WO2015044339A1

WO2015044339A1 - A new rat model for diabetic vascular complications

Info

Publication number: WO2015044339A1
Application number: PCT/EP2014/070610
Authority: WO
Inventors: Maria F GOMEZ; Lina ÅKESSON; Åke LERNMARK
Original assignee: Gomez Maria F; Åkesson Lina; Lernmark Åke
Priority date: 2013-09-27
Filing date: 2014-09-26
Publication date: 2015-04-02

Abstract

BBDRlepr-/- rats, wherein chromosome 5 comprises a D5Uwm27 microsatellite marker having a size of 160 base pairs, but not of 175 base pairs, as determined by use of primers according to SEQ ID 25 and SEQ ID 26. These rats spontaneously develop diabetes complications without chemical manipulation already at puberty. Further, they do spontaneously develop vascular complications including cardiovascular and kidney disease, which are evident at already at 6 months of age.

Description

A NEW RAT MODEL FOR DIABETIC VASCULAR COMPLICATIONS Field of the invention

The present invention relates a rat model for diabetic micro-and macrovascular complications. Further, the invention relates to a method for obtaining such a model.

Background

Diabetes is a lifelong incapacitating disease affecting multiple organs. More than 346 million people worldwide have diabetes and this number is rapidly increasing. In 2004, an estimated 3.4 million people died from the consequences of hyperglycemia, i.e. elevated blood glucose levels. Presently, diabetes type 1 and type 2 cannot be cured and only partially (type 2) prevented. The disease is associated with devastating chronic complications including coronary heart disease, stroke, peripheral vascular disease (macrovascular disease), as well as microvascular disease (i.e. nephropathy, retinopathy and neuropathy). In patients with diabetes, a much more widespread and aggressive form of atherosclerosis is observed in the coronary arteries, lower extremities and extracranial carotid arteries, causing nearly 80% of all deaths and much of the disability in this group of patients. Diabetes also worsens early and late outcomes of myocardial infarction and stroke, increases the risk of recurrence and leads to worse prognosis following surgical revascularization procedures, such as increased rates of in stent thrombosis and restenosis after balloon angioplasty.

More than 80% of diabetes deaths occur in low- and middle-income countries and the WHO (World Health Organization) predicts that the number of diabetes deaths will double between 2005 and 2030.

The WHO states:

• Diabetes increases the risk of heart disease and stroke. More than 50% of people with diabetes die of cardiovascular disease (primarily heart disease and stroke).

Combined with reduced blood flow, neuropathy in the feet increases the chance of foot ulcers and eventual limb amputation.

· Diabetic retinopathy is an important cause of blindness, and occurs as a result of long-term accumulated damage to the small blood vessels in the retina. After 15 years of diabetes, approximately 2% of people become blind, and about 10%> develop severe visual impairment.

Diabetes is among the leading causes of kidney failure. 10-20%) of people with diabetes die of kidney failure. • Diabetic neuropathy is damage to the nerves as a result of diabetes, and affects up to 50% of subjects with diabetes. Although many different problems can occur as a result of diabetic neuropathy, common symptoms are tingling, pain, numbness, or weakness in the feet and hands.

· The overall risk of dying among people with diabetes is at least double than the risk of their peers without diabetes.

The WHO Global strategy on diet, physical activity and health complements WHO's diabetes work by focusing on population- wide approaches to promote healthy diet and regular physical activity, thereby reducing the growing global problem of overweight and obesity.

Current treatment of diabetes, either type 2 diabetes or type 1 (autoimmune) diabetes is inadequate. Type 2 diabetes often associated with obesity requires a cocktail of drugs along with change in life style to avoid the development of diabetes complications. The late complications are all related to both macro and microvascular complications. Despite major advances in cardiovascular medicine in the past decades, with the now widespread use of antithrombotic, lipid- and/or blood pressure lowering drugs for the reduction of risk factors leading to cardiovascular disease, there is still no single treatment that specifically targets diabetic cardiovascular complications. Animal models that allow mechanistic studies for the discovery of novel targetable pathways are very much needed.

Type 1 diabetes is managed with insulin replacement therapy. Despite novel insulin types and approaches to administer the hormone, more than 90% will develop retinopathy, 30-40% nephropathy and there is a 500% over-mortality in myocardial infarctions.

Research on diabetic complications has been hampered by the limitation that most common animal models used for type 1 (i.e. NOD mice, BB rat) or type 2 diabetes (i.e. db/db mice, GK rat) research do not develop classical micro-and macrovascular complications and they do not usually progress beyond histological signs of

microangiopathy and nephropathy. Also, no rodent diabetes models spontaneously develop proliferative retinopathy or end-stage renal disease.

There are commercially available laboratory rat and mouse strains that spontaneously develop type 1 or type 2 diabetes. However, these fail to mimic the vascular complications as seen in humans and are highly resistant to atherosclerosis. Additional genetic manipulation of available diabetic mice (by for example combination with hypercholesterolemic ApoE KO or LDLR KO mice) has been proven successful to induce atherosclerosis, but to our knowledge, no single rat model of diabetes has been shown to develop atherosclerosis.

One model of interest is the congenic BBDR^{lepr /lepr~} rat line bred by Moralejo et al {Physiol Genomics 41 : 9-20, 2010), by introgression of the Koletsky rat leptin receptor mutant (lepr-/lepr-).

The Koletsky rat contains the mutation corpulent (cp), an autosomal recessive mutations that cause obesity in the rat. The mutation is also known as lepr-. . The cp mutation arose spontaneously after several generations of selective inbreeding in a stock derived from an SHR/N female crossed with a male, normotensive SD (Sprague- Dawley) rat as described by Dr. Simon Koletsky in 1973 (Koletsky, S. "Obese spontaneously hypertensive rats— a model for study of atherosclerosis". Exp Mol Pathol, 1973, 19, 5360). Breeding stock of this model was eventually transferred to the NIH, where the mutation was first backcrossed onto several strains: SHR, WKY, and LA as well as to the BBDR. The obese phenotype is due to a functional null mutation of the leptin receptor (Lepr). The Koletsky mutation (lepr-) is a point mutation that causes a premature stop at codon 763 (TAT→TAG, Tyr→stop) before the transmembrane domain of the leptin receptor. This truncates all known isoforms of the receptor. The lepr- or cp is a null mutation. Even though the Koletsky rat becomes obese, insulin resistant, and hyperleptinemic, it does not develop vascular complications. The

Koletsky rat is thus not useful for studying macro- and microvascular complications resulting from diabetes. A line of rats derived from the original Koletsky rats was later called Spontaneous Hypertensive Obese (SHROB) rat. These rats are obese and have hypertension, proteinuria, hypertriglyceridemia, hyperinsulinemia and insulin resistance.

While the male as well as female BBDR ^lepr~/lepr~ _rats became obese, only the males developed hyperglycemia classified as type 2 diabetes. However, neither male nor female rats of Moralejo et al's congenic BBDR^{lepr /lepr"} rat line spontaneously develop classical micro-and macro vascular complications.

Models based on the chemical induction of diabetes (with for example streptozotocin or alloxan) have been used in the past. These models, in combination with dyslipidemic backgrounds have resulted in the development of mild or early diabetic microvascular complications in both mice and rats, but macrovascular complications only in mice (not in rats). However, the side effects of chemicals to induce diabetes make it difficult to interpret diabetes complications in these animals. Is it diabetes or is it side effects of chemicals, such as streptozotocin or alloxan? The development of novel treatments to prevent or treat cardiovascular complications is complicated by the fact that detailed mechanistic studies are not feasible in humans. Laboratory animals that replicate micro- and macrovascular disease would be ideal for drug/treatment discovery mainly for 3 reasons:

- Small size

- Low variability

- Rapid disease progression

Rodents and in particular rats (due to their larger size) are very well suited for mechanistic studies, which require in vivo measurements of cardiovascular parameters and functional assays.

In vitro studies using isolated cell types will not replicate the multifaceted pathophysiology of cardiovascular disease. It is well know that cells in culture dedifferentiate or change their phenotype, no longer mimicking their behaviors as observed in situ. Thus, adequate animal models are necessary for further understanding the complicated pathways involved in the diabetic micro- and macrovascular complications and to render possible the development of novel drugs targeting the pathways.

Further, using chemical toxins such as streptozotocin or alloxan for the induction of diabetes in laboratory rats and mice is associated with varying degree of diabetes and very seldom leads to the development of vascular complications unless performed on hyperlipidemic backgrounds or further genetically modified animals. Single-dose chemical induction is no longer recommended as an appropriate method, since the toxic effects have been well-documented. Low-dose regimes are still widely- accepted for the study of the very early phases of vascular complications, however these toxins are associated with increased risk for tumors and cataract formation leading to blindness in long-term studies. Thus, the animals in such chemical induced models suffer and it may be questioned if medical benefit outweighs the suffering of the animal.

An appropriate animal model for diabetic micro- and macrovascular complications should include spontaneous onset of diabetes at young age, to shorten the time to the first signs of complications. Further, the appearance of vascular

complications should preferably occur spontaneously and specifically without any dietary manipulations, and as early as possible (ideally within 3-6 months of diabetes).

Thus, there is need within the art for a rat model for diabetic micro-and macrovascular complications. Summary

Consequently, the present invention seeks to mitigate, alleviate, eliminate or circumvent one or more of the above-identified deficiencies in the art and disadvantages singly or in any combination by providing rats which spontaneously develop diabetes complications without chemical manipulation already at puberty and spontaneously develop vascular complications including atherosclerosis and kidney disease, which are evident already at 6 months of age. Such rats belongs to a congenic BBDRlepr-/- or congenic BBDRlepr+/- rat line, wherein chromosome 5 comprises a D5Uwm27 microsatellite marker having a size of 160 base pairs, but not of 175 base pairs, as determined by use of primers according to SEQ ID 25 and SEQ ID 26.

Further advantageous features of the invention are defined in the dependent claims. In addition, advantageous features of the invention are elaborated in

embodiments disclosed herein. Detailed summary of preferred embodiments

The BB rat was first described to develop diabetes in 1974 in the no longer existent BioBreeding (BB) company in Canada. The BB rats represented an outbred Wistar rat and spontaneous diabetes was initially detected at a low frequency (<20%). Onset of diabetes was associated with islet inflammation or insulitis. The MHC type of the BB rat was found to be RT1.B u/u, the orthologue of HLA-DQ, the highest risk factor for type 1 diabetes in humans. Sister-brother breeding began in 1976 and two major lines were established in 1980: a diabetes-prone (DP) and a diabetes-resistant (DR).

The present BBDR rats dates back to 1982 when BBDR and BBDP rats were subjected to sister-brother breeding completed in 1990. Inbred BBDR (no diabetes) were then crossed with BBDP (>90% diabetes) demonstrating that diabetes segregated as a single locus (Markholst H, Eastman S, Wilson D, Andreasen BE, Lernmark A. "Diabetes segregates as a single locus in crosses between inbred BB rats prone or resistant to diabetes". J Exp Med. 1991 Jul l;174(l):297-300). The BBDR rat therefore has all genetic factors necessary for autoimmune diabetes except the mutation on chromosome 4 in the Gimap5 gene that makes the animals develop autoimmune diabetes. Cyclic backcross of DP diabetes onto the BBDR rat made it possible to clone the BB rat diabetes gene (MacMurray AJ, Moralejo DH, Kwitek AE, Rutledge EA, Van Yserloo B, Gohlke P, Speros SJ, Snyder B, Schaefer J, Bieg S, Jiang J, Ettinger RA, Fuller J, Daniels TL, Pettersson A, Orlebeke K, Birren B, Jacob HJ, Lander ES, Lernmark A. "Lymphopenia in the BB rat model of type 1 diabetes is due to a mutation in a novel immune-associated nucleotide (Ian)-related gene". Genome Res. 2002 Jul;12(7): 1029-39).

The BBDR rat is maintained, as it is resistant to spontaneous diabetes but prone to develop autoimmune diabetes. It is possible to induce autoimmune diabetes in the BBDR by introgression of the Gimap5 mutation. It is also possible to induce autoimmune diabetes in the BBDR rat with the Kilham's rat virus, which depletes T cells (Guberski DL, Thomas VA, Shek WR, Like AA, Handler ES, Rossini AA, Wallace JE, Welsh RM. "Induction of type I diabetes by Kilham's rat virus in diabetes- resistant BB/Wor rats". Science. 1991 Nov 15;254(5034): 1010-3). Similarly, depletion of T cells with an ART2 monoclonal antibody and the virus-infection mimic Poly I:C (polyinosinic:polycytidylic acid) is also a well-known approach to induce autoimmune diabetes in the BBDR rat. The BBDR rat has the necessary genetic propensity to develop autoimmunity. In addition, the BBDR rat also carries genetic factors that make the rat prone to develop diabetes. The BBDR rat is therefore considered useful for the introgression of genes that may induce obesity or type 2 diabetes.

Rats, such as the Koletsky rat, homozygous for autosomal leptin receptor gene mutations, not only become obese and insulin resistant, but also

develophyperleptinemia, which results in a dysregulated immune system.

The BBDR rat has diabetes-susceptible genes, but does not become diabetic in viral antibody-free conditions. The BBDR is lean without signs of obesity..

Using marker-assisted breeding to introgress the Koletsky rat leptin receptor mutant (lepr-/lepr-), a congenic BBDR.(lepr-/lepr-) rat was established to study obesity and type 2 diabetes in the BBDR rat (Moralejo DH, Hansen CT, Treuting P, Hessner MJ, Fuller JM, Van Yserloo B, Jensen R, Osborne W, Kwitek AE, Lernmark A.

Differential effects of leptin receptor mutation on male and female BBDR Gimap5- /Gimap5- spontaneously diabetic rats" Physiol Genomics. 2010 Mar 3;41(l):9-20). BBDR rats being carriers of the leptin receptor mutation were also crossed with BBDR rats carrying the Gimap5 mutation to generate BBDR rats with autoimmune diabetes, obesity as well as type 2 diabetes. In this way it was possible to study interactions between these conditions. However, these rats did not develop classical micro-and macrovascular complications.

The congenic BBDR (lepr-/lepr-) rats developed obesity at early age as a result of the point mutation in the leptin receptor gene. The mutation causes a premature stop at codon 763 (TAT→TAG, Tyr→stop) before the transmembrane domain of the leptin receptor. All known isoforms of the receptor are therefore truncated and no longer functional. As described herein above, the mutation was introduced by crossing with a male normotensive SD (Sprague-Dawley) rat as described by Koletsky in 1973. In addition to the point mutation, the congenic BBDR rat line with the leptin receptor point mutation has a Koletsky rat DNA introgression of about 15 million base pairs including the mutated leptin receptor gene. Thus, the BBDR rat line with the leptin receptor mutation also has several other genes not being BBDR-genes but SD (Sprague-Dawley) genes. The BBDR rat line with the leptin receptor mutation generated at the University of Washington in Seattle, referred to as BBDR.(lepr-/lepr-) rats no longer exists.

Heterozygous breeding pairs were transferred to Lund University in Malmo.

The Lund University facility fulfills all guidelines and recommendations of the

Federation of European Laboratory Animal Science Associations (FELASA;

www.felasa.eu) including health monitoring at a more stringent level compared to the USA.

The leptin receptor mutation also known as lepr- or cp is thus a null mutation.

The leptin receptor (LEPR; OMIM: 601007; Gene ID: 24536), is a member of the class I cytokine receptor family and is expressed in the hypothalamus in areas that regulates appetite and body weight. Interestingly, it is also expressed in endothelial cells, pancreatic beta cells, bone marrow precursors, monocytes/macrophages, and T and B cells. The ligand for the receptor, i.e. leptin (Lep; OMIM: 164160; Gene ID: 25608), is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. It is mainly produce by adipocyte tissue in relation to body fat mass, and at lower levels, by stomach, skeletal muscle and placenta. The other important role of leptin is to regulate body weight by reduction of food intake via a satiety signal and to increase energy expenditure through stimulation of thermogenesis.

The present inventors have bred a novel congenic BBDR^{lepr ~ ~} rat line by heterozygous BBDR-^lepr+/" breeding over five generations, starting from the rat line BBOR. A-(D5Rat98-D5Rat233)/Rhw previously bred by Moralejo et al (Physiol Genomics 41 : 9-20, 2010). In this novel rat line, the introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 is reduced to about 800 000 base pairs or less, compared to 15 300 000 base pairs in the Moralejo rat model. The size of the introgressed DNA fragment is reduced by spontaneous cross-over, whereby the present rat lines are genetically more similar to other congenic BBDR rat line than BBOR.L A-(D5Rat98-D5Rat233)/R w. The breeding was marker assisted (cf. table 1) in order to provide rats, in which the size of the introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 was reduced. Further, SNPs have been used in assisting the maintenance of a stable rat line, as the markers used in the breeding were quite distant (about 14 million base pairs) from each other in the area of concern. In exemplified embodiments (cf. table 2), three variants of the introgressed DNA fragment of different size are provided. The present ratlines are however not limited to these sizes in its broadest context.

It was surprisingly found that male rats of this novel congenic BBDR^{lepr ~ ~} rat line, in addition to becoming obese and spontaneously developing hyperglycemia as the Moralejo rat, also develop macrovascular as well as microvascular complications, including enlarged heart, elevated systolic blood pressure, thickening of the arterial wall, early signs atherosclerosis (i.e. lipid and macrophage deposition), enlarged kidneys, a >100-fold increase in albumin/creatinine ratio, enlarged liver, liver steatosis and significant perivascular and perirenal lipid accumulation. The rat line thus is well suited for studying macro- and macrovascular complications resulting from diabetes.

Further, the early onset of hyperglycemia and the relatively rapid and spontaneous onset of complications will shorten the time required for mechanistic studies as well as for studies aimed at prevention and intervention of vascular complications of diabetes.

Without being bond to any theory, it is believed that the increase in BBDR similarity through selective marker assisted, breeding of rats wherein spontaneous crossing-over of DNA from the BBDR rat has contributed genetic factors important to the development of diabetes complications or removed factors preventing the development of diabetes. It may be that the higher the number of genes introgressed from BBDR, the higher the risk for diabetes complications, i.e. the more BBDR like the higher the risk for complications in association with the obesity induced by the lepr mutation. However, according to some embodiments, the introgressed DNA fragment from the Koletsky rat should not be to limited in size, i.e. not only the lepr (-/-) mutation is of importance, but also further genes originating from SD/SHR rat, also known as the Koletsky rat , should be comprised in the introgressed DNA fragment.

Thus, an embodiment relates to a congenic BBDRlepr-/- rat line as well as a congenic BBDRlepr+/- rat line, which spontaneously develop diabetes complications and vascular complications including cardiovascular and kidney disease. Another embodiment relates to a rat of any of these ratlines, such as a male lepr-/- rat. Such a male lepr-/- rat have any combination of the following phenotypic characteristics:

-a body mass index of 0.95 to 1.24 g/cm²; - a liver/tibia ratio (g/cm) of 10.7 to 14.3;

- a heart/tibia ratio (mg/cm) of 386 to 478;

- a 2 kidneys/tibia ratio (g/cm) of 1.09 to 1.38;

- an alanine aminotransferase (ALT) serum level of 2.0 to 15.8 μ1¾ΐ/Ι.;

- an aspartate aminotransferase (AST) serum level of 2.76 to 16.6 8 μ1¾ΐ/Ι.;

- a total cholesterol (mg/mL) level of 3.0 to 4.1;

- triglycerides (mg/mL) levels of 15.7 to 23.8;

- a systolic blood pressure (mm Hg) of 151.8 to 162.6;

- an albumin/creatinine ratio (mg/mg) of 3.8 to 6.9.

In contrast to animals of the congenic BBDRlepr+/- rat line, both female and male rats animals of the congenic BBDRlepr-/- are infertile due to gross obesity and may thus not reproduce. However, only male rats being lepr-/- do develop diabetes complications and vascular complications. These new rat lines have a significantly smaller introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 of about 800 000 base pairs or less, compared to 15 300 000 base pairs in lines within the art. Especially, the rat lines disclosed herein have a D5Uwm27 microsatellite marker size of 160 base pairs (BBDR), compared to 175 in the rat line EDR.LA-(D5Rat98-D5Rat23 J)/Rhw, as determined by use of primers according to SEQ ID 25 and SEQ ID 26. The microsatellite marker D5Uwm27 is flanked by a forward primer site with at least 95% sequence identity to the corresponding primer sequence specified in Table 1 and a reverse primer site with at least 95 % sequence identity to the corresponding primer sequence specified in Table 1. The microsatellite marker sizes provided in Table 1 are in base pairs and indicate the length of the microsatellite region of interest, including the regions complementary to the forward and reverse primers.

Chromosome 5 of rats comprises various DNA microsatellites which may be used in genotyping of the chromosome. Microsatellites are regions within DNA sequences (or "loci") where short sequences of DNA (often di-, tri- or tetra-nucleotides) are repeated in tandem arrays, that is repeated one after the other. At the same location within the genomic DNA, the number of times the sequence is repeated may vary between species, or between strains or even between individuals. Analyzing the length of these microsatellites, which reflects the number of repeats, is a useful and simple approach to distinguish rats of different genotype. Thus, the microsatellites at chromosome 5 may be used to distinguish between BBDR arts and Koletsky rats. Evidently, also SNPs (Single-Nucleotide Polymorphisms), and direct sequencing may be used to distinguish between BBDR rats and Koletsky rats. DNA sequencing of the BBDR rat will identify sequence polymorphisms including single nucleotide polymorphisms that distinguish BBDR from the Koletsky rat. Classical microsatellite genotyping methods will result in a PCR product, where the product will include the sequences of the specific primer and reverse primer for the microsatellite region of interest. As described above, the microsatellite marker sizes provided in Table 1 includes the primers and the corresponding Sequence ID.

In Table 1 below microsatellites at Chromosome 5 are listed. The order of appearance follows the microsatellite position on Chromosome 5, and start and stop positions from the RGSC Genome Assembly v3.4 (Laulederkind SJ, Hayman GT, Wang SJ, Smith JR, Lowry TF, Nigam R, Petri V, De Pons J, Dwinell MR, Shimoyama M. "The Rat Genome Database 2013— data, tools and users." Brief Bioinform. 2013 Feb; doi: 10.1093/bib/bbt007) are listed in table 1.

Further, in Table 1 the satellite markers (D5Uwm27 to D5Rhw20(46)) of the introgressed Koletsky DNA fragment in the rat model of Moralejo et al are indicated in bold. Further, the satellite marker representative for the present invention, i.e.

D5Uwm27, is underlined.

Table 1 - Microsatellites at Chromosome 5

Microsatellite Size Size Start Stop Fwd Primer Rev Primer

(bp) (bp)

BBDR Koletsky

D5Rat187 180 190 8464827 8465004 SEQ ID No. 1 : GGGCTTATCCCTAGTTTCCC SEQ ID No. 2: AAGCATGTGTCATATGCCCA

D5Rat121 230 220 9396684 9396878 SEQ ID No. 3: CAGTCAGGTGGTTAAAGGGG SEQ ID No. 4: AGAGCTCTGGACTTGAGCCA

D5Rat125 255 265 17702961 17703194 SEQ ID No. 5: TCCACAGTATTCCCTGGTCC SEQ ID No. 6: ACGTTGTATTGGCCAACATG

D5Rat131 165 170 35390492 35390646 SEQ ID No. 7: GGGGTACCAAATTAATCTTCCC SEQ ID No. 8: TGCAAGAACACGTGCACATA

D5Rat4 175 182 49767270 49767421 SEQ ID No. 9: TCTGAGCATTGAGGGTTATTGTT SEQ ID No. 10: AACACAAGACCTCAGGAGCG

D5Rat7 195 190 57974571 57974732 SEQ ID No. 11 : GGGTATTCCTTAATCCACCCA SEQ ID No. 12: GGTCAGTTGTCAATACTGGGG

D5Rat11 160 175 65168721 65168874 SEQ ID No. 13: TCAATATGTGGGTGTGGGC SEQ ID No. 14: TGTGTTGCAACAAAGGAACAA

D5Rat14 160 150 79540687 79540838 SEQ ID No. 15: ACCATACCATGGCACACATG SEQ ID No. 16: ACATCCAGAGGGTGCTTCAC

D5Rat258 260 250 89141992 89142218 SEQ ID No. 17: ATGCATGTGCATTTGCTGAT SEQ ID No. 18: TGAATGGCTGTTCTAACTGCA

D5Mit4 320 255 94515803 94516069 SEQ ID No. 19: CCAGCTCATGTGCACAGG SEQ ID No. 20: GTTGTTGATGTTGTTGTTGTTGG

D5Rat98 204 250 100017060 100017265 SEQ ID No. 21 : ACACTGTGGCCTCCAAATTC SEQ ID No. 22: ACCCAATGCCAGTCCATAAA

D5Rat183 185 230 100548332 100548462 SEQ ID No. 23: CTGGCCATATGTCACCTAATG SEQ ID No. 24: TCCAATTGGATCCTGAACCA

D5Uwm27 160 175 107820053 107820218 SEQ ID No. 25: TGATATGAGCTTCCCTTAC SEQ ID No. 26: GCATCAACTACTGCTTCC

D5 hw23(1) 205 218 122318113 122318323 SEQ ID No. 27: GAAGCACTATACACCCCGTTG SEQ ID No. 28: TGAACCCACAGCATGAAAAC

D5WOX39 170 160 122394986 122395133 SEQ ID No. 29: ACATCGTATCCTATCAACACCA SEQ ID No. 30: CATGCCTGTGTACGAGTGTG

D5Rhw9(35) 205 205 122898821 122898999 SEQ ID No. 31 : CAATTGGTCCCCCTCTGTG SEQ ID No. 32: GAGCACCATCACAAAACCAA

D5Rhw12(38) 230 235 122923292 122923493 SEQ ID No. 33: ATTTCTGCCCTTTCCTGCTC SEQ ID No. 34: GAGGTTTGGTACTGGCAATCA

D5Rhw13(39) 195 230 122956585 122956775 SEQ ID No. 35: CACACTACTTTATTTCTTCCGTGCT SEQ ID No. 36: ACACCCAAGAGCAGTTAGCC

D5Rhw14(40) 200 175 122960141 122960301 SEQ ID No. 37: ATCCTTGCCAGCTTCCTTCT SEQ ID No. 38: ACCTGGGAACCTGATCCTTC

D5Rhw16(42) 210 230 123006119 123006308 SEQ ID No. 39: TTCCTTCTTTGGAGGAACCA SEQ ID No. 40: TGGAGGAATGATGTGTTTGG

D5Rhw20(46) 175 200 123123248 123123404 SEQ ID No. 41 : GGATGTGCTAGGGAAATAGCC SEQ ID No. 42: GGCAAAGTGAAGCTTTGGAG

D5Rat233 275 240 124931813 124932061 SEQ ID No. 43: CAAATGGAGAATCCGAATCC SEQ ID No. 44: ACATGTCTGAGGTTGGCCTC

D5Got48 190 200 129504699 129504883 SEQ ID No. 45: TTTAACCACTTCACCGCTCA SEQ ID No. 46: GTCCACCCTTTCTTCGGG

D5Uia1 200 195 129942122 129942311 SEQ ID No. 47: GCGGTGTAGAGAGATCCTGT SEQ ID No. 48: TGATTTAACACAGGTTTTCCAG

D5Uwm37 175 170 130527319 130527490 SEQ ID No. 49: TGCAAATGAAAGACATACAG SEQ ID No. 50: AAGTTTAAAAGTGCCCAG

D5Rat95 175 180 130642376 130642474 SEQ ID No. 51 : GGAACCTGCACAATCATGTG SEQ ID No. 52: CCATCTACTCCAGTCCTTGGTT

D5Rat32 185 175 139659415 139659574 SEQ ID No. 53: CAGTTGCCCATGCTTCAGTA SEQ ID No. 54: TTATTGGTGTGTGTCACCAGG

D5Rat33 145 155 143540180 143540583 SEQ ID No. 55: TGGAGAAAAGAAGAACCTCCA SEQ ID No. 56: GTGCCCCTCAGACTGAACTC

D5Rat39 150 175 152925660 152925801 SEQ ID No. 57: CTCCTTTGTCCCACCTGAGA SEQ ID No. 58: GGAGAGGGTAAGGTGGGACT

D5Rat106 230 220 156856641 156856851 SEQ ID No. 59: TTACTGGCTGTTTGCTTTAGCA SEQ ID No. 60: TGAAGTTTCCCTTAAATGGGTG

D5Rat47 140 145 163349562 163349681 SEQ ID No. 61 : TGAAGAAGACAGCCAGTGTCA SEQ ID No. 62: GCAGACACTCTGGGGTCTTT

Start and Stop from *RGSC Genome Assembly v3.4 (default)

In addition to microsatellite markers, also single nucleotide polymorphisms were used to distinguish BBDR from the Koletsky rat as outlined above. In order to identify relevant SNPs, DNA was isolated from BBDR +/+ (wildtype) as well as from the present congenic BBDRlepr-/- and BBDRlepr+/- rat lines by standard methods. The Rat Genome Data base (http://rgd.mcw.edu/) was used to obtain genome nucleotide sequences in and around the lepr mutation and the microsatellites previously used to map the introgression of Koletsky DNA on chromosome 5 (cf. Table 1). Based on nucleotide sequences from the rat genome database, primers for DNA sequencing were designed.

The primer sequences and DNA from both the BBDR+/+ and the present the congenic BBDRlepr-/- ratline were submitted to sequencing (GATC Biotech AG, Konstanz, Germany). The resulting sequences were analyzed and compared by alignment to identify single nucleotide polymorphisms (SNP); one single nucleotide differs from one strain to the other. Subsequently, the flanking nucleotide sequences were next analyzed against the entire rat genome to verify that they were unique to specific position in the rat genome. The flanking sequences were submitted to the Custom TaqMan® SNP Genotyping Assays

(https://tools.lifetechnologies.com/content/sfs/manuals/cms_041290.pdf ) to establish a TaqMan assay (Applied Biosystems®//Life Technologies// Thermo Scientific). Each TaqMan assay is unique to each SNP, as defined by the flanking primer sequences and the report sequence (cf. Table 3).

In Table 2 below selected SNPs at Chromosome 5 are listed. The order of appearance follows the SNP position on Chromosome 5. In order to match the SNPs to the microsatellite markers, also these are included in the table. The positions are based on the RGSC Genome Assembly v3.4 (Laulederkind SJ, Hayman GT, Wang SJ, Smith JR, Lowry TF, Nigam R, Petri V, De Pons J, Dwinell MR, Shimoyama M. "The Rat Genome Database 2013—data, tools and users." Brief Bioinform. 2013 Feb;

doi: 10.1093/bib/bbt007) .

In table 3 below, primers, reporter sequences and dyes used in the TaqMan analysis are provided. The reporter 1 sequence is selective for SNPs in DR-rats, while the reporter 2 sequence is selective for SNPs in Koletsky rats. SNP position¹/ Distance (no. bp) DR Koletsky BBCP BBCP

Microsatellite BBCP Long

SNP NAME Microsatellite from Lepr (base/length of (base/length of Short xShort (position) Koletsky

position¹ mutation microsatellite) microsatellite) Koletsky Koletsky

D5Uwm27 107 820 053-

160 175 160 160 160 107 820 218

BCP107.8 107 820 833 -14 642 704 A G A A

BCP115.9 115 931 866 -6 531 671 C T T C

BCP121.7 121 723 999 -739 538 A c c C

D5Rhw23(l) 122 318 113-

205 218 218 218 218 122 318 323

BCP122.39 122 394 627 -68 910 G A A A

D5Wox39 122 394 986-

170 160 160 160 160 122 395 133

LEPR763 122 463 537 0 T A A A

BCP122.5 122 504 015 40 478 c T T T

D5Rhw9 (35) 122 898 821-

205 205 205 205 205 122 898 999

D5Rhwl2(38) to 122 923 292 to

D5Rhwl6(42) 123 006 308

BCP123.1 123 117 423 653 886 C A A A

D5Rhw20(46) 123 123 248- 123 123 404

'Position based on RGSC Genome Assembly v3.4 (cf. Laulederkind SJ, Hayman GT, Wang SJ, Smith JR, Lowry TF, Nigam R, Petri V, De Pons J, Dwinell MR, Shimoyama M. "The Rat Genome Database 2013—data, tools and users." Brief Bioinform. 2013 Feb; doi: 10.1093/bib/bbt007)

Table 3 - Primers and reporter sequences for TaqMan analysis of SNP (SNP in bold and underlined)

Reporter

SNP Name Forward Primer Seq. Reverse Primer Seq. Reporter 1 Sequence (DR) Note

1 Dye

reporter forward

BCP107.8 TGGTTGGATTTCGTTGAATGACATTG ATGACTAGGGC 1 1 1 1 ACTTTAACTGAACTTT IC CTACATATTGTCTGAATAAAA

sequence SEQ ID NO 63 SEQ ID NO 64 SEQ ID NO 65

BCP115.9 TGACTAAAGCTTTGCTGGAACACA ACAAAAGAGTTGCCCCTGACAT IC ACAACAATGAAAGGCCATAG reporter reverse sequence

SEQ ID NO 67 SEQ ID NO 68 SEQ ID NO 69

BCP121.7 GTCAACGGACATTATATTTTGTAGATCTCACT AGGCAGGAGAAAAAGTTCCTTGATTAT VIC AGAGACATACTGTTTAAAGAT reporter reverse sequence

SEQ ID NO 71 SEQ ID NO 72 SEQ ID NO 73

reporter forward

BCP122.39 GGGTCCTGCAGTTTGTACCTTAAC GCAACTTGGGAGCAAAGGATTTATC FAM TGACGATGGGTTGTTGT

sequence SEQ ID NO 75 SEQ ID NO 76 SEQ ID NO 77

LEPR763 CTTTCCTGGACACTGTCACCTAA CCACTTCATTCCATCATCATCATTAAGG VIC CAGATATAACAGACTATAATCA reporter reverse sequence

SEQ ID NO 79 SEQ ID NO 80 SEQ ID NO 81

BCP122.5 GGGAGAATTGAACTTAGGTCAAGAAGT GCAAAGTGCTGGTG ATA A A A CTGT VIC AGGATTAGTTAACCTGTTCCTC reporter reverse sequence

SEQ ID NO 83 SEQ ID NO 84 SEQ ID NO 85

BCP123.1 CTCTTCTCTCCCTGTGGAAAGC TGTTAATAAGACTGATTTAGGTCCAAGCTC VIC CCAGTAAAACTCGTGAGGTA reporter reverse sequence

SEQ ID NO 87 SEQ ID NO 88 SEQ ID NO 89

Table 3 cont.

Reporter Reporter 2 Sequence

SNP Name Forward Primer Seq. Reverse Primer Seq. Note

2 Dye (Koletsky)

reporter forward

BCP107.8 TGGTTGGATTTCGTTGAATGACATTG ATGACTAGGGC 1 1 1 1 ACTTTAACTGAACTTT FAM CATATTGTCTGGATAAAA

sequence SEQ ID NO 63 SEQ ID NO 64 SEQ ID NO 66

BCP115.9 TGACTAAAGCTTTGCTGGAACACA ACAAAAGAGTTGCCCCTGACAT FAM ACAACAATGAAAGACCATAG reporter reverse sequence

SEQ ID NO 67 SEQ ID NO 68 SEQ ID NO 70

BCP121.7 GTCAACGGACATTATATTTTGTAGATCTCACT AGGCAGGAGAAAAAGTTCCTTGATTAT FAM AGACATACTGTGTAAAGAT reporter reverse sequence

SEQ ID NO 71 SEQ ID NO 72 SEQ ID NO 74

reporter forward

BCP122.39 GGGTCCTGCAGTTTGTACCTTAAC GCAACTTGGGAGCAAAGGATTTATC IC ATGACGATGGATTGTTGT

sequence SEQ ID NO 75 SEQ ID NO 76 SEQ ID NO 78

LEPR763 CTTTCCTGGACACTGTCACCTAA CCACTTCATTCCATCATCATCATTAAGG FAM CAGATATAACAGACTTTAATCA reporter reverse sequence

SEQ ID NO 79 SEQ ID NO 80 SEQ ID NO 82

BCP122.5 GGGAGAATTGAACTTAGGTCAAGAAGT GCAAAGTGCTGGTGATAAAACTGT FAM AGGATTAGTTAACCTATTCCTC reporter reverse sequence

SEQ ID NO 83 SEQ ID NO 84 SEQ ID NO 86

BCP123.1 CTCTTCTCTCCCTGTGGAAAGC TGTTAATAAGACTGATTTAGGTCCAAGCTC FAM CCCAGTAAAACTCTTGAGGTA reporter reverse sequence

SEQ ID NO 87 SEQ ID NO 88 SEQ ID NO 90

The marker (microsatellite) D5Wox39 is present within the DNA fragment comprising the Lepr gene.

According to an embodiment, the chromosome 5 comprises a D5Wox39 microsatellite marker having a size of 160 base pairs (Koletsky), as determined by use of primers according to SEQ ID 29 and SEQ ID 30, said D5Wox39 microsatellite marker being flanked by a forward primer site with at least 95 % sequence identity to the corresponding primer sequence specified in Table 1 and a reverse primer site with at least 95 % identity similarity to the corresponding reverse primer sequence specified in Table 1. Further, a SNP denoted LEPR763 (cf. table 2) characteristic for the Koletsky rat is present. Thus, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described herein comprises an "A" at position 122 463 537 (position based on RGSC Genome Assembly v3.4). In BBDR rats the corresponding position is "T" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 82. Further, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described herein may comprise an "A" at position 122 394 627 (position based on RGSC Genome Assembly v3.4) close to the

microsatellite D5Wox39. In BBDR rats the corresponding position is "G" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 78. Furthermore, the congenic

BBDRlepr-/- and congenic BBDRlepr+/- rat lines described herein may comprise a "T" at position 122 504 015 (position based on RGSC Genome Assembly v3.4) in between the Lepr-mutation and the microsatellite D5Rhw9 (35). In BBDR rats the corresponding position is "C" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 86.

The rat lines disclosed herein are BBDR-lines. Thus, chromosome 5 of lines disclosed herein, according to an embodiment, comprises the microsatellite markers: D5Ratl87; D5Ratl21; D5Ratl25; D5Ratl31; D5Rat4; D5Rat7; D5Ratl l; D5Ratl4; D5Rat258; D5Mit4; D5Rat98; D5Ratl83; D5Rat233; D5Got48; D5Uial; D5Uwm37; D5Rat95; D5Rat32; D5Rat33; D5Rat39; D5Ratl06; and D5Rat47 of BBDR type and having the length specified in Table 1. The sequences for primers to be used in analyzing the types and length of markers present at chromosome 5 are provided in Table 1. The microsatellite markers are being flanked by a forward primer site with at least 95 % sequence identity to the corresponding primer sequence provided in Table 1 and a reverse primer site with at least 95 % sequence identity to the corresponding reverse primer sequence provided in Table 1. A classical analysis method includes amplification of the microsatellites by the polymerase chain reaction (PCR) process. Such a process includes a repeated thermal cycle, where DNA is denaturated at a high temperature to separate the double strand, then cooled down to allow annealing of primers of unique sequences to the DNA, after which a DNA polymerase can synthesize a new DNA strand complementary to the nucleotide sequence of the microsatellite template strand. This process results in the production of enough DNA to identify the length of the microsatellite by a simple agarose or polyacrylamide gel analysis. Several methods with higher throughput are routinely used for microsatellite detection, such as the CGH-style microarray from Nimblgen/Roche. Classical microsatellite genotyping methods results in a PCR product, where the product will include the sequences of the specific primer and reverse primer for the microsatellite region of interest. All microsatellite marker sizes in Table 1 thus include the length of the microsatellite region of interest and the lengths of the corresponding primer and reverse primer.

As described the present rat lines the new rat lines has a significantly smaller introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 of 800 000 or less base pairs.

A BBDRlepr+/- rat is a heterozygote, which means it is a genotype consisting of two different alleles at the lepr locus. For the present congenic BBDRlepr+/- rat, it means that all cells will contain one BDDR alelle (lepr+) and one Koletsky alelle

(lepr-), i.e. the introgressed DNA fragment. The length of the satellite markers of these two forms will therefore differ (cf. Table 1). Thus, when analyzing the length of a microsatellite marker present within the introgressed Koletsky fragment for a heterozygote, two sizes for the marker will be detected, one BBDR and one Koletsky. In analyzing the D5Uwm27 microsatellite marker of the present congenic BBDRlepr+/- rat line, the size of the marker will be 160 bp, but not 175 bp, as the rats lack the introgressed DNA fragment detected by this marker. On the contrary, in analyzing a the D5Uwm27 microsatellite marker in the BBDRlepr+/- rat line bred by Moralejo et al, two marker sizes will be detected, i.e. 160 bp and 175 bp, respectively. Similarly, in a SNP-analysis of a BBDRlepr+/- rat, the rat may have different bases at a given position, such as "T" and "A", respectively, at position 122 463 537, i.e. the Lepr-mutation (cf. Table 2).

According to one embodiment, the introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 has a size of about 800 000. In such an embodiment, chromosome 5 comprises a D5Rhw20(46) microsatellite marker having a size of 200 base pairs (Koletsky), as determined by use of primers according to SEQ ID 41 and SEQ ID 42, and a D5Rhw23(l) microsatellite marker having a size of 218 base pairs (Koletsky), as determined by use of primers according to SEQ ID 27 and SEQ ID 28. The D5Rhw20 (46) microsatellite marker being flanked by a forward primer site with at least 95 % sequence identity to the corresponding primer sequence provided in Table 1 and a reverse primer site with at least 95 % sequence identity to the

corresponding reverse primer sequence provided in Table 1. The D5Rhw 23 (1) microsatellite marker being flanked by a forward primer site with at least 95 % sequence identity to the corresponding primer sequence provided in Table 1 and a reverse primer site with at least 95 % sequence identity to the corresponding reverse primer sequence provided in Table 1. Further, typically also the markers 5Rhw9 (35); D5Rhwl2 (38); D5Rhwl3 (39); D5Rhwl4 (40); and D5Rhwl6 (42) are of Koletsky type and in such an embodiment have the length specified in Table 1. The primer and reverse primer sequences to be used in analyzing the type of marker present at chromosome 5 are provided in Table 1. In such an embodiment, the congenic

BBDRlepr-/- and congenic BBDRlepr+/- rat lines described comprises an "A" at position 122 394 627 (position based on RGSC Genome Assembly v3.4) close to the microsatellite D5Wox39. In BBDR rats the corresponding position is "G" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 78 in such an embodiment. Further, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described comprises an "C" at position 121 723 999 (position based on RGSC Genome Assembly v3.4) close to the microsatellite D5Rhw23(l). In BBDR rats the corresponding position is "A" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 74 in such an embodiment.

Furthermore, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described comprises an "A" at position 123 117 423 (position based on RGSC Genome Assembly v3.4) close to the microsatellite D5Rhw20(46). In BBDR rats the corresponding position is "C" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 90 in such an embodiment.

It was further found that the length of the introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 may vary, although being around 800 000 base pairs. In embodiments wherein at least one of the markers D5Rhw23(l); 5Rhw9 (35); D5Rhwl2 (38); D5Rhwl3 (39); D5Rhwl4 (40); D5Rhwl6 (42); and D5Rhw20(46) (the congenic BBDRlepr+/-), or both of the markers

D5Rhw23(l); 5Rhw9 (35); D5Rhwl2 (38); D5Rhwl3 (39); D5Rhwl4 (40); D5Rhwl6 (42); and D5Rhw20(46) (the congenic BBDRlepr-/-) are of Koletsky type, and wherein least one of the nucleotides (the congenic BBDRlepr+/-) at position 121 723 999 is "C", or both of the nucleotides (the congenic BBDRlepr-/-) at position 121 723 999 are "C", the nucleotides at position 107 820 833, and 115 931 866, respectively may vary. When at least one of the nucleotides at position 121 723 999 is "C", the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 74.

According to a first such embodiment (cf. BBCP Long Koletsky in Table 2), the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described comprises a "G" at position 107 820 833 (position based on RGSC Genome Assembly v3.4). In BBDR rats the corresponding position is "A" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 66 according to such a first embodiment. Further, according to such a first embodiment, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described comprises a "T" at position 115 931 866 (position based on RGSC Genome Assembly v3.4). In BBDR rats the corresponding position is "C" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 70.

According to a second such embodiment (cf. BBCP Short Koletsky in Table 2), the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described does not comprises a "G" at position 107 820 833 (position based on RGSC Genome Assembly v3.4), but solely an "A". In BBDR rats the corresponding position is "A" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines does not comprises a nucleotide sequence according to SEQ ID No. 66. The genome of the congenic BBDRlepr+/-, as well as the congenic BBDRlepr-/- rat line, only comprises nucleotide sequences according to SEQ ID No. 65 (encompassing the SNP at position 107 820 833) at both alleles. Further, according to such a second embodiment, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described comprises a "T" at position 115 931 866 (position based on RGSC Genome Assembly v3.4). In BBDR rats the corresponding position is "C" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines comprises a sequence according to SEQ ID No. 70 according to such a second embodiment. In such a second embodiment, the introgressed Koletsky DNA fragment is shorter than in the first one. According to a third such embodiment (cf. BBCP xShort Koletsky in Table 2), the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described does not comprises a "G" at position 107 820 833 (position based on RGSC Genome Assembly v3.4), but solely an "A". In BBDR rats the corresponding position is "A" (cf. Table 2). Further, according to such a second embodiment, the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines described does not comprise an "T" at position 115 931 866 (position based on RGSC Genome Assembly v3.4) , but solely an "C". In BBDR rats the corresponding position is "C" (cf. Table 2). Thus, the genome of the congenic BBDRlepr-/- and congenic BBDRlepr+/- rat lines according to such a third embodiment does not comprises a nucleotide sequence according to SEQ ID No. 66 or 70. The genome of the congenic BBDRlepr+/- rat line, as well as of the congenic BBDRlepr-/- rat lines only comprises nucleotide sequences according to SEQ ID No. 65

(encompassing the SNP at at position 107 820 833) and 69 (encompassing the SNP at position 115 931 866) at both alleles. In such a third embodiment, the introgressed Koletsky DNA fragment is shorter than in the second one.

According to another embodiment, the introgressed DNA fragment containing the leptin receptor mutation on chromosome 5 has a size of less than 800 000. Similar to D5Uwm27, only one marker length may then be detected in heterozygotes also for other microsatellite markers. In such an embodiment, chromosome 5 comprises a

D5Rhw20(46) microsatellite having a marker size of 175 base pairs (BBDR), and not 200 base pairs (Koletsky), as determined by use of primers according to SEQ ID 41 and SEQ ID 42, and/or a D5Rhw23(l) microsatellite marker having a size of 205 base pairs (BBDR), and not 218 base pairs (Koletsky), as determined by use of primers according to SEQ ID 27 and SEQ ID 28. The D5Rhw20(46) microsatellite marker being flanked by a forward primer site with at least 95 % sequence identity to SEQ ID 41 and a reverse primer site with at least 95 % sequence identity to SEQ ID 42. The D5Rhw23(l) microsatellite marker being flanked by a forward primer site with at least 95 % sequence identity to the corresponding primer sequence provided in Table 1 and a reverse primer site with at least 95 % sequence identity to the corresponding reverse primer sequence provided in Table 1.

Further, also 1, 2, 3, 4 or 5 of the markers 5Rhw9(35); D5Rhwl2(38);

D5Rhwl3(39); D5Rhwl4(40); and D5Rhwl6(42) may be of BBDR, and not of Koletsky, type. The ones not being of BBDR type may be of Koletsky type. The primers and reversed primers for the markers 5Rhw9(35); D5Rhwl2 (38); D5Rhwl3 (39); D5Rhwl4 (40); and D5Rhwl6 (42) are provided in Table 1. Thus, the following combinations of marker set may be present:

a) a D5Rhw9(35) microsatellite having a marker size of 205 base pairs (Koletsky), as determined by use of primers according to SEQ ID 31 and SEQ ID 32; a D5Rhwl2(38) microsatellite marker size of 235 base pairs (Koletsky), as determined by use of primers according to SEQ ID 33 and SEQ ID 34; a D5Rhwl3(39) microsatellite marker size of 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 35 and SEQ ID 36; a D5Rhwl4(40) microsatellite marker size of 175 base pairs (Koletsky), as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and a D5Rhwl6(42) microsatellite marker size of 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 39 and SEQ ID 40. For such a combination, the genome of the congenic rat line does not comprise:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 74; or

but do comprise:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; an

- a nucleotide sequence according to SEQ ID No. 90.

b) a D5Rhw9(35) microsatellite marker size of 205 base pairs (Koletsky), as determined by use of primers according to SEQ ID 31 and SEQ ID 32; a D5Rhwl2(38) microsatellite marker size of 235 base pairs (Koletsky), as determined by use of primers according to SEQ ID 33 and SEQ ID 34; a D5Rhwl3(39) microsatellite marker size of 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 35 and SEQ ID 36; a D5Rhwl4(40) microsatellite marker size of 175 base pairs (Koletsky), as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and a

D5Rhwl6(42) microsatellite marker size of 210 base pairs (BBDR), and not 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 39 and SEQ ID 40. For such a combination, the genome of the congenic rat line does not comprise:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70; - a nucleotide sequence according to SEQ ID No. 74; or

- a nucleotide sequence according to SEQ ID No. 90;

but do comprise:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; and

- a nucleotide sequence according to SEQ ID No. 89.

c) a D5Rhw9(35) microsatellite marker size of 205 base pairs (Koletsky), as determined by use of primers according to SEQ ID 31 and SEQ ID 32; a D5Rhwl2(38) microsatellite marker size of 235 base pairs (Koletsky), as determined by use of primers according to SEQ ID 33 and SEQ ID 34; a D5Rhwl3(39) microsatellite marker size of 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 35 and SEQ ID 36; a D5Rhwl4(40) microsatellite marker size of 200 base pairs (BBDR), and not 175 base pairs (Koletsky), as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and a D5Rhwl6(42) microsatellite marker size of 210 base pairs (BBDR), and not 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 39 and SEQ ID 40. For such a combination, the genome of the congenic rat line does not comprise:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 74; or

- a nucleotide sequence according to SEQ ID No. 90;

but do comprise:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; an<

- a nucleotide sequence according to SEQ ID No. 89.

d) a D5Rhw9(35) microsatellite marker size of 205 base pairs (Koletsky), as determined by use of primers according to SEQ ID 31 and SEQ ID 32; a D5Rhwl2(38) microsatellite marker size of 235 base pairs (Koletsky), as determined by use of primers according to SEQ ID 33 and SEQ ID 34; a D5Rhwl3(39) microsatellite marker size of 195 base pairs (BBDR), and not 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 35 and SEQ ID 36; a D5Rhwl4(40) microsatellite marker size of 200 base pairs (BBDR), and not 175 base pairs (Koletsky), as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and a D5Rhwl6(42) microsatellite marker size of 210 base pairs (BBDR), and not 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 39 and SEQ ID 40. For such a combination, the genome of the congenic rat line does not comprise:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 74; or

- a nucleotide sequence according to SEQ ID No. 90;

but do comprise:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; an

- a nucleotide sequence according to SEQ ID No. 89.

e) a D5Rhw9(35) microsatellite marker size of 205 base pairs (Koletsky), as determined by use of primers according to SEQ ID 31 and SEQ ID 32; a D5Rhwl2(38) microsatellite marker size of 230 base pairs (BBDR), and not 235 base pairs (Koletsky), as determined by use of primers according to SEQ ID 33 and SEQ ID 34; a

D5Rhwl3(39) microsatellite marker size of 195 base pairs (BBDR), and not 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 35 and SEQ ID 36; a D5Rhwl4(40) microsatellite marker size of 200 base pairs (BBDR), and not 175 base pairs (Koletsky), as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and a D5Rhwl6(42) microsatellite marker size of 210 base pairs (BBDR), and not 230 base pairs (Koletsky), as determined by use of primers according to SEQ ID 39 and SEQ ID 40. For such a combination, the genome of the congenic rat line does not comprise:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 90;

but do comprise:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; and

- a nucleotide sequence according to SEQ ID No. 89.

f) a D5Rhw9(35) microsatellite marker size of 205 base pairs (BBDR), as determined by use of primers according to SEQ ID 31 and SEQ ID 32; a D5Rhwl2(38) microsatellite marker size of 230 base pairs (BBDR), and not 235 base pairs (Koletsky), as determined by use of primers according to SEQ ID 33 and SEQ ID 34; a

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 74; or

- a nucleotide sequence according to SEQ ID No. 90;

but do comprise:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; an

- a nucleotide sequence according to SEQ ID No. 89. The term congenic line relates to an inbred strain of rats produced by repeated crossing of one gene line onto another inbred (isogenic) line. For the present rat lines the BBDR line is the inbred (isogenic) line. The herein disclose rat line were obtained by repeated crosses to BBDR.

The presence or absence of a certain SNP, may according to an embodiment be determined by use of a forward and reverse primer according to table 3 in combination with the corresponding reporter sequences. Thus

- the SNP BCP107.8 may be determined by use of primers according to SEQ ID NO. 63 and 64 and reporter sequences according to SEQ ID NO. 65 and 66;

- the SNP BCP115.9 may be determined by use of primers according to SEQ

ID NO. 67 and 68 and reporter sequences according to SEQ ID NO. 69 and 70;

- the SNP BCP121.7 may be determined by use of primers according to SEQ ID NO. 71 and 72 and reporter sequences according to SEQ ID NO. 73 and 74;

- the SNP BCP122.39 may be determined by use of primers according to SEQ ID NO. 75 and 76 and reporter sequences according to SEQ ID NO. 77 and 78;

- the SNP LEPR763 may be determined by use of primers according to SEQ ID NO. 79 and 80 and reporter sequences according to SEQ ID NO. 81 and 82;

- the SNP BCP122.5 may be determined by use of primers according to SEQ ID NO. 83 and 84 and reporter sequences according to SEQ ID NO. 85 and 86; and/or - the SNP BCP122.5 may be determined by use of primers according to SEQ

ID NO. 87 and 88 and reporter sequences according to SEQ ID NO. 89 and 90.

According to an embodiment, the present rat lines are obtained by marker assisted (cf. Table 1), repeated crossing of one gene line onto another inbred (isogenic) line to provide a lepr(-/+) rat line having a D5UWM27 microsatellite marker size of 160 base pairs (BBDR).

Further, it according to an embodiment, the present rats lines are subjected to a health monitoring program (related to defined microbiological units including being e g Helicobacter spp. free) as recommended by the Federation of European Laboratory Animal Science Associations (www.felasa.eu). The present rat lines are bred under pathogen-free conditions including being Helicobacter free. The exact microbiological tests performed can be found in the FELASA recommendation, Appendix 3 (W. Niclas, P. Baneux, R. Boot, T. Decelle, A. A. Deeny, M. Fumanelli and B. Illgen-Wilcke. "Recommendations for the health monitoring of rodent and rabbit colonies in breeding and experimental units". Lab Anim 2002 36: 20). The animal facility at Lund

University/CRC wherein the rat lines have been bred is confirmed free from the microbiological units listed in the recommendation, including but not limited to

Helicobacter, since the start-up in 2007.

In one embodiment, two groups of male rats were distinguished; a diabetic group, or "high glucose" group, and another group with mild hyperglycemia, or "low glucose" group. Rats were weighed daily and glucose was measured twice weekly from

40 days of age. Diabetes diagnosis was established if blood glucose exceeded 11.1 mM.

The diabetic group, or "high glucose" group, was diabetic according to this definition

(>11.1 mM). The mild hyperglycemia, or "low glucose" group, did not meet the 11.1 mM threshold but had significantly higher blood glucose levels when compared to control lean male rats or female rats (Table 2), and can, according to an embodiment, be defined by a blood glucose value of >6.5 mM at 100 days of age. Both groups develop diabetes vascular complications.

Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The preferred specific embodiments described herein are, therefore, to be construed as merely illustrative and not limitative of the remainder of the description in any way whatsoever.

Further, although the present invention has been described above with reference to specific embodiments, it is not intended to be limited to the specific form set forth herein. Rather, the invention is limited only by the accompanying claims and, other embodiments than the specific above are equally possible within the scope of these appended claims, e.g. different than those described above.

In the claims, the term "comprises/comprising" does not exclude the presence of other elements or steps. Additionally, although individual features may be included in different claims, these may possibly advantageously be combined, and the inclusion in different claims does not imply that a combination of features is not feasible and/or advantageous.

In addition, singular references do not exclude a plurality. The terms "a", "an", "first", "second" etc do neither preclude a plurality.

Experimental

The following examples are mere examples and should by no mean be interpreted to limit the scope of the invention. Rather, the invention is limited only by the accompanying claims. Materials, methods and results

Generation of helicobacter free rats

BBDR rats heterozygous for the Koletsky mutation (Lepr-) were transferred from the R H Williams Laboratory at the University of Washington to Lund

University/CRC in Malmo, Sweden. The transfer to the barrier facility at CRC was a two-step procedure, enabling the development of a helicobacter free strain of

BBDR.lepr+/- rats. First, breeders from RH Williams Laboratory were quarantined in the Experimental department at Lund University, generating 14 new breeding pairs. New breeding pairs were then put together and maintained in the same cage for 12 hours during dark cycle. After 23 days of gestation, females were subject to caesarian sections and newborn pups were transferred to surrogate Sprague Dawley mothers at the CRC barrier facility (survival rate 82 %, 11 pups attempted from two mothers). Housing

Animals in the barrier facility were maintained in 12 h dark/ 12 h- light cycle with ad libitum access to food (Labfor R3, Lantmannen, Kimstad) and water. Sentinel rats were tested quarterly according to Federation for Laboratory Animal Science Association (FELASA) standard (www.felasa.eu) and has been confirmed specific pathogen free and helicobacter free since transfer in 2010. Female and male rat endpoint experiments were performed at 180 days of age unless otherwise stated. Euthanasia was performed by bleeding from the abdominal aorta under general anesthetic with isoflurane (5%, flow 2000 ml/min). Genotyping of Lepr fragment on chromosome 5.

The rat colony is maintained by heterozygous breeding, generating 25% BBDR.lepr-/-, 25% BBDR.lepr+/+ and 50% BBDR lepr+/- rats. Introgression of the Lepr gene from the Koletsky rat to the BBDR rat and genotyping of the BBDR.lepr rat has been described in detail elsewhere (Moralejo DH, Park HA, Speros SJ, MacMurray AJ, Kwitek AE, Jacob HJ, Lander ES, Lernmark A. "Genetic dissection of lymphopenia from autoimmunity by introgression of mutated Ian5 gene onto the F344 rat." J

Autoimmun 21 :315-324, 2003). In short, ear biopsies from ID-marks were collected in DNA was prepared after 3 hours digestion with proteinase K (Fermenta, Stockholm) using a standard isopropanol/ethanol protocol. PCR amplification of SSLP markers D5Rat98, D5UWM27, D5Rhw23, D5Rhw9, D5Rhwl3 and D5Rhw20 was performed with a 2720 Thermal Cycler (Applied Biosystems, Stockholm) and PCR products were analyzed using CEQ 8000 DNA analyzer (Beckman Coulter, Stockholm).

The SNP analysis was performed as described above. Phenotyping

Rats were weighed daily and glucose was measured twice weekly from 40 days of age. Diabetes diagnosis was established if blood glucose exceeded 11.1 mM. Two groups of male rats were distinguish, a diabetic group or "high glucose" group which was diabetic according to this definition (>11.1 mM) and another group with mild hyperglycemia or "low glucose" group, which did not meet the 11.1 mM threshold, but had significantly higher blood glucose levels when compared to control lean male rats or female rats (Table 2). Both groups develop diabetes vascular complications, including enlarged heart, elevated systolic blood pressure, thickening of the arterial wall, early signs of atherosclerosis (i.e. lipid and macrophage deposition), enlarged kidneys, increase in albumin/creatinine ratio, enlarged liver, liver steatosis and significant perivascular and perirenal lipid accumulation. The present rats have blood glucose levels that oscillate dramatically in a manner not observed in BBDR.lepr-/lepr- rats (Moralejo rats described in Moralejo et al...).

Diabetes Free Survival: The median diabetes free survival time for male rats is 77.5 days.

Table 2. Blood glucose levels at different time points (mean ± SEM; Lepr+/? represents data from Lepr+/+ and Lepr+/-).

Males Females

Lepr+/? Lepr-/- all 77^v, ' , ^v Lepr+/? Lepr-/- nign glucose low glucose

50 d 5,56 ±0,15 7,21 ±0,50 7,96 ±0,84 6,32 ±0,32 5,41 ±0,23 5,57 ±0,12

75 d 5,17 ±0,12 10,9 ±1,29 13,7 ±1,83 6,96 ±0,68 4,76 ±0,11 6,45 ±0,41

100 d 5,03 ±0,14 13,0 ±1,35 16,0 ±1,91 8,76 ±0,67 5,07 ±0,10 5,63 ±0,30

125 d 5,16 ±0,23 16,1 ±1,87 22,6 ±1,62 6,89 ±0,32 4,58 ±0,17 5,3 1±0,20

150 d 4,86 ±0,11 16,1 ±2,08 22,7 ±2,20 6,82 ±0,76 4,59 ±0,083 5,61 ±0,42

180 d 5,23 ±0,19 16,5 ±2,06 23,8 ±1,69 6,24 ±0,48 4,86 ±0,14 6,21 ±0,67 Obesity

Both male and female rats are obese when compared to heterozygous or lepr+/+ littermates with significantly higher body mass index (BMI, Table 3). Male rats with the high blood glucose phenotype had significantly lower body weight and BMI when compared to rats with low/intermediate glucose levels. Obese males had significantly shorter tibias than lean control littermates and male rats had longer tibias than females (Table 3).

Table 3. BG and body weight.

Males Females

High gluLow

Lepr+/+ Lepr+/- Lepr-/- Lepr+/+ Lepr+/- cose glucose Lepr-/-

BMI 0,71 0,73 1,08 0.98 1.21 0,56 0,56 1,15

(g/cm²) ±0,020 ±0,016 ±0,034 ±0.030 ±0.032 ±0,030 ±0,010 ±0,013

Tibia

4,23 4,24 4,00 3.97 4.04 3,78 3,86 3,81 length

±0,024 ±0,021 ±0,031 ±0.050 ±0.027 ±0,050 ±0,019 ±0,018

(cm) Tissue and serum collection.

Female and male rat endpoint experiments were performed at 180 days of age unless otherwise stated. Euthanasia was performed by bleeding from the abdominal aorta under general anesthetic with isoflurane (5%, flow 2000 ml/min). The pancreas was excised immediately followed by collection of urine from the bladder. Liver, kidneys, heart, aorta and tibia were harvested after perfusion of the heart with PBS. All organs were weighed before further processing.

Organ size

As shown in Table 4, present rats have significantly larger liver, heart and kidneys when compared to lean littermate control rats. Table 4. Organ size.

Males Females

High Low

Lepr+/+ Lepr+/- Lepr-/- Lepr+/+ Lepr+/- Lepr-/- glucose glucose

Liver/Tibia 4.01 4.10 12.7 13.8 11.5 2.45 2.67 11.7 (g/cm) ±0.17 ±0.22 ±0.57 ±0.50 ±0.87 ±0.12 ±0.053 ±0.45

Heart/Tibia 365.8 357.9 442.3 421,2 466,4 274.7 303.1 479.4 (mg/cm) ±38.9 ±19.3 ±20.0 ±35,5 ±11,7 ±11.2 ±10.8 ±14.4

2 kidneys 0.665 0.775 1.25 1.33 1.14 0.527 0.525 1.20 /tibia (g/cm) ±0.041 ±0.041 ±0.040 ±0.047 ±0.051 ±0.015 ±0.0090 ±0.023

Serum sampling

Rats were anesthetized with isoflurane (Isoba Vet, Apoteket, Stockholm) at induction dose 5% and maintenance dose 3% at a gas flow of 2000 ml/min (Abbott, GE Medical, Stockholm). Whole blood was collected from the tail vein into Microtainer SST tubes with gel separator (BD Preanalytical Systems, Stockholm). Blood samples were allowed to coagulate and then centrifuged for 15 minutes at 3000 rpm in 15°C. Serum was stored in aliquots in microtubes and stored in -80°C until analyses. Serum was collected at baseline (mean age 50 days) and at endpoint. From sampled serum insulin, leptin, glucagon, TG, cholesterol and lipoprotein fractions (lipoprint) can be measured.

Serum insulin, leptin and glucagon, TG, cholesterol, Lipoprint

Serum cholesterol and triglycerides were measured by colorimetric assays as described before (cf. C. Gustavsson, C.-D. Agardh, A.V. Zetterqvist, J. Nilsson, E.

Agardh & M.F. Gomez. Vascular Cellular Adhesion Molecule- 1 (VCAM-1) Expression in Mice Retinal Vessels is Affected by Both Hyperglycemia and Hyperlipidemia PLoS ONE 2010;13;5(9):el2699 - (InfmityTM-Cholesterol and InfmityTM-Triglyceride; Thermo Scientific, Middletown, VA, USA)). Serum insulin and leptin were measured using a duplex kit (Meso Scale Discovery, USA) and serum glucagon using a single plex kit (Meso Scale Discovery). The lower detection limit for each analyte was within the range described by the manufacturer. All assays were performed according to the instructions of the manufacturers. Serum insulin and leptin were measured using a duplex kit (Cat no K15158C, Meso Scale Discovery, USA) and serum glucagon using a single plex kit (Cat no K150HCC, Meso Scale Discovery). The lower detection limit for each analyte was within the range described by the manufacturer. All assays were performed according to the instructions of the manufacturers.

Serum levels of leptin and insulin were elevated in male and female present rats when compared to heterozygous or lepr+/+ littermates. For insulin, significantly lower levels were measured in male rats with the high blood glucose phenotype, when compared to rats with low/intermediate glucose levels. A similar trend was observed for leptin, with lower levels in male rats with higher blood glucose levels. Glucagon levels were significantly higher in female rats when compared to male rats but no significant differences were found between genotypes, as seen in Table 5.

Table 5. Serum analysis.

Males Females

High Low

Lepr+/+ Lepr+/- Lepr-/- Lepr+/+ Lepr+/- Lepr-/- glucose glucose

Insulin 922,4 700,0 1875 1380 2505 566,5 506,7 2082

(pg/mL) ±93,7 ±99,1 ±75.6 ±190.7 ±192.7 ±280,1 ±109,0 ±184.6

Leptin 7,10 10,4 66.7 53.6 82.3 5,39 8,52 87.4 (ng/niL) ±0,79 ±0,61 ±9.71 ±7.24 ±18.8 ±0,51 ±1,01 ±11.9

Glucagon 109,8 156,1 125.1 125.1 122.4 172,1 165,8 232.5 (pg/mL) ±21,1 ±33,9 ±27.8 ±27.8 ±23.4 ±45,8 ±37,8 ±18.3

ALT and AST

Liver enzymes alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured using standard spectrophotometric procedures with Reflotron GPT and GOT, respectively, according to the manufacturer's instructions (Roche Diagnostics Scandinavia AB).

Male rats had significantly higher levels of alanine transaminase (ALT) in serum when compared to control rats (Table 6), indicating liver injury. This elevation was more pronounced in rats displaying the high blood glucose phenotype. No significant increase in serum ALT levels was observed in female rats. Serum levels of aspartate transaminase (AST) were also measured and a trend towards higher levels in male rats was observed. Table 6. Liver.

Males Females

Lep ^rr+/+ Lep ^rr+/- Le ^rpr-/- g ,lucose g ,lucose Leprr+/+ Leprr+/- Leprr-A

ALT 0,705 0,719 7,72 11,8 2,41 1,22 1,09 2,06

^kat/L) ±0,029 ±0,060 ±2,46 ±4,03 ±0,41 ±0,30 ±0,16 ±0,28

AST 2,15 2,18 8,21 12,0 3,27 3,93 3,42 3,22

^kat/L) ±0,18 ±0,23 ±2,71 ±4,57 ±0,51 ±1,03 ±0,48 ±0,52

Higher serum cholesterol and triglycerides; Both female and male rats show substantially enhanced cholesterol and triglyceride levels (Table 7). Male rats with the high blood glucose phenotype have significantly higher cholesterol levels when compared to rats with low/intermediate glucose levels and a similar trend was observed for triglycerides. Triglyceride levels exceed previously published levels for BBDR.lepr- /lepr- (Moralejo) rats. Diabetic male rats have also enlarged liver, liver steatosis and significant perivascular and perirenal lipid accumulation.

Table 7. Cholesterol and triglycerides.

Males Females

Lepr+/+ Lepr+A ^Lepr" "^{igh L}°^w Lepr+/+ Lepr+A ^Lepr" ^r A glucose glucose ^r A

Total

1,23 1,33 3,56 3,86 1,24 1,26 3,70 cholesterol

±0,032 ±0,035 ±0,15 ±0,21 ±0,064 ±0,21 (mg/mL)

Triglycerides 2,40 2,64 19,4 21,5 17,7 1,84 14,7 (mg/mL) ±0,29 ±0,24 ±1,61 ±2,29 ±2,02 ±0,27 ±1, 13

Genotype dependent shift in lipoprotein fraction distribution

Using the FDA approved Lipoprint LDL System, we examined the lipoprotein sub fraction distribution in obese and lean rats (Table 8). Male rats display a shift in the distribution of LDL subfractions, with an increase in the atherogenic small-dense LDL particles (LDL3-LDL7) and a corresponding decrease in the fraction of large-buoyant LDL particles, as well as VLDL and IDL particles. Rats with the high blood glucose phenotype had significantly higher total cholesterol levels when compared to rats with low/intermediate glucose levels (Table 8). This increase is predominantly reflected in increased levels of the atherogenic small-dense LDL-particles, VLDL and HDL.

Table 8. Lipoprotein fraction distribution (mean ± SEM).

Males Females

Lepr+/+ Lepr+/- Lepr-/- Lepr+/+ Lepr+/- Lepr-/-

VLDL-cholesterol

VLDL (mg/dL) 28.9 64.8 ±5.01 ^c' 25.1 58.5 ±5.60 ^c'

27.6 ±1.27 23.7 ±0.75

±1.74 f ±2.36 f

VLDL (%) 22.4 17.3 ±1.03 19.9 16.3 ±1.68

22.7 ±0.82 19.1 ±0.59 d

±1.50 d ±1.24

IDL-cholesterol

MID-C (mg/dL) 16.2 36.5 ±2.13 ^c' 17.0 41.7 ±5.48 ^c'

14.8 ±0.89 6.6 ±0.72

±0.95 f

±0.76 f 1

MID-C (%) 12.8 9.74 ±0.29 ^a- 13.7 11.5 ±1.64

12.3 ±0.85 13.7 ±0.99

±0.60 e ±0.87

MID-B (mg/dL) 7.11 5.86 15.9 ±2.21

6.78 ±0.92 13.6 ±1.91 5.29 ±0.81

±1.51 ±1.91 b, d

MID-B (%) 5.33 5.00

5.78 ±0.98 3.58 ±0.49 4.43 ±0.72 4.59 ±0.72

±1.14 ±0.72

MID-A (mg/dL) 1.22 0.14

1.50 ±0.46 0.37 ±0.19 0.14 ±0.14 0.76 ±0.49

±0.49 ±0.14

MID-A (%) 1.00 0.053 ±0.053 0.14

1.33 ±0.44 b, d 0.14 ±0.14 0.24 ±0.18

±0.37 ±0.14

Large-buoyant LDL- cholesterol

LDL1 (mg/dL) 1.22 0.053 ±0.053 0.14

1.44 ±0.34 0 0.18 ±0.18

±0.36 c, d ±0.14

LDL1 (%) 1.00 ₀ c, e 0.14 0.059

1.44 ±0.34 0

±0.29 ±0.14 ±0.059

LDL2 (mg/dL) 1.22 0.21 ±0.16 ^b' 0.14 0.059

1.44 ±0.34

±0.36 d 0.29 ±0.18

±0.14 ±0.059

LDL2 (%) 0.78 0.053 ±0.053 0.14

1.44 ±0.34 0

±0.22 c, d 0.29 ±0.18

±0.14

Small-dense LDL- cholesterol

LDL3 (mg/dL) 1.67 0.14

1.56 ±0.29 1.42 ±0.36 0.29 ±0.18 0.29 ±0.19

±0.37 ±0.14

LDL3 (%) 1.22 0.42 ±0.12 0.14 0.059

1.56 ±0.29

±0.28 d 0.29 ±0.18

±0.14 ±0.059

LDL4 (mg/dL) 0.78 3.21 ±0.49 ^b' 1.47 ±0.38

0.56 ±0.29 0 0 d

±0.32

LDL4 (%) 0.67

0.56 ±0.29 0.79 ±0.096 0 0 0.41 ±0.12

±0.29

LDL5 (mg/dL) 0.11 3.53 ±0.48 ^c' 2.24 ±0.41

0 0 0 b, e

±0.11

LDL5 (%) 0.11 0.95 ±0.093 0.59 ±0.12 ^

0 d

±0.1 1 c, f 0 0

LDL6 (mg/dL) 2.68 ±0.30 ^c' 2.41 ±0.39

0 0 f 0 0 b, e

LDL6 (%) 0.79 ±0.096 0.71 ±0.14

0 0 c, f 0 0 b, e

LDL7 (mg/dL) 0 0 7.58 ±0.91 ^c> 0 0 10.8 ±1.76 LDL7 (%) _{0 0} 2.1 1 ±0.24 ^c' _{Q Q} 2.88 ±0.53

HDL-cholesterol

HDL (mg/dL) 64.0 ±3.50 ^ 230.3 ±12.5 ₇₃._{6 ±7}.₀₆ 76.7^ 241.0 ±17.3

HDL (%) _{52 7 ±2 04} 54.0 61.4 ±1.66 - 60.6 ^ ^

±1 1 ±1. /3

a <0.05 vs. Lepr+/+; ^b P<0.01 vs. Lepr+/+; ^c P<0.001 vs. Lepr+/+; ^d <0.05 vs. Lepr+/-; ^c <0.07 vs Lepr+/-; ^f P<0.001 vs. Lepr+/-

Cardiovascular disease (CVD)

The IITC Life Science tail cuff plethysmography blood pressure system

(Woodland Hills, CA) was used to monitor blood pressure. Rats were conditioned to restrainer and chamber by performing the measurement procedure during two

consecutive days. Blood pressure recording was performed on day three. Rats were placed in a restrainer (model 79-81 restrainer for rats) with a darkened nose cone in a heating chamber (32 - 34 °C) for six minutes before inflation of the cuff (model B60/7- 16"). Maximum inflation pressure was 220 mm Hg and 190 mm Hg for obese rats and lean rats respectively. Typically, three runs were performed six minutes apart, with three cycles of measurements in each run. Blood pressure was automatically monitored with MRBP Controller VI .45 and analyzed with IITC Life Science Data Acquisition Software version 1.45.

At 180 days of age, the heart of male diabetic rats is enlarged. At this time point, diabetic male rats have significantly elevated systolic blood pressure (SBP) when compared to control littermates. A trend towards increased heart rate is observed in male rats with the high blood glucose phenotype. Longitudinal analysis of systolic blood pressure shows a progressive increase in SBP from 50 days of age (Table 9).

Table 9. CDV.

Males Females

Lepr+/+ Lepr+/- Lepr-/- g ,lucose g ,lucose Lepr+/+ Lepr+/- Lepr-/-

S stohc ₁₂₇^_{8 139}^ ₁₅₈^_{7 158}^_{0 159}^_{4 128}^_{2 141}^_{0 167}^₀

(mm _{±Q η 3 3 9 γ Q}

Hg)

Heart ₇^ 986 Q 9^Q ^ ^ 1 ^

Rate (mm 278 _±0 ^ ^ _±^ ^ 310 ±17 304 _±13 ^ Kidney histology

Paraffin embedded kidneys were sectioned and evaluated histologically.

Diabetic male rats not only develop macrovascular complications

(atherosclerosis) at 180 days of age, but also microvascular complications as evidenced by the enlarged kidneys (Table 10), significantly increased albumin/creatinine ratio, and changes in kidney histology, clearly indicating an abnormally high permeability for albumin in the renal glomerulus. Histological examination revealed that male rats have dilated and filled tubuli, loss of podocin expression in glomeruli. Female rats, despite obese phenotype and elevated blood lipids have no changes in tubular structure and only minor loss of podocin expression.

Table 10. Kidney.

Males Females

High Low

Lepr+/+ Lepr±/- Lepr-/- Lepr±/± Lepr±/- Lepr-/- glucose glucose

Albumin/creatine 0,087 0,068 5,66 5,68 5,03 0,17 0,14 8,42

(mg/mg) ±0,012 ±0,019 ±0,86 ±1,17 ±1,26 ±0,056 ±0,017 ±2,38

Score; kidney 0,40 1,23 1,40 1,08 0,25 Not 0,58

0,50 ±0

histology ±0,10 ±0,079 ±0,10 ±0,083 ±0,25 evaluated ±0,15

Pancreas histology

Pancreas was excised and put in Stefanini fixative for 24 hours. Pancreatic tissue was stained as previously described (Wierup et al, Regul Pept 2002). Primary antibodies were diluted in PBS containing 0.25% bovine serum albumin and 0.25% Triton X-100 and applied overnight at 4° C. Guinea pig polyclonal anti-proinsulin (1 :5120, code 9003 Euro-Diagnostica, Malmo, Sweden), guinea pig polyclonal anti- glucagon (1 :5120, code 8708 Euro-Diagnostica), goat polyclonal anti-somatostatin (1 :800, code SC7819, Santa Cruz Biotechnology Inc., Santa Cruz, CA) and either mouse monoclonal for human and rat OPN or rabbit polyclonal for mouse OPN (1 :500, Developmental Studies Hybridoma Bank, Iowa City, Iowa, USA and IBL Hamburg, Germany, respectively) were used. Secondary antibodies specific for rabbit-, guinea pig-, or goat- IgG, and coupled to either fluorescein isothiocyanate (FITC) or Texas-Red (Jackson, West Grove, PA, USA) were applied for 1 h at room temperature.

Immunofluorescence was examined in an epi-fiuorescence microscope (Olympus BX60). Images were taken with a digital camera (Nikon DS-2Mv). Disturbed morphology was observed in islets from all (100%) Lepr-/- rats, with very large islets in general, disturbed islet architecture with alpha cells mixed in between beta cells and also abnormal islet shape (popcorn islets). In Lepr-/- rats, very weak insulin immunoreactivity was observed whereas a normal amount of alpha cells with normal immunoreactivity was found. All lean rats displayed normal islet morphology with alpha cells always at the rim of the islet.

Histological evaluation of atherosclerotic lesions in the subvalvular region. Hearts were embedded in Optical Cutting Temperature (OCT) Compound and lipid (Oil Red O) and macrophage (Moma-2; monocyte/macrophage 2) contents were evaluated in cross-sections (10 μιη) of the aortic root as described before (Fredrikson GN et al, ATVB 2003). Rat anti-mouse Moma-2 primary antibody (BMA Biomedicals, Augst, Switzerland) and biotinylated rabbit anti-rat IgG (Vector Laboratories,

Burlingame, CA) secondary antibody were used. Sections were counter-stained with Harris hematoxylin for determination of subvalvular lesion area, expressed both in μιη² and as percentage of total cross sectional area (including intima and media) to correct for potential structural differences in the arterial wall between groups (Prevost G et al, Diab & Metabolism 2011). Specificity of immune staining was confirmed by the absence of staining when primary or secondary antibodies were omitted from the protocol. At least six sections per rat were analyzed under blind conditions by computer-aided morphometry (BioPix iQ 2.0 software, Biopix AB, Gothenburg, Sweden).

Histological examination of the aortic root shows thickening of the arterial wall and early signs atherosclerosis (lipid and macrophage deposition), which is unique for a rat model.

Summary of the present phenotvpe - Differences between present BBDR.^lepr~/lepr~ rat line & BBDR.lepr-/lepr-)

The difference between the published BBDR.^{lepr /lepr"} rat line (cf. Moralejo et al) and the present BBDR.^{lepr /lepr"} rat lineis the size of the DNA introgression from the

Koletsky rat (cp). The present rat lines are thus structurally different from the previously published BBDR.^{lepr /lepr"} rat, since the introgressed DNA fragment that contains the leptin receptor mutation on chromosome 5 is narrowed to about 800 000 bp, instead of the original 15 300 000 bp that characterized the BBDR.^{lepr /lepr"} rat. In addition to the genetic difference, several phenotypic aspects support the fact that present rat line, is a new line of rats that in addition to diabetes and obesity also develops cardiovascular complications (listed below):

• Higher serum cholesterol: Present female rats have -50% lower cholesterol levels than BBDR.^{lepr /lepr}-.

• Higher serum triglycerides: Both present female and male rats have

substantially enhanced triglyceride levels when compared to BBDR.^{lepr /lepr~} rats, with ~1150 mg/dl in females and 2300 mg/dl in males, exceeding previously published levels for BBDR.^{lepr /lepr'} rats by 130% and 475% respectively.

• Oscillating plasma glucose: Present rats have plasma glucose levels that oscillate dramatically in a manner not observed in BBDR.^{lepr /lepr~} rats.

• Diabetes Free Survival: The median survival time for present rats is 77.5 days, while the previously reported survival time for BBDR.^{lepr /lepr"} rats is 55 days.

• The unique and unexpected phenotypes of the present rats were established in the FELASA type of barrier facility using irradiated pellets from Labfor R2 Breeding Diet, a rodent diet different from the one used in the US barrier (Picolab Rodent Diet 20, #5053). So both the environment in which the present rats were developed and bred and the diet these rats received were different from those used for BBDR.^{lepr /lepr"} rats.

Claims

1. A congenic BBDRlepr-/- and/or congenic BBDRlepr+/- rat line,

characterized in that chromosome 5 comprises a D5Uwm27 microsatellite marker having a size of 160 base pairs, but not of 175, as determined by use of primers according to SEQ ID 25 and SEQ ID 26.

2. The congenic rat line according to claim 1, wherein chromosome 5 comprises a D5Wox39 microsatellite marker having a size of 160 base pairs, as determined by use of primers according to SEQ ID 29 and SEQ ID 30.

3. The congenic rat line according to claim 2, wherein the genome of rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82; and

- a nucleotide sequence according to SEQ ID No. 86.

4. The congenic rat line according to any of the claims claim 1 to 3, wherein chromosome 5 comprises:

a D5Rhw23(l) microsatellite marker having a size of 218 base pairs, as determined by use of primers according to SEQ ID 27 and SEQ ID 28;

a D5Wox39 microsatellite marker having a size of 160 base pairs, as determined by use of primers according to SEQ ID 29 and SEQ ID 30;

a D5Rhw9(35) microsatellite marker having a size of 205 base pairs, as determined by use of primers according to SEQ ID 31 and SEQ ID 32;

a D5Rhwl2(38) microsatellite marker having a size of 235 base pairs, as determined by use of primers according to SEQ ID 33 and SEQ ID 34;

a D5Rhwl3(39) microsatellite marker having a size of 230 base pairs, as determined by use of primers according to SEQ ID 35 and SEQ ID 36;

a D5Rhwl4(40) microsatellite marker having a size of 175 base pairs, as determined by use of primers according to SEQ ID 37 and SEQ ID 38;

a D5Rhwl6(42) microsatellite marker having a size of 230 base pairs, as determined by use of primers according to SEQ ID 39 and SEQ ID 40; and

a D5Rhw20(46) microsatellite marker having a size of 200 base pairs, as determined by use of primers according to SEQ ID 41 and SEQ ID 42.

5. The congenic rat line according to claim 4, wherein the genome of rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 74; and

- a nucleotide sequence according to SEQ ID No. 90.

6. The congenic rat line according to claim 5, wherein genome rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 66; and

- a nucleotide sequence according to SEQ ID No. 70

7. The congenic rat line according to claim 5, wherein the genome of rats in the line not comprises:

- a nucleotide sequence according to SEQ ID No. 66,

but wherein the genome of rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 65.

8. The congenic rat line according to claim 5, wherein the genome of rats in the line not comprises:

- a nucleotide sequence according to SEQ ID No. 66; or

- a nucleotide sequence according to SEQ ID No. 70;

but wherein the genome of rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 65; and

- a nucleotide sequence according to SEQ ID No. 69.

9. The congenic rat line according to claim 1 or 2, wherein chromosome 5 comprises:

a D5Rhw23(l) microsatellite marker size having a of 205 base pairs, but not 218 base pairs, as determined by use of primers according to SEQ ID 27 and SEQ ID 28; and/or

a D5Rhw20(46) microsatellite marker having a size of 175 base pairs, but not 200 base pairs, as determined by use of primers according to SEQ ID 41 and SEQ ID 42.

10. The congenic rat line according to claim 9, wherein chromosome 5 comprises:

a D5Rhwl4(40) microsatellite marker having a size of 175 base pairs, as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and

a D5Rhwl6(42) microsatellite marker having a size of 230 base pairs, as determined by use of primers according to SEQ ID 39 and SEQ ID 40.

11. The congenic rat line according to claim 10, wherein the genome of rats in the line not comprises:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 74; or

but wherein the genome of rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; and

- a nucleotide sequence according to SEQ ID No. 90.

12. The congenic rat line according to claim 9, wherein chromosome 5 comprises:

a D5Rhwl3(39) microsatellite marker having a size of 230 base pairs, as determined by use of primers according to SEQ ID 35 and SEQ ID 36; a D5Rhwl4(40) microsatellite marker having a size of 175 base pairs, as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and

a D5Rhwl6(42) microsatellite marker having a size of 210 base pairs, and not 230 base pairs, as determined by use of primers according to SEQ ID 39 and SEQ ID 40.

13. The congenic rat line according to claim 9, wherein chromosome 5 comprises:

a D5Rhwl4(40) microsatellite marker having a size of 200 base pairs, and not 175 base pairs, as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and

14. The congenic rat line according to claim 9, wherein chromosome 5 comprises:

a D5Rhwl3(39) microsatellite marker having a size of 195 base pairs, and not 230 base pairs, as determined by use of primers according to SEQ ID 35 and SEQ ID 36;

a D5Rhwl4(40) microsatellite marker having a size of 200 base pairs, and not 175 base pairs, as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and a D5Rhwl6(42) microsatellite marker having a size of 210 base pairs, and not 230 base pairs, as determined by use of primers according to SEQ ID 39 and SEQ ID 40.

15. The congenic rat line according to claim 9, wherein chromosome 5 comprises:

a D5Rhwl2(38) microsatellite marker having a size of 230 base pairs, and not 235 base pairs, as determined by use of primers according to SEQ ID 33 and SEQ ID 34;

a D5Rhwl4(40) microsatellite marker having a size of 200 base pairs, and not

175 base pairs, as determined by use of primers according to SEQ ID 37 and SEQ ID 38; and

16. The congenic rat line according to any one of the claims 12 to 15, wherein the genome of rats in the line not comprises:

- a nucleotide sequence according to SEQ ID No. 66;

- a nucleotide sequence according to SEQ ID No. 70;

- a nucleotide sequence according to SEQ ID No. 74; or

- a nucleotide sequence according to SEQ ID No. 90;

but wherein the genome of rats in the line comprises:

- a nucleotide sequence according to SEQ ID No. 65;

- a nucleotide sequence according to SEQ ID No. 69;

- a nucleotide sequence according to SEQ ID No. 73;

- a nucleotide sequence according to SEQ ID No. 78;

- a nucleotide sequence according to SEQ ID No. 82;

- a nucleotide sequence according to SEQ ID No. 86; and

- a nucleotide sequence according to SEQ ID No. 89.

17. The congenic rat line according to any one of the preceding claims, wherein chromosome 5 comprises:

a D5Ratl87 microsatellite marker having a size of 180, as determined by use of primers according to SEQ ID 1 and SEQ ID 2;

a D5Ratl21 microsatellite marker having a size of 230, as determined by use of primers according to SEQ ID 3 and SEQ ID 4;

a D5Ratl25 microsatellite marker having a size of 255, as determined by use of primers according to SEQ ID 5 and SEQ ID 6;

a D5Ratl31 microsatellite marker having a size of 165, as determined by use of primers according to SEQ ID 7 and SEQ ID 8;

a D5Rat4 microsatellite marker having a size of 175, as determined by use of primers according to SEQ ID 9 and SEQ ID 10;

a D5Rat7 microsatellite marker having a size of 195, as determined by use of primers according to SEQ ID 11 and SEQ ID 12;

a D5Ratl 1 microsatellite marker having a size of 160, as determined by use of primers according to SEQ ID 13 and SEQ ID 14;

a D5Ratl4 microsatellite marker having a size of 160, as determined by use of primers according to SEQ ID 15 and SEQ ID 16;

a D5Rat258 microsatellite marker having a size of 260, as determined by use of primers according to SEQ ID 17 and SEQ ID 18;

a D5Mit4 microsatellite marker having a size of 320, as determined by use of primers according to SEQ ID 19 and SEQ ID 20;

a D5Rat98 microsatellite marker having a size of 204, as determined by use of primers according to SEQ ID 21 and SEQ ID 22;

a D5Ratl83 microsatellite marker having a size of 185, as determined by use of primers according to SEQ ID 23 and SEQ ID 24;

a D5Rat233 microsatellite marker having a size of 275, as determined by use of primers according to SEQ ID 43 and SEQ ID 44;

a D5Got48 microsatellite marker having a size of 190, as determined by use of primers according to SEQ ID 45 and SEQ ID 46;

a D5Uial microsatellite marker having a size of 200, as determined by use of primers according to SEQ ID 47 and SEQ ID 48;

a D5Uwm37 microsatellite marker having a size of 175, as determined by use of primers according to SEQ ID 49 and SEQ ID 50; a D5Rat95 microsatellite marker having a size of 175, as determined by use of primers according to SEQ ID 51 and SEQ ID 52;

a D5Rat32 microsatellite marker having a size of 185, as determined by use of primers according to SEQ ID 53 and SEQ ID 54;

a D5Rat33 microsatellite marker having a size of 145, as determined by use of primers according to SEQ ID 55 and SEQ ID 56;

a D5Rat39 microsatellite marker having a size of 150, as determined by use of primers according to SEQ ID 57 and SEQ ID 58;

a D5Ratl06 microsatellite marker having a size of 230, as determined by use of primers according to SEQ ID 59 and SEQ ID 60; and

a D5Rat47 microsatellite marker having a size of 140, as determined by use of primers according to SEQ ID 61 and SEQ ID 62.

18. The congenic rat line according to any one of the preceding claims, displaying a mean blood glucose value of at least 6.5 mM at hundred days of age.

19. The congenic rat line according to claim 18, wherein said mean blood glucose value is between 6.5 mM, at hundred days of age, and 11.1 mM.

20. The congenic rat line according to claim 18, wherein said mean blood glucose value is above 11.1 mM.

21. A rat of a congenic rat line according to any one of the preceding claims.

22. The art according to claim 21, wherein said rat is a male lepr-/- rat.

23. The rat according to claim 22, wherein said rat has a body mass index of 0.95 to 1.24 g/cm².

24. The rat according to claim 22 or 23, wherein said rat has a liver/tibia ratio

(g/cm) of 10.7 to 14.3.

25. The rat according to any one of the claims 22 to 24, wherein said rat has a heart/tibia ratio (mg/cm) of 386 to 478.

26. The rat according to any one of the claims 22 to 25, wherein said rat has 2 kidneys/tibia ratio (g/cm) of 1.09 to 1.38

27. The rat according to any one of the claims 22 to 26, wherein said rat has an alanine aminotransferase (ALT) serum level of 2.0 to 15.8 μ1¾ΐ/ί.

28. The rat according to any one of the claims 22 to 27, wherein said rat has an aspartate aminotransferase (AST) serum level of 2.76 to 16.6 8 μ1¾ΐ/Ι_^.

29. The rat according to any one of the claims 22 to 28, wherein said rat has total cholesterol (mg/mL) level of 3.0 to 4.1.

30. The rat according to any one of the claims 22 to 29, wherein said rat has triglycerides (mg/mL) levels of 15.7 to 23.8.

31. The rat according to any one of the claims 22 to 30, wherein said rat has a systolic blood pressure (mm Hg) of 151.8 to 162.6.

32. The rat according to any one of the claims 22 to 31 , wherein said rat has an albumin/creatinine ratio (mg/mg) of 3.8 to 6.9.