WO2015009544A1 - Interférence arn de fabp4 pour le traitement de l'athérosclérose - Google Patents

Interférence arn de fabp4 pour le traitement de l'athérosclérose Download PDF

Info

Publication number
WO2015009544A1
WO2015009544A1 PCT/US2014/046201 US2014046201W WO2015009544A1 WO 2015009544 A1 WO2015009544 A1 WO 2015009544A1 US 2014046201 W US2014046201 W US 2014046201W WO 2015009544 A1 WO2015009544 A1 WO 2015009544A1
Authority
WO
WIPO (PCT)
Prior art keywords
lipid
sirna
liposomes
liposome
plaque
Prior art date
Application number
PCT/US2014/046201
Other languages
English (en)
Inventor
Brian Walton
Gabriel Lopez BERESTEIN
Anil Kumar SOOD
Siqin ZHAORIGETU
Original Assignee
Texas Heart Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Texas Heart Institute filed Critical Texas Heart Institute
Publication of WO2015009544A1 publication Critical patent/WO2015009544A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system

Definitions

  • the disclosure herein generally relates to methods of making anionic liposomal FABP4siRNA. More particularly, the disclosure relates to an anionic liposomal atherosclerosis related siRNA delivery system.
  • Atherosclerosis is a chronic inflammatory disease, is the principal cause of heart attack, and stroke, thus being responsible for 30% of all deaths in the United States [1-3].
  • Atherosclerosis is characterized as a systemic, progressive disease process in which the arterial wall thickens through a process of inflammation [4-7], oxidative stress, and dyslipidemia [8-10].
  • Liposomes have been used in the diagnosis and treatment of cancer [16,17] and, to a lesser extent, cardiovascular disease [18-20].
  • the aqueous cores of liposomes have the ability to concentrate hydrophilic compounds for imaging [21-23].
  • liposomes have been used successfully in molecular imaging such as single photon emission computed 58 tomography [21-23] and as nuclear isotope imaging agents to enhance local tissue imaging [24].
  • Liposomal uptake by tumors has also been shown to occur, and is speculated to be the result of altered vascular permeability; however, no mechanism has been confirmed, although it has also been demonstrated that anionic liposomes have been taken up into the atheromas of Watanabe heritable hyperiipidemic rabbits within lipid pools [20], however the description of treatment using Watanabe rabbits demonstrate the effectiveness of liposomal penetration into atherosclerotic plaque but did not characterize the plaque or cellular distribution such as the clear co-localization with macrophages and FABP4.
  • an embodiment of the method a method of making an anionic liposomal siRNA comprising: mixing a lipid-A and a lipid-B to form a lipid mixture comprising lipid-A and lipid-B; and mixing: (i) the lipid mixture, (ii) an siRNA, and (iii) a solvent to form a liposome.
  • the siRNA comprises FABP4siRNA, in further embodiments the siRNA comprises 4 kinds of FABP4siRNA reagent, and in another embodiment the siRNA further comprises a fluorescent tag.
  • lipid-A comprises DMPG
  • lipid-B comprises DMPC
  • lipid-A and lipid-B are in a molar ratio of between about 9.99: 0.01 to about 0.01 : 9.99
  • lipid-A and lipid-B are in a molar ratio of between about 3 to about 7.
  • the lipid mixture; siRNA; and said solvent are mixed in a ratio of about 10:1 :40.
  • the solvent comprises tertiary butanol.
  • the liposome comprises an anionic charge, in a further embodiment, said liposome is between .01 microns to about 1000 microns.
  • said liposomes further comprising a nanogold label, and in a still further embodiment the liposomes are about 2pm to about 7 m.
  • the liposomes are further lyophilized and stored at -20 °C.
  • a method of delivering a siRNA to an atherosclerotic plaque comprising:1 ) administering an anionic liposomal delivery system to a patient comprising the plaque, wherein the liposomal delivery system comprises:(a) an anionic liposome, wherein the liposome comprises a siRNA, and a lipid mixture; and 2) targeting macrophage cells comprising the plaque with the liposome, wherein the targeting silences FABP4 and stables the plaque.
  • administration is intravenous or intra-arterial.
  • a method of delivering a siRNA to an atherosclerotic plaque the liposomes comprise a mixture of a lipid-A, and a lipid-B, in another embodiment, the liposome further comprise a solvent, in a further embodiment, lipid- A comprises DMPG, and in a still further embodiment lipid-B comprises DMPC.
  • lipid-A and lipid-B are in a molar ratio of between about 9.99: 0.01 to about 0.01 : 9.99, in a further embodiment lipid-A and lipid-B are in a molar ratio of between about 3 to about 7.
  • the siRNA comprises FABP4siRNA, in another embodiment, the siRNA further comprises a fluorescent tag, in a further embodiment, the lipid mixture; siRNA; and said solvent are mixed in a ratio of about 10:1 :40,and in a still further embodiment, targeting further requires clatherin mediated endocytosis.
  • a method of visualizing liposomal uptake by atherosclerotic plaques comprising:(1 ) administering to a patient comprising the plaque a fluorescently labeled anionic liposome, wherein the liposome comprises a fluorescent tagged siRNA; and (2) visualizing said labeled anionic liposome, and identifying the location of the liposomes.
  • Figure 1 (A) is a Light microscopy analysis of Oil Red O-stained atherosclerotic plaque comprising highly complex lesions in ApoE-/- mouse aortic tissue (20X magnification), in accordance with an embodiment of this invention
  • MFC macrophage derived foam cells
  • CC cholesterol monohydrate crystal
  • P plaque
  • L lumen
  • Figure 2 provides a study of the uptake and distribution of anionic liposomes in atherosclerotic plaque in the aortic tissue of ApoE-/- mice, A non- silencing siRNA sequence (Sequence 1 : UACAAUAGUCAGUCGGAUUCUUCAAACUGGGCGUGGAACACUAAUAAGCAAG CAAUUGGAAAGUCGACCACAAUAA) which was purchased from Thermo Scientific was tagged with Alexa Fluor 488 dye (excitation, 495 nm; emission, 519 nm) 409 was incorporated into liposomes and used to determine liposome uptake and distribution in 410 atherosclerotic plaque of aortic tissue.
  • Sequence 1 UACAAUAGUCAGUCGGAUUCUUCAAACUGGGCGUGGAACACUAAUAAGCAAG CAAUUGGAAAGUCGACCACAAUAA
  • Figure 3 illustrate the distribution of anionic liposomes in the atherosclerotic plaque of ApoE-/- mouse aortic tissue.
  • Confocal microscopy images (63X magnification) showing fluorescently labeled liposomes (A, green) and immunofluorescence staining for CD68+ macrophages (B, red) in atherosclerotic plaque, liposomes accumulated in macrophage-rich areas (C) shows an overlay (yellow) of images depicted in (A) and (B) showing the colocalization of liposomes with macrophages;
  • (D) transmission electron microscopy analysis (20.000X magnification) showing the accumulation of macrophages in atherosclerotic plaque; scale bar 2 ⁇ m; Li, liposome; N, nucleus, all in accordance with embodiments of this invention;
  • FIG. 4 illustrate the effect of amantadine on the uptake of fluorescently labeled liposomes into human coronary artery endothelial cells (HCAECs);
  • HCAECs human coronary artery endothelial cells
  • A is a confocal microscopy analysis (63X magnification) showing the uptake of fluorescently labeled liposomes into HCAECs after 30 minutes of incubation; as indicated, some cells were pretreated with amantadine for 20 minutes and/or TNF-a for 1 hour;
  • Figure 5 illustrates that Amantadine inhibits TNF-a induced clathrin overexpression; confocal microscopy analysis (63X magnification) shows clathrin expression (green punctuate structures) in (A) untreated HCAECs; (B) HCAECs pretreated with TNF-a for 3hrs; and (C) HCAECs pretreated with 1 mM amantadine for 20 minutes and TNF-a and for 3hrs; (D) immunoblot analysis showing results similar to those above; ⁇ -actin was used as loading control (HC, heavy chain; Amt, amantadine), in accordance with an embodiment of this invention.
  • HC heavy chain
  • Amt amantadine
  • Atherosclerosis is a chronic inflammatory disease, characterized as having a systemic, progressive disease process, in which the arterial wall thickens through a process of inflammation, oxidative stress, and dyslipidemia. This process leads to plaque formation, and flow limitation in the vessel lumen.
  • Liposomes are manipulated, wherein their size and external charge may be specified.
  • the aqueous cores of liposomes have the ability to concentrate hydrophilic compounds, thus in some embodiments herein described, liposomes target select tissues and deliver sufficient quantities of compounds for imaging studies, further their malleable nature may allow for the local delivery of novel therapeutic compounds directly to the atherosclerotic plaque.
  • Embodiments of the methods herein described have been used to show distribution of the anionic liposomes of this invention, in atherosclerotic plaque in the aortic tissues of apolipoprotein E-deficient (ApoE- -) mice.
  • liposomes contain fluorescently labeled nonsilencing siRNA which can be tracked using confocal microscopy.
  • confocal microscopy analysis showed the uptake of anionic liposomes into atherosclerotic plaque in ApoE-/- mouse aortic tissue and the co-localization of these liposomes with macrophages which are the primary metabolically active component of atherosclerotic plaque and play a pivotal role in plaque instability.
  • transmission electron microscopy analysis further revealed the accumulation of the anionic liposomes in macrophages.
  • HCAECs human coronary artery endothelial cells
  • TNF tumor necrosis factor
  • immunoblot analysis showed that endogenous clathrin expression was significantly increased in HCAECs stimulated with TNF-a but was inhibited by amantadine, thus indicated that clathrin-mediated endocytosis is partly responsible for the uptake of liposomes by endothelial cells.
  • anionic liposomes target the macrophage-rich areas of plaque in ApoE-/- mice and may be used lead in the development of novel diagnostic and therapeutic strategies for treating vulnerable plaque in humans.
  • ApoE-/-mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). The animal 90 experimental protocol was approved by the Animal Welfare Committee (Permit number AWC 1 1-069) at The University of Texas Health Science Center at Houston.
  • Liposomes were prepared with DMPC (1 ,2-dimyristoyl-sn-glycero-3- phosphocholine) and DMPG (1 ,2-dimyristoyl-sn-glycero-3-phosphoglycerol) (Avanti Polar Lipids, Inc., Alabaster, AL, USA) 96 in a 7:3 molar ratio. Lipids and a nonsilencing siRNA sequence tagged with Alexa Fluor dye (Qiagen, 97 Valencia, CA, USA) were mixed in excess tertiary butanol, and Tween 20 was added. This mixture was then lyophilized and stored at -20 °C until use.
  • DMPC 1,2-dimyristoyl-sn-glycero-3- phosphocholine
  • DMPG 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol
  • this preparation was hydrated with 1X phosphate-buffered saline (PBS) at a concentration of 50 pg/ml to achieve the desired dose in a 100 ⁇ injection.
  • PBS phosphate-buffered saline
  • Liposomes were prepared as described above, with DMPC (1 ,2-dimyristoyl- sn-glycero-3-phosphocholine) and DMPG (1 ,2-dimyristoyl-sn-glycero-3- phosphoglycerol) in a 7:3 molar ratio.
  • DMPC is neutral and DMPG has a negative charge.
  • Liposome particle sizes are in a range of about 200 nm to about 300 nm with the average size of about 235 nm.
  • Table 2 shows the multimodal size distribution of liposomes formed by an embodiment of the method herein described.
  • the aorta of each mouse was collected for immunofluorescence staining and transmission electron microscopy (TEM) analyses.
  • TEM transmission electron microscopy
  • Aortas were divided into two sections. One section was fixed for immunofluorescence staining in 4% paraformaldehyde in PBS (pH 7.4) overnight at 4°C. The tissue was then rinsed in 15% sucrose for 24 hours at 4°C. The plaque tissues were identified, cut into 5-mm segments, embedded in optimal cutting temperature (OCT) compound (Tissue-Tek; Sakura Finetek, Torrance, CA, USA), and stored at -80°C before slides were made. The second section of tissue was fixed for TEM analysis in 3% glutaraldehyde in PBS (pH 7.4).
  • OCT optimal cutting temperature
  • the slides were incubated in 1 % 136 BSA/10% normal goat serum in 0.1 % PBS-Tween 20 for 1 h to permeabilize the tissue and block nonspecific protein-protein interactions.
  • the slides were then incubated with rabbit polyclonal anti-CD68 (sc-9139; Santa Cruz Biotechnology, Santa Cruz, CA; 1 :100 dilution) at 4°C overnight, washed three times with 1X PBS, and incubated with anti-rabbit Texas red conjugated secondary antibody (#6719, Abcam, Cambridge, UK; 1 :1000 dilution) at room temperature for 60 minutes. Images were analyzed on a Leica SP5 confocal system with a Leica TCS SP5 II microscope as described above.
  • tissue sections were initially fixed with 3% glutaraldehyde in PBS (pH 7.4) and post-fixed in 1 % osmium tetroxide. Dehydration was carried out in a series of graded alcohol washes (70%, 80%, 90%, and 100% ethanol), followed by two acetone washes. The samples were infiltrated with Epon plastic resin, embedded, and cut into 1 ⁇ -thick sections with an RMC MTXL Ultra Microtome (Boeckeler Instruments, Arlington, AZ, USA) for low-resolution images. Furthermore, the plaque sections were cut into 60 to 80 nm-thick sections for ultra-structure images. The thin sections were stained for Uranyl Acetate and Lead Citrate. Images were acquired with a JEOL JeM-1230 transmission electron microscope (JEOL, Tokyo, Japan). Cell Culture and Treatment
  • HCAECs were purchased from Lonza Walkersville, Inc. (Walkersville, MD, USA). Cells were cultured in EBM-2 (Lonza) medium. Liposomes were added to serum-free incubation medium at a final concentration of 150 pg/ml total lipids. To measure liposome uptake, medium was replaced by liposome containing medium or medium without liposomes (control) and incubated for 30 minutes. In the TNF-a treatment experiment, cells were incubated with TNF-a (R&D System, 100 ng/ml) for 1 or 3 hours to analyze clathrin expression. Then, the cells were washed, and incubated with liposomes.
  • TNF-a R&D System
  • the blot was incubated with goat anti-rabbit horse radish peroxidase-labeled secondary antibody (Bio-Rad). Proteins were detected by using Pierce enhanced chemiluminescence Western blotting substrate, ⁇ -actin (A1978, Sigma-Aldrich) was used as loading control.
  • EXAMPLE 1 Liposomal uptake in Atherosclerotic Plaque.
  • Light microscopy analysis of Oil Red O-stained atherosclerotic plaque revealed highly complex lesions within the plaque (p).
  • TEM analysis of the atherosclerotic plaque showed the presence of foam cells (derived from macrophage cells) and cholesterol monohydrate crystals (cc) ( Figure 1 B and C).
  • immunofluorescence staining was performed after the injection of PBS-control ( Figure 2A) or fluorescently labeled liposomes ( Figure 2B and 2C).
  • EXAMPLE 2 Colocalization of Macrophages and Fluorescently Labeled Liposomes in Atherosclerotic Plaque.
  • metabolically active components of atherosclerotic plaque such as macrophages preferentially uptake negatively charged particles.
  • atherosclerosis associated macrophages expressing CD68 co-localized with fluorescently labeled liposomes in atherosclerotic plaque confocal fluorescence imaging of atherosclerotic plaque in the aortic tissue of ApoE-/- mice was performed.
  • CD68 staining indicated the presence of macrophages in the plaque area (3B), and fluorescently labeled liposomes were visible in the macrophage-rich area of plaque (3C). Fluorescently labeled liposomes and CD68+ macrophages colocalized primarily in the adventitia lipid rich areas of plaque ( Figure 3A-C). To further confirm the distribution of anionic liposomes. In a further embodiment of the methods herein described, TEM analysis was conducted. As shown in Figure 3D, liposomes accumulated within macrophages in atherosclerotic plaque, indicating an association between liposomal uptake and areas of metabolically active plaque.
  • EXAMPLE 3 The Role of Clathrin-mediated Endocytosis in Liposome Uptake by HCAECs.
  • the clathrin-mediated endocytosis as a pathway for the uptake of liposomes by HCAECs, and the effects of amantadine, (an independent inhibitor of clathrin mediated endocytosis [35,36] on liposome uptake in HCAECs) were studied. Further, to examine the effects of amantadine under inflammatory conditions, HCAECs were treated with TNF-a, a key cytokine in the recruitment and activation of inflammatory cells.
  • EXAMPLE 4 Analysis of Clathrin Expression in HCAECs.
  • confocal microscopy analysis was used to show that TNF-a-induced an increase in the uptake of liposomes which was mediated by an increase in clathrin expression. Basal expression of endogenous clathrin in HCAECs was low (Figure 5A). However, in cells stimulated with TNF-a for 3 hours, clathrin expression was significantly increased ( Figure 5B). Amantadine greatly inhibited clathrin expression in TNF-a-stimulated cells (Figure 5C). The results of immunoblot analysis were fully consistent with the results of confocal microscopy (Figure 5D), these data indicate that the TNF-a-induced increase in liposome uptake which was mediated by clathrin-dependent endocytosis.
  • the uptake of anionic liposomes into HCAECs was shown to occur through clathrin-mediated endocytosis ( Figures 4 and 5). Macrophages play a pivotal role in plaque instability, which is directly involved in triggering acute coronary syndromes including but not limited to: unstable angina, acute myocardial infarction, and sudden coronary death [37-41].
  • the an anionic liposome herein described may be used as liposomal drug delivery system for therapeutically targeting the inhibition of macrophage infiltration in atherosclerotic plaque, and may thus be used to promote plaque stabilization.
  • anionic liposomes have several advantages that positively charged liposomes do not. Namely, positively charged liposomes have been shown to be toxic as a carrier and tend to attach to arterial walls [42,43]. In contrast, the anionic liposomes described herein are passively absorbed through atherosclerotic areas of the arterial wall as a result of altered permeability caused by glycocalyx loss. For liposomes to be taken up into atherosclerotic plaque, they must first cross the local endothelial barrier. Clathrin and caveolar-mediated endocytosis are the most commonly reported processes of cellular uptake [42-46].
  • Clathrin- coated vesicles are the best characterized of the vesicular carriers and provide a specific delivery system for the uptake of extracellular material [47].
  • the uptake of liposomes into HCAECs was low under normal conditions but was significantly increased in HCAECs stimulated with TNF-a.
  • amantadine an independent inhibitor of clathrin-mediated endocytosis, significantly. 12

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des procédés pour produire de l'ARNsi FABP4 liposomale anionique et un système d'administration d'ARNsi liposomale anionique lié à l'athérosclérose, pour cibler l'athérosclérose. Cette invention se rapporte à un procédé pour produire de l'ARNsi liposomale anionique consistant à mélanger un lipide A et un lipide B pour former un mélange de lipides comprenant le lipide A et le lipide B; et mélanger (i) le mélange de lipides, un ARNsi (ii) et (iii) un solvant pour former un liposome. Dans d'autres modes de réalisation, l'ARNsi comprend également une étiquette fluorescente. Dans certains modes de réalisation du procédé de production d'ARNsi liposomale anionique, le lipide A comprend le composé DMPG, dans un autre mode de réalisation, le lipide B comprend le composé DMPC.
PCT/US2014/046201 2013-07-11 2014-07-10 Interférence arn de fabp4 pour le traitement de l'athérosclérose WO2015009544A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361844904P 2013-07-11 2013-07-11
US61/844,904 2013-07-11

Publications (1)

Publication Number Publication Date
WO2015009544A1 true WO2015009544A1 (fr) 2015-01-22

Family

ID=52346647

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/046201 WO2015009544A1 (fr) 2013-07-11 2014-07-10 Interférence arn de fabp4 pour le traitement de l'athérosclérose

Country Status (1)

Country Link
WO (1) WO2015009544A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110438127A (zh) * 2019-08-09 2019-11-12 中国药科大学 抑制FABP4靶基因表达的siRNA及其应用
CN113521251A (zh) * 2021-08-04 2021-10-22 宁夏医科大学 Fabp4在制备改善动脉粥样硬化的药物中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110054011A1 (en) * 2007-08-30 2011-03-03 Mccullagh Keith RNA Antagonist Compounds for the Modulation of FABP4/AP2
US20110237435A1 (en) * 2008-06-27 2011-09-29 Children's Hospital & Research Center At Oakland Lipophilic nucleic acid delivery vehicle and methods of use thereof
US20110256224A1 (en) * 2009-10-09 2011-10-20 Signablok, Inc. Methods and compositions for targeted delivery
US20120015026A1 (en) * 2009-03-25 2012-01-19 Giancarlo Francese Pharmaceutical composition containing a drug and sirna

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110054011A1 (en) * 2007-08-30 2011-03-03 Mccullagh Keith RNA Antagonist Compounds for the Modulation of FABP4/AP2
US20110237435A1 (en) * 2008-06-27 2011-09-29 Children's Hospital & Research Center At Oakland Lipophilic nucleic acid delivery vehicle and methods of use thereof
US20120015026A1 (en) * 2009-03-25 2012-01-19 Giancarlo Francese Pharmaceutical composition containing a drug and sirna
US20110256224A1 (en) * 2009-10-09 2011-10-20 Signablok, Inc. Methods and compositions for targeted delivery

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALMER ET AL.: "Adiponectin-coated nanoparticles for enhanced imaging of atherosclerotic plaques", INTERNATIONAL JOURNAL OF NANOMEDICINE, vol. 6, 20 June 2011 (2011-06-20), pages 1279 - 1290 *
LEUSCHNER ET AL.: "Therapeutic siRNA silencing in inflammatory monocytes in mice", NATURE BIOTECHNOLOGY, vol. 29, no. 11, 9 October 2011 (2011-10-09), pages 1005 - 1013 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110438127A (zh) * 2019-08-09 2019-11-12 中国药科大学 抑制FABP4靶基因表达的siRNA及其应用
CN113521251A (zh) * 2021-08-04 2021-10-22 宁夏医科大学 Fabp4在制备改善动脉粥样硬化的药物中的应用

Similar Documents

Publication Publication Date Title
Kadiyala et al. High-density lipoprotein-mimicking nanodiscs for chemo-immunotherapy against glioblastoma multiforme
Song et al. Development of a multi-target peptide for potentiating chemotherapy by modulating tumor microenvironment
Cheng et al. A targeting nanotherapy for abdominal aortic aneurysms
Du et al. Epidermal growth factor receptor-targeting peptide nanoparticles simultaneously deliver gemcitabine and olaparib to treat pancreatic cancer with breast cancer 2 (BRCA2) mutation
Xie et al. PEGylated carboxymethyl chitosan/calcium phosphate hybrid anionic nanoparticles mediated hTERT siRNA delivery for anticancer therapy
Dong et al. Self-assembly of amphiphilic phospholipid peptide dendrimer-based nanovectors for effective delivery of siRNA therapeutics in prostate cancer therapy
Maussang et al. Glutathione conjugation dose-dependently increases brain-specific liposomal drug delivery in vitro and in vivo
Wu et al. An apoptotic body-biomimic liposome in situ upregulates anti-inflammatory macrophages for stabilization of atherosclerotic plaques
Zhang et al. Cyclopamine disrupts tumor extracellular matrix and improves the distribution and efficacy of nanotherapeutics in pancreatic cancer
Dasa et al. Development of target-specific liposomes for delivering small molecule drugs after reperfused myocardial infarction
Serpooshan et al. [Pyr1]-Apelin-13 delivery via nano-liposomal encapsulation attenuates pressure overload-induced cardiac dysfunction
Teng et al. Intracellular codelivery of anti-inflammatory drug and anti-miR 155 to treat inflammatory disease
Guan et al. iRGD‐liposomes enhance tumor delivery and therapeutic efficacy of antisense oligonucleotide drugs against primary prostate cancer and bone metastasis
Wang et al. Simultaneously overcome tumor vascular endothelium and extracellular matrix barriers via a non-destructive size-controlled nanomedicine
Segura-Ibarra et al. Rapamycin nanoparticles localize in diseased lung vasculature and prevent pulmonary arterial hypertension
Xue et al. Cellular vehicles based on neutrophils enable targeting of atherosclerosis
Harisa et al. Erythrocyte nanovesicles: Biogenesis, biological roles and therapeutic approach: Erythrocyte nanovesicles
Mocanu et al. P-selectin targeted RAGE-shRNA lipoplexes alleviate atherosclerosis-associated inflammation
Zhao et al. Tumor cellular membrane camouflaged liposomes as a non-invasive vehicle for genes: specific targeting toward homologous gliomas and traversing the blood–brain barrier
Liu et al. Pulmonary circulation-mediated heart targeting for the prevention of heart failure by inhalation of intrinsically bioactive nanoparticles
Wang et al. DOX-loaded peptide dendritic copolymer nanoparticles for combating multidrug resistance by regulating the lysosomal pathway of apoptosis in breast cancer cells
Zhaorigetu et al. Delivery of negatively charged liposomes into the atherosclerotic plaque of apolipoprotein E-deficient mouse aortic tissue
Sigalov Nature‐inspired nanoformulations for contrast‐enhanced in vivo MR imaging of macrophages
Bochicchio et al. In vitro and ex vivo delivery of tailored siRNA-nanoliposomes for E2F1 silencing as a potential therapy for colorectal cancer
Yu et al. Nanoparticles targeting extra domain B of fibronectin-specific to the atherosclerotic lesion types III, IV, and V-enhance plaque detection and cargo delivery

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14826066

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14826066

Country of ref document: EP

Kind code of ref document: A1