WO2015035532A1 - Plantes transgéniques - Google Patents

Plantes transgéniques Download PDF

Info

Publication number
WO2015035532A1
WO2015035532A1 PCT/CN2013/001057 CN2013001057W WO2015035532A1 WO 2015035532 A1 WO2015035532 A1 WO 2015035532A1 CN 2013001057 W CN2013001057 W CN 2013001057W WO 2015035532 A1 WO2015035532 A1 WO 2015035532A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
seq
sbhkt1
promoter
nucleic acid
Prior art date
Application number
PCT/CN2013/001057
Other languages
English (en)
Inventor
Hai-Chun JING
Tiantian WANG
Original Assignee
Institute Of Botany
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute Of Botany filed Critical Institute Of Botany
Priority to PCT/CN2013/001057 priority Critical patent/WO2015035532A1/fr
Priority to CN201380079516.3A priority patent/CN107787180B/zh
Publication of WO2015035532A1 publication Critical patent/WO2015035532A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Definitions

  • the invention relates to transgenic plants with improved phenotypic traits, including enhanced growth under salt stress conditions. Also within the scope of the invention are related methods, uses, isolated nucleic acids and vector constructs.
  • Salinity is a soil condition characterized by a high concentration of soluble salts. Soils are classified as saline when the ECe is 4 dS/m or more, which is equivalent to approximately 40mMNaCI and generates an osmotic pressure of approximately 0.2 MPa. This definition of salinity derives from the ECe that significantly reduces the yield of most crops (Munns and Tester 2008).
  • Salinity is a major limiting factor for agricultural production of irrigated land (Munns and Tester 2008). Understanding the molecular mechanisms of salt responsive genes and utilisation of these for the improvement of crop salt tolerance is therefore essential for food and energy security for the need of the growing human population.
  • plants have evolved mechanisms of Na + extrusion and/or intracellular compartmentalisation of Na + into the vacuole to prevent excessive accumulation of Na + in the cytosol and maintain Na + /K + homeostasis at the cellular level, while at the whole- plant level, maintenance of a low sodium concentration in leaves (termed shoot Na + exclusion) is achieved through the withdrawal of Na + from the xylem and a reduction of transport of Na + to the leaves (for a review see Munns and Tester 2008).
  • NSCs non-selective cation channels
  • the HKT (high-affinity potassium transporter) genes are transmembrane proteins and belong to Trk/Ktr/HKT transporter family, and are known to be important in the regulation of Na + and K + transport in higher plants.
  • the HKT family of proteins is a large family that is structurally and functionally diverse. Members of the HKT family function as Na+/K+ symporters or as Na+-selective transporters of both high and low affinity. Subfamily 1 contains low affinity Na+ uniporters.
  • different HKTs (even within a single species) have different functional properties and different binding affinities for Na+ and/or K+.
  • HKTs can classified into subfamily 1 or subfamily 2 based on structural properties, little is known about the amino acid motifs that confer K + transport affinity. On this basis, functional properties, specifically binding to Na+ and/or K+, are difficult to predict on the basis of sequence motifs.
  • the dicotyledonous model plant Arabidopsis has only one HKT homologous protein (AtHKT1 ; 1 ) and this has been shown to be a selective Na + transporter in the Xenopus laevis oocyte expression system.
  • the wild-type AtHKT1 ; 1 controls root/shoot Na + distribution by unloading Na + from the ascending xylem sap and counteracts salt stress in leaves by loading this cation into the descending phloem, thus reducing the Na + accumulation in shoots.
  • the major contribution of the HKT transporters in salt tolerance is the exclusion of Na + from leaves.
  • the relevance of HKT proteins in enhancing crop salt tolerance was first demonstrated in rice (Oryza sativus) by the cloning of the SKC1 locus through QTL mapping in a Nona Bokra x Koshihikari segregating population.
  • the SKC1 locus encodes an HKT-type Na + -selective transporter OsHKT1 ;5 and is involved in the retrieval of Na + from the transpiration stream, a process which prevents further transport of Na + to leaves.
  • the relevance of the HKT genes for crop salt tolerance was further demonstrated by work characterising the Nax2 locus gene in durum wheat, TmHKT1;5-A, which withdraws Na + from the xylem and reduces transport of Na + to the leaves, increasing durum wheat grain yield on saline soils by 25% compared to near-isogenic lines without the Nax2 locus (for a review see Munns and Tester 2008).
  • the second HKT family member to be functionally characterised is involved in Na + entry into the outer layer cells of roots.
  • TaHKT2; 1 a subfamily 1 HKT, was cloned from wheat (Triticum aestivum L.) root and mediates K + transport energised through coupling to Na + rather than H + . Subsequently it has been shown that under high salt conditions TaHKT2; 1 -mediated K + uptake is inhibited and low affinity Na + uptake occurs in wheat roots (Gassmann et al. 1996).
  • the present invention is aimed at meeting this need.
  • the inventors have characterised a member of the sorghum HKT genes, SbHKT1;4. Unlike the function reported for HKTs in many in other crops, SbHKT1 ;4 exhibited a strong K + transport activity even in the presence of high external Na + concentrations in a yeast heterologous expression system and stimulated K + transportation under Na + stress in Arabidopsis transgenic lines. This function of SbHKT1;4 in sorghum can be used to design crops with enhanced salt tolerance.
  • the inventors have identified and characterised four sorghum genes encoding HKT proteins. However, only one of these, SbHKT1;4 displayed enhanced expression under high levels of Na + and sufficient K + conditions in a salt tolerant sorghum accession. Also, the inventors have shown that, surprisingly, SbHKT1;4 has a remarkable ability to take up K + under high Na + stress, resembling the feature of HKT gene normally found in the halophytic plants. None of the other three sorghum genes encoding HKT proteins share these properties.
  • the invention relates to a transgenic plant comprising and expressing a nucleic acid construct comprising SEQ ID No. 1 or a functional variant thereof wherein said functional variant has at least 75% sequence identity to SEQ ID No. 1 .
  • the invention in a second aspect, relates to a product derived from a plant as described herein.
  • the invention in another aspect, relates to a method for increasing salt tolerance of a plant comprising introducing and expressing a nucleic acid construct comprising SEQ ID No. 1 or a functional variant thereof in a plant wherein said functional variant has at least 75% sequence identity to SEQ ID No. 1.
  • the invention relates to a method for increasing growth/yield under salt stress conditions comprising introducing and expressing a nucleic acid construct comprising SEQ ID No. 1 or a functional variant thereof in a plant.
  • the invention in another aspect, relates to a method for modulating K uptake under salt stress comprising introducing and expressing a nucleic acid construct comprising SEQ ID No. 1 or a functional variant thereof in a plant wherein said functional variant has at least 75% sequence identity to SEQ ID No. 1.
  • the invention relates to a method for producing a transgenic plant comprising introducing and expressing a nucleic acid construct comprising SEQ ID No. 1 or a functional variant thereof in a plant wherein said functional variant has at least 75% sequence identity to SEQ ID No. 1 .
  • the invention relates to a plant obtained or obtainable by a method described herein.
  • the invention relates to an isolated nucleic acid comprising SEQ ID No. 3 .
  • the invention relates to a vector comprising SEQ ID No. 3 or a functional variant operably linked to a regulatory sequence wherein said functional variant has at least 75% sequence identity to SEQ ID No. 1 .
  • the invention relates to a vector comprising SEQ ID No. 1 or a functional variant operably linked to a regulatory sequence wherein said functional variant has at least 75% sequence identity to SEQ ID No. 1 .
  • the invention relates to an isolated host cell according to claim 29 wherein said host cell is a bacterial or a plant cell.
  • the invention relates to a use of an isolated nucleic acid or a vector described herein in increasing salt tolerance, maintaining Na/K homeostasis or for increasing growth or yield of a plant under salt stress.
  • A The structures of the SbHKT genes.
  • B A sequence alignment of the four putative ion-selectivity pore-forming regions (P-Loops: P A to P D ) of HKT proteins in higher plants. Asterisks indicate the amino acid positions where the glycine and serine residues are conserved. Amino acids at Asp-207, Asp-238 in TsHKT1 ;2 conferring K + specificity are indicated by the black dots. Amino acids marked with # at Ala-240, Leu-247, Gln-270, Asn-365, Glu-464 in TaHKT2; 1 are known to confer salt tolerance.
  • Figure 2 An un-rooted minimum-evolution phylogenetic tree of protein sequences of HKT homologues with 10,000 bootstrap replicates.
  • A Effects of 200mM NaCI applied for two weeks on growth and development of two sorghum cultivars contrasting in their salt tolerance (2007, tolerant; Ji2731 , sensitive). Five day old seedlings were transferred to liquid media and grown for one week, and then thinned leaving twelve uniform plants. An aliquot of 5M NaCI stock solution was then added into the liquid culture with 200mM NaCI.
  • B The magnified image of the third salt-stressed leaves of the two sorghum accessions.
  • C Effects of salinity on shoot dry, fresh biomass and chlorophyll content of the two sorghum accessions. For shoot fresh weight (FW) and dry weight (DW) measurements, plants from each accession were harvested after two weeks of NaCI exposure.
  • Data were expressed as mean values ⁇ SD of at least three replicates of 30 plants each. D, E and F, Na + , K + content and Na + /K + ratio illustrated in sorghum accessions (2007, tolerant; Ji2731 , sensitive). After three days exposure, shoot of seedlings were harvested for ion content measured by ICP (Inductive Coupled Plasma Emission Spectrometer). Illustrated are the mean values ⁇ SD for Na + and K + content or for Na + /K + ratio calculated from the data in D and E. Data from three experiments with similar results are shown. Columns with different capital letters indicate significant difference at p ⁇ 0.05 (Duncan test).
  • FIG. 4 Expression of SbHKT1;4 gene.
  • A RT-PCR analysis of the expression levels of the SbHKT1;4 in 2007 (salt-tolerant) and Ji2731 (salt-sensitive) sorghum accessions. RNA was extracted from the root (R), stem (S), leaf blade (L), leaf sheath (SH) and leaf vein (V) from the mature plants in the earing stage, and the reverse transcription products were amplified.
  • B Subcellular localisation of GFP-tagged SbHKT1 ;4 in the pavement cells of N. benthamiana leaves.
  • FIG. 6 Expression of sorghum HKT genes ⁇ SbHKT1;3, SbHKT1;5 and SbHKT2;1), Na + /H + antiporter NHX and SOS genes in shoots (A) and roots (B) of 2007 (salt- tolerant) and Ji2731 (salt-sensitive) sorghum accessions, respectively.
  • the transcript levels were measured using Quantitative Reverse Transcriptase PCR.
  • the samples were prepared from 12h treated plants as in Figure 5. Data are shown as means ⁇ SD from two biological repeats.
  • FIG. 7 Functional characterisation of SbHKT1;4 expressed in mutants of Saccharomyces cerevisiae.
  • A Growth inhibition tests of S.cerevisiae G19 (MATa, his3, Ieu2, ura3, trpl, ade2, and ena1::HIS3::ena4) expressed the SbHKT1;4 gene, empty vector, AtHKT1;1 or AtKATI.
  • B Growth of yeast strain WA6 ⁇ Mat a ade2 ura3 trpl trk1D::LEU2 trk2D::HIS3) cells harbouring the SbHKT1;4, empty vector PYES2 or NcHAK (N. crassa).
  • a and B Cation selectivity of SbHKT4; 1 .
  • Steady-state current amplitudes were recorded at -60mV in the bath solution containing 10mM Li + , Na + , K + , Cs + or NH 4 + , respectively.
  • FIG. 9 The conductance of SbHKTI ;4 is dependent on the external Na + /K + ratio.
  • a and C Steady-state current amplitudes from the SbHKTI ;4-expressing oocytes exposed to 10mM K + , 5mM Na + , 10mM K + + 5mM Na + and 50mM K + , 5mM Na + , 50mM K + + 5mM Na + , respectively. Voltage of 50s duration were applied to the membrane with -60mV.
  • FIG. 10 Effects of SbHKTI ;4 over-expression on the tolerance to Na + stress in transgenic Arabidopsis in comparison with the wild type Col-g/iand the athkt1-1 mutant.
  • 06L6-2, 06L2-14 and 06L8-7 are three independent transgenic Arabidopsis athkt1-1 mutants overexpressing SbHKT1;4.
  • FIG. 11 Growth comparison of Arabidopsis wild type Col-g/7, athkt1-1 mutant and SbHKT1;4 overexpressing athkt1-1 mutant lines subjected to K + deficient stress. The same transgenic lines used in Figure 8A were used.
  • nucleic acid As used herein, the words “nucleic acid”, “nucleic acid sequence”, “nucleotide”, “nucleic acid molecule” or “polynucleotide” are intended to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), natural occurring, mutated, synthetic DNA or RNA molecules, and analogs of the DNA or RNA generated using nucleotide analogs. It can be single-stranded or double-stranded. Such nucleic acids or polynucleotides include, but are not limited to, coding sequences of structural genes, anti-sense sequences, and non-coding regulatory sequences that do not encode mRNAs or protein products.
  • genes may include introns and exons as in the genomic sequence, or may comprise only a coding sequence as in cDNAs, and/or may include cDNAs in combination with regulatory sequences. In specific embodiments for example those that relate to isolated nucleic acid sequences, cDNAs are a preferred embodiment.
  • peptide refers to amino acids in a polymeric form of any length, linked together by peptide bonds.
  • transgenic means with regard to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which either
  • genetic control sequence(s) which is operably linked with the nucleic acid sequence according to the invention, for example a promoter, or
  • the natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original plant or the presence in a genomic library.
  • the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part.
  • the environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp.
  • a naturally occurring expression cassette for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a polypeptide useful in the methods of the present invention, as defined above - becomes a transgenic expression cassette when this expression cassette is modified by non-natural, synthetic ("artificial") methods such as, for example, mutagenic treatment. Suitable methods are described, for example, in US 5,565,350 or WO 00/15815 both incorporated by reference.
  • transgenic plant for the purposes of the invention is thus understood as meaning, as above, that the nucleic acids used in the methods of the invention are not at their natural locus in the genome of said plant, it being possible for the nucleic acids to be expressed homologously or heterologously.
  • transgenic also means that, while the nucleic acids according to the different embodiments of the invention are at their natural position in the genome of a plant, the sequence has been modified with regard to the natural sequence, and/or that the regulatory sequences of the natural sequences have been modified.
  • Transgenic is preferably understood as meaning the expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place.
  • the transgene is stably integrated into the plant and the plant is preferably homozygous for the transgene.
  • the aspects of the invention involve recombination DNA technology and in a preferred embodiment exclude embodiments that are solely based on generating plants by traditional breeding methods.
  • halophytes Depending on the differential growth responses to saline conditions, plants are classified as halophytes and glycophytes (Munns and Tester 2008). While almost all crops are glycophytes and readily suffer from Na + stress, halophytes are a diverse group of plants with the ability to achieve growth in soils tolerating at least 200mM NaCI stress, due to their distinctive ability to maintain high cytosol K + /Na + ratios in severely saline soils. As demonstrated in the examples, the inventors have shown that SbHKT1;4, a subfamily 1 HKT from the glycophytic crop sorghum, mediates K + transportation under Na + stress and is involved in balancing the Na + /K + ratio in the plant resulting in improved plant growth. SbHKT1;4 is therefore a key component in sorghum salt tolerance.
  • HKTs orthologues of SbHKT1;4, for example in wheat are not reported to have the same function. This is illustrated by the wheat subfamily 1 HKT TaHKT2;1 . It has been shown that TaHKT2; 1-mediated K + uptake is in fact inhibited and low affinity Na + uptake occurs in wheat roots (Gassmann et al. 1996). Furthermore, maize is evolutionary closely related to sorghum, but in the maize genome, only ZmHKT1;5 and ZmHKT2;1 have been found and an SbHKT1;4 orthologue in maize appears not to exist.
  • SbHKT1 ;4 has a very high affinity for Na+.
  • transgenic plants take up excessive Na+ when the gene is ubiquitously overexpressed, as demonstrated by the fact that these transgenic plants have higher Na+ content, reduced growth and accelerated senescence and death.
  • the high affinity of SbHKT1 ;4 for Na+ can be utilised to enhance salt tolerance of a plant in different ways.
  • SbHKT1;4 can be expressed in a plant preferably using a tissue specific promoter.
  • a preferred promoter is a xylem specific promoter which directs expression of the gene in the root parenchyma cells to unload the Na+ thus preventing upward Na+ transportation.
  • SbHKT1 ;4 alleviates the harmful effects of excessive environmental Na+ in saline soils to plants by facilitating K+ uptake.
  • yeast complementation tests showed that SbHKTI ;4 complements the growth of the K+-transport deficient mutants ⁇ 6 under very low exogenously applied K+ concentrations. This is also demonstrated by experiments using transgenic plants. Transgenic seedlings overexpressing SbHKT1;4 in the mutant athktl background were generated and grown on plates with growth medium. At increased concentrations of K+ in the growth medium, transgenic seedlings overexpressing SbHKT1;4 could take up more K+ under high Na+ concentration and retain a better growth than the controls.
  • transgenic plants expressing SbHKT1;4 according to the invention are more resistant to salt stress in the presence of hO than control plants.
  • the invention relates to a transgenic plant expressing a nucleic acid construct comprising or consisting of a nucleic acid sequence encoding for a SbHKTI ;4 peptide.
  • the nucleic acid construct may comprise the genomic SbHKTI ;4 sequence as shown in SEQ ID No. 1 , a functional variant thereof, the SbHKTI ;4 cDNA as shown in SEQ ID. No. 3 or a functional variant thereof.
  • the SbHKTI ;4 peptide corresponds to SEQ ID No.
  • the term "functional variant" of a nucleic acid or peptide sequence as used according to the various aspects of the invention refers to a variant gene sequence or part of the gene sequence which retains the biological function of the full non-variant SbHKT1 ;4 nucleic acid or peptide sequence, for example confers increased salt stress tolerance when expressed in a transgenic plant.
  • a functional variant also comprises a variant of the gene of interest encoding a peptide which has sequence alterations that do not affect function of the resulting protein, for example in non-conserved residues. Also encompassed is a variant that is substantially identical, i.e. has only some sequence variations, for example in non- conserved residues, to the wild type sequences as shown herein and is biologically active.
  • SbHKT1 encompasses not only SbHKT1 ;4, for example a nucleic acid sequence comprising or consisting of SEQ ID No: 1 , a polypeptide comprising or consisting or SEQ ID No: 2, but also functional variants of SbHKT1 ;4, for example variants of SEQ ID No: 1 or 2 that do not affect the biological activity and biological function of the resulting protein.
  • Alterations in a nucleic acid sequence which result in the production of a different amino acid at a given site that do however not affect the functional properties of the encoded polypeptide, are well known in the art.
  • a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine.
  • a codon encoding another less hydrophobic residue such as glycine
  • a more hydrophobic residue such as valine, leucine, or isoleucine.
  • changes which result in substitution of one negatively charged residue for another such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product.
  • Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products. Modifications in the conserved sites and signature motifs of the protein are specifically excluded.
  • variants of a particular SbHKT1 ;4 nucleotide or peptide sequence according to the various aspects of the invention will have at least about 75%, preferably at least about 85%, 86%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to that particular non-variant SbHKT1 ;4 nucleotide or peptide sequence as defined in SEQ IDs No. 1 , 3 and 2 respectively and as determined by sequence alignment programs known in the art.
  • fragment is intended a portion of the nucleotide sequence or a portion of the amino acid sequence and hence of the protein encoded thereby. Fragments of a nucleotide sequence encode protein fragments that retain the biological activity of the native protein and hence act to modulate responses to salt stress.
  • salt stress can be moderate or severe salt stress.
  • moderate or mild stress/stress conditions are used interchangeably and refer to non-severe stress.
  • moderate stress unlike severe stress, does not lead to plant death.
  • moderate, that is non-lethal, stress conditions wild type plants are able to survive, but show a decrease in growth and seed production and prolonged moderate stress can also result in developmental arrest. The decrease can be at least 5%-50% or more.
  • Tolerance to severe stress is measured as a percentage of survival, whereas moderate stress does not affect survival, but growth rates.
  • the precise conditions that define moderate stress vary from plant to plant and also between climate zones, but ultimately, these moderate conditions do not cause the plant to die. Salt stress can thus refer to moderate or severe stress and is present when the soil is saline.
  • Soils are generally classified as saline when the ECe is 4 dS/m or more, which is equivalent to approximately 40mMNaCI and generates an osmotic pressure of approximately 0.2 MPa. Most plants can however tolerate and survive about 4 to 8 dS/m although this will impact on plant fitness and thus yield. For example in rice, soil salinity beyond ECe ⁇ 4 dS/m is considered moderate salinity while more than 8 dS/m becomes high. Similarly, pH 8.8 - 9.2 is considered as non-stress while 9.3 - 9.7 as moderate stress and equal or greater than 9.8 as severe stress.
  • salt stress refers to an ECe of 4 dS/m or more, for example about 4 to about 8 dS/m or about 40mMNaCI or more, for example about 40mMNaCI to about 100 mMN or about 40mMNaCI to 200 mMNaCI.
  • HKT proteins are characterised by four transmembrane domain- pore domain- transmembrane domain (MPM) motifs. Each of the four pore forming domains comprises a conserved Glycine or Serine residue. The conserved Glycine or Serine residue in the first pore forming domain is involved in determining cation specificity.
  • HKT proteins in plants can be divided into two groups: Subfamily 1 has a Ser-Gly-Gly-Gly signature implicated in conferring Na + specificity and subfamily 2 has Gly-Gly-Gly-Gly signature implicated in conferring Na + -K + symport. HKT proteins also comprise a TrkH domain (Pfam accession number PF02386) which is characteristic for a group of proteins comprising potassium transport proteins (trk). Variants of SbHKT1 ;4 preferably retain one or more of these conserved residues.
  • SbHKT1 ;4 peptide used in the various aspects of the invention and as shown in SEQ ID No. 2 or a peptide which has at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%,
  • NO: 2 is characterised by the presence of four MPM motifs and a subfamily 1 Ser-Gly-
  • conserveed residues include S121 , G503 and G279.
  • the peptide is also characterised by the presence of Q303, N398 and E495. These residues correspond to Q270, N365 and E464 residues in TaHKT2; 1 , which have been proven important for Na + transport activity.
  • K + transport affinity could not be defined solely by using this signature amino acid.
  • More HKT members in subfamily 1 have been characterised with strong K + specificity (Liu et al. 2001 ; AN et al. 2012).
  • SbHKT1;4, a subfamily 1 member has a distinctive K + ion transport activity.
  • the plant expressing a nucleic acid construct encoding a SbHKT1 ;4 peptide can be any monocot or any dicot plant.
  • the transgenic plant may be sorghum expressing the endogenous sorghum gene SbHKT1;4 by recombinant means.
  • the sorghum gene SbHKT1;4 can be expressed in any other plant to alter salt tolerance.
  • SbHKT1;4 in the dicot plant Arabidopsis is functional thus demonstrating that when SbHKT1;4 is expressed in another very different plant species that is not related to sorghum the SbHKT1 ;4 peptide elicits function.
  • a dicot plant may be selected from the families including, but not limited to Asteraceae, Brassicaceae (eg Brassica napus), Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae), Malvaceae, Rosaceae or Solanaceae.
  • the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage, tomato, potato, yam, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa, bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species.
  • the plant is oilseed rape.
  • biofuel and bioenergy crops such as rape/canola, sugar cane, sweet sorghum, Panicum virgatum (switchgrass), linseed, lupin and willow, poplar, poplar hybrids, Miscanthus or gymnosperms, such as loblolly pine.
  • high erucic acid oil seed rape, linseed and for amenity purposes (e.g. turf grasses for golf courses), ornamentals for public and private gardens (e.g. snapdragon, petunia, roses, geranium, Nicotiana sp.) and plants and cut flowers for the home (African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant).
  • a monocot plant may, for example, be selected from the families Arecaceae, Amaryllidaceae or Poaceae.
  • the plant may be a cereal crop, such as wheat, rice, barley, maize, oat, sorghum, rye, millet, buckwheat, turf grass, Italian rye grass, sugarcane or Festuca species, or a crop such as onion, leek, yam or banana.
  • the plant is a crop plant.
  • crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use.
  • Most preferred plants are maize, rice, wheat, oilseed rape, sorghum, soybean, potato, tomato, tobacco, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
  • plant as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, fruit, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest.
  • plant also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the gene/nucleic acid of interest.
  • the various aspects of the invention described herein clearly extend to any plant cell or any plant produced, obtained or obtainable by any of the methods described herein, and to all plant parts and propagules thereof unless otherwise specified.
  • the present invention extends further to encompass the progeny of a primary transformed or transfected cell, tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement being that progeny exhibit the same genotypic and/or phenotypic characteristic(s) as those produced by the parent in the methods according to the invention.
  • the invention also extends to harvestable parts of a plant of the invention as described above such as, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs.
  • the invention furthermore relates to products derived, preferably directly derived, from a harvestable part of such a plant, such as dry pellets or powders, oil, fat and fatty acids, starch or proteins.
  • the invention also relates to food products and food supplements comprising the plant of the invention or parts thereof.
  • the nucleic acid construct as used in the various aspects of the invention comprises a regulatory element.
  • regulatory element is used interchangeably herein with “control sequence” and “promoter” and all terms are to be taken in a broad context to refer to regulatory nucleic acid sequences capable of effecting expression of the sequences to which they are ligated.
  • promoter typically refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and which is involved in recognising and binding of RNA polymerase and other proteins, thereby directing transcription of an operably linked nucleic acid.
  • transcriptional regulatory sequences derived from a classical eukaryotic genomic gene (including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence) and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue- specific manner.
  • additional regulatory elements i.e. upstream activating sequences, enhancers and silencers
  • transcriptional regulatory sequence of a classical prokaryotic gene in which case it may include a -35 box sequence and/or -10 box transcriptional regulatory sequences.
  • regulatory element also encompasses a synthetic fusion molecule or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ.
  • a “plant promoter” comprises regulatory elements, which mediate the expression of a coding sequence segment in plant cells. Accordingly, a plant promoter need not be of plant origin, but may originate from viruses or micro-organisms, for example from viruses which attack plant cells. The "plant promoter” can also originate from a plant cell, e.g. from the plant which is transformed with the nucleic acid sequence to be expressed in the inventive process and described herein. This also applies to other “plant” regulatory signals, such as "plant” terminators.
  • the promoters upstream of the nucleotide sequences useful in the methods of the present invention can be modified by one or more nucleotide substitution(s), insertion(s) and/or deletion(s) without interfering with the functionality or activity of either the promoters, the open reading frame (ORF) or the 3'-regulatory region such as terminators or other 3' regulatory regions which are located away from the ORF. It is furthermore possible that the activity of the promoters is increased by modification of their sequence, or that they are replaced completely by more active promoters, even promoters from heterologous organisms.
  • the nucleic acid molecule For expression in plants, the nucleic acid molecule must, as described above, be linked operably to or comprise a suitable promoter which expresses the gene at the right point in time and with the required spatial expression pattern.
  • the promoter strength and/or expression pattern of a candidate promoter may be analysed for example by operably linking the promoter to a reporter gene and assaying the expression level and pattern of the reporter gene in various tissues of the plant.
  • Suitable well-known reporter genes are known to the skilled person and include for example beta-glucuronidase or beta- galactosidase.
  • the term "operably linked” as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
  • the nucleic acid sequence may be expressed using a promoter that drives overexpression.
  • Overexpression means that the transgene is expressed at a level that is higher than expression of endogenous counterparts driven by their endogenous promoters.
  • overexpression may be carried out using a strong promoter, such as a constitutive promoter.
  • a "constitutive promoter” refers to a promoter that is transcriptionally active during most, but not necessarily all, phases of growth and development and under most environmental conditions, in at least one cell, tissue or organ.
  • constitutive promoters examples include the cauliflower mosaic virus promoter (CaMV35S or 19S), rice actin promoter, maize ubiquitin promoter, rubisco small subunit, maize or alfalfa H3 histone, OCS, SAD1 or 2, GOS2 or any promoter that gives enhanced expression.
  • CaMV35S or 19S cauliflower mosaic virus promoter
  • rice actin promoter examples include the cauliflower mosaic virus promoter (CaMV35S or 19S), rice actin promoter, maize ubiquitin promoter, rubisco small subunit, maize or alfalfa H3 histone, OCS, SAD1 or 2, GOS2 or any promoter that gives enhanced expression.
  • enhanced or increased expression can be achieved by using transcription or translation enhancers or activators and may incorporate enhancers into the gene to further increase expression.
  • an inducible expression system may be used, where expression is driven by a promoter induced by environmental stress conditions (for example the pepper pathogen-induced membrane protein gene CaPIMPI or promoters that comprise the dehydration-responsive element (DRE), the promoter of the sunflower HD-Zip protein gene Hahb4, which is inducible by water stress, high salt concentrations and ABA or a chemically inducible promoter (such as steroid- or ethanol-inducible promoter system).
  • the promoter may also be tissue-specific.
  • the types of promoters listed above are described in the art. Other suitable promoters and inducible systems are also known to the skilled person.
  • a root-specific promoter may be used. This is a promoter that is transcriptionally active predominantly in plant roots, substantially to the exclusion of any other parts of a plant, whilst still allowing for any leaky expression in these other plant parts.
  • root-specific promoters include promoters of root expressible genes, for example the promoters of the following genes: RCc3, Arabidopsis PHT1 , Medicago phosphate transporter, Arabidopsis Pyk10, tobacco auxin-inducible gene, beta-tubulin, LRX1 , ALF5, EXP7, LBD16, ARF1 , tobacco RD2, SIREO, Pyk10, PsPR10.
  • the promoter is a constitutive or strong promoter.
  • the regulatory sequence is an inducible promoter, a stress inducible promoter or a tissue specific promoter.
  • the stress inducible promoter is preferably a salt stress inducible promoter.
  • the promoter is the endogenous SbHKT1;4 promoter.
  • the promoter is a promoter which is induced by salt stress, for example OsABA2, HaHbl , SbUSOSI or rab16A.
  • the promoter directs expression in the root xylem, for example RolC and RolD. Root-specific and xylem parenchyma-specific promoters are known in the art, for example in from WO 2006/024291 incorporated herein by reference.
  • the invention in another aspect, relates to a method for increasing salt tolerance of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid encoding a SbHKT1 ;4 peptide as shown in SEQ ID No. 2 or a functional variant thereof, for example a peptide which has for example at least 75% or at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 2 in a plant.
  • the nucleic acid may comprise or consist of SEQ ID No. 1 or 3 or a functional variant thereof.
  • a control plant as used according to all of the aspects of the invention is a plant, which has not been modified according to the methods of the invention. Accordingly, the control plant has not been genetically modified to express a nucleic acid as described herein.
  • the control plant is a wild type plant.
  • the control plant is a plant that does not carry a transgenic according to the methods described herein, but expresses a different transgene.
  • the control plant is typically of the same plant species, preferably the same genotype as the plant to be assessed. The inventors have demonstrated that the affinity of the SbHKT1 ;4 peptide for Na+ is high and in fact higher than that of known HKTs.
  • the inward Na + currents of SbHKT1 ;4 expressing oocytes indicated that the Na + affinity of SbHKT1 ;4 was much higher than OsHKT1 ; 1 , OsHKT1 ;3 and OsHKT2;4.
  • the method may comprise the step of obtaining a progeny plant derived from the plant or plant.
  • the method may further comprise screening plants for those that comprise the polynucleotide construct described herein and which have an increased salt stress tolerance and selecting a plant that has an increased salt stress tolerance.
  • further steps include measuring the salt stress tolerance in said plant progeny, and comparing it to that of a control plant.
  • the progeny plant is stably transformed and comprises the exogenous polynucleotide which is heritable as a fragment of DNA maintained in the plant cell and the method may include steps to verify that the construct is stably integrated.
  • the method may also comprise the additional step of collecting seeds from the selected progeny plant.
  • the invention in another aspect, relates to a method for increasing growth and/or yield under salt stress conditions comprising introducing and expressing a nucleic acid construct comprising a nucleic acid encoding a SbHKT1 ;4 peptide as shown in SEQ ID No. 2 or a functional variant thereof, for example a peptide which has at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 2.
  • SEQ ID No. 1 in a plant.
  • the nucleic acid may comprise or consist of SEQ ID No. 1 or 3 or a functional variant thereof.
  • yield in general means a measurable produce of economic value, typically related to a specified crop, to an area, and to a period of time. Individual plant parts directly contribute to yield based on their number, size and/or weight, or the actual yield is the yield per square meter for a crop and year, which is determined by dividing total production (includes both harvested and appraised production) by planted square meters.
  • yield of a plant may relate to vegetative biomass (root and/or shoot biomass), to reproductive organs, and/or to propagules (such as seeds) of that plant.
  • yield comprises one or more of and can be measured by assessing one or more of: increased seed yield per plant, increased seed filling rate, increased number of filled seeds, increased harvest index, increased number/size of seed/capsules/pods, increased seed size, increased growth or increased branching, for example inflorescences with more branches.
  • yield comprises an increased number of seed capsules/pods and/or increased floral branching. Yield is increased relative to control plants. Growth may for example be measured by measuring hypocotyls or stem elongation.
  • the invention in another aspect, relates to a method for modulating K+ uptake under salt stress comprising introducing and expressing a nucleic acid construct comprising a nucleic acid encoding a SbHKT1 ;4 peptide as shown in SEQ ID No. 2 or a functional variant thereof, for example a peptide which has at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 2 in a plant.
  • the nucleic acid may comprise or consist of SEQ ID No. 1 or 3 or a functional variant thereof. Salt stress is moderate or severe as described herein.
  • the invention in another aspect, relates to a method for maintaining Na+/K+ homeostasis under salt stress comprising introducing and expressing a nucleic acid construct comprising a nucleic acid encoding a SbHKT1 ;4 peptide as shown in SEQ ID No. 2 or a functional variant thereof, for example a peptide which has at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 2 in a plant.
  • the nucleic acid may comprise SEQ ID No. 1 or 3 or a functional variant thereof. Salt stress is moderate or severe as described herein.
  • the invention relates to a method for producing a transgenic plant comprising
  • nucleic acid construct comprising a nucleic acid encoding a SbHKT1 ;4 peptide as shown in SEQ ID No. 2 or a functional variant thereof, for example a peptide which has at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID NO: 2 in a plant,
  • step b) obtaining a progeny plant derived from the plant or plant cell of step a).
  • the nucleic acid may comprise SEQ ID No. 1 or 3 or a functional variant thereof.
  • the construct further comprises a regulatory sequence as described herein.
  • Preferred plants are crop plants or biofuel plants as described herein, for example maize, rice, wheat, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
  • the invention also relates to plants obtained or obtainable with said method.
  • the invention relates to an isolated nucleic acid comprising SEQ ID No. 3.
  • the invention relates to a vector comprising SEQ ID No. 3 operably linked to a regulatory sequence.
  • the regulatory sequence may be as described herein.
  • the invention in another aspect, relates to a vector comprising SEQ ID No. 1 or SEQ ID No. 3 operably linked to a regulatory sequence.
  • the regulatory sequence may be as described herein. In one embodiment, said regulatory sequence is not the endogenous promoter.
  • the invention relates to an isolated host cell comprising a nucleic acid or vector as described above.
  • Said host cell is a bacterial cell, for example Agrobacterium, or a plant cell.
  • the invention relates to a culture medium comprising said isolated host cell under conditions in which this can be grown and propagated.
  • the invention relates to the use of a nucleic acid or vector as described above in modulating the response to salt stress and/or in maintaining Na+/K+ homeostasis.
  • the invention relates to the use of a nucleic acid or vector as described above in increasing growth or yield of a plant under salt stress.
  • nucleic acids and vectors described herein are used to generate transgenic plants using transformation methods known in the art.
  • a nucleic acid comprising SEQ D No. 1 , 3 or a functional variant thereof is introduced into a plant and expressed as a transgene.
  • the nucleic acid sequence is introduced into said plant through a process called transformation.
  • transformation or transformation as referred to herein encompasses the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer.
  • Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis may be transformed with a genetic construct of the present invention and a whole plant regenerated there from.
  • tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem).
  • the polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome.
  • the resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.
  • Transformation of plants is now a routine technique in many species.
  • any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell.
  • the methods described for the transformation and regeneration of plants from plant tissues or plant cells may be utilized for transient or for stable transformation. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, transformation using viruses or pollen microinjection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant material, DNA or RNA-coated particle bombardment, infection with (non-integrative) viruses and the like.
  • Transgenic plants, including transgenic crop plants are preferably produced via Agrobacterium tumefaciens mediated transformation.
  • the plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants.
  • the seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection by spraying.
  • a further possibility is growing the seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can grow into plants.
  • the transformed plants are screened for the presence of a selectable marker such as the ones described above.
  • putatively transformed plants may also be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organisation.
  • expression levels of the newly introduced DNA may be monitored using Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.
  • the generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques.
  • a first generation (or T1 ) transformed plant may be selfed and homozygous second-generation (or T2) transformants selected, and the T2 plants may then further be propagated through classical breeding techniques.
  • the generated transformed organisms may take a variety of forms.
  • they may be chimeras of transformed cells and non- transformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).
  • clonal transformants e.g., all cells transformed to contain the expression cassette
  • grafts of transformed and untransformed tissues e.g., in plants, a transformed rootstock grafted to an untransformed scion.
  • the invention relates to an isolated nucleic acid comprising or consisting of SEQ ID No. 4.
  • the invention relates to a vector comprising SEQ ID No. 4 operably linked to a target gene.
  • the nucleic acid as shown in SEQ ID No. 4 regulates expression of the target gene and is characterised by the presence of seven c/ ' s-elements: CACTFTPPCA1 , EBOXBNNAPA, ACGTATERD1 , ROOTMOTI FTAPOX1 , TAAAGSTKST1 , WBOXATNPR1 and WRKY710s.
  • the invention relates to an isolated host cell comprising a nucleic acid comprising or consisting of SEQ ID No. 4 or vector comprising or consisting of SEQ ID No. 4 as described above.
  • Said host cell is a bacterial cell, for example Agrobacterium, or a plant cell.
  • the invention relates to the use of a nucleic acid comprising or consisting of SEQ ID No. 4 or vector comprising SEQ ID No. 4 as described above in modulating the response to salt stress, maintaining Na+/K+ homeostasis and/or increasing growth or yield of a plant.
  • Plant materials, growth conditions, and stress treatment Plant materials, growth conditions, and stress treatment
  • Hydroponic culture of sorghum seedlings were performed on 1/2 Hoagland (containing Ca(N03) 2 2 mM, KN0 3 2.5mM, NH 4 N0 3 0.5mM, KH 2 P0 4 0.5mM, MgS0 4 1 mM, Kl 5 ⁇ , H 3 B0 3 0.1 mM, MnS0 4 0.13 mM, ZnS0 4 0.03 mM, Na 2 Mo0 4 1.033 ⁇ , ZnS0 4 0.1 ⁇ , CoCI 2 0.105 ⁇ , FeNa-EDTA 0.1 mM) under growth chamber conditions.
  • the temperature of the growth chamber was maintained at 26°C during the day time and 18°C at night while the daily photoperiod was set at 16 hour.
  • day length was set at 16h, as described (Jing et al. 2002).
  • RNA was isolated using the RNA prep pure plant kit (TIANGEN), and reverse transcribed by using an oligo dT primer and TOYOBO reverse transcriptase.
  • HKT genes with homology to AtHKT1;1 were identified from BLASTX searches of the Sorghum phytozome database.
  • the resulting PCR fragments were first cloned into the PCR8/GW/Topo vector using the TOPO TA Cloning Kit (Invitrogen).
  • the primers of successful combinations are listed in Table 1.
  • the radiation phylogenetic tree was constructed using the MEGA program (Kumar et al. 2008) with the minimum-evolution method and 1000 bootstrap replicates.
  • the coding sequences of sorghum HKT1;4 gene combined with the green fluorescent protein to yield a fusion protein in the vector pH7WGF2.0 under the control of the Cauliflower mosaic virus (CaMV) 35S promoter were used to transform A. tumefaciens (GV3101 ).
  • Agrobacterium cells suspension carrying the new recombination construct balanced mix with Agrobacterium cells suspension carrying P19 vector were infiltrated into young, fully expanded Nicotiana benthamiana L. (tobacco) leaves using a needleless syringe. 2-3 days after infiltration, subcellular localisation of GFP in leaf pavement cells was determined with a Leica TCS SP5 laser scanning confocal microscope system (Leica Microsystems, Wetzlar, Germany). Fluorescence signals were collected by a 60x water immersion objective, and were excited using an argon laser at 488nm (GFP) and bright-field images were collected using the transmitted light detector.
  • GFP Cauliflower mosaic virus
  • RT-PCR system was carried with the primers of gene expression in sorghum and Arabidopsis are listed in Table 1 . Actin genes from S. bicolour and Arabidopsis were cloned and used as internal standards to normalise the expression data. The primers used for qPCR amplification are listed in Table 1. SYBR Prime Script RT-PCR Kit (TaKaRa, Japan) was used for quantitative RT-PCR. Three replications were performed for each sample. Data were quantified using the comparative CT method (2 " ⁇ method).
  • the Escherichia coli strain DH5a was routinely used for plasmid DNA propagation.
  • the yeast strains used for the growth inhibition and K + uptake complementary experiments were Na + sensitive strain G19 (MATa, his3, Ieu2, ura3, trpl, ade2, and ena1::HIS3::ena4) , deficient endogenous K + uptake mutant strain ⁇ ⁇ 6 (Mat a ade2 ura3 trpl trk1D::LEU2 trk2D::HIS3).
  • the SbHKT cDNA was subcloned into pYES2 plasmid (Invitrogen) and used to transform the indicated S. cerevisiae.
  • OD600 reached 0.7, and 10-fold serial diluted cultures were incubated on AP plates containing the 2% galactose, appropriate auxotrophic and indicated concentrations of K + and Na + .
  • the SbHKT1;4 cDNA was subcloned into the pGEMHE vector.
  • the capped cRNA was synthesised with the Ambion mMESSAGE mMACHINE Kit using T7 RNA polymerase.
  • X. laevis oocytes were isolated from six different frogs and kept for 1-2 d at 18°C in an ND-96 oocyte culture solution. Oocytes were injected with 32nl of cRNA in SOOng/ ⁇ of RNase-free water for voltage-clamp recordings. Recordings were performed 2 d after injection, and using a two-electrode voltage-clamp amplifier as described previously (Liu and Luan 2001 ), with some modifications.
  • the perfusion solution contained 6mM MgCI 2 , 1 .8mM CaCI 2 , 185mM D-mannitol and 10mM MES-Tris (pH 5.6) and various concentrations of Na + , K + or other cations.
  • the plant materials were harvested and rinsed, then dried at 65°C for 2 days.
  • the digested solution added to 50ml volume with distilled water.
  • K + and Na + contents in the solution were determined by using a Thermo 6300 Inductive Coupled Plasma Emission Spectrometer (ICP). Results
  • a BLAST strategy was used to identify orthologues of HKT genes in sorghum.
  • the Arabidopsis AtHKT1;1 (AtHKTI) amino acid sequences were used to retrieve corresponding sequences in the sorghum genome database (www.phytozome.neU.
  • Four highly orthologous sequences were recovered, and the loci annotated are on four chromosomes, Sb03g012590, Sb04g005010, Sb06g027900 and Sb10g029000, respectively.
  • these four genes were named as SbHKT1;3 ⁇ Sb04g005010), SbHKT1;4 ⁇ Sb06g027900), SbHKT1;5 ⁇ Sb03g01 '2590) and SbHKT2;1 ⁇ Sb10g029000), respectively.
  • Figure 1 shows the analysis of the genie structure of the four SbHKT genes, which was experimentally verified. All four genes had a three-exon-two-intron structure, and SbHKT1;4 had an exceptionally long first intron of 2246bp in length (Figure 1A).
  • the full lengths of the amplified cDNA fragments were 1899bp for SbHKT1;3, 1692bp for SbHKT1;4, 1497bp for SbHKT1;5, and 1638bp for SbHKT2;1, respectively.
  • Figure 1 B shows the deduced amino acid sequences of the four SbHKT proteins aligned with model plant HKT-type proteins. All sorghum SbHKT transporters consisted of four membrane-pore-membrane (MPM) motifs as in other known crop HKT proteins, and had characteristics in common with fungal TRK transporters. The serine or glycine residues at the filter positions in the P A , P B , Pc and P D regions in Sorghum HKT proteins were highly conserved. Figure 1 B also highlights the positions of the amino acid residues in HKT proteins which have been shown to confer salt tolerance by point mutation studies.
  • MPM membrane-pore-membrane
  • HKT proteins were divided into two subfamilies in higher plants (Corratge-Faillie et al. 2010).
  • SbHKT1 ;3, SbHKT1 ;4 and SbHKT1 ;5 belong to Subfamily 1 with the serine residue at the 94 th , 121 st and 26 th sites, respectively, suggesting that they are possibly Na + -Na + type transporters, whereas SbHKT2; 1 belongs to Subfamily 2 with the glycine residue in the first filter at the 80 th site, suggesting that it is possibly a K + -Na + type transporter rather than a Na + -Na + type transporter (Maser et al.
  • the phylogenetic analysis placed the sorghum HKT sequences amongst the Arabidopsis, cereal and halophytes.
  • the four sorghum HKTs were also grouped into different clades and were closely related to the corresponding orthologues of maize or rice, suggesting that the divergence of the HKT proteins occurred prior to the separation of these species.
  • only two orthologous sequences were retrieved from maize and we could not identify HKT1 ;3 and HKT1 ;4 in published maize genomes, which might be part of the reasons for the differences in salt tolerance between sorghum and maize.
  • HKT genes The relationship of the HKT genes was also analysed by using the information of these c/s-elements, and the clustering showed a similar result with the alignment using amino acid sequences.
  • the c/s-elements existed in the promoter regions of HKT genes co-evolved with its function in biological processes and probably reflected a similar transcriptional regulation.
  • the promoter region of SbHKT1;4 contained the largest numbers of stress-related c/s-elements amongst the four genes.
  • SbHKT1;4 was constitutively expressed at low levels in all tissues examined, but was differentially expressed in the two accessions, being relatively more abundant in root, sheath and leaf veins of the salt tolerance accession 2007.
  • transient expression analysis was performed by injecting the fusion protein of SbHKT1 ;4-GFP into Nicotiana benthamiana epidermal cells.
  • SbHKT1;4 was obviously more highly up-regulated in the roots and shoots of the salt tolerant sorghum 2007 than the sensitive Ji2731 .
  • the expression of SbHKT1;4 in 2007 was increased much earlier, just following 1 h of sudden Na + stress.
  • the salt tolerant accession 2007 displayed significantly higher up-regulated expression of SbHKT1;4 in roots under 10 mM KCI and high Na + stress over a 24h time period, which implied that SbHKT1;4 expression might be important for K + transportation under high Na + stress in sorghum.
  • SbNHX3 in the shoot and root of 2007 were more than twice of those in Ji2731 under Na + stress.
  • SbHKT1;4 expression was induced to much higher levels in accession 2007, especially in roots, implicating a role in salt tolerance in sorghum.
  • yeast cells expressing the SbHKT1;4 displayed much stronger inhibition of growth in comparison with the vector-only control ( Figure 7A, middle). These results suggested that SbHKT1;4 rendered the mutant strain more sensitive to Na + by enhancing the Na + transport activity. We devised further experiments to examine whether such Na + sensitivity was K + dependent.
  • the K + concentration fo the medium (10mM KCI) was exogenously applied to the medium in the presence of 150mM NaCI, and the reduced growth of the SbHKT1;4 harbouring strain was almost restored to a level comparable with the empty vector, implicating that unlike AtHKT1;1, SbHKT1;4 might have a role to stimulate the uptake of K + under high Na + stress (Figure 7A, right).
  • SbHKT1 ;4 functioned as a K + transporter in S. cerevisiae and such capacity was not be affected by high Na + concentrations, indicating a strong K + uptake activity similar to NcHAK.
  • SbHKT1;4 functioned to maintain growth and optimal Na + /K + balance under Na + stress in transgenic Arabidopsis
  • Floral dip a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J. 16, 735-743.
  • SEQ ID No. 1 SbHKT1 ;4 nucleic acid sequence (genomic)
  • CTACGTTCTGCATGCAGTGCTTATGGAAATGTTGGCTTCTCAATGGGCTACAGCT G CAG CAGACAGATCAATCCAGATG GG CTCTG CACAG ACAG ATG G
  • SEQ ID No. 3 SbHKT1 ;4 nucleic acid sequence (cDNA) >Sb06g027900.1 CDS transcripts 1692bp

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des plantes transgéniques exprimant le gène HKT du sorgho ayant des traits phénotypiques améliorés, y compris une meilleure croissance dans des conditions de stress salin. Le cadre de l'invention comprend également des procédés apparentés, des utilisations, des acides nucléiques isolés et des produits de recombinaison de vecteurs.
PCT/CN2013/001057 2013-09-11 2013-09-11 Plantes transgéniques WO2015035532A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/CN2013/001057 WO2015035532A1 (fr) 2013-09-11 2013-09-11 Plantes transgéniques
CN201380079516.3A CN107787180B (zh) 2013-09-11 2013-09-11 转基因植物

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2013/001057 WO2015035532A1 (fr) 2013-09-11 2013-09-11 Plantes transgéniques

Publications (1)

Publication Number Publication Date
WO2015035532A1 true WO2015035532A1 (fr) 2015-03-19

Family

ID=52664895

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2013/001057 WO2015035532A1 (fr) 2013-09-11 2013-09-11 Plantes transgéniques

Country Status (2)

Country Link
CN (1) CN107787180B (fr)
WO (1) WO2015035532A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753795A (zh) * 2018-06-28 2018-11-06 云南省烟草农业科学研究院 一种提高烟草叶片钾含量的基因NtNHX1-3及其克隆方法与应用
CN108901823A (zh) * 2018-06-22 2018-11-30 安徽袁粮水稻产业有限公司 一种高效选育耐低钾高产水稻育种材料的方法
CN110734483A (zh) * 2019-11-15 2020-01-31 河南农业大学 耐低钾相关蛋白TaPR1及其编码基因和应用
US12092580B1 (en) 2024-01-19 2024-09-17 King Faisal University Multivariate optimization of microwave digestion for determining of some elements in baobab (A. digitata L.) fruit pulp by ICP-MS

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111763758B (zh) * 2020-07-17 2021-04-23 中国农业科学院作物科学研究所 一种提高植物耐盐性的基因及其相关应用
CN112251447A (zh) * 2020-10-22 2021-01-22 上海交通大学 盐芥盐诱导表达基因TsHKT1;2启动子的克隆与应用
CN112626086B (zh) * 2021-01-20 2022-05-06 山东大学 蒺藜苜蓿基因MtREVOLUTA在提高豆科近缘饲草紫花苜蓿耐盐性中的应用
CN116162631A (zh) * 2022-11-29 2023-05-26 海南大学 一种PvHKT1蛋白及其相关生物材料与应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006045829A1 (fr) * 2004-10-29 2006-05-04 Cropdesign N.V. Plantes à caractéristiques de croissance améliorées et procédé de production desdites plantes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102690830A (zh) * 2011-03-22 2012-09-26 中国科学院遗传与发育生物学研究所 耐盐基因及其应用

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006045829A1 (fr) * 2004-10-29 2006-05-04 Cropdesign N.V. Plantes à caractéristiques de croissance améliorées et procédé de production desdites plantes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"Sequence: ABXC01004427.1, Sorghum bicolor chromosome 6 SORBIchr_6_Cont4427, whole genome shotgun sequence", EMBL-EBI ENA, 21 July 2011 (2011-07-21) *
DATABASE NCBI 13 July 2009 (2009-07-13), PATERSON, A. H. ET AL.: "hypothetical protein SORBIDRAFT_06g027900[Sorghum bicolor", accession no. P_002448492 *
DATABASE NCBI 13 July 2009 (2009-07-13), PATERSON, A. H. ET AL.: "Sorghum bicolor hypothetical protein, mRNA", accession no. M_002448447 *
PATERSON, A. H. ET AL.: "The Sorghum bicolor genome and the diversification of grasses", NATURE, vol. 457, 29 January 2009 (2009-01-29), pages 551 - 556 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108901823A (zh) * 2018-06-22 2018-11-30 安徽袁粮水稻产业有限公司 一种高效选育耐低钾高产水稻育种材料的方法
CN108753795A (zh) * 2018-06-28 2018-11-06 云南省烟草农业科学研究院 一种提高烟草叶片钾含量的基因NtNHX1-3及其克隆方法与应用
CN110734483A (zh) * 2019-11-15 2020-01-31 河南农业大学 耐低钾相关蛋白TaPR1及其编码基因和应用
US12092580B1 (en) 2024-01-19 2024-09-17 King Faisal University Multivariate optimization of microwave digestion for determining of some elements in baobab (A. digitata L.) fruit pulp by ICP-MS

Also Published As

Publication number Publication date
CN107787180B (zh) 2020-09-22
CN107787180A (zh) 2018-03-09

Similar Documents

Publication Publication Date Title
US11447792B2 (en) Nucleotide sequences and corresponding polypeptides conferring modulated growth rate and biomass in plants grown in saline and oxidative conditions
WO2015035532A1 (fr) Plantes transgéniques
US9809827B2 (en) Transgenic maize
US20050086718A1 (en) Plant transcriptional regulators of abiotic stress
US20070240243A9 (en) Plant transcriptional regulators of drought stress
US20060008874A1 (en) Plant transcriptional regulators of abiotic stress
US20110119785A1 (en) Nucleotide sequences and corresponding polypeptides conferring modulated growth rate and biomass in plants grown in saline and oxidative conditions
WO2015058479A1 (fr) Végétaux modifiés
US10487337B2 (en) Methods for monocot plant improvement
US20110265199A1 (en) Nucleotide sequences and polypeptides encoded thereby useful for increasing tolerance to oxidative stress in plants
WO2009038581A2 (fr) Séquences nucléotidiques et polypeptides correspondants conférant un taux de croissance et une biomasse modulés à des plantes cultivées dans des conditions salines et d'oxydation
US11873503B2 (en) Nucleotide sequences and corresponding polypeptides conferring modulated growth rate and biomass in plants grown in saline and oxidative conditions
US20160108416A1 (en) Atsp1, an e3 ubiquitin ligase, and its use
Tan Understanding the Physiological Importance of Amino Acid Transport Processes in Legumes
WO2019171080A2 (fr) Régulation de la dégradation des protéines ii associée aux plastes
Jordano et al. Stress tolerant plants

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13893388

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13893388

Country of ref document: EP

Kind code of ref document: A1