fragment specifically binds to human cell surface expressed IL-6 and/or to circulating soluble IL-6 molecules in vivo.
  • said antibody or antibody fragment specifically binds to IL-6 expressed on or by human cells in the subject.
  • said antibody or antibody fragment has an in vivo half-life of at least about 30 days in a healthy human subject.
  • said antibody or antibody fragment has a binding affinity (Kd) for IL-6 of less than about 50 picomolar, or a rate of dissociation (K 0ff ) from IL- 6 of less than or equal to 10 "4 S- 1 .
  • said antibody or antibody fragment specifically binds to the same linear or conformational epitope(s) and/or competes for binding to the same linear or conformational epitope(s) on an intact human IL-6 polypeptide or fragment thereof as an anti-IL-6 antibody comprising the polypeptides of SEQ ID NO: 702 and SEQ ID NO: 704.
  • said antibody or antibody fragment contains an Fc region that has been modified to alter effector function, half-life, proteolysis, and/or glycosylation.
  • a single dosage effective amount of aid anti-IL-6 antibody or antibody fragment comprises at least or consists of 1 , 5, 10, 15, 20, 25, 50, 60, 80, 100, 120, 160, 200, or 320 mg of said anti-IL-6 antibody or antibody fragment.
  • a dosage effective amount of said anti-IL- 6 antibody or antibody fragment is between about 0.1 and 100 mg/kg of body weight of the subject.
  • said anti-IL-6 antibody or fragment thereof is administered at least 1 , 2, 3, 4, or 5 doses.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen that comprises or consists of administering said anti- IL-6 antibody or antibody fragment every 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen that comprises or consists of administering 1, 5, 10, 15, 20 or 25 mg of said anti-IL-6 antibody or antibody fragment every 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen that comprises or consists of administering 25 mg of said anti-IL-6 antibody or antibody fragment every 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen that comprises or consists of administering 25 mg of said anti-IL-6 antibody or antibody fragment every 4 weeks.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen is effected every 4 weeks or monthly for 8, 12, 16, 20, 24, 28, 32, 36 weeks or more or for 2, 3, 4, 5, 6 or more months.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen wherein said subject is treated by a dosage regimen that comprises or consists of administering 50, 60 or 75 mg of said anti-IL-6 antibody or antibody fragment every 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen
  • a dosage regimen that comprises or consists of administering 80, 100 or 120 mg of said anti-IL-6 antibody or antibody fragment eveiy 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen wherein said subject is treated by a dosage regimen that comprises or consists of administering 160 mg of said anti-IL-6 antibody or antibody fragment every 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen that comprises or consists of administering 200 mg of said anti-IL-6 antibody or antibody fragment every 4 weeks or every month.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen t wherein said subject is subject is treated by a dosage regimen that comprises or consists of administering said anti-IL-6 antibody or antibody fragment every 4 weeks or every month for at least 16 weeks or 4 months.
  • said anti-IL-6 antibody or fragment composition is administered in a dosage regimen wherein said subject is subject is treated by a dosage regimen that comprises or consists of administering said anti-IL-6 antibody or antibody fragment every 4 weeks or every month for at least 20 or 24 weeks or at least 5 or 6 months.
  • CRP C-reactive protein
  • the treated patient or subject has elevated IL-6 serum level.
  • the treated patient or subject has elevated IL-6 level in the joints.
  • NSAlDs non-steroidal anti-inflammatory drugs
  • DMARDs non-biologic Disease Modifying Anti-Rheumatic Drugs
  • said antibody or antibody fragment thereof inhibits with at least one activity associated with IL-6.
  • the antibody or antibody fragment inhibits at least one of the at least one activity associated with IL-6 is an in vitro activity comprising stimulation of proliferation of Tl 165 cells; binding of IL-6 to IL-6R; activation (dimerization) of the gpl 30 signal-transducing glycoprotein; formation of IL-6/IL-6R/gpl 30 multimers; stimulation of haptoglobin production by HepG2 cells modified to express human IL-6 receptor; or any combination thereof.
  • W in vitro activity comprising stimulation of proliferation of Tl 165 cells; binding of IL-6 to IL-6R; activation (dimerization) of the gpl 30 signal-transducing glycoprotein; formation of IL-6/IL-6R/gpl 30 multimers; stimulation of haptoglobin production by HepG2 cells modified to express human IL-6 receptor; or any combination thereof.
  • the treated patient or subject prior to administration of the antibody, or antigen-binding fragment thereof the subject has exhibited or is at risk for developing at least one of the following symptoms: elevated serum C-reactive protein ("CRP"); elevated erythrocyte sedimentation rate; or a combination thereof.
  • CRP serum C-reactive protein
  • the antibody or antibody fragment thereof is directly or indirectly coupled to a detectable label, cytotoxic agent, therapeutic agent, or an immunosuppressive agent.
  • the antibody or antibody fragment thereof is directly or indirectly coupled to a detectable label comprising fluorescent dyes, bioluminescent materials, radioactive materials, chemiluminescent moieties, streptavidin, avidin, biotin, radioactive materials, enzymes, substrates, horseradish peroxidase, acetylcholinesterase, alkaline phosphatase, ⁇ - galactosidase, luciferase, rhodamine, fluorescein, fluorescein isothiocyanate, umbelliferone, dichlorotriazinylamine, phycoerythrin, dansyl chloride, luminol, luciferin, aequorin, Iodine 125 (1251), Carbon 14 (14C), Sulfur 35 (35S), Tritium (3H), Phosphorus 32 (32P), or any combination thereof.
  • a detectable label comprising fluorescent dyes, bioluminescent materials, radioactive materials, chemiluminescent moi
  • the antibody or antibody fragment thereof is co-administered with another therapeutic agent selected from the group consisting of analgesics, antibiotics, anti-cachexia agents, anti-coagulants, anti-cytokine agents, antiemetic agents, anti-fatigue agent, anti-fever agent, anti-inflammatory agents, anti-nausea agents, antipyretics, antiviral agents, anti-weakness agent, chemotherapy agents, cytokine antagonist, cytokines, cytotoxic agents, gene therapy agents, growth factor, IL-6 antagonists, immunosuppressive agents, statins, or any combination thereof.
  • another therapeutic agent selected from the group consisting of analgesics, antibiotics, anti-cachexia agents, anti-coagulants, anti-cytokine agents, antiemetic agents, anti-fatigue agent, anti-fever agent, anti-inflammatory agents, anti-nausea agents, antipyretics, antiviral agents, anti-weakness agent, chemotherapy agents, cytokine antagonist, cytokines, cytotoxic agents
  • the antibody or antibody fragment is coadministered with an agonist of a factor comprising tumor necrosis factor-alpha, interferon gamma, interleukin 1 alpha, interleukin 1 beta, interleukin 6, or any combination thereof.
  • the antibody or antibody fragment is coadministered with a cytokine antagonist which is an antagonist of TNF-a, IL- ⁇ ⁇ , IL-l a, IL-2, 1L-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-a, IFN- ⁇ , IFN-y, BAFF, CXCL13, IP-10, leukemia-inhibitory factor, or a combination thereof.
  • a cytokine antagonist which is an antagonist of TNF-a, IL- ⁇ ⁇ , IL-l a, IL-2, 1L-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-a, IFN- ⁇ , IFN-y, BAFF, CXCL13, IP-10, leukemia-inhibitory factor, or a combination thereof.
  • the antibody or antibody fragment is coadministered with an antagonist of VEGF, EPO, EGF, HRG, Hepatocyte Growth Factor (HGF), Hepcidin, or any combination thereof.
  • the antibody or antibody fragment is coadministered with other anti-IL-6 antibodies or antigen-binding fragments thereof, antisense nucleic acids, polypeptides, small molecules, or any combination thereof.
  • the antibody or antibody fragment is coadministered with an antisense nucleic acid comprises at least approximately 10 nucleotides of a sequence encoding IL-6, 1L-6 receptor alpha, gpl30, p38 MAP kinase, JAK1, JAK2, JAK3, or SYK.
  • the antibody or antibody fragment is coadministered with an IL-6 antagonist polypeptide that comprises a fragment of a polypeptide having a sequence selected from the group consisting IL-6, IL-6 receptor alpha, gpl30, p38 MAP kinase, JAK1, JAK2, JAK3, and SYK.
  • the antibody or antibody fragment is coadministered with an IL-6 antagonist comprising a soluble IL-6, IL-6 receptor alpha, gpl 30, p38 MAP kinase, JAK1 , JAK2, JAK3, SYK, or any combination thereof, e.g., one coupled to a half-life increasing moiety.
  • an IL-6 antagonist comprising a soluble IL-6, IL-6 receptor alpha, gpl 30, p38 MAP kinase, JAK1 , JAK2, JAK3, SYK, or any combination thereof, e.g., one coupled to a half-life increasing moiety.
  • the antibody or antibody fragment is administered to the subject in the form of at least one nucleic acid that encodes said antibody or antibody fragment thereof.
  • the antibody or antibody fragment is in a pharmaceutical composition comprising a pharmaceutical excipient.
  • the invention is directed to a dosage composition, or syringe or injector pen containing a single dosage of an anti-IL-6 antibody or antibody fragment which is for use in treating or preventing psoriatic arthritis according to any of the foregoing claims, and wherein said anti-IL-6 antibody or antibody fragment comprises or consists of CDRs, variable heavy or light polypeptides or light and heavy polypeptides having the amino acid sequences as set forth in any of the foregoing claims, wherein the single dosage of said anti-IL-6 antibody or antibody fragment contained in said composition or syringe or injector pen containing same comprises at most or consists of 1 , 5, 10, 15, 20, or 25 mg of said anti- IL-6 antibody or antibody fragment.
  • the invention is directed to a single dosage composition, or syringe or injector pen comprising an anti-IL-6 antibody or fragment , which is for administration every 4 weeks or monthly for treating or managing the symptoms of psoriatic arthritis.
  • the invention is directed to a single dosage composition
  • syringe or injector pen of claim which contains an antibody dosage comprising or consisting of 25 mg of said anti- an anti-Il-6 antibody or antibody fragment according to the invention.
  • the invention is directed to a single dosage composition
  • syringe or injector pen of claim which contains an antibody dosage comprising or consisting of 25 mg of said anti- an anti-Il-6 antibody or antibody fragment according to the invention, wherein the antibody or antibody fragment is comprised in an aqueous or 0.9 % saline solution.
  • the invention is directed to a therapeutic regimen for treating or preventing psoriatic arthritis or managing the side effects of psoriatic arthritis in a subject W in need thereof, wherein the therapeutic regimen comprises or consists of administering a single dosage of an anti-lL-6 antibody or antibody fragment every 4 weeks or monthly using a syringe or injector pen which single dosage comprises at most or consists of 1 , 5, 10, 15, 20, or 25 mg of - an anti-Il-6 antibody or antibody fragment comprising or consisting of any of the anti-IL-6 antibody sequences set forth herein, preferably an anti-IL-6 antibody or antibody fragment that comprises the VL polypeptide of SEQ ID NO:20 or 709 and a VH polypeptides having the amino acid sequence of SEQ ID NO: 18, 19 or 657, or that comprises the VL polypeptide of SEQ ID NO:709 and a VH polypeptides having the amino acid sequence of SEQ ID NO:657 or which comprises a light chain polypeptide having the amino
  • the invention is directed methods or regimens as above- described wherein the treated subject or caregiver subcutaneously administers the single dosage every 4 weeks or monthly.
  • the invention is directed to methods or regimens as above-described wherein the treated subject or caregiver subcutaneously administers a single dosage of anti-IL-6 antibody according to the invention every 4 weeks or monthly by use of an injector pen.
  • the invention is directed to methods or regimens as above-described which further include the administration of a DMARD, a corticosteroid.
  • the invention is directed to methods or regimens as above-described which further include the administration of methotrexate.
  • the invention is directed to methods or regimens as above-described wherein the treated subject has developed a resistance or tolerance to methotrexate.
  • the invention is directed to methods or regimens as above-described wherein the treated subject has previously received another anti-IL-6 antagonist or an anti-TNF biologic.
  • the invention is directed to methods or regimens as above-described wherein the treated subject has previously received Humira®, Remicade®, or Actmera®.
  • the invention is directed to methods or regimens as above-described wherein the treated subject is treated for at least 12 weeks or 3 months.
  • the invention is directed to methods or regimens as above-described wherein the treated subject is treated for at least 16 weeks or 4 months.
  • the invention is directed to methods or regimens as above-described wherein the treated subject is treated for at least 20 weeks or 5 months.
  • the invention is directed to methods or regimens as above-described wherein the treated subject is treated for at least 24 weeks or 6 months.
  • the invention is directed to methods or regimens as above-described wherein the treated subject is treated for more than at least 24 weeks or 6 months.
  • the invention is directed to methods or regimens as above-described wherein the treated subject exhibits prolonged disease remission after said antibody treatment.
  • FIGURE 1 shows alignments of variable light and variable heavy sequences between a rabbit antibody variable light and variable heavy sequences and homologous human sequences and the humanized sequences.
  • Framework regions are identified FR1-FR4.
  • Complementarity determining regions are identified as CDR1-CDR3. Amino acid residues are numbered as shown.
  • the initial rabbit sequences are called RbtVL and RbtVH for the variable light and variable heavy sequences respectively.
  • Three of the most similar human germline antibody sequences, spanning from Framework 1 through to the end of Framework 3 are aligned below the rabbit sequences.
  • the human sequence that is considered the most similar to the rabbit sequence is shown first. In this example those most similar sequences are L12A for the light chain and 3-64-04 for the heavy chain.
  • Human CDR3 sequences are not shown.
  • the closest human Framework 4 sequence is aligned below the rabbit Framework 4 sequence.
  • the vertical dashes indicate a residue where the rabbit residue is identical with at least one of the human residues at the same position.
  • the bold residues indicate that the human residue at that position is identical to the rabbit residue at the same position.
  • the final humanized sequences are called VLh and VHh for the variable light and variable heavy sequences respectively.
  • the underlined residues indicate that the residue is the same as the rabbit residue at that position but different than the human residues at that position in the three aligned human sequences.
  • FIGURES 2 and 3 show alignments between a rabbit antibody light and variable heavy sequences and homologous human sequences and the humanized sequences.
  • Framework regions are identified as FR1-FR4.
  • Complementarity determining regions are identified as CDR1 -CDR3.
  • FIGURES 4A-B and 5A-B show alignments between light and variable heavy sequences, respectively, of different forms of Abl .
  • Framework regions are identified as FR1-FR4.
  • Complementarity determining regions are identified as CDR1 -CDR3. Sequence differences within the CDR regions highlighted.
  • FIGURE 6 provides a pharmacokinetic profile of antibody Abl in cynomolgus monkey. Plasma levels of antibody Abl were quantitated through antigen capture ELISA. This protein displays a half-life of between 12 and 17 days consistent with other full length humanized antibodies.
  • FIGURE 7A-D provides binding data for antibodies Ab4, Ab3, Ab8 and Ab2, respectively.
  • FIGURE 7E provides binding data for antibodies Abl, Ab6 and Ab7.
  • FIGURE 8 shows the mean plasma concentration of Abl resulting from a single administration of Abl to patients with advanced cancer.
  • FIGURE 9A demonstrates suppression of serum CRP levels in healthy individuals.
  • FIGURE 9B demonstrates suppression of serum CRP levels in advanced cancer patients.
  • FIGURE 10 shows the mean CRP values for each dosage concentrations (placebo, 80 mg, 160 mg, and 320 mg) of the Abl monoclonal antibody.
  • FIGURE 11 shows the change in median values of CRP from each dosage concentration group corresponding to FIGURE 10.
  • FIGURE 12 shows a reduction in serum CRP levels in patients with various cancers after dosing at 80, 160 or 320 mg for 12 weeks.
  • FIGURE 13 shows the effect of subcutaneous and intravenous administration of ALD518 through week 12 after antibody dosing at 50 or 100 mg.
  • FIGURE 14 shows the effect of subcutaneous and intravenous administration of ALD518 through week 12 after antibody dosing at 50 or 100 mg.
  • FIGURE 15 shows plasma CRP level concentrations after subcutaneous or intravenous dosing of humanized Abl .
  • FIGURE 16 shows the study design used in Example 21 for safety and efficacy studies of Abl , also known as MBS-945429 or clazakizumab.
  • Single asterisk (*) indicates that rescue was allowed during Period II during the Long Term (Open-Label) Extension until all ongoing subjects were switched to the final dose of 2 mg.
  • Double asterisks (**) indicate that during Long Term (Open Label) Extension, subjects continued the doses from Period II until a final dose was selected based on the Week 24 final analysis. The selected dose was 25 mg after the Week 24 analysis and was used for subjects remaining in the study for the rest of the long term extension.
  • FIGURE 17 shows a bar plot of ACR20 response by treatment by clazakizumab at day 113 (Week 16) for all randomized and treated subjects.
  • FIGURE 18 shows the ACR20 response rate to clazakizumab at the scheduled time point during the double-blind period (periods I and II) in all randomized and treated subjects.
  • subjects in the 3 clazakizumab groups achieved a numerically higher ACR20 response rate compared with the placebo group.
  • Day 1 13 (Week 16) the differences from placebo in ACR 20 response rates were numerically higher in the 25 mg and 100 mg clazakizumab groups compared with the difference from placebo and the difference from placebo with the 200 mg clazakizumab group (as noted previously).
  • FIGURE 19 shows ACR50 response rate to clazakizumab at the scheduled time point during the double blind (periods I and II) for all randomized and treated subjections.
  • subjects in all 3 clazakizumab dose groups achieved a numerically higher ACR50 response rate compared with the placebo group.
  • Day 1 13 (Week 16) the difference from placebo was numerically higher in the 25 mg and 100 mg clazakizumab groups compared with the 200 mg clazakizumab group.
  • a similar trend was noted at Day 169 (Week 24) with numerically higher differences from placebo noted in the 25 mg and 100 mg clazakizumab groups compared to the 200 mg clazakizumab group.
  • FIGURE 20 shows ACR70 response rate to clazakizumab at the scheduled time point during the double blind (periods I and II) for all randomized and treated subjections.
  • subjects in all 3 clazakizumab groups achieved a higher ACR70 response rate compared with the placebo group.
  • Day 1 13 (Week 16) the difference from placebo was numerically higher in the 25 mg and 100 mg clazakizumab groups compared with the difference from placebo for the 200 mg clazakizumab group.
  • a similar trend was noted at Day 169 (Week 24) with numerically higher differences from placebo noted in the 25 mg and 100 mg clazakizumab groups compared to the 200 mg clazakizumab group.
  • FIGURE 21 shows the median percent improvement in tender joint count after clazakizumab administration and during the double-blind period (periods I and II) for all randomized and treated subjects). As shown, beginning at Day 8 and continuing through Day 169 (Week 24), a numerically greater improvement in the median change from baseline tender joint count was shown for at least 1 dose of clazakizumab compared with the placebo group. Mean change from baseline results also showed numerically greater improvement in the tender joint count for all 3 clazakizumab groups compared with the placebo group at Day 1 13 (Week 16) and Day 169 (Week 24).
  • FIGURE 22 shows the median percent improvement in swollen joint count after clazakizumab administration and during the double-blind period (periods I and II) for all randomized and treated subjects. As shown, beginning at Day 8 and continuing through Day 169 (Week 24), the median change from baseline swollen joint count showed numerically greater improvement in all 3 clazakizumab groups compared with the placebo group. Mean change from baseline results for swollen joint counts also showed numerically greater improvement in the 3 clazakizumab groups compared with the placebo group at Day 1 13 (Week 16) and Day 169 (Week 24).
  • FIGURE 23 shows the response mean values of total IL-6 biomarker over time by treatment with clazakizumab during the double-blind period (periods I and II) in all pharmacodynamic analysis subjects.
  • FIGURE 24 shows the mean values of free IL-6 biomarker over time by treatment with clazakizumab during the double-blind period (periods I and II) in all pharmacodynamic analysis subjects.
  • Amplification as used herein refers broadly to the amplification of polynucleotide sequences is the in vitro production of multiple copies of a particular nucleic acid sequence.
  • the amplified sequence is usually in the form of DNA.
  • a variety of techniques for carrying out such amplification are known in the art. See, e.g., Van Brunt (1990) Bio/Technol. 8(4): 291-294. Polymerase chain reaction or PCR is a prototype of nucleic acid amplification, and use of PCR herein should be considered exemplary of other suitable amplification techniques.
  • Engineered, as used herein with an antibody refers to a non-naturally occurring antibody produced by recombinant or genetic engineering methodologies known in the art or described herein.
  • Antibody refers broadly to any polypeptide chain-containing molecular structure with a specific shape that fits to and recognizes an epitope, where at least one non-covalent binding interactions stabilize the complex between the molecular structure and the epitope.
  • the archetypal antibody molecule is the immunoglobulin, and all types of immunoglobulins, IgG, IgM, IgA, IgE, IgD, from all sources, e.g., human, rodent, rabbit, cow, sheep, pig, dog, chicken, are considered to be "antibodies.”
  • Antibodies include but are not limited to chimeric antibodies, human antibodies and other non-human mammalian antibodies, humanized antibodies, single chain antibodies (scFvs), camelbodies, nanobodies, IgNAR (single-chain antibodies derived from sharks), small-modular immunopharmaceuticals (SMIPs), and antibody fragments (e.g., Fabs, Fab', F(ab') 2 .) Numerous antibody coding sequences have been described; and others may be raised by methods well-known in the art.
  • Antigen-binding fragment refers broadly to a fragment of an antibody which recognizes an antigen (e.g., paratopes.)
  • the antigen-binding fragment may comprise a paratope that may be a small region (e.g., 15-22 amino acids) of the antibody's Fv region and may contain parts of the antibody's heavy and light chains. See Goldsby, et al. Antigens (Chapter 3) Immunology (5 th Ed.) New York: W.H. Freeman and Company, pages 57-75.
  • C-Reactive Protein refers broadly to a 224 amino acid protein found in the blood that rise in response to inflammation (e.g.
  • CRP also encompasses any pre-pro, pro- and mature forms of this CRP amino acid sequence, as well as mutants and variants including allelic variants of this sequence.
  • CRP levels e.g. in the serum, liver, or elsewhere in the body, can be readily measured using routine methods and commercially available reagents, e.g. ELISA, antibody test strip, immunoturbidimetry, rapid immunodiffusion, visual agglutination, Western blot, Northern blot As mentioned above CRP levels may in addition be measured in patients having or at risk of developing thrombosis according to the subject technology.
  • Coding sequence refers broadly to an in-frame sequence of codons that (in view of the genetic code) correspond to or encode a protein or peptide sequence. Two coding sequences correspond to each other if the sequences or their complementary sequences encode the same amino acid sequences. A coding sequence in association with appropriate regulatory sequences may be transcribed and translated into a polypeptide. A polyadenylation signal and transcription termination sequence will usually be located 3 ' to the coding sequence.
  • a "promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • Promoter sequences typically contain additional sites for binding of regulatory molecules (e.g., transcription factors) which affect the transcription of the coding sequence.
  • a coding sequence is "under the control" of the promoter sequence or “operatively linked” to the promoter when RNA polymerase binds the promoter sequence in a cell and transcribes the coding sequence into mRNA, which is then in turn translated into the protein encoded by the coding sequence.
  • Complementarity determining region, hypervariable region, or CDR refer broadly to at least one of the hyper-variable or complementarity determining regions (CDRs) found in the variable regions of light or heavy chains of an antibody (See Kabat, E. A. et al. (1987)Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md.). These expressions include the hypervariable regions as defined by Kabat et al. ("Sequences of Proteins of Immunological Interest," Kabat E., et al. (1983) US Dept. of Health and Human Services) or the hypervariable loops in 3-dimensional structures of antibodies. Chothia and Leska (1987) J Mol. Biol.
  • the CDRs in each chain are held in close proximity by framework regions and, with the CDRs from the other chain, contribute to the formation of the antigen binding site.
  • the CDRs there are select amino acids that have been described as the selectivity determining regions (SDRs) which represent the critical contact residues used by the CDR in the antibody-antigen interaction (Kashmiri (2005) Methods 36:25-34).
  • SDRs selectivity determining regions
  • Disease or condition refers broadly to a disease or condition that a patient has been diagnosed with or is suspected of having, particularly a disease or condition associated with elevated IL-6.
  • a disease or condition encompasses, without limitation thereto, psoriatic arthritis, as well as idiopathic conditions characterized by symptoms that include elevated IL-6.
  • Effective amount refers broadly to an amount of an active ingredient that is effective to relieve or reduce to some extent at least one of the symptoms of the disease in need of treatment, or to retard initiation of clinical markers or symptoms of a disease in need of prevention, when the compound is administered.
  • an effective amount refers to an amount of the active ingredient which exhibit effects such as (i) reversing the rate of progress of a disease; (ii) inhibiting to some extent further progress of the disease; and/or, (iii) relieving to some extent (or, preferably, eliminating) at least one symptoms associated with the disease.
  • the effective amount may be empirically determined by experimenting with the compounds concerned in known in vivo and in vitro model systems for a disease in need of treatment.
  • an amount of an anti-IL-6 antibody effective to prevent or treat a hypercoagulable state refers to an amount of anti-IL-6 antibody that, when administered to a subject, will cause a measurable improvement in the subject's coagulation profile, or prevent, slow, delay, or arrest, a worsening of the coagulation profile for which the subject is at risk.
  • an amount of an anti-IL-6 antibody effective to reduce serum CRP levels refers to an amount of anti-IL-6 antibody that, when administered to a subject, will cause a measurable decrease in serum CRP levels, or prevent, slow, delay, or arrest, an increase in serum CRP levels for which the subject is at risk.
  • an amount of an anti-IL-6 antibody effective to increase serum albumin levels refers to an amount of anti-IL-6 antibody that, when administered to a subject, will cause a measurable increase in serum albumin levels, or prevent, slow, delay, or arrest, a decrease in serum albumin levels for which the subject is at risk.
  • an amount of an anti-IL-6 antibody effective to reduce weakness refers to an amount of anti-IL-6 antibody that, when administered to a subject, will cause a measurable decrease in weakness as determined by the hand grip strength test.
  • an amount of an anti-IL-6 antibody effective to increase weight refers to an amount of anti-IL-6 antibody that, when administered to a subject, will cause a measurable increase in a patient's weight.
  • An effective amount will vary according to the weight, sex, age and medical histoiy of the individual, as well as the severity of the patient's condition(s), the type of disease(s), mode of administration, and the like.
  • an effective amount may be readily determined using routine experimentation, e.g., by titration (administration of increasing dosages until an effective dosage is found) and/or by reference to amounts that were effective for prior patients.
  • the anti-IL-6 antibodies of the present subject technology will be administered in dosages ranging between about 0, 1 mg/kg and about 20 mg/kg of the patient's body-weight.
  • Expression Vector refers broadly to a DNA vectors contain elements that facilitate manipulation for the expression of a foreign protein within the target host cell.
  • vectors will include sequences to facilitate such manipulations, including a bacterial origin of replication and appropriate bacterial selection marker.
  • Selection markers encode proteins necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media.
  • Exemplary vectors and methods for transformation of yeast are described, for example, in Burke, D., Dawson, D., & Stearns, T. (2000). Methods in yeast genetics: a Cold Spring Harbor Laboratory course manual. Plainview, N.Y.: Cold Spring Harbor Laboratory Press.
  • Folding refers broadly to the three-dimensional structure of polypeptides and proteins, where interactions between amino acid residues act to stabilize the structure. While non-covalent interactions are important in determining structure, usually the proteins of interest will have intra- and/or intermolecular covalent disulfide bonds formed by two cysteine residues. For naturally occurring proteins and polypeptides or derivatives and variants thereof, the proper folding is typically the arrangement that results in optimal biological activity, and can conveniently be monitored by assays for activity, e.g. ligand binding, enzymatic activity.
  • Framework region or FR refers broadly to at least one of the framework regions within the variable regions of the light and heavy chains of an antibody. See Kabat, et al. (1987) Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, MD. These expressions include those amino acid sequence regions interposed between the CDRs within the variable regions of the light and heavy chains of an antibody.
  • the FRs may comprise human FRs highly homologous to the parent antibody ⁇ e.g., rabbit antibody).
  • gpl30 also called Interleukin-6 receptor subunit beta
  • Interleukin-6 receptor subunit beta refers broadly to a transmembrane protein that forms one subunit of type I cytokine receptors in the IL-6 receptor family ⁇ e.g., 918 precursor amino acid sequence available as Swiss-Prot Protein Accession No. P40189 and SEQ ID NO: 728).
  • gpl 30 also encompasses any pre-pro, pro- and mature forms of this amino acid sequence, such as the mature form encoded by amino acids 23 through 918 of the sequence shown, as well as mutants and variants including allelic variants of this sequence.
  • Heterologous region or domain of a DNA construct refers broadly to an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature.
  • the heterologous region encodes a mammalian gene
  • the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism.
  • Another example of a heterologous region is a construct where the coding sequence itself is not found in nature (e.g. , a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
  • Homology refers broadly to a degree of similarity between a nucleic acid sequence and a reference nucleic acid sequence or between a polypeptide sequence and a reference polypeptide sequence. Homology may be partial or complete. Complete homology indicates that the nucleic acid or amino acid sequences are identical. A partially homologous nucleic acid or amino acid sequence is one that is not identical to the reference nucleic acid or amino acid sequence. The degree of homology can be determined by sequence comparison. The term "sequence identity" may be used interchangeably with "homology.”
  • Host cell refers broadly to a cell that contains an expression vector and supports the replication or expression of the expression vector.
  • Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast, insect (e.g. , SF9), amphibian, or mammalian cells such as CHO, HeLa, HEK-293 (e.g., cultured cells, explants, and cells in vivo.)
  • Isolated refers broadly to material removed from its original environment in which it naturally occurs, and thus is altered by the hand of man from its natural environment.
  • Isolated material may be, for example, exogenous nucleic acid included in a vector system, exogenous nucleic acid contained within a host cell, or any material which has been removed from its original environment and thus altered by the hand of man (e.g., "isolated antibody").
  • Improved refers broadly to any beneficial change resulting from a treatment.
  • a beneficial change is any way in which a patient's condition is better than it would have been in the absence of the treatment.
  • "Improved” includes prevention of an undesired condition, slowing the rate at which a condition worsens, delaying the development of an undesired condition, and restoration to an essentially normal condition.
  • improvement in psoriatic arthritis encompasses any decrease in pain, swelling, joint stiffness, or inflammation, and/or an increase in joint mobility.
  • IL-6 antagonist refers broadly to any composition that prevents, inhibits, or lessens the effect(s) of IL-6 signaling. Generally, such antagonists may reduce the levels or activity of IL-6, IL-6 receptor alpha, gp l 30, or a molecule involved in IL-6 signal transduction, or may reduce the levels or activity complexes between the foregoing (e.g., reducing the activity of an IL-6 / IL-6 receptor complex).
  • Antagonists include antisense nucleic acids, including DNA, RNA, or a nucleic acid analogue such as a peptide nucleic acid, locked nucleic acid, morpholino (phosphorodiamidate morpholino oligo), glycerol nucleic acid, or threose nucleic acid.
  • a nucleic acid analogue such as a peptide nucleic acid, locked nucleic acid, morpholino (phosphorodiamidate morpholino oligo), glycerol nucleic acid, or threose nucleic acid.
  • IL-6 antagonists specifically include peptides that block IL-6 signaling such as those described in any of U.S. Patent Nos. 5,210,075; 6, 1 72,042; 6,599,875; 6,841 ,533; and
  • IL-6 antagonists according to the subject technology may include p38 MAP kinase inhibitors such as those reported in U.S. Patent Application No. 2007/0010529 given this kinase's role in cytokine production and more particularly IL-6 production.
  • IL-6 antagonists according to the subject technology include the glycoalkaloid compounds reported in U.S. Patent Application Publication No. 2005/0090453 as well as other IL-6 antagonist compounds isolatable using the IL-6 antagonist screening assays reported therein.
  • IL-6 antagonists include antibodies, such as anti- IL-6 antibodies, anti-IL-6 receptor alpha antibodies, anti-gpl30 antibodies, and anti-p38 MAP kinase antibodies including (but not limited to) the anti-IL-6 antibodies disclosed herein, Actemra®
  • IL-6 antagonists include portions or fragments of molecules involved in IL-6 signaling, such as IL-6, IL-6 receptor alpha, and gpl 30, which may be native, mutant, or variant sequence, and may optionally be coupled to other moieties (such as half-life-increasing moieties, e.g. an Fc domain).
  • an IL-6 antagonist may be a soluble IL-6 receptor or fragment, a soluble IL-6 receptor:Fc fusion protein, a small molecule inhibitor of IL-6, an anti-IL-6 receptor antibody or antibody fragment or variant thereof, antisense nucleic acid.
  • IL-6 antagonists include any means known in the art, including contacting a subject with nucleic acids which encode or cause to be expressed any of the foregoing polypeptides or antisense sequences.
  • Interleukin-6 refers broadly to interleukin-6 (IL-6) encompasses not only the following 212 amino acid sequence available as GenBank Protein Accession No. NP 000591 (e.g., SEQ ID NO: 1), but also any pre-pro, pro- and mature forms of this IL-6 amino acid sequence, as well as mutants and variants including allelic variants of this sequence.
  • Interleukin-6 receptor (IL-6 receptor alpha (IL-6RA) [CD 126] refers broadly to 468 amino acid protein that binds IL-6, a potent pleiotropic cytokine that regulates cell growth and differentiation and also plays an important role in immune response (e.g. , Swiss-Prot Protein Accession No. P08887 and SEQ ID NO: 727). IL-6R also includes any pre-pro, pro- and mature forms of this amino acid sequence, as well as mutants and variants including allelic variants of this sequence.
  • Mammal refers broadly to any and all warm-blooded vertebrate animals of the class Mammalia, including humans, characterized by a covering of hair on the skin and, in the female, milk-producing mammary glands for nourishing the young.
  • mammals include but are not limited to alpacas, armadillos, capybaras, cats, camels, chimpanzees, chinchillas, cattle, dogs, goats, gorillas, hamsters, horses, humans, lemurs, llamas, mice, non-human primates, pigs, rats, sheep, shrews, squirrels, and tapirs.
  • Mammals include but are not limited to bovine, canine, equine, feline, murine, ovine, porcine, primate, and rodent species. Mammal also includes any and all those listed on the Mammal Species of the World maintained by the National Museum of Natural History, Smithsonian Institution in Washington DC.
  • Nucleic acid or nucleic acid sequence refers broadly to a deoxy- ribonucleotide or ribonucleotide oligonucleotide in either single- or double-stranded form.
  • the term encompasses nucleic acids, i.e., oligonucleotides, containing known analogs of natural nucleotides.
  • the term also encompasses nucleic-acid-like structures with synthetic backbones.
  • a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
  • nucleic acid is used interchangeably with gene, cDNA, mR A, oligonucleotide, and polynucleotide.
  • Operatively linked refers broadly to when two DNA fragments are joined such that the amino acid sequences encoded by the two DNA fragments remain in-frame.
  • Paratope refers broadly to the part of an antibody which recognizes an antigen (e.g., the antigen-binding site of an antibody.) Paratopes may be a small region (e.g., 15-22 amino acids) of the antibody's Fv region and may contain parts of the antibody's heavy and light chains. See Goldsby, et al. Antigens (Chapter 3) Immunology (5 th Ed.) New York: W.H. Freeman and Company, pages 57-75.
  • Patient refers broadly to any animal who is in need of treatment either to alleviate a disease state or to prevent the occurrence or reoccurrence of a disease state.
  • "Patient” as used herein refers broadly to any animal who has risk factors, a history of disease, susceptibility, symptoms, signs, was previously diagnosed, is at risk for, or is a member of a patient population for a disease.
  • the patient may be a clinical patient such as a human or a veterinary patient such as a companion, domesticated, livestock, exotic, or zoo animal.
  • subject may be used interchangeably with the term "patient”.
  • Polyploid yeast that stably expresses or expresses a desired secreted heterologous polypeptide for prolonged time refers broadly to a yeast culture that secretes said polypeptide for at least several days to a week, more preferably at least a month, still more preferably at least about 1-6 months, and even more preferably for more than a year at threshold expression levels, typically at least about 10-25 mg/liter and preferably substantially greater.
  • Polyploidal yeast culture that secretes desired amounts of recombinant polypeptide refers broadly to cultures that stably or for prolonged periods secrete at least about 10-25 mg/liter of heterologous polypeptide, more preferably at least about 50-500 mg/liter, and most preferably at least about 500-1000 mg/liter or more.
  • Prolonged improvement in coagulation profile refers broadly to a measurable improvement in the subject's coagulation profile relative to the initial coagulation profile (i.e. the coagulation profile at a time before treatment begins) that is detectable within about a week from when treatment begins (e.g. administration of an IL-6 antagonist such as Abl ) and remains improved for a prolonged duration, e.g., at least about 14 days, at least about 21 days, at least about 28 days, at least about 35 days, at least about 40 days, at least about 50 days, at least about 60 days, at least about 70 days, at least about 11 weeks, or at least about 12 weeks from when the treatment begins.
  • a prolonged duration e.g., at least about 14 days, at least about 21 days, at least about 28 days, at least about 35 days, at least about 40 days, at least about 50 days, at least about 60 days, at least about 70 days, at least about 11 weeks, or at least about 12 weeks from when the treatment begins.
  • Prolonged reduction in serum CRP refers broadly to a measurable decrease in serum CRP level relative to the initial serum CRP level (i.e. the serum CRP level at a time before treatment begins) that is detectable within about a week from when a treatment begins (e.g.
  • an anti-IL-6 antibody and remains below the initial serum CRP level for an prolonged duration, e.g. at least about 14 days, at least about 21 days, at least about 28 days, at least about 35 days, at least about 40 days, at least about 50 days, at least about 60 days, at least about 70 days, at least about 1 1 weeks, or at least about 12 weeks from when the treatment begins.
  • Promoter refers broadly to an array of nucleic acid sequences that direct transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
  • a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
  • a "constitutive" promoter is a promoter that is active under most environmental and developmental conditions.
  • An “inducible” promoter is a promoter that is active under environmental or developmental regulation.
  • Prophylactically effective amount refers broadly to the amount of a compound that, when administered to a patient for prophylaxis of a disease or prevention of the reoccurrence of a disease, is sufficient to effect such prophylaxis for the disease or reoccurrence.
  • the prophylactically effective amount may be an amount effective to prevent the incidence of signs and/or symptoms.
  • the "prophylactically effective amount” may vary depending on the disease and its severity and the age, weight, medical history, predisposition to conditions, preexisting conditions, of the patient to be treated.
  • Prophylaxis refers broadly to a course of therapy where signs and/or symptoms are not present in the patient, are in remission, or were previously present in a patient.
  • Prophylaxis includes preventing disease occurring subsequent to treatment of a disease in a patient. Further, prevention includes treating patients who may potentially develop the disease, especially patients who are susceptible to the disease ⁇ e.g., members of a patent population, those with risk factors, or at risk for developing the disease).
  • Recombinant refers broadly with reference to a product, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
  • Selectable Marker refers broadly to a selectable marker is a gene or gene fragment that confers a growth phenotype (physical growth characteristic) on a cell receiving that gene as, for example through a transformation event.
  • the selectable marker allows that cell to survive and grow in a selective growth medium under conditions in which cells that do not receive that selectable marker gene cannot grow.
  • Selectable marker genes generally fall into several types, including positive selectable marker genes such as a gene that confers on a cell resistance to an antibiotic or other drug, temperature when two ts mutants are crossed or a ts mutant is transformed; negative selectable marker genes such as a biosynthetic gene that confers on a cell the ability to grow in a medium without a specific nutrient needed by all cells that do not have that biosynthetic gene, or a mutagenized biosynthetic gene that confers on a cell inability to grow by cells that do not have the wild type gene; and the like. Suitable markers include but are not limited to ZEOMYCIN® (zeocin), neomycin, G418, LYS3, MET1 , MET3a, ADE1 , ADE3, and URA3.
  • positive selectable marker genes such as a gene that confers on a cell resistance to an antibiotic or other drug, temperature when two ts mutants are crossed or a ts mutant is transformed
  • the specified antibodies bind to a particular protein at least two times greater than the background (non-specific signal) and do not substantially bind in a significant amount to other proteins present in the sample.
  • a specific or selective reaction will be at least twice background signal or noise and more typically more than about 10 to 100 times background.
  • Signs of disease refers broadly to any abnormality indicative of disease, discoverable on examination of the patient; an objective indication of disease, in contrast to a symptom, which is a subjective indication of disease.
  • Solid support, support, and substrate refers broadly to any material that provides a solid or semi-solid structure with which another material can be attached including but not limited to smooth supports (e.g., metal, glass, plastic, silicon, and ceramic surfaces) as well as textured and porous materials.
  • smooth supports e.g., metal, glass, plastic, silicon, and ceramic surfaces
  • Subjects as used herein refers broadly to anyone suitable to be treated according to the present subject technology include, but are not limited to, avian and mammalian subjects, and are preferably mammalian. Mammals of the present subject technology include, but are not limited to, canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g., rats and mice), lagomorphs, primates, humans. Any mammalian subject in need of being treated according to the present subject technology is suitable. Human subjects of both genders and at any stage of development (i.e., neonate, infant, juvenile, adolescent, adult) can be treated according to the present subject technology.
  • the present subject technology may also be carried out on animal subjects, particularly mammalian subjects such as mice, rats, dogs, cats, cattle, goats, sheep, and horses for veterinary purposes, and for drug screening and drug development purposes. "Subjects" is used interchangeably with “patients.”
  • Mating competent yeast species refers broadly encompass any diploid or tetraploid yeast which can be grown in culture. Such species of yeast may exist in a haploid, diploid, or tetraploid form. The cells of a given ploidy may, under appropriate conditions, proliferate for indefinite number of generations in that form. Diploid cells can also sporulate to form haploid cells. Sequential mating can result in tetraploid strains through further mating or fusion of diploid strains. In the present subject technology the diploid or polyploidal yeast cells are preferably produced by mating or spheroplast fusion.
  • Haploid Yeast Cell refers broadly to a cell having a single copy of each gene of its normal genomic (chromosomal) complement.
  • Polyploid Yeast Cell refers broadly to a cell having more than one copy of its normal genomic (chromosomal) complement.
  • Diploid Yeast Cell refers broadly to a cell having two copies (alleles) of essentially every gene of its normal genomic complement, typically formed by the process of fusion (mating) of two haploid cells.
  • Tetraploid Yeast Cell refers broadly to a cell having four copies (alleles) of essentially every gene of its normal genomic complement, typically formed by the process of fusion (mating) of two haploid cells. Tetraploids may carry two, three, four, or more different expression cassettes. Such tetraploids might be obtained in S. cerevisiae by selective mating homozygotic heterothallic a/a and alpha/alpha diploids and in Pichia by sequential mating of haploids to obtain auxotrophic diploids.
  • a [met his] haploid can be mated with [ade his] haploid to obtain diploid [his]; and a [met arg] haploid can be mated with [ade arg] haploid to obtain diploid [arg]; then the diploid [his] x diploid [arg] to obtain a tetraploid prototroph. It will be understood by those of skill in the art that reference to the benefits and uses of diploid cells may also apply to tetraploid cells.
  • Yeast Mating refers broadly to a process by which two haploid yeast cells naturally fuse to form one diploid yeast cell.
  • Meiosis refers broadly to a process by which a diploid yeast cell undergoes reductive division to form four haploid spore products. Each spore may then germinate and form a haploid vegetatively growing cell line.
  • Variable region or VR refers broadly to the domains within each pair of light and heavy chains in an antibody that are involved directly in binding the antibody to the antigen.
  • Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains.
  • Each light chain has a variable domain (V L ) at one end and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
  • Variants refers broadly to single-chain antibodies, dimers, multimers, sequence variants, and domain substitution variants.
  • Single-chain antibodies such as SMIPs, shark antibodies, nanobodies (e.g. , Camelidiae antibodies).
  • Sequence variants can be specified by percentage identity (similarity, sequence homology) e.g., 99%, 95%, 90%, 85%, 80%, 70%, 60%, or by numbers of permitted conservative or non-conservative substitutions.
  • Domain substitution variants include replacement of a domain of one protein with a similar domain of a related protein. A similar domain may be identified by similarity of sequence, structure (actual or predicted), or function.
  • domain substitution variants include the substitution of at least one CDRs and/or framework regions.
  • Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture, and transformation (e.g. , electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
  • the present technology also relates to compositions, methods, and uses of anti-IL-6 antibodies and/or antigen-binding fragments thereof according to the subject technology for treating, preventing, or alleviating the onset of psoriatic arthritis.
  • the subject therapy may comprise administering the antibody prior or concurrent to development of the symptoms of psoriatic arthritis. Particularly this may be used in patients who have shown signs of inadequate response to Non-Steroidal Anti-Inflammatory Drugs (NSAlDs) and/or non-biologic Disease Modifying Anti-Rheumatic Drugs (DMARDs).
  • Non-biologic DMARDs include, but are not limited to: Mycophenolate mofetil (CellCept®), calcineurin inhibitors (e.g., cyclosporine, sirolimus, everolimus), oral retinoids, azathioprine, fumeric acid esters, D- penicillamine, and cyclophosphamide.
  • Non-Steroidal Anti-Inflammatory Drugs including but are not limited to Salicylates (e.g., Aspirin (acetylsalicylic acid), Diflunisal, Salsalate); Propionic acid derivatives (e.g.
  • Ibuprofen Ibuprofen, Naproxen, Fenoprofen, Ketoprofen, Flurbiprofen, Oxaprozin, Loxoprofen); Acetic acid derivatives (e.g., Indomethacin, Sulindac, Etodolac, Ketorolac, Diclofenac, Nabumetone); Enolic acid (Oxicam) derivatives (e.g., Piroxicam, Meloxicam, Tenoxicam, Droxicam, Lornoxicam, lsoxicam); Fenamic acid derivatives (Fenamates) (e.g., Mefenamic acid, Meclofenamic acid, Flufenamic acid, Tolfenamic acid); Selective COX-2 inhibitors (Coxibs) (e.g., Celecoxib, Rofecoxib, Valdecoxib, Parecoxib, Lumiracoxib, Etoricoxib, Firocoxib), Sulphonanilides (
  • the subject technology provides for method of treating psoriatic arthritis comprising administration of a composition comprising an effective amount of an Ab l , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Ab 10, Abl 1 , Abl 2, Abl 3, Ab l 4, Ab l 5, Abl 6, Abl 7, Ab l 8, Abl 9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the subject technology also provides for method of preventing psoriatic arthritis comprising administration of a composition comprising an effective amount of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, Abl O, Abl 1 , Abl 2, Ab l 3, Ab l 4, Ab l 5, Abl 6, Abl 7, Abl 8, Ab l 9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, to a subject in need thereof, wherein the antibody, or antigen-binding fragment thereof, specifically binds to IL-6.
  • the antibody, or antigen-binding fragment thereof is aglycosylated. Further, the antibody, or antigen-binding fragment thereof, may contain an Fc region that has been modified to alter effector function, half-life, proteolysis, and/or glycosylation. Additionally, the antibody, or antigen-binding fragment thereof, is a human, humanized, single chain, or chimeric antibody.
  • the method of treating or preventing psoriatic arthritis may comprise administering a composition comprises at least about 25, 80, 100, 160, 200, or 320 mg of an Abl, Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl 1 , Abl2, Ab l 3, Abl4, Abl 5, Abl 6, Abl7, Abl8, Abl9, Ab20, Ab21 , Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31 , Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof.
  • the method of treating or preventing psoriatic arthritis may comprise administering a composition comprises at least about 25, 80, 100, 160, 200, or 320 mg of an Abl , Ab2, Ab3, Ab4, Ab5, Ab6, Ab7, Ab8, Ab9, AblO, Abl 1 , Abl 2, Abl3, Abl4, Abl 5, Abl6, Abl7, Abl 8, Abl 9, Ab20, Ab21, Ab22, Ab23, Ab24, Ab25, Ab26, Ab27, Ab28, Ab29, Ab30, Ab31, Ab32, Ab33, Ab34, Ab35, or Ab36 antibody, or an antigen-binding fragment thereof, subcutaneously every 4 weeks for at least 8, 16, 20, or 24 weeks.
  • 1L-6 antagonists such as Abl described herein are useful for ameliorating or reducing the symptoms of, or treating, or preventing, psoriatic arthritis.
  • the IL-6 antagonists described herein e.g., Abl-Ab36
  • the dosing regimen is based on pharmacokinetic and pharmacodynamic data from previous studies. For example, in the advanced cancer clinical trial, single IV doses of 80, 160, and 320 mg ALD518 decreased CRP levels to normal or near normal for 12 weeks. In the rheumatoid arthritis clinical trial, 2 IV doses of 80, 160, and 320 mg ALD518 given 8 weeks apart decreased CRP levels to normal or nearly normal for 16 weeks. However, in the NSCLC clinical trial, CRP levels were decreased 2 weeks after the first of 3 IV doses of 80, 160, and 320 mg of ALD518, 8 weeks apart, but increased prior to the second dose.
  • ALD518* is an asialated, humanized anti-IL-6 monoclonal antibody with a half-life of -30 days containing the humanized variable heavy and light sequences set forth in SEQ ID NO: 19 and 20.
  • Pharmacokinetic (PK) modeling of data from the NSCLC clinical trial indicates that doses of ALD518 80 mg administered once every 3 weeks would not result in trough ALD518 concentrations high enough to fully suppress CRP.
  • the doses may be 160 mg and 320 mg of humanized monoclonal antibody that selectively binds IL-6 administered every 4 weeks. See, e.g., Gallo, et al. ( 1992) Br J Cancer 65:479-80; Duffy, et al. (2008) Cancer 1 13:750-7.
  • Examplary ALD518 plasma concentration effective to inhibit CRP may be at least about 1 5 g/mL.
  • ALD518 is an exemplary humanized anti-IL-6 monoclonal antibody.
  • ALD518 may be supplied as a pH 6.0 frozen injection in single-use vials ⁇ e.g., 80, 160, or 320 mg) for intravenous administration.
  • exemplary non-active excipients include but are not limited to 25 mM histidine and 250 mM sorbitol.
  • exemplary non-active excipients include but are not limited to 25 mM histidine, 250 mM sorbitol, and 0.015% polysorbate 80.
  • Compositions comprising humanized monoclonal antibodies that selectively bind IL-6 (e.g., ALD5 18) may be sterile, preservative-free frozen liquid injection in depyrogenated sterile vials, which are stoppered and sealed containing approximately 80 mg (e.g. , 7.6 mL in a 10 mLvial) or approximately 160 mg (e.g., 4 mL in a 5 mL vial).
  • one dose of ALD518 e.g., 160 mg or 320 mg
  • 250 mL 0.9% saline may be administered IV over a period of at least about one hour ( ⁇ 15 minutes) on the morning of RT Day 1 and RT Treatment Week 4.
  • IL-6 antagonists described herein are useful for ameliorating or reducing the symptoms of, or treating, or preventing psoriatic arthritis.
  • IL-6 antagonists described herein are administered to a patient in combination with another active agent.
  • an IL-6 antagonist such as Abl may be co-administered with at least one chemotherapy agents, such as VEGF antagonists, EGFR antagonists, platins, taxols, irinotecan, 5-fluorouracil, gemcytabine, leucovorine, steroids, cyclophosphamide, melphalan, vinca alkaloids (e.g., vinblastine, vincristine, vindesine and vinorelbine), mustines, tyrosine kinase inhibitors, radiotherapy, sex hormone antagonists, selective androgen receptor modulators, selective estrogen receptor modulators, PDGF antagonists, TNF antagonists, IL- 1 antagonists, interleukins (e.g. 1L- 12 or IL-2), IL- 12R antagonists, Erbitux®
  • chemotherapy agents such as VEGF antagonists, EGFR antagonists, platins, tax
  • cetuximab cetuximab
  • Avastin® bevacizumab
  • Pertuzumab anti-CD20 antibodies
  • Rituxan® rituximab
  • ocrelizumab ofatumumab
  • DXL625 Herceptin® (trastuzumab), or any combination thereof.
  • the subject technology includes antibodies having binding specificity to IL-6 and possessing a variable light chain sequence comprising the sequence set forth in the polypeptide sequence of SEQ ID NO: 2 or SEQ ID NO: 709 and humanized versions and variants thereof including those set forth in FIGS. 1 and 8-1 1 , and those identified in Table 1.
  • Antibodies consist of two identical light polypeptide chains of molecular weight approximately 23,000 daltons (the "light chain”), and two identical heavy chains of molecular weight 53,000-70,000 (the “heavy chain”).
  • the four chains are joined by disulfide bonds in a "Y" configuration wherein the light chains bracket the heavy chains starting at the mouth of the "Y” configuration.
  • the "branch” portion of the "Y” configuration is designated the Fab region; the stem portion of the "Y” configuration is designated the Fc region.
  • the amino acid sequence orientation runs from the N-terminal end at the top of the "Y” configuration to the C-terminal end at the bottom of each chain.
  • the N-terminal end possesses the variable region having specificity for the antigen that elicited it, and is approximately 100 amino acids in length, there being slight variations between light and heavy chain and from antibody to antibody.
  • the variable region is linked in each chain to a constant region that extends the remaining length of the chain and that within a particular class of antibody does not vary with the specificity of the antibody (i.e., the antigen eliciting it).
  • IgG immunoglobulin molecule
  • IgM immunoglobulin molecule
  • IgA immunoglobulin molecule
  • IgD immunoglobulin molecule
  • IgE constant region or class determines subsequent effector function of the antibody, including activation of complement (Kabat, E. A. (1976) Structural Concepts in Immunology and Immunochemistry, 2nd Ed., pp. 413- ⁇ 436, Holt, Rinehart, Winston), and other cellular responses (Andrews, et al. (1980) Clinical Immunobiology pp 1-18, W. B.
  • Light chains are classified as either ⁇ (kappa) or ⁇ (lambda). Each heavy chain class can be paired with either kappa or lambda light chain. The light and heavy chains are covalently bonded to each other, and the "tail" portions of the two heavy chains are bonded to each other by covalent disulfide linkages when the immunoglobulins are generated either by hybridomas or by B cells.
  • antibodies or antigen binding fragments or variants thereof may be produced by genetic engineering.
  • antibody-producing cells are sensitized to the desired antigen or immunogen.
  • the messenger RNA isolated from antibody producing cells is used as a template to make cDNA using PCR amplification.
  • a library of vectors, each containing one heavy chain gene and one light chain gene retaining the initial antigen specificity, is produced by insertion of appropriate sections of the amplified immunoglobulin cDNA into the expression vectors.
  • a combinatorial library is constructed by combining the heavy chain gene library with the light chain gene library.
  • Antibody coding sequences of interest include those encoded by native sequences, as well as nucleic acids that, by virtue of the degeneracy of the genetic code, are not identical in sequence to the disclosed nucleic acids, and variants thereof.
  • Variant polypeptides can include amino acid (aa) substitutions, additions or deletions. The amino acid substitutions can be conservative amino acid substitutions or substitutions to eliminate non-essential amino acids, such as to alter a glycosylation site, or to minimize misfolding by substitution or deletion of at least one cysteine residues that are not necessary for function.
  • Variants can be designed so as to retain or have enhanced biological activity of a particular region of the protein (e.g., a functional domain, catalytic amino acid residues).
  • Variants also include fragments of the polypeptides disclosed herein, particularly biologically active fragments and/or fragments corresponding to functional domains. Techniques for in vitro mutagenesis of cloned genes are known. Also included in the subject technology are polypeptides that have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent.
  • Chimeric antibodies may be made by recombinant means by combining the variable light and heavy chain regions (V L and V H ), obtained from antibody producing cells of one species with the constant light and heavy chain regions from another.
  • V L and V H variable light and heavy chain regions
  • chimeric antibodies utilize rodent or rabbit variable regions and human constant regions, in order to produce an antibody with
  • the human constant regions of chimeric antibodies of the subject technology may be selected from IgGl, IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgGlO, IgG l l , IgG12, IgG13, IgG14, IgG15, IgG16, IgG17, IgGl 8 or IgGl 9 constant regions.
  • Humanized antibodies are engineered to contain even more human-like immunoglobulin domains, and incorporate only the complementarity-determining regions of the animal-derived antibody. This is accomplished by carefully examining the sequence of the hyper-variable loops of the variable regions of the monoclonal antibody, and fitting them to the structure of the human antibody chains. Although facially complex, the process is straightforward in practice. See, e.g., U.S. Patent No. 6, 187,287. In a preferred embodiment, humanization may be effected as disclosed in detail infra. This scheme grafts CDRs onto human FRs highly homologous to the parent antibody that is being humanized.
  • Immunoglobulins and fragments thereof may be modified post-translationally, e.g. to add effector moieties such as chemical linkers, detectable moieties, such as fluorescent dyes, enzymes, toxins, substrates, bioluminescent materials, radioactive materials, chemiluminescent moieties and the like, or specific binding moieties, such as streptavidin, avidin, or biotin, and the like may be utilized in the methods and compositions of the present subject technology. Examples of additional effector molecules are provided infra.
  • the subject technology also includes antibodies having binding specificity to IL-6 and possessing a variable heavy chain sequence comprising the sequence set forth in the polypeptide sequences of SEQ ID NO: 3 and SEQ ID NO: 657 and humanized versions and variants thereof including those set forth in FIGS. 1 and 8-1 1 , and those identified in Table 1.
  • the subject technology further includes antibodies having binding specificity to IL-6 and possessing a variable heavy chain sequence which is a modified version of SEQ ID NO: 3 wherein the tryptophan residue in CDR2 is changed to a serine as set forth in the polypeptide sequence of SEQ ID NO: 658 and humanized versions and variants thereof including those set forth in FIGS. 1 and 8-1 1 , and those identified in Table 1.
  • the subject technology further contemplates antibodies comprising at least one of the polypeptide sequences of SEQ ID NO: 4; SEQ ID NO: 5; and SEQ ID NO: 6 which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable light chain sequence of SEQ ID NOs: 2 or 709, and/or at least one of the polypeptide sequences of SEQ ID NO: 7; SEQ ID NO: 8 or 120; and SEQ ID NO: 9 which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable heavy chain sequence of SEQ ID NOs: 3 or 19 or 657, or combinations of these polypeptide sequences.
  • the antibodies of the subject technology include combinations of the CDRs and the variable heavy and light chain sequences set forth above.
  • the subject technology contemplates other antibodies, such as for example chimeric antibodies, comprising at least one of the polypeptide sequences of SEQ ID NO: 4; SEQ ID NO: 5; and SEQ ID NO: 6 which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable light chain sequence of SEQ ID NOs: 2 or 709, and/or at least one of the polypeptide sequences of SEQ ID NO: 7; SEQ ID NO: 8 or 120; and SEQ ID NO: 9 which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable heavy chain sequence of SEQ ID NOs: 3 or 19 or 657, or combinations of these polypeptide sequences.
  • the antibodies of the subject technology include combinations of the CDRs and humanized versions of the variable heavy and light chain sequences set forth above.
  • antibody fragments of the subject technology comprise, or alternatively consist of, humanized versions of the polypeptide sequence of SEQ ID NO: 2, 20, 647, 651, 660, 666, 699, 702, 706, or 709.
  • antibody fragments of the subject technology comprise, or alternatively consist of, humanized versions of the polypeptide sequence of SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, or 708.
  • fragments of the antibody having binding specificity to IL-6 comprise, or alternatively consist of, at least one of the polypeptide sequences of SEQ ID NO: 4; SEQ ID NO: 5; and SEQ ID NO: 6 which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable light chain sequence of SEQ ID NO: 2 or SEQ ID NO: 709.
  • fragments of the antibody having binding specificity to IL-6 comprise, or alternatively consist of, at least one of the polypeptide sequences of SEQ ID NO: 7; SEQ ID NO: 8 or SEQ ID NO: 120; and SEQ ID NO: 9 which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable heavy chain sequence of SEQ ID NO: 3 or 657 or 19.
  • fragments of the antibodies having binding specificity to IL-6 comprise, or alternatively consist of, one, two, three or more, including all of the following antibody fragments: the variable light chain region of SEQ ID NO: 2; the variable heavy chain region of SEQ ID NO: 3; the complementarity-determining regions (SEQ ID NO: 4; SEQ ID NO: 5; and SEQ ID NO: 6) of the variable light chain region of SEQ ID NOs: 2 or 709; and the complementarity-determining regions (SEQ ID NO: 7; SEQ ID NO: 8 or SEQ ID NO: 120; and SEQ ID NO: 9) of the variable heavy chain region of SEQ ID NOs: 3 or 657 or 19.
  • the subject technology also contemplates variants wherein either of the heavy chain polypeptide sequences of SEQ ID NO: 18 or SEQ ID NO: 19 is substituted for the heavy chain polypeptide sequence of SEQ ID NOs: 3 or 657; the light chain polypeptide sequence of SEQ ID NO: 20 is substituted for the light chain polypeptide sequence of SEQ ID NO: 2 or SEQ ID NO: 709; and the heavy chain CDR sequence of SEQ ID NO: 120 is substituted for the heavy chain CDR sequence of SEQ ID NO: 8.
  • the anti-IL-6 antibody is Abl , comprising SEQ ID NO: 2 and SEQ ID NO: 3, or more particularly an antibody comprising SEQ ID NO: 657 and SEQ ID NO: 709 (which are respectively encoded by the nucleic acid sequences in SEQ ID NO: 700 and SEQ ID NO: 723) or one comprised of the alternative SEQ ID NOs set forth in the preceding paragraph, and having at least one of the biological activities set forth herein.
  • the anti-IL-6 antibody will comprise a humanized sequence as shown in Figures 8-1 1.
  • Exemplary Abl embodiments include an antibody comprising a variant of the light chain and/or heavy chain.
  • Exemplary variants of the light chain of Abl include the sequence of any of the Ab 1 light chains shown (i. e. , any of SEQ ID NO: 2, 20, 647, 651 , 660, 666, 699, 702, 706, or 709) wherein the entire CDRl sequence is replaced or wherein at least one residues in the CDRl sequence is substituted by the residue in the corresponding position of any of the other light chain CDRl sequences set forth (i.e., any of SEQ ID NO: 23, 39, 55, 71, 87, 103, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396, 412, 428, 444, 460, 476, 492, 508, 524, 540, 556, or 572); and/or wherein the entire CDR2
  • Exemplary variants of the heavy chain of Abl include the sequence of any of the Abl heavy chains shown (i.e., any of SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, or 708) wherein the entire CDRl sequence is replaced or wherein at least one residues in the CDRl sequence is substituted by the residue in the corresponding position of any of the other heavy chain CDRl sequences set forth (i.e.
  • any of the other heavy chain CDR3 sequences set forth i.e., any of SEQ ID NO: 28, 44, 60, 76, 92, 108, 129, 145, 161, 177, 193, 209, 225, 241 , 257, 273, 289, 305, 321 , 337, 353, 369, 385, 401, 417, 433, 449, 465, 481 , 497, 513, 529, 545, 561 , or 577).
  • the subject technology contemplates other antibodies, such as for example chimeric or humanized antibodies, comprising at least one of the polypeptide sequences of SEQ ID NO: 4; SEQ ID NO: 5; and SEQ ID NO: 6 which correspond to the complementarity- determining regions (CDRs, or hypervariable regions) of the variable light chain sequence of SEQ ID NO: 2, and/or at least one of the polypeptide sequences of SEQ ID NO: 7 (CDRl) ; SEQ ID NO: 8 (CDR2) ; SEQ ID NO: 120 (CDR2); and SEQ ID NO: 9 (CDR3) which correspond to the complementarity-determining regions (CDRs, or hypervariable regions) of the variable heavy chain sequence of SEQ ID NO: 3 or SEQ ID NO: 19, or combinations of these polypeptide sequences.
  • the antibodies of the subject technology include combinations of the CDRs and the variable heavy and light chain sequences set forth above including those set forth in FIGS. 1 and 8-1
  • the anti-IL-6 antibody of the subject technology is one comprising at least one of the following: a CDRl light chain encoded by the sequence in SEQ ID NO: 12 or SEQ ID NO: 694; a light chain CDR2 encoded by the sequence in SEQ ID NO: 13; a light chain CDR3 encoded by the sequence in SEQ ID NO: 14 or SEQ ID NO: 695; a heavy chain CDRl encoded by the sequence in SEQ ID NO: 15, a heavy chain CDR2 encoded by SEQ ID NO: 16 or SEQ ID NO: 696 and a heavy chain CDR3 encoded by SEQ ID NO: 17 or SEQ ID NO: 697.
  • the subject technology embraces such nucleic acid sequences and variants thereof.
  • the subject technology is directed to amino acid sequences corresponding to the CDRs of said anti-IL-6 antibody which are selected from SEQ ID NO: 4 (CDRl), SEQ ID NO: 5 (CDR2), SEQ ID NO: 6 (CDR3) , SEQ ID NO: 7, SEQ ID NO: 120 and SEQ ID NO: 9.
  • the anti-IL-6 antibody of the subject technology comprises a light chain nucleic acid sequence of SEQ ID NO: 10, 662, 698, 701 , 705, 720, 721 , 722, or 723; and/or a heavy chain nucleic acid sequence of SEQ ID NO: 1 1 , 663, 700, 703, 707, 724, or 725.
  • the subject technology is directed to the corresponding polypeptides encoded by any of the foregoing nucleic acid sequences and combinations thereof.
  • the anti-IL-6 antibodies or a portion thereof will be encoded by a nucleic acid sequence selected from those comprised in SEQ ID NO: 10, 12, 13, 14, 662, 694, 695, 698, 701, 705, 720, 721 , 722, 723, 1 1 , 15, 16, 17, 663, 696, 697, 700, 703, 707, 724, and 725.
  • the CDRl in the light chain may be encoded by SEQ ID NO: 12 or 694
  • the CDR2 in the light chain may be encoded by SEQ ID NO: 13
  • the CDR3 in the light chain may be encoded by SEQ ID NO: 14 or 695
  • the CDRl in the heavy chain may be encoded by SEQ ID NO: 15
  • the CDR2 in the heavy chain may be encoded by SEQ ID NO: 16 or 696
  • the CDR3 in the heavy chain may be encoded by SEQ ID NO: 17 or 697.
  • antibodies containing these CDRs may be constructed using appropriate human frameworks based on the humanization methods disclosed herein.
  • variable light chain will be encoded by SEQ ID NO: 10, 662, 698, 701, 705, 720, 721 , 722, or 723 and the variable heavy chain of the anti-IL-6 antibodies will be encoded by SEQ ID NO: 1 1 , 663, 700, 703, 707, 724, or 725.
  • variable light and heavy chains of the anti-IL-6 antibody respectively will be encoded by SEQ ID NO: 10 and 1 1, or SEQ ID NO: 698 and SEQ ID NO: 700 or SEQ ID NO: 701 and SEQ ID NO: 703 or SEQ ID NO: 705 and SEQ ID NO: 707.
  • the subject technology covers nucleic acid constructs containing any of the foregoing nucleic acid sequences and combinations thereof as well as recombinant cells containing these nucleic acid sequences and constructs containing wherein these nucleic acid sequences or constructs may be extrachromosomal or integrated into the host cell genome
  • the subject technology covers polypeptides containing any of the CDRs or combinations thereof recited in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 120, SEQ ID NO: 9 or polypeptides comprising any of the variable light polypeptides comprised in SEQ ID NO: 2, 20, 647, 651 , 660, 666, 699, 702, 706, or 709 and/or the variable heavy polypeptides comprised in SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661 , 664, 665, 704, or 708.
  • These polypeptides optionally may be attached directly or indirectly to other immunoglobulin polypeptides or effector moieties such as therapeutic or detectable entities.
  • the anti-IL-6 antibody is one comprising at least one of the following: a variable light chain encoded by the sequence in SEQ ID NO: 10 or SEQ ID NO: 698 or SEQ ID NO: 701 or SEQ ID NO: 705 and a variable chain encoded by the sequence in SEQ ID NO: 1 1 or SEQ ID NO: 700 or SEQ ID NO: 703 or SEQ ID NO: 707.
  • the anti-IL-6 antibody is a variant of the foregoing sequences that includes at least one substitution in the framework and/or CDR sequences and which has at least one of the properties of Abl in vitro and/or upon in vivo administration.
  • the anti-IL-6 antibody includes at least one of the Abl light-chain and/or heavy chain CDR sequences (see Table 1) or variant(s) thereof which has at least one of the properties of Abl in vitro and/or upon in vivo administration (examples of such properties are discussed in the preceding paragraph).
  • CDR sequences see Table 1 or variant(s) thereof which has at least one of the properties of Abl in vitro and/or upon in vivo administration (examples of such properties are discussed in the preceding paragraph).
  • One of skill in the art would understand how to combine these CDR sequences to form an antigen-binding surface, e.g. by linkage to at least one scaffold which may comprise human or other mammalian framework sequences, or their functional orthologs derived from a SMIP, camelbody, nanobody, IgNAR or other immunoglobulin or other engineered antibody.
  • embodiments may specifically bind to human IL-6 and include one, two, three, four, five, six, or more of the following CDR sequences or variants thereof: a polypeptide having at least 72.7% ⁇ i.e., 8 out of 1 1 amino acids) identity to the light chain CDR1 of SEQ ID NO: 4; a polypeptide having at least 81.8% (i.e., 9 out of 1 1 amino acids) identity to the light chain CDR1 of SEQ ID NO: 4; a polypeptide having at least 90.9% (i.e.
  • Other exemplary embodiments include at least one polynucleotides encoding any of the foregoing, e.g., a polynucleotide encoding a polypeptide that specifically binds to human IL-6 and includes one, two, three, four, five, six, or more of the following CDRs or variants thereof:
  • Such antibody fragments or variants thereof may be present in at least one of the following non-limiting forms: Fab, Fab', F(ab') 2 , Fv and single chain Fv antibody forms.
  • the anti-IL-6 antibodies described herein further comprises the kappa constant light chain sequence comprising the sequence set forth in the polypeptide sequence of SEQ ID NO: 586.
  • the anti-IL-6 antibodies described herein further comprises the gamma- 1 constant heavy chain polypeptide sequence comprising one of the sequences set forth in the polypeptide sequence of SEQ ID NO: 588 and SEQ ID NO: 719.
  • Embodiments of antibodies described herein may include a leader sequence, such as a rabbit Ig leader, albumin pre-peptide, a yeast mating factor pre pro secretion leader sequence (such as P. pastoris or Saccharomyces cerevisiae a or alpha factor), or human HAS leader.
  • a leader sequence such as a rabbit Ig leader, albumin pre-peptide, a yeast mating factor pre pro secretion leader sequence (such as P. pastoris or Saccharomyces cerevisiae a or alpha factor), or human HAS leader.
  • Exemplary leader sequences are shown offset from FRl at the N-terminus of polypeptides shown in Figs. 10A-B and 1 1 A-B as follows: rabbit Ig leader sequences in SEQ ID NOs: 2 and 660 and SEQ ID NOs: 3 and 661; and an albumin prepeptide in SEQ ID NOs: 706 and 708, which facilitates secretion.
  • leader sequences known in the art to confer desired properties may also be used, either alone or in combinations with one another, on the heavy and/or light chains, which may optionally be cleaved prior to administration to a subject.
  • a polypeptide may be expressed in a cell or cell-free expression system that also expresses or includes (or is modified to express or include) a protease, e.g., a membrane-bound signal peptidase, that cleaves a leader sequence.
  • the subject technology contemplates an isolated anti-IL-6 antibody comprising a V H polypeptide sequence comprising: SEQ ID NO: 3, 18, 19, 22, 38, 54, 70, 86, 102, 1 17, 1 18, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299, 315, 331 , 347, 363, 379, 395, 41 1 , 427, 443, 459, 475, 491 , 507, 523, 539, 555, 571 , 652, 656, 657, 658, 661 , 664, 665, 668, 672, 676, 680, 684, 688, 691 , 692, 704, or 708; and further comprising a V L polypeptide sequence comprising: SEQ ID NO: 2, 20, 21 , 37, 53, 69, 85, 101, 1 19, 122, 138, 154, 170, 186, 202, 218, 23
  • the subject technology contemplates humanized and chimeric forms of these antibodies wherein preferably the FR will comprise human FRs highly homologous to the parent antibody.
  • the chimeric antibodies may include an Fc derived from IgGl , IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgG lO, IgG l 1 , IgG12, IgG 13, IgG14, IgG15, IgG16, IgG l 7, IgGl 8 or IgG l 9 constant regions and in particular a variable heavy and light chain constant region as set forth in SEQ ID NO: 588 and SEQ ID NO: 586.
  • the antibodies or V H or V L polypeptides originate or are selected from at least one rabbit B cell populations prior to initiation of the humanization process referenced herein.
  • the anti-IL-6 antibodies and fragments and variants thereof have binding specificity for primate homologs of the human IL-6 protein.
  • primate homologs of the human IL-6 protein are IL-6 obtained from Macaca fascicularis (cynomolgus monkey) and the Rhesus monkey.
  • the anti-IL-6 antibodies and fragments and variants thereof inhibits the association of IL- 6 with IL-6R, and/or the production of IL-6/IL-6R/gpl 30 complexes and/or the production of IL-6/IL- 6R/gpl30 multimers and/or antagonizes the biological effects of at least one of the foregoing.
  • Polyclonal Antibody are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen. Polyclonal antibodies which selectively bind the IL-6 may be made by methods well-known in the art. See, e.g., Howard & Kaser (2007) Making and Using Antibodies: A Practical Handbook CRC Press.
  • a monoclonal antibody contains a substantially homogeneous population of antibodies specific to antigens, which population contains substantially similar epitope binding sites.
  • Monoclonal antibodies may be obtained by methods known to those skilled in the art. See, e.g.
  • Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, GILD and any subclass thereof.
  • a hybridoma producing an antibody of the present subject technology may be cultivated in vitro, in situ, or in vivo.
  • Chimeric antibodies are molecules different portions of which are derived from different animal species, such as those having variable region derived from a murine antibody and a human immunoglobulin constant region, which are primarily used to reduce immunogenicity in application and to increase yields in production, for example, where murine monoclonal antibodies have higher yields from hybridomas but higher immunogenicity in humans, such that human murine chimeric monoclonal antibodies are used.
  • Chimeric antibodies and methods for their production are known in the art. See Cabilly, et al. (1984) Proc. Natl. Acad. Sci. USA 81 : 3273-3277; Morrison, et al. (1994) Proc. Natl. Acad. Sci.
  • Humanized antibodies are engineered to contain even more human-like immunoglobulin domains, and incorporate only the complementarity-determining regions of the animal-derived antibody. This may be accomplished by examining the sequence of the hyper-variable loops of the variable regions of the monoclonal antibody, and fitting them to the structure of the human antibody chains. See, e.g. , U.S. Patent No. 6, 187,287. Likewise, other methods of producing humanized antibodies are now well known in the art. See, e.g., U.S. Patent Nos. 5,225,539; 5,530,101 ;
  • Antibody Fragments (antigen-binding fragments)
  • immunoglobulin fragments comprising the epitope binding site (e.g., Fab', F(ab') 2 , or other fragments) may be synthesized.
  • "Fragment,” or minimal immunoglobulins may be designed utilizing recombinant immunoglobulin techniques.
  • Fv immunoglobulins for use in the present subject technology may be produced by synthesizing a fused variable light chain region and a variable heavy chain region. Combinations of antibodies are also of interest, e.g. diabodies, which comprise two distinct Fv specificities.
  • Antigen-binding fragments of immunoglobulins include but are not limited to SMIPs (small molecule immunopharmaceuticals), camelbodies, nanobodies, and IgNAR.
  • An anti-idiotypic (anti-Id) antibody is an antibody which recognizes unique determinants generally associated with the antigen-binding site of an antibody.
  • An Id antibody may be prepared by immunizing an animal of the same species and genetic type (e.g., mouse strain) as the source of the antibody with the antibody to which an anti-Id is being prepared. The immunized animal will recognize and respond to the idiotypic determinants of the immunizing antibody by producing an antibody to these idiotypic determinants (the anti-Id antibody). See e.g., U.S. Patent No. 4,699,880.
  • the anti-Id antibody may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti-anti-Id antibody.
  • the anti-anti-Id may be epitopically identical to the original antibody which induced the anti-Id.
  • antibodies to the idiotypic determinants of an antibody it is possible to identify other clones expressing antibodies of identical specificity.
  • An antibody of the subject technology further may be prepared using an antibody having at least one of the VH and/or VL sequences derived from an antibody starting material to engineer a modified antibody, which modified antibody may have altered properties from the starting antibody.
  • An antibody may be engineered by modifying at least one residues within one or both variable regions (i.e., VH and/or VL), for example within at least one CDR regions and/or within at least one framework regions. Additionally or alternatively, an antibody may be engineered by modifying residues within the constant region(s), for example to alter the effector function(s) of the antibody.
  • variable region engineering One type of variable region engineering that may be performed is CDR grafting.
  • Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties. See, e.g., Riechmann, et al. (1998) Nature 332: 323-327; Jones, et al. (1986) Nature 321 : 522-525; Queen, et al. (1989) Proc. Natl. Acad. U.S.A. 86: 10029-10033; U.S. Patent Nos.
  • Suitable framework sequences may be obtained from public DNA databases or published references that include germline antibody gene sequences.
  • germline DNA sequences for human heavy and light chain variable region genes may be found in the "VBase" human germline sequence database (available on the Internet), as well as in Kabat, E. A., et al. (1991 ) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; Tomlinson, et al. (1992) "The Repertoire of Human Germline VH Sequences Reveals about Fifty Groups of VH Segments with Different Hypervariable Loops” J. Mol. Biol. 227: 776-798; and Cox, et al. (1994) Eur. J Immunol. 24: 827-836.
  • variable region modification is to mutate amino acid residues within the VH and/or VL CDR 1 , CDR2 and/or CDR3 regions to thereby improve at least one binding properties ⁇ e.g., affinity) of the antibody of interest.
  • Site-directed mutagenesis or PCR-mediated mutagenesis may be performed to introduce the mutation(s) and the effect on antibody binding, or other functional property of interest, may be evaluated in appropriate in vitro or in vivo assays.
  • Site-directed mutagenesis or PCR-mediated mutagenesis may be performed to introduce the mutation(s) and the effect on antibody binding, or other functional property of interest, may be evaluated in appropriate in vitro or in vivo assays.
  • the mutations may be amino acid substitutions, additions or deletions, but are preferably substitutions. Moreover, typically no more than one, two, three, four or five residues within a CDR region are altered.
  • Engineered antibodies of the subject technology include those in which modifications have been made to framework residues within VH and/or VL, e.g. to improve the properties of the antibody. Typically such framework modifications are made to decrease the immunogenicity of the antibody. For example, one approach is to "backmutate" at least one framework residues to the corresponding germline sequence. More specifically, an antibody that has undergone somatic mutation may contain framework residues that differ from the germline sequence from which the antibody is derived. Such residues may be identified by comparing the antibody framework sequences to the germline sequences from which the antibody is derived.
  • antibodies of the subject technology may be engineered to include modifications within the Fc region, typically to alter at least one functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and/or antigen-dependent cellular cytotoxicity.
  • an antibody of the subject technology may be chemically modified (e.g., at least one chemical moieties may be attached to the antibody) or be modified to alter its glycosylation, again to alter at least one functional properties of the antibody. Such embodiments are described further below.
  • the numbering of residues in the Fc region is that of the EU index of abat.
  • the hinge region of CHI may be modified such that the number of cysteine residues in the hinge region is altered, e.g., increased or decreased. See U.S. Patent No. 5,677,425.
  • the number of cysteine residues in the hinge region of CHI may be altered to, for example, facilitate assembly of the light and heavy chains or to increase or decrease the stability of the antibody.
  • the Fc hinge region of an antibody may be mutated to decrease the biological half-life of the antibody. More specifically, at least one amino acid mutations may be introduced into the CH2-CH3 domain interface region of the Fc-hinge fragment such that the antibody has impaired Staphylococcyl protein A (SpA) binding relative to native Fc-hinge domain SpA binding. See, e.g., U.S. Patent No. 6,165,745.
  • SpA Staphylococcyl protein A
  • the antibody may be modified to increase its biological half-life.
  • Various approaches are possible. For example, at least one of the following mutations may be introduced: T252L, T254S, T256F. See U.S. Patent No. 6,277,375.
  • the antibody may be altered within the CHI or CL region to contain a salvage receptor binding epitope taken from two loops of a CH2 domain of an Fc region of an IgG. See U.S. Patent Nos. 5,869,046 and 6, 121,022.
  • the Fc region may be altered by replacing at least one amino acid residue with a different amino acid residue to alter the effector function(s) of the antibody.
  • at least one amino acid selected from amino acid residues 234, 235, 236, 237, 297, 318, 320 and 322 may be replaced with a different amino acid residue such that the antibody has an altered affinity for an effector ligand but retains the antigen-binding ability of the parent antibody.
  • the effector ligand to which affinity may be altered may be, for example, an Fc receptor or the C I component of complement. See U.S. Patent Nos. 5,624,821 and 5,648,260.
  • the Fc region may be modified to increase the affinity of the antibody for an Fey receptor by modifying at least one amino acids at the following positions: 238, 239, 248, 249, 252, 254, 255, 256, 258, 265, 267, 268, 269, 270, 272, 276, 278, 280, 283, 285, 286, 289, 290, 292, 293, 294, 295, 296, 298, 301, 303, 305, 307, 309, 312, 315, 320, 322, 324, 326, 327, 329, 330, 331, 333, 334, 335, 337, 338, 340, 360, 373, 376, 378, 382, 388, 389, 398, 414, 416, 419, 430, 434, 435, 437, 438 or 439.
  • an aglycosylated antibody may be made (i.e., the antibody lacks glycosylation).
  • Glycosylation may be altered to, for example, increase the affinity of the antibody for antigen.
  • carbohydrate modifications may be accomplished by, for example, altering at least one sites of glycosylation within the antibody sequence.
  • at least one amino acid substitutions may be made that result in elimination of at least one variable region framework glycosylation sites to thereby eliminate glycosylation at that site.
  • Such aglyclosylation may increase the affinity of the antibody for antigen. See, e.g., U.S. Patent Nos. 5,714,350 and 6,350,861.
  • an antibody may be made that has an altered type of glycosylation, such as a hypofucosylated antibody having reduced amounts of fucosyl residues or an antibody having increased bisecting GlcNac structures.
  • carbohydrate modifications may be accomplished by, for example, expressing the antibody in a host cell with altered glycosylation machinery.
  • Cells with altered glycosylation machinery have been described in the art and may be used as host cells in which to express recombinant antibodies of the subject technology to thereby produce an antibody with altered glycosylation. See U.S. Patent Application Publication No.
  • An antibody may be pegylated to, for example, increase the biological (e.g., serum) half-life of the antibody.
  • the antibody, or fragment thereof typically is reacted with polyethylene glycol (PEG), such as a reactive ester or aldehyde derivative of PEG, under conditions in which at least one PEG groups become attached to the antibody or antibody fragment.
  • PEG polyethylene glycol
  • the pegylation is carried out via an acylation reaction or an alkylation reaction with a reactive PEG molecule (or an analogous reactive water-soluble polymer).
  • the subject technology also provides variants and equivalents that are substantially homologous to the antibodies, antibody fragments, diabodies, SMIPs, camelbodies, nanobodies, IgNAR, polypeptides, variable regions and CDRs set forth herein. These may contain, e.g., conservative substitution mutations, (i.e., the substitution of at least one amino acids by similar amino acids). For example, conservative substitution refers to the substitution of an amino acid with another within the same general class, e.g., one acidic amino acid with another acidic amino acid, one basic amino acid with another basic amino acid, or one neutral amino acid by another neutral amino acid.
  • the subject technology further contemplates the above-recited polypeptide homologs of the antibody fragments, variable regions and CDRs set forth herein further having anti- IL-6 activity.
  • anti-IL-6 activity are set forth herein, for example, under the heading "Anti-IL-6 Activity," infra.
  • Anti-lL-6 antibodies have also been disclosed in the following published and unpublished patent applications, which are co-owned by the assignee of the present application: WO 2008/144763; U.S. Patent Application Publication Nos. 2009/0028784, 2009/0297513, and 2009/0297436.
  • Other anti-IL-6 antibodies have been disclosed in the following U.S. Patents and Published Patent
  • any anti-IL-6 antibodies sequence described herein further characterization or optimization may be achieved by systematically either adding or removing amino acid residues to generate longer or shorter peptides, and testing those and sequences generated by walking a window of the longer or shorter size up or down the antigen from that point. Coupling this approach to generating new candidate targets with testing for effectiveness of antigenic molecules based on those sequences in an immunogenicity assay, as known in the art or as described herein, may lead to further manipulation of the antigen.
  • such optimized sequences may be adjusted by, e.g., the addition, deletions, or other mutations as known in the art and/or discussed herein to further optimize the anti-IL-6 antibodies (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing delivery, enhance immunogenicity, increasing solubility, targeting to a particular in vivo location or cell type).
  • the anti-IL-6 antibodies e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing delivery, enhance immunogenicity, increasing solubility, targeting to a particular in vivo location or cell type.
  • the subject technology contemplates polypeptide sequences having at least about 90% sequence homology to any at least one of the polypeptide sequences of antibody fragments, variable regions and CDRs set forth herein. More preferably, the subject technology contemplates polypeptide sequences having at least about 95% sequence homology, even more preferably at least about 98% sequence homology, and still more preferably at least about 99% sequence homology to any at least one of the polypeptide sequences of antibody fragments, variable regions and CDRs set forth herein. Methods for determining homology between nucleic acid and amino acid sequences are well known to those of ordinary skill in the art.
  • the anti-IL-6 antibodies polypeptides described herein may comprise conservative substitution mutations, (i.e., the substitution of at least one amino acids by similar amino acids).
  • conservative substitution refers to the substitution of an amino acid with another within the same general class, e.g. , one acidic amino acid with another acidic amino acid, one basic amino acid with another basic amino acid, or one neutral amino acid by another neutral amino acid.
  • Anti-IL-6 antibodies polypeptide sequences may have at least about 60, 65, 70, 75, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 98.5, 99, 99.5, 99.8, 99.9, or 100% sequence homology to any at least one of the polypeptide sequences set forth herein.
  • the subject technology contemplates polypeptide sequences having at least about 95% sequence homology, even more preferably at least about 98% sequence homology, and still more preferably at least about 99% sequence homology to any at least one of the polypeptide sequences of Anti-lL-6 antibodies polypeptide sequences set forth herein.
  • Methods for determining homology between amino acid sequences, as well as nucleic acid sequences, are well known to those of ordinary skill in the art. See, e.g., Nedelkov & Nelson (2006) New and Emerging Proteomic Techniques
  • an anti-IL-6 antibodies polypeptide may have at least about 60, 65, 70, 75, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 98.5, 99, 99.5, 99.8, 99.9, or 100% sequence homology with a polypeptide sequence.
  • homology is understood as meaning the number of agreeing amino acids (identity) with other proteins, expressed in percent.
  • identity is preferably determined by comparing a given sequence with other proteins with the aid of computer programs. If sequences which are compared with each other are different in length, the identity is to be determined in such a way that the number of amino acids which the short sequence shares with the longer sequence determines the percentage identity.
  • the identity can be determined routinely by means of known computer programs which are publicly available such as, for example, ClustalW. Thompson, et al. (1994) Nucleic Acids Research 22: 4673-4680.
  • ClustalW is publicly available from the European Molecular Biology Laboratory and may be downloaded from various internet pages, inter alia the IGBMC (Institut de Genetique et de Biologie Moleisme et Cellulaire) and the EBI and all mirrored EBI internet pages (European Bioinformatics Institute). If the ClustalW computer program Version
  • EBI European Bioinformatics Institute
  • sequence database researches One possibility of finding similar sequences is to carry out sequence database researches.
  • at least one sequences may be entered as what is known as a query.
  • This query sequence is then compared with sequences present in the selected databases using statistical computer programs.
  • database queries blast searches
  • Non-specific variants typically contain at least one non-conservative amino acid substitutions, deletions, insertions, inversions, or truncation or a substitution, insertion, inversion, or deletion in a critical residue or critical region of an epitope.
  • Molecular biology and biochemistry techniques for modifying anti-IL-6 antibodies polypeptides while preserving specificity are well known in the art. See, e.g., Ho, et al. (1989) Gene 77(1): 51-59; Landt, et al. (1990) Gene 96(1): 125-128; Hopp & Woods (1991) Proc. Natl. Acad. Sci.
  • Amino acids that are essential for function may be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis. Cunningham, et al. (1989) Sci. 244: 1081-85. The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as epitope binding. Sites that are critical for ligand-receptor binding may also be determined by structural analysis such as crystallography, nuclear magnetic resonance, or photoaffinity labeling. Smith, et al. (1992) J. Mol. Biol. 224: 899-904; de Vos, et al. (1992) Sci- 255: 306-12.
  • substitutions are those that substitute a given amino acid in an anti-IL-6 antibody polypeptide with another amino acid of like characteristics.
  • conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg, replacements among the aromatic residues Phe, Tyr.
  • Guidance concerning which amino acid changes are likely to be phenotypically silent is found in, for example, Bowie, et al. (1990) Sci. 247: 1306-10.
  • polypeptides often contain amino acids other than the twenty "naturally occurring" amino acids.
  • amino acids including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art.
  • Known modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross- linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, g-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • the subject technology further contemplates the generation and use of anti-idiotypic antibodies that bind any of the foregoing sequences.
  • such an anti-idiotypic antibody could be administered to a subject who has received an anti-IL-6 antibody to modulate, reduce, or neutralize, the effect of the anti-IL-6 antibody.
  • a further exemplary use of such anti-idiotypic antibodies is for detection of the anti-IL-6 antibodies of the present subject technology, for example to monitor the levels of the anti-IL-6 antibodies present in a subject's blood or other bodily fluids.
  • anti-IL-6 antibodies comprising any of the polypeptide or polynucleotide sequences described herein substituted for any of the other polynucleotide sequences described herein.
  • the present subject technology contemplates antibodies comprising the combination of any of the variable light chain and variable heavy chain sequences described herein, and further contemplates antibodies resulting from substitution of any of the CDR sequences described herein for any of the other CDR sequences described herein.
  • preferred anti-IL-6 antibodies or fragments or variants thereof may contain a variable heavy and/or light sequence as shown in FIG. 2-5, such as SEQ ID NO: 651, 657, 709 or variants thereof wherein at least one CDR or FR residues are modified without adversely affecting antibody binding to IL-6 or other desired functional activity.
  • Fusions comprising the anti-IL-6 antibodies polypeptides are also within the scope of the present subject technology.
  • the fusion protein may be linked to a GST fusion protein in which the anti-IL-6 antibodies polypeptide sequences are fused to the C-terminus of the GST sequences.
  • Such fusion proteins may facilitate the purification of the recombinant Anti-IL-6 antibodies polypeptides.
  • anti-IL-6 antibodies polypeptides may be fused with a protein that binds B-cell follicles, thus initiating both a humoral immune response and activation of T cells. Berney, et al. (1999) J. Exp. Med. 190: 851-60.
  • the Anti-IL-6 antibodies polypeptides may be genetically coupled with and anti-dendritic cell antibody to deliver the antigen to the immune system and stimulate a cellular immune response.
  • a chimeric or fusion protein of the subject technology may be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, e.g., by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers.
  • Fusion proteins may include C-terminal or N-terminal translocation sequences. Further, fusion proteins can comprise additional elements, e.g., for protein detection, purification, or other applications. Detection and purification facilitating domains including but not limited to metal chelating peptides such as polyhistidine tracts, histidine-tryptophan modules, or other domains that allow purification on immobilized metals; maltose binding protein; protein A domains that allow purification on immobilized immunoglobulin; or the domain utilized in the FLAG extension/affinity purification system (Immunex Corp, Seattle WA.)
  • a fusion protein may be prepared from a protein of the subject technology by fusion with a portion of an immunoglobulin comprising a constant region of an immunoglobulin. More preferably, the portion of the immunoglobulin comprises a heavy chain constant region which is optionally and more preferably a human heavy chain constant region.
  • the heavy chain constant region is most preferably an IgG heavy chain constant region, and optionally and most preferably is an Fc chain, most preferably an IgG Fc fragment that comprises CH2 and CH3 domains. Although any IgG subtype may optionally be used, the IgGl subtype is preferred.
  • the Fc chain may optionally be a known or "wild type" Fc chain, or alternatively may be mutated.
  • Fc chain also optionally comprises any type of Fc fragment.
  • the term "Fc chain” also optionally comprises any type of Fc fragment.
  • Several of the specific amino acid residues that are involved in antibody constant region- mediated activity in the IgG subclass have been identified. Inclusion, substitution or exclusion of these specific amino acids therefore allows for inclusion or exclusion of specific immunoglobulin constant region-mediated activity.
  • specific changes may result in aglycosylation for example and/or other desired changes to the Fc chain. At least some changes may optionally be made to block a function of Fc which is considered to be undesirable, such as an undesirable immune system effect. See McCafferty, et al. (2002) Antibody Engineering: A Practical Approach (Eds.) Oxford University Press.
  • cleavable linker sequences such as Factor Xa ⁇ see, e.g., Ottavi, (1998) Biochimie 80: 289-93), subtilisin protease recognition motif ⁇ see, e.g., Polyak (1997) Protein Eng. 10: 615-19); enterokinase (Invitrogen, San Diego, CA.), between the translocation domain (for efficient plasma membrane expression) and the rest of the newly translated polypeptide may be useful to facilitate purification.
  • one construct can include a polypeptide encoding a nucleic acid sequence linked to six histidine residues followed by a thioredoxin, an enterokinase cleavage site ⁇ see, e.g., Williams ( 1995) Biochemistry 34: 1787-97), and an C-terminal translocation domain.
  • the histidine residues facilitate detection and purification while the enterokinase cleavage site provides a means for purifying the desired protein(s) from the remainder of the fusion protein.
  • Technology pertaining to vectors encoding fusion proteins and application of fusion proteins are well described in the scientific and patent literature. See, e.g., Kroll (1993) DNA Cell. Biol. 12: 441-53.
  • the anti-IL-6 antibodies may be conjugated to other moieties. Such conjugates are often used in the preparation of vaccines.
  • the anti-IL-6 antibodies polypeptide may be conjugated to a carbohydrate ⁇ e.g., mannose, fucose, glucose, GlcNAs, maltose), which is recognized by the mannose receptor present on dendritic cells and macrophages.
  • the ensuing binding, aggregation, and receptor-mediated endocytosis and phagocytosis functions provide enhanced innate and adaptive immunity. See Mahnke, et al. (2000) J. Cell Biol. 151 : 673-84; Dong, et al.
  • KLH Keyhole Limpet Hemocyanin
  • OMPS microbial outer membrane proteins
  • polynucleotides of the subject technology comprise, or alternatively consist of, the following polynucleotide sequence encoding the variable light chain polypeptide sequence of SEQ ID NO: 2 which is encoded by the polynucleotide sequence of SEQ ID NO: 10 or the polynucleotide sequence of SEQ ID NO: 662, 698, 701, or 705.
  • polynucleotides of the subject technology comprise, or alternatively consist of, the following polynucleotide sequence encoding the variable heavy chain polypeptide sequence of SEQ ID NO: 3 which is encoded by the polynucleotide sequence of SEQ ID NO: 1 1 or the polynucleotide sequence of SEQ ID NO: 663, 700, 703, or 707.
  • polynucleotides encoding fragments or variants of the antibody having binding specificity to 1L-6 comprise, or alternatively consist of, at least one of the polynucleotide sequences of SEQ ID NO: 12 or 694; SEQ ID NO: 13; and SEQ ID NO: 14 or 695 which correspond to polynucleotides encoding the complementarity-determining regions (CDRs, or hypervariable regions) of the light chain variable sequence of SEQ ID NO: 2.
  • CDRs complementarity-determining regions
  • polynucleotides encoding fragments or variants of the antibody having binding specificity to 1L-6 comprise, or alternatively consist of, at least one of the polynucleotide sequences of SEQ ID NO: 15; SEQ ID NO: 16 or 696; and SEQ ID NO: 17 or 697 which correspond to polynucleotides encoding the complementarity-determining regions (CDRs, or hypervariable regions) of the heavy chain variable sequence of SEQ ID NO: 3 or SEQ ID NO: 661 or SEQ ID NO: 657 or others depicted in Figs. 8 or 9.
  • CDRs complementarity-determining regions
  • polynucleotide sequences including at least one of the polynucleotide sequences encoding antibody fragments or variants described herein.
  • polynucleotides encoding fragments or variants of the antibody having binding specificity to IL-6 comprise, or alternatively consist of, one, two, three or more, including all of the following polynucleotides encoding antibody fragments: the polynucleotide SEQ ID NO: 10 encoding the light chain variable region of SEQ ID NO: 2; the polynucleotide SEQ ID NO: 1 1 encoding the heavy chain variable region of SEQ ID NO: 3; the polynucleotide SEQ ID NO: 720 encoding the light chain polypeptide of SEQ ID NO: 20; the polynucleotide SEQ ID NO: 721 encoding the light chain polypeptide of SEQ ID NO: 647; the polynucleotide SEQ ID NO
  • variable heavy and light chain sequences may be expressed alone or in combination and these sequences preferably are fused to suitable variable constant sequences, e.g., those in SEQ ID NO: 589 and SEQ ID NO: 587.
  • nucleotide sequences encoding anti-IL-6 antibodies of the present subject technology are identified in Table 1.
  • the polynucleotide sequences shown are to be understood to be illustrative, rather than limiting.
  • One of skill in the art can readily determine the polynucleotide sequences that would encode a given polypeptide and can readily generate coding sequences suitable for expression in a given expression system, such as by adapting the polynucleotide sequences provided and/or by generating them de novo, and can readily produce codon-optimized expression sequences, for example as described in published U.S. Patent Application No. 2008/0120732 or using other methods known in the art.
  • polynucleotides of the subject technology further comprise, the following polynucleotide sequence encoding the kappa constant light chain sequence of SEQ ID NO: 586 which is encoded by the polynucleotide sequence of SEQ ID NO: 587.
  • polynucleotides of the subject technology further comprise, the following polynucleotide sequence encoding the gamma- 1 constant heavy chain polypeptide sequence of SEQ ID NO: 588 which is encoded by the polynucleotide sequence of SEQ ID NO: 589.
  • the subject technology is directed to an isolated polynucleotide comprising a polynucleotide encoding an anti-IL-6 V H antibody amino acid sequence selected from SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661 , 664, 665, 704, and 708 or encoding a variant thereof wherein at least one framework residue (FR residue) has been substituted with an amino acid present at the corresponding position in a rabbit anti-IL-6 antibody V H polypeptide or a conservative amino acid substitution.
  • FR residue framework residue
  • the subject technology specifically encompasses humanized anti-IL-6 antibodies or humanized antibody binding fragments or variants thereof and nucleic acid sequences encoding the foregoing comprising the humanized variable heavy chain and/or light chain polypeptides depicted in the sequences contained in FIG. 1-5, or those identified in Table 1, or variants thereof wherein at least one framework or CDR residues may be modified.
  • any modifications are introduced they will not affect adversely the binding affinity of the resulting anti- IL-6 antibody or fragment or variant thereof.
  • the subject technology is directed to an isolated polynucleotide comprising the polynucleotide sequence encoding an anti-IL-6 V L antibody amino acid sequence selected from SEQ ID NO: 2, 20, 647, 651 , 660, 666, 699, 702, 706, and 709 or encoding a variant thereof wherein at least one framework residue (FR residue) has been substituted with an amino acid present at the corresponding position in a rabbit anti-IL-6 antibody V L polypeptide or a conservative amino acid substitution.
  • an isolated polynucleotide comprising the polynucleotide sequence encoding an anti-IL-6 V L antibody amino acid sequence selected from SEQ ID NO: 2, 20, 647, 651 , 660, 666, 699, 702, 706, and 709 or encoding a variant thereof wherein at least one framework residue (FR residue) has been substituted with an amino acid present at the corresponding position in a rabbit anti-IL-6 antibody V L polypeptide or a conservative amino acid substitution.
  • the subject technology is directed to at least one heterologous polynucleotides comprising a sequence encoding the polypeptides set forth in SEQ ID NO: 2 and SEQ ID NO: 3; SEQ ID NO: 2 and SEQ ID NO: 18; SEQ ID NO: 2 and SEQ ID NO: 19; SEQ ID NO: 20 and SEQ ID NO: 3; SEQ ID NO: 20 and SEQ ID NO: 18; or SEQ ID NO: 20 and SEQ ID NO: 19.
  • the subject technology is directed to an isolated polynucleotide that expresses a polypeptide containing at least one CDR polypeptide derived from an anti-IL-6 antibody wherein said expressed polypeptide alone specifically binds IL-6 or specifically binds IL-6 when expressed in association with another polynucleotide sequence that expresses a polypeptide containing at least one CDR polypeptide derived from an anti-IL-6 antibody wherein said at least one CDR is selected from those contained in the V L or V H polypeptides set forth in SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, 708, 2, 20, 647, 651, 660, 666, 699, 702, 706, or 709.
  • Host cells and vectors comprising said polynucleotides are also contemplated.
  • the subject technology covers nucleic acid constructs containing any of the foregoing nucleic acid sequences and combinations thereof as well as recombinant cells containing these nucleic acid sequences and constructs containing wherein these nucleic acid sequences or constructs may be extrachromosomal or integrated into the host cell genome.
  • the subject technology further contemplates vectors comprising the polynucleotide sequences encoding the variable heavy and light chain polypeptide sequences, as well as the individual complementarity determining regions (CDRs, or hypervariable regions) set forth herein, as well as host cells comprising said sequences.
  • the host cell is a yeast cell.
  • the yeast host cell belongs to the genus Pichia.
  • more than one exemplary polynucleotide encoding a given polypeptide sequence is provided, as summarized in Table 3.
  • Table 3 Multiple exemplary polynucleotides encoding particular polypeptides.
  • sequence identifiers refer to the same polypeptide or polynucleotide sequence, as summarized in Table 4. References to these sequence identifiers are understood to be interchangeable, except where context indicates otherwise.
  • Table 4 Repeated sequences. Each cell lists a group of repeated sequences included in the sequence listing.
  • Certain exemplary embodiments include polynucleotides that hybridize under moderately or highly stringent hybridization conditions to a polynucleotide having one of the exemplary coding sequences recited in Table 1 , and also include polynucleotides that hybridize under moderately or highly stringent hybridization conditions to a polynucleotide encoding the same polypeptide as a polynucleotide having one of the exemplary coding sequences recited in Table 1 , or polypeptide encoded by any of the foregoing polynucleotides.
  • high stringency hybridization conditions refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences. High stringency conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, high stringency conditions are selected to be about 5-10 °C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH.
  • Tm thermal melting point
  • the Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • High stringency conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides).
  • High stringency conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, optionally 10 times background hybridization.
  • Exemplary high stringency hybridization conditions can be as following: 50% formamide, 5*SSC, and 1 % SDS, incubating at 42 °C, or, 5*SSC, 1% SDS, incubating at 65 °C, with wash in 0.2 ⁇ SSC, and 0.1% SDS at 65 °C.
  • Such hybridizations and wash steps can be carried out for, e.g., 1 , 2, 5, 10, 15, 30, 60; or more minutes.
  • Nucleic acids that do not hybridize to each other under high stringency conditions are still substantially related if the polypeptides that they encode are substantially related. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderate stringency hybridization conditions.
  • Exemplary "moderate stringency hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 1 xSSC at 45°C. Such hybridizations and wash steps can be carried out for, e.g., 1, 2, 5, 10, 15, 30, 60, or more minutes. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency.
  • Expression vectors for use in the methods of the subject technology will further include yeast specific sequences, including a selectable auxotrophic or drug marker for identifying transformed yeast strains.
  • a drug marker may further be used to amplify copy number of the vector in a yeast host cell.
  • the polypeptide coding sequence of interest is operably linked to transcriptional and translational regulatory sequences that provide for expression of the polypeptide in yeast cells.
  • These vector components may include, but are not limited to, at least one of the following: an enhancer element, a promoter, and a transcription termination sequence. Sequences for the secretion of the polypeptide may also be included, e.g. a signal sequence, and the like.
  • a yeast origin of replication is optional, as expression vectors are often integrated into the yeast genome.
  • the polypeptide of interest is operably linked, or fused, to sequences providing for optimized secretion of the polypeptide from yeast diploid cells.
  • Nucleic acids are "operably linked" when placed into a functional relationship with another nucleic acid sequence.
  • DNA for a signal sequence is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence.
  • "operably linked” means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites or alternatively via a PCR/recombination method familiar to those skilled in the art (Gateway ®
  • Promoters are untranslated sequences located upstream (5') to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of particular nucleic acid sequences to which they are operably linked. Such promoters fall into several classes: inducible, constitutive, and repressible promoters (that increase levels of transcription in response to absence of a repressor). Inducible promoters may initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient or a change in temperature.
  • the yeast promoter fragment may also serve as the site for homologous recombination and integration of the expression vector into the same site in the yeast genome; alternatively a selectable marker is used as the site for homologous recombination. Pichia transformation is described in Cregg, et al. (1985) Mol. Cell. Biol. 5:3376-3385.
  • Suitable promoters from Pichia include the AOX1 and promoter (Cregg, et al. (1989) Mol. Cell. Biol. 9: 1316-1323); ICL1 promoter (Menendez, et al. (2003) Yeast 20(13): 1097- 108); glyceraldehyde-3 -phosphate dehydrogenase promoter (GAP) (Waterham, et al. (1997) Gene 186( l):37-44); and FLD1 promoter (Shen, et al. (1998) Gene 216(1 ):93- 102).
  • the GAP promoter is a strong constitutive promoter and the AOX and FLD 1 promoters are inducible.
  • yeast promoters include ADH1 , alcohol dehydrogenase II, GAL4, PH03, PH05, Pyk, and chimeric promoters derived therefrom.
  • non-yeast promoters may be used in the subject technology such as mammalian, insect, plant, reptile, amphibian, viral, and avian promoters. Most typically the promoter will comprise a mammalian promoter (potentially endogenous to the expressed genes) or will comprise a yeast or viral promoter that provides for efficient transcription in yeast systems.
  • the polypeptides of interest may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, e.g.
  • the signal sequence may be a component of the vector, or it may be a part of the polypeptide coding sequence that is inserted into the vector.
  • the heterologous signal sequence selected preferably is one that is recognized and processed through one of the standard pathways available within the host cell.
  • the S. cerevisiae alpha factor pre-pro signal has proven effective in the secretion of a variety of recombinant proteins from P. pastoris.
  • Other yeast signal sequences include the alpha mating factor signal sequence, the invertase signal sequence, and signal sequences derived from other secreted yeast polypeptides.
  • signal peptide sequences may be engineered to provide for enhanced secretion in diploid yeast expression systems.
  • Other secretion signals of interest also include mammalian signal sequences, which may be heterologous to the protein being secreted, or may be a native sequence for the protein being secreted.
  • Signal sequences include pre-peptide sequences, and in some instances may include propeptide sequences.
  • Many such signal sequences are known in the art, including the signal sequences found on immunoglobulin chains, e.g., K28 preprotoxin sequence, PHA-E, FACE, human MCP-1 , human serum albumin signal sequences, human Ig heavy chain, human Ig light chain, and the like. See Hashimoto, et al. (1998) Protein Eng 1 1(2): 75; and Kobayashi, et al. (1998) Therapeutic Apheresis 2(4): 257.
  • Transcription may be increased by inserting a transcriptional activator sequence into the vector.
  • These activators are cis-acting elements of DNA, usually about from 10 to 300 bp, which act on a promoter to increase its transcription.
  • Transcriptional enhancers are relatively orientation and position independent, having been found 5 ' and 3' to the transcription unit, within an intron, as well as within the coding sequence itself. The enhancer may be spliced into the expression vector at a position 5 ' or 3 ' to the coding sequence, but is preferably located at a site 5 ' from the promoter.
  • Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from 3 ' to the translation termination codon, in untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA.
  • Plasmids from the transformants are prepared, analyzed by restriction endonuclease digestion and/or sequenced.
  • recombination methods based on att sites and recombination enzymes may be used to insert DNA sequences into a vector. Such methods are described, for example, by Landy (1989) Ann. Rev. Biochem. 58: 913-949; and are known to those of skill in the art. Such methods utilize intermolecular DNA recombination that is mediated by a mixture of lambda and E. coli -encoded recombination proteins. Recombination occurs between specific attachment (att) sites on the interacting DNA molecules.
  • Att sites may be introduced into a sequence of interest by ligating the sequence of interest into an appropriate vector; generating a PCR product containing att B sites through the use of specific primers; generating a cDNA library cloned into an appropriate vector containing att sites.
  • the expression host may be further modified by the introduction of sequences encoding at least one enzymes that enhance folding and disulfide bond formation, i.e. foldases, chaperonins, Such sequences may be constitutively or inducibly expressed in the yeast host cell, using vectors, markers, are known in the art. Preferably the sequences, including transcriptional regulatory elements sufficient for the desired pattern of expression, are stably integrated in the yeast genome through a targeted methodology.
  • the eukaryotic PDI is not only an efficient catalyst of protein cysteine oxidation and disulfide bond isomerization, but also exhibits chaperone activity. Co-expression of PDI can facilitate the production of active proteins having multiple disulfide bonds. Also of interest is the expression of BIP (immunoglobulin heavy chain binding protein); cyclophilin; and the like.
  • BIP immunoglobulin heavy chain binding protein
  • cyclophilin cyclophilin
  • each of the haploid parental strains expresses a distinct folding enzyme, e.g. one strain may express BIP, and the other strain may express PDI or combinations thereof.
  • Vectors are used to introduce a foreign substance, such as DNA, RNA or protein, into an organism or host cell.
  • Typical vectors include recombinant viruses (for polynucleotides) and liposomes or other lipid aggregates (for polypeptides and/or polynucleotides).
  • a "DNA vector” is a replicon, such as plasmid, phage or cosmid, to which another polynucleotide segment may be attached so as to bring about the replication of the attached segment.
  • An "expression vector” is a DNA vector which contains regulatory sequences which will direct polypeptide synthesis by an appropriate host cell.
  • Exemplary expression vectors and techniques for their use are described in the following publications: Old, et al. (1989) Principles of Gene Manipulation: An Introduction to Genetic Engineering, Blackwell Scientific Publications, 4th edition,; Sambrook, et al.
  • a liposomes or other lipid aggregate may comprise a lipid such as phosphatidylcholines (lecithins) (PC), phosphatidylethanolamines (PE), lysolecithins,
  • a lipid such as phosphatidylcholines (lecithins) (PC), phosphatidylethanolamines (PE), lysolecithins,
  • lysophosphatidylethanolamines phosphatidylserines (PS), phosphatidylglycerols (PG),
  • PI phosphatidylinositol
  • PA phosphatidic acids
  • fatty acids gangliosides, glucolipids, glycolipids, mono-, di or triglycerides, ceramides, cerebrosides and combinations thereof
  • a cationic lipid or other cationic amphiphile
  • DOTAP l ,2-dioleyloxy-3- (trimethylamino) propane
  • CTAP N-cholesteryloxycarbaryl-3,7, 12-triazapentadecane-l, 15- diamine
  • CTAP N-[l -(2,3, -ditetradecyloxy)propyl]-N,N-dimethyl-N-hydroxyethylammonium bromide
  • DM IE N-[l-(2,3,-dioleyloxy)propyl]-N,N-dimethyl-N-hydroxy ethylammonium bromide
  • polyvinylmethylether polymethyloxazoline, polyethyloxazoline, polyhydroxypropyloxazoline, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide,
  • hydroxyethylcellulose polyethyleneglycol, polyaspartamide and combinations thereof.
  • Other suitable cationic lipids are described in Miller (1998) Angewandte Chemie International Edition 37(13-14): 1768-1785 and Cooper, et al. (1998) Chem. Eur. J. 4(1): 137-151.
  • Liposomes can be crosslinked, partially crosslinked, or free from crosslinking.
  • Crosslinked liposomes can include crosslinked as well as non-crosslinked components.
  • Suitable cationic liposomes or cytofectins are commercially available and can also be prepared as described in Sipkins et al. (1998) Nature Medicine 4(5): 623- 626 or as described in Miller, supra.
  • Exemplary liposomes include a polymerizable zwitterionic or neutral lipid, a polymerizable integrin targeting lipid and a polymerizable cationic lipid suitable for binding a nucleic acid.
  • Liposomes can optionally include peptides that provide increased efficiency, for example as described in U.S. Patent No. 7,297,759. Additional exemplary liposomes and other lipid aggregates are described in U.S. Patent No. 7,166,298. Additional Exemplary Embodiments of the Subject technology
  • the subject technology contemplates at least one anti-IL-6 antibodies or antibody fragments or variants thereof which may specifically bind to the same linear or conformational epitope(s) and/or compete for binding to the same linear or conformational epitope(s) on an intact human IL-6 polypeptide or fragment thereof as an anti-IL-6 antibody comprising Abl and chimeric, humanized, single chain antibodies and fragments thereof (containing at least one CDRs of the afore-identified antibodies) that specifically bind IL-6, which preferably are aglycosylated.
  • the anti-IL-6 antibody or fragment or variant thereof may specifically bind to the same linear or conformational epitope(s) and/or compete for binding to the same linear or conformational epitope(s) on an intact human IL-6 polypeptide or a fragment thereof as Abl and chimeric, humanized, single chain antibodies and fragments thereof (containing at least one CDRs of the afore-mentioned antibody) that specifically bind IL-6, which preferably are aglycosylated.
  • the anti-IL-6 antibody which may specifically bind to the same linear or conformational epitopes on an intact IL-6 polypeptide or fragment thereof that is (are) specifically bound by Abl may bind to an IL-6 epitope(s) ascertained by epitopic mapping using overlapping linear peptide fragments which span the full length of the native human IL-6 polypeptide.
  • the IL-6 epitope comprises, or alternatively consists of, at least one residues comprised in IL-6 fragments selected from those respectively encompassing amino acid residues 37-51 , amino acid residues 70-84, amino acid residues 169-183, amino acid residues 31-45 and/or amino acid residues 58-72.
  • the subject technology is also directed to an anti-IL-6 antibody that binds with the same IL- 6 epitope and/or competes with an anti-IL-6 antibody for binding to IL-6 as an antibody or antibody fragment disclosed herein, including but not limited to an anti-IL-6 antibody selected from Abl and chimeric, humanized, single chain antibodies and fragments thereof (containing at least one CDRs of the afore-mentioned antibody) that specifically bind IL-6, which preferably are aglycosylated.
  • the subject technology is also directed to an isolated anti-IL-6 antibody or antibody fragment or variant thereof comprising at least one of the CDRs contained in the V H polypeptide sequences comprising: SEQ ID NO: 3, 18, 19, 22, 38, 54, 70, 86, 102, 1 17, 1 18, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299, 315, 331 , 347, 363, 379, 395, 41 1 , 427, 443, 459, 475, 491 , 507, 523, 539, 555, 571, 652, 656, 657, 658, 661 , 664, 665, 668, 672, 676, 680, 684, 688, 691, 692, 704, or 708 and/or at least one of the CDRs contained in the V L polypeptide sequence consisting of: 2, 20, 21, 37, 53, 69, 85, 101 , 1 19, 122,
  • the anti-IL-6 antibody described herein may comprise at least 2 complementarity determining regions (CDRs) in each the variable light and the variable heavy regions which are identical to those contained in an anti-IL-6 antibody comprising Abl and chimeric, humanized, single chain antibodies and fragments thereof (containing at least one CDRs of the afore-mentioned antibody) that specifically bind IL-6, which preferably are aglycosylated.
  • CDRs complementarity determining regions
  • the anti-IL-6 antibody described herein may comprise at least 2 complementarity determining regions (CDRs) in each the variable light and the variable heavy regions which are identical to those contained in Abl .
  • CDRs complementarity determining regions
  • all of the CDRs of the anti-IL- 6 antibody discussed above are identical to the CDRs contained in an anti-IL-6 antibody comprising Abl and chimeric, humanized, single chain antibodies and fragments thereof (containing at least one CDRs of the afore-mentioned antibody) that specifically bind IL-6, which preferably are
  • all of the CDRs of the anti-IL-6 antibody discussed above are identical to the CDRs contained in Abl, e.g. , an antibody comprised of the VH and VL sequences comprised in SEQ ID NO: 657 and SEQ ID NO: 709 respectively.
  • the one or more anti-IL-6 antibodies discussed above are aglycosylated or substantially non-glycosylated (e.g., may contain one or more, e.g., 1-5 mannose residues); that contain an Fc region that has been modified to alter effector function, half-life, proteolysis, and/or glycosylation; are human, humanized, single chain or chimeric; and are a humanized antibody derived from a rabbit (parent) anti-IL-6 antibody.
  • Exemplary constant regions that provide for the production of aglycosylated antibodies in Pichia are comprised in SEQ ID NO: 588 and SEQ ID NO: 586 which respectively are encoded by the nucleic acid sequences in SEQ ID NO: 589 and SEQ ID NO: 587.
  • the subject technology further contemplates at least one anti-IL-6 antibodies wherein the framework regions (FRs) in the variable light region and the variable heavy regions of said antibody respectively are human FRs which are unmodified or which have been modified by the substitution of at most 2 or 3 human FR residues in the variable light or heavy chain region with the corresponding FR residues of the parent rabbit antibody, and wherein said human FRs have been derived from human variable heavy and light chain antibody sequences which have been selected from a library of human germline antibody sequences based on their high level of homology to the corresponding rabbit variable heavy or light chain regions relative to other human germline antibody sequences contained in the library.
  • the anti-IL-6 antibody or fragment or variant thereof may specifically bind to IL-6 expressing human cells and/or to circulating soluble IL-6 molecules in vivo, including IL-6 expressed on or by human cells in a patient with a disease associated with cells that express IL-6.
  • the subject technology further contemplates anti-IL-6 antibodies or fragments or variants thereof directly or indirectly attached to a detectable label or therapeutic agent.
  • the subject technology also contemplates at least one nucleic acid sequences which result in the expression of an anti-IL-6 antibody or antibody fragment or variant thereof as set forth above, including those comprising, or alternatively consisting of, yeast or human preferred codons.
  • the subject technology also contemplates vectors (including plasmids or recombinant viral vectors) comprising said nucleic acid sequence(s).
  • the subject technology also contemplates host cells or recombinant host cells expressing at least one of the antibodies set forth above, including a mammalian, yeast, bacterial, and insect cells.
  • the host cell is a yeast cell.
  • the yeast cell is a diploidal yeast cell.
  • the yeast cell is a Pichia yeast.
  • the subject technology also contemplates a method of treatment comprising administering to a patient with a disease or condition associated with psoriatic arthritis a therapeutically effective amount of at least one anti-IL-6 antibody or antigen-binding fragment or variant thereof.
  • the diseases that may be treated are presented in the non-limiting list set forth above.
  • the treatment further includes the administration of another therapeutic agent or regimen selected from chemotherapy, radiotherapy, cytokine administration or gene therapy agent.
  • drugs associated with the treatment of psoriatic arthritis including but not limited to TNF-a inhibitors, glyococordicoids, triamcinolone, dexamethasone, prednisone, may also be administered sequentially or subsequently with at least one anti-IL-6 antibody or antigen-binding fragment or variant thereof described herein.
  • drugs associated with the treatment of psoriatic arthritis include but are not limited to ARISTOCORT (triamcinolone), BAYCADROM (dexamethasone), DECADRON (dexamethasone), DELTASONE (prednisone), DEXAMETHASONE INTE SOL (dexamethasone), ENBREL (etancercept), HUMIRA (adalimumab), REMICADE (infliximab), RIDUARA (aruaofin), and SIMPONI® (golimumab).
  • IL-6 is a member of a family of cytokines that promote cellular responses through a receptor complex consisting of at least one subunit of the signal-transducing glycoprotein gpl30 and the IL-6 receptor (IL-6R).
  • the IL-6R may also be present in a soluble form (sIL-6R).
  • sIL-6R soluble form
  • IL-6 binds to IL-6R, which then dimerizes the signal-transducing receptor gpl30.
  • the anti-IL-6 antibodies of the subject technology, or IL-6 binding fragments or variants thereof are useful by exhibiting anti-IL-6 activity.
  • the anti-IL-6 antibodies of the subject technology, or IL-6 binding fragments or variants thereof exhibit anti-IL-6 activity by binding to IL-6 which may be soluble IL-6 or cell surface expressed IL-6 and/or may prevent or inhibit the binding of IL-6 to IL-6R and/or activation (dimerization) of the gpl30 signal-transducing glycoprotein and the formation of IL- 6/IL-6R/gp l 30 multimers and the biological effects of any of the foregoing.
  • the subject anti-IL-6 antibodies may possess different antagonistic activities based on where (i.e., epitope) the particular antibody binds IL-6 and/or how it affects the formation of the foregoing IL-6 complexes and/or multimers and the biological effects thereof. Consequently, different anti-IL-6 antibodies according to the subject technology e.g., may be better suited for preventing or treating conditions involving the formation and accumulation of substantial soluble IL-6 such as rheumatoid arthritis whereas other antibodies may be favored in treatments wherein the prevention of IL-6/IL-6R/gpl 30 or IL-6/IL- 6R/gpl30 multimers is a desired therapeutic outcome. This can be determined in binding and other assays.
  • anti-IL-6 activity of the anti-IL-6 antibody of the present subject technology may also be described by their strength of binding or their affinity for IL-6. This also may affect their therapeutic properties.
  • the anti-IL-6 antibodies of the present subject technology, and fragments thereof having binding specificity to IL-6 bind to IL-6 with a dissociation constant (K D ) of less than or equal to 5xl(T 7 , 10 '7 , 5xl (T 8 , 10 ⁇ 8 , 5xl(T 9 , 10 "9 , 5x10 " '°, 10 "10 , 5xl0 "n , 10 " “, 5xl 0 "12 , 10 "12 , 5xl 0 "13 , 10 '13 , 5xl 0 "14 , lO 4 , 5xl 0 "15 or 10 ⁇ 15 .
  • the anti-IL-6 antibodies and fragments and variants thereof bind IL-6 with a dissociation constant of less than or equal to 5xl0 "10 .
  • the anti-IL-6 activity of the anti-IL-6 antibodies of the present subject technology, and fragments and variants thereof having binding specificity to IL-6 bind to IL-6 with an off-rate of less than or equal to 10 "4 S "1 , 5xlO "5 S “1 , 10 "5 5xl 0 "6 S “1 , 10 "6 S “1 , 5xl0 "7 S “1 , or 10 "7 S “ '.
  • the anti-IL-6 antibodies of the subject technology, and fragments and variants thereof having binding specificity to IL-6 bind to a linear or conformational IL-6 epitope.
  • the anti-IL-6 activity of the anti-IL-6 antibodies of the present subject technology, and fragments and variants thereof having binding specificity to IL-6 exhibit anti-IL-6 activity by ameliorating or reducing the symptoms of, or alternatively treating, or preventing, diseases and disorders associated with IL-6.
  • diseases and disorders associated with IL-6 are set forth infra.
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments and variants thereof do not have binding specificity for IL-6R or the gp-130 signal-transducing glycoprotein.
  • the present subject technology provides methods of isolating a clonal population of antigen-specific B cells that may be used for isolating at least one antigen-specific cell.
  • these methods contain a series of culture and selection steps that can be used separately, in combination, sequentially, repetitively, or periodically.
  • these methods are used for isolating at least one antigen-specific cell, which can be used to produce a monoclonal antibody, which is specific to a desired antigen, or a nucleic acid sequence corresponding to such an antibody.
  • the present subject technology provides a method comprising the steps of:
  • the present subject technology provides an improvement to a method of isolating a single, antibody-producing B cell, the improvement comprising enriching a B cell population obtained from a host that has been immunized or naturally exposed to an antigen, wherein the enriching step precedes any selection steps, comprises at least one culturing step, and results in a clonal population of B cells that produces a single monoclonal antibody specific to said antigen.
  • a "clonal population of B cells” refers to a population of B cells that only secrete a single antibody specific to a desired antigen. That is to say that these cells produce only one type of monoclonal antibody specific to the desired antigen.
  • enriched cell population cells means increasing the frequency of desired cells, typically antigen-specific cells, contained in a mixed cell population, e.g., a B cell-containing isolate derived from a host that is immunized against a desired antigen.
  • a mixed cell population e.g., a B cell-containing isolate derived from a host that is immunized against a desired antigen.
  • an enriched cell population encompasses a cell population having a higher frequency of antigen-specific cells as a result of an enrichment step, but this population of cells may contain and produce different antibodies.
  • cell population encompasses pre- and a post-enrichment cell populations, keeping in mind that when multiple enrichment steps are performed, a cell population can be both pre- and post-enrichment.
  • the present subject technology provides a method:
  • Each cell population may be used directly in the next step, or it can be partially or wholly frozen for long- or short- term storage or for later steps.
  • cells from a cell population can be individually suspended to yield single cell suspensions.
  • the single cell suspension can be enriched, such that a single cell suspension serves as the pre-enrichment cell population.
  • at least one antigen-specific single cell suspensions together form the enriched cell population; the antigen- specific single cell suspensions can be grouped together, e.g., re-plated for further analysis and/or antibody production.
  • the present subject technology provides a method of enriching a cell population to yield an enriched cell population having an antigen-specific cell frequency that is about 50% to about 100%, or increments therein.
  • the enriched cell population has an antigen-specific cell frequency at least about 50%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, or 100%.
  • the present subject technology provides a method of enriching a cell population whereby the frequency of antigen-specific cells is increased by at least about 2-fold, 5- fold, 10-fold, 20-fold, 50-fold, 100-fold, or increments therein.
  • increment is used to define a numerical value in varying degrees of precision, e.g., to the nearest 10, 1 , 0.1 , 0.01.
  • the increment can be rounded to any measurable degree of precision, and the increment need not be rounded to the same degree of precision on both sides of a range.
  • the range 1 to 100 or increments therein includes ranges such as 20 to 80, 5 to 50, and 0.4 to 98.
  • increments therein means increments between 100 and the measurable limit.
  • less than 100 or increments therein means 0 to 100 or increments therein unless the feature, e.g., temperature, is not limited by 0.
  • Antigen-specificity can be measured with respect to any antigen.
  • the antigen can be any substance to which an antibody can bind including, but not limited to, peptides, proteins or fragments thereof; carbohydrates; organic and inorganic molecules; receptors produced by animal cells, bacterial cells, and viruses; enzymes; agonists and antagonists of biological pathways; hormones; and cytokines.
  • Exemplary antigens include, but are not limited to, IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, IFN-a, IFN- ⁇ , BAFF, CXCL13, lP-10, VEGF, EPO, EGF, HRG, Hepatocyte Growth Factor (HGF) and Hepcidin.
  • Preferred antigens include IL-6, IL-13, TNF- a, VEGF-a, Hepatocyte Growth Factor (HGF) and Hepcidin.
  • the antigen used in each enrichment step can be the same as or different from one another. Multiple enrichment steps with the same antigen may yield a large and/or diverse population of antigen-specific cells; multiple enrichment steps with different antigens may yield an enriched cell population with cross-specificity to the different antigens.
  • Enriching a cell population can be performed by any cell-selection means known in the art for isolating antigen-specific cells. For example, a cell population can be enriched by
  • the method of enriching a cell population includes at least one chromatographic enrichment step.
  • a cell population can also be enriched by performed by any antigen-specificity assay technique known in the art, e.g. , an ELISA assay or a halo assay.
  • ELISA assays include, but are not limited to, selective antigen immobilization (e.g., biotinylated antigen capture by streptavidin, avidin, or neutravidin coated plate), non-specific antigen plate coating, and through an antigen build-up strategy (e.g., selective antigen capture followed by binding partner addition to generate a heteromeric protein-antigen complex).
  • the antigen can be directly or indirectly attached to a solid matrix or support, e.g., a column.
  • a halo assay comprises contacting the cells with antigen-loaded beads and labeled anti-host antibody specific to the host used to harvest the B cells.
  • the label can be, e.g., a fluorophore.
  • at least one assay enrichment step is performed on at least one single cell suspension.
  • the method of enriching a cell population includes at least one chromatographic enrichment step and at least one assay enrichment step.
  • the cell populations of the present subject technology contain at least one cell capable of recognizing an antigen.
  • Antigen-recognizing cells include, but are not limited to, B cells, plasma cells, and progeny thereof.
  • the present subject technology provides a clonal cell population containing a single type of antigen-specific B-cell, i.e., the cell population produces a single monoclonal antibody specific to a desired antigen.
  • the present subject technology also provides methods for obtaining an enriched cell population containing at least one antigen-specific, antibody-secreting cell.
  • the present subject technology provides an enriched cell population containing about 50% to about 100%, or increments therein, at least about 60%, 70%, 80%, 90%, or 100% of antigen-specific, antibody-secreting cells.
  • the present subject technology provides a method of isolating a single B cell by enriching a cell population obtained from a host before any selection steps, e.g., selecting a particular B cell from a cell population and/or selecting an antibody produced by a particular cell.
  • the enrichment step can be performed as one, two, three, or more steps.
  • a single B cell is isolated from an enriched cell population before confirming whether the single B cell secretes an antibody with antigen-specificity and/or a desired property.
  • a method of enriching a cell population is used in a method for antibody production and/or selection.
  • the present subject technology provides a method comprising enriching a cell population before selecting an antibody.
  • the method can include the steps of: preparing a cell population comprising at least one antigen-specific cell, enriching the cell population by isolating at least one antigen-specific cell to form an enriched cell population, and inducing antibody production from at least one antigen-specific cell.
  • the enriched cell population contains more than one antigen-specific cell.
  • each antigen-specific cell of the enriched population is cultured under conditions that yield a clonal antigen-specific B cell population before isolating an antibody producing cell therefrom and/or producing an antibody using said B cell, or a nucleic acid sequence corresponding to such an antibody.
  • the present subject technology allows antibody selection from among a high frequency of antigen-specific cells. Because an enrichment step is used prior to antibody selection, the majority of the cells, preferably virtually all of the cells, used for antibody production are antigen-specific. By producing antibodies from a population of cells with an increased frequency of antigen specificity, the quantity and variety of antibodies are increased.
  • an antibody is preferably selected after an enrichment step and a culture step that results in a clonal population of antigen-specific B cells.
  • the methods can further comprise a step of sequencing a selected antibody or portions thereof from at least one isolated, antigen-specific cells. Any method known in the art for sequencing can be employed and can include sequencing the heavy chain, light chain, variable region(s), and/or complementarity determining region(s) (CDR).
  • the method for antibody selection can also include at least one steps of screening a cell population for antigen recognition and/or antibody functionality.
  • the desired antibodies may have specific structural features, such as binding to a particular epitope or mimicry of a particular structure; antagonist or agonist activity; or neutralizing activity, e.g., inhibiting binding between the antigen and a ligand.
  • the antibody functionality screen is ligand-dependent. Screening for antibody functionality includes, but is not limited to, an in vitro protein-protein interaction assay that recreates the natural interaction of the antigen ligand with recombinant receptor protein; and a cell-based response that is ligand dependent and easily monitored ⁇ e.g., proliferation response).
  • the method for antibody selection includes a step of screening the cell population for antibody functionality by measuring the inhibitory concentration (IC50).
  • IC50 inhibitory concentration
  • at least one of the isolated, antigen-specific cells produces an antibody having an IC50 of less than about 100, 50, 30, 25, 10 g/mL, or increments therein.
  • the method for antibody selection can also include at least one steps of screening a cell population for antibody binding strength.
  • Antibody binding strength can be measured by any method known in the art (e.g., Biacore®).
  • at least one of the isolated, antigen-specific cells produces an antibody having a high antigen affinity, e.g., a dissociation constant (Kd) of less than about 5xl 0 "10 M-l , preferably about lxlO "13 to 5xl0 "10 , lxlO "12 to lxlO "10 , lxl O "12 to 7.5x10 " ", lxlO "11 to 2x10 " “, about 1.5x10-” or less, or increments therein.
  • Kd dissociation constant
  • the antibodies are said to be affinity mature.
  • the affinity of the antibodies is comparable to or higher than the affinity of any one of Panorex® (edrecolomab), Rituxan® (rituximab), Herceptin® (traztuzumab), Mylotarg® (gentuzumab), Campath® (alemtuzumab), Zevalin® (ibritumomab), Erbitux® (cetuximab), Avastin®
  • the affinity of the antibodies is comparable to or higher than the affinity of Humira®.
  • the affinity of an antibody can also be increased by known affinity maturation techniques.
  • at least one cell population is screened for at least one of, preferably both, antibody functionality and antibody binding strength.
  • the method for antibody selection can also include at least one steps of screening a cell population for antibody sequence homology, especially human homology.
  • at least one of the isolated, antigen-specific cells produces an antibody that has a homology to a human antibody of at least about 50% to about 100%, or increments therein, or at least about 60%, 70%, 80%, 85%, 90%, or 95% homologous.
  • the antibodies can be humanized to increase the homology to a human sequence by techniques known in the art such as CDR grafting or selectivity determining residue grafting (SDR).
  • the present subject technology also provides the antibodies themselves according to any of the embodiments described above in terms of IC50, Kd, and/or homology.
  • [0298] 1. Identify the amino acid that is the first one following the signal peptide sequence. This is the start of Framework 1.
  • the signal peptide starts at the first initiation methionine and is typically, but not necessarily 22 amino acids in length for rabbit light chain protein sequences.
  • the start of the mature polypeptide can also be determined experimentally by N-terminal protein sequencing, or can be predicted using a prediction algorithm. This is also the start of Framework 1 as classically defined by those in the field.
  • [0303] 3. Use the rabbit light chain sequence of the polypeptide starting from the beginning of Framework 1 to the end of Framework 3 as defined above and perform a sequence homology search for the most similar human antibody protein sequences. This will typically be a search against human germline sequences prior to antibody maturation in order to reduce the possibility of immunogenicity, however any human sequences can be used. Typically a program like BLAST can be used to search a database of sequences for the most homologous. Databases of human antibody sequences can be found from various sources such as NCBI (National Center for Biotechnology Information).
  • Example: RbtVL amino acid sequence from residues numbered 1 through 88 in Fig. 1 is BLASTed against a human antibody germline database. The top three unique returned sequences are shown in Fig. 1 as L12A (SEQ ID NO: 734), VI (SEQ ID NO: 735), and Vx02 (SEQ ID NO: 736).
  • L12A SEQ ID NO: 7344 was the most homologous human germline variable light chain sequence and is used as the basis for the humanization of RbtVL.
  • [0307] Determine the framework and CDR arrangement (FR1 , FR2, FR3, CDR1 & CDR2) for the human homolog being used for the light chain humanization. This is using the traditional layout as described in the field. Align the rabbit variable light chain sequence with the human homolog, while maintaining the layout of the framework and CDR regions.
  • the human L12A frameworks 1 , 2 and 3 are unaltered.
  • the resulting humanized sequence is shown below as VLh from residues numbered 1 through 88. Note that the only residues that are different from the L12A human sequence are underlined, and are thus rabbit-derived amino acid residues. In this example only 8 of the 88 residues are different than the human sequence.
  • the rabbit light chain framework 4 which is typically the final 1 1 amino acid residues of the variable light chain and begins as indicated in Step 7 above and typically ends with the amino acid sequence ' ...VVKR' (SEQ ID NO: 744) is replaced with the nearest human light chain framework 4 homolog, usually from germline sequence. Frequently this human light chain framework 4 is of the sequence 'FGGGTKVEIKR' (SEQ ID NO: 745). It is possible that other human light chain framework 4 sequences that are not the most homologous or otherwise different may be used without affecting the specificity, affinity and/or immunogenicity of the resulting humanized antibody. This human light chain framework 4 sequence is added to the end of the variable light chain humanized sequence immediately following the CDR3 sequence from Step 7 above. This is now the end of the variable light chain humanized amino acid sequence.
  • FIG. 1 Framework 4 (FR4) of the RbtVL rabbit light chain sequence is shown above a homologous human FR4 sequence.
  • the human FR4 sequence is added to the humanized variable light chain sequence (VLh) right after the end of the CD3 region added in Step 7 above.
  • Figs. 8 and 9 depict preferred humanized anti-IL-6 variable heavy and variable light chain sequences humanized from the variable heavy and light regions in Abl according to the subject technology. These humanized light and heavy chain regions are respectively contained in the polypeptides set forth in SEQ ID NO: 647, or 651 and in SEQ ID NO: 652, 656, 657 or 658.
  • the CDR2 of the humanized variable heavy region in SEQ ID NO: 657 (containing a serine substitution in CDR2) is set forth in SEQ ID NO: 658.
  • Alignments illustrating variants of the light and heavy chains are shown in Figs. 10 and 1 1, respectively, with sequence differences within the CDR regions highlighted. Sequence identifiers of CDR sequences and of exemplary coding sequences are summarized in Table 1, above.
  • [0317] Identify the amino acid that is the first one following the signal peptide sequence. This is the start of Framework 1.
  • the signal peptide starts at the first initiation methionine and is typically 19 amino acids in length for rabbit heavy chain protein sequences. Typically, but not necessarily always, the final 3 amino acid residues of a rabbit heavy chain signal peptide are ' ...VQC, followed by the start of Framework 1.
  • the start of the mature polypeptide can also be determined
  • [0321] Use the rabbit heavy chain sequence of the polypeptide starting from the beginning of Framework 1 to the end of Framework 3 as defined above and perform a sequence homology search for the most similar human antibody protein sequences. This will typically be against a database of human germline sequences prior to antibody maturation in order to reduce the possibility of immunogenicity, however any human sequences can be used. Typically a program like BLAST can be used to search a database of sequences for the most homologous. Databases of human antibody sequences can be found from various sources such as NCBI (National Center for Biotechnology Information).
  • Example: RbtVH amino acid sequence from residues numbered 1 through 98 in Fig. 1 is BLASTed against a human antibody germline database. The top three unique returned sequences are shown in Fig. 1 as 3-64-04 (SEQ ID NO: 739), 3-66-04 (SEQ ID NO: 740), and 3-53-02 (SEQ ID NO: 741).
  • Example: 3-64-04 in Fig. 1 was the most homologous human germline variable heavy chain sequence and is used as the basis for the humanization of RbtVH.
  • [0325] Determine the framework and CDR arrangement (FR1 , FR2, FR3, CDR1 & CDR2) for the human homolog being used for the heavy chain humanization. This is using the traditional layout as described in the field. Align the rabbit variable heavy chain sequence with the human homolog, while maintaining the layout of the framework and CDR regions.
  • rabbit heavy chain Framework 1 these three residues follow a Glycine residue preceded by a Serine residue.
  • this is a Glycine residue preceded by an Isoleucine residue in the rabbit heavy chain Framework 2. It is possible that the specificity, affinity and/or immunogenicity of the resulting humanized antibody may be unaltered if smaller or larger sequence exchanges are performed, or if specific residue(s) are altered, however the exchanges as described have been used successfully, but do not exclude the possibility that other changes may be permitted.
  • a tryptophan amino acid residue typically occurs four residues prior to the end of the rabbit heavy chain CDR2 region, whereas in human heavy chain CDR2 this residue is typically a Serine residue.
  • Changing this rabbit tryptophan residue to a the human Serine residue at this position has been demonstrated to have minimal to no effect on the humanized antibody's specificity or affinity, and thus further minimizes the content of rabbit sequence-derived amino acid residues in the humanized sequence.
  • the final three amino acids of Framework 1 positions 28-30
  • the final residue of Framework 2 position 49
  • the resulting humanized sequence is shown below as VHh from residues numbered 1 through 98. Note that the only residues that are different from the 3- 64-04 human sequence are underlined, and are thus rabbit-derived amino acid residues. In this example only 15 of the 98 residues are different than the human sequence.
  • the rabbit heavy chain framework 4 which is typically the final 1 1 amino acid residues of the variable heavy chain and begins as indicated in Step 7 above and typically ends with the amino acid sequence ' ...TVSS' (SEQ ID NO: 747) is replaced with the nearest human heavy chain framework 4 homolog, usually from germline sequence. Frequently this human heavy chain framework 4 is of the sequence 'WGQGTLVTVSS' (SEQ ID NO: 748). It is possible that other human heavy chain framework 4 sequences that are not the most homologous or otherwise different may be used without affecting the specificity, affinity and/or immunogenicity of the resulting humanized antibody. This human heavy chain framework 4 sequence is added to the end of the variable heavy chain humanized sequence immediately following the CDR3 sequence from Step 7 above. This is now the end of the variable heavy chain humanized amino acid sequence.
  • the human FR4 sequence is added to the humanized variable heavy chain sequence (VHh) right after the end of the CD3 region added in Step 7 above.
  • the subject technology is also directed to the production of the antibodies described herein or fragments thereof.
  • Recombinant polypeptides corresponding to the antibodies described herein or fragments thereof are secreted from polyploidal, preferably diploid or tetraploid strains of mating competent yeast.
  • the subject technology is directed to methods for producing these recombinant polypeptides in secreted form for prolonged periods using cultures comprising polyploid yeast, i.e., at least several days to a week, more preferably at least a month or several months, and even more preferably at least 6 months to a year or longer.
  • polyploid yeast cultures will express at least 10-25 mg/liter of the polypeptide, more preferably at least 50-250 mg/liter, still more preferably at least 500-1000 mg/liter, and most preferably a gram per liter or more of the recombinant polypeptide(s).
  • a pair of genetically marked yeast haploid cells are transformed with expression vectors comprising subunits of a desired heteromultimeric protein.
  • One haploid cell comprises a first expression vector
  • a second haploid cell comprises a second expression vector.
  • diploid yeast cells will be transformed with at least one expression vectors that provide for the expression and secretion of at least one of the recombinant polypeptides.
  • a single haploid cell may be transformed with at least one vectors and used to produce a polyploidal yeast by fusion or mating strategies.
  • a diploid yeast culture may be transformed with at least one vectors providing for the expression and secretion of a desired polypeptide or polypeptides.
  • vectors may comprise vectors e.g., linearized plasmids or other linear DNA products that integrate into the yeast cell's genome randomly, through homologous recombination, or using a recombinase such as Cre/Lox or Flp/Frt.
  • additional expression vectors may be introduced into the haploid or diploid cells; or the first or second expression vectors may comprise additional coding sequences; for the synthesis of heterotrimers; heterotetramers.
  • the expression levels of the non-identical polypeptides may be individually calibrated, and adjusted through appropriate selection, vector copy number, promoter strength and/or induction and the like.
  • the transformed haploid cells are genetically crossed or fused.
  • the resulting diploid or tetraploid strains are utilized to produce and secrete fully assembled and biologically functional proteins, humanized antibodies described herein or fragments thereof.
  • diploid or tetraploid cells for protein production provides for unexpected benefits.
  • the cells can be grown for production purposes, i.e. scaled up, and for extended periods of time, in conditions that can be deleterious to the growth of haploid cells, which conditions may include high cell density; growth in minimal media; growth at low temperatures; stable growth in the absence of selective pressure; and which may provide for maintenance of heterologous gene sequence integrity and maintenance of high level expression over time.
  • haploid strains can comprise numerous minor autotrophic mutations, which mutations are complemented in the diploid or tetraploid, enabling growth and enhanced production under highly selective conditions.
  • Transformed mating competent haploid yeast cells provide a genetic method that enables subunit pairing of a desired protein.
  • Haploid yeast strains are transformed with each of two expression vectors, a first vector to direct the synthesis of one polypeptide chain and a second vector to direct the synthesis of a second, non-identical polypeptide chain.
  • the two haploid strains are mated to provide a diploid host where optimized target protein production can be obtained.
  • additional non-identical coding sequence(s) are provided. Such sequences may be present on additional expression vectors or in the first or the second expression vectors. As is known in the art, multiple coding sequences may be independently expressed from individual promoters; or may be coordinately expressed through the inclusion of an "internal ribosome entry site” or "IRES", which is an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap-independent translation of the gene. IRES elements functional in yeast are described by Thompson, et al. (2001) PNAS 98: 12866-12868. [0338] In one embodiment of the subject technology, antibody sequences are produced in combination with a secretory J chain, which provides for enhanced stability of IgA. See U.S. Patent Nos. 5,959,177 and 5,202,422.
  • the two haploid yeast strains are each auxotrophic, and require supplementation of media for growth of the haploid cells.
  • the pair of auxotrophs are complementary, such that the diploid product will grow in the absence of the supplements required for the haploid cells.
  • Many such genetic markers are known in yeast, including requirements for amino acids ⁇ e.g. met, lys, his, arg), nucleosides (e.g. ura3, adel); and the like. Amino acid markers may be preferred for the methods of the subject technology.
  • diploid cells which contain the desired vectors can be selected by other means, e.g., by use of other markers, such as green fluorescent protein, antibiotic resistance genes, various dominant selectable markers, and the like.
  • Two transformed haploid cells may be genetically crossed and diploid strains arising from this mating event selected by their hybrid nutritional requirements and/or antibiotic resistance spectra.
  • populations of the two transformed haploid strains are spheroplasted and fused, and diploid progeny regenerated and selected.
  • diploid strains can be identified and selectively grown based on their ability to grow in different media than their parents.
  • the diploid cells may be grown in minimal medium thatmay include antibiotics.
  • the diploid synthesis strategy has certain advantages. Diploid strains have the potential to produce enhanced levels of heterologous protein through broader complementation to underlying mutations, which may impact the production and/or secretion of recombinant protein.
  • any antibiotics used to select those strains do not necessarily need to be continuously present in the growth media.
  • a haploid yeast may be transformed with a single or multiple vectors and mated or fused with a non-transformed cell to produce a diploid cell containing the vector or vectors.
  • a diploid yeast cell may be transformed with at least one vectors that provide for the expression and secretion of a desired heterologous polypeptide by the diploid yeast cell.
  • two haploid strains are transformed with a library of polypeptides, e.g. a library of antibody heavy or light chains.
  • Transformed haploid cells that synthesize the polypeptides are mated with the complementary haploid cells.
  • the resulting diploid cells are screened for functional protein.
  • the diploid cells provide a means of rapidly, conveniently and inexpensively bringing together a large number of combinations of polypeptides for functional testing. This technology is especially applicable for the generation of heterodimeric protein products, where optimized subunit synthesis levels are critical for functional protein expression and secretion.
  • the expression level ratio of the two subunits is regulated in order to maximize product generation.
  • Heterodimer subunit protein levels have been shown previously to impact the final product generation.
  • Regulation can be achieved prior to the mating step by selection for a marker present on the expression vector.
  • the expression level By stably increasing the copy number of the vector, the expression level can be increased. In some cases, it may be desirable to increase the level of one chain relative to the other, so as to reach a balanced proportion between the subunits of the polypeptide.
  • Antibiotic resistance markers are useful for this purpose, e.g.
  • Zeocin® (phleomycin) resistance marker provides a means of enrichment for strains that contain multiple integrated copies of an expression vector in a strain by selecting for transformants that are resistant to higher levels of Zeocin® (phleomycin) or G418.
  • the proper ratio (e.g. 1 : 1; 1 :2) of the subunit genes may be important for efficient protein production. Even when the same promoter is used to transcribe both subunits, many other factors contribute to the final level of protein expressed and therefore, it can be useful to increase the number of copies of one encoded gene relative to the other.
  • diploid strains that produce higher levels of a polypeptide, relative to single copy vector strains are created by mating two haploid strains, both of which have multiple copies of the expression vectors.
  • Host cells are transformed with the above-described expression vectors, mated to form diploid strains, and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants or amplifying the genes encoding the desired sequences.
  • a number of minimal media suitable for the growth of yeast are known in the art. Any of these media may be supplemented as necessary with salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as phosphate, HEPES), nucleosides (such as adenosine and thymidine), antibiotics, trace elements, and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled in the art.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • a protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) may be useful to inhibit proteolytic degradation during purification, and antibiotics may be included to prevent the growth of adventitious contaminants.
  • PMSF phenyl methyl sulfonyl fluoride
  • the composition may be concentrated, filtered, dialyzed, using methods known in the art.
  • the diploid cells of the subject technology are grown for production purposes.
  • Such production purposes desirably include growth in minimal media, which media lacks pre-formed amino acids and other complex biomolecules, e.g., media comprising ammonia as a nitrogen source, and glucose as an energy and carbon source, and salts as a source of phosphate, calcium and the like.
  • media comprising ammonia as a nitrogen source, and glucose as an energy and carbon source, and salts as a source of phosphate, calcium and the like.
  • Preferably such production media lacks selective agents such as antibiotics, amino acids, purines, pyrimidines
  • the diploid cells can be grown to high cell density, for example at least about 50 g/L; more usually at least about 100 g/L; and may be at least about 300, about 400, about 500 g/L or more.
  • the growth of the subject cells for production purposes is performed at low temperatures, which temperatures may be lowered during log phase, during stationary phase, or both.
  • low temperature refers to temperatures of at least about 15°C, more usually at least about 17°C, and may be about 20°C, and is usually not more than about 25°C, more usually not more than about 22°C. In another embodiment of the subject technology, the low temperature is usually not more than about 28°C.
  • Growth temperature can impact the production of full-length secreted proteins in production cultures, and decreasing the culture growth temperature can strongly enhance the intact product yield. The decreased temperature appears to assist intracellular trafficking through the folding and post-translational processing pathways used by the host to generate the target product, along with reduction of cellular protease degradation.
  • secreted, active protein preferably a mammalian protein.
  • active antibodies refers to a correctly folded multimer of at least two properly paired chains, which accurately binds to its cognate antigen.
  • Expression levels of active protein are usually at least about 10-50 mg/liter culture, more usually at least about 100 mg/liter, preferably at least about 500 mg/liter, and may be 1000 mg/liter or more.
  • the methods of the subject technology can provide for increased stability of the host and heterologous coding sequences during production.
  • the stability is evidenced, for example, by maintenance of high levels of expression of time, where the starting level of expression is decreased by not more than about 20%, usually not more than 10%, and may be decreased by not more than about 5% over about 20 doublings, 50 doublings, 100 doublings, or more.
  • the strain stability also provides for maintenance of heterologous gene sequence integrity over time, where the sequence of the active coding sequence and requisite transcriptional regulatory elements are maintained in at least about 99% of the diploid cells, usually in at least about 99.9% of the diploid cells, and preferably in at least about 99.99% of the diploid cells over about 20 doublings, 50 doublings, 100 doublings, or more.
  • substantially all of the diploid cells maintain the sequence of the active coding sequence and requisite transcriptional regulatory elements.
  • Antibody polypeptides of the subject technology having IL-6 binding specificity may also be produced by constructing, using conventional techniques well known to those of ordinary skill in the art, an expression vector containing an operon and a DN A sequence encoding an antibody heavy chain in which the DNA sequence encoding the CDRs required for antibody specificity is derived from a non-human cell source, preferably a rabbit B-cell source, while the DNA sequence encoding the remaining parts of the antibody chain is derived from a human cell source.
  • a second expression vector is produced using the same conventional means well known to those of ordinary skill in the art, said expression vector containing an operon and a DNA sequence encoding an antibody light chain in which the DNA sequence encoding the CDRs required for antibody specificity is derived from a non-human cell source, preferably a rabbit B-cell source, while the DNA sequence encoding the remaining parts of the antibody chain is derived from a human cell source.
  • the expression vectors are transfected into a host cell by convention techniques well known to those of ordinary skill in the art to produce a transfected host cell, said transfected host cell cultured by conventional techniques well known to those of ordinary skill in the art to produce said antibody polypeptides.
  • the host cell may be co-transfected with the two expression vectors described above, the first expression vector containing DNA encoding an operon and a light chain-derived polypeptide and the second vector containing DNA encoding an operon and a heavy chain-derived polypeptide.
  • the two vectors contain different selectable markers, but preferably achieve substantially equal expression of the heavy and light chain polypeptides.
  • a single vector may be used, the vector including DNA encoding both the heavy and light chain polypeptides.
  • the coding sequences for the heavy and light chains may comprise cDNA.
  • the host cells used to express the antibody polypeptides may be either a bacterial cell such as E. coli, or a eukaryotic cell.
  • a mammalian cell of a well-defined type for this purpose such as a myeloma cell or a Chinese hamster ovary (CHO) cell line may be used.
  • the general methods by which the vectors may be constructed transfection methods required to produce the host cell and culturing methods required to produce the antibody polypeptides from said host cells all include conventional techniques.
  • the cell line used to produce the antibody is a mammalian cell line, any other suitable cell line, such as a bacterial cell line such as an E. co/ -derived bacterial strain, or a yeast cell line, may alternatively be used.
  • the antibody polypeptides may be purified according to standard procedures in the art, such as for example cross-flow filtration, ammonium sulphate precipitation, affinity column chromatography and the like.
  • the antibody polypeptides described herein may also be used for the design and synthesis of either peptide or non-peptide mimetics that would be useful for the same therapeutic applications as the antibody polypeptides of the subject technology. See, for example, Saragobi et al. (1991) Science 253 : 792-795.
  • This section recites exemplary embodiments of heavy and light chain polypeptides, as well as exemplary polynucleotides encoding such polypeptides. These exemplary polynucleotides are suitable for expression in the disclosed Pichia expression system.
  • the present subject technology encompasses polynucleotides having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity (sequence homology) to the polynucleotides recited in this application or that encode polypeptides recited in this application, or that hybridize to said polynucleotides under conditions of low-stringency, moderate-stringency, or high-stringency conditions, preferably those that encode polypeptides (e.g.
  • the subject technology encompasses a composition comprising such a polynucleotide and/or a polypeptide encoded by such a polynucleotide.
  • the subject technology encompasses a method of treatment of a disease or condition associated with IL-6 or that may be prevented, treated, or ameliorated with an IL- 6 antagonist such as Abl (e.g. psoriatic arthritis) comprising administration of a composition comprising such a polynucleotide and/or polypeptide.
  • a heavy chain polypeptide will comprise at least one of the CDR sequences of the heavy and/or light chain polypeptides recited herein (including those contained in the heavy and light chain polypeptides recited herein) and at least one of the framework region polypeptides recited herein, including those depicted in Figs. 1 and 8-1 1 or Table 1 , and contained in the heavy and light chain polypeptide sequences recited herein.
  • a heavy chain polypeptide will comprise at least one Framework 4 region sequences as depicted in Figs. 1 and 8-1 1 or Table 1 , or as contained in a heavy or light chain polypeptide recited herein.
  • a light chain polypeptide will comprise at least one of the CDR sequences of the heavy and/or light chain polypeptides recited herein (including those contained in the heavy and light chain polypeptides recited herein) and at least one of the Framework region polypeptides recited herein, including those depicted in Figs. 1 and 8-1 1 or Table 1, and contained in the heavy and light chain polypeptide sequences recited herein.
  • a light chain polypeptide will comprise at least one Framework 4 region sequences as depicted in Figs. 1 and 8-1 1 or Table 1, or as contained in a heavy or light chain polypeptide recited herein.
  • Abl heavy chain polypeptides e.g. any of SEQ ID NO: 3, 18, 19, 652, 656, 657, 658, 661, 664, 665, 704, or 708, another Abl heavy chain polypeptide may be substituted unless the context indicates otherwise.
  • Abl light chain polynucleotides e.g. any of SEQ ID NO: 10, 662, 698, 701 , or 705
  • another Abl light chain polynucleotide may be substituted unless the context indicates otherwise.
  • one of the Abl heavy chain polynucleotides is recited, e.g. any of SEQ ID NO: 1 1, 663, 700, 703, or 707, another Abl heavy chain polynucleotide may be substituted unless the context indicates otherwise.
  • any member of any of the following groups is understood to encompass substitution by any other member of the group, as follows: Ab2 Light chain polypeptides (SEQ ID NO: 21 and 667); Ab2 Light chain polynucleotides (SEQ ID NO: 29 and 669); Ab2 Heavy chain polypeptides (SEQ ID NO: 22 and 668); Ab2 Heavy chain polynucleotides (SEQ ID NO: 30 and 670); Ab3 Light chain polypeptides (SEQ ID NO: 37 and 671); Ab3 Light chain polynucleotides (SEQ ID NO: 45 and 673); Ab3 Heavy chain polypeptides (SEQ ID NO: 38 and 672); Ab3 Heavy chain polynucleotides (SEQ ID NO: 46 and 674); Ab4 Light chain polypeptides (SEQ ID NO: 53 and 675); Ab4 Light chain polynucleotides (SEQ ID NO: 61 and 677); Ab4 Heavy chain polypeptides (SEQ ID NO: 54
  • the subject technology also includes screening assays designed to assist in the
  • the anti-IL-6 antibodies of the subject technology are used to detect the presence of IL-6 in a biological sample obtained from a patient exhibiting symptoms of a disease or disorder associated with IL-6.
  • the presence of IL-6, or elevated levels thereof when compared to pre-disease levels of IL-6 in a comparable biological sample, may be beneficial in diagnosing a disease or disorder associated with IL-6.
  • Another embodiment of the subject technology provides a diagnostic or screening assay to assist in diagnosis of diseases or disorders associated with IL-6 in patients exhibiting symptoms of an IL-6 associated disease or disorder identified herein, comprising assaying the level of IL-6 expression in a biological sample from said patient using a post-translationally modified anti-IL-6 antibody or binding fragment or variant thereof.
  • the anti-IL-6 antibody or binding fragment or variant thereof may be post-translationally modified to include a detectable moiety such as set forth previously in the disclosure.
  • the IL-6 level in the biological sample is determined using a modified anti-IL-6 antibody or binding fragment or variant thereof as set forth herein, and comparing the level of IL-6 in the biological sample against a standard level of IL-6 (e.g., the level in normal biological samples).
  • a standard level of IL-6 e.g., the level in normal biological samples.
  • the above-recited assay may also be useful in monitoring a disease or disorder, where the level of IL-6 obtained in a biological sample from a patient believed to have an IL-6 associated disease or disorder is compared with the level of IL-6 in prior biological samples from the same patient, in order to ascertain whether the IL-6 level in said patient has changed with, for example, a treatment regimen.
  • a biological sample includes, but is not limited to, sera, plasma, urine, saliva, mucous, pleural fluid, synovial fluid and spinal fluid.
  • antibodies and fragments and variants thereof may be modified post- translationally to add effector moieties such as chemical linkers, detectable moieties such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, and chemiluminescent moieties, or functional moieties such as for example streptavidin, avidin, biotin, a cytotoxin, a cytotoxic agent, and radioactive materials.
  • effector moieties such as chemical linkers, detectable moieties such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, and chemiluminescent moieties, or functional moieties such as for example streptavidin, avidin, biotin, a cytotoxin, a cytotoxic agent, and radioactive materials.
  • anti-IL-6 antibodies and antigen-binding fragments thereof described herein may be modified post-translationally to add effector moieties such as chemical linkers, detectable moieties such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, chemiluminescent moieties, a cytotoxic agent, radioactive materials, or functional moieties.
  • effector moieties such as chemical linkers, detectable moieties such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, chemiluminescent moieties, a cytotoxic agent, radioactive materials, or functional moieties.
  • Ligands may include naturally occurring molecules, or recombinant or synthetic molecules.
  • exemplary ligands include, but are not limited to, avadin, biotin, peptides, peptidomimetics, polylysine (PLL), polyethylene glycol (PEG), mPEG, cationic groups, spermine, spermidine, polyamine, thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin, glycosylated polyaminoacids, transferrin, aptamer, immunoglobulins (e.g., antibodies), insulin, transferrin, albumin, sugar, lipophilic molecules (e.g., steroids, bile acids, cholesterol, cholic acid, and fatty acids), vitamin A, vitamin E, vitamin K, vitamin B, folic acid, B 12,
  • moieties may be added to the antigen or epitope to increase half-life in vivo (e.g., by lengthening the time to clearance from the blood stream.
  • Such techniques include, for example, adding PEG moieties (also termed pegylation), and are well-known in the art. See U.S. Patent Application Publication No. 2003/0031671.
  • An anti-IL-6 antibody or antigen binding fragment thereof, described herein may be "attached" to a substrate when it is associated with the solid label through a non-random chemical or physical interaction.
  • the attachment may be through a covalent bond.
  • attachments need not be covalent or permanent.
  • Materials may be attached to a label through a "spacer molecule" or "linker group.”
  • spacer molecules are molecules that have a first portion that attaches to the biological material and a second portion that attaches to the label. Thus, when attached to the label, the spacer molecule separates the label and the biological materials, but is attached to both.
  • Methods of attaching biological material (e.g., label) to a label are well known in the art, and include but are not limited to chemical coupling.
  • the anti-IL-6 antibody or antigen-binding fragments described herein may be modified post-translationally to add effector labels such as chemical linkers, detectable labels such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, and chemiluminescent labels, or functional labels such as for example streptavidin, avidin, biotin, a cytotoxin, a cytotoxic agent, and radioactive materials.
  • effector labels such as chemical linkers, detectable labels such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, and chemiluminescent labels, or functional labels such as for example streptavidin, avidin, biotin, a cytotoxin, a cytotoxic agent, and radioactive materials.
  • effector labels such as chemical linkers, detectable labels such as for example fluorescent dyes, enzymes, substrates, bioluminescent materials, radioactive materials, and chemiluminescent labels, or functional labels such as for example streptavi
  • fluorescent materials include, but are not limited to, rhodamine, fluorescein, fluorescein isothiocyanate, umbelliferone, dichlorotriazinylamine, phycoerythrin and dansyl chloride.
  • chemiluminescent labels include, but are not limited to, luminol.
  • bioluminescent materials include, but are not limited to, luciferin and aequorin.
  • radioactive materials include, but are not limited to, bismuth-213 ( 213 Bs), carbon- 14 ( 14 C), carbon-1 1 ( n C), chlorine-18 (CI 18 ), chromium-51 ( 51 Cr), cobalt-57 ( 57 Co), cobalt-60 ( 60 Co), copper-64 ( 64 Cu), copper-67 ( 67 Cu), dysprosium- 165 ( 165 Dy), erbium-169 ( 169 Er), fluorine-18 ( 18 F), gallium-67 ( 67 Ga), gallium-68 ( 68 Ga), germanium-68 ( 68 Ge), holmium-166 ( 166 Ho), indium-1 1 1 ( U 1 ln), iodine-125 ( 125 I), iodine-123 ( , 24 I), iodine-124 ( 12 I), iodine-131 ( 131 I), iridium-192 ( 192 Ir), iron-59 ( 59 Fe), krypton-81 ( sl Kr), lead-212
  • the anti-IL-6 antibodies and antigen-binding fragments described herein may be conjugated to cytotoxic agents including, but are not limited to, methotrexate, aminopterin, 6-mercaptopurine, 6- thioguanine, cytarabine, 5-fluorouracil dacarbazine; alkylating agents such as mechlorethamine, thiotepa chlorambucil, melphalan, carmustine (BSNU), mitomycin C, lomustine (CCNU), 1- methylnitrosourea, cyclophosphamide, mechlorethamine, busulfan, dibromomannitol, streptozotocin, mitomycin C, cis-dichlorodiamine platinum (II) (DDP) cisplatin and carboplatin (paraplatin);
  • cytotoxic agents including, but are not limited to, methotrexate, aminopterin, 6-mercaptopurine, 6- thioguanine,
  • anthracyclines include daunorubicin (formerly daunomycin), doxorubicin (adriamycin), detorubicin, carminomycin, idarubicin, epirubicin, mitoxantrone and bisantrene; antibiotics include dactinomycin (actinomycin D), bleomycin, calicheamicin, mithramycin, and anthramycin (AMC); and antimitotic agents such as the vinca alkaloids, vincristine and vinblastine.
  • cytotoxic agents include paclitaxel (TAXOL ® ), ricin, pseudomonas exotoxin, gemcitabine, cytochalasin B, gramicidin D, ethidium bromide, emetine, etoposide, teniposide, colchicine, dihydroxy anthracin dione, 1- dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, procarbazine, hydroxyurea, asparaginase, corticosteroids, mitotane (0,P'-(DDD)), interferons, and mixtures of these cytotoxic agents.
  • TAXOL ® paclitaxel
  • ricin pseudomonas exotoxin
  • gemcitabine cytochalasin B
  • gramicidin D ethidium bromide
  • emetine etoposide
  • teniposide
  • cytotoxic agents include, but are not limited to, chemotherapeutic agents such as carboplatin, cisplatin, paclitaxel, gemcitabine, calicheamicin, doxorubicin, 5-fluorouracil, mitomycin C, actinomycin D, cyclophosphamide, vincristine, bleomycin, VEGF antagonists, EGFR antagonists, platins, taxols, irinotecan, 5-fluorouracil, gemcitabine, leucovorin, steroids, cyclophosphamide, melphalan, vinca alkaloids ⁇ e.g., vinblastine, vincristine, vindesine and vinorelbine), mustines, tyrosine kinase inhibitors, radiotherapy, sex hormone antagonists, selective androgen receptor modulators, selective estrogen receptor modulators, PDGF antagonists, TNF antagonists, IL-1 antagonists, interleukins (e.g.
  • IL-12 or IL-2 IL-12R antagonists
  • Erbitux ® Erbitux ®
  • Avastin ® Pertuzumab
  • anti-CD20 antibodies Rituxan ®
  • ocrelizumab ofatumumab
  • DXL625, Herceptin ® Herceptin ®
  • Toxic enzymes from plants and bacteria such as ricin, diphtheria toxin and Pseudomonas toxin may be conjugated to the humanized antibodies, or binding fragments thereof, to generate cell- type-specific-killing reagents. Youle, et al. (1980) Proc. Nat'l Acad. Sci. USA 77: 5483; Gilliland, et al ( 1980) Proc.
  • cytotoxic agents include cytotoxic ribonucleases. See U.S. Patent No. 6,653,104.
  • the anti-IL-6 antibodies and antigen-binding fragments described herein may be conjugated to a radionuclide that emits alpha or beta particles (e.g., radioimmunoconjuagtes).
  • radioactive isotopes include but are not limited to beta-emitters such as phosphorus-32 ( 32 P), scandium-47 ( 47 Sc), copper-67 ( 67 Cu), gallium-67 ( 67 Ga), yttrium-88 ( 88 Y), yttrium-90 ( 90 Y), iodine-125 ( ,25 I), iodine-131 ( 13I I), samarium-153 ( 15 Sm), lutetium-177 ( 177 Lu), rhenium-186 ( ,86 Re), rhenium-188 ( 188 Re), and alpha-emitters such as astatine-21 1 ( 211 At), lead-212 ( 212 Pb), bismuth-212 ( 2,2 Bi), bismuth-213 ( 13 Bi)
  • the anti-IL-6 antibodies and antigen-binding fragments thereof described herein may be attached to a substrate.
  • substrates e.g., solid supports
  • the substrate may be modified to contain channels or other configurations. See Fung (2004) [Ed.] Protein Arrays: Methods and Protocols Humana Press and Kambhampati (2004) [Ed.] Protein Microarray Technology John Wiley & Sons.
  • Substrate materials include, but are not limited to acrylics, agarose, borosilicate glass, carbon (e.g., carbon nanofiber sheets or pellets), cellulose acetate, cellulose, ceramics, gels, glass (e.g., inorganic, control led-pore, modified, soda-lime, or functionalized glass), latex, magnetic beads, membranes, metal, metalloids, nitrocellulose, NYLON ® , optical fiber bundles, organic polymers, paper, plastics, polyacryloylmorpholide, poly(4-methylbutene), poly(ethylene terephthalate), poly(vinyl butyrate), polyacrylamide, polybutylene, polycarbonate, polyethylene, polyethyleneglycol terephthalate, polyformaldehyde, polymethacrylate, polymethylmethacrylate, polypropylene, polysaccharides, polystyrene, polyurethanes, polyvinylacetate, polyvinylchloride, polyvinyliden
  • Substrates need not be flat and can include any type of shape including spherical shapes (e.g., beads) or cylindrical shapes (e.g., fibers). Materials attached to solid supports may be attached to any portion of the solid support (e.g. , may be attached to an interior portion of a porous solid support material).
  • the substrate body may be in the form of a bead, box, column, cylinder, disc, dish (e.g., glass dish, PETRI dish), fiber, film, filter, microtiter plate (e.g., 96-well microtiter plate), multi-bladed stick, net, pellet, plate, ring, rod, roll, sheet, slide, stick, tray, tube, or vial.
  • dish e.g., glass dish, PETRI dish
  • microtiter plate e.g., 96-well microtiter plate
  • multi-bladed stick net, pellet, plate, ring, rod, roll, sheet, slide, stick, tray, tube, or vial.
  • the substrate may be a singular discrete body (e.g., a single tube, a single bead), any number of a plurality of substrate bodies (e.g, a rack of 10 tubes, several beads), or combinations thereof (e.g., a tray comprises a plurality of microtiter plates, a column filled with beads, a microtiter plate filed with beads).
  • a singular discrete body e.g., a single tube, a single bead
  • any number of a plurality of substrate bodies e.g, a rack of 10 tubes, several beads
  • a tray comprises a plurality of microtiter plates, a column filled with beads, a microtiter plate filed with beads.
  • An anti-IL-6 antibody or antigen-binding fragment thereof may be "attached" to a substrate when it is associated with the solid substrate through a non-random chemical or physical interaction.
  • the attachment may be through a covalent bond.
  • attachments need not be covalent or permanent.
  • Materials may be attached to a substrate through a "spacer molecule" or "linker group.”
  • spacer molecules are molecules that have a first portion that attaches to the biological material and a second portion that attaches to the substrate. Thus, when attached to the substrate, the spacer molecule separates the substrate and the biological materials, but is attached to both.
  • Methods of attaching biological material (e.g., label) to a substrate are well known in the art, and include but are not limited to chemical coupling.
  • Microtiter plates which support and contain the solid-phase for solid-phase synthetic reactions may be used.
  • Microtiter plates may house beads that are used as the solid-phase.
  • particle or “microparticle” or “nanoparticle” or “bead” or “microbead” or “microsphere” herein is meant microparticulate matter having any of a variety of shapes or sizes. The shape may be generally spherical but need not be spherical, being, for example, cylindrical or polyhedral.
  • the particles may comprise a wide variety of materials depending on their use, including, but not limited to, cross-linked starch, dextrans, cellulose, proteins, organic polymers including styrene polymers such as polystyrene and methylstyrene as well as other styrene co-polymers, plastics, glass, ceramics, acrylic polymers, magnetically responsive materials, colloids, thoriasol, carbon graphite, titanium dioxide, nylon, latex, and TEFLON ® . See e.g., "Microsphere Detection Guide” from Bangs Laboratories, Fishers, IN.
  • the anti-IL-6 antibody or antigen-binding fragment may be attached to on any of the forms of substrates described herein (e.g., bead, box, column, cylinder, disc, dish (e.g., glass dish, PETRI dish), fiber, film, filter, microtiter plate (e.g., 96-well microtiter plate), multi-bladed stick, net, pellet, plate, ring, rod, roll, sheet, slide, stick, tray, tube, or vial).
  • particles or beads may be a component of a gelling material or may be separate components such as latex beads made of a variety of synthetic plastics (e.g., polystyrene).
  • the label e.g., streptavidin
  • IL-6 IL-6 may be measured to assess the risk for psoriatic arthritis or the severity of psoriatic arthritis. These markers may be measured from serum, synovial fluid, or skin biopsies using known methods in the art (e.g., immunoassays).
  • Serum IL-6 levels may be measured as a pharmacodynamic marker evaluate the effect of neutralization of IL-6 levels.
  • Serum IL-6 levels may be measured using an immunoassay (e.g., ELISA assay). A decrease of serum IL-6 levels may be indicative of a lessening of inflammation.
  • Serum Inflammatory Biomarkers e.g., ELISA assay
  • Serum biomarkers may be measured to determine the expression of pro-inflammatory cytokines and other soluble biomarkers that may correlate with psoriatic arthritis (PsA) disease activity including but not limited to acute phase reactants, serum pro-inflammatory cytokines (e.g., IL-1, TNF-a, IFN- ⁇ , IL-12p40, IL-17), chemokines (e.g., RANTES, MlP-la, MCP-1), matrix metalloproteinases (e.g., MMP-2, MMP-3, MMP-9) and other biomarkers associated with inflammation and autoimmune pathways that are known in the art.
  • PsA psoriatic arthritis
  • Soluble biomarkers of bone and cartilage metabolism may also be assessed by an immunoassay (e.g., ELISA).
  • a decrease in a serum inflammatory biomarker may be indicative of a lessening of inflammation.
  • Skin biopsies may be collected for biomarker analysis including whole genome array analysis and immunohistochemistry (IHC).
  • Immunohistochemical analysis may include the measurement of epidermal thickness, frequency of resident and inflammatory cell populations (e.g., T cells, macrophages, and keratinocytes) and other inflammatory markers related to the IL-6 pathway known in the art. Specifically, the following specific antigens may be assessed per standard IHC procedure using the formalin-fixed samples: CD3, CD68, keratin 16, FoxP3, IL-6R and MMP-3. A decrease in an inflammatory biomarker in a skin biopsy may be indicative of a lessening of inflammation.
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments or variants thereof, as well as combinations of said antibody fragments or variants are administered to a subject at a concentration of between about 0.1 and 20 mg/kg, such as about 0.4 mg/kg, about 0.8 mg/kg, about 1.6 mg/kg, or about 4 mg/kg, of body weight of recipient subject.
  • compositions comprising the anti-IL-6 antibodies described herein may comprise at least about 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 mg.
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments or variants thereof, as well as combinations of said antibody fragments or variants are administered to a subject at a concentration of about 0.4 mg/kg of body weight of recipient subject.
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments or variants thereof, as well as combinations of said antibody fragments or variants are administered to a recipient subject with a frequency of once every twenty-six weeks or less, such as once every sixteen weeks or less, once every eight weeks or less, or once every four weeks, or less.
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments or variants thereof, as well as combinations thereof are administered to a recipient subject with a frequency at most once per period of approximately one week, such as at most once per period of approximately two weeks, such as at most once per period of approximately four weeks, such as at most once per period of approximately eight weeks, such as at most once per period of approximately twelve weeks, such as at most once per period of approximately sixteen weeks, such as at most once per period of approximately twenty-four weeks.
  • compositions described herein may be administered in any of the following routes: buccal, epicutaneous, epidural, infusion, inhalation, intraarterial, intracardial, intracerebroventricular, intradermal, intramuscular, intranasal, intraocular, intraperitoneal, intraspinal, intrathecal, intravenous, oral, parenteral, pulmonary, rectally via an enema or suppository, subcutaneous, subdermal, sublingual, transdermal, and transmucosal.
  • routes of administration are intravenous injection or infusion.
  • the administration can be local, where the composition is administered directly, close to, in the locality, near, at, about, or in the vicinity of, the site(s) of disease, e.g., local (joint) or systemic, wherein the composition is given to the patient and passes through the body widely, thereby reaching the site(s) of disease.
  • Local administration ⁇ e.g., subcutaneous injection
  • Administration can be topical with a local effect, composition is applied directly where its action is desired (e.g., joint).
  • administration of a composition comprising an effective amount of an anti-IL-6 antibody selected from the group consisting of Abl- Ab36 or an antigen-binding fragment thereof, may be subcutaneous.
  • the compounds can be administered by a variety of dosage forms as known in the art. Any biologically-acceptable dosage form known to persons of ordinary skill in the art, and combinations thereof, are contemplated. Examples of such dosage forms include, without limitation, chewable tablets, quick dissolve tablets, effervescent tablets,
  • Other compounds which can be included by admixture are, for example, medically inert ingredients (e.g. , solid and liquid diluent), such as lactose, dextrosesaccharose, cellulose, starch or calcium phosphate for tablets or capsules, olive oil or ethyl oleate for soft capsules and water or vegetable oil for suspensions or emulsions; lubricating agents such as silica, talc, stearic acid, magnesium or calcium stearate and/or polyethylene glycols; gelling agents such as colloidal clays; thickening agents such as gum tragacanth or sodium alginate, binding agents such as starches, arabic gums, gelatin, methylcellulose, carboxymethylcellulose or polyvinylpyrrolidone; disintegrating agents such as starch, alginic acid, alginates or sodium starch glycolate; effervescing mixtures; dyestuff; sweeteners; wetting agents such as lecithin
  • Liquid dispersions for oral administration can be syrups, emulsions, solutions, or suspensions.
  • the syrups can contain as a carrier, for example, saccharose or saccharose with glycerol and/or mannitol and/or sorbitol.
  • the suspensions and the emulsions can contain a carrier, for example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol.
  • kits including at least one container comprising pharmaceutical dosage units comprising an effective amount of at least one antibody and fragments thereof of the present subject technology.
  • Kits may include instructions, directions, labels, marketing information, warnings, or information pamphlets.
  • the amount of anti-IL-6 antibodies in a therapeutic composition may vary according to factors such as the disease state, age, gender, weight, patient history, risk factors, predisposition to disease, administration route, preexisting treatment regime (e.g., possible interactions with other medications), and weight of the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased as indicated by the exigencies of therapeutic situation.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of antibodies, or antigen-binding fragments thereof, calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the subject technology are dictated by and directly dependent on the unique characteristics of the antibodies, and fragments thereof, and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an antibodies, and fragments thereof, for the treatment of sensitivity in individuals.
  • therapeutic use for treatment of conditions in mammals e.g.
  • the antibodies and fragments thereof of the present subject technology may be administered in an effective amount.
  • the dosages as suitable for this subject technology may be a composition, a pharmaceutical composition or any other compositions described herein.
  • the dosage may be administered as a single dose, a double dose, a triple dose, a quadruple dose, and/or a quintuple dose.
  • the dosages may be administered singularly, simultaneously, and sequentially. For example, two doses may be administered on the same day followed by subsequent two doses four weeks later.
  • the dosage form may be any form of release known to persons of ordinary skill in the art.
  • the compositions of the present subject technology may be formulated to provide immediate release of the active ingredient or sustained or controlled release of the active ingredient. In a sustained release or controlled release preparation, release of the active ingredient may occur at a rate such that blood levels are maintained within a therapeutic range but below toxic levels over an extended period of time (e.g. , 4 to 24 hours).
  • the preferred dosage forms include immediate release, extended release, pulse release, variable release, controlled release, timed release, sustained release, delayed release, long acting, and combinations thereof, and are known in the art.
  • compositions comprising an anti-IL-6 antibodies or antigen-binding fragments thereof may be incorporated or encapsulated in a suitable polymer matrix or membrane for site- specific delivery, or may be functionalized with specific targeting agents capable of effecting site specific delivery.
  • suitable polymer matrix or membrane for site- specific delivery
  • specific targeting agents capable of effecting site specific delivery.
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments or variants thereof, as well as combinations of said antibody fragments or variants are administered to a subject in a pharmaceutical formulation.
  • a "pharmaceutical composition” refers to a chemical or biological composition suitable for administration to a mammal.
  • compositions may be specifically formulated for administration via at least one of a number of routes, including but not limited to buccal, epicutaneous, epidural, inhalation, intraarterial, intracardial, intracerebroventricular, intradermal, intramuscular, intranasal, intraocular, intraperitoneal, intraspinal, intrathecal, intravenous, oral, parenteral, rectally via an enema or suppository, subcutaneous, subdermal, sublingual, transdermal, and transmucosal.
  • routes including but not limited to buccal, epicutaneous, epidural, inhalation, intraarterial, intracardial, intracerebroventricular, intradermal, intramuscular, intranasal, intraocular, intraperitoneal, intraspinal, intrathecal, intravenous, oral, parenteral, rectally via an enema or suppository, subcutaneous, subdermal, sublingual, transdermal, and transmucosal.
  • administration can occur
  • the anti-IL-6 antibodies described herein, or IL-6 binding fragments or variants thereof, as well as combinations of said antibody fragments or variants may be optionally administered in combination with at least one active agent.
  • active agents include analgesic, antipyretic, anti-inflammatory, antibiotic, antiviral, and anti-cytokine agents.
  • Active agents include agonists, antagonists, and modulators of TN ⁇ -alpha, IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-18, WN-alpha, i -gamma, BAFF, CXCL13, IP- 10, VEGF, EPO, EGF, HRG, Hepatocyte Growth Factor (HGF), Hepcidin, including antibodies reactive against any of the foregoing, and antibodies reactive against any of their receptors. Active agents also include 2- Arylpropionic acids, Aceclofenac, Acemetacin, Acetylsalicylic acid (Aspirin), Alclofenac,
  • Alminoprofen Amoxiprin, Ampyrone, Arylalkanoic acids, Azapropazone, Benorylate/Benorilate, Benoxaprofen, Bromfenac, Carprofen, Celecoxib, Choline magnesium salicylate, Clofezone, COX-2 inhibitors, Dexibuprofen, Dexketoprofen, Diclofenac, Diflunisal, Droxicam, Ethenzamide, Etodolac, Etoricoxib, Faislamine, fenamic acids, Fenbufen, Fenoprofen, Flufenamic acid, Flunoxaprofen, Flurbiprofen, Ibuprofen, Ibuproxam, Indometacin, Indoprofen, ebuzone, Ketoprofen, Ketorolac, Lornoxicam, Loxoprofen, Lumiracoxib, Magnesium salicylate, Meclofenamic acid, Mefenamic acid, Mel
  • Roxithromycin Spectinomycin, Streptomycin, Sulfacetamide, Sulfamethizole, Sulfanilimide, Sulfasalazine, Sulfisoxazole, Sulfonamides, Teicoplanin, Telithromycin, Tetracycline, Tetracyclines, Ticarcillin, Tinidazole, Tobramycin, Trimethoprim, Trimethoprim-Sulfamethoxazole,
  • Troleandomycin Trovafloxacin, and Vancomycin. Active agents also include Aldosterone,
  • Betamethasone Corticosteroids, Cortisol, Cortisone acetate, Deoxycorticosterone acetate, Dexamethasone, Fludrocortisone acetate, Glucocorticoids, Hydrocortisone,
  • Antiviral agents include but are not limited to abacavir, aciclovir, acyclovir, adefovir, amantadine, amprenavir, an
  • an antiretroviral synergistic enhancer arbidol, atazanavir, atripla, brivudine, cidofovir, combivir, darunavir, delavirdine, didanosine, docosanol, edoxudine, efavirenz, emtricitabine, enfuvirtide, entecavir, entry inhibitors, famciclovir, fomivirsen,
  • a "pharmaceutical excipient” or a “pharmaceutically acceptable excipient” is a carrier, usually a liquid, in which an active therapeutic agent is formulated.
  • the active therapeutic agent is a humanized antibody described herein, or at least one fragments or variants thereof.
  • the excipient generally does not provide any pharmacological activity to the formulation, though it may provide chemical and/or biological stability, and release characteristics. Exemplary formulations can be found, for example, in Grennaro (2005) [Ed.]
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents that are physiologically compatible.
  • the carrier is suitable for parenteral administration.
  • the carrier can be suitable for intravenous, intraperitoneal, intramuscular, or sublingual administration.
  • Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is
  • compositions of the subject technology use thereof in the pharmaceutical compositions of the subject technology is contemplated.
  • Supplementary active compounds can also be incorporated into the compositions.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the subject technology contemplates that the pharmaceutical composition is present in lyophilized form.
  • the composition may be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • the carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.
  • the subject technology further contemplates the inclusion of a stabilizer in the pharmaceutical composition.
  • the antibodies and fragments thereof, of the present subject technology thereof may be formulated into pharmaceutical compositions of various dosage forms.
  • the antibody may be ALD518, a humanized anti-interleukin-6 (anti-IL-6) monoclonal immunoglobulin 1 (IgGl) antibody manufactured in the yeast Pichia pastoris.
  • ALD518 may be supplied as a pH 6.0 frozen injection in single-use vials (80 mg or 160 mg ) for intravenous administration.
  • Examplary non-active excipients include but are not limited to histidine (e.g., 25 mM) and sorbitol (e.g., 250 mM).
  • a 160 mg formulation may comprise as non-active excipients, 25 mM histidine, 250 mM sorbitol, and 0.015% polysorbate 80.
  • at least one anti-IL-6 antibodies or binding fragments thereof, as the active ingredient may be intimately mixed with appropriate carriers and additives according to techniques well known to those skilled in the art of pharmaceutical formulations. See Grennaro (2005) [Ed.] Remington: The Science and Practice of Pharmacy [21 st Ed.]
  • the antibodies described herein may be formulated in phosphate buffered saline pH 7.2 and supplied as a 5.0 mg/mL clear colorless liquid solution.
  • compositions for liquid preparations include solutions, emulsions, dispersions, suspensions, syrups, and elixirs, with suitable carriers and additives including but not limited to water, alcohols, oils, glycols, preservatives, flavoring agents, coloring agents, and suspending agents.
  • Typical preparations for parenteral administration comprise the active ingredient with a carrier such as sterile water or parenterally acceptable oil including but not limited to polyethylene glycol, polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil, with other additives for aiding solubility or preservation may also be included.
  • a carrier such as sterile water or parenterally acceptable oil including but not limited to polyethylene glycol, polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil, with other additives for aiding solubility or preservation may also be included.
  • a carrier such as sterile water or parenterally acceptable oil including but not limited to polyethylene glycol, polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil, with other additives for aiding solubility or preservation may also be included.
  • a solution it may be lyophilized to a powder and then reconstituted immediately prior to use.
  • any biologically-acceptable dosage form known to persons of ordinary skill in the art, and combinations thereof, are contemplated.
  • dosage forms include, without limitation, reconstitutable powders, elixirs, liquids, solutions, suspensions, emulsions, powders, granules, particles, microparticles, dispersible granules, cachets, inhalants, aerosol inhalants, patches, particle inhalants, implants, depot implants, injectables
  • isotonic agents e.g., sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, e.g. , monostearate salts and gelatin.
  • the compounds described herein may be formulated in a time release formulation, e.g. in a composition that includes a slow release polymer.
  • the anti-IL-6 antibodies may be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic copolymers (PLG). Many methods for the preparation of such formulations are known to those skilled in the art.
  • the administration formulation comprises, or alternatively consists of, about 10.5 mg/mL of antibody, 25 mM Histidine base, Phosphoric acid q.s. to pH 6, and 250 mM sorbitol.
  • the administration formulation comprises, or alternatively consists of, about 10.5 mg/mL of antibody, 12.5 mM Histidine base, 12.5 mM Histidine HC1 (or 25 mM Histidine base and Hydrochloric acid q.s. to pH 6), 250 mM sorbitol, and 0.015% (w/w) Polysorbate 80.
  • the administration formulation comprises, or alternatively consists of, about 50 or 100 mg/mL of antibody, about 5 mM Histidine base, about 5 mM Histidine HC1 to make final pH 6, 250 mM sorbitol, and 0.015% (w/w) Polysorbate 80.
  • the administration formulation comprises, or alternatively consists of, about 20 or 100 mg/mL of antibody, about 5 mM Histidine base, about 5 mM Histidine HC1 to make final pH 6, 250 to 280 niM sorbitol (or sorbitol in combination with sucrose), and 0.015% (w/w) Polysorbate 80, said formulation having a nitrogen headspace in the shipping vials.
  • compositions typically must be sterile and stable under the conditions of manufacture and storage.
  • the subject technology contemplates that the pharmaceutical composition is present in lyophilized form.
  • the composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.
  • the subject technology further contemplates the inclusion of a stabilizer in the pharmaceutical composition.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
  • the alkaline polypeptide can be formulated in a time release formulation, for example in a composition which includes a slow release polymer.
  • the active compounds can be prepared with carriers that will protect the compound against rapid release, such as a controlled release formulation, including implants and
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid and polylactic, polyglycolic copolymers (PLG). Many methods for the preparation of such formulations are known to those skilled in the art.
  • the compounds can be administered by a variety of dosage forms. Any biologically-acceptable dosage form known to persons of ordinary skill in the art, and combinations thereof, are contemplated. Examples of such dosage forms include, without limitation, reconstitutable powders, elixirs, liquids, solutions, suspensions, emulsions, powders, granules, particles, microparticles, dispersibie granules, cachets, inhalants, aerosol inhalants, patches, particle inhalants, implants, depot implants, injectables (including subcutaneous, intramuscular, intravenous, and intradermal), infusions, and combinations thereof.
  • the term “Abl” refers to an antibody comprising the light chain sequence of SEQ ID NO: 702 and the heavy chain sequence of SEQ ID NO: 704, except where the context indicates otherwise.
  • the laboratory designation “Abl” also encompasses an anti-IL-6 antibody also known as “clazakizumab,” “ALD518” and “BMS-945429” comprising the light chain sequence of SEQ ID NO: 19 and the heavy chain sequence of SEQ ID NO: 20.
  • Panels of antibodies are derived by immunizing traditional antibody host animals to exploit the native immune response to a target antigen of interest.
  • the host used for immunization is a rabbit or other host that produces antibodies using a similar maturation process and provides for a population of antigen-specific B cells producing antibodies of comparable diversity, e.g., epitopic diversity.
  • the initial antigen immunization can be conducted using complete Freund's adjuvant (CFA), and the subsequent boosts effected with incomplete adjuvant.
  • CFA complete Freund's adjuvant
  • the subsequent boosts effected with incomplete adjuvant.
  • antibody titers are tested, and the Antibody Selection (ABS) process is initiated if appropriate titers are established.
  • ABS Antibody Selection
  • B cell sources include: the spleen, lymph nodes, bone marrow, and peripheral blood mononuclear cells (PBMCs). Single cell suspensions are generated, and the cell suspensions are washed to make them compatible for low temperature long term storage. The cells are then typically frozen.
  • PBMCs peripheral blood mononuclear cells
  • Enriched B cells produced according to Example 1 are then plated at varying cell densities per well in a 96 well microtiter plate. Generally, this is at 50, 100, 250, or 500 cells per well with 10 plates per group. The media is supplemented with 4% activated rabbit T cell conditioned media along with 50K frozen irradiated EL4B feeder cells. These cultures are left undisturbed for 5-7 days at which time supernatant-containing secreted antibody is collected and evaluated for target properties in a separate assay setting. The remaining supernatant is left intact, and the plate is frozen at -70°C.
  • the culture process typically results in wells containing a mixed cell population that comprises a clonal population of antigen-specific B cells, i.e., a single well will only contain a single monoclonal antibody specific to the desired antigen.
  • Antibody-containing supernatants derived from the well containing a clonal antigen-specific B cell population produced according to Example 2 are initially screened for antigen recognition using EL1SA methods. This includes selective antigen immobilization (e.g., biotinylated antigen capture by streptavidin coated plate), non-specific antigen plate coating, or alternatively, through an antigen build-up strategy (e.g., selective antigen capture followed by binding partner addition to generate a heteromeric protein-antigen complex). Antigen-positive well supernatants are then optionally tested in a function-modifying assay that is strictly dependant on the ligand.
  • selective antigen immobilization e.g., biotinylated antigen capture by streptavidin coated plate
  • non-specific antigen plate coating e.g., antigen build-up strategy
  • Antigen-positive well supernatants are then optionally tested in a function-modifying assay that is strictly dependant on the ligand.
  • One such example is an in vitro protein-protein interaction assay that recreates the natural interaction of the antigen ligand with recombinant receptor protein.
  • a cell-based response that is ligand dependent and easily monitored (e.g., proliferation response) is utilized.
  • Supernatant that displays significant antigen recognition and potency is deemed a positive well.
  • Cells derived from the original positive well are then transitioned to the antibody recovery phase.
  • Cells are isolated from a well that contains a clonal population of antigen-specific B cells (produced according to Example 2 or 3), which secrete a single antibody sequence. The isolated cells are then assayed to isolate a single, antibody-secreting cell. Dynal® (magnetic beads) streptavidin beads are coated with biotinylated target antigen under buffered medium to prepare antigen- containing microbeads compatible with cell viability.
  • FlTC fluorescein isothiocyanate
  • the host can be any mammalian host, e.g., rabbit, mouse, rat
  • FlTC fluorescein isothiocyanate
  • the host can be any mammalian host, e.g., rabbit, mouse, rat
  • This mixture is then re-pipetted in aliquots onto a glass slide such that each aliquot has on average a single, antibody-producing B-cell.
  • the antigen-specific, antibody-secreting cells are then detected through fluorescence microscopy. Secreted antibody is locally concentrated onto the adjacent beads due to the bound antigen and provides localization information based on the strong fluorescent signal.
  • Antibody-secreting cells are identified via FITC detection of antibody-antigen complexes formed adjacent to the secreting cell.
  • the single cell found in the center of this complex is then recovered using a micromanipulator.
  • the cell is snap-frozen in an Eppendorf PCR tube for storage at -80°C until antibody sequence recovery is initiated.
  • Antibody sequences are recovered using a combined RT-PCR based method from a single isolated B-cell produced according to Example 4 or an antigenic specific B cell isolated from the clonal B cell population obtained according to Example 2.
  • Primers are designed to anneal in conserved and constant regions of the target immunoglobulin genes (heavy and light), such as rabbit immunoglobulin sequences, and a two-step nested PCR recovery step is used to obtain the antibody sequence. Amplicons from each well are analyzed for recovery and size integrity. The resulting fragments are then digested with Alul to fingerprint the sequence clonality. Identical sequences display a common fragmentation pattern in their electrophoretic analysis.
  • the antibodies have high affinity towards IL-6 (single to double digit pM Kd) and demonstrate potent antagonism of IL-6 in multiple cell-based screening systems (Tl 165 and HepG2). Furthermore, the collection of antibodies displays distinct modes of antagonism toward IL- 6-driven processes.
  • Antigen recognition was determined by coating Immulon 4 plates (Thermo) with 1 ⁇ g/mL of huIL-6 (50 ⁇ /well) in phosphate buffered saline (PBS, Hyclone) overnight at 4 °C. On the day of the assay, plates were washed 3 times with PBS /Tween 20 (PBST tablets, Calbiochem). Plates were then blocked with 200 jiL/well of 0.5% fish skin gelatin (FSG, Sigma) in PBS for 30 minutes at 37°C. Blocking solution was removed, and plates were blotted.
  • PBS phosphate buffered saline
  • Serum samples were made (bleeds and pre- bleeds) at a starting dilution of 1 : 100 (all dilutions were made in FSG 50 ⁇ ⁇ ) followed by 1 : 10 dilutions across the plate (column 12 was left blank for background control). Plates were incubated for 30 minutes at 37°C. Plates were washed 3 times with PBS/Tween 20. Goat anti-rabbit Fc-HRP (Pierce) diluted 1 :5000 was added to all wells (50 ⁇ ), and plates were incubated for 30 minutes at 37°C. Plates were washed as described above.
  • TMB-Stable stop (Fitzgerald Industries) was added to plates, and color was allowed to develop, generally for 3 to 5 minutes. The development reaction was stopped with 50 ⁇ 0.5 M HC1. Plates were read at 450 nm. Optical density (OD) versus dilution was plotted using Graph Pad Prizm software, and titers were determined. Functional Titer Assessment
  • Tl 165 proliferation assay The functional activity of the samples was determined by a Tl 165 proliferation assay.
  • Tl 165 cells were routinely maintained in modified RPMI medium (Hyclone) supplemented with HEPES, sodium pyruvate, sodium bicarbonate, L-glutamine, high glucose, penicillin/streptomycin, 10% heat inactivated fetal bovine serum (FBS) (all supplements from Hyclone), 2-mercaptoethanol (Sigma), and 10 ng/mL of huIL-6 (R&D).
  • FBS heat inactivated fetal bovine serum
  • R&D 2-mercaptoethanol
  • cell viability was determined by trypan blue (Invitrogen), and cells were seeded at a fixed density of 20,000 cells/well. Prior to seeding, cells were washed twice in the medium described above without human-IL-6 (by
  • Spleen and lymph nodes were processed into a single cell suspension by disassociating the tissue and pushing through sterile wire mesh at 70 ⁇ (Fisher) with a plunger of a 20 cc syringe.
  • Cells were collected in the modified RPMI medium described above without huIL-6, but with low glucose. Cells were washed twice by centrifugation. After the last wash, cell density was determined by trypan blue. Cells were centrifuged at 1500 rpm for 10 minutes; the supernatant was discarded. Cells were resuspended in the appropriate volume of 10% dimethyl sulfoxide (DMSO, Sigma) in FBS (Hyclone) and dispensed at 1 mL/vial. Vials were then stored at -70 °C for 24 h prior to being placed in a liquid nitrogen (LN2) tank for long-term storage.
  • DMSO dimethyl sulfoxide
  • PBMCs Peripheral blood mononuclear cells
  • Cells were washed twice with the modified medium described above by centrifugation at 1500 rpm for 10 minutes at room temperature, and cell density was determined by trypan blue staining. After the last wash, cells were resuspended in an appropriate volume of 10% DMSO FBS medium and frozen as described herein.
  • PBMC, splenocyte, or lymph node vials were thawed for use. Vials were removed from LN2 tank and placed in a 37°C water bath until thawed. Contents of vials were transferred into 15 mL conical centrifuge tube (Corning) and 10 mL of modified RPMI described above was slowly added to the tube. Cells were centrifuged for 5 minutes at 1.5 rpm, and the supernatant was discarded. Cells were resuspended in 10 mL of fresh media. Cell density and viability was determined by trypan blue. Cells were washed again and resuspended at 1 E07 cells/80 medium.
  • Biotinylated huIL-6 (B huIL-6) was added to the cell suspension at the final concentration of 3 ⁇ g/mL and incubated for 30 minutes at 4°C. Unbound B huIL-6 was removed with two 10 mL washes of phosphate-buffered (PBF): Ca/Mg free PBS (Hyclone), 2 mM
  • EDTA ethylenediamine tetraacetic acid
  • BSA bovine serum albumin
  • a pilot cell screen was established to provide information on seeding levels for the culture.
  • Three 10-plate groups (a total of 30 plates) were seeded at 50, 100, and 200 enriched B cells/well.
  • each well contained 50K cells/well of irradiated EL-4.B5 cells (5,000 Rads) and an appropriate level of T cell supernatant (ranging from 1-5% depending on preparation) in high glucose modified RPMI medium at a final volume of 250 ⁇ . Cultures were incubated for 5 to 7 days at 37 °C in 4% C0 2 .
  • the ELISA format used is as described above except 50 i of supernatant from the B cell cultures (BCC) wells (all 30 plates) was used as the source of the antibody. The conditioned medium was transferred to antigen-coated plates. After positive wells were identified, the supernatant was removed and transferred to a 96-well master plate(s). The original culture plates were then frozen by removing all the supernatant except 40 ⁇ and adding 60 ⁇ ⁇ of 16% DMSO in FBS. Plates were wrapped in paper towels to slow freezing and placed at -70 °C.
  • Plates containing wells of interest were removed from -70 °C, and the cells from each well were recovered with 5-200 washes of medium/well. The washes were pooled in a 1.5 mL sterile centrifuge tube, and cells were pelleted for 2 minutes at 1500 rpm.
  • Specific B cells that produce antibody can be identified by the fluorescent ring around them due to antibody secretion, recognition of the bead-associated biotinylated antigen, and subsequent detection by the fluorescent-lgG detection reagent. Once a cell of interest was identified, the cell in the center of the fluorescent ring was recovered via a micromanipulator (Eppendorf). The single cell synthesizing and exporting the antibody was transferred into a 250 ⁇ . microcentrifuge tube and placed in dry ice. After recovering all cells of interest, these were transferred to -70°C for long-term storage.
  • Antibody genes Genes were cloned and constructed that directed the synthesis of a chimeric humanized rabbit monoclonal antibody.
  • Expression vector contains the following functional components: 1) a mutant ColEl origin of replication, which facilitates the replication of the plasmid vector in cells of the bacterium Escherichia coli; 2) a bacterial Sh ble gene, which confers resistance to the antibiotic Zeocin® (phleomycin) and serves as the selectable marker for transformations of both E. coli and P. pastoris; 3) an expression cassette composed of the glyceraldehyde dehydrogenase gene ⁇ GAP gene) promoter, fused to sequences encoding the Saccharomyces cerevisiae alpha mating factor pre pro secretion leader sequence, followed by sequences encoding a P. pastoris transcriptional termination signal from the P.
  • the Zeocin® (phleomycin) resistance marker gene provides a means of enrichment for strains that contain multiple integrated copies of an expression vector in a strain by selecting for transformants that are resistant to higher levels of Zeocin® (phleomycin).
  • P. pastoris strains P. pastoris strains metl, lys3, ura3 and adel may be used. Although any two complementing sets of auxotrophic strains could be used for the construction and maintenance of diploid strains, these two strains are especially suited for this method for two reasons. First, they grow more slowly than diploid strains that are the result of their mating or fusion. Thus, if a small number of haploid adel or ura3 cells remain present in a culture or arise through meiosis or other mechanism, the diploid strain should outgrow them in culture.
  • AGCGCTTATTCCGCTATCCAGATGACCCAGTC-the Afel site is single underlined (SEQ ID NO: 729).
  • the end of the HSA signal sequence is double underlined, followed by the sequence for the mature variable light chain (not underlined); the reverse CGTACGTTTGATTTCCACCTTG (SEQ ID NO: 730).
  • Variable light chain reverse primer BsiWI site is underlined, followed by the reverse complement for the 3' end of the variable light chain.
  • restriction enzyme digest with Afel and BsiWI this enable insertion in-frame with the pGAPZ vector using the human HAS leader sequence in frame with the human kapp light chain constant region for export.
  • a similar strategy is performed for the heavy chain.
  • the forward primer employed is
  • AGCGCTTATTCCGAGGTGCAGCTGGTGGAGTC (SEQ ID NO: 731).
  • the Afel site is single underlined.
  • the end of the HSA signal sequence is double underlined, followed by the sequence for the mature variable heavy chain (not underlined).
  • the reverse heavy chain primer is CTCGAGACGGTGACGAGGGT (SEQ ID NO: 732).
  • the Xhol site is underlined, followed by the reverse complement for the 3 ' end of the variable heavy chain. This enables cloning of the heavy chain in-frame with IgG- ⁇ CH1-CH2-CH3 region previous inserted within pGAPZ using a comparable directional cloning strategy.
  • each expression vector Prior to transformation, each expression vector is linearized within the GAP promoter sequences with Avrll to direct the integration of the vectors into the GAP promoter locus of the P. pastoris genome. Samples of each vector are then individually transformed into electrocompetent cultures of the adel, ura3, metl and lys3 strains by electroporation and successful transformants are selected on YPD Zeocin® (phleomycin) plates by their resistance to this antibiotic.
  • Resulting colonies are selected, streaked for single colonies on YPD Zeocin® (phleomycin) plates and then examined for the presence of the antibody gene insert by a PGR assay on genomic DNA extracted from each strain for the proper antibody gene insert and/or by the ability of each strain to synthesize an antibody chain by a colony lift/immunoblot method.
  • Haploid adel, metl and lys3 strains expressing one of the three heavy chain constructs are collected for diploid constructions along with haploid ura3 strain expressing light chain gene.
  • the haploid expressing heavy chain genes are mated with the appropriate light chain haploid ura3 to generate diploid secreting protein.
  • the cross-streaked replica plated cells are then transferred to a mating plate and incubated at 25°C to stimulate the initiation of mating between strains. After two days, the cells on the mating plates are transferred again to a sterile velvet on a replica-plating block and then transferred to minimal medium plates. These plates are incubated at 30°C for three days to allow for the selective growth of colonies of prototrophic diploid strains. Colonies that arose are picked and streaked onto a second minimal medium plate to single colony isolate and purify each diploid strain. The resulting diploid cell lines are then examined for antibody production. [0466] Putative diploid strains are tested to demonstrate that they are diploid and contain both expression vectors for antibody production.
  • diploid strains For diploidy, samples of a strain are spread on mating plates to stimulate them to go through meiosis and form spores. Haploid spore products are collected and tested for phenotype. If a significant percentage of the resulting spore products are single or double auxotrophs it may be concluded that the original strain must have been diploid. Diploid strains are examined for the presence of both antibody genes by extracting genomic DNA from each and utilizing this DNA in PCR reactions specific for each gene.
  • Resulting colonies are picked from the agar, streaked onto a minimal medium plate, and the plates are incubated for two days at 30°C to generate colonies from single cells of diploid cell lines. The resulting putative diploid cell lines are then examined for diploidy and antibody production as described above.
  • a diploid strain for the production of full length antibody is derived through the mating of metl light chain and lys3 heavy chain using the methods described above.
  • Culture media from shake-flask or fermenter cultures of diploid P. pastoris expression strains are collected and examined for the presence of antibody protein via SDS-PAGE and immunoblotting using antibodies directed against heavy and light chains of human IgG, or specifically against the heavy chain of IgG.
  • Assay for antibody activity The recombinant yeast-derived humanized antibody is evaluated for functional activity through the IL-6 driven Tl 165 cell proliferation assay and IL-6 stimulated HepG2 haptoglobin assay described above.
  • Human IL-6 can provoke an acute phase response in rats, and one of the major acute phase proteins that is stimulated in the rat is alpha-2 macroglobulin (A2M).
  • A2M alpha-2 macroglobulin
  • Plasma was recovered and the A2M was quantitated via a commercial sandwich ELISA kit (ICL Inc., Newberg OR; cat. no.- E-25A2M). The endpoint was the difference in the plasma concentration of A2M at the 24 hour time point (post-Abl).
  • the ID50 for antibody Abl was 0.1 mg/kg with complete suppression of the A2M response at the 0.3 mg/kg. This demonstrates that the IL-6 may be neutralized in vivo by anti-IL-6 antibodies described herein.
  • Antibody Abl was dosed in a single bolus infusion to a single male and single female cynomolgus monkey in phosphate buffered saline. Plasma samples were removed at fixed time intervals and the level of antibody Abl was quantitated through of the use of an antigen capture ELISA assay. Biotinylated IL-6 (50 ⁇ of 3 ⁇ g/mL) was captured on Streptavidin coated 96 well microtiter plates. The plates were washed and blocked with 0.5% Fish skin gelatin. Appropriately diluted plasma samples were added and incubated for 1 hour at room temperature. The supernatants removed and an anti-hFc-HRP conjugated secondary antibody applied and left at room temperature.
  • This humanized full length aglycosylated antibody expressed and purified Pichia pastoris displays comparable characteristics to mammalian expressed protein.
  • multiple doses of this product display reproducible half-lives inferring that this production platform does not generate products that display enhanced immunogenicity.
  • IL-6 signaling is dependent upon interactions between IL-6 and two receptors, IL-6R1 (CD126) and gpl30 (IL-6 signal transducer).
  • IL-6R1 CD126
  • gpl30 IL-6 signal transducer
  • biotinylated IL-6 (R&D systems part number 206-IL-OOl MG/CF, biotinylated using Pierce EZ-link sulfo-NHS-LC-LC-biotin product number 21338 according to manufacturer's protocols) was initially bound to a streptavidin coated biosensor (ForteBio part number 18-5006). Binding is monitored as an increase in signal. [0477] The IL-6 bound to the sensor was then incubated either with the antibody in question or diluent solution alone. The sensor was then incubated with soluble IL-6R1 (R&D systems product number 227-SR-025/CF) molecule.
  • IL-6R1 If the IL-6R1 molecule failed to bind, the antibody was deemed to block IL-6/IL-6R1 interactions. These complexes were incubated with gpl30 (R&D systems 228- GP-010/CF) in the presence of IL-6R1 for stability purposes. If gp 130 did not bind, it was concluded that the antibody blocked gpl 30 interactions with IL-6.
  • the antibody was bound to a biosensor coated with an anti-human IgGl Fc-specific reagent (ForteBio part number 18-5001 ).
  • the IL-6 was bound to the immobilized antibody and the sensor was incubated with IL-6R1. If the IL-6R1 did not interact with the IL-6, then it was concluded that the IL-6 binding antibody blocked IL-6/IL-6R1 interactions. In those situations where antibody /IL-6/IL-6R1 was observed, the complex was incubated with gpl30 in the presence of IL-6R1. If gpl30 did not interact, then it was concluded that the antibody blocked IL-6/gpl30 interactions.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des procédés thérapeutiques d'utilisation d'un anticorps, ou d'un fragment liant l'antigène de celui-ci, qui lie sélectivement IL-6 pour le traitement ou la prévention de la polyarthrite psoriasique et pour la prise en charge des effets secondaires et des symptômes de la polyarthrite psoriasique et des compositions thérapeutiques destinées à être utilisées dans le cadre desdits procédés et comprenant un anticorps, un fragment liant l'antigène de celui-ci, qui lie sélectivement IL-6 pour le traitement ou la prévention de la polyarthrite psoriasique.
PCT/US2014/059543 2013-10-07 2014-10-07 Anticorps anti-il-6 pour le traitement de la polyarthrite psoriasique WO2015054293A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/876,376 US20160130340A1 (en) 2013-10-07 2015-10-06 Dosing regimens using anti-il-6 antibodies for the treatment of rheumatoid and psoriatic arthritis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361887666P 2013-10-07 2013-10-07
US61/887,666 2013-10-07

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/876,376 Continuation-In-Part US20160130340A1 (en) 2013-10-07 2015-10-06 Dosing regimens using anti-il-6 antibodies for the treatment of rheumatoid and psoriatic arthritis

Publications (1)

Publication Number Publication Date
WO2015054293A1 true WO2015054293A1 (fr) 2015-04-16

Family

ID=52813586

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/059543 WO2015054293A1 (fr) 2013-10-07 2014-10-07 Anticorps anti-il-6 pour le traitement de la polyarthrite psoriasique

Country Status (1)

Country Link
WO (1) WO2015054293A1 (fr)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9701747B2 (en) 2007-05-21 2017-07-11 Alderbio Holdings Llc Method of improving patient survivability and quality of life by anti-IL-6 antibody administration
US9717793B2 (en) 2009-11-24 2017-08-01 Alderbio Holdings Llc Method of improving patient survivability and quality of life by administering an anti-IL-6 antibody
US9725509B2 (en) 2007-05-21 2017-08-08 Alderbio Holdings Llc Expression vectors containing isolated nucleic acids encoding anti-human IL-6 antibody
US9765138B2 (en) 2008-11-25 2017-09-19 Alderbio Holdings Llc Isolated anti-IL-6 antibodies
US9771421B2 (en) 2007-05-21 2017-09-26 Alderbio Holdings Llc Treating anemia in chronic IL-6 associated diseases using anti-IL-6 antibodies
US9775921B2 (en) 2009-11-24 2017-10-03 Alderbio Holdings Llc Subcutaneously administrable composition containing anti-IL-6 antibody
US9834603B2 (en) 2007-05-21 2017-12-05 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US9879074B2 (en) 2008-11-25 2018-01-30 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US9926370B2 (en) 2007-05-21 2018-03-27 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat thrombosis
US9957321B2 (en) 2010-11-23 2018-05-01 Alderbio Holdings Llc Anti-IL-6 antibodies for the treatment of oral mucositis
US9994635B2 (en) 2008-11-25 2018-06-12 Alderbio Holdings Llc Antagonists of IL-6 to raise albumin and/or lower CRP
US10040851B2 (en) 2007-05-21 2018-08-07 Alderbio Holdings Llc Antagonists to IL-6 to raise albumin and/or lower CRP
US10053506B2 (en) 2008-11-25 2018-08-21 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat cachexia, weakness, fatigue, and/or fever
US10093732B2 (en) 2008-11-25 2018-10-09 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat thrombosis
US10117955B2 (en) 2008-11-25 2018-11-06 Alderbio Holdings Llc Methods of aiding in the diagnosis of diseases using anti-IL-6 antibodies
US10160804B2 (en) 2007-05-21 2018-12-25 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat cachexia, weakness, fatigue, and/or fever

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040028681A1 (en) * 2000-10-25 2004-02-12 Hiroaki Ito Preventives or remedies for psoriasis containing as the active ingredient il-6 antagonist
WO2010065079A2 (fr) * 2008-11-25 2010-06-10 Alder Biopharmaceuticals, Inc. Anticorps anti-il-6 et utilisation desdits
US8062866B2 (en) * 2008-11-13 2011-11-22 Femta Pharmaceuticals, Inc. Humanized anti-IL-6 antibodies

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040028681A1 (en) * 2000-10-25 2004-02-12 Hiroaki Ito Preventives or remedies for psoriasis containing as the active ingredient il-6 antagonist
US8062866B2 (en) * 2008-11-13 2011-11-22 Femta Pharmaceuticals, Inc. Humanized anti-IL-6 antibodies
WO2010065079A2 (fr) * 2008-11-25 2010-06-10 Alder Biopharmaceuticals, Inc. Anticorps anti-il-6 et utilisation desdits

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
OGATA ET AL.: "Pathological Role of Interleukin-6 in Psoriatic Arthritis", ARTHRITIS, vol. 2012, 11 October 2011 (2011-10-11), pages 1 - 7 *
OGATA ET AL.: "Psoriatic arthritis in two patients with an inadequate response to treatment with tociizumab", JOINT BONE SPINE, vol. 79, no. ISS. 1, 1 January 2012 (2012-01-01), pages 85 - 87 *

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10759853B2 (en) 2007-05-21 2020-09-01 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US9771421B2 (en) 2007-05-21 2017-09-26 Alderbio Holdings Llc Treating anemia in chronic IL-6 associated diseases using anti-IL-6 antibodies
US9725509B2 (en) 2007-05-21 2017-08-08 Alderbio Holdings Llc Expression vectors containing isolated nucleic acids encoding anti-human IL-6 antibody
US10913794B2 (en) 2007-05-21 2021-02-09 Vitaeris Inc. Antibodies to IL-6 and use thereof
US10160804B2 (en) 2007-05-21 2018-12-25 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat cachexia, weakness, fatigue, and/or fever
US10800841B2 (en) 2007-05-21 2020-10-13 Vitaeris, Inc. Methods of treating autoimmunity using specific anti-IL-6 antibodies
US11827700B2 (en) 2007-05-21 2023-11-28 Vitaeris Inc. Treatment or prevention of diseases and disorders associated with cells that express IL-6 with Anti-IL-6 antibodies
US10787507B2 (en) 2007-05-21 2020-09-29 Vitaeris Inc. Antagonists of IL-6 to prevent or treat thrombosis
US9758579B2 (en) 2007-05-21 2017-09-12 Alder Bioholdings, Llc Nucleic acids encoding anti-IL-6 antibodies of defined epitopic specificity
US9834603B2 (en) 2007-05-21 2017-12-05 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US9701747B2 (en) 2007-05-21 2017-07-11 Alderbio Holdings Llc Method of improving patient survivability and quality of life by anti-IL-6 antibody administration
US9884912B2 (en) 2007-05-21 2018-02-06 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US9926370B2 (en) 2007-05-21 2018-03-27 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat thrombosis
US10344086B2 (en) 2007-05-21 2019-07-09 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US10233239B2 (en) 2007-05-21 2019-03-19 Alderbio Holdings Llc Isolated host cells expressing anti-IL-6 antibodies
US10040851B2 (en) 2007-05-21 2018-08-07 Alderbio Holdings Llc Antagonists to IL-6 to raise albumin and/or lower CRP
US10640560B2 (en) 2008-11-25 2020-05-05 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat cachexia, weakness, fatigue, and /or fever
US10787511B2 (en) 2008-11-25 2020-09-29 Vitaeris Inc. Antagonists of IL-6 to raise albumin and/or lower CRP
US10117955B2 (en) 2008-11-25 2018-11-06 Alderbio Holdings Llc Methods of aiding in the diagnosis of diseases using anti-IL-6 antibodies
US10053506B2 (en) 2008-11-25 2018-08-21 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat cachexia, weakness, fatigue, and/or fever
US9994635B2 (en) 2008-11-25 2018-06-12 Alderbio Holdings Llc Antagonists of IL-6 to raise albumin and/or lower CRP
US10858424B2 (en) 2008-11-25 2020-12-08 Alderbio Holdings Llc Anti-IL-6 antibodies for the treatment of arthritis
US10093732B2 (en) 2008-11-25 2018-10-09 Alderbio Holdings Llc Antagonists of IL-6 to prevent or treat thrombosis
US9879074B2 (en) 2008-11-25 2018-01-30 Alderbio Holdings Llc Antibodies to IL-6 and use thereof
US9765138B2 (en) 2008-11-25 2017-09-19 Alderbio Holdings Llc Isolated anti-IL-6 antibodies
US10391169B2 (en) 2009-07-28 2019-08-27 Alderbio Holdings Llc Method of treating allergic asthma with antibodies to IL-6
US10471143B2 (en) 2009-11-24 2019-11-12 Alderbio Holdings Llc Antagonists of IL-6 to raise albumin and/or lower CRP
US9775921B2 (en) 2009-11-24 2017-10-03 Alderbio Holdings Llc Subcutaneously administrable composition containing anti-IL-6 antibody
US9821057B2 (en) 2009-11-24 2017-11-21 Alderbio Holdings Llc Anti-IL-6 antibody for use in the treatment of cachexia
US9724410B2 (en) 2009-11-24 2017-08-08 Alderbio Holdings Llc Anti-IL-6 antibodies or fragments thereof to treat or inhibit cachexia, associated with chemotherapy toxicity
US9717793B2 (en) 2009-11-24 2017-08-01 Alderbio Holdings Llc Method of improving patient survivability and quality of life by administering an anti-IL-6 antibody
US9957321B2 (en) 2010-11-23 2018-05-01 Alderbio Holdings Llc Anti-IL-6 antibodies for the treatment of oral mucositis

Similar Documents

Publication Publication Date Title
US10858424B2 (en) Anti-IL-6 antibodies for the treatment of arthritis
US20210332126A1 (en) Anti-il-6 antibodies for the treatment of oral mucositis
US10471143B2 (en) Antagonists of IL-6 to raise albumin and/or lower CRP
EP2361096B1 (fr) Anticorps il-6 pour prévenir ou traiter la cachexie
WO2015054293A1 (fr) Anticorps anti-il-6 pour le traitement de la polyarthrite psoriasique
US8420089B2 (en) Antagonists of IL-6 to raise albumin and/or lower CRP
US20160130340A1 (en) Dosing regimens using anti-il-6 antibodies for the treatment of rheumatoid and psoriatic arthritis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14852131

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14852131

Country of ref document: EP

Kind code of ref document: A1