WO2015018980A1 - Diagnostic methods of detecting bacteria resistant to beta-lactam antibiotics - Google Patents

Abstract

The present invention relates to a method of determining the presence of beta-lactam-resistant bacteria in a biological sample using bla _CTX-M specific oligonucleotide probes. Such probes, as well as primers suitable for amplifying CTX-M-encoding DNA are provided.

Description

DIAGNOSTIC METHODS OF DETECTING BACTERIA RESISTANT TO BETA- LACTAM ANTIBIOTICS

FIELD OF THE INVENTION

The present invention relates to the field of molecular diagnostics, in particular for the determination of the presence of beta-lactam-resistant bacteria in a biological sample.

BACKGROUND OF THE INVENTION

Bacterial resistance to antimicrobial drugs, such as antibiotics, is a serious and growing health concern worldwide. Among Gram-negative bacte- ria, the most prominent cause of drug resistance is the emergence of beta- lactamase enzymes, which destroy the beta-lactam ring of beta-lactam antibiotics. Extended-spectrum beta-lactamases (ESBLs), an important subgroup of beta-lactamases, are capable of conferring resistance to the most common beta-lactam antibiotics in use in institutional and outpatient care, such as peni- cillins, cephalosporins, and monobactams. ESBLs may also confer multi-drug resistance to non-beta-lactam antibiotics such as quinolones, aminoglycosides and trimethoprim, narrowing treatment options.

ESBL-producing bacteria were first discovered in the early 1980s among hospitalized patients, particularly in the most vulnerable patients in in- tensive care units, but have now spread also among community-based patients. ESBL-associated infectious syndromes include mainly urinary tract infections and secondly intra-abdominal infections. Upon escape to the bloodstream, ESBL-producing bacteria may cause sepsis or other infections serious enough to warrant hospitalization.

To date over ten different classes of ESBLs have been identified across the world. So far TEM and SHV enzymes have formed the most common ESBL classes but since the start of the 21 st century, it has becoming increasingly clear that a change in the prevalence of ESBL classes is taking place. CTX-M enzymes have largely replaced and outnumbered other types of ESBLs, and are now considered as the most clinically important sub-class of ESBLs.

Presumably, CTX-M-encoding blacrx-M gene originates from chro- mosomally encoded enzymes of the Kluyvera spp but exists today as a plas- mid-conjugated gene with the ability to move between different bacterial popu- lations. Primary carriers of blacrx-M include Escherichia coli, Klebsiella pneu- moniae, Salmonella typhimurium, and Proteus mirabilis, but further blacrx-M- carrying bacterial strains emerge increasingly. To date over 124 different CTX- M types have been reported. There is no consensus on the precise classification of CTX-M types but according to D'Andrea (Int. J. Med., 2013. Epub ahead of print), the main CTX-M groups are CTX-M-1 , -2, -8, -9, -25, and KLUC. Amino acid variation within each subgroup is less than 5%, while the inter-group variation is at least 10%.

Detection and identification of ESBL producers is crucial not only because delayed recognition and inappropriate treatment of infected patients has been associated with increased mortality but also to limit the spread of these multidrug-resistant organisms. Widely used sensitivity tests, such as disk diffusion and dilution antimicrobial susceptibility tests, as well as confirmatory tests, mostly based on synergy between clavulanic acid and cephalosporin, are inexpensive and relatively easy to use. However, such tests are time- consuming and suffer from limited sensitivity.

Assaying ESBLs at the genetic level represents an alternative approach for the identification and typing of blacrx-M genes. To this end, numerous PCR-based assays have been developed. Such assays are precise and sensitive but many of them require a battery of amplicon specific sequencing primers as well as labor-intensive and time-consuming analysis of the PCR product, e.g. by DNA sequencing. These drawbacks can be avoided, at least partly, by universal, degenerated CTX-M primers or by employing real-time PCR-based methods allowing simultaneous amplification and analysis of the PCR product as disclosed by Birkett et al. in J. Med. Microbiol., 2007, 56:52- 55.

A further drawback associated with methods of identifying blacrx-M genotypes at the nucleotide level, is concomitant detection of highly homologous non-blacTx-M gene sequences, particularly chromosomal K1 gene of Klebsiella oxytoca, causing false positive results and, thus, necessitating use of confirmatory tests.

Patent Publication US 2009/0163382 discloses primers and probes for a microarray-based method of detecting antibiotic-resistant bacterial species on the basis of a number of different antibiotic resistance genes. However, only a part of the 124 different currently known CTX-M types are detected by this method. Also Fu et al. (J. Microbiol. Methods, 2012, 89:1 10-1 18) disclose a DNA microarray for drug-resistant gene detection. The array contains a total of 1 15 probes from 17 categories of drug-resistant genes. However, only a part of the 124 different currently known CTX-M types are detected by this method.

To ensure patient safety, optimal treatment and control of the spread of ESBLs, there is a need in the art for highly sensitive and specific broad-range assays for determining the presence of ESBLs in a biological sample.

BRIEF DESCRIPTION OF THE INVENTION

In one aspect, the present invention relates to a method of determining the presence or absence of CTX-M producing bacteria in a biological sample. The method comprises the steps of:

a) providing a biological sample suspected to contain CTX-M producing bacteria;

b) amplifying CTX-M encoding DNA in said sample, if any; and c) detecting the amplified DNA using at least one probe, which hybridize to a region of blacrx-M gene, which region corresponds to that of nucleotides 397-617 of SEQ ID NO: 23 in CTX-M-15, and which probe comprises at least 10 consecutive nucleotides of a nucleic acid sequence set forth in SEQ ID NO: 24 or SEQ ID NO: 72;

wherein steps b) and c) may be performed either separately or simultaneously.

In some embodiments of the present method, the probe hybridizes to a region of blacrx-M gene, which region corresponds to that of nucleotides 503-539 of SEQ ID NO: 23 in CTX-M-15. A person skilled in the art can easily recognize corresponding blacrx-M regions in other CTX-M variants. In other words, the present embodiments are not limited to probes hybridizing to blacrx- M-is but encompass probes hybridizing to any blacrx-M variant.

In some other embodiments of the present method, the probe may be bisected to a 5'-probe and a 3'-probe. In some still further embodiments, said 5'-probe comprises a nucleic acid sequence set forth in SEQ ID NO: 34, 35, or 63, and/or said 3'-probe comprises a nucleic acid sequence set forth in SEQ ID NO: 44, 45, or 70. The probes may also have a sequence identity of at least 80% with the sequences disclosed herein as long as they retain their ca- pability to hybridize with blacrx-M genes under normal hybridization conditions. In some other embodiments of the present method, the amplification step is performed with a forward primer comprising a nucleic acid sequence set forth in SEQ ID NO: 1 , 2, or 61 and a reverse primer comprising a nucleic acid sequence set forth in SEQ ID NO: 1 1 or 12. The primers may also have a sequence identity of at least 80% with the sequences disclosed herein as long as they retain their capability to amplify blacrx-M genes under normal PCR primer hybridization conditions.

In further aspects, the present invention provides oligonucleotide primers and probes capable of amplifying and hybridizing to blacrx-M., respec- tively. The probes may comprise a nucleic acid sequence having at least 80% sequence identity to the sequence set forth in any of SEQ ID NO:34, 35, 44, 45, 63, or 70, or to at least 10 consecutive nucleotides of SEQ ID NO:24 or SEQ ID NO: 72, as long as they retain their capability to hybridize with blacrx-M genes under normal hybridization conditions. In some embodiments, also pro- vided is an oligonucleotide probe mixture comprising at least three different oligonucleotide molecules each comprising, independently form each other, at least 10 consecutive nucleotides of a nucleic acid sequence comprised in SEQ ID NO: 24 or SEQ ID NO: 72. In some embodiments, probes derived from SEQ ID NO:24 or SEQ ID NO: 72 may exist as bisected dual probes. The primers, in turn, may comprise a nucleic acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 , 2, 1 1 , 12, or 61 , as long as they retain their capability to amplify blacrx-M genes under normal PCR primer hybridization conditions.

It is noteworthy that any feature disclosed in connection with the present method applies to the present primers and probes, and vice versa, if applicable.

Other aspects, specific embodiments, objects, details, and advantages of the invention are set forth in the following drawings, detailed description, examples, attached tables, and dependent claims. BRIEF DESCRIPTION OF THE DRAWINGS

In the following the invention will be described in greater detail by means of preferred embodiments with reference to the attached drawings, in which

Figure 1 is a schematic drawing illustrating the principle of chelate- complementation-based detection methods (Karhunen et al., Anal. Chem., 2010, 82:751 -754). In Figure 1A, no target oligonucleotide is present and, thus, chelate complementation does not occur. In Figure 1 B, a target oligonucleotide is present and chelate complementation is enabled upon binding of the lantha- nide-ion-carrier-chelate-conjugated probe and the antenna-conjugated probe in a close proximity to the target oligonucleotide. Figure 2 illustrates the performance of the present primers in a SYBR® Green l-based PCR. In this experiment, initial 10000 genome copies of CTX-M-9-group-positive (open symbols) or CTX-M-negative (filled symbols) E. coli were amplified using forward and reverse primer mixtures of SEQ ID NO: 2 and SEQ ID NO:12 (square), SEQ ID NO:2 and SEQ ID NO:1 1 (circle), SEQ ID NO:1 and SEQ ID NO:12 (triangle), and SEQ ID NO:1 and SEQ ID NO:1 1 (diamond), respectively. Controls with no template DNA are shown in broken lines with symbols explained above. Average results obtained with three parallel reactions are shown. RFU, relative fluorescence unit.

Figure 3 illustrates the distinction of K1 amplification from blacrx-M amplification. Figure 3A shows a PCR amplification graph of a representative reaction with either 0 (circle), 1 000 (triangle), or 10000 (square) genome copies of CTX-M-1 -group-positive E. coli, or 10000 genome copies of K. oxytoca (cross). Figure 3B shows the melt curves of corresponding amplification prod- ucts. The curves for amplification products with initial 1 000 or 10000 genome copies of CTX-M positive E. coli are superimposed. RFU, relative fluorescent unit.

Figure 4 shows a chelate complementation-based PCR amplification graph as an average of three parallel reactions when two independent CTX-M-1 -group (circle), CTX-M-2-group (triangle), or CTX-M-9-group-positive (square) E. coli samples, three independent K. oxytoca samples (cross), and one CTX-M-negative E. coli sample (cross) were used as templates in an amount of 10000 genome copies per reaction. In this experiment, primer mixtures of SEQ ID NO:2 and SEQ ID NO:1 1 were used together with Eu-probe (SEQ ID NO:35) and antenna-probe (SEQ ID NO:45) mixtures (0.05 μΜ of each individual probe). Only CTX-M-positive samples provided signals distinguishable from the background signal.

Figure 5 demonstrates the analytical sensitivity of the present diagnostic chelate complementation-based PCR method as an average of three independent reactions. DNA from a CTX-M-1 -group-positive (Figure 5A), CTX- M-2-group-positive (Figure 5B), or CTX-M-9-group-positive (Figure 5C) E. coli sample was used as a template at 10000 (circle), 1 000 (triangle), 100 (square), 10 (diamond), 1 (minus sign), 0.1 (plus sign), 0.01 (line with no symbol), or 0 (cross) genome copies per PCR reaction. The threshold cycle is the PCR cycle where the reaction signal exceeds the threshold level (signal-to- background 1 .5).

Figure 6 presents the results of the analytical specificity of the chelate complementation-based PCR with extended CTX-M variant target variety with Eu-probe mixture of SEQ ID NO: 63 and antenna-probe mixture of SEQ ID NO:70 as an average of three independent reactions. Thirty CTX-M-positive samples (cross) were used as templates in an amount of 100 genome copies per reaction. Twenty five CTX-M-negative samples (triangles) were used as templates in an amount of 100 000 genome copies per reaction. Only CTX-M- positive samples produced signals distinguishable from the background signal.

Figure 7 illustrates the analytical sensitivity of the chelate comple- mentation-based PCR with extended CTX-M variant target variety with Eu- probe mixture of SEQ ID NO: 63 and antenna-probe mixture of SEQ ID NO: 70 as an average of three independent reactions. DNA from a CTX-M-2-group- positive sample was used as a template at 100 000 (line with no symbol), 10000 (circle), 1 000 (triangle), 100 (square), 10 (diamond), 1 (minus sign), 0.1 (plus sign) or 0 (cross) genome copies per PCR reaction. Similar results were obtained with CTX-M-1 -group, CTX-M-8-group, CTX-M-9-group, or CTX-M-25- group-positive samples.

Figure 8 demonstrates the performance of the chelate complementation-based PCR with extended CTX-M variant target variety with Eu-probe mixture of SEQ ID NO: 63 and antenna-probe mixture of SEQ ID NO: 70 with bacterial cells using CTX-M-2-positive cells as an example. The data points of the figure represent an average of three independent reactions. DNA was not isolated from the bacterial cells before analysis but the cells were added intact as a template to the PCR reaction at 300 000 (line with no symbol), 30000 (circle), 3 000 (triangle), 300 (square), 30 (diamond), 3 (minus sign), 0.3 (plus sign) or 0 (cross) colony forming units per PCR reaction.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to methods and means for determining the presence of beta-lactamase, particularly extended spectrum beta- lactamase (ESBL), producing bacteria in a biological sample. More specifically, the ESBL-producing bacteria are CTX-M-producing bacteria.

As used herein, the term "extended spectrum beta-lactamase" or "ESBL" refers any enzyme capable of providing resistance to and deactivating the antibacterial properties of beta-lactam antibiotics such as penicillins, cephalosporins (e.g. cefotaxime, ceftriaxone, ceftazidime, cefepime, and oxy- imino-monobactam aztreonam), and monobactams by breaking down the β- lactam ring structure common to all beta-lactam antibiotics.

As used herein, the term "CTX-M" refers to any member of a subgroup of ESBLs, i.e. plasmid encoded enzymes having predominantly greater activity against cefotaxime than other oxyimino cephalosoprins. A person skilled in the art realizes that the term "CTX-M" encompasses not only the at least 124 different blacrx-M -encoded enzymes identified to date but also any CTX-M species to be discovered in the future. Thus, all CTX-M species irrespective of the subgroup into which they have been classified on the basis of amino acid sequence alignments, are encompassed in the term "CTX-M".

As used herein, the term "CTX-M-1 -group-positive sample" refers to a sample containing bacteria carrying a gene for a CTX-M type belonging to the CTX-M-1 group. Corresponding terminology has been used for other main CTX-M groups, namely CTX-M-2, -8, -9, and -25 groups.

In the context of the present invention, 1 17 CTX-M sequences and

22 closely related non-CTX-M sequences obtained from NCBI public sequence database, publicly available Lahey Clinic database (as of and 1 1 October 2012), and disclosed in scientific articles (Saladin et al. FEMS Microbiol. Lett., 2002, 209:161 -168; Pagani et al., J. Clin. Mirobiol., 2003, 41 :4264-4269; Naas et al., Antimicrob. Agents Chemother., 2007, 51 :223-230; Birkett et al., J. Med. Microbiol., 2007, 56:52-55; Oxacelay et al., J. Antimicrob. Chemother., 2009, 64:986-989; Monstein et al., BMC Infect. Dis., 2009, accepted for publication) were aligned (Table 1 ). The alignment was systematically analysed and used for identifying target sites for amplification primers and detec- tion probes with the highest possible CTX-M inter-variant homology but with enough differences for discriminating closely related non-CTX-M sequences, particularly chromosomal K1 gene of Klebsiella oxytoca.

Table 1. CTX-M and non-CTX-M sequences used in present alignments.

Gene Accession number(s) Gene Accession number(s)

CTX-M-1 Χ92506 CTX-M-74* GQ 149243

CTX-M-2 Χ92507 CTX-M-75* GQ 149244 Y10278, AB059404,

CTX-M-3 AB098539, AF550415 CTX-M-76 AM982520

CTX-M-4 Y14156 CTX-M-77 AM982521

CTX-M-5 STU95364 CTX-M-78 AM982522

CTX-M-6 AJ005044 CTX-M-79 EF426798

CTX-M-7 AJ005045 CTX-M-80 EU202673

CTX-M-8 AF189721 CTX-M-81 EU136031

CTX-M-9 AF174129 CTX-M-82 EU545409, DQ256091

CTX-M-10 AF255298 CTX-M-83 FJ214366

CTX-M-1 1 AY0051 10, AJ310929 CTX-M-84 FJ214367

AF305837, AY571969,

CTX-M-12 AJ704396 CTX-M-85 FJ214368

CTX-M-13 AF252623 CTX-M-86 FJ214369

AF252622, JQ003803,

CTX-M-14 AF31 1345 CTX-M-88 FJ873739

AY044436, JN676851 ,

JN038339, AY463958,

JN676854, EU1 18593,

CTX-M-15 EU1 18599, EU118601 CTX-M-89 FJ971899

CTX-M-16 AY029068 CTX-M-90 FJ907381

CTX-M-17 AY033516 CTX-M-91 GQ870432

CTX-M-18 AF325133 CTX-M-92 GU127598

CTX-M-19 AF325134 CTX-M-93 HQ166709

CTX-M-20 AJ416344 CTX-M-94 HM167760

CTX-M-21 AJ416346 CTX-M-95 FN813245

CTX-M-22 AY080894 CTX-M-97 HM776707

CTX-M-23 AF488377 CTX-M-98 HM755448

CTX-M-24 AY143430 CTX-M-99 HM803271

CTX-M-25 AF518567 CTX-M-100 FR682582

CTX-M-26 AY157676 CTX-M-101 HQ398214

CTX-M-27 AY156923 CTX-M-102 HQ398215

CTX-M-28 AJ549244 CTX-M-104 HQ833652

CTX-M-29 AY267213 CTX-M-105 HQ833651

CTX-M-30 AY292654 CTX-M-106 HQ913565

CTX-M-31 AJ567481 CTX-M-107 JF274244

CTX-M-32 AJ557142 CTX-M-108 JF274245

CTX-M- 33* AY238472 CTX-M-109 JF274248

CTX-M-34 AY515297 CTX-M-1 10 JF274242

AB176532, AB176534,

CTX-M-35 AB176533 CTX-M-1 1 1 JF274243

CTX-M-36 AB177384 CTX-M-1 12 JF274246

CTX-M-37 AY649755 CTX-M-1 13 JF274247

CTX-M-38 AY822595 CTX-M-1 14 GQ351346

CTX-M-39 AY954516 CTX-M-1 16 JF966749

CTX-M-40 AY750914 CTX-M-1 17 JN227085

CTX-M-41 DQ023162 CTX-M-121 JN790862

CTX-M-42 DQ061 159 CTX-M-122 JN790863

CTX-M-43 DQ102702 CTX-M-123 JN790864

CTX-M-44 D37830 CTX-M-124 JQ429324

CTX-M-45 D89862 CTX-M-126* AB703101

CTX-M-46 AY847147 CTX-M-131 JN969893

CTX-M-47 AY847143 CTX-M-132 JX313020

CTX-M-48 AY847144 CTX-M-133 AB 185834

K1

CTX-M-49 AY847145 (K. oxytoca) AY077482

CTX-M-50 AY847146 K1 (K. oxytoca) AY077483

CTX-M-51 DQ21 1987 K1 (K. oxytoca) AY077484

CTX-M-52 DQ223685 K1 (K. oxytoca) AY077485

CTX-M-53 DG268764 K1 (K. oxytoca) AY077486

CTX-M-54 DQ303459 K1 (K. oxytoca) AY077487 CTX-M-55 DQ885477 K1 (K. oxytoca) AY077488

CTX-M-56 EF374097 K1 (K. oxytoca) AY077489

CTX-M-57 DQ810789 K1 (K. oxytoca) AF473577

CTX-M-58 EF210159 K1 (K. oxytoca) AY055205

CTX-M-59 DQ408762 blaOXY-1 a (K. oxytoca) Y17715

CTX-M-60 AM41 1407 blaOXY-2a (K. oxytoca) Y17714

CTX-M-61 EF219142 blaOXY-3 (K. oxytoca) AF491278

CTX-M-62 EF219134 blaOXY-4 (K. oxytoca) AY077481

CTX-M-63 AB205197 blaOXY-5( K. oxytoca) AJ871872

CTX-M-64 AB284167 blaOXY-6 (K. oxytoca) AJ871879

CTX-M-65 EF418608 Sed-1 (Citrobacter sedlakii) AF321608

CTX-M-66 EF576988 bla gene (C. diversus) X62610

bla gene (PRMBL

CTX-M-67 EF581888 P. vulgaris) D29982

CTX-M-68 EU177100 cumR+cumA (P. vulgaris) X80128

CTX-M-69 EU402393 HugA (Proteus penneri) AF324468

CTX-M-71 FJ815436 blaCKO-1 (C. koseri) AF477396

CTX-M-72 AY847148

The present oligonucleotides are not fully complementary to sequences marked with an asterisk.

In the alignment, a region ideal for designing the present primers and probes was recognized. This target region comprises short regions which show very high homology between different CTX-M-variants but differs clearly from a corresponding region in closely related non-CTX-M sequences used in the alignment.

The alignment was used to design fully complementary probes and primers for more than 90% of the CTX-M variants. Designed probes and 3'- primers contained at least 2 to 6 nucleotide differences as compared to the closely-related non-CTX-M sequences used in the alignment. All probe sequences were designed to be complementary to and thus detect antisense strands because reverse primers amplifying antisense strands have more nucleotide mismatches against non-CTX-M sequences compared to forward pri- mers amplifying sense strands. In other words, the antisense strands are amplified more specifically than the corresponding sense strands. In order to simplify the present methods for determining the presence of CTX-M producing bacteria in a biological sample, each oligonucleotide sequence was designed individually such that the total number of sequences required for identifying as many CTX-M variants as possible would be as low as possible. Thus, the present sequences differ from earlier CTX-M probes and primes not only by their length but also by significantly lower number of different primer and probe molecules required for broad-range CTX-M detection.

As used herein, the term "primer" refers to an oligonucleotide mole- cule comprising or consisting of at least 20 nucleotides designed to hybridize with a complementary portion of a target blacrx-M gene and to act as an initiation site for the amplification of the target nucleic acid molecule e.g. by PCR.

As used herein, the term "5'-primer", i.e. "forward primer", refers to a primer molecule which hybridizes to the antisense strand and amplifies the nucleotides of the sense strand of a blacrx-M gene, whereas the term "3'- primer", i.e. "reverse primer", refers to a primer molecule which hybridizes to the sense strand and amplifies the nucleotides of the antisense strand of a blacrx-M gene.

In one aspect, the present invention provides 5'-primers comprising or consisting of the following nucleic acid sequence:

5'-ATGTGCAGXiACCAGTAAX₂GT-3' (SEQ ID NO:1 )

wherein Xi is either C or T, and X2 is either A or G; or

5'-ATGTGCAGXiACCAGTAAX₂GTX₃ATG-3' (SEQ ID NO:2), wherein Xi is either C or T;

X₂ is either A or G; and

X3 is G when Xi is C, and X2 is A or G; or

X3 is G when Xi is T, and X2 is G; or

X₃ is T when Xi is T, and X2 is A; or

5'-ATGTGCAGXiACCAGTAAX₂GX₃X ATG-3' (SEQ ID NO: 61 ), wherein Xi is C when X₂ is A or G, and X3 is T, and X4 is G;

Xi is C when X₂ is A, X₃ is C, and X4 is G;

Xi is T when X₂ is G, X3 is T, and X4 is G; or

Xi is T when X₂ is A, X₃ is T, and X4 is T.

These primers may be presented in an alternative way, i.e. as mix- tures of forward primers comprising or consisting of nucleic acid sequences set forth in SEQ ID NO:s 3 to 6, SEQ ID NO:s 7 to 10, or SEQ ID NO:s 7 to 10 and 62, respectively (Table 2). Depending on the desired coverage of the detection and identification of CTX-M producing bacteria, any combination or any one of these primers or primer mixtures may be employed. Table 2. Designed forward primers. Primers of SEQ ID NO:s 3 to 6 are encompassed in the forward primer mixture of SEQ ID NO:1 , while primers of SEQ ID NO:s 7 to 10 are encompassed in the forward primer mixture of SEQ ID NO:2, and while primers of SEQ ID NOs: 7 to 10 and 62 are encompassed in the forward primer mixture of SEQ ID NO: 61 .

SEQ ID Sequence 5' -> 3' Length (bp) Tm (°C) NO:

3 ATGTGCAGCACCAGTAAAGT 20 63.4

4 ATGTGCAGCACCAGTAAGGT 20 65.2

5 ATGTGCAGTACCAGTAAAGT 20 60.2

6 ATGTGCAGTACCAGTAAGGT 20 62.0

7 ATGTGCAGCACCAGTAAAGTGATG 24 66.3

8 ATGTGCAGCACCAGTAAGGTGATG 24 67.8

9 ATGTGCAGTACCAGTAAGGTGATG 24 65.2

10 ATGTGCAGTACCAGTAAAGTTATG 24 61 .9

62 ATGTGCAGCACCAGTAAAGCGATG 24 70.1 ^*

*Calculated by OligoAnalyzer 3.1 with the following values: c(Na ) = 100 mM, c(Mg²⁺) = 1.5 mM, c(dNTP) = 0.4 mM. The remaining melting temperatures were calculated with an earlier version of the program.

In another aspect, the present invention provides 3'-primers com- prising or consisting of a nucleic acid sequence:

5'-TGXiGX₂AATCAX3X4TTX₅TTCATX6G-3' (SEQ ID NO:1 1 ), or 5'-TGXiGX2AATCAX₃X₄TTX₅TTCATX6GC-3' (SEQ ID NO:12), wherein,

Xi is A when X₂ is either A or C, X3 is G, X4 is C, X₅ is A, and X₆ is C;

Xi is G when X₂ is C, X3 is G, X4 is C, X₅ is either G or A, and

Xi is G when X₂ is C, X3 is A, X4 is T, X₅ is G, and Χβ is G Again, these primers may be set forth in an alternative way, i.e. as mixtures of reverse primers comprising or consisting of SEQ ID NO:s 13 to 17, or SEQ ID NO:s 18 to 22, respectively. Depending on the desired coverage of the detection and identification of CTX-M producing bacteria, any combination or any one of the primers set forth above may be employed.

Table 3. Designed reverse primers. Primers of SEQ ID NO:s 13 to 17 are encompassed in the reverse primer mixture of SEQ ID NO:1 1 , while primers of SEQ ID NO:s 18 to 22 are encompassed in the reverse primer mixture of SEQ ID NO:12.

SEQ ID Sequence 5' -> 3' Length Tm (°C)

NO: 13 TGAGAAATCAGCTTATTCATCG 22 59.6

14 TGAGCAATCAGCTTATTCATCG 22 61 .9

15 TGGGCAATCAGCTTGTTCATGG 22 66.6

16 TGGGCAATCAATTTGTTCATGG 22 63.2

17 TGGGCAATCAGCTTATTCATGG 22 64.1

18 TGAGAAATCAGCTTATTCATCGC 23 62.1

19 TGAGCAATCAGCTTATTCATCGC 23 64.3

20 TGGGCAATCAGCTTGTTCATGGC 23 68.8

21 TGGGCAATCAATTTGTTCATGGC 23 65.7

22 TGGGCAATCAGCTTATTCATGGC 23 66.5

In some embodiments, the above disclosed 5'- and 3'-phmers or primer mixtures may be used in any desired combination for the amplification of CTX-M target nucleic acids. Thus, if desired, 5'-primer mixture of SEQ ID NO:1 may be used together with 3'-primer mixture of SEQ ID NO:12; 5'-primer mixture of SEQ ID NO:2 and 3'-primer mixture of SEQ ID NO:1 1 ; and 5'-primer mixture of SEQ ID NO:61 and 3'-primer mixture of SEQ ID NO:1 1 . However, more preferred non-limiting examples of suitable primer pairs include 5'-primer mixture of SEQ ID NO:1 and 3'-primer mixture of SEQ ID NO:1 1 ; 5'-primer mixture of SEQ ID NO:2 and 3'-primer mixture of SEQ ID NO:12; and 5'-primer mixture of SEQ ID NO:61 and 3'-primer mixture of SEQ ID NO:12. Replacing the primer mixture of SEQ ID NO:1 or 2 with the primer mixture of SEQ ID NO:61 extends the range of CTX-M-types to be amplified to cover also CTX-M- 1 14, if present in the sample.

It should be realized that in some embodiments, the primers do not have to be exactly complementary to the target strand but must be sufficiently complementary to hybridize therewith and retain the capability to amplify the 6/acT -M genes under normal primer hybridization conditions.

As used herein, the term "hybridize" or "bind" refers to the physical interaction between complementary regions of two single-stranded nucleic acid molecules creating a double-stranded structure. In particular, the term "hybridize" refers to interactions between present oligonucleotides and their target polynucleotides under hybridization conditions that allow complementary regions of the two molecules to interact by hydrogen bonding and remain engaged. The term "hybridization conditions" refers independently not only to the conditions of the hybridization step per se, but also to the conditions of one or more washing steps performed thereafter. Modifiable variables of the hybridi- zation conditions include, but are not limited to, duration (typically from some seconds to some hours), temperature (generally from 25°C to 70°C), salt composition and concentration (e.g., 2-4xSSC6xSSC, or SSPE), chaotropic agent composition (e.g., formamide, or dimethyl sulfoxide (DMSO)) and concentra- tion, and usage of substances that decrease non-specific binding (e.g., bovine serum albumin (BSA), or salmon sperm DNA (ssDNA)).

The term "hybridization stringency" refers to the degree to which mismatches are tolerated in hybridization. The more stringent the conditions, the more likely mismatched DNA strands are to be forced apart, whereas less stringent hybridization conditions enhance the stability of mismatched strands. A person skilled in the art is able to select the hybridization conditions such that a desired level of stringency is achieved. Generally, the stringency may be increased by increasing temperatures, lowering the salt concentrations, and using organic solvents. The present primers are designed to hybridize to their target sequences under normal PCR primer hybridization conditions. A person skilled in the art is able to determine and select such conditions easily.

A further aspect of the present invention relates to oligonucleotide probes. As used herein, the term "probe" refers to an oligonucleotide designed for detecting a target nucleic acid molecule in a sample to be analyzed. De- pending on the selected detection method, the present probes may be provided in different forms as well known in the art. For instance, each probe may be provided as a single probe molecule or as a dual probe consisting of two individual probe molecules, which hybridize next to each other to adjacent positions, preferably with zero to ten intervening nucleotides, in a complementary target sequence. In some embodiments, the dual probes have one intervening nucleotide in the complementary target sequence.

As explained above, the present probes may be provided as single oligonucleotide molecules, denoted hereinafter as mono-probes. In such cases, the probes hybridize to the region of blacrx-M gene corresponding to nu- cleotides 397-617 (i.e. an amplicon obtainable by the present primers) or preferably nucleotides 503-539 of SEQ ID NO: 23 derived from CTX-M-15 variant (Gene Bank No. AY463958). In some embodiments, the mono-probes comprise or consist of at least 10, preferably 10 to 30, nucleotides which hybridize to consecutive nucleotides in said region of nucleotides 397-617 or 503-539 of SEQ ID NO: 23. A person skilled in the art can readily determine corresponding gene regions in other CTX-M variants. In some further embodiments, the present mono-probes comprise or consist of a nucleic acid sequence of SEQ ID NO: 24 SEQ ID NO: 72, or at least 10, preferably 10 to 30, consecutive nucleotides thereof. SEQ ID NO:24 and 72 are as follows:

5'-TTAACTAXiAAX₂CCX3ATTGCX4GAX₅AAX6CACGTX₇X8AX₉GG-3',

wherein Xi is T when X₂ is T, X₃ is G, X4 is G, X₅ is A, X₆ is G, X₇ is

Xi is T when X₂ is T, X₃ is G, X4 is C, X₅ is A, X₆ is A, X₇ is C, Xs is T when X₂ is T, X₃ is G, X4 is G, X₅ is A, X₆ is A, X₇ is C, Xs is

Xi is C when X₂ is T, X₃ is C, X4 is G or T, X₅ is G, Χβ is A, X₇ is T,

Xi is C when X₂ is T, X₃ is G, X4 is G, X₅ is G, Χβ is A, , X₇ is T, X₈ is A, and X₉ is C;

Xi is C when X₂ is T, X₃ is G, X4 is C, X₅ is A, X₆ is A, X₇ is C, Xs is when X₂ is C, X₃ is C, X₄ is G, X₅ is A, X₆ is A, X₇ is C, Xs is

5'-TTAACTAXiAX₂X₃CCX₄X₅TX6X₇CX8GAX₉XioAXi 1CACGT-

Xi₂Xi₃AXi₄GG-3' (SEQ ID NO:72), wherein

Xi is T when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, X₇ is G, Xs is G, X9 is A, X10 is A, X11 is G, Xi₂ is C; Xi₃ is A or G, and Xi₄ is T;

Xi is T or C, when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, X₇ is G, Xs is C, X9 is A, X10 is A, X is A, Xi₂ is C; Xi₃ is A, and Xi₄ is C;

Xi is T when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, X₇ is G, Xs is G, X9 is A, X10 is A, X is A, Xi₂ is C; Xi₃ is A, and Xi₄ is T;

Xi is C when X₂ is A, X₃ is C, X4 is C, X₅ is A, X₆ is T, X₇ is G, Xs is G, X9 is A, X10, is A, X is A, Xi₂ is C; Xi₃ is A, and Xi₄ T;

Xi is C when X₂ is A, X₃ is C, X4 is A, X₅ is A, X₆ is C, X₇ is G, Xs is

T, X₉ is A, X10, is A, X is G, Xi₂ is C; Xi₃ is A, and Xi₄ T;

Xi is C when X₂ is A, X₃ is T, X4 is C, X₅ is A, X₆ is T, X₇ is G, Xs is G or T, X₉ is G when Xi₀, is A, X is A, Xi₂ is T; Xi₃ is A, and Xi₄ is C;

Xi is C when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, X₇ is G, Xs is G, Xg is G, X10, is A, X is A, Xi₂ is T; Xi₃ is A, and Xi₄ is C;

Xi is C, when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, X₇ is G, Xs is C, Xg is A, Xio is G, Xn is A, Xi₂ is C; X13 is A, and Xi₄ is C;

Xi is C, when X₂ is A, X₃ is T, X4 is C, X₅ is A, X₆ is T, X₇ is A, X₈ is T, X₉ is A, X10 is A, X is A, X12 is C; X13 is A, and Xi₄ is C;

Xi is C, when X₂ is A, X₃ is T, X4 is C, X₅ is A, X₆ is C, X₇ is G, Xs is T, Xg is A, X10 is A, X is A, Xi₂ is C; X13 is A, and Xi₄ is C;

Xi is C, when X₂ is G, X3 is T, X4 is G, X₅ is A, X₆ is T, X₇ is G, Xs is C, Xg is A, X10 is A, X is A, Xi₂ is C; X13 is A, and Xi₄ is C;

Xi is C, when X₂ is A, X₃ is T, X4 is G, X₅ is T, X₆ is T, X₇ is G, Xs is C, Xg is A, X10 is A, X is A, Xi₂ is C; X13 is A, and Xi₄ is C; and

Xi is C, when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, X₇ is A, X₈ is

C, Xg is A, X10 is A, X is A, Xi₂ is C; X13 is A, and Xi₄ is C.

These probes may be set forth in an alternative different way, i.e. as a mixture of oligonucleotide probes comprising or consisting of SEQ ID NO:s 25 to 33, or SEQ ID NO:s 25-30 and 73-79, respectively (Table 4). Depending on the desired coverage of the detection and identification of CTX-M producing bacteria, any combination or any one of the probes set forth herein may be employed.

Table 4. Designed mono-probe mixture, which enables detection of 90% of existing CTX-M variants. Probes of SEQ ID NO:s 25 to 33 are encom- passed in the mono-probe mixture of SEQ ID NO:24, while probes of SEQ ID NO:s 25-33 and 73-79 are encompassed in the mono-probe mixture of SEQ ID NO:72.

SEQ ID Sequence 5' -> 3' Length

NO:

25 TTAACTATAATCCGATTGCGGAAAAGCACGTCAATGG 37

26 TTAACTACAATCCCATTGCGGAGAAACACGTTAACGG 37

27 TTAACTACAATCCCATTGCTGAGAAACACGTTAACGG 37

28 TTAACTACAATCCGATTGCGGAGAAACACGTTAACGG 37

29 TTAACTATAATCCGATTGCCGAAAAACACGTCAACGG 37

30 TTAACTACAATCCGATTGCCGAAAAACACGTCAACGG 37

31 TTAACTATAATCCGATTGCGGAAAAGCACGTCGATGG 37

32 TTAACTATAATCCGATTGCGGAAAAACACGTCAATGG 37

33 TT AACT AC AACCCC ATTG CG G AA AA AC ACGTC AATG G 37

73 TTAACTACAATCCGATTGCCGAAGAACACGTCAACGG 37

74 TTAACTACAATCCCATTACTGAAAAACACGTCAACGG 37 75 TTAACTACAATCCCATCGCTGAAAAACACGTCAACGG 37

76 TTAACTACAGTCCGATTGCCGAAAAACACGTCAACGG 37

77 TT AACT AC AACCC AATCG CTG A A AAG C ACGTC AATG G 37

78 TTAACTACAATCCGTTTGCCGAAAAACACGTCAACGG 37

79 TTAACTACAATCCGATTACCGAAAAACACGTCAACGG 37

Depending on the detection method to be employed, the present mono-probes may be bisected to form any desired dual-probes. Such dual- probes do not have to be contiguous, i.e any appropriate number of nucleotides around the bisection site may be omitted from the probes. Furthermore, a person skilled in the art can easily choose a suitable bisection site taking into account specific requirements of the detection method to be employed. Members of the present dual-probes may be denoted as 5'-probes and 3'-probes reflecting their order in a corresponding blacrx-M sense sequence. In other words, the sequence of a 5'-probe lies upstream from the sequence of a 3'- probe.

In some embodiments, 5'-probes according to the present invention comprise or consist of a nucleic acid sequence:

5'-TTAACTAXiAAX₂CCX₃ATTG-3' (SEQ ID NO: 34), or 5'-TTAACTAXiAAX₂CCX₃ATTGC-3' (SEQ ID NO: 35), wherein Xi is T or C when X₂ is T, and X3 is G;

Xi is C when X₂ is C or T, and X3 is C; or

5'-TTAACTAXiAX₂X3CCX₄X₅TX₆X₇C-3' (SEQ ID NO 63): Xi is T when X₂ is A, X₃ is T, X4 is G, X₅ is A, X₆ is T, and X₇ is G; Xi is C when X₂ is A, X₃ is C, X4 is C, X₅ is A, X₆ is T, and X₇ is G; Xi is C when X₂ is A, X₃ is T, X4 is C or G, X₅ is A, X₆ is T, and X₇ is

G or A;

Xi is C when X₂ is A, X₃ is T, X4 is C, X₅ is A, X₆ is C, and X₇ is G;

Xi is C, X₂ is G, X₃ is T, X₄ is G, X₅ is A, X₆ is T or X₇ is G;

Xi is C when X₂ is A, X₃ is C, X4 is A, X₅ is A, X₆ is C, and X₇ is G; Xi is C when X₂ is A, X₃ is T, X4 is G, X₅ is T, X₆ is T, and X₇ is G.

These probes may be set forth in an alternative different way, i.e. as a mixture of oligonucleotide probes comprising or consisting of SEQ ID NO:s 36 to 39, SEQ ID NO:s 40 to 43, or SEQ ID NO:s 40-43 and 64-69, respectively (Table 5). Depending on the desired coverage of the detection and iden- tification of CTX-M producing bacteria, any combination or any one of the probes set forth herein may be employed. As compared to the probe mixtures of SEQ ID NO:34 and 35, the probe mixture of SEQ ID NO: 63 extends the target recognition to samples positive for CTX-M-8, CTX-M-40, CTX-M-63, CTX-M-67, CTX-M-78, CTX-M-86, or CTX-M-121 . Thus, while the former probes provide detection of about 90% of the CTX-M variants, the latter probe extends the detection rate to over 90% of the existing CTX-M variants.

Table 5. Designed 5'-probes. Probes of SEQ ID NO:s 36 to 39 are encompassed in the 5'-probe mixture of SEQ ID NO:34, while probes of SEQ ID NO:s 40 to 43 are encompassed in the 5'-probe mixture of SEQ ID NO:35, and while probes of SEQ ID NO:s 40^13 and 64-69 are encompasses in the 5'-probe mixture of SEQ ID NO: 63.

*Calculated by OligoAnalyzer 3.1 with the following values: c(Na ) = 100 mM, c(Mg²⁺) = 1.5 mM, c(dNTP) = 0.4 mM. The remaining melting temperatures were calculated with an earlier version of the program.

In some embodiments, 3'-probes according to the present invention comprise or consist of a nucleic acid sequence:

5'- GAXiAAX₂CACGTX₃X₄AX₅G -3' (SEQ ID NO: 44), or 5'- GAXiAAX₂CACGTX₃X₄AX₅GG -3' (SEQ ID NO: 45), wherein Xi is A when X₂ is G, X3 is C; X4 is A or G, and X₅ is T; or Xi is A when X₂ is A, X₃ is C; X4 is A, and X₅ is C or T; and Xi is G when X₂ is A, X₃ is T; X4 is A, and X₅ is C;

5'- GAXiX2AX₃CACGTX₄X₅AX6GG -3' (SEQ ID NO: 70), wherein

Xi is A when X₂ is A, X₃ is G, X4 is C; X₅ is A or G, and Xe is T;

Xi is A when X₂, is A, X₃ is A, X4 is C; X₅ is A, and Xe is C or T;

Xi is G when X₂, is A, X₃ is A, X4 is T; X₅ is A, and Xe is C; and

Xi is A when X₂ is G, X₃ is A, X4 is C; X₅ is A, and Xe is C.

These probes may be set forth in an alternative different way, i.e. as a mixture of oligonucleotide probes comprising or consisting of SEQ ID NO:s 46 to 50, SEQ ID NO:s 51 to 55, or SEQ ID NO:s 51-55 and 71 , respectively (Table 6). Depending on the desired coverage of the detection and identification of CTX-M producing bacteria, any combination or any one of the probes set forth herein may be employed. As compared to the probe mixtures of SEQ ID NO:44 and 45, the probe mixture of SEQ ID NO: 70 extends the target recognition to samples positive for CTX-M-1 10. Table 6. Designed 3'-probes. Probes of SEQ ID NO:s 46 to 50 are encompassed in the 5'-probe mixture of SEQ ID NO:44, while probes of SEQ ID NO:s 51 to 55 are encompassed in the 5'-probe mixture of SEQ ID NO:45; or wherein probes of SEQ ID NO:s 51-55 and 71 are encompassed in the 5'-probe mixture of SEQ ID NO: 70.

Calculated by OligoAnalyzer 3.1 with the following values: c(Na ) = 100 mM, c(Mg²⁺) = 1.5 mM, c(dNTP) = 0.4 mM. The remaining melting temperatures were calculated with an earlier version of the program. Dual probes consisting of a 5'-probe of either SEQ ID NO:34, 35, or 63 and a 3'-probe of either SEQ ID NO:44, 45, or 70 were designed to have melting temperatures (T_m) allowing binding to their target sequences only in temperatures lower than the annealing and extension temperatures ideal for the present primers. The T_m is the temperature (under defined ionic strength, pH, and DNA concentration) at which 50% of the present oligonucleotides hybridize to a perfectly matched target sequence.

A person skilled in the art realizes that the present primers and probes may be modified in different ways as long as they retain their specificity for CTX-M variants. For instance, oligonucleotide analogues, such as peptide nucleic acids (PNA), or oligonucleotides comprising modified bases may be comprised in the present primers or probes. Also, various chemical compounds or groups (e.g., amino groups) or other molecules, such as labels necessary for the detection, can be attached to the primers or probes, or they can be entirely unmodified. Naturally, antiparallel sequences of these oligonucleotide sequences are equally suitable, as is obvious to a person skilled in the art.

It should be understood that the present primers and probes encompass also those, which have at least 80 % identity, preferably at least 85 %, more preferably at least 90% identity to the present primers and probes. More preferably, the sequences have at least 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, most preferably 100% identity to the oligonucleotide sequences disclosed herein. In particular there may be differences in the 5'-ends of the primers.

As used herein, the percent identity between two amino acid or two nucleic acid sequences is equivalent to the percent homology between the two sequences. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of consecutive positions of the polynucleotide expected to hybridize to Wacr -w x 100). The comparison of sequences and de- termination of percent identity between two sequences can be accomplished using standard methods known in the art.

It should also be realized that the present primer and probe sequences may lack one or more nucleotides, have one or more additional nucleotide, or have one or more change in the nucleotide sequence compared to the primer and probe sequences disclosed herein as long as they retain their functional characteristics. The present primers and probes may be produced using any method known in the art suitable for that purpose.

As used herein, the term "biological sample" refers to any sample of biological, preferably human, origin including, but not limited to, swab and brush samples of mucosae from different body parts, pus samples, and samples of different bodily fluids enabling a local infection to be detected. Non- limiting examples of such bodily fluids include synovial fluid, peritoneal fluid, cerebrospinal fluid (CSF), urine and blood. Said biological sample may also be a surface sample, such as a wipe sample taken e.g. in a hospital environment. Food samples and soil samples are also contemplated.

In some embodiments of the present invention, DNA has to be extracted from the biological sample to be studied prior to any amplification reaction. DNA may be extracted from the biological sample by using well-known DNA extraction methods or commercially available kits, such as NucleoSpin® Tissue kit (Macherey-Nagel) or chloroform-phenol extraction. The DNA can also be obtained directly from the sample to be analysed without separate isolation.

Any appropriate technique comprising an amplification phase and a detection phase may be employed in the present diagnostic method. Depend- ing on the technique in question, the amplification and detection phases may be performed either simultaneously or sequentially.

In some embodiments of the method according to the present invention, detection of CTX-M producing bacteria is performed utilizing chelate complementation technology disclosed in International Patent Publication WO2010/109065. For this purpose the present probes are provided as dual probes, which hybridize next to each other to adjacent positions, preferably with zero to ten, intervening nucleotides, in a complementary target sequence. One member of the dual probe is labelled with a lanthanide ion carrier chelate, such as a cyclic or non-cyclic aminopolycarboxylic acid chelate of Eu(lll), Sm(lll), Tb(lll) and Dy(lll), while the other member is labelled with a light- harvesting antenna ligand, such as monodentate, bidentate, tridentate or tetradentate. Upon recognition and hybridization to the target sequence, the lanthanide ion carrier chelate and the antenna ligand are brought to a close proximity enabling chelate complementation, i.e. formation of a highly fluores- cent mixed lanthanide complex, which consequently increases the intensity of the lanthanide luminescence. When the complex is formed, fluorescence may be excited at one wavelength and the emission measured at another wavelength at the same time or, in time-resolved fluorometry, after a short delay after excitation.

Chelate complementation technique may be employed both in iso- thermal and thermocycled nucleic acid amplification reactions, such as realtime quantitative PCR or homogeneous end-point PCR. A person skilled in the art can easily select ion carrier chelates having high enough thermodynamic and kinetic stability in order to be suitable for use in PCR.

A preferred detection method for determining the presence or ab- sence of a CTX-M producing bacteria in a biological sample is a chelate complementation based real time PCR, the principle of which is illustrated in Figure 1 . Preferably, oligonucleotide probes conjugated with an Europium (Eu) ion carrier chelate, preferably 7d-DOTA-Eu'", comprise or consist of a nucleic acid sequence set forth in SEQ ID NO: 34, 35, or 63, while the probes conjugated with a light harvesting antenna ligand, preferably 4-((4- isothiocyanatophenyl)ethynyl)-pyridine-2,6-dicarboxylic acid, comprise or consist of a nucleic acid sequence set forth in SEQ ID NO:s 44, 45, or 70, or vice versa.

Other techniques suitable for being applied in the present methods of determining the presence of a CTX-M producing bacteria in a biological sample include homogeneous fluorescence-based nucleic acid hybridization assays typically based on either a quenched probe, i.e. TaqMan® probe, or two energy-transfer probes. As well known in the art, the quenched probes, i.e. single-stranded self-quenching oligonucleotide probes containing both a fluo- rescent moiety and a quencher moiety, may be utilized in real time quantitative PCR, wherein the fluorescent moiety is cleaved by the nuclease action of nucleic acid polymerase upon hybridisation during nucleic acid amplification resulting in a detectable fluorescence signal. Preferred probes for use as quenched probes are the mono-probes designed herein, such as those com- prising or consisting of a nucleic acid sequence set forth in SEQ ID NO:24 or 72, or at least 10, preferably 10 to 30, consecutive nucleotides thereof. In some embodiments, the probes comprise or consist of a nucleic acid sequence set forth in SEQ ID NO:s 34, 35, 44, 45, 63, or 70.

In the case of two energy-transfer probes, the other probe molecule is labelled with an energy donor, while the other probe molecule is labelled with an energy acceptor. Generally, the emission spectrum of the donor should overlap with the excitation spectrum of the acceptor. A person skilled in the art can easily select appropriate donor-acceptor-pairs suitable for use in real time quantitative PCR or any other applicable DNA amplification method. Upon recognition of a complementary target sequence, the donor- and acceptor- labelled probes hybridize next to each other to adjacent positions creating a detectable fluorescence signal resulting from fluorescent energy transfer (FRET) from the donor to the acceptor. Dual probes according to the present invention are preferred when this detection technology is to be utilized. Probes comprising or consisting of SEQ ID NO:34, 35, or 63 may be labelled with an acceptor, such as TAMRA™ or Cy5™, while the probes comprising or consisting of SEQ ID NO: 44, 45, or 70 may be labelled with a donor, such as FAM™, TET™, or Cy3™, or vice versa.

Another detection method based on FRET and suitable for being employed in the present methods for determining the presence or absence of a CTX-M producing bacteria in a biological sample relies on molecular beacons, which are single-stranded oligonucleotide hybridization probes that form a stem-and-loop structure. The loop contains a nucleic acid probe sequence according to any of the present embodiments, while the stem is formed by annealing of complementary arm sequences that are located on either side of the probe sequence. One of the arms is labeled with a fluorophore, while the other arm is labeled with a quencher. In the absence of a target sequence, the stem keeps the probe in a closed conformation, causing the fluorescence to be quenched. Instead, in the presence of a target sequence, the loop sequence will hybridize thereto thus linearizing the probe and causing the fluorophore and quencher to move away from each other leading to the restoration of a fluorescence signal.

In some further embodiments of the methods according to the present invention, detection of CTX-M producing bacteria may be achieved by employing homogeneous detection with competitive hybridization. Such meth- ods and different variations thereof are readily available in the art. In such embodiments, the present probes are provided as double-stranded probes, wherein the first strand comprises or consists of SEQ ID NO:24 or SEQ ID NO: 72, or at least 10 or 10 to 30 consecutive nucleotides thereof, or SEQ ID NO:34, 35, 44, 45, 63, or 70, and the second strand is complementary to the first strand. In some embodiments, the probe may, additionally or alternatively, be a mixture of at least three different oligonucleotide molecules each having a first strand which comprises or consists of, independently form each other, a nucleic acid sequence comprised in SEQ ID NO: 24 or 72 or at least 10 or 10 to 30 consecutive nucleotides thereof. The first and second probe strands may be of equal or different length. Typically, the first strand is labelled with a fluor- ophore and the second strand with a quencher. In the absence of a target nucleic acid molecule, the probe strands hybridize with each other and form a double-stranded probe molecule whose fluorescence is quenched. On the other hand, in the presence of a target nucleic acid molecule, the first probe strand hybridizes to the target and, consequently, escapes from the quenching effect of the quencher probe and leads to a detectable signal. The level of the fluorescence signal is proportional to the amount of the target nucleic acid in the biological sample to be analysed. This technique may be combined both with real-time quantitative PCR or end-point PCR. Preferably, a closed-tube platform comprising an integrated thermal cycler, a signal detection unit, such as a time-resolved fluorescence measurement unit, and software for the analysis of results, is employed. Such platforms are available in the art and they may contain all required reagents in dry form.

Still another technique suitable for being utilized in the present diagnostic methods is ligation-mediated PCR (LM-PCR), wherein two probe molecules hybridize next to each other to adjacent positions in a complementary target strand resulting in a double-stranded molecule with a single- stranded nick. In case of a perfect match between the probe molecules and the target sequence, the nick is ligated by a DNA ligase thereby connecting the probe molecules. In case of a mismatch, no ligation reaction occurs and, con- sequently, the probe molecules will not be connected.

In some embodiments of the present methods for detecting CTX-M producing bacteria, DNA microarray technology may be employed. In this context, a DNA microarray or a DNA chip refers to a small substrate on which one or more of the present probes, preferably those comprising or consisting of a nucleic acid sequence selected from the group consisting of SEQ ID NO:s 24 to 55, and 63 to 79 have been attached. The probes may be attached onto the surface of the microarray support, such a nitrocellulose membrane, nylon membrane, glass, or silicon, covalent or non-covalent binding with any commercially available arrayer that is suitable for this purpose, or they can be pi- petted manually onto the surface. Alternatively, the probes can be synthesized directly onto the surface by an appropriate in situ synthesis method, such as photolithography or ink-jet technology.

For microarray applications, any appropriate labeling method can be used in order to produce a labeled target strand or a labeled probe molecule. Non-limiting examples of suitable labels include fluorescent labels (e.g., Cy5™, Cy3™, Cy2™, TexasRed™, FITC, Alexa Fluor® 488, TMR, FluorX™, ROX™, TET™, or HEX™), radioactive labels (e.g., 32P, 33P, or 33S), chemilumines- cent labels (e.g., HiLight Single-Color Kit), and colorimetric labels (e.g., enzyme labels).

The microarray can be analyzed by any equipment or reader appli- cable to this purpose. If the target strand is fluorescently labelled, the analysis can also be performed for example by a fluorescence microscope. If a radioactive label has been used, the array or membrane can be analyzed by autoradiography.

Generally speaking, hybridization-based detection methods may be classified into two categories, i.e. to those performed in a solution and to those performed on a solid support. Of the above-mentioned suitable exemplary detection methods, only microarray-based techniques belong to the latter category in which the detection probes are attached onto a solid support which binds DNA. Non-limiting example of suitable solid surfaces include nitrocellulose or nylon membranes and glass or silicon based surfaces.

Importantly, the present probes do not essentially self-hybridize or form other unwanted secondary structures which would prevent or compromise their suitability for use in in-solution-hybridization techniques for detection purposes.

In one aspect, the present invention provides a kit for use in any of the present methods of detecting the presence of CTX-M producing bacteria in a biological sample. Such a kit may comprise one or more of the present probes comprising or consisting of a nucleic acid sequence set forth in SEQ ID NO:24 or SEQ ID NO: 72, at least 10 or 10 to 30 consecutive nucleotides thereof, SEQ ID NO; 34, 35, 44, 45, 63, or 70. Alternatively or additionally, the probe may be a mixture of at least three different oligonucleotide molecules each comprising or consisting of, independently form each other, a nucleic acid sequence comprised in SEQ ID NO: 24 or SEQ ID NO: 72 or at least 10 or 10 to 30 consecutive nucleotides thereof. The present primers, or any combina- tion thereof, may or may not be included in the kit. The kit may also be suitable for use in any known platform utilizing integrated amplification and detection. It will be obvious to a person skilled in the art that, as the technology advances, the inventive concept can be implemented in various ways. The invention and its embodiments are not limited to the examples described above but may vary within the scope of the claims. Examples

Example 1. Primer characterizations

Sample preparation

Nine different patient samples obtained from the National Institute for Health and Welfare, Finland, were available for these tests. Six of the sam- pies contained Wacrx-w-carrying Eschericia coli while three of the samples contained K7-carrying Klebsiella oxytoca. On the basis of sequencing analyses, of the six E. coli samples two were CTX-M-1 -group-positive, two were CTX-M-2- group-positive, and two were CTX-M-9-group-positive.

DNA of inactivated bacterial cells was extracted using NucleoSpin® Tissue kit according to the manufacturer's instructions except for a pre-lysing step and wash and elution volumes. The pre-lysing was performed by adding 155 μΙ Buffer T1 and 25 μΙ Proteinase K to 45 μΙ bacterial suspension, and incubating three hours at 56 °C. Buffers B5 and BE were used in volumes of 550 μΙ and 80 μΙ, respectively. DNA concentrations were determined with Quant- iT™ PicoGreen® dsDNA assay kit, and by exciting the samples at 480 nm and collecting the fluorescence emission at 520 nm for 1 .0 second. DNA yield varied between 5 μg and 28 μg as determined with standard curves generated with known DNA amounts.

Amplification reactions

Primer mixtures (SEQ ID NO:1 , 2, 1 1 , and 12) were ordered from

Thermo Fisher Scientific and tested for functionality at different concentrations in all possible combinations using SYBR® Green l-based real-time PCR. In the tests, isolated DNA from a CTX-M-9-group-positive E. coli sample was used as a template at either 0, 1 000, or 10000 genome copies per reaction. Isolated DNA from a b/acrx-M-deficient E. coli strain (ATCC 25922) was used as a negative control at 10000 genome copies per PCR reaction.

Alternative templates used for testing the combination of primer mixtures of SEQ ID NO: 2 and SEQ ID NO: 12 included DNA isolated from a K. oxytoca sample (10000 genome copies per reaction) and a CTX-M-1 -positive E. coli sample (either 0, 1 000, or 10000 genome copies per reaction).

In addition to the the template DNA, each reaction mixture contained 0.4 mM dNTP (Bio-Rad), 0.4 μΙ Phire® Hotstart II DNA Polymerase (Thermo Fisher Scientific), 50 mM KCI, 1 .5 mM MgCI₂, 2 mg/ml BSA, and SYBR® Green I (Life Technologies) in GenomEra PCR buffer (Abacus Diag- nostica) in a total volume of 20 μΙ.

Each amplification reaction was carried out in triplicate using C1000 Touch™ thermal cycler combined with CFX96 Touch™ Real-Time PCR Detec- tion System (Bio-Rad). The cycling consisted of initial denaturation at 98°C for 2.5 min, followed first by 9 cycles of 62°C for 15 s, 73°C for 10 s, and 98°C for 10 s, and then 18 cycles of 25°C for 30 s, 73°C for 10 s, 98°C for 10 s, 62°C for 15 s, 73°C for 10 s, and 98°C for 10 s. The fluorescence was measured at the end of the extension step in every second cycle starting at cycle 10. Results

According to the results, all combinations of forward and reverse primer mixtures performed well in amplifying CTX-M-positive DNA samples regardless of the template concentration but, as expected, failed in specific amplification of CTX-M-negative control samples as well as K. oxytoca sam- pies.

Figure 2 shows the results obtained using different primer mixture combinations at a total primer concentration of 0.5 μΜ for both forward and reverse primer mixtures (the concentration of individual primer oligos varied between 0.10 μΜ and 0.13 μΜ). For Figure 2, template DNA was used in an amount of 10000 genome copies per reaction. Results obtained with the other template DNA amounts tested were in perfect concord with the results shown in Figure 2, and differences in the performance of parallel reactions were close to non-existing.

After PCR, a melt curve analysis was performed in order to charac- terize amplified products and melting temperatures thereof. According to the analysis, all reactions containing CTX-M-positive template DNA produced a single melting point peak, which corresponded well with the theoretical melting temperature of a correct amplicon. These results confirmed that the forward and reverse primer mixtures work well in any combination and that they amplify the target sequence specifically. Owing to a very high homology between blacrx-M and K1 genes, the present primer mixtures produced a specific amplification product also in PCRs, which contained K. oxytoca DNA as a template. This result is illustrated in Figure 3, wherein the primer mixtures SEQ ID NO: 2 and SEQ ID NO: 12 were used at individual primer concentration of 0.5 μΜ). Thus, further procedures are required for distinguishing the K1 amplification product form the blacrx-M amplification product.

Example 2. Probe preparation and characterization for chelate complementation assays

3'-aminoC6-modified Eu-probes (SEQ ID NO:s 34 and 35) as well as both 5'-aminoC6-modified and 3'-phosphate-modified antenna-probes (SEQ ID NO:s 44 and 45) were purchased from Biomers.net.

The Eu-probes were labeled with 7d-DOTA-Eu'" (2,2',2"-(10-(3- isothiocyanatobenzyl)-1 ,4,7,10-tetraazacyclododecane-1 ,4,7-triyl)tri(acetate)- europium(lll)) at the 3'-end via the aminoC6 linker essentially as described earlier e.g. by Karhunen et al. in Acta Chimica Acta 772 (2013) 87-92. Briefly, each labeling reaction contained 2.2 pg/μΙ of oligonucleotide probe and 20-fold molar excess of the DOTA-Eu'" in 50 mM carbonate buffer, pH 9.8. The reactions were incubated overnight at a temperature of +37 °C in slow shaking. The ion carrier chelate labeled probe was prepurified with a NAP™-5 gel filtration column (GE Healthcare) according to the manufacturer's instructions using an elution buffer containing 10 mM Tris (pH 7.5), 50 mM NaCI and 10 μΜ EDTA. Thereafter, the eluates were purified with reverse-phase HPLC with a 150 mm ^χ 4.6 mm Aeris™ PEPTIDE column (Phenomenex) using a gradient from 95% of solution A (50 mM triethylammonium acetate; TEAA; Sigma- Aldrich) and 5% solution of B (95% acetonitrile in 50 mM TEAA) to 86% of A and 14% of B in 1 min, and to 70% of A and 30% of B in 7 min, and finally to 100% of B in one min with a flow rate of 2.00 ml/min. After washing with 100% of B for 1 min, the percentage of B was lowered to 5% in 1 min, and the col- umn was equilibrated with 95% of A for 8 min. The collected fractions were dried in miVac Duo (GeneVac Ltd.).

The antenna-probes were labeled with isothiocyanate-activated form of the light absorbing antenna ligand (4-((isothiocyanatophenyl)ethynyl)- pyridine-2,6-dicarboxylic acid) at the 5'-end via the aminoC6 linker essentially as described earlier e.g. by Karhunen et al. (ibid.). Briefly, each labeling reac- tion contained 1 .4 μς/μΙ of oligonucleotide probe and 100-fold molar excess of the antenna ligand dissolved in Ν,Ν-dimethylformamide using a Hielscer ultrasonic homogenizer. The labeling reactions were carried out in 50 mM carbonate buffer, pH 9.8. The reactions were incubated overnight at a tempera- ture of +50 °C in slow shaking and prepurified similarly to the 7d-DOTA-Eu'" labeling reactions. Thereafter, the eluates were purified with reverse-phase HPLC with a 150 mm χ 4.6 mm Hypersil® ODS C18 column (Thermo Fisher Scientific) using a gradient from 95% of solution A (50 mM triethylammonium acetate; TEAA; Sigma-Aldrich) and 5% solution of B (95% acetonitrile in 50 mM TEAA) to 86% of A and 14% of B in 1 min, and to 70% of A and 30% of B in 25 min, and finally to 100% of B in 2 min with a flow rate of 0.5 ml/min. After washing with 100% of B for 5 min, the percentage of B was lowered to 5% in 3 min, and the column was equilibrated with 95% of A for 22 min. The collected fractions were dried in miVac Duo (GeneVac Ltd.) and stored in -20 °C.

The HPLC fractions were dissolved in 10 mM Tris (pH 7.5), 50 mM

NaCI, 10 μΜ EDTA and their oligonucleotide contents were determined by measuring absorbance at 260 and 330 nm with NanoDrop® ND-1000 spectrophotometer (NanoDrop Technologies) using UV-Vis Software.

Success of the labeling reactions and the ability of the probes to form fluorescent complexes with complementary target oligonucleotides was verified by hybridization experiments. To this end, artificial target oligonucleotides were designed such that the total number of target sequences was the lowest possible while each Eu-probe would form a fluorescent complex with at least one of the antenna-probes upon binding to the target oligonucleotide, and vice versa. The designed target oligonucleotides A to E, covering complementary sites for each probe sequence designed herein, are shown in Table 7.

Table 7. Synthetic target oligonucleotides designed for verifying the functionality of the present probes. Variable sites have been highlighted by underlining.

Target Sequence 5'→ 3' SEQ oligonucleotide ID

NO:

A TCCCATTGACGTGC I I I I CCGCAATCGGATTATAGTTAACAAGGT 56

B TCCCGTTAACGTG I I I CTCCG CAATGG GGTTGTAGTTAACAAG GT 57

C TCCCGTTG ACGTGTTTTTCCG CAATGG G ATTGTAGTTAAC AAG GT 58 D TCCCATCGACGTGC 1 1 1 1 CCGCAATCGGATTGTAGTTAACAAGGT 59

E TCCCATTG ACGTGTTTTTCCG CAATCG G ATTGTAGTTAACAAG GT 60

The hybridization reactions contained in a total volume of 60 μΙ either 0 or 10 nM of a synthetic target oligonucleotide (Integrated DNA Technologies) and 25 nM of the corresponding Eu- and antenna-labeled probes in 50 mM Tris-HCI (pH 7.7), 600 mM NaCI, 0.1 % (vol/vol) Tween 20, 0.05% (w/v) NaN₃, 30 μΜ DTPA. The experiments were performed in yellow MaxiSorp™ plates (Nunc) by incubating the reactions for 10 min at RT, for another 20 min at +50 °C, and finally for 15 min at RT. The first and the third incubations were performed at slow agitation. Thereafter, Eu'" luminescence was measured with Victor™ 1420 plate reader (PerkinElmer Wallac).

All Eu- and antenna-probe combinations tested provided 180- to

1700-fold higher Eu-signals in reactions containing fully complementary target oligonucleotides than in reactions without any target oligonucleotides. In other words, the labeling reactions were successful and each probe combination provided a specific signal readily distinguishable from the background signals. Example 3. Chelate complementation-based PCR

The present primers and probes were used at different concentrations and in different combinations. Eu-probe mixture of SEQ ID NO: 34 was used with antenna-probe mixture of SEQ ID NO: 44, and Eu-probe mixture of SEQ ID NO: 35 was used with antenna-probe mixture of SEQ ID NO: 45. Al- ternative templates included isolated DNA from two independent CTX-M-1 - group-positive, CTX-M-2-group-positive and CTX-M-9-group-positive E. coli samples, three independent K. oxytoca samples, and one CTX-M-negative E. coli sample. Template concentrations varied between 0 and 10000 genome copies per amplification reaction.

Amplification reactions were built up as described above with some modifications. The reaction mixture contained 30 μΜ DTPA but no SYBR® Green I. Further, owing to a greater reaction volume (40 μΙ instead of 20 μΙ) 0.8 μΙ Phire® Hotstart II DNA Polymerase was used. In these experiments, both forward and reverse primer mixtures (SEQ ID NO:2 and SEQ ID NO:1 1 , re- spectively) were used at a total primer concentration of 0.5 μΜ. Each PCR was carried out in triplicate employing C1000 Touch™ thermal cycler. The cycling consisted of initial denaturation at 98°C for 2.5 min, followed first by 10 cycles of 62°C for 15 s, 73°C for 10 s, and 98°C for 10 s, and then 18 cycles of 25°C for 35 s, 73°C for 10 s, 98°C for 10 s, 62°C for 15 s, 73°C for 10 s, and 98°C for 10 s. The fluorescence was measured in every second cycle at 25°C starting at cycle 10. The measurements were performed with Victor™ X4 Multilabel Plate Reader (PerkinElmer) using excitation wavelength of 340 nm, measure- ment wavelength of 615 nm, delay time of 250 s, and measurement time of 750 MS.

All probe mixture combinations tested performed well but the combination of Eu-probe mixture of SEQ ID NO: 35 and antenna-probe mixture of SEQ ID NO: 45 provided the highest signal to background ratio. Results ob- tained with this probe mixture combination at individual probe concentration of 0.05 μΜ using template amount of 10000 genome copies per reaction are presented in Figure 4. None of the three independent K. oxytoca samples nor the CTX-M-negative E. coli sample provided a signal beyond the background signal while all CTX-M-positive samples provided a signal readily distinguishable from the background signal.

Results of analytical sensitivity tests performed with ten-fold dilution series of CTX-M-positive samples (either 0, 0.01 , 0.1 , 1 , 10, 100, 1 000, or 10000 genome copies per reaction) together with Eu-probe mixture of SEQ ID NO: 35 and antenna-probe mixture of SEQ ID NO: 45 (at individual probe con- centration of 0.05 μΜ) are shown in Figure 5. Each of the three parallel reactions provided signals, that exceeded the threshold signal level (signal-to- background 1 .5) when 10 or more genome copies per reaction were used as a template. For CTX-M-9-group template, even one genome copy per reaction was enough to provide a detectable signal in all three parallel samples, and 0.01 genome copies per reaction provided a signal in one of the parallel samples. For CTX-M-1 -group and CTX-M-2-group-positive samples, one genome copy per reaction provided a signal in two of the three parallel samples. Thus, the analytical sensitivity of the present chelate complementation-based diagnostic method is 10 genome copies. Importantly, this value shows that the pre- sent method is up to 10 times more sensitive than a known VAPChip array for blacTx-M (Bogaerts et al. 201 1 , Antimicrob. Agents Chemother. 55 :4457-4460). Example 4. Chelate complementation-based PCR with extended CTX-M variant target variability

Eu-probe mixture of SEQ ID NO: 63 was used with antenna-probe mixture of SEQ ID NO: 70. For analytical specificity study alternative templates included isolated DNA from twelve independent CTX-M-1 -group-positive, two independent CTX-M-2-group-positive, one CTX-M-8-group-positive, and twelve independent CTX-M-9-group-positive E. coli samples, two independent CTX- M-1 -group-positive E. cloacae samples, one CTX-M-25-group-positive K. pneumoniae sample, four independent K. oxytoca samples, and one CTX-M- negative sample of 21 different bacteria species (E. hormaechi, S. mutans, C. freundii, S. enteriditis, S. aureus, S. epidermidis, E. cloacae, M. morganii, P. mirabilis, A. baumannii, S. mitis, S. pyogenes, E. faecalis, E. facium, C. perfringens, F. nucleatum, S. pneumoniae, P. vulgaris, P. aeruginosa, E. coli, K. pneumoniae). Template concentrations were 100 000 genome copies per reaction for CTX-M-negative samples and 100 genome copies per reaction for CTX-M-positive samples. For analytical sensitivity studies with isolated DNA, alternative templates included isolated DNA from one sample positive for either CTX-M-1 -group, CTX-M-2-group, CTX-M-8-group, CTX-M-9-group, or CTX-M- 25-group with template concentrations of either 0, 0.1 , 1 , 10, 100, 1 000, 10000, 100000 genome copies per reaction .

Amplification reactions were performed as described above in Example 3. All reactions contained internal amplification control to verify successful amplification in negative reactions.

The results of the analytical specificity study are shown in Figure 6. None of the CTX-M-negative samples nor the K. oxytoca samples provided a signal beyond the background signal while all CTX-M-positive samples provided a signal readily distinguishable from the background signal.

The results of the analytical sensitivity tests regarding the CTX-M-2- group-positive sample are shown in Figure 7. Clear signal increase is seen in all cases with 1 or more genome copies per reaction. Similar results were obtained with CTX-M-1 -group, CTX-M-8-group, CTX-M-9-group, or CTX-M-25- group-positive samples.

Example 5. Chelate complementation-based PCR with bacteria cells

Eu-probe mixture of SEQ ID NO: 63 was used with antenna-probe mixture of SEQ ID NO: 70. Alternative templates included bacterial cells from one CTX-M-1 -group-positive, one CTX-M-2-group-positive, one CTX-M-9- group-positive and one CTX-M-8-group-positive E. coli sample and one CTX- M-25-group-positive K. pneumoniae sample.

Bacterial cells were cultured in 5 ml of SB medium in thermomixer at 37 °C until at visible turbidity but not overgrown. After centrifugation (2719xg, 2 min), the cell pellet was gently suspended in 2 ml of sterile PBS buffer. The growth of bacteria in 1 ml of the resulting suspension was halted by introducing 0.05% NaN₃ and the remaining bacterial suspension without NaN₃ was immediately used for the preparation of ten-fold dilution series in SB medium. One hundred ul of the SB dilutions were plated on LA plates and cultured at 37°C. Of the NaN₃ treated bacteria suspension, ten-fold dilution series were prepared in sterile water and stored refrigerated until analysis by PCR. Samples of the water dilution series were added into a PCR reaction directly without DNA isolation. Amplification reactions were performed as described above in Example 3. All reactions contained internal amplification control to verify successful amplification in negative reactions. Colonies on the LA plates were counted after overnight culture to confirm the bacterial count in the samples analysed in the PCR reactions.

As an example, representative results of bacterial cell PCR with CTX-M-2-group-positive cells are shown in Figure 8. CTX-M was detected in all samples with three or more colony forming units of bacteria.

ACKNOWLEDGEMENT OF SUPPORT

The work leading to this invention has received funding from the European Union Seventh Framework Programme (FP7/2007-2013) under grant agreement n° 259848.

Claims

1 . A method of determining the presence or absence of CTX-M producing bacteria in a biological sample, wherein said method comprises the steps of:

a) providing a biological sample suspected to contain CTX-M producing bacteria;

b) amplifying CTX-M encoding DNA in said sample, if any; and c) detecting the amplified DNA using at least one probe, which hybridizes to a region of blacrx-M gene, which region corresponds to that of nu- cleotides 397-617 of SEQ ID NO: 23 in CTX-M-15, and which probe comprises at least 10 consecutive nucleotides of a nucleic acid sequence set forth in SEQ ID NO: 24 or SEQ ID NO: 72,

wherein steps b) and c) may be performed either separately or simultaneously.

2. The method according to claim 1 , wherein said region corresponds to that of nucleotides 503-539 of SEQ ID NO: 23 in CTX-M-15.

3. The method according to claim 1 or 2, wherein said probe is a mixture of at least three probes each comprising at least 10 consecutive nucleotides of different nucleic acid sequences set forth in SEQ ID NO: 24 or SEQ ID NO: 72.

4. The method according to claim 3, wherein said probe mixture comprises nine or sixteen probes each comprising at least 10 consecutive nucleotides of different nucleic acid sequences set forth in SEQ ID NO: 24 or SEQ ID NO: 72, respectively.

5. The method according to any one of claims 1 to 4, wherein said probe has been bisected to a 5'-probe and a 3'-probe.

6. The method according 5, wherein said 5'-probe comprises a nucleic acid sequence set forth in SEQ ID NO: 34, 35, or 63, and said 3'-probe comprises a nucleic acid sequence set forth in SEQ ID NO: 44, 45 or 70.

7. The method according to any preceding claim, wherein said amplification is performed with a forward primer comprising a nucleic acid sequence set forth in SEQ ID NO: 1 , 2, or 61 , and a reverse primer comprising a nucleic acid sequence set forth in SEQ ID NO: 1 1 or 12.

8. The method according to any preceding claim, wherein said de- tection is performed in solution.

9. The method according to claim 8, wherein said detection is based on a technique selected from the group consisting of chelate complementation, fluorescence-based nucleic acid hybridization assays, and ligation-mediated PCR.

10. The method according to any one of claims 1 to 7, wherein said detection is performed on a solid support.

1 1 . The method according to claim 10, wherein said detection is based on a DNA microarray technique.

12. An oligonucleotide probe comprising a nucleic acid sequence having at least 80% sequence identity to a sequence set forth in SEQ ID

NO:34, 35, 44, 45, 63, or 70, or to at least 10 consecutive nucleotides of a nucleic acid sequence set forth in SEQ ID NO: 24 or SEQ ID NO: 72.

13. The oligonucleotide probe according to claim 12, wherein said probe comprises at least three different oligonucleotide molecules each com- prising, indepently form each other, at least 10 consecutive nucleotides of a nucleic acid sequence comprised in SEQ ID NO: 24 or SEQ ID NO: 72.

14. The oligonucleotide probe according to claim 13, wherein said probe is a probe mixture comprising nine or sixteen probes each comprising at least 10 consecutive nucleotides of different nucleic acid sequences set forth in SEQ ID NO: 24 or SEQ ID NO: 72, respectively.

15. An oligonucleotide primer comprising a nucleic acid sequence having at least 80% sequence identity to the sequence set forth in SEQ ID NO:1 , 2, 1 1 , 12, or 61 .