WO2015008320A1

WO2015008320A1 - Gene spatial distribution analysis system for cell tissue

Info

Publication number: WO2015008320A1
Application number: PCT/JP2013/069239
Authority: WO
Inventors: 智晴梶山; 徹土生; 神原　秀記
Original assignee: 株式会社日立製作所
Priority date: 2013-07-16
Filing date: 2013-07-16
Publication date: 2015-01-22

Abstract

In the sampling and genetic analysis of plant cell tissue, an "excision" stimulus, which is a significant physical stimulus on solid matter during sampling, is applied and intracellular gene destruction begins to occur from that instant. Therefore, to analyze the spatial distribution of gene expression, the present invention provides a method for sampling and collecting multiple tissue sections rapidly. The present invention relates to a sampling device for sampling sections from multiple points of cell tissue, wherein: the sampling device comprises multiple needles; the sampling device is configured so that the needles can be rapidly changed between a sampling position and a discharging position; and the distances between the multiple needles at the sampling position are greater than the distances between the multiple needles at the discharging position.

Description

Gene spatial distribution analysis system for cellular tissue

The present invention relates to an apparatus and system for simultaneously collecting a plurality of tissue sections from cellular tissues such as plant parts and animal organs. The present invention also relates to a gene analysis method for collected tissue sections, and more particularly to an apparatus for analyzing nucleic acids derived from plant tissues having cell walls and vacuoles.

A technique has been reported in which a minute part of a plant tissue is collected using a needle or the like and a substance such as a gene or protein expressed in the collected material is analyzed (Non-patent Documents 1 and 3). In this technique, microscopic sections are separated and collected under microscopic observation by using a needle or a chip that vibrates with a piezo element for plant tissue sliced using a microtome. In this technique, cDNA is synthesized by reverse transcription for genes in the collected sections.

Also, as a cDNA cloning technique for an expressed gene in plant tissue, a cDNA synthesis technique using a poly (T) probe immobilized on beads as a template is disclosed (Non-patent Document 2). This technique discloses that cDNA is synthesized on beads using a sample ground at a liquid nitrogen temperature.

In an example using animal cells, as a quantitative PCR analysis technique using cDNA on beads, a cDNA library using a gene obtained from cells as a template is synthesized on a microcarrier such as magnetic beads, and the cDNA library is synthesized. A gene analysis method has been developed in which quantitative PCR for the first gene is performed, and then washed and the cDNA library is repeatedly used for quantitative analysis for the second and third genes. This technique enables quantitative analysis of multiple types of genes per cell (Non-Patent Document 4).

The present inventors examined a study of capturing the response of plants to the environment as a change in gene expression. Specifically, we examined how gene expression differs depending on differences in plant solids and spatial location when external stimuli were applied to plants. In particular, by performing a multipoint analysis on the gene expression state at regular intervals, it becomes possible to analyze the spatial distribution of gene expression at a site, and to analyze gene responses between tissues. In order to realize this analysis, it is necessary to extract a plurality of tissue sections at a certain interval from a region of interest in the tissue and extract a gene.

However, in the collection and genetic analysis of plant tissues, it was confirmed that a gene excision in the cell occurred from the moment when a “resection” stimulus, which is a large physical stimulus, was given to the tissue at the time of collection. This is considered to be because gene-degrading enzymes that are abundantly stored mainly in vacuoles in plant cells infiltrate into cells due to “resection” stimulation. In the prior art, in order to avoid the influence of this infiltration, a method of freezing the tissue to be collected in advance to a liquid nitrogen temperature is employed, but it is difficult to collect a microsection from a completely frozen state, Since gene degradation occurs when freezing and thawing occurs during collection, low gene recovery is a major issue. In addition, a method for collecting genes by collecting a plurality of microsections in a certain range has not been known. In particular, since the interval between sections that can be collected is a spatial resolution of gene distribution, it is necessary to collect at intervals as narrow as possible. The prior art does not disclose a technique that addresses these issues.

In addition, the collected tissue sections are collected in individual containers, and gene collection work is performed independently. As this container, it is effective to use tubes or microplates arranged at regular intervals, but in order to increase the gene recovery rate from the collected tissue section, it is quickly transferred to the container after collection. , It is necessary to suppress the gene degradation. Since the arrangement interval of these containers is generally larger than the interval when the sections are collected, it is necessary to change the interval. The prior art does not disclose such collection means or a method for collecting in a container.

The present inventors solved the above problems by the following method.

The tissue section collecting apparatus of the present invention has a plurality of needles for collecting microsections of tissue, achieves a state in which the needles are close to each other at the time of collecting a section from the tissue, and at the time of collecting (discharging) the collected section In addition, it has a configuration that can be quickly changed to a container interval of a tube or a microplate as a collection container. Furthermore, the present inventors have found that a change in position of a plurality of needles can be quickly performed by switching the position by rotating one part.

That is, the present invention includes the following.

[1] A collection device for collecting sections from a plurality of points of cellular tissue,
Having a plurality of needles,
It is configured so that the needle can be quickly changed between the collection position and the discharge position.
The distance between the plurality of needles at the collection position is wider than the distance between the plurality of needles at the discharge position,
The collection device.

[2] A plurality of needles are coupled to the arm,
The arm is attached to the case,
The case includes a main body and a slide portion around the main body,
The slide part is attached to the main body so that it can rotate.
The collection device according to [1], wherein the change of the collection position and the discharge position of the plurality of needles can be switched by rotation of the slide portion with respect to the main body in the case.

[3] The sampling apparatus according to [2], wherein at the sampling position, nine needles are arranged in a square lattice pattern, and include one central needle present at the center and eight peripheral needles present at the periphery. .

[4] The sampling device according to [3], wherein nine needles are arranged in a square lattice shape or a rectangular lattice shape at the discharge position.

[5] The collection device according to [3] or [4], wherein the center of rotation of the slide portion with respect to the main body in the case coincides with the position of the center needle.

[6] The eight arms coupled to the eight peripheral needles are respectively attached to the case at at least two positions of the main body and the slide portion, and the arm is attached to the main body by the rotation of the slide portion relative to the main body. The sampling device according to [5], wherein the sampling device is configured to rotate around the center.

[7] The peripheral needle arranged at the corner at the collection position is arranged at the center of the side at the discharge position, and the peripheral needle arranged at the center of the side at the collection position is arranged at the corner at the discharge position. [4 ] To [6].

[8] The attachment part to the body of the arm coupled to the peripheral needle disposed at the corner at the collection position is more than the attachment part to the body of the arm coupled to the peripheral needle disposed at the center of the side at the collection position. The collection device according to [7], which is close to the central needle.

[9] The collection device according to any one of [1] to [8], wherein the needle has a syringe structure.

[10] The collection device according to any one of [1] to [9], wherein the needle has a square needle tip having four vertices.

[11] The collection device according to any one of [1] to [10], wherein the needle has an outer diameter of 0.26 mm or less and an inner diameter of 0.13 mm or less.

[12] The device according to any one of [1] to [11], wherein the cell tissue is a plant cell tissue.

[13] A system for collecting sections from a plurality of points of cellular tissue,
The collection device according to any one of [1] to [12];
Means for inserting the first gel layer into the needle;
A second gel layer for placing cellular tissue;
A mechanism for moving the needle with the second gel layer so as to penetrate the tissue.

[14] An apparatus for analyzing nucleic acids derived from a plurality of points in a cell tissue,
The collection device according to any one of [1] to [12] or the collection system according to [13];
Means for disrupting the cells;
Means for separating nucleic acids;
Means for analyzing nucleic acids;
Including the analysis device.

[15] The analyzer according to [14], wherein the means for crushing cells is a pestle.

The present invention makes it possible to simultaneously and rapidly collect a plurality of tissue sections of cellular tissue, and to analyze the spatial distribution characteristics of gene expression.

It is a figure explaining one Embodiment of the collection device of this invention. It is a figure explaining one Embodiment of a needle and an arm. It is a figure explaining one Embodiment of the collection position of a needle. It is a figure explaining one Embodiment of the discharge position of a needle. It is a figure explaining one Embodiment of the mechanism of the change of the collection position and discharge position of a needle. It is explanatory drawing of one Embodiment of the procedure of a cell-tissue section collection using the collection apparatus of this invention. It is explanatory drawing of one Embodiment of the procedure of a cell-tissue section collection using the collection apparatus of this invention. It is a photograph which shows the microscopic image of the cell-tissue section actually extract | collected with the collection device of this invention. The amount of each gene at nine points collected from a cell tissue section by the collection device of the present invention is illustrated.

The present inventors have developed the following method for collecting a section of plant tissue. The collection device and system of the present invention are particularly preferably used for carrying out the collection method.

In order to select a part of the plant tissue arbitrarily and collect it quickly, the plant tissue was collected with a collection needle. Specifically, we developed a tissue collection needle using 27G or 31G tubules, and developed a method to collect sections from multiple sites of the same individual. In addition, in order to quickly preserve the gene expression state, as a method for quickly reducing the collected section to below freezing temperature, a solution containing pure water or a gene degrading enzyme inhibitor is prepared as a droplet, The harvested section was transferred and the droplet was cooled to liquid nitrogen temperature. Here, in order to reliably transfer the microsection from the needle to the droplet, it has been found that it is preferable to give the needle a syringe structure and push the tissue in the needle with a plunger. At this time, tissue damage occurs due to contact with the needle. Therefore, as a means for preventing this damage, it was necessary to protect the collected section with a gel layer of gel or polymer in advance. In the case of performing gene fixation or cDNA synthesis (reverse transcription reaction), the gel layer such as gel or polymer needs to be a substance that does not inhibit such reaction. These gel layers protected tissue, transferred sections quickly into droplets, and cooled at liquid nitrogen temperature to achieve excision to cooling within 1 minute.

It was effective to completely destroy the cells in the tissue by making the droplet containing the tissue of the microsection below the freezing point. When physical force was applied with a pestle or the like in a state of freezing below freezing, all cell tissues were completely crushed and the cytoplasm could be extracted outside the cell wall. However, for the purpose of preventing gene adhesion to the pestle surface and reducing the gene recovery rate, (i) In order to reduce gene adhesion to crushing tools such as pestle, a hydrophilic polymer is coated on the tube surface in advance. (ii) A technique that allows the whole pestle to be centrifuged while the pestle remains in the tube in order to separate and recollect the crushed adhering material. (iii) Minimizing the reaction volume in the cDNA synthesis process after crushing. went.

The above method is a method of collecting a section of plant tissue,
Insert the first gel layer into the needle,
Place the plant tissue on the second gel layer,
A method for collecting a plant tissue section, comprising the step of passing the needle through the plant tissue together with a second gel layer and collecting a section of the plant tissue with the needle.

Therefore, the cell tissue to be sliced in the present invention is preferably a plant cell tissue, but the harvesting device of the present invention can also be used for sectioning from animal cell tissue. The “plant” in the plant cell tissue means any organism classified as a plant, specifically, an organism having a cell wall and performing photosynthesis. More specifically, seed plants, fern plants, moss plants, multicellular algae and the like are included. The plant cell tissue may be any tissue collected from such a plant, and may be a tissue obtained from organs such as roots, leaves, stems, vascular systems, buds, flowers, and seeds. The obtained plant tissue may be used as it is, or may be pretreated (washing, cutting, etc.). The “section” to be collected refers to a small piece of plant tissue, and is preferably as small as possible, for example, one piece is 0.5 mm or less. Moreover, as a specific example of animal cell tissue, application to human cells such as a thin section of a pathological sample or a cultured cell sheet is possible.

The sampling device of the present invention has a plurality of needles. The plurality of needles are configured so that they can be quickly changed at the collection position and the discharge position. The distance between the plurality of needles at the collection position is wider than the distance between the plurality of needles at the discharge position. That is, by collecting sections from cellular tissue at the narrowest possible interval at the needle collection position and then changing to the discharge position, a container for performing gene recovery work after collecting the sections, for example, at certain intervals The section can be rapidly discharged into the arranged tube or microplate, for example, within 1 minute. Therefore, the collection position of the needle refers to the position of the needle when a section is collected from the cell tissue, and the discharge position refers to the position of the needle when the section collected by the needle is discharged to another container or the like. .

The change of the needle collection position and the discharge position is preferably performed by an arm coupled to a plurality of needles. The plurality of needles may be coupled to one arm, or the plurality of needles may be coupled to the plurality of arms. The sampling device of the present invention preferably further has a case, and a plurality of arms respectively coupled to a plurality of needles are attached to the case. The case preferably includes a main body and a slide portion around the main body, and the slide portion is rotatably attached to the main body. It is preferable from the viewpoint of quick position change that the change of the collection position and the discharge position of the plurality of needles can be switched by rotation of the slide portion with respect to the main body in the case.

In another embodiment, an arm coupled with a plurality of needles may have a structure that can be expanded and contracted, and the arm may be configured to expand and contract to change the needle collection position and the discharge position. Examples of the expandable structure include a bellows structure, and a plurality of needles are coupled to the bellows structure arm, and the sampling position and the discharge position may be changed by expanding and contracting the bellows structure. . Alternatively, a plurality of needles arranged in a vertical row are surrounded by a vertical guide member, and are configured to be movable only in the vertical direction inside the vertical guide member, and the plurality of needles arranged in a horizontal row are horizontal guide members And may be configured to be movable only in the lateral direction within the laterally long guide member. There are a plurality of sets of vertically long guide members and a single vertical row of needles disposed therein, and there are also a plurality of sets of horizontal long guide members and a single horizontal row of needles disposed therein. The distance in the lateral direction of the plurality of needles can be changed by moving the plurality of vertically long guide members closer to or away from each other in the lateral direction. At the same time, the lateral distances of the plurality of needles can be changed by moving the plurality of horizontally long guide members closer to or away from each other in the longitudinal direction. That is, by moving the vertically long guide member and the horizontally long guide member, the needle collection position and the discharge position can be changed, and the interval between the needles can be narrowed or widened.

The needle (collecting needle) is not particularly limited as long as it has strength and size suitable for collecting a section from a cell tissue, preferably a plant cell tissue. For example, a commercially available injection needle made of stainless steel can be used after being processed if necessary. Preferred sizes are those of 27G and 31G gauges, and small sections can be taken with small sizes. For example, when a 27G injection needle is used, it has an outer diameter of 0.4 mm, an inner diameter of 0.2 mm, and a tube wall thickness of 0.1 mm, and a section of about 26 cells / layer can be collected. For example, when a 31G injection needle is used, it has an outer diameter of 0.26 mm, an inner diameter of 0.13 mm, and a tube thickness of 0.06 mm, and a section of about 11 cells / layer can be collected. However, the use of narrower tubes than the above is not disturbed. At present, it has been reported that thin tubes made of stainless steel have an outer diameter of 80 μm and a wall thickness of about 25 μm.

The shape of the needle tip of the needle is not particularly limited, and may be, for example, a round shape, an oval shape, a square shape, a diamond shape, or the like, but preferably has a quadrangular needle tip having four vertices. Thereby, the dispersion | variation in the quantity of the plant tissue extract | collected can be suppressed. Further, the needle at the tip having four vertices has an effect of suppressing variation in the amount of collected tissue not only in plant tissue but also in collecting a section from animal tissue. In particular, it can be utilized when recovering a section from a partial microregion such as a pathological section prepared by freezing or formalin fixation.

The needle preferably further has a syringe structure. For example, it can be performed by inserting a thin tube (hollow thin tube) into the needle and using it as a plunger (presser) for discharging the slice. Thereby, it is possible to discharge the plant tissue section collected in the needle easily and without damage. Further, the needle may be connected to the plunger by a mounting tool such as a luer lock, or may be held by a mechanical pencil in the holder.

The needle may be treated with a nucleolytic enzyme inhibitor (eg, an RNAse inhibitor) before use, thereby preventing the nucleic acid in the plant tissue section from being degraded. Moreover, you may process with a hydrophilic polymer before use, and it becomes easy to hold | maintain a gel layer and a plant tissue section in a needle by this.

The sampling device of the present invention preferably has nine needles. The nine needles are arranged in a square lattice at the sampling position, preferably in a close-packed square lattice. In other words, the plurality of needles are close to a state where they are in contact with each other at the sampling position. The nine needles arranged in a square lattice at the sampling position are composed of one central needle at the center and eight peripheral needles at the periphery.

For example, when nine needles having an outer diameter of 0.26 mm are arranged in a close-packed square lattice, the interval between the center lines of the needles is in the direction of the sides of the lattice (for example, the centers of the peripheral needle 305 and the peripheral needle 308 in FIG. Line distance) is 0.26 mm, and in the diagonal direction (for example, the distance between the center lines of the peripheral needle 305 and the central needle 301 in FIG. 3) is √0.1352 mm. The nine needles at the discharge position are preferably arranged in a square lattice shape or a rectangular lattice shape. The arrangement of the square lattice or the rectangular lattice at the discharge position is wider than the arrangement at the collection position. For example, the distance between the needles at the collection position and the discharge position is 10 to 25 times. When nine needles having an outer diameter of 0.26 mm are arranged in a square lattice at the discharge position, for example, the interval between the center lines of the needles is the direction of the sides of the lattice (for example, the distance between the center lines of the

needles

301 and 302 in FIG. 4). ) And 6 mm, and √72 mm in the diagonal direction (for example, the distance between the center lines of

needles

301 and 308 in FIG. 4).

Since the rotation center of the slide portion with respect to the main body in the case coincides with the position of the central needle, when the slide portion is rotated with respect to the main body, the central needle does not move, and only the peripheral needle moves. . Therefore, the center needle may be fixed to the case.

The eight arms coupled to the eight peripheral needles are preferably attached to the case at at least two positions of the main body and the slide portion, respectively, and the arm is attached to the main body by the rotation of the slide portion with respect to the main body. It is configured to rotate around the center. In that case, when the slide part is rotated with respect to the main body, the peripheral needle arranged at the corner at the collection position is arranged at the center of the side at the discharge position, and the peripheral needle arranged at the center of the side at the collection position is It is arranged at the corner at the discharge position. The attachment to the body of the arm connected to the peripheral needle arranged at the corner at the collection position is more central to the needle than the attachment to the body of the arm connected to the peripheral needle located in the center of the side at the collection position. Close position, inside concentric circles.

The invention also relates to a system for collecting sections from multiple points of cellular tissue. The collection system of the present invention comprises:
The above collection device;
Means for inserting the first gel layer into the needle;
A second gel layer for placing cellular tissue;
And a mechanism for moving the needle so as to penetrate the tissue together with the second gel layer.

In order to insert the first gel layer into the needle, for example, an arbitrary method such as a method of penetrating the needle one or more times through the gel sheet, a method of putting the solution into the needle and gelling the solution can be adopted. . That is, the means for inserting the first gel layer into the needle can be a mechanism for moving the collection needle so as to penetrate the gel sheet. Or it is good also as a means which inject | pours the solution which can be gelatinized into a needle and can gelatinize the solution.

The arrangement of the cellular tissue in the second gel layer is not particularly limited, and may be performed by placing the cellular tissue on a gel sheet or by placing the cellular tissue in a container containing the solution and gelling the solution. it can. A gel layer may be further disposed on the cell tissue. In that case, the first gel layer may or may not be inserted into the needle in advance.

Subsequently, the needle is passed through the cell tissue together with the second gel layer, and a section of the cell tissue is collected by the needle. As a result, a tissue section is collected in the needle while being sandwiched between the first gel layer and the second gel layer. The needle penetration is preferably performed as perpendicular to the cell tissue and the second gel layer as possible. In this way, tissue sections can be collected quickly, preferably within 5 minutes, and the resulting tissue sections are also small, protecting the tissue.

¡Tissue sections collected by the needle are transferred into the droplet as quickly as possible and frozen. For example, the time until the tissue section is transferred into a droplet and frozen is within 3 minutes, preferably within 1 minute. Thereby, it is possible to fix a gene expression state that is less affected by physical stimulation at the time of collection.

Droplets are prepared with pure water, physiological saline, phosphate buffered saline (PBS), TE buffer, and a solution obtained by adding a nucleolytic enzyme inhibitor (for example, RNAse inhibitor) to these solvents. Especially for nuclease inhibitor addition solutions, reagents based on ammonium sulfate (representative product name: RNALater (Ambion® Inc.)) and guanidine-based storage and extraction reagents (representative products: RLT buffer and RLC buffer) (QIAGEN)) is available.

The size of the droplet varies depending on the size of the collected slice, but is preferably 1 μL or less, for example, 0.5 μL. In particular, when a solution to which a nucleolytic enzyme inhibitor is added is used as a droplet, the size of the droplet should be minimized as its components may inhibit cDNA synthesis. Such a droplet is prepared, for example, in a tube, and a tissue section is transferred there. The tube for preparing the droplets can be any type and size of tube known in the art. For example, when performing gene expression analysis, a PCR tube can be employed. It is preferable that the tube is made of a material that can easily hold the contents of the droplet or tissue section (such as nucleic acid), or has been treated so as to be easily held. For example, the tube can be made of a hydrophilic material (for example, a hydrophilic polymer), or the surface of the tube can be subjected to hydrophilic treatment (for example, coating with a hydrophilic polymer, UV ozone treatment method, etc.).

After transferring the tissue section to the droplet, freeze the droplet. Freezing can be performed by methods known in the art. For example, a method using liquid nitrogen and a freezer are generally used. By freezing, the gene expression status in the tissue section can be preserved, and cell disruption described later is facilitated.

Next, a method for separating nucleic acids from tissue sections collected as described above will be described. First, the cells of the tissue section collected by the method of the present invention are crushed. The disruption of cells can be performed by any method known in the art, and physical disruption such as homogenization using pestle, glass beads, or ultrasonic treatment can be used.

When disrupting cells using a pestle, in a preferred embodiment, the pestle has a shape that can be homogenized in a tube and then integrated with the tube for centrifugation. More preferably, the pestle has a shape that can be subjected to centrifugation with its tip fully inserted into the tube. For example, the pestle and the tube can be integrated by using a cap that can fix the pestle to the tube. Alternatively, the pestle and the tube can be integrated by using a stopper that is integrated with the tube and is positioned in the center of the tube without shaking in the horizontal direction. By centrifuging using a pestle with such a shape, the contents can be recovered with high efficiency even when the contents (such as nucleic acids) of a tissue section adhere to the surface of the pestle, and rapid operation is possible. It becomes possible.

In addition, it is preferable that the pestle is made of a material that does not attach nucleic acid or the like of the tissue section or is treated so that nucleic acid or the like does not adhere. For example, when the pestle is made of a water-repellent material (eg, polyetheretherketone (PEEK), polyvinylidene chloride, etc.), the surface of the pestle is subjected to hydrophilic treatment (eg, coating with a hydrophilic polymer, UV ozone treatment method, etc.) )It can be performed. Thereby, adhesion of nucleic acid or the like of the tissue section to the pestle surface can be prevented, and the recovery rate of the nucleic acid of the tissue section can be further increased.

After the cells are disrupted, the nucleic acid derived from the tissue section is separated. Examples of the nucleic acid to be separated include genomic DNA, messenger RNA (mRNA), non-coding RNA (ncRNA), microRNA, and fragments thereof. Nucleic acid separation can be performed using methods known in the art depending on the type of nucleic acid to be separated. For example, nucleic acids contained in cells, ie, DNA and RNA, using proteolytic enzymes such as Proteinase K, chaotropic salts such as guanidine thiocyanate and guanidine hydrochloride, surfactants such as Tween and SDS, or commercially available reagents for cell lysis Can be eluted. Genomic DNA may be fragmented by physical cleavage or restriction enzyme cleavage. In the case of separating RNA (mRNA or the like), among the nucleic acids eluted as described above, DNA is degraded by a DNA degrading enzyme (DNase), and a sample containing only RNA as a nucleic acid is obtained. When cDNA is prepared, cDNA is synthesized from a sample containing only RNA by capturing only mRNA using a DNA probe containing a poly-T sequence and then performing reverse transcription using reverse transcriptase from the mRNA. be able to.

By immobilizing a nucleic acid (for example, genomic DNA, mRNA, etc.) isolated from a tissue as described above or a nucleic acid (for example, cDNA) having the same or complementary sequence as the nucleic acid on a solid phase carrier, A library can be created. Moreover, tissue-derived nucleic acids can be analyzed by analyzing nucleic acids separated from tissues as described above (or nucleic acids immobilized on solid phase carriers). Such nucleic acid library preparation methods and nucleic acid analysis methods are well known in the art. For example, a tissue-derived cDNA library can be prepared on beads as a solid phase carrier, and nucleic acids (genes) expressed in the tissue can be repeatedly analyzed. Specifically, sections are collected from multiple points (multiple locations) of cell tissue, nucleic acids are separated from each section, a cDNA library corresponding to the nucleic acid derived from each section is prepared, and the nucleic acid is quantitatively PCR It is possible to analyze the expression status of one or more genes at a plurality of locations in the cell tissue. Thus, according to the present invention, nucleic acids derived from cell tissues can be used quickly and efficiently.

Further, the collection system of the present invention includes information input means (camera, observation stage, monitor, etc.) for determining the section collection location on the cell tissue, needle position determination means, needle movement / position adjustment means, needle position A cleaning means or the like may be provided.

Hereinafter, specific examples of embodiments of the present invention will be described with reference to the drawings. However, it should be noted that these examples are merely examples for realizing the present invention and do not limit the present invention.

The tissue section collecting apparatus of the present embodiment has a plurality of needles for collecting microsections of the tissue, achieves a state in which the needles are close to each other when collecting the sections from the tissue, and when collecting the collected sections, A collection needle head that can be quickly changed to the collection container tube or the microplate container interval is used. In particular, as the interval between the collection containers, industry standard standards for microplates such as 9 mm intervals and 4.5 mm intervals are used.

FIG. 1 is a bird's-eye view of a collection needle head in which nine needles for cell tissue section collection are arranged in 3 × 3. The sampling needle defines one central needle as the central needle 101 and eight peripheral needles as the peripheral needle 102. As the needle, 31G was used. The 31G needle has an outer diameter of 0.26mm, an inner diameter of 0.13mm, and a tube wall thickness of 0.06mm.

The shape of the needle tip of the needle is not particularly limited, and may be, for example, a round shape, an oval shape, a square shape, a rhombus shape, or the like, but preferably has a quadrangular needle tip having four vertices. Thereby, the dispersion | variation in the quantity of the extract | collected tissue can be suppressed. Each needle further has a syringe structure. For example, a thin tube 103 made of tungsten can be inserted into a needle and used as a plunger (presser) for discharging a slice. As a result, the tissue section collected in the needle can be discharged easily and without damage. Each needle is coupled to an arm. The central needle arm is 104. Although only one arm of the peripheral needle is described because the illustration is complicated (105), all are connected one by one. Each arm is connected to a case 106 arranged to wrap a bundle of needles. The case 106 is shown only half a circle. The case has a slide portion 107. The central needle arm 104 is coupled to and integrated with the case. The other needle is movably connected to the case via the arm. FIG. 2 is an example of a peripheral needle and arm. The arm 201 is coupled to the needle 202 by a portion 203. As a bonding method, adhesion or the like can be used. For convenience, the needle can be wrapped with resin or tape and fixed to the arm. The arm has a hole 204 for a movable center and a hole 205 for slide movement.

FIG. 3 is a schematic view of the needle head as seen from above. Consists of a central needle 301, a central needle arm (not shown) connected to the case, eight peripheral needles 302 to 309, eight arms 312 to 319 integrated therewith, and a case Is done. The case includes a main body 310 and a slide portion 311 that can move in a circumferential shape. Each of the eight peripheral needle arms has a center point at eight central pins 320 in the case main body, and the movable pin 321 of the case slide portion is configured to fit in the slide movable hole. For this reason, when the slide part of the case is moved in a circumferential shape, the arm moves with the center point as a fulcrum, and as a result, the needle can be repositioned. FIG. 4 shows a state where the slide portion is moved and the needle position is changed. The nine needles are arranged in a square grid with a pitch of 9 mm, for example.

In the head of this embodiment, both needles are arranged in a square lattice in the gathering state of the needles, that is, the collection position (FIG. 3) and the diffusion state, that is, the discharge position (FIG. 4). It is a feature that can be achieved only by sliding the slide portion. FIG. 5 illustrates a specific structure. A description will be given by taking two pairs of needles and arms as an example. First, the needle position 501 and the position 502 indicate the needle position when the needle 302 in FIG. 3 is gathered (collection position) and enlarged (discharge position), respectively. A line segment 503 is a line segment connecting the position 501 and the position 502, and a broken line 504 is a perpendicular bisector of the line segment 503. It can be seen that the center point 505 is on this perpendicular bisector. An arm 506 and an arm 507 indicate arm positions at the time of gathering (collection position) and at the time of enlargement (discharge position), respectively. An arc 508 indicates the range of movement of the movable pin when the arm is movable. The arc 508 is on the dashed circle 509, the center of which is the same as the center of the case and the position of the center needle. That is, the center of the case slide portion coincides with the center of the center needle, and the center angle of the arc 508 indicates the slide amount (rotation amount) of the slide portion. In this manner, as with the needle 302, regarding the needles 302 to 305 having a 3 × 3 arrangement at the time of assembly, the movable center points of the arms to which they are coupled are all located on the circle of the broken line 510.

Similarly, the needle position 511 and the position 512 indicate the needle position when the needle 308 of FIG. 3 is assembled (collection position) and enlarged (discharge position), respectively. A line segment 513 is a line segment connecting the position 501 and the position 502, and a broken line 514 is a perpendicular bisector of the line segment 513. It can be seen that the center point 515 is on this vertical bisector. An arc 516 indicates a moving range of the movable pin when the arm is moved, that is, a slide amount (rotation amount). In this way, as with the needle 308, regarding the needles 306 to 309 that are located at the center of the side of the 3 × 3 arrangement at the time of assembly, all the movable center points of the arms to which they are coupled are on the circle of the broken line 517. To position.

８Eight peripheral needles are divided into two groups according to their moving distance. The needles 302 to 305 are corners at the time of gathering (collection position), and the center of the side at the time of enlargement (discharge position), and the movement distance is small. On the other hand, the needles 306 to 309 are at the center of the side at the time of gathering (collection position) and are corners at the time of enlargement (discharge position), and the movement distance is large. Since the length and center angle of the arc, which is the range of movement of the slide part, must be the same for the eight peripheral needles, the position of the center pin of the arm coupled to the needles 302 to 305 having a small moving distance is the moving distance. It is arranged inside the concentric circle from the position of the center pin of the arm coupled to the needles 306 to 309 having a large diameter. By appropriately adjusting this position, two types of movements can be performed simultaneously at the same slide movement angle (rotation angle). In other words, if the arc 508 and the arc 516 are the same amount, the movement of both types of needles can be controlled simultaneously by sliding the slide portion, and a square lattice arrangement can be achieved at the time of assembly and expansion.

Next, how to use this sampling needle head will be described. For simplicity, only three needles are illustrated and described with reference to FIG. Reference numerals 601 to 603 denote three needles, and reference numerals 604 to 606 denote flangers. First, as shown in FIG. 6A, when the needles are arranged in an assembled state (collecting position) and the needles are inserted into the gel sheet 607, a gel layer 608 can be formed in each needle as shown in FIG. 6B. However, this gel layer may be formed in advance with another polymer or the like.

Next, the tissue is collected. As shown in FIG. 7A, the tissue 701 to be collected is placed on the gel sheet 702. In that state, the assembled needle is pierced into the tissue and the underlying gel sheet. As a result, the tissue layer and the lower gel layer are inserted into the three needles under the previous gel layer. Thereafter, when the needle is gently pulled up, a sample is obtained in which the tissue sections at three adjacent points are collected in the shape of a gel / tissue / gel sandwich in the needle.

FIG. 8 is a microscopic image of a section actually collected. Collected using a 31G needle. (1) in FIG. 8 is a section taken from the shoot apex portion, and shoot apex cells and buds and vascular bundles at both ends can be observed. (2) in FIG. 8 is a section taken from the center of the cotyledon, and the cotyledon cell can be confirmed.

Next, the needle is changed to an expanded state (discharge position), and the sample is pushed out into droplets formed on the inner wall of the tube 703 arranged in advance at a constant interval, for example, 9 mm as shown in FIG. 7B. In this case, since the gel layer protects the slice, it can be transferred into the droplet without causing breakage of the slice. It is important to use droplets when transferring the sample to the tube. When the sample is attached to the inner wall of the tube without using a droplet, the sample to be handled is very small and cannot be observed with the naked eye, so that it is difficult to move reliably. By using the droplet, the tissue section pushed out by the capillary tip can be reliably moved into the droplet.

The size of the droplet varies depending on the size of the collected slice, but is preferably 1 μL or less, for example, 0.5 μL. In particular, when a solution to which a nucleolytic enzyme inhibitor is added is used as a droplet, the size of the droplet should be minimized as its components may inhibit cDNA synthesis. Such a droplet is prepared, for example, in a tube, and a plant tissue section is transferred thereto.

The tube for preparing the droplets can be any type and size of tube known in the art. For example, when performing gene expression analysis described later, a PCR tube can be employed. It is preferable that the tube is made of a material that can easily hold the contents of the droplets or plant tissue sections (such as nucleic acids) or has been treated so as to be easily held. For example, the tube can be made of a hydrophilic material (for example, a hydrophilic polymer), or the surface of the tube can be subjected to a hydrophilic treatment (for example, coating with a hydrophilic polymer, a UV ozone treatment method, or the like). Note that a microplate can be used instead of the tube.

Thereafter, the droplet is frozen with liquid nitrogen or the like. As a result, the genes in the tissue section are preserved. It is important to quickly perform from collection to ejection to droplets and freezing. After freezing, pestle is used to crush the whole ice droplet, and it is recovered with a centrifuge, and a cDNA library is synthesized on magnetic beads, so that the gene expression level can be analyzed.

Next, an example in which a tissue section was collected from a cotyledon and a gene expression analysis was performed on a seedling of Arabidopsis thaliana (wild-type Col strain) 4 days after seeding as a sample will be described below.

1. Prior preparation In the present Example, the tissue slice was extract | collected in the state pinched | interposed with the agarose gel. As advance preparations, the following was implemented.

(1) A 2% weight agarose gel was prepared with sterilized ultrapure water and dispensed into a petri dish so that a gel sheet having a thickness of about 2 mm was formed.

(2) The pestle was treated with an RNase inhibitor and dried, and then infiltrated with 0.1% Tween 20, 10 mM Tris-HCl (pH 8.0) and dried.

(3) About 0.5 μL of a buffer RLC droplet was formed on the wall of a 0.2 mL PCR tube and placed at room temperature.

(4) Liquid nitrogen was prepared.

2. Tissue section collection (1) A needle was attached to a collection device (needle holder), and a thin tube was inserted into the needle. With the needle placed at the collection position, the needle was inserted into the agarose gel sheet to form a gel layer in the needle.

(2) The plant to be collected was placed on the gel sheet, and a needle was inserted into the collection site. The plant and the lower gel sheet were penetrated simultaneously. As a result, a sandwich of a gel layer, a plant tissue layer, and a gel layer could be collected in the needle.

(3) Immediately, by sliding the slide part of the case, the needle is changed to the discharge position, the specimen in the sandwich state in the needle is pushed out by the syringe, and they are transferred to the droplet in the 0.2 mL tube. . The lid of the tube to which the sample was transferred was closed, and the tube was immediately immersed in liquid nitrogen to cool the droplet containing the sample.

3. Tissue disruption (1) The tube was taken out of liquid nitrogen, and the ice droplet containing the specimen was crushed with a pestle (about 5 seconds). 0.5 μL ice droplets can be easily crushed together with the internal specimen.

(2) A pestle cap was attached and the tube was centrifuged together with the pestle (about 10 seconds).

(3) The pestle was removed from the tube, the lid was closed, and it was immersed again in liquid nitrogen.

4). cDNA cloning The cDNA library is prepared using the method described in Japanese Patent Application Laid-Open No. 2007-319028 or Non-Patent Document 4. Specifically, it is as follows.

(1) First, a master mix having the following composition was prepared (amount per tube).

10 x DNase I Buffer 0.36 μl
DNase I 0.5 μl
PBS pH7.4 2.6 μl

The master mix was dispensed (3.46 μL after dispensing) and treated at room temperature for 5-10 minutes.

(2) 1.2 μL of EDTA (2.5 mM) was injected, treated at 70 ° C. for 5 minutes, and cooled on ice.

(3) The following reagents were added.

0.1% Tween20, 10 mM Tris-HCl (pH 8.0) 15.6 μl
10 mM dNTP Mix 1.0 μl
Oligo (dT) ₃₀ magnetic beads 1.0 μl

The oligo (dT) ₃₀ magnetic beads are obtained by immobilizing oligo (dT) ₃₀ on magnetic beads in advance. Subsequently, the mixture was reacted at 70 ° C. for 5 minutes and then cooled to 4 ° C.

(4) Reverse transcription was performed using the following reagents.

5 x RT Buffer 6.0μl
0.1M DTT 1.0μl
RNase OUT 1.0μl
Super Script III RT 1.0μl

The mixture was reacted at 50 ° C. for 50 minutes with stirring, treated at 85 ° C. for 1.5 minutes, and ice-cooled.

(5) RNase H was added at 1.0 μL, reacted at 37 ° C. for 30 minutes with stirring, and ice-cooled.

Through the above steps, a cDNA library was synthesized on the beads.

In this example, 31G was used as a sampling needle, and sampling was performed with a sampling interval of 0.3 mm. Nine sections were collected, and the expression levels of the vascular marker gene SUC2 (AT1G22710), the tissue marker KNAT2 (AT1G70510), and the control gene TUB2 (AT5G62690) were measured by quantitative PCR. The sequences of probes and amplification oligos used for quantitative PCR analysis are shown in Table 1.

FIG. 9 shows the amount of each gene at 9 points collected from a cell tissue section. The amount of each gene was normalized with the expression level of TUB2 as 100,000. Each gene amount of 3 × 3 points could be measured in about 1 mm square in the cotyledon.

[Table 1]

(1) TUB2
FW primer: CCAGTTGTAGTTTTTTTCTCTGCTT (SEQ ID NO: 1)
RV primer: GGCAATAACAAGATTAAGAACAAAAG (SEQ ID NO: 2)
MGB probe: CATCAACCAGATATGTCAAATA (SEQ ID NO: 3)

(2) KNAT2
FW primer: TCGATTGGTGGAATGTTCATAA (SEQ ID NO: 4)
RV primer: AGAGATATTTTGTCGCCTTCAGT (SEQ ID NO: 5)
MGB probe: AAATGGGCCTTACCC (SEQ ID NO: 6)

(3) SUC2
FW primer: CATTGTCGTCCCTCAGATGGT (SEQ ID NO: 7)
RV primer: ACCACCGAATAGTTCGTCGAAT (SEQ ID NO: 8)
MGB probe: CTGTGGGAGGTGGAC (SEQ ID NO: 9)

101: Center needle
102: Peripheral needle
103: Capillary tube
104: Arm
105: Arm
106: Case
107: Slide part
201: Arm
202: Needle
203: Combined part
204: Hole
205: hole
301: Center needle
302-309: Peripheral needle
310: Body
311: Slide part
312-319: Arm
320: Center pin
321: Movable pin
501-502: Needle position
503: Line segment
504: Dashed line
505: Center point
506-507: Arm
508: Arc
509: Yen
510: Dashed line
511-512: Needle position
513: Line segment
514: Dashed line
515: Center point
516: Arc
517: Dashed line
601-603: Needle
604-606: Flanger
607: Gel sheet
608: Gel layer
701: Organization
702: Gel sheet
703: Tube

Claims

A collection device for collecting sections from multiple points of cellular tissue,
Having a plurality of needles,
It is configured so that the needle can be quickly changed between the collection position and the discharge position.
The distance between the plurality of needles at the collection position is wider than the distance between the plurality of needles at the discharge position,
The collection device.
A plurality of needles are connected to the arm,
The arm is attached to the case,
The case includes a main body and a slide portion around the main body,
The slide part is attached to the main body so that it can rotate.
The collection device according to claim 1, wherein the collection position and the discharge position of the plurality of needles can be switched by rotation of a slide portion with respect to a main body in the case.
The sampling device according to claim 2, wherein at the sampling position, nine needles are arranged in a square lattice pattern and are composed of one central needle existing in the center and eight peripheral needles existing in the periphery.
The sampling device according to claim 3, wherein nine needles are arranged in a square lattice shape or a rectangular lattice shape at the discharge position.
The sampling device according to claim 3 or 4, wherein the center of rotation of the slide portion with respect to the main body in the case coincides with the position of the central needle.
The eight arms connected to the eight peripheral needles are respectively attached to the case at at least two locations of the main body and the slide portion, and the arm is centered on the attachment portion to the main body by the rotation of the slide portion relative to the main body. 6. A sampling device according to claim 5, wherein the sampling device is configured to rotate.
The peripheral needle arranged at the corner at the collection position is arranged at the center of the side at the discharge position, and the peripheral needle arranged at the center of the side at the collection position is arranged at the corner at the discharge position. The collection device according to any one of the above.
The attachment part to the body of the arm connected to the peripheral needle arranged at the corner at the sampling position is closer to the central needle than the attachment part to the body of the arm connected to the peripheral needle arranged in the center of the side at the collection position. The collecting device according to claim 7, which is close.
The sampling device according to any one of claims 1 to 8, wherein the needle has a syringe structure.
The sampling device according to any one of claims 1 to 9, wherein the needle has a square needle tip having four vertices.
The sampling device according to any one of claims 1 to 10, wherein the needle has an outer diameter of 0.26 mm or less and an inner diameter of 0.13 mm or less.
The apparatus according to any one of claims 1 to 11, wherein the cell tissue is a plant cell tissue.
A system for collecting sections from multiple points of cellular tissue,
The collection device according to any one of claims 1 to 12,
Means for inserting the first gel layer into the needle;
A second gel layer for placing cellular tissue;
A mechanism for moving the needle with the second gel layer so as to penetrate the tissue.
An apparatus for analyzing nucleic acids derived from multiple points of cellular tissue,
The collection device according to any one of claims 1 to 12 or the collection system according to claim 13,
Means for disrupting the cells;
Means for separating nucleic acids;
Means for analyzing nucleic acids;
Including the analysis device.
The analysis device according to claim 14, wherein the means for crushing the cells is a pestle.