WO2015053624A2 - Antisense oligonucleotide directed removal of proteolytic cleavage sites, the hchwa-d mutation, and trinucleotide repeat expansions - Google Patents

Abstract

The invention relates to means and methods for removing a proteolytic cleavage site, the HCHWA-D mutation or the amino acids encoded by a trinucleotide repeat expansion from a protein comprising providing a cell that expresses pre-m RNA encoding said protein with an anti-sense oligonucleotide that induces skipping of the exonic sequence that comprises said proteolytic cleavage site, HCHWA-D mutation or trinucleotide repeat expansion, respectively, the method further comprising allowing translation of m RNA produced from said pre-m RNA.

Description

Antisense oligonucleotide directed removal of proteolytic cleavage sites, the HCHWA-D mutation, and trinucleotide repeat expansions

The invention relates to the field of genetic and acquired diseases. The invention in particular relates to the alteration of mRNA processing of specific pre-mRNA to remove a proteolytic cleavage site, the HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion from a protein encoded by said pre-mRNA.

Proteolytic processing is a major form of post translational modification which occurs when a protease cleaves one or more bonds in a target protein to modify its activity. This processing may lead to activation, inhibition, alteration or destruction of the protein's activity. Many cellular processes are controlled by proteolytic processing. The attacking protease may remove a peptide segment from either end of the target protein, but it may also cleave internal bonds in the protein that lead to major changes in the structure and function of the protein.

Proteolytic processing is a highly specific process. The mechanism of proteolytic processing varies according to the protein being processed, location of the protein, and the protease. Proteolytic processing can have various functions. For instance, proteolysis of precursor proteins regulates many cellular processes including gene expression, embryogenesis, the cell cycle, programmed cell death, intracellular protein targeting and endocrine/neural functions. In all of these processes, proteolytic cleavage of precursor proteins is necessary. The proteolysis is often done by serine proteases in the secretory pathways. These proteases are calcium dependent serine endoproteases and are related to yeast and subtilisin proteases and therefore called Subtihsin-like Proprotein

Convertases (SPCs) or PCs. Seven members of this family have been identified & characterized and each have conserved signal peptides, pro-regions, catalytic and P-domains but differ in their C-terminal domains in mammals.

Autocatalytic cleavage of an N-terminal propeptide activates these proteases, which is required for folding and activity also release of prodomain. Other examples of function associated with proteolytic processing are the blood clotting cascades, the metaloendopeptidases, the secretases and the caspases. Yet other examples are the viral proteases that specifically process viral polyproteins. The art describes various strategies to inhibit the various proteases.

For instance, gamma-secretase inhibitors are presently being developed for the treatment of T cell acute lymphoblastic leukemia (Nature Medicine 2009: 15, 50 - 58). Caspase inhibitors are being developed for a variety of different applications (The Journal of Biological Chemistry 1998: 273, 32608-32613) for instance in the treatment of sepsis (Nature Immunology 2000: 1, 496 - 501).

A problem with the use of protease inhibitors is that these proteins typically have a range of targets in the human body and associated therewith a range of effects. Inhibiting a protease in the human body through the action of a protease inhibitor thus not only inhibits the desired effect but typically also has a range of other effects which may or may not affect the utility of the protease inhibitor for the indicated disease. Another problem associated with protease inhibitors is that it is not always easy to produce an inhibitor that is sufficiently specific for the target protease and therefore may also inhibit other proteases.

The present invention provides an alternative approach to interfere with the proteolytic processing of target proteins. Instead of designing inhibitors to the proteases, the target protein itself is modified. In the art, it is known to modify a protease cleavage site in a target protein. This is typically done by introducing point mutations into the coding region of a protein. These mutations typically breakup the recognition sequence of the protease. These types of modification are usually introduced into a cDNA copy of the gene and this altered copy is inserted into the DNA of cells by recombinant DNA technology. Although this can be done in the laboratory it is difficult to implement such strategies in the clinic, if only because gene therapy applications that rely on the introduction of a complete gene are, at present, not very efficient and the original gene associated with the problem is not removed.

The present disclosure provides a method for removing a proteolytic cleavage site from a protein comprising providing a cell that expresses a pre- mRNA encoding said protein with an antisense oligonucleotide (AON) that induces skipping of the exon sequence that encodes said proteolytic cleavage site, or partially removing said proteolytic cleavage site, rendering it inactive, the method further comprising allowing translation of mRNA produced from said pre-mRNA.

The present disclosure also provides for methods for removing exons containing trinucleotide repeat expansions. Such expansions can lead to a number of conditions including fragile X syndrome, fragile XE syndrome, Friedreich ataxia, myotonic dystrophy, spinocerebellar ataxia (SCA) type 8, spinobulbar muscular atrophy (SBMA, also known as Kennedy's disease), Huntington disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), and the SCA types 1, 2, 3, 6, 7, 12, and 17 (see tables la and lb). Preferably the trinucleotide repeat expansion is a CAG repeat expansion, i.e., a

polyglutamine expansion.

Polyglutamine (polyQ) diseases are a group of autosomal dominant neurodegenerative disorders caused by CAG triplet repeat expansions in protein coding regions of the genome. This CAG repeat is translated into an extended glutamine stretch in the mutant protein, which causes a gain of toxic function inducing neuronal loss in various regions throughout the brain. A hallmark of all polyQ disorders is the formation of large insoluble protein aggregates containing the expanded disease protein. Exemplary polyQ disorders are listed in Table la.

The most prevalent polyQ disorder, Huntington's disease (HD), is caused by a CAG repeat expansion in the first exon of the HTT gene on chromosome 4pl6. The expanded CAG transcript is translated into a mutant huntingtin (htt) protein with an expanded polyQ tract at the N-terminus.

Carriers of 39 or more CAG repeats will develop HD, whereas people with 35 to 38 repeats show reduced penetrance.

Spinocerebellar ataxia type 3 (SCA3), also known as Machado- Joseph disease (MJD), is another polyglutamine (polyQ) disorder. In SCA3, the CAG repeat is located in the penultimate exon of the ATXN3 gene on

chromosome 14q32.1. Healthy individuals have a CAG repeat ranging from 10 to 51, whereas SCA3 patients have an expansion of 55 repeats or more.

Transgenic mice expressing either a mutant ataxin-3 cDNA fragment or the mutated full-length genomic sequence showed a clear ataxic phenotype with a more severe phenotype in the animals carrying larger repeats, demonstrating a relationship between CAG repeat length and disease severity. The ATXN3 gene codes for the ataxin-3 protein of 45 kDa, which acts as an isopeptidase and is thought to be involved in deubiquitination and proteasomal protein degradation 8-10. The ataxin-3 protein contains an N-terminal Josephin domain that displays ubiquitin protease activity and a C-terminal tail with 2 or 3 ubiquitin interacting motifs (UIMs), depending on the isoform.

Successful allele -specific reduction of the mutant ataxin-3 transcript was shown using lentiviral shRNAs directed against a single nucleotide polymorphism (SNP) in the ATXN3 gene in vitro and in vivo. However, this approach is limited to SCA3 patients carrying a heterozygous SNP in the ATXN3 gene. The present disclosure provides a novel way to reduce toxicity of the ataxin-3 protein through protein modification. Using AONs it is possible to mask sequences in the pre-mRNA from the splicing machinery resulting in exclusion of the targeted exon, either partially or in its entirety. If the reading frame remains intact, subsequent translation yields an internally truncated protein. This has the major advantage that a polyQ-containing part of the protein is removed, while maintaining global ataxin-3 protein levels. This strategy can be used to remove the trinucleotide repeats in other proteins as well.

Attempts at inhibiting the pathogenic effect of trinucleotide repeats have also focused on steric block antisense oligonucleotides. For example, in DM1 the trinucleotide repeat in the RNA sequesters the protein MBNL1 resulting in a loss-of -function phenotype for MBNL1. Small molecule compounds, as well as antisense oligonucleotides have been used to bind the trinucleotide repeat in an attempt to inhibit the binding of MBNL1. The present disclosure relates to oligonucleotides and methods for skipping an exon either partially on in its entirety. This is a completely different mechanism than that used by steric blocking antisense oligonucleotides.

Methods are provided herein for treating trinucleotide repeat expansion disorders and for removing trinucleotide repeats from pre-mRNA, both in vivo and in vitro. In some embodiments, methods are provided for treating a disease in an individual that is associated with a mutant gene that comprises a trinucleotide repeat expansion when compared to the gene of a normal individual. Such diseases are provided in, e.g., tables la and lb. The methods comprise providing to an individual in need thereof a therapeutically effective amount of one or more anti-sense oligonucleotide that induces skipping of one or more exonic sequences that comprise the amino acids encoded by a trinucleotide repeat expansion. The treatment may comprise of administering the anti-sense oligonucleotides or administering cells

comprising said oligonucleotides. A trinucleotide repeat as used herein is at least 3, preferably at least

4 repeating trinucleotides. A trinucleotide repeat expansion refers to an increase in number of trinucleotide repeats over the normal individual. The increase in repeats necessary to cause pathology differs depending on the protein (see, e.g., tables la and lb).

The methods and compositions described herein are useful for removing trinucleotide repeat expansions. The removal of the expansion is the result of skipping the exonic sequence that comprises said trinucleotide repeat expansion. The skipping of said exonic sequence may be achieved by the removal of the exon in its entirety. Alternatively, the exon may be partially skipped. This can occur, e.g., when an alternative splice site or a cryptic splice site is utilized. For example, the examples in the disclosure describes the partial skipping of exon 9 from ATXN3. Regardless of whether the skipped exonic sequences represent an entire or partial exon, the trinucleotide repeat expansion is skipped in its entirety, i.e., the skipped exonic sequences fully comprise the trinucleotide repeat expansion.

It is clear to a skilled person that when a wild-type allele is present which lacks a trinucleotide repeat expansion, exon-skipping will result in the removal of the wild-type trinucleotide repeat. Throughout the disclosure "removal of a trinucleotide repeat expansion" is used to refer to the skipping of the exonic sequences which contains an entire trinucleotide repeat (when in the wild-type form) or an entire trinucleotide repeat expansion (when in the mutant form). Preferably, the exon containing a trinucleotide repeat expansion does not contain a proteolytic cleavage site. For the ATXN3 gene, it is preferred that for the in frame removal of trinucleotide repeats, exons 9 and 10 are skipped partially or in their entirety. The disclosure further provides a set of oligonucleotides comprising a first oligonucleotide that induces skipping of exonic sequences of exon 9 and a second oligonucleotide that induces skipping of exonic sequences of exon 10.

For the ATN1 gene, the CAG repeat is located in exon 5. For in- frame removal, sequences from exon 6 should also be removed. It is preferred that an exonic sequence from exon 5 and an exonic sequence from exon 6 are skipped.

For the ATXN1 gene, it is preferred that an exonic sequence from exon 8 is skipped.

For the CACNA1A gene, it is preferred that an exonic sequence from exon 47 is skipped.

For the ATXN7 gene, it is preferred that an exonic sequence from exon 3 is skipped.

For the TBP gene, the CAG repeat is located in exon 3 and for in- frame removal, sequences from exon 4 should also be skipped. It is preferred that an exonic sequence from exon 3 and an exonic sequence from exon 4 are skipped.

The disclosure also provides methods and compounds useful in the treatment of Alzheimer's disease (AD). AD is characterized by the deposition of amyloid in extracellular plaques and intracellular neurofibrillary tangles in the brain. The amyloid plaques are mainly composed of amyloid peptides which originate from the Amyloid Precursor Protein (APP) by a series of proteolytic cleavage steps. Several alternative splicing forms of APP have been identified of which the most abundant are proteins of 695, 751 and 770 amino acids length. These are herein referred to as APP695, APP751, and APP770.

The beta peptides are produced from APP through the sequential action of two proteolytic enzymes termed beta and gamma-secretase. Beta- secretase cleaves first in the extracellular domain of APP just outside of the trans-membrane domain to produce a C-terminal fragment of APP containing the the trans-membrane domain and cytoplasmic domain. The cytoplasmic domain is the substrate for gamma-secretase which cleaves at several adjacent positions within the trans-membrane domain to produce the A-beta peptides and the cytoplasmic fragment. Various proteolytic cleavages mediated by gamma-secretase result in A-beta peptides of different chain length. A-beta 42 is regarded to be the more pathogenic amyloid peptide because of its strong tendency to form neurotoxic aggregates.

In preferred embodiments, methods are provided for removing a proteolytic cleavage site from APP comprising providing a cell that expresses pre-mRNA encoding APP with an anti-sense oligonucleotide that induces skipping of the exonic sequence that encodes said proteolytic cleavage site, the method further comprising allowing translation of mRNA produced from said pre-mRNA. Preferably, an exonic sequence corresponding to exon 16 of

APP751 is skipped. Preferred oligonucleotides are provided in Table 3.

The invention further provides an oligonucleotide of 14-40 nucleotides comprising an AON sequence or a derivative thereof depicted in table 2 or table 3 for skipping an exon in a pre-mRNA produced by the corresponding gene of table 2 or table 3.

The invention further provides an oligonucleotide of 14-40 nucleotides specific for the target sequence depicted in table 3 for skipping an exon in a pre-mRNA produced by the corresponding gene identified in table 3. Preferably, methods for treating Alzheimer's disease are provided herein comprising administering to an individual in need thereof an effective amount of an anti-sense oligonucleotide that induces skipping of an APP exonic sequence that encodes a proteolytic cleavage site a described herein.

Mutations in APP are also involved in hereditary cerebral haemorrhage with amyloidosis, Dutch type (HCHWA-D). HCHWA-D is an autosomal dominant condition caused by a single basepair mutation in the APP gene that leads to a single amino acid substitution in APP (glutamine instead of glutamic acid) (Levy et al. Science 1990 248: 1124-6, corresponding to Abeta E22Q (see Figure 19).

In HCHWA-D, amyloid protein progressively deposits in cerebral blood vessel walls with subsequent degenerative vascular changes that usually result in spontaneous cerebral hemorrhage, ischemic lesions, and progressive dementia. The principal clinical characteristic is recurring cerebral

hemorrhages, sometimes preceded by migrainous headaches or mental changes. Methods are provided herein for treating individuals afflicted with

HCHWA-D, comprising administering to an individual in need thereof a therapeutically effective amount of one or more anti-sense oligonucleotides that induces skipping of the exonic sequences containing the HCHWA-D mutation. The HCHWA-D mutation is located in exon 16 of the APP751 transcripts isoform (see Figures 19 and 20) and exon 17 of the APP770 transcript isoform (Figure 20). Preferably, the oligonucleotides that induce skipping of the HCHWA-D mutation induce the skipping of exonic sequences corresponding to exon 16 of APP751. As is clear to a skilled person, the exonic sequences corresponding to exon 16 of APP751 correspond to exon 17 in

APP770. A skilled person can determine the location of the E22Q mutation in other APP transcripts. The skipping of said exonic sequences may remove an exon in its entirety. Alternatively, an exon may be removed partially, for example if a crytic splice site is utilized as a splice acceptor or donor. While not wishing to be bound by theory, removal of the exon containing the HCHWA-D mutation, is thought to reduce the formation or slow the progression of amyloid protein deposits in cerebral blood vessel walls.

The disclosure also provides oligonucleotides which induce the skipping of the exonic sequences comprising the HCHWA-D mutation. Such oligonucleotides are useful for removing the HCHWA-D mutation from the APP mRNA, and in particular, in the treatment of HCHWA-D.

Oligonucleotides corresponding to hAPPExl6_l-hAPPExl6_6 of table 3 are preferred.

The methods of the invention are particularly useful for removing proteolytic cleavage sites, the HCHWA-D mutation, and the amino acids encoded by trinucleotide repeat expansions from proteins. It does not require removal or modification of the gene itself but rather prevents the incorporation of the genetic code for the proteolytic cleavage site, HCHWA-D mutation, or trinucleotide repeat expansions into the coding region of the protein in the mature mRNA. In this way the process is reversible. The oligonucleotide has a finite life span in the cell and therefore has a finite effect on the removal. Another advantage is that the removal is not absolute. Not all pre-mRNA coding for the target protein that is generated by the cell is typically targeted. It is possible to achieve high levels of skipping. The skipping efficiency depends, for instance, on the particular target, the particular exon sequence to be skipped, the particular AON design and/or the amount of AON used.

Skipping percentages are typically expressed as the ratio of mRNA that does not have the coding part of the proteolytic cleavage site (skipped mRNA) versus the sum of skipped mRNA and unmodified mRNA coding for the unmodified target protein (unmodified mRNA). The possibility of tailoring the percentage of skipping is advantageous. For instance when the unmodified protein is associated with a toxic phenotype but also has a positive function to perform that is not performed (as well) by the modified protein. By removing the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by trinucleotide repeat expansions only from a fraction of the protein formed, it is possible to reduce the toxic property while leaving the positive or desired function of the unmodified protein at least partially intact.

The present invention modulates the splicing of a pre-mRNA into an mRNA such that an exonic sequence that codes for a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion that is present in the exons encoded by the pre-mRNA is not included in the mature mRNA produced from the pre-mRNA. Protein that is subsequently translated from this mRNA does not contain the proteolytic cleavage site, HCHWA-D mutation, trinucleotide repeat expansion. The invention thus does not actually remove a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion from a protein that has already been formed. Rather it promotes the production of a novel protein that does not contain the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion. However, when looking at a cell as an entity wherein protein synthesis and degradation are at equilibrium, the result of a method of the invention can be seen as removing a proteolytic cleave site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion from a protein. Unmodified target protein is gradually replaced by target protein that does not contain the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion. Thus the invention also provides a method for producing a cell that contains a modified protein that lacks a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a

trinucleotide repeat expansion when compared to the unmodified protein encoded in the genome, the method comprising providing a cell that expresses pre-mRNA encoding said protein with an AON that induces skipping of the exon sequence or part of the exon sequence that encodes said proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a

trinucleotide repeat expansion , the method further comprising allowing translation of mRNA produced from said pre-mRNA in said cell. The novel mRNA from which the coding sequence for the proteolytic cleavage site, HCHWA-D mutation, or trinucleotide repeat expansion is removed is a shortened or smaller coding sequence that codes for a shorter or smaller version of the unmodified protein. Often, the modified protein is an internally deleted version of the unmodified protein wherein the internal deletion at least breaks-up and preferably deletes the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide expansion . In the case of the trinucleotide expansion, the internally deleted protein lacks all the amino acids encoded by the expansion.

Antisense-mediated modulation of splicing (also referred to as exon- skipping) is one of the fields where AONs have been able to live up to their expectations. In this approach, AONs are implemented to facilitate cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. The antisense- mediated modulation of splicing has been diversified since its first introduction and now many different kinds of manipulations are possible. Apart from classical exon skipping where typically an entire exon is skipped from the mature mRNA, it is for instance possible to skip a part of an exon and also exon -inclusion is possible. The latter occurs when AONs targeted toward appropriate intron sequences are coupled to the business end of SR-proteins.

Exon skipping has been used to restore cryptic splicing, to change levels of alternatively spliced genes, and to restore disrupted open reading frames. This approach has been employed with a number of genes including Apolipoprotein B, Bcl-X, Collagen type 7, dystrophin, dysferlin, prostate- specific membrane antigen, IL-5 receptor alpha, MyD88, Tau, TNFalpha2 receptor, Titin, WT1, beta-globulin, and CFTR. Accordingly, in preferred embodiments, methods are provided for removing a proteolytic cleavage site from a protein, wherein the protein is not Apolipoprotein B, Bcl-X, Collagen type 7, dystrophin, dysferlin, prostate-specific membrane antigen, IL-5 receptor alpha, MyD88, Tau, TNFalpha2 receptor, Titin, WT1, beta-globulin, or CFTR, more preferably is the protein not dystrophin.

In contrast to the previous uses for exon-skipping, the present invention provides a method for removing a proteolytic cleavage site, HCHWA- D mutation, or the amino acids encoded by a trinucleotide repeat expansions in order to treat an individual, restore function to a protein, or reduce toxicity of a protein. The methods and oligonucleotides described herein are particularly useful for removing proteolytic cleavage sites, HCHWA-D mutation, or the amino acids encoded by trinucleotide repeat expansions from a protein, wherein the protein is involved in a neurogenerative disorder.

Prevention of inclusion of a coding part for a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion (in particular the polyQ repeat) into mature mRNA is in the present invention is preferably achieved by means of exon-skipping. Antisense oligonucleotides for exon-skipping typically enable skipping of an exon or the 5' or 3' part of it. Antisense oligonucleotides can be directed toward the 5' splice site, the 3' splice, to both splice sites, to one or more exon-internal sites and to intron sequences, for instance specific for the branch point. The latter enables skipping of the upstream exon.

Skipping of the nucleotides that code for the proteolytic cleavage site is typically achieved by skipping the exon that contains the nucleotides that code for the proteolytic cleavage site. This results in removal of the proteolytic recognition motif from the protein. The proteolytic cleavage site comprises the recognition sequence for the specific protease and the two amino acids between which the peptide linkage is cleaved by the protease. The proteolytic cleavage site can overlap the boundary of two adjacent exons or if a part of the exon is skipped, overlap the exon sequence that contains the cryptic splice

acceptor/donor sequence. In this embodiment, it is preferred to skip the exon sequence that codes for the peptide linkage that is cleaved by the protease. Whether or not a recognition sequence for a protease is actually used in nature depends not only on the presence of the recognition sequence itself but also on the location of the site in the folded protein. An internally located recognition site is typically not used in nature. In the present invention a proteolytic cleavage site is an active proteolytic cleavage site that is actually used in nature.

Skipping of exonic sequences that contain the nucleotides that code for the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion is preferably achieved by means of an AON that is directed toward an exon internal sequence. An oligonucleotide is said to be directed toward an exon internal sequence if the complementarity region that contains the sequence identity to the reverse complement of the target pre-mRNA is within the exon boundary. Presently all exons that have been targeted by means of exon-skipping can be induced to be skipped from the mature mRNA. Often with one AON and sometime with two AON directed toward the exon. However, not all AON that can be designed induce detectable amounts of skipping. Most experience with exon-skipping has been gained in the DMD system. Using AON directed toward exon-internal sequences it has been shown that all exons can be skipped (with the exception of course of the first and the last exon). However, not all AON designed against an exon- internal sequence actually induce detectable amounts of skipping of the targeted exon. The frequency of randomly selected exon-internal AON that induce skipping is around 30% depending on the actual exon that is targeted. Since the first trials, however, the experience gained from AON that

successfully induced skipping has resulted in a significant improvement of the success ratio of a designed AON (PMID: 18813282

Aartsma-Rus et al Mol Ther 17(3):548 (2009). The factors that improve the success ratio include among others: the predicted structure of the exon RNA at the target site, the exact sequence targeted and the predicted presence or absence of specific SR-protein binding sites in the target site (ibidem).

Skipping of an exonic sequence that codes for a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion is preferably such that downstream amino acids of the target protein are present in the newly formed protein. In this way the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a

trinucleotide repeat expansion is removed while leaving much of the

downstream protein intact. In this embodiment the functionality of the modified protein is at least part of the functionality of the protein as present in normal individuals. Thus preferably the modified protein contains an "in frame" deletion of the proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion. Preferably said "in frame" deleted protein has at least 20%, preferably at least 50% of the functionality of the unmodified protein in a normal individual. Thus in a preferred embodiment the number of nucleotides that is skipped is dividable by three. Skipping of an exon sequence that codes for a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion is typically achieved by skipping the exon that contains this sequence. Skipping of the target exon is sufficient if this exon contains a number of nucleotides that is dividable by three. If the exon contains another number, it is preferred to also skip an adjacent exon such that the total number of skipped nucleotides is again dividable by three. In most cases the skipping of an adjacent exon is sufficient, however, if this also does not result in a number of skipped nucleotides that is dividable by three the skipping of yet a further exon, adjacent to the two mentioned, may be necessary. Skipping of four or more exons is possible but often does not yield a lot of the correct protein. Sometimes it is possible to skip only a part of an exon. This is either the 5' part of the 3' part of the exon. This occurs when the exon contains a cryptic 3' or 5' splice site that can be activated.

The term pre-mRNA refers to a non-processed or partly processed precursor mRNA that is synthesized from a DNA template in the cell nucleus by transcription. Within the context of the invention, inducing and/or promoting skipping of an exon sequence that codes for a proteolytic cleavage site as indicated herein means that at least 1%, 10%, 20%, 30%, 40%,50%, 60%, 70%, 80%, 90% or more of the mRNA encoding the targeted protein in a cell will not contain the skipped exon sequence

(mochfied/(modified+unmochfied) mRNA). This is preferably assessed by PCR as described in the examples.

An AON of the invention that induces skipping of an exon sequence that encodes a proteolytic cleavage site, HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion, preferably comprises a sequence that is complementary to said exon. In some embodiments, the AON induces skipping of an exon in its entirety. In other embodiments, the AON induces skipping of a part of an exon, preferably, said part encodes a

proteolytic cleavage site. Preferably the AON contains a continuous stretch of between 8-50 nucleotides that is complementary to the exon. An AON of the invention preferably comprises a stretch of at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides that is

complementary to said exon. In a preferred embodiment said AON contains a continuous stretch of between 12-45 nucleotides that is complementary to the exon. More preferably a stretch of between 15-41 nucleotides. Depending on the chemical modification introduced into the AON the complementary stretch may be at the smaller side of the range or at the larger side. A preferred antisense oligonucleotide according to the invention comprises a T-O alkyl phosphorothioate antisense oligonucleotide, such as 2'-O-methyl modified ribose (RNA), 2'-0-ethyl modified ribose, 2'-O-propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives. A most preferred AON according to the invention comprises of 2'-0-methyl phosphorothioate ribose. Such AON typically do not need to have a very large complementary stretch. Such AON typically contain a stretch of between 15-25 complementary nucleotides. As described herein below, another preferred AON of the invention comprises a morpholino backbone. AON comprising such backbones typically contain somewhat larger stretches of complementarity. Such AON typically contain a stretch of between 25-40 complementary nucleotides. When in this invention reference is made to range of nucleotides, this range includes the number(s) mentioned. Thus, by way of example, when reference is made to a stretch of between 8-50, this includes 8 and 50.

An AON of the invention that is complementary to a target RNA is capable of hybridizing to the target RNA under stringent conditions. Typically this means that the reverse complement of the AON is at least 90% and preferably at least 95% and more preferably at least 98% and most preferably at least 100% identical to the nucleotide sequence of the target at the targeted sited. An AON of the invention thus preferably has two or less mismatches with the reverse complement of the target RNA, preferably it has one or no mismatches with the reverse complement of the target RNA. In another preferred embodiment, the AON may be specifically designed to have one or more mismatches, preferably one or two mismatches, e.g. in cases where it is necessary to reduce the affinity when the skipping of the 100% complementary AON is more effective than biologically desired in view of the necessary remaining protein activity. A mismatch is defined herein as a nucleotide or nucleotide analogue that does not have the same base pairing capacity in kind, not necessarily in amount, as the nucleotide it replaces. For instance the base of uracil that replaces a thymine and vice versa, is not a mismatch. A preferred mismatch comprises an inosine. An inosine nucleotide is capable of pairing with any natural base in an RNA, i.e. capable of pairing with an A, C, G or U in the target RNA.

In a preferred embodiment, the nucleotide analogue or equivalent comprises a modified backbone. Examples of such backbones are provided by morpholino backbones, carbamate backbones, siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioform acetyl backbones, methyleneform acetyl backbones, riboacetyl backbones, alkene containing backbones, sulfamate, sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones.

Phosphorodiamidate morpholino oligomers are modified backbone

oligonucleotides that have previously been investigated as antisense agents. Morpholino oligonucleotides have an uncharged backbone in which the deoxyribose sugar of DNA is replaced by a six membered ring and the phosphodiester linkage is replaced by a phosphorodiamidate linkage.

Morpholino oligonucleotides are resistant to enzymatic degradation and appear to function as antisense agents by arresting translation or interfering with pre-mRNA splicing rather than by activating RNase H. Morpholino oligonucleotides have been successfully delivered to tissue culture cells by methods that physically disrupt the cell membrane, and one study comparing several of these methods found that scrape loading was the most efficient method of delivery; however, because the morpholino backbone is uncharged, cationic lipids are not effective mediators of morpholino ohgonucleotide uptake in cells. A recent report demonstrated triplex formation by a morpholino oligonucleotide and, because of the non-ionic backbone, these studies showed that the morpholino oligonucleotide was capable of triplex formation in the absence of magnesium. A modified backbone is typically preferred to increase nuclease resistance of the AON, the target RNA or the AON/target RNA hybrid or a combination thereof. A modified backbone can also be preferred because of its altered affinity for the target sequence compared to an

unmodified backbone. An unmodified backbone can be RNA or DNA, preferably it is an RNA backbone.

It is further preferred that the linkage between the residues in a backbone does not include a phosphorus atom, such as a linkage that is formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.

A preferred nucleotide analogue or equivalent comprises a Peptide Nucleic Acid (PNA), having a modified polyamide backbone (Nielsen, et al.

(1991) Science 254, 1497-1500). PNA-based molecules are true mimics of DNA molecules in terms of base-pair recognition. The backbone of the PNA is composed of 7V-(2-aminoethyl)- glycine units linked by peptide bonds, wherein the nucleobases are linked to the backbone by methylene carbonyl bonds. An alternative backbone comprises a one- carbon extended pyrrolidine PNA monomer (Govindaraju and Kumar (2005) Chem. Commun, 495-497). Since the backbone of a PNA molecule contains no charged phosphate groups, PNA- RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively (Egholm et al (1993) Nature 365, 566-568).

A further preferred backbone comprises a morpholino nucleotide analog or equivalent, in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring. A most preferred nucleotide analog or

equivalent comprises a phosphorodiamidate morpholino oligomer (PMO), in which the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring, and the anionic phosphodiester linkage between adjacent morpholino rings is replaced by a non-ionic phosphorodiamidate linkage.

In yet a further embodiment, a nucleotide analogue or equivalent of the invention comprises a substitution of one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes base- pairing but adds significant resistance to nuclease degradation. A preferred nucleotide analogue or equivalent comprises phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester,

aminoalkylphosphotriester, H-phosphonate, methyl and other alkyl

phosphonate including 3'-alkylene phosphonate, 5'-alkylene phosphonate and chiral phosphonate, phosphinate, phosphoramidate including 3'-amino phosphoramidate and aminoalkylphosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphotriester, selenophosphate or boranophosphate.

A further preferred nucleotide analogue or equivalent of the invention comprises one or more sugar moieties that are mono- or

disubstituted at the 2', 3' and/or 5' position such as a -OH; -F; substituted unsubstituted, linear or branched lower (C1-C1O) alkyl, alkenyl, alkynyl, alkaryl, allyl, aryl, or aralkyl, that may be interrupted by one or more heteroatoms; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S-or N-alkynyl; 0-, S-, or N-allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; -amino xy;

methoxyethoxy; -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. The sugar moiety can be a pyranose or derivative thereof, or a deoxypyranose or derivative thereof, preferably a ribose or a derivative thereof, or a

deoxyribose or a derivative thereof. Such preferred derivatized sugar moieties comprise Locked Nucleic Acid (LNA), in which the 2'-carbon atom is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. A preferred LNA comprises 2'-0,4'-C-ethylene-bridged nucleic acid (Morita et al. 2001. Nucleic Acid Res Supplement No. 1: 241-242). These substitutions render the nucleotide analogue or equivalent RNase H and nuclease resistant and increase the affinity for the target RNA. As is apparent to one of skill in the art, the substitutions provided herein render the double- stranded complex of the antisense oligonucleotide with its target pre-mRNA RNase H resistant. Accordingly, preferred oligonucleotides bind to the pre- mRNA of said protein to form a double-stranded nucleic acid complex and are chemically modified to render said double-stranded nucleic acid complex RNAse H resistant.

It is understood by a skilled person that it is not necessary for all positions in an antisense oligonucleotide to be modified uniformly. In addition, more than one of the aforementioned analogues or equivalents may be incorporated in a single antisense oligonucleotide or even at a single position within an antisense oligonucleotide. In certain embodiments, an antisense oligonucleotide of the invention has at least two different types of analogues or equivalents.

As mentioned herein above a preferred AON according to the invention comprises a T-O alkyl phosphorothioate antisense oligonucleotide, such as 2'-0-methyl modified ribose (RNA), 2'-0-ethyl modified ribose, 2'-0- propyl modified ribose, and/or substituted derivatives of these modifications such as halogenated derivatives. A most preferred AON according to the invention comprises of 2'-0-methyl phosphorothioate ribose.

An AON of the invention can be linked to a moiety that enhances uptake of the antisense oligonucleotide in cells. Examples of such moieties are cholesterols, carbohydrates, vitamins, biotin, lipids, phospholipids, cell- penetrating peptides including but not limited to antennapedia, TAT, transportan and positively charged amino acids such as oligoarginine, poly- arginine, ohgolysine or polylysine, antigen-binding domains such as provided by an antibody, a Fab fragment of an antibody, or a single chain antigen binding domain such as a cameloid single domain antigen-binding domain. Preferably, additional flanking sequences are used to modify the binding of a protein to said AON, or to modify a thermodynamic property of the AON, more preferably to modify target RNA binding affinity.

AON administration is humans is typically well tolerated. Clinical manifestations of the administration of AON in human clinical trials have been limited to the local side effects following subcutaneous (SC) injection (on the whole intravenous (i.v.) administration seems to be better tolerated) and generalized side effects such as fever and chills that similar to the response to interferon administration, respond well to paracetamol. More than 4000 patients with different disorders have been treated so far using systemic delivery of first generation AON (phosphorothioate backbone), and

approximately 500 following local administration. The typical dosage used ranged from 0.5 mg/kg every other day for 1 month in Crohn's disease, to 200 mg twice weekly for 3 months in rheumatoid arthritis, to higher dosages of 2 mg/kg day in other protocols dealing with malignancies. Fewer patients (approx. 300) have been treated so far using new generation AON (uniform phosphorothioated backbone with flanking 2' methoxyethoxy wing) delivered systemically at doses comprised between 0.5 and 9 mg/kg per week for up to 3 weeks.

Delivery of AON to cells of the brain can be achieved by various means. For instance, they can be delivered directly to the brain via

intracerebral inoculation (Schneider et al, journal of Neuroimmunology 195 (2008) 21-27), intraparenchymal infusion (Broaddus et al., J Neurosurg. 1998 Apr;88(4):734-42), intrathecal, or intraventricularly. Alternatively, the AON can be coupled to a single domain antibody or the variable domain thereof (VHH) that has the capacity to pass the Blood Brain barrier. Nanotechnology has also been used to deliver oligonucleotides to the brain, e.g., a nanogel consisting of cross-linked PEG and polyethylenimine. Encapsulation of AON in liposomes is also well-known to one of skill in the art. The AONs can also be introduced into the cerebral spinal fluid.

An AON of the invention preferably comprises a sequence that is complementary to part of said pre-mRNA as defined herein. In a more preferred embodiment, the length of said complementary part of said oligonucleotide is of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides. Preferably, additional flanking sequences are used to modify the binding of a protein to said molecule or oligonucleotide, or to modify a thermodynamic property of the oligonucleotide, more preferably to modify target RNA binding affinity. An AON of the invention may further comprise additional nucleotides that are not

complementary to the target site on the target pre-mRNA. In a preferred embodiment an AON contains between 8-50 nucleotides. An AON of the invention preferably comprises a stretch of at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In a preferred embodiment said AON contains a continuous stretch of between 12-45 nucleotides, more preferably a stretch of between 15-41 nucleotides. Depending on the chemistry of the backbone as indicated herein above an AON of the invention contains between 15-25 nucleotides. An AON of the invention with a morpholino backbone typically contains a stretch of between 25-40 nucleotides. In a preferred embodiment the indicated amounts for the number of

nucleotides in the AON refers to the length of the complementarity to the target pre-mRNA, preferably to an exon internal sequence, however, the target sequence can also be a 5' or a 3' splice site of an exon or an intron sequence, such as preferably a branch point. In another preferred embodiment the indicated amounts refer to the total number of nucleotides in the AON.

Preferably the complementary part is at least 50% of the length of the oligonucleotide of the invention, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% or even more preferably at least 95%, or even more preferably 98% and most preferably up to 100% of the length of the

oligonucleotide of the invention, with the putative exception of deliberately introduced specific mismatches, e.g. for downregulating affinity when necessary.

With respect to AON that also contain additional nucleotides, the total number of nucleotides typically does not exceed 50, and the additional nucleotides preferably range in number from between 5-25, preferably from 10- 25, more preferably from 15-25. The additional nucleotides typically are not complementary to the target site on the pre-mRNA but may be complementary to another site on said pre-mRNA or may serve a different purpose and not be complementary to the target pre-mRNA, i.e., less than 95% sequence identity of the additional nucleotides to the reverse complement of the target pre- mRNA.

The proteolytic cleavage site that is to be removed from a protein by a method or AON of the invention is preferably a serine endoprotease cleavage site, a metaloendopeptidase cleavage site, a secretase cleavage site and/or a caspase cleavage site. In a particularly preferred embodiment said cleavage site is a caspase cleavage site or secretase cleavage site. Caspases are a family of intracellular cysteine proteases that play a central role in the initiation and execution of programmed cell death. The term caspases is a short form for Cystein Aspartate-specific Proteases: their catalytical activity depends on a critical cystein-residue within a highly conserved active-site pentapeptide QACRG, and the caspases specifically cleave their substrates after Asp residues (also the serine-protease granzyme B has specificity for Asp in the PI position of substrates). More than ten different members of the caspase-family have been identified in mammals. According to a unified nomenclature, the caspases are referred to in the order of their publication: so Caspase- 1 is ICE (Interleukin-lbeta-Converting Enzyme), the first aspartate-specific cystein protease described. The secretase family of proteases is subdivided into three groups, the alpha-, beta- and gamma-secretases. In a preferred embodiment said secretase is a gamma-secretase.

The protein from which the proteolytic cleavage site or one or more trinucleotide repeats is to be removed can be any protein that contains a proteolytic cleavage site or trinucleotide repeat. In a preferred embodiment said protein is a mammalian protein, more preferably a primate protein. In a particularly preferred embodiment said protein is a human protein. In a preferred embodiment said protein is associated with a disease in humans. In a particularly preferred embodiment said protein is associated with a triplet repeat disease in humans. Preferably, a polyglutamine repeat disease. In a preferred embodiment said protein comprises a caspase cleavage site or secretase cleavage site. Preferably, the protein comprises a caspase-3 or -6 proteolytic cleavage site. Preferably the protein is a protein that is normally present in the brain of a mammal. In a particularly preferred embodiment the gene encoding said protein is a mutant gene that encodes a trinucleotide repeat expansion when compared to the gene of a normal individual.

In a particularly preferred embodiment said protein is a protein encoded by one of the genes listed in table la or lb. In a particularly preferred embodiment said gene is a mutant gene that is the causative gene in a polyglutamine disorder, preferably a gene of table la. In a particularly preferred embodiment said gene is the huntingtin (Htt) gene. Htt is expressed in all mammalian cells. The highest concentrations are found in the brain and testes, with moderate amounts in the liver, heart, and lungs. The function of Htt in humans is as yet not entirely resolved. Htt interacts among others with proteins which are involved in transcription, cell signaling and intracellular transporting. In humans the gene, and in particular mutants thereof is associated with Huntington's disease (HD). HD is a progressive

neurodegenerative genetic disorder, which affects muscle movement and muscle coordination and leads to cognitive decline and dementia. It typically becomes noticeable in middle age. HD is the most common genetic cause of abnormal involuntary writhing movements called chorea and is much more common in people of Western European descent than in those from Asia or Africa. The disease is caused by an autosomal dominant mutation of the Htt- gene. A child of an affected parent has a 50% risk of inheriting the disease.

For the Htt gene it is preferred that the caspase-6 proteolytic cleavage site encoded by exon Htt exon 12 is removed from the Huntingtin protein. It is preferred that the coding region that codes for the proteolytic cleavage site is removed "in frame", so as to allow incorporation of the normal downstream amino acid sequence into the mutant protein. In one embodiment said "in frame" removal is achieved by providing the cell with an AON that enables skipping of exon 12 and an AON that enables skipping of exon 13 of the Htt gene. In another preferred embodiment said "in frame" removal is achieved by providing the cell with an AON capable of inducing exon skipping directed toward the region delimited by nucleotides 269 - 297 of exon 12 of the Htt gene. In a preferred embodiment, said AON is directed toward region delimited by nucleotides 207 until 341 of exon 12. It is preferred that said AON is directed toward the internal region delimited by nucleotides 207 until 341 of exon 12. This includes nucleotides 207 and 341. It has been found in the present invention that AON directed toward the preferred regions induce skipping of the last 135 nucleotides of exon 12, thereby producing an "in frame" complete deletion of two active caspase 3 cleavage sites at amino acid 513 and 552, and removal of the first amino acid of an active caspase 6 site partially located in exon 12 and partially in exon 13. AON HDExl2_l (table 2 ) activates a cryptic splice site at nucleotide 206 in exon 12, leading to the absence of the remainder of exon 12 from the formed mRNA.

The invention further provides an isolated and/or recombinant modified Htt mRNA having a deletion of at least nucleotides 207 until 341 of exon 12. The modified Htt mRNA preferably comprises the exons 1-11, the first 206 nucleotides of exon 12 and exons 13-67. In another preferred embodiment said modified Htt mRNA comprises the exons 1-11, 14-67. In another embodiment the invention comprises an isolated and/or recombinant modified Htt protein comprising a deletion of amino acids 538- 583. The modified Htt protein preferably comprises the amino acid sequence encoded by exons 1-11, the first 206 nucleotides of exon 12, and exons 13-67. In another preferred embodiment said modified Htt protein comprises the amino acid sequence encoded by exons 1-11, 14-67. In yet another embodiment the invention provides an isolated and/or recombinant cell comprising a modified Htt mRNA and/or a modified Htt protein as indicated herein above. Preferably, said cell comprises an Htt gene comprising a coding region of a polyglutamine repeat, the length of which is associated with HD.

For the ATXN3 gene it is preferred that the calpain cleavage sites in exon 7 is removed from the protein. It is preferred that the coding region that codes for the proteolytic cleavage site is removed "in frame", so as to allow incorporation of the normal downstream amino acid into the mutant protein. In one embodiment said "in frame" removal is achieved by providing the cell with an AON that enables skipping of exon 7 and an AON that enables skipping of exon 8 of the ATXN3 gene.

For the ATXN3 gene it is preferred that the calpain and caspase cleavage sites in exons 8 and 9 are removed from the protein. Accordingly, a cell is provided with an anti-sense oligonucleotide(s) that induces skipping of exons 8 and 9, for removing said proteolytic cleavage site from said protein in a cell that produces pre-mRNA encoding said protein.

For the ATN1 gene it is preferred that the caspase 3 cleavage site near the N-terminus of the protein and the polyglutamine tract (¹⁰⁶DSLD¹⁰⁹) in exon 5 is removed from the protein. It is preferred that the coding region that codes for the proteolytic cleavage site is removed "in frame", so as to allow incorporation of the normal downstream amino acid into the mutant protein. In one embodiment said "in frame" removal is achieved by providing the cell with an AON that enables skipping of exon 5 and an AON that enables skipping of exon 6 of the ATN1 gene. In a preferred embodiment said AON comprises a sequence as depicted in table 2 under DPRLA AON.

Dentatorubral-pallidoluysian atrophy (DRPLA) is an autosomal dominant spinocerebellar degeneration caused by an expansion of a CAG repeat encoding a polyglutamine tract in the atrophin-1 protein. The invention further provides an AON of the invention of preferably between 14-40 nucleotides that induces skipping of an exonic sequence that encodes a proteolytic cleavage site in a protein, the HCHWA-D mutation, or the amino acids encoded by a trinucleotide repeat expansion. In a preferred embodiment the invention provides an AON as indicated herein above comprising a sequence as depicted in table 2. The AON is suitable for skipping the indicated exon of the gene. In a particularly preferred

embodiment said AON comprises the sequence of HDExl2_l of table 2. In another preferred embodiment the invention provides an AON as indicated herein above that is specific for the region identified by a sequence of an AON depicted in table 2. In a preferred embodiment said AON comprises at least 10 consecutive nucleotides of the region identified by an oligonucleotide as depicted in table 2. In a particularly preferred embodiment the invention provides an AON as indicated herein above that is specific for the region identified by a sequence of HDExl2_l of table 2.

The invention further provides the use of exon-skipping in a cell for removing a proteolytic cleavage site from a protein. Further provided is the use of an AON that induces skipping of an exon that encodes a proteolytic cleavage site in a protein, for removing said proteolytic cleavage site from said protein in a cell that produces pre-mRNA encoding said protein. The invention further provides an oligonucleotide of between 14-40 nucleotides that induces skipping of an exon that encodes a proteolytic cleavage site in a protein for use in the treatment of a disease that is associated with a proteolytic cleavage product of said protein.

In another embodiment the invention provides a method for altering the proteolytic processing of a protein that comprises a proteolytic cleavage site comprising providing a cell that produces a pre-mRNA that codes for said protein with an AON that is specific for said pre-mRNA; and that prevents inclusion of the code for said proteolytic cleavage site into mature mRNA produced from said pre-mRNA, the method further comprising allowing translation of said mRNA to produce the protein of which the proteolytic processing is altered.

The invention further provides the use of exon-skipping in a cell for removing the amino acids encoded by a trinucleotide repeat expansion from a protein. Further provided is the use of an AON that induces skipping of an exonic sequence that comprises a trinucleotide repeat in a pre-mRNA.

Preferably, the protein is encoded by a gene listed in table la or lb. The invention further provides an oligonucleotide of between 14-40 nucleotides that induces skipping of an exonic sequence that comprises a trinucleotide repeat expansion in a pre-mRNA for use in the treatment of a disease that is associated with the amino acids encoded by a trinucleotide repeat expansion of said protein (see, e.g., Tables la and lb).

The invention further provides the use of exon-skipping in a cell for removing the HCHWA-D mutation from an APP pre-mRNA. Further provided is the use of an AON that induces skipping of an exonic sequence that contains the HCHWA-D mutation in a mutant APP protein, for removing said HCHWA-D mutation from said protein in a cell that produces pre-mRNA encoding said protein. The invention further provides an oligonucleotide of between 14-40 nucleotides that induces skipping of an exonic sequence that encodes the HCHWA-D mutation in APP protein for use in the treatment of HCHWA-D.

The invention further provides a non-human animal comprising an oligonucleotide of the invention. Preferably said non-human animal comprises a mutant gene that encodes a trinucleotide repeat expansion when compared to the gene of a normal individual. The invention further provides a modified human protein from which a proteolytic cleavage site is removed by means of exon skipping.

Further provides an mRNA encoding a modified human protein from which a proteolytic cleavage site is removed by means of exon skipping.

The invention further provides a modified human APP protein from which the HCHWA-D mutation is removed by means of exon skipping. Further provided is an mRNA encoding a modified human APP protein from which a the HCHWA-D mutation is removed by means of exon skipping.

The invention further provides a cell encoding a human protein comprising a proteolytic cleavage site, wherein said cell contains an AON of the invention for removing said proteolytic cleavage site from said protein in said cell.

The invention further provides a cell encoding a human protein comprising the amino acids encoded by a trinucleotide repeat expansion, wherein said cell contains an AON of the invention for removing the amino acids encoded by a trinucleotide repeat expansion from said protein in said cell. Preferably, the protein is encoded by a gene listed in table la or lb.

The invention further provides a cell encoding a human APP protein comprising the HCHWA-D mutation, wherein said cell contains an AON of the invention for removing said the HCHWA-D mutation from said protein in said cell. The general nomenclature of cleavage site positions of the substrate were formulated by Schecter and Berger, 1967-68 [Schechter and Berger, 1967], [Schechter and Berger, 1968]. They designate the cleavage site between Pl-Ρ , incrementing the numbering in the N-terminal direction of the cleaved peptide bond (P2, P3, P4, etc.). On the carboxyl side of the cleavage site numbering are likewise incremented (ΡΓ, P2', P3' etc. ). Brief description of the drawings

Figure 1: Exon skipping after transfection with various concentrations

HDExl2_l AON. A) Patient derived HD fibroblasts were treated with 1, 25, 150, and ΙΟΟΟηΜ HDExl2_l. β-Actin was taken along as loading control.

Increasing the AON concentration from InM to 25nM resulted in a higher skip percentage from 16% to 92% as was measured by Lab-on-a-Chip. The highest skip percentage of 95% was obtained with 150nM HDExl2_l. Too high concentration of AON resulted in inefficient skip. In the Mock I control

(transfection agent only) no skip is visible as expected. The potency of

HDExl2_l exon 12 skip was also seen in another HD and control fibroblast cell line and human neuroblastoma SH-SY5Y cells. B) Schematic

representation of PCR of HD exons 9 to 14. Both schematic representation of normal (top) and shorter, skipped exon 12 (bottom) products are shown.

Figure 2: Log dose response curve of HDExl2_l AON in a HD fibroblast cell line. X-axis displays the log concentration (nM) and y-axis the percentage of skip. The half maximum inhibitory value (IC50) of the HDExl2_l AON was found to be 40nM. The optimal percentage exon 12 skip was achieved with an AON concentration of 150nM and higher. Results shown as mean ± SEM (n= 2- 3).

Figure 3: Sanger sequencing of normal (A) and skipped (B) PCR product.

HDExl2_l AON transfection in a HD fibroblast cell line resulted in an in- frame skip of 135 nucleotides, which corresponds with 45 amino acids. The observed skip is caused by the activation of an alternative splice site

(AG I GTRAG, see dashed box), resulting in an alternative splice site exon isoform. This partial exon 12 skip results in the deletion of an active caspase-3 site ⁵⁴⁹DLND⁵⁵² and partial removal of the first amino acid (Isoleucine) of an active caspase-6 site (5831 VLD 586). Figure 4: Partial amino acid sequence of the huntingtin protein. Underlined are the amino acids encoded by exon 12 and 13. Highlighted in red is the part of the protein that is currently skipped by the exon 12 AON. In bold is the caspase-3 site ⁵¹⁰DSVD⁵¹³, caspase-3 site ⁵⁴⁹DLND⁵⁵² and caspase-6 site

583IVLD586.

Figure 5: Schematic diagram of huntingtin. A) Diagram of complete htt protein. PolyQ indicates the polyglutamine tract. The arrows indicate the caspase cleavage sites and their amino acid positions. B) Amino-terminal part of the htt protein. Htt exon 1 to 17 are depicted. The arrows indicate the caspase cleavage sites and their amino acid positions. C) Schematic

representation and amino acid sequence of htt exon 12 and 13 with the caspase cleavage motifs depicted in bold. Exon boundaries are shown with vertical grey bars. D) Partial amino acid and nucleotide sequence of htt exon 12 and 13. Caspase cleavage motifs are depicted in bold and exon boundary is shown with vertical grey bar. The light grey highlighted sequence denotes the part which is skipped after HDExl2_l AON treatment.

Figure 6: Schematic representation of caspase motif hotspot in the htt protein and the skipping of exon 12 and 13. (A) The active caspase-6 site at amino acid position 586 (IVLD) is encoded by the last 3 nucleotides of exon 12 and the first 9 nucleotides of exon 13. Exon 12 also encodes two active caspase-3 sites at amino acids 513 (DSVD) and 552 (DLND). (B) To remove all three proteolytic cleavage sites from the htt protein, both exon 12 and 13 have to be skipped by using 3 AONs. (C) AON12.1 targets a region in the 3' part of htt exon 12. This results in the activation of a 5' cryptic splice site and an in-frame exclusion of the 3' part of exon 12. The resulting protein lacks the caspase-3 site at amino acid 552 (DLND), and the isoleucine (I) of the active caspase-6 site at amino acid 586 (IVLD) is replaced by a glutamine (Q). Figure 7: Optimal AON concentrations. Human fibroblasts were transfected with concentrations ranging from 10 to 200 nM per htt AON. RNA was isolated after 24 hours and Lab-on-a-Chip analysis was performed to calculate exon skip levels for AON12.1 and AON12.2 combined (A), and AON13 (B). (* PO.05, ** PO.01, *** PO.001, n = 4).

Figure 8: Transfection to induce double and single exon skipping. Control and HD patient fibroblasts were transfected with htt AONs, control AON, and non- transfected cells (Mock) and RNA was isolated after 24 hours. (A) Agarose gel analysis of the htt transcript with primers flanking exon 12 and 13.

Transfection with 100 nM per AON resulted in a product lacking both exon 12 and 13 (AON12.1+12.2+13) or a shorter than expected PCR product after transfection with 100 nM AON12.1, lacking the 3' part of exon 12. (B) Lab-on- a-Chip analysis was performed to calculate partial exon 12 skip levels in control cells transfected with AON12.1 concentrations ranging from 10 to 200 nM. (C) Skip efficiencies determined by Lab-on-a-Chip after 50 nM AON treatment in HD cells. (D) Skip efficiencies determined by Lab-on-a-Chip after 50 nM AON treatment in control cells. Both partial skip (AON12.1) and full skip percentages (AON12.1, AON12.2, and AON13) are shown in C and D (** PO.01, *** PO.001, n = 4). Partial skip (AON 12.1) (E) and full skip

(AON12.1, AON12.2, and AON13) (F) confirmed by Sanger sequencing.

Figure 9: Formation of modified htt protein after partial exon 12 skipping that is resistant to caspase-6 cleavage. Human control fibroblasts were transfected with 50nM AON12.1 and control AONs. (A) Transfection with AON 12.1 resulted in the appearance of a htt protein that is shorter than the full length protein and runs around 343 kDa. (B) Levels of normal (black bars) and shorter (white bar) htt protein after transfection with AON 12.1

determined by Odyssey software quantification (** P<0.01, n = 6). (C) In vitro caspase-6 cleavage assay shows a 586 amino acids N-terminal htt fragment appearance of 95 kDa, that increases with increasing concentration of caspase- 6. In samples from cells treated with AON12.1 this N-terminal htt fragment of 95 kDa is reduced, while an unrelated caspase-6 fragment at 35 kDa remains unchanged. (D) Quantification of C, determined by Odyssey software, using the 35 kDa caspase-6 fragment as reference (* PO.05, n = 4).

Figure 10: Skipping murine htt exon 12 and 13 in vitro. Mouse C2C12 cells were transfected with murine htt AONs, control AON, scrambled AON, and not transfected (Mock). (A) Agarose gel analysis of the htt transcript with primers flanking exon 12 and 13. Skipping of htt exon 12 and 13 is seen after transfection with mAON12.1, mAON12.2, and mAON13. (B) Lab-on-a-Chip analysis of double-exon skipping after AON treatment (*** P<0.001, n=4).

Figure 11: A single bilateral injection of Alexa488 AON into the striatum resulted in widespread distribution in the mouse midbrain. AON-Alexa488 is shown in green. NeuN (A) and GFAP (B) are shown in red. Nuclei were counterstained with DAPI as shown in blue. Scale bar = lOpm.

Figure 12: Reduction of mouse htt exon 12 and 13 after a single local injection into the mouse striatum. A single injection consisting of mAON12.1,

mAON12.2 and mAON13 (10 μg each) or 30 μg scrambled AON was injected bilaterally into the mouse striatum. After 7 days the mice were sacrificed and the presence of exon 12, 13 and 27 in the htt transcript was examined by qRT- PCR. (** PO.01, n = 5).

Figure 13: Single exon skipping of ataxin-3 pre-mRNA in vitro. Control fibroblasts were transfected with ataxin-3 AONs, control AON, and non- transfected (mock) and RNA was isolated after 24 hours, (a) Agarose gel analysis of the ataxin-3 transcript with primers flanking exon 9 and 10 (full- length, grey arrowhead). Transfection with 50 nM AON against exon 9 resulted in a product lacking the entire exon 9 (AON9.1, white arrowhead) or lacking the 3' part of exon 9 (AON9.2, two white arrowheads). Transfection with 50 nM AON10 resulted in a product lacking exon 10 (three white arrowheads). Fibroblasts were transfected with concentrations ranging from 10 to 200 nM per ataxin-3 AON and Lab-on-a-Chip analysis was performed to calculate exon skip levels for (b) AON9.1, (c) AON9.2, and (d) AON10. Mean ± SD, data were evaluated using paired student t-test, * PO.05, ** P<0.01, *** PO.001, relative to mock transfection, n = 4. Figure 14: Double exon skipping of ataxin-3 pre-mRNA in vitro, (a) Schematic representation of two approaches to induce in-frame skipping of the CAG repeat-containing exon. (b) Skip of exon 9 and 10 (AON9.1 + AON10) confirmed by Sanger sequencing, (c) Partial skip of exon 9 and complete skip of exon 10 (AON9.2 + AON10) confirmed by Sanger sequencing, (d) Agarose gel analysis of the ataxin-3 transcript with primers flanking exon 9 and 10.

Transfection of control fibroblasts resulted in a product lacking both exon 9 and 10 (AON9.1 + AON10, black arrowhead) or lacking the 3' part of exon 9 and exon 10 (AON9.2 + AON10, white arrowhead), (e) Lab-on-a-Chip analysis was performed to calculate exon skip levels in control cells. Mean + SD, data were evaluated using paired student t-test, ** P<0.01, *** PO.001, relative to mock, n = 4.

Figure 15: Modified ataxin-3 protein after exon 9 and 10 skipping. Human control and SCA3 fibroblasts were transfected with 50nM of each AON. (a) Transfection with AON9.1 and AON10, or AON9.2 and AON10 resulted in modified ataxin-3 proteins of 35 kDa (ataxin-3 A72aa) and 37 kDa (ataxin-3 A59aa), respectively. The modified protein products were shown using an ataxin-3 specific antibody. The reduction in polyQ-containing mutant ataxin-3 was shown with the polyQ antibody 1C2. Densitometric analysis was used after transfection with AONs. Ataxin-3 A72aa (white bars) and ataxin-3 A59aa (black bars) in (b) control and (c) SCA3 cells. Mean + SD, data were evaluated using paired student t-test, * P<0.05, ** PO.01, *** P<0.001, relative to mock, n = 5. Figure 16: Full-length and modified ataxin-3 protein displays identical ubiquitin binding, (a) Schematic representation of the known functional domains of the ataxin-3 protein involved in deubiquitination. The ataxin-3 protein consists of an N-terminal (Josephin) domain with ubiquitin protease activity and a C-terminal tail with the polyQ repeat and 3 ubiquitin

interacting motifs (UIMs). After exon skipping (ataxin-3 A59aa), the polyQ repeat is removed, leaving the Josephin domain and UIMs intact, (b) Overview of a leucine (L) to alanine (A) substitution in UIM 1 (L229A), UIM 2 (L249A) or both (L229A/L249A) in full-length ataxin-3 and ataxin-3 A59aa. (c) Ubiquitin binding assay. HIS-tagged full-length ataxin-3 and ataxin-3 A59aa-bound ubiquitylated proteins were analyzed by Western blot. HIS control and beads only were taken along as negative control. The modified ataxin-3 A59aa lacking the polyQ repeat showed identical ubiquitylated protein binding as unmodified ataxin-3. (n = 3) Figure 17: Double exon skipping of murine ataxin-3 pre-mRNA in vitro.

Mouse C2C12 cells were transfected with murine ataxin-3 AONs, control AON, scrambled AON, and not transfected (Mock), (a) Agarose gel analysis of the ataxin-3 transcript with primers flanking exon 9 and 10. Skipping of ataxin-3 exon 9 and 10 was seen after transfection with mAON9.1 and mAONlO. (b) Sanger sequencing confirmed the precise skipping of exon 9 and 10. (c)

Transfection with mouse AON9.1 and AON10 resulted in the appearance of a modified ataxin-3 protein of 34 kDa.

Figure 18: Reduction of mouse ataxin-3 exon 9 in vivo. Seven days after a single injection consisting of mAON9 and mAONIO (20 μg each) into the mouse cerebral ventricle. qRT-PCR analysis of cerebellar tissue showed reduced exon 9 and 10 transcript levels, whereas exon 4 and 11 levels were not affected. Mean + SD, data were evaluated using paired student t-test, * PO.05, n = 3.

Figure 19: schematic of APP pre-mRNA and HCHWA-D mutation. The exon- intron structure of APP751 is depicted in this pre-mRNA schematic

representation. The shape of the exon-boxes depict the reading frame. The HCHWA-D mutation is located in exon 16 of APP751.

Figure 20: APP isoforms in human and mouse

Schematic representation of the exon-intron structure of two different human APP isoforms (APP751 and APP770), and mouse APP. The exon containing the HCHWA-D mutation is indicated by the read arrow head. Below the exon- intron scheme is the amino acid sequence encoded for by the exons

surrounding the HCHWA-D mutation-containing exon, where the HCHWA-D mutation is indicated with a blue box, and the gamma-secretase cleavage site with a red box.

Examples

Example 1

AON-mediated exon skipping in neurodegenerative diseases to remove proteolytic cleavage sites. AON-mediated exon skipping in Huntington's disease to remove proteolytic cleavage sites from the huntingtin protein

Methods

AONs and primers

All AONs consisted of 2'-O-methyl RNA and full length phosphorothioate backbones.

Cell cultures and AON transfection

Patient fibroblast cells and human neuroblastoma cells were transfected with AONs at concentrations ranging between 1 - 1000 nM. using Polyethylenemine (PEI) ExGen500 according to the manufacturer's instructions, with 3,3 μΐ PEI per pg of transfected AON. A second transfection was performed 24 hours after the first transfection. RNA was isolated 24 hours after the second transfection and cDNA was synthesized using random hexamer primers.

Cell lines used:

FLB73 Human Fibroblast Control

GM04022 Human Fibroblast HD

GM02173 Human Fibroblast HD

SH-SY5Y Neuroblastoma Control

Quantitative Real-Time PCR (qRT-PCR) was carried out using the

LightCycler® 480 System (Roche) allowing for quantification of gene

expression. Agarose gel and Sanger sequencing

All PCR products were run on 2% agarose gel with 100 base pair ladders. Bands were isolated using the QIAgen® PCR purification kit according to manufacturer's instructions. The samples were then sequenced by Sanger sequencing using the Applied Biosystems BigDyeTerminator v3.1 kit.

Lab-on-a-Chip

Lab-on-a-Chip automated electrophoresis was used to quantify the PCR products using a 2100 Bioanalyzer. Samples were made 1 part β-Actin primed product, as a reference transcript, to 5 parts experimental PCR products. The samples were run on a DNA 1000 chip.

Western blot

Protein was isolated from cells 72 hours after the first transfection and run on a Western blots, transferred onto a PVDF membrane and immunolabelled with primary antibodies recognizing htt, 1H6 or 4C8 (both 1: 1,000 diluted)

Materials

AONs and primers were obtained from Eurogentec, Liege, Belgium.

AON sequences:

HDExl2_l: CGGUGGUGGUCUGGGAGCUGUCGCUGAUG

HDExl2_2: UCACAGCACACACUGCAGG

HDExl3_l: GUUCCUGAAGGCCUCCGAGGCUUCAUCA

HDExl3_2: GGUCCUACUUCUACUCCUUCGGUGU

Patient fibroblast cell lines GM04022 and GM02173 were obtained from

Coriell, Institute for Medical Research, Camden, USA and control fibroblast cell line FLB73 from Maaike Vreeswijk, LUMC. Results

Transfection of AON HDExl2_l in both patient derived HD fibroblast and human neuroblastoma cells showed an efficient skip (see Fig 1) of exon 12. The optimal percentage exon 12 skip was achieved with a concentration of 150nM, but a skip was already visible at InM (see Fig 2). Sanger sequencing confirmed that the last 135 nucleotides of exon 12 were skipped after transfection of the cells with AON HDExl2_l. This corresponded to deletion of 45 amino acids containing two active caspase 3 sites and the first amino acid of an active caspase 6 site (see Fig 3 and 4). In silico analysis revealed that the observed skip is likely due to the activation of the alternative splice site AG I GTRAG resulting in an alternative splice site exon isoform (see Fig 3).

Conclusions

With AON HDExl2_l we have shown a partial skip of exon 12 of the huntingtin transcript that results in a truncated but in frame protein product. Using different cell lines we have confirmed this partial exon 12 skip by Sanger sequencing and in silico analysis revealed a alternative splice site in exon 12 that is likely the cause of this partial skip. This skipped protein product misses two complete caspase-3 cleavage sites located in exon 12, and the first amino acid of the caspase-6 cleavage site that is located on the border of exon 12 and 13. Recent mouse model data showed that the preferred site of in vivo htt cleavage to be at amino acid 552, which is used in vitro by either caspase-3 or caspase-2 ¹ and that mutation of the last amino acid of the caspase 6 cleavage site at amino acid position 586 reduces toxicity in an HD model ².

Functional analysis will be performed to determine whether AON HDExl2_l can reduce the toxicity of mutant huntingtin and to determine the level of prevention of formation of toxic N-terminal huntingtin fragments. Also other AONs will be tested to completely skip exons 12 and 13 of the huntingtin transcript.

Example 2

AON mediated skipping of htt exon 12 or 13 in human fibroblasts

The caspase-6 site at amino acid position 586 previously shown to be important in disease pathology is encoded partly in exon 12 and partly in exon 13. Exon 12 also encodes two active caspase-3 sites at amino acids 513 and 552 (10,33). Skipping of both exon 12 and 13 would maintain the open reading frame and therefore is anticipated to generate a shorter htt protein lacking these 3 caspase sites (see Figure 6). The AONs used in this study are shown below.

AON Name Sequence (5' - 3')

hHTTExl2_7 GUCCCAUCAUUCAGGUCCAU

hHTTExl2_5 CUCAAGAUAUCCUCCUCAUC

hHTTExl3_l GGCUGUCCAAUCUGCAGG

Control AON UCCUUUCAUCUCUGGGCUC

mAON12.1 GGCUCAAGAUGUCCUCCUCAUCC

mAON12.2 UUUCAGAACUGUCCGAAGGAGUC

mAON13 GGCUGUCCUAUCUGCAUG

Scrambled AON CUGAACUGGUCUACAGCUC

Alexa488 AON GGUACACCUAGCGGAACAAU

AONs were transfected in human fibroblasts, total RNA was isolated after 24 hours and cDNA was amplified using htt primers flanking the skipped exons to examine skipping efficiencies. When transfected individually, none of the AONs induced exon 12 skipping. A complete exon 12 skip of 341 base pairs could be achieved by combining two AONs (hHTTExl2_7 and hHTTExl2_5). The most efficient complete exon 12 skip of 30.9% (±0.3%) was achieved by transfecting ΙΟΟηΜ of each hHTTExl2_7 and hHTTExl2_5 (Fig. 7A). Skipping efficiency of htt exon 13 by hHTTExl3_l was (45.2% ±3.4%) at a concentration of 50nM (Fig. 7B). Skipped products were confirmed by Sanger sequencing. With a full skip of both exon 12 and 13 the mRNA reading frame is maintained. With a combination of three AONs we achieved an efficient skip of htt exon 12 and exon 13. This resulted in a skip of 465 base pairs (Fig. 8A) that was confirmed by Sanger sequencing (Fig 8F). The efficiency of this double skip was 62.4% (±3.2%) and 58.0% (±19.1%) in HD and control cells, respectively (Fig. 8C and D). Partial exon 12 skipping results in a shorter htt protein resistant to caspase 6 cleavage Interestingly, hHTTExl2_7, targeting the 3' part of exon 12 resulted in a partial skip of exon 12 of 135 base pairs (Fig. 8A) that was confirmed by Sanger sequencing (Fig. 8E). The highest skipping percentage of hHTTExl2_7 in control cells was 59.9% (±0.7%) at a concentration of 50 nM (Fig. 8B). The efficiency of this partial skip in HD cells was 62.2% (±3.6%) (Fig. 8C). This partial exclusion of the 3' part of htt exon 12 can be explained by activation of a cryptic 5' splice site present within exon 12 (AG I GTCAG).

Western blot analysis using the 4C8 antibody indeed revealed an additional band of approximately 343 kDa after transfection with hHTTExl2_7 (Fig. 9A). The 5 kDa shorter htt protein is in concordance with the calculated 45 amino acid skip after AON12.1 transfection. This shorter htt protein represents 27.9% (±15.1%) of total htt protein levels (Fig. 9B).

To test if the modified htt protein was resistant to caspase-6 cleavage at amino acid position 586 we performed an in vitro caspase-6 assay. Protein was isolated from human fibroblasts three days after treatment with 50 nM of hHTTExl2_7. Htt protein fragments were detected by Western blotting using the 4C8 antibody. After samples were incubated with recombinant active caspase-6, N-terminal htt fragments of 98 kDa were detected (Fig. 9C).

Previous studies showed that these fragments are involved in neuronal dysfunction and neurodegeneration in HD. Samples treated with hHTTExl2_7 resulted in a 31.9% (±21.5%) reduction of these 98 kDa htt fragments, while the shorter htt fragment of 35 kDa, which is not cleaved at amino acid 586, remained unchanged (Fig. 9D). This shows that mutating the

first amino acid of the 586 amino acid caspase-6 motif is sufficient to prevent proteolytic cleavage.

Example 3

Removal of the 586 caspase-6 cleavage site from mouse htt protein in vitro and in vivo

To investigate the potential of htt exon skipping in vivo and to test if removal of the amino acid sequence surrounding the 586 caspase-6 cleavage site could be harmful in vivo, we designed AONs homologues to the mouse sequence. Since mice do not exhibit the cryptic splice site that is responsible for the partial skip in human cells, we investigated the full skip of exon 12 and 13 as was described for the human cells. Transfection of 200nM of each mouse specific htt AON targeting exon 12 and 13 in mouse C2C12 cells showed a skip of both exons with an efficiency of 86.8% (±5.6) (Fig. 10A and B).

To investigate distribution of the AON in the mouse brain, 10 pg of Alexa Fluor 488 labeled control AON was injected bilaterally into the striatum of a control mouse. The mouse was sacrificed after one week, the brain was perfused, and sections were immunolabeled using the neuronal marker NeuN and astrocyte marker glial fibrillary acidic protein (GFAP). Examination under the fluorescence microscope showed AON distribution throughout the midbrain in both astrocytes and neuronal cells (see Fig. 11A and B).

Next, a single dose of 30 pg scrambled AON or 30 pg AON mix (10 pg per AON) was injected bilaterally into the mouse striatum. After 7 days the mice were sacrificed and expression levels of exon 12 and 13 in the mouse htt transcript were assessed by qRT-PCR (Fig. 12). Exon 12 was significantly reduced by 21.5% (±8.5%) and exon 13 was significantly reduced by 23.1% (±8.3%). Exon 27, downstream of the area targeted for skipping, was not reduced showing that a single intrastriatal administration of AONs already resulted in a skip of htt exon 12 and 13.

Material and methods

In vivo injection into mice

Mouse htt specific AONs (mAON12.1, mAON12.2, and mAON13) and scrambled control AONs were injected in anesthetized C57bl/6j male mice between the ages of 12-14 weeks (Janvier SAS, France). Animals were singly housed in individually ventilated cages (JVC) at a 12 hour light cycle with lights on at 7 am. Food and water were available ad libitum. Animals were anesthetized with a cocktail of Hypnorm-Dormicum-demineralized water in a volume ratio of 1.33: 1:3. The depth of anesthesia was confirmed by examining the paw and tail reflexes. When mice were deeply anesthetized they were mounted on a Kopf stereotact (David Kopf instruments, Tujunga, USA). A total of 30 pg AON mix diluted in 2.5 μΐ sterile saline was bilaterally injected at the exact locations 0.50mm frontal from bregma, ±2.0mm medio-lateral,

and -3.5mm dorso-ventral. For injections, customized borosilicate glass micro- capillary tips of approximately 100 pm in diameter, connected to a Hamilton needle (5 μΐ, 30 gauge) were used. The Hamilton syringe was connected to an injection pump (Harvard apparatus, Holliston, MA, USA) which controlled the injection rate set at 0.5 μΐ/min. After surgery the animals were returned to the home cage and remained undisturbed until sacrifice, with the exception of daily weighing in order to monitor their recovery from surgery. After 7 days the mice were sacrificed by intraperitoneal injection of overdose Euthasol (ASTfarma, Oudewater, the Netherlands) and brain tissue isolated and snap frozen till further analysis. To determine AON distribution 2 mice were injected with 10 pg of Alexa Fluor 488 labeled control AON. After 7 days the mice were sacrificed, perfused and brain isolated and frozen till further analysis.

Immunohistochemistry on mouse brain sections To assess AON distribution, brains were removed and post fixated overnight in 4% paraformaldehyde (PFA) (Sigma, St. Louis, USA) in PBS at 4oC.

Subsequently they were cryoprotected in 15% and 30% sucrose in PBS, snap frozen on dry ice and stored at -80oC. Brains were cut into 30 pm sections on a Leica cryostat and sections stored in 0.1% sodium azide in PBS. Sections were stained free floating and after three washes in PBS containing 0.2% Triton X- 100 (PBS-Triton) were incubated overnight at 4°C with mouse anti-NeuN (Millipore) or rabbit anti-GFAP (Sigma), both diluted 1:5000 in PBS-Triton with 1% normal goat serum and 0.4% Thimerosal (Sigma). Next, sections were washed, incubated for 3 hours with rabbit anti-Alexa594 (Invitrogen Life

Technologies). After three more washes, sections were mounted on glass slides with a DAPI/DABCO solution and examined on a Leica confocal microscope. Calculations and statistical analysis

RNA and protein skipping percentages were calculated using the following formula: Skipping% = (Molarity skipped product / (Total molarity full length product + skipped product)) * 100%. The 95 kDa N-terminal htt fragment levels were calculated using the 35 kDa caspase-6 fragment as reference. The skipping percentages were analyzed using a paired two-sided Student t test. Differences were considered significant when P < 0.05.

Example 4

AON mediated skipping of ataxin-3 exon 9 and 10 in vitro

The CAG repeat in the ATXN3 gene is located in exon 10, which is 119 nucleotides in length. Thus skipping will disrupt the reading frame. To preserve the reading frame exon 9 (97 nucleotides) and 10 need to be skipped simultaneously (Figure 14a). Various AONs were designed targeting exon internal sequences of ataxin-3 exon 9 and 10 and transfected in human fibroblasts (Table 1). PCR analysis revealed a 97 nucleotide skip after transfection with ΙΟΟηΜ of AON9.1 (efficiency = 59.2% ±1.0%) (Figure 13a and b). Sanger sequencing confirmed that this was a skip of exon 9. Transfection with 100 nM AON9.2 resulted in a skip of 55 nucleotides (efficiency = 62.3% ±3.7%) instead of the anticipated 97 nucleotides (Figure 13a and c). Sanger sequencing revealed that this fragment was a partial skip product that still contained the 5' part of exon 9. In silico analysis showed the existence of a cryptic 5' splice site AG I GTCCA in exon 9 that could explain the occurrence of this shorter fragment ²⁴. Successful skipping of exon 10 was achieved with 50 nM AON 10 (efficiency = 96.3% ±0.3%) (Figure 13a and d), as confirmed by Sanger sequencing. Co-transfection of AON9.1 and AON10 and AON9.2 and AON10 resulted in a skip of respectively 216 and 174 nucleotides (Figure 14b and c). The efficiency of the AON9.1 and AON10 induced double skip was 77.0% (±0.9%) in control fibroblasts (Figure 14d and e). The efficiency of AON9.2 and AON 10 co- transfection was 97.8% (±0.8%) in control fibroblasts (Figure 14d and e). The unexpected in-frame partial skip of exon 9 with AON9.2 resulted in an alternative approach to remove the CAG repeat containing exon from the ataxin-3 protein (Figure 14).

Modified ataxin-3 protein maintains it ubiquitin binding capacity

To investigate if AON transfection resulted in a modified ataxin-3 protein, control and SCA3 fibroblasts were transfected with AONs targeting exon 9 and 10 and protein was isolated three days after transfection. We did not see a negative effect on cell viability after AON treatment in either control or SCA3 fibroblasts. Western blot analysis using an ataxin-3 -specific antibody revealed a modified band of approximately 35 kDa after the complete skip of exon 9 and 10 (ataxin-3 A72aa) (Figure 15a); 11.4% (±5.1%) and 6.2% (±1.9%) of total ataxin-3 protein levels consisted of this modified ataxin-3 A72aa protein , in respectively control and SCA3 fibroblasts (Figure 15 b and c).

The partial exon skip resulted in a novel 37 kDa protein (ataxin-3 A59aa) (Figure 15a). 27.1% (±9.0%) and 15.9% (±3.2%) of total ataxin-3 protein levels consisted of this 59 amino acids shorter ataxin-3 protein, in respectively control and SCA3 cells (Figure 15 b and c). The ataxin-3 A72aa protein was also formed, suggesting that AON9.2 and AON 10 transfection also resulted in some ataxin-3 A72aa protein. The consistent lower percentage of exon skipping in SCA3 cells were caused by the lower AON transfection efficiencies in the diseased cells as compared to control cells.

A significant reduction in expanded polyQ containing ataxin-3 was shown using the 1C2 antibody, that recognizes long glutamine stretches (Figure 15a) in the samples with the full and partial exon skip approaches. This indicates a reduction of expanded polyQ -containing ataxin-3 in SCA3 patient derived fibroblasts after AON transfection.

The polyQ repeat in the ataxin-3 protein is located between the second and third UIM (Figure 16a). Both full and partial exon skip approaches resulted in removal of the polyQ repeat, preserving the Josephin domain, nuclear export signal (NES), and UIMs. To investigate whether the ubiquitin binding capacities of the UIMs in ataxin-3 are still intact after protein modification, poly-ubiquitin chains were incubated with purified cell free produced full- length ataxin-3 and ataxin-3 A59aa protein. As negative controls, we produced 3 different ataxin-3 protein products containing 1 amino acid substitutions from leucine (L) to alanine (A) in UIM 1 (L229A), UIM 2 (L249A), or both (L229A/L249A) (Figure 16B). Single amino acid changes in UIM 1 (L229A) already showed reduced binding of ataxin-3 to poly-ubiquitin chains, whereas double UIM mutated ataxin-3 (L229A/L249A) resulted in a nearly complete elimination poly-ubiquitin binding (Figure 16c). The negative HIS control protein did not bind ubiquitylated proteins as expected. Ataxin-3 A59aa bound poly-ubiquitin chains comparable to full-length ataxin-3, indicating that its ubiquitin binding capacity after protein modification is still intact (Figure 16c). AON mediated skipping of ataxin-3 exon 9 and 10 in mouse

To examine ataxin-3 exon skipping in the mouse brain and to determine if the modified protein is not harmful, we designed AONs specific to the mouse sequence. Since mice do not exhibit the cryptic splice site that is responsible for the partial exon 9 skip in the human transcript, we only investigated the full skip of exon 9 and 10. Transfection of 200 nM of each murine AON9

(mAON9) and AON10 (mAONIO) in mouse C2C12 cells showed a skip of both exons with an efficiency of 31.7% (±2.4%) (Figure 17a). Sanger sequencing confirmed this in -frame double exon skip (Figure 17b). Transfection with mAON9 and mAONIO resulted in formation of a modified protein of 34 kDa (Figure 17c).

Next, a single intra-cerebral ventricular (ICV) injection was administered of 40 μg ataxin-3 AON mix (20 μg per AON) or 40 μg scrambled AON. After 7 days the mice were sacrificed and skipping efficiency in the cerebellum was assessed by qRT-PCR (Figure 18). Exon 9 was found significantly reduced by 44.5% (±7.6%) and exon 10 was reduced by 35.9% (±14.1%) after a single ICV injection of AONs as compared to scrambled AON. Exon 4, upstream, and exon 11, downstream of the area targeted for skipping were not reduced,

demonstrating a specific skip of ataxin-3 exon 9 and 10 in vivo.

In the current study we show a novel approach to reduce toxicity of the mutant ataxin-3 protein through skipping of the CAG repeat containing exon in the ataxin-3 transcript. The resulting modified ataxin-3 protein lacks the polyQ repeat that is toxic when expanded, but maintains its ubiquitin binding properties. ICV administration of these AONs in mice resulted in skipping of the CAG repeat-containing exon in the cerebellum of control mice, proving distribution and efficiency of ataxin-3 exon skipping after ICV injection in vivo. There was no negative effect on cell viability after AON treatment in both control and SCA3 fibroblasts and also no overt toxicity in vivo. Additional Materials and methods

Cell culture and transfection

Patient derived fibroblasts from SCA3 patients (GM06151, purchased from Coriell Cell Repositories, Camden, USA) and controls (FLB73, a kind gift from Dr. M.P.G. Vreeswijk, LUMC) were cultured at 37°C and 5% C0₂ in Minimal Essential Medium (MEM) (Gibco Invitrogen, Carlsbad, USA) with 15% heat inactivated Fetal Bovine Serum (FBS) (Clontech, Palo Alto USA), 1%

Glutamax (Gibco) and 100 U/ml penicillin/streptomycin (P/S) (Gibco). Mouse myoblasts C2C12 (ATCC, Teddington, UK) were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Gibco) with 10% FBS, 1% glucose, 2% Glutamax and 100 U/ml P/S.

AON transfection was performed in a 6-well plate with 3 μΐ of Lipofectamine 2000 (Life Technologies, Paisley, UK) per well. AON and Lipofectamine 2000 were diluted in MEM to a total volume of 500 Dl and mixtures were prepared according to the manufacturer's instruction. Four different transfection conditions were used: 1) transfection with 1-200 nM AONs, 2) transfection with non-relevant h40AON2 directed against exon 40 of the DMD gene

(Control AON) ³⁶, 3) transfection with scrambled AON (Scrambled), and 4) transfection without AON (Mock). For AON sequences, see Table 1. Mixtures were added to a total volume of 1 ml of MEM. Four hours after transfection, medium was replaced with fresh medium containing 5% FBS. All AONs consisted of 2'-O-methyl RNA and contained a full-length phosphorothioate modified backbone (Eurogentec, Liege, Belgium).

TABLE 1: Antisense oligonucleotides sequences used for transfection and injection

References cited

1. Wellington, C.L. et al. Inhibiting caspase cleavage of huntingtin reduces toxicity and aggregate formation in neuronal and nonneuronal cells. J. Biol. Chem. 275, 19831-19838 (2000). 2. Graham, R.K. et al. Cleavage at the Caspase-6 Site Is Required for

Neuronal Dysfunction and Degeneration Due to Mutant Huntingtin. Cell 125, 1179-1191 (2006). Table la: Polyglutamine (PolyQ) Diseases

Normal Pathogenic

Type Gene PolyQ PolyQ

repeats repeats

DRPLA

(Dentatorubropallidoluysian ATN1 or DRPLA 6 - 35 49 - 88 atrophy)

HD (Huntington's disease) Htt (Huntingtin) 10 - 35 35+

Androgen

SBMA (Spinobulbar muscular

receptor on the X 9 - 36 38 - 62 atrophy or Kennedy disease)

chromosome.

SCAl (Spinocerebellar ataxia

ATXN1 6 - 35 49 - 88 Type 1)

SCA2 (Spinocerebellar ataxia

ATXN2 14 - 32 33 - 77 Type 2)

SCA3 (Spinocerebellar ataxia

Type 3 or Machado-Joseph ATXN3 12 - 40 55 - 86 disease)

SCA6 (Spinocerebellar ataxia

CACNA1A 4 - 18 21 - 30 Type 6)

SCA7 (Spinocerebellar ataxia

ATXN7 7 - 17 38 - 120 Type 7)

SCAl 7 (Spinocerebellar ataxia

TBP 25 - 42 47 - 63 Type 17) Table lb: Non-Polyglutamine Diseases

Unstable repeat disorders caused by loss-of -function, RNA-mediated, or unknown mechanism

MIM Norma Main clinical

Diseas Repea Gene Expanded

Numbe 1 features e t unit product repeat

r repeat length

Loss of function mechanism

FRAXA 309550 (CGC)n FMRP 6-60 >200 (full Mental

mutation) retardation, macroorchidsm, connective tissue defects, behavioral abnormahties

FRAXE 309548 (CCG)n FMR2 4-39 200-900 Mental

retardation

FRDA 229300 (GAA)n Frataxin 6-32 200-1700 Sensory ataxia, car diomy op athy , diabetes

RNA-mediated pathogenesis

DM1 160900 (CTG)n DMPK 5-37 50-10,000 Myotonia,

weakness, cardiac conduction defects, insulin resistance, cataracts, testicular

Annual Review of Neuroscience

Vol. 30: 575-621 (Volume publication date July 2007)

Trinucleotide Repeat Disorders

Harry T. Orr and Huda Y. Zoghbi

Table 2

List of AON

HDExl2_l: CGGUGGUGGUCUGGGAGCUGUCGCUGAUG HDExl2_2: UCACAGCACACACUGCAGG

HDExl3_l: GUUCCUGAAGGCCUCCGAGGCUUCAUCA HDExl3_2: GGUCCUACUUCUACUCCUUCGGUGU HDExl2_2 is a comparative example of an oligonucleotide having the nucleotide sequence of Htt in the sense strand.

DRPLA AONs:

1 DRPLAEx5_18 GUC GCU GCU GCC AUC AUC AU

2 DRPLAEx5_128 AAG AGG AAG CAG GAG GCA GA

3 DRPLAEx5_81 GGA GGA GCC UGG AAC AUU CG

1 DRPLAEx6_80 AAG CUC GCG CUC CUU CUC GC

2 DRPLAEx6_l CGA GUU GAA GCC GCG AUC CA

3 DRPLAEx6 84 GUU CAA GCU CGC GCU CCU UC

HDEx AON are oligonucleotides for skipping exons 12 or 13 of the Htt gene. DRPLA AON are oligonucleotides for skipping exons 5 or 6 of the

DRPLA/ATNl gene. Table 3 provides further oligonucleotides for exon skipping.

APP: amyloid precursor protein in Alzheimer's disease (AD); ATNl: Atrophin 1 in DRPLA; ATNX3: Ataxin 3 for SCA3; ATXN7: Ataxin 7 in SCA7; TBP: TATA binding protein for SCA17; and HTT in Huntington's disease (HD)

Table 3 AON sequences targeting proteins involved in neurodegenerative diseases

Disease AON Name Target Sequence AON Sequence

AD hAPPExl5_ _1 GTTCTGGGTTGACAAATATCAAG CUUGAUAUUUGUCAACCCAGAAC

AD hAPPExl5_ _2 CGGAGGAGATCTCTGAAGTGAAG CUUCACUUCAGAGAUCUCCUCCG

AD hAPPExl5_ _3 GATGC AGAATTC C GAC ATGAC GUCAUGUCGGAAUUCUGCAUC

AD hAPPExl5_ _4 CTCAGGATATGAAGTTCATCATC GAUGAUGAACUUCAUAUCCUGAG

AD hAPPExl6_ _1 GCAATCATTGGACTCATGGT ACCAUGAGUCCAAUGAUUGC

AD hAPPExl6_ _2 GATCGTCATCACCTTGGTGA UCACCAAGGUGAUGACGAUC

AD hAPPExl6_ _3 GTACACATCCATTCATCATGGTG CACCAUGAUGAAUGGAUGUGUAC

AD hAPPExl6_ _4 GCAGAAGATGTGGGTTCAAAC GUUUGAACCCACAUCUUCUGC

AD hAPPExl6_ _5 GGTGATGCTGAAGAAGAAACAG CUGUUUCUUCUUCAGCAUCACC

AD hAPPExl6_ 6 TCATCATGGTGTGGTGGAGGTAG CUACCUCCACCACACCAUGAUGA

DRPLA hATNlEx5_ _1 CTCCCTCGGCCACAGTCTCCCT AGGGAGACUGUGGCCGAGGGAG

DRPLA hATNlEx5_ _2 GCGGAGCCTTAATGATGATGGC GCCAUCAUCAUUAAGGCUCCGC

DRPLA hATNlEx5_ _3 AGCAGCGACCCTAGGGATATCG CGAUAUCCCUAGGGUCGCUGCU

DRPLA hATNlEx5_ _4 AGGAC AAC C GAAGC AC GTC C C GGGACGUGCUUCGGUUGUCCU

DRPLA hATNlEx5_ _5 TGGAAGTGTGGAGAATGACTCTG CAGAGUCAUUCUCCACACUUCCA

DRPLA hATNlEx5_ _6 ATCTTCTGGCCTGTCCCAGGGC GCCCUGGGACAGGCCAGAAGAU

DRPLA hATNlEx5_ _7 CGACAGCCAGAGGCTAGCTTTGA UCAAAGCUAGCCUCUGGCUGUCG

DRPLA hATNlEx5_ _8 CTCGAATGTTCCAGGCTCCTCC GGAGGAGCCUGGAACAUUCGAG

DRPLA hATNlEx5_ _9 TCTATCCTGGGGGCACTGGTGG CCACCAGUGCCCCCAGGAUAGA

DRPLA hATNlEx5_ _10 TGGACCCCCAATGGGTCCCAAG CUUGGGACCCAUUGGGGGUCCA

DRPLA hATNlEx5_ _11 AGGGGCTGCCTCATCAGTGG CCACUGAUGAGGCAGCCCCU

DRPLA hATNlEx5_ _12 AAGCTCTGGGGCTAGTGGTGCTC GAGCACCACUAGCCCCAGAGCUU

DRPLA hATNlEx5_ _13 ACAAAGCCGCCTACCACTCCAG CUGGAGUGGUAGGCGGCUUUGU

DRPLA hATNlEx5_ _14 CTCCACCACCAGCCAACTTCC GGAAGUUGGCUGGUGGUGGAG

DRPLA hATNlEx5_ _15 CCAACCACTACCTGGTCATCTG CAGAUGACCAGGUAGUGGUUGG

DRPLA hATNlEx5_ _16 TGGCCCAGAGAAGGGCCCAAC GUUGGGCCCUUCUCUGGGCCA

DRPLA hATNlEx5_ _17 TTCCTCTTCTGCTCCAGCGCC GGCGCUGGAGCAGAAGAGGAA

DRPLA hATNlEx5_ _18 GTTTCCTTATTCATCCTCTAG CUAGAGGAUGAAUAAGGAAAC

DRPLA hATNlEx5_ _19 GCCTCTCTGTCTCCAATCAGC GCUGAUUGGAGACAGAGAGGC

DRPLA hATNlEx5_ _20 CCATCCCAGGCTGTGTGGAG CUCCACACAGCCUGGGAUGG

DRPLA hATNlEx5_ _21 TCTACTGGGGCCCAGTCCACCG CGGUGGACUGGGCCCCAGUAGA

DRPLA hATNlEx5_ _22 GCATCACGGAAACTCTGGGCC GGCCCAGAGUUUCCGUGAUGC

DRPLA hATNlEx5_ _23 CCACTGGAGGGCGGTAGCTCC GGAGCUACCGCCCUCCAGUGG

DRPLA hATNlEx5_ _24 CTCCCTGGGGTCTCTGAGGCC GGCCUCAGAGACCCCAGGGAG

DRPLA hATNlEx5_ _25 CACCAGGGCCAGCACACCTGC GCAGGUGUGCUGGCCCUGGUG

DRPLA hATNlEx5_ _26 GTGTC CTAC AGC C AAGC AGGC C GGCCUGCUUGGCUGUAGGACAC

DRPLA hATNlEx5_ _27 CAAGGGTCCTACCCATGTTCAC GUGAACAUGGGUAGGACCCUUG

DRPLA hATNlEx5_ _28 C AC C GGTGC CT AC GGTC AC C AC GUGGUGACCGUAGGCACCGGUG

DRPLA hATNlEx5_ _29 CTCTTCGGCTACCCTTTCCAC GUGGAAAGGGUAGCCGAAGAG

DRPLA hATNlEx5_ _30 GGTCATTGCCACCGTGGCTTC GAAGCCACGGUGGCAAUGACC

DRPLA hATNlEx5_ _31 C C AC C GTAC GGAAAGAGAGC C GGCUCUCUUUCCGUACGGUGG

DRPLA hATNlEx5_ _32 CCACCGGGCTATCGAGGAACCTC GAGGUUCCUCGAUAGCCCGGUGG

DRPLA hATNlEx5_ _33 CAGGCCCAGGGACCTTCAAGCC GGCUUGAAGGUCCCUGGGCCUG

DRPLA hATNlEx5_ _34 CCACCGTGGGACCTGGGCCCCTG CAGGGGCCCAGGUCCCACGGUGG

DRPLA hATNlEx5_ _35 GCCACCTGCGGGGCCCTCAGGC GCCUGAGGGCCCCGCAGGUGGC

DRPLA hATNlEx5_ _36 CCATCGCTGCCACCACCACCT AGGUGGUGGUGGCAGCGAUGG

DRPLA hATNlEx5_ _37 CCTGCCTCAGGGCCGCCCCTG CAGGGGCGGCCCUGAGGCAGG

DRPLA hATNlEx5_ _38 GCCGGCTGAGGAGTATGAGACC GGUCUCAUACUCCUCAGCCGGC

DRPLA hATNlEx5_ _39 C C AAGGTGGT AGATGTAC C C A UGGGUACAUCUACCACCUUGG

DRPLA hATNlEx5_ _40 GCCATGCCAGTCAGTCTGCCAG CUGGCAGACUGACUGGCAUGGC

DRPLA hATNlEx6_ I CCTGGATCGCGGCTTCAACTC GAGUUGAAGCCGCGAUCCAGG

DRPLA hATNlEx6_ _2 CCTGTACTTCGTGCCACTGGAGG CCUCCAGUGGCACGAAGUACAGG

DRPLA hATNlEx6_ _3 GACCTGGTGGAGAAGGTGCGGCG CGCCGCACCUUCUCCACCAGGUC

DRPLA hATNlEx6_ _4 CGCGAAGAAAAGGAGCGCGAGCG CGCUCGCGCUCCUUUUCUUCGCG

DRPLA hATNlEx6_ _5 GCGAGCGGGAACGCGAGAAAG CUUUCUCGCGUUCCCGCUCGC

DRPLA hATNlEx6_6 GCGAGAAGGAGCGCGAGCTTG CAAGCUCGCGCUCCUUCUCGC

SCA3 hATXN3Ex7_l TTGTCGTTAAGGGTGATCTGC GCAGAUCACCCUUAACGACAA

SCA3 hATXN3Ex7_2 CTGCCAGATTGCGAAGCTGA UCAGCUUCGCAAUCUGGCAG

SCA3 hATXN3Ex7_3 GACCAACTCCTGCAGATGATT AAUCAUCUGCAGGAGUUGGUC

SCA3 hATXN3Ex7_4 GGTCCAACAGATGCATCGAC GUCGAUGCAUCUGUUGGACC

SCA3 hATXN3Ex7_5 GCACAACTAAAAGAGCAAAG CUUUGCUCUUUUAGUUGUGC

SCA3 hATXN3Ex8_l GTTAGAAGCAAATGATGGCTC GAGCCAUCAUUUGCUUCUAAC

SCA3 hATXN3Ex8_2 CTCAGGAATGTTAGACGAAG CUUCGUCUAACAUUCCUGAG

SCA3 hATXN3Ex8_3 GAGGAGGATTTGCAGAGGGC GCCCUCUGCAAAUCCUCCUC

SCA3 hATXN3Ex8_4 GAGGAAGCAGATCTCCGCAG CUGCGGAGAUCUGCUUCCUC

SCA3 hATXN3Ex8_5 GGCTATTCAGCTAAGTATGCAAG CUUGCAUACUUAGCUGAAUAGCC

SCA3 hATXN3Ex9_l GGTAGTTCCAGAAACATATCTC GAGAUAUGUUUCUGGAACUACC

SCA3 hATXN3Ex9_2 GCTTCGGAAGAGACGAGAAGC GCUUCUCGUCUCUUCCGAAGC hATXN3ExlO_

SCA3 1 CAGCAGCAAAAGCAGCAACAGC GCUGUUGCUGCUUUUGCUGCUG hATXN3ExlO_

SCA3 2 GACCTATCAGGACAGAGTTC GAACUCUGUCCUGAUAGGUC

SCA7 hATXN7Ex3_l GAGCGGAAAGAATGTCGGAGC GCUCCGACAUUCUUUCCGCUC

SCA7 hATXN7Ex3_2 AGCGGGCCGCGGATGACGTCA UGACGUCAUCCGCGGCCCGCU

SCA7 hATXN7Ex3_3 AGCAGCCGCCGCCTCCGCAG CUGCGGAGGCGGCGGCUGCU

SCA7 hATXN7Ex3_4 ACACGGCCGGAGGACGGCG CGCCGUCCUCCGGCCGUGU

SCA7 hATXN7Ex3_5 GCGCCGCCTCCACCTCGGCCG CGGCCGAGGUGGAGGCGGCGC

SCA7 hATXN7Ex3_6 ACCTCGGCCGCCGCAATGGCGA UCGCCAUUGCGGCGGCCGAGGU

SCA7 hATXN7Ex3_7 GGCCTCTGCCCAGTCCTGAAGT ACUUCAGGACUGGGCAGAGGCC

SCA7 hATXN7Ex3_8 TGATGCTGGGACAGTCGTGGAAT AUUCCACGACUGUCCCAGCAUCA

SCA7 hATXN7Ex3 9 AGGCTTCCAAACTTCCTGGGAAG CUUCCCAGGAAGUUUGGAAGCCU

CATCAGCGACAGCTCCCAGACCACCACC

HD hHTTExl2_l G CGGUGGUGGUCUGGGAGCUGUCGCUGAUG

HD hHTTExl2_2 TCACAGCACACACTGCAGGC GCCUGCAGUGUGUGCUGUGA

HD HTTExl2_3 GGTCAGCAGGTCATGACATCAT AUGAUGUCAUGACCUGCUGACC

HD HTTExl2_4 AGAGCTGGCTGCTTCTTCAG CUGAAGAAGCAGCCAGCUCU

HD hHTTExl2_5 GATGAGGAGGATATCTTGAG CUCAAGAUAUCCUCCUCAUC

HD HTTExl2_6 TCAGTGAAGGATGAGATCAGTGG CCACUGAUCUCAUCCUUCACUGA

HD hHTTExl2_7 ATGGACCTGAATGATGGGAC GUCCCAUCAUUCAGGUCCAU

HD HTTExl2_8 TGACAAGCTCTGCCACTGAT AUCAGUGGCAGAGCUUGUCA

HD HTTExl2_9 TCCAGCCAGGTCAGCGCCGT ACGGCGCUGACCUGGCUGGA

HD HTTExl2_10 ACTCAGTGGATCTGGCCAGCT AGCUGGCCAGAUCCACUGAGU

HD HTTExl3_l CCTGCAGATTGGACAGCC GGCUGUCCAAUCUGCAGG

HD hHTTExl3_2 GGTAC C GAC AAC C AGTATTT AAAUACUGGUUGUCGGUACC

HD hHTTExl4_l AACATGAGTCACTGCAGGCAG CUGCCUGCAGUGACUCAUGUU

HD hHTTExl4_2 GCCTTCTGACAGCAGTGTTGAT AUCAACACUGCUGUCAGAAGGC

HD hHTTExl4_3 GTTGAGAGATGAAGCTACTG CAGUAGCUUCAUCUCUCAAC

SCA17 hTBPEx3_l: GCCATGACTCCCGGAATCCCTA UAGGGAUUCCGGGAGUCAUGGC

SCA17 hTBPEx3_2: CCTATCTTTAGTCCAATGATGC GCAUCAUUGGACUAAAGAUAGG

SCA17 hTBPEx3_3: TATGGCACTGGACTGACCCCAC GUGGGGUCAGUCCAGUGCCAUA

SCA17 hTBPEx3_4: GCAGCTGCAGCCGTTCAGCAG CUGCUGAACGGCUGCAGCUGC

SCA17 hTBPEx3_5: GTTC AGC AGTC AAC GTC C C AGC GCUGGGACGUUGACUGCUGAAC

SCA17 hTBPEx3_6: AACCTCAGGCCAGGCACCACAG CUGUGGUGCCUGGCCUGAGGUU

SCA17 hTBPEx3_7: GCACCACAGCTCTTCCACTCA UGAGUGGAAGAGCUGUGGUGC

SCA17 hTBPEx3_8: CTCACAGACTCTCACAACTGC GCAGUUGUGAGAGUCUGUGAG

SCA17 hTBPEx3_9: GGCACCACTCCACTGTATCCCT AGGGAUACAGUGGAGUGGUGCC

SCA17 hTBPEx3_10: CATCACTCCTGCCACGCCAGCT AGCUGGCGUGGCAGGAGUGAUG

SCA17 hTBPEx3_l l: AGAGTTCTGGGATTGTACCGCA UGCGGUACAAUCCCAGAACUCU

SCA17 hTBPEx4_l: TGTATCCACAGTGAATCTTGGT ACCAAGAUUCACUGUGGAUACA

SCA17 hTBPEx4_2: GGTTGTAAACTTGACCTAAAG CUUUAGGUCAAGUUUACAACC

SCA17 hTBPEx4_3: CATTGCACTTCGTGCCCGAAACG CGUUUCGGGCACGAAGUGCAAUG

Claims

Claims

1. A method for treating a disease that is associated with a mutant gene that comprises a trinucleotide repeat expansion when compared to the gene of a normal individual, said method comprising administering to an individual in need thereof a therapeutically effective amount of one or more anti-sense oligonucleotides that induces skipping of an exonic sequence that comprises said trinucleotide repeat expansion.

2. The method according to claim 1, wherein the mutant gene is the causative gene of a polyglutamine disorder.

3. The method according to claim 2, wherein said gene is the ATXN3 gene and exonic sequences from exons 9 and 10 are skipped.

4. A method for removing the amino acids encoded by a trinucleotide repeat expansion from a mutant protein, comprising providing a cell that expresses pre-mRNA encoding said protein with an anti-sense oligonucleotide that induces skipping of an exonic sequence that comprises said trinucleotide repeat expansion, the method further comprising allowing translation of mRNA produced from said pre-mRNA.

5. The method according to claim 4, wherein the trinucleotide repeat expansion is a polyglutamine expansion.

6. One or more oligonucleotides of between 14-40 nucleotides that induces skipping of an exonic sequence that comprises a trinucleotide repeat expansion in a pre-mRNA.

7. The one or more oligonucleotides of claim 6, wherein said

oligonucleotide binds to the pre-mRNA of said protein to form a double- stranded nucleic acid complex and wherein said oligonucleotide is chemically modified to render said double-stranded nucleic acid complex RNAse H resistant.

8. The one or more oligonucleotides of claim 6, wherein said one or more oligonucleotides comprises an oligonucleotide that induces skipping of an exonic sequence from exon 9 of ATXN3 and an oligonucleotide that induces skipping of an exonic sequence from exon 10 of ATXN3 comprising a trinucleotide repeat expansion.

9. A method for treating an individual afflicted with HCHWA-D (hereditary cerebral haemorrhage with amyloidosis, Dutch type), said method comprising administering to an individual in need thereof a therapeutically effective amount of one or more anti-sense oligonucleotides that induces skipping of the exonic sequence that comprises said HCHWA-D mutation, or one or more cells comprising said oligonucleotides.

10. The method of claim 9, wherein said oligonucleotide induces skipping of an exonic sequence corresponding to exon 16 of APP751.

11. A method for removing the HCHWA-D mutation from mutant APP protein, comprising providing a cell that expresses pre-mRNA encoding said mutant protein with an anti-sense oligonucleotide that induces skipping of the exonic sequence that comprises said HCHWA-D mutation, the method further comprising allowing translation of mRNA produced from said pre-mRNA.

12. The method of claim 11, wherein said oligonucleotide induces skipping of an exonic sequence corresponding to exon 16 of APP751.

13. One or more oligonucleotides of between 14-40 nucleotides that induce skipping of an exonic sequence that comprises the HCHWA-D mutation from mutant APP protein.

14. The one or more oligonucleotides of claim 13, wherein said oligonucleotide binds to the pre-mRNA of said protein to form a double- stranded nucleic acid complex and wherein said oligonucleotide is chemically modified to render said double-stranded nucleic acid complex RNAse H resistant.

15. The oligonucleotide of claim 13, wherein said one or more

oligonucleotides comprises an oligonucleotide that induces skipping of an exonic sequence corresponding to exon 16 of APP751.