WO2015003150A2

WO2015003150A2 - Allele-specific pcr detection and discrimination of cyp2c194a, 4b and *17

Info

Publication number: WO2015003150A2
Application number: PCT/US2014/045447
Authority: WO
Inventors: Robert J. Desnick; Stuart A. SCOTT
Original assignee: Icahn School Of Medicine At Mount Sinai
Priority date: 2013-07-03
Filing date: 2014-07-03
Publication date: 2015-01-08
Also published as: WO2015003150A3

Abstract

The present invention relates to methods and compositions for identifying polymorphisms in the human CYP2C19 gene, and their use for determining treatments in a subject.

Description

ALLELE-SPECIFIC PCR DETECTION AND DISCRIMINATION OF

CYP2C19*4A. *4B AND *17

RELATED APPLICATIONS

This application claims the benefit of priority to U.S. provisional application serial number 61/842,743, filed July 3, 2013; the entire content of which is hereby incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

CYP2C19 is involved in the metabolism of clinically relevant drugs including, but not limited to, the antiplatelet prodrugs clopidogrel and prasugrel, proton-pump inhibitors, anti- epileptic drugs and anti-depressants, which has prompted interest in clinical CYP2C19 genotyping. The CYP2C19*4B allele is defined by both gain-of-function [c.-806C>T (*17)] and loss-of-function [c. lA>G (*4)] variants on the same haplotype; however, current genotyping assays are unable to determine the phase of these variants. Thus, an assay was developed that could rapidly detect and discriminate the related *4A, *4B, and *17 alleles.

SUMMARY OF THE INVENTION

The present invention relates to methods and compositions for identifying

polymorphisms in the human CYP2C19 gene. In particular, the methods and compositions of the present invention relate to identifying the phase of the single-nucleotide polymorphisms c.-806C>T (*17) and c. lA>G (*4) of the CYP2C19 gene in a subject. The present invention also relates to kits for identifying the phase of the single-nucleotide polymorphisms c- 806C>T (*77) and c. lA>G (*4) of the CYP2C19 gene in a subject. The present invention also relates to methods of treating a cardiovascular disease, a gastrointestinal disease, a mood disorder, or epilepsy in a subject, wherein the method of treatment is determined based on the CYP2C19 haplotype of the subject.

The present invention relates to nucleic acid molecules that can be double-stranded molecules. Reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. Reference to an adenosine, a thymidine (uridine), a cytidine, or a guanosine at a particular site of the sense strand of a nucleic acid molecule is also intended to include the thymidine (uridine), adenosine, guanosine, or cytidine (respectively) at the corresponding site on an anti-sense strand of a complementary strand of a nucleic acid molecule. Reference can be made to either strand, and the nucleic acid molecule still comprises the same polymorphic site, and an oligonucleotide can be designed to hybridize to either strand. The present invention also relates to double-stranded nucleic acid molecules that can be formed of two polynucleotide chains that are linked together by hydrogen bonds between complementary base pairs along their lengths, with the 3 ', 5'-phosphodiester bonds of the two chains running in opposite directions. A nucleic acid strand, unless circular, has polarity with one 5' end and one 3' end.

The invention further provides for nucleic acids that are complementary to a nucleic acid. Such complementary nucleic acids can comprise nucleic acid sequences, which hybridize to a nucleic acid sequence of the CYP2C19 gene locus, or an allele thereof.

In one aspect, the present invention provides a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C).

In another aspect, the present invention provides a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 3, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C).

In another aspect, the present invention provides a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 1 1, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 12, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In one embodiment, the purified nucleic acid is a synthetic oligonucleotide primer. Synthetic oligonucleotide primers can be synthesized and purified by a variety of methods such as, but not limited to chemical synthesis by phosphoramidite synthesis. These methods are known to a person of skill in the art. Synthetic oligonucleotide primers are available from commercial sources, for example, but not limited to, Integrated DNA Technologies.

Synthetic oligonucleotide primers are free of modifications that can be found in cellular nucleic acids, including, but not limited to, histones and methylation.

In another aspect, the present invention provides an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs:7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs:7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In one embodiment, the oligonucleotide primer pair, further comprises a primer having at least about 80% identity to SEQ ID NO: 3, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C); a primer having at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C); or a combination thereof.

In another aspect, the present invention provides an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

In another aspect, the present invention provides an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In one embodiment, the oligonucleotide primer pair, further comprises a primer having at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C); a primer having at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C); or a combination thereof.

In another aspect, the present invention provides a method for treating a

cardiovascular disease in a subject, the method comprising: (a) determining the CYP2C19 gene diplotype of the subject by PCR amplification using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof; (b) determining whether to administer an antiplatelet drug metabolized by CYP2C19 based on the diplotype of the subject; and (c) administering said anti-platelet drug metabolized by CYP2C19 or an alternative therapy to the subject.

In one embodiment, the method further comprises determining the dose of the antiplatelet drug metabolized by CYP2C19 to be administered based on the diplotype of the subject.

In one embodiment, the cardiovascular disease is acute coronary syndrome, acute coronary syndrome with percutaneous coronary intervention, peripheral vascular disease, cerebrovascular disease, symptomatic atherosclerosis, ST elevation myocardial infarction (STEMI), coronary thrombosis, recent myocardial infarction, recent stroke, or a combination thereof.

In one embodiment, the anti-platelet drug metabolized by CYP2C19 is clopidogrel, prasugrel, or a combination thereof.

In one embodiment, the administering step comprises giving a standard dose of an anti-platelet drug metabolized by CYP2C19 to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In another embodiment, the method further comprises monitoring the subject for bleeding complications if the CYP2C19 gene diplotype comprises

cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

In one embodiment, the administering step comprises giving an alternative therapy to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C),

cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene. In another embodiment, the alternative therapy is a P2Y12 inhibitor. In a further embodiment, the P2Y12 inhibitor is prasugrel, ticagrelor, or a combination thereof.

In one embodiment, the administering step comprises giving an increased dose of an anti-platelet drug metabolized by CYP2C19 to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or

guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene. In another aspect, the present invention provides a method for treating a

gastrointestinal disease in a subject, the method comprising: (a) determining the CYP2C19 gene diplotype of the subject by PCR amplification using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof; (b) determining a dose of a proton pump inhibitor to be administered based on the diplotype of the subject; and (c) administering said dose to the subject.

In one embodiment, the gastrointestinal disease is dyspepsia, peptic ulcer disease, gastroesophageal reflux disease (GERD), laryngopharyngeal reflux, Barrett's esophagus, stress gastritis prevention, gastrinomas, Zollinger-Ellison syndrome, erosive esophagitis, or a combination thereof.

In one embodiment, the proton pump inhibitor is selected from the group consisting of lansoprazole, omeprazole, pantoprazole, rabeprazole, and esomeprazole, or a combination thereof.

In another aspect, the present invention provides a method for treating epileptic seizures in a subject, the method comprising: (a) determining the CYP2C19 gene diplotype of the subject by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof; (b) determining a dose of an anti-epileptic drug to be administered based on the diplotype of the subject; and (c) administering said dose to the subject.

In one embodiment, the anti-epileptic drug is selected from the group consisting of diazepam, clobazam, clonazepam, clorazepate, nordazepam, phenytoin, mephenytoin, fosphenytoin, ethotoin, phenobarbital, primidone, hexobarbital, methylphenobarbital, or a combination thereof.

In another aspect, the present invention provides a method for treating a mood disorder in a subject, the method comprising: (a) determining the CYP2C19 gene diplotype of the subject by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof; (b) determining a dose of an anti-depressant drug to be administered based on the diplotype of the subject; and (c) administering said dose to the subject.

In one embodiment, the anti-depressant drug is selected from the group consisting of diazepam, amitriptyline, clomipramine, imipramine, citalopram, moclobemide, fluvoxamine, or a combination thereof.

In one embodiment the administering step comprises giving a standard dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In one embodiment, the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In one embodiment, the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/guanosine(G), or guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene. In another embodiment, the administering step comprises giving an increased dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In a further embodiment, the administering step comprises giving a decreased dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/guanosine(G), or guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene.

In one embodiment, the PCR amplification comprises at least one PCR reaction using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof. In another embodiment, the PCR amplification comprises at least two PCR reactions using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof. In a further embodiment, the PCR amplification comprises at least three PCR reactions using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof. In yet another embodiment, the PCR amplification comprises at least four PCR reactions using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof.

In one embodiment, the diplotype comprises the presence or absence of the polymorphic C.-806OT (« 7) and c. lA>G (*4) alleles of CYP2C19 gene.

In one embodiment, the subject is a human.

In one embodiment, the sample comprises a blood sample, a salvia sample, a buccal swab, a serum sample, a sputum sample, a lacrimal secretion sample, a semen sample, a vaginal secretion sample, a fetal tissue sample, a skin tissue sample, a muscle tissue sample, an amniotic fluid sample, a chorionic villi sample, or a combination thereof. In another embodiment, a nucleic acid is extracted from the sample. In a further embodiment, the nucleic acid comprises genomic DNA. In yet another embodiment, the nucleic acid comprises mRNA, or a cDNA derived therefrom.

In one embodiment, the method further comprises determining the presence or absence of one or more additional CYP2C19 polymorphic alleles.

In one embodiment, the method further comprises adding a control primer pair to the PCR reaction. In another embodiment, the control primer pair amplifies a region of the human genome. In another embodiment, the control primer pair amplifies a region of human chromosome 10q23.33. In a further embodiment, the control primer pair amplifies a region of the CYP2C19 gene. In another embodiment, the amplified region is between 100 and 4000 nucleotides in length. In yet another embodiment, the control primer pair comprises the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6.

In another aspect, the present invention provides a kit for determining whether to administer an anti-platelet drug metabolized by CYP2C19 to a subject, the kit comprising reagents for determining the diplotype of the polymorphic C.-806OT (*17) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof.

In another aspect, the present invention provides a kit for determining whether to administer a proton pump inhibitor to a subject, the kit comprising reagents for determining the diplotype of the polymorphic C.-806OT (« 7) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR

amplification using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof.

In another aspect, the present invention provides a kit for determining whether to administer an anti-epileptic drug to a subject, the kit comprising reagents for determining the diplotype of the polymorphic C.-806OT (* 7) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof.

In another aspect, the present invention provides a kit for determining whether to administer an anti-depressant to a subject, the kit comprising reagents for determining the diplotype of the polymorphic C.-806OT (* 7) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of SEQ ID NOs: 1, 2, 3, 4, or a combination thereof. In one embodiment, the kit further comprises a control primer pair. In another embodiment, the control primer pair amplifies a region of the human genome. In another embodiment, the control primer pair amplifies a region of human chromosome 10q23.33. In a further embodiment, the control primer pair amplify a region of the CYP2C19 gene. In yet another embodiment, the amplified region is between 100 and 4000 nucleotides in length. In one embodiment, the control primer pair comprises the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Illustration of the CYP2C19 C.-806OT ( « 7) and c. lA>G (*4) variant allele locations and primers used in the allele-specific PCR (ASP) assay. ASP products are 865 bp and the internal amplification control product (CYP2C19 exon 4) is 539 bp. Black numbered boxes represent CYP2C19 exons.

FIG. 2. Allele-specific PCR (ASP) system for detection of CYP2C19*4A, *4B, and *17. Illustration of the primers and amplification strategy to detect and discriminate between the CYP2C19 (A) wild-type (i.e., non- *4 or *17 alleles), (B) *17, (C) *4A, and (D) *4B alleles. Horizontal bars represent successful PCR amplification between specific primer sets and horizontal bars represent failed PCR amplification due to only unidirectional primer extension.

FIG. 3. Results from allele-specific PCR (ASP) detection of representative samples with known CYP2C19 genotypes confirmed by cloning and allele-specific sequencing and/or targeted genotyping. (A) Sanger sequence confirmation of representative controls for the defining *17 (c.-806C>T) and *4 (c. lA>G) variants. (B) Representative ASP results from the assay development cohort. (C) Representative ASP results from the assay validation cohort, including the targeted genotyping results and revised genotype results following ASP. WT: wild-type.

FIG. 4. Results for two selected samples (*1/*4A and *1/*4B) illustrating the dynamic range of the ASP assay.

FIG. 5. Illustration of the CYP2C19 variant allele locations. Black numbered boxes represent CYP2C19 exons.

FIG. 6. Metabolism of clopidogrel (WoldWideWeb at pharmgkb.org/). DETAILED DESCRIPTION OF THE INVENTION

The singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise.

The term "about" is used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20%.

Polymorphisms in the CYP2C19 gene

The hepatic cytochrome P450 (CYP450) superfamily of hemoproteins are the principal enzymes involved in human drug metabolism and bioactivation. Over 50 human CYP450 isozymes have been identified; however, members of the CYP2 and CYP3 families have significant importance as they contribute to the metabolism of the majority of drugs (1). One of the most important CYP2C subfamily enzymes is CYP2C19, which is involved in the metabolism of a large number of clinically relevant drugs and drug classes such as antidepressants, benzodiazepines, mephenytoin, proton pump inhibitors, and the antiplatelet prodrug clopidogrel (2-4). The CYP2C19 gene is located on chromosome 10q23.33 in a cluster with other CYP2C subfamily members oriented from centromere to telomere as: CYP2C18-CYP2C19-CYP2C9-CYP2C8 (5, 6).

Both common and rare CYP2C19 variant alleles have been identified in different populations, which have been catalogued by the Human Cytochrome P450 (CYP) Allele Nomenclature Committee (7). Many of these alleles encode reduced or complete loss-of- function enzyme variants, and their frequencies can significantly differ between racial and ethnic groups (8-12). The role of variant CYP2C19 alleles in drug response variability and adverse events, particularly with respect to clopidogrel response (13-16), has become increasingly recognized. As such, clinical CYP2C19 genotyping is now broadly available, including some progressive programs that involve both point-of-care (17) and pre-emptive (18) CYP2C19 testing, as well as practice recommendations for CYP2C19-directed antiplatelet therapy (19, 20).

The frequencies of an extensive CYP2C19 variant allele panel (*2 - *10, *12 - *17, *22) in the African-American, Asian, Caucasian, Hispanic, and Ashkenazi Jewish (AJ) populations were previously reported (12). These studies also identified the novel

CYP2C19*4B allele that is defined by both a gain-of- function promoter substitution [a- 806OT (*17)] and a loss-of-function initiation of translation mutation [c. lA>G (*4)] on the same haplotype (21). The CYP2C19*17 allele is common in most populations and is included in many commercial genotyping assays; however, the increase in activity conferred by its promoter variant (c.-806OT) is abolished when accompanied by the downstream ATG translation initiation mutation (c.1 A>G) that together define *4B. Of note, the c.1 A>G mutation also occurs independent of the *17 variant and this allele is designated *4A (7). Given that current genotyping and sequencing assays are unable to distinguish the phase of the c.-806C>T and c. lA>G variants, a rapid allele-specific PCR (ASP) system was developed to detect and differentiate the related *4A, *4B, and *17 alleles for improved

pharmacogenetic metabolizer prediction.

The present invention relates to methods and compositions for identifying polymorphisms in the human CYP2C19 gene. In particular, the methods and compositions of the present invention relate to identifying the phase of the single-nucleotide polymorphisms c.-806C>T (*17) and c. lA>G (*4) of the CYP2C19 gene in a subject. The present invention also relates to kits to identify the phase of the single-nucleotide polymorphisms c.-806C>T (*17 and c.1A>G (*4) of the CYP2C19 gene in a subject. The present invention also relates to methods of treating a cardiovascular disease, a gastrointestinal disease, a mood disorder, or epilepsy in a subject, wherein the method of treatment is determined based on the CYP2C19 haplotype of the subject.

The methods of the invention are useful in various subjects, such as humans, including adults, children, and developing human fetuses at the prenatal stage.

The CYP2C19 gene locus can comprise all CYP2C19 sequences or products in a cell or organism, including CYP2C19 coding sequences (e.g., exons), CYP2C19 non-coding sequences (e.g., introns), or CYP2C19 regulatory sequences controlling transcription and/or translation (e.g. promoter, enhancer, terminator).

The CYP2C19 gene, also known as CPCJ, CYP2C, P450C2C, P450IIC19, encodes the cytochrome P450, family 2, subfamily C, polypeptide 19. It is a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are

monooxygenases which catalyze many reactions including, but not limited to, drug metabolism and synthesis of cholesterol, steroids and other lipids. Without being bound by theory, it localizes to the endoplasmic reticulum and is known to metabolize many xenobiotics. Polymorphism within the CYP2C19 gene is associated with variable ability to metabolize many drugs. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q23.33. In the context of the invention, the CYP2C19 gene also encompasses its variants, analogs and fragments thereof, including alleles therof.

As used herein, "allele" refers to a particular genetic variant or polymorphism in the sequence of a gene, representing an alternative form of the gene.

As used herein, "single-nucleotide polymorphism" or "SNP" refers to variations at single-nucleotide positions in the DNA sequence among individuals.

As used herein, "haplotype" means a specific combination of single-nucleotide polymorphisms (SNPs) on a chromosome that are inherited together.

As used herein, "diplotype" refers to the combination in one individual of two haplotypes, one from each chromosome.

The designations of all CYP2C19 alleles refer to those defined by the Cytochrome P450 Allele Nomenclature Committee (WorldWideWeb at cypalleles.ki.se/cyp2cl9.htm) (7).

As used herein, refers to the wild-type haplotypes of the CYP2C19 gene, comprising the * 1A, * 1B and * 1C haplotypes (WorldWideWeb at

cypalleles. hi. se/cyp2cl9. htm).

SEQ ID NO: 7 is the human wild-type genomic nucleic acid sequence corresponding to the sense strand of the * 1A haplotype of the CYP2C19 gene (96001bp), wherein "ATG" at postion 4928 denotes the beginning of the open reading frame. The nucleic acid bases are written in the 5 ' to 3 ' direction.

As used herein, positions in the CYP2C19 gene correspond to the position of the nucleotide from the first adenosine ("A") of the ATG start codon of the genomic nucleic acid sequence. For example, the first "A" of the ATG codon is position +1. The first "A" of the ATG codon is at position 4928 of SEQ ID NO: 7. Nucleotide positions are represented by positive, or negative, integers only. The positive integers indicate nucleotide positions in the 3' direction from the first "A" of the ATG codon and negative integers indicate nucleotide positions in the 5' direction from the first "A" of the ATG codon.

The * 1B haplotype of the CYP2C19 gene consists of two single-nucleotide polymorphisms, a thymidine (T) present at position +99 (position 5026 of SEQ ID NO: 7), as compared to a cytidine (C) in * 1A (+99C>T), and a guanosine (G) present at position +80161 (position 85088 of SEQ ID NO: 7), as compared to an adenosine (A) in * 1A (+80161A>G). The polypeptide expressed from the * IB allele thus comprises a valine (V) at position 331, as compared to isoleucine (I) in the polypeptide expressed from * 1A (133 IV), this substitution has no effect on enzymatic activity. The * 1C haplotype of the CYP2C19 gene comprises a single-nucleotide

polymorphism, a guanosine (G) present at position +80161 (position 85088 of SEQ ID NO: 7), as compared to an adenosine (A) in * 1A (+80161A>G). The polypeptide expressed from the * 1C haplotype thus comprises a valine (V) at position 331, as compared to isoleucine (I) in the polypeptide expressed from the * 1A allele (133 IV), this substitution has no effect on enzymatic activity.

SEQ ID NO: 8 is the human wild-type genomic nucleic acid sequence corresponding to the sense strand of the *4A haplotype of the CYP2C19 gene (96001bp). The nucleic acid bases are written in the 5 ' to 3 ' direction.

As used herein, ⁱⁱ*4A" refers to the haplotype of the CYP2C19 gene comprising a single-nucleotide polymorphism (SNP), a guanosine (G) present at position +1 (position 4928 of SEQ ID NO: 8), as compared to an adenosine (A) in the * 1 haplotype sequence (+1A>G). The *4 allele of CYP2C19 is a loss-of-function allele. The c.1 A>G SNP results in a GTG initiation codon and loss of polypeptide expression.

SEQ ID NO: 9 is the human wild-type genomic nucleic acid sequence corresponding to the sense strand of the * 17 haplotype of the CYP2C19 gene (9600 lbp), wherein the "ATG" beginning at postion 4928 denotes the beginning of the open reading frame. The nucleic acid bases are written in the 5 ' to 3 ' direction:

As used herein, "* 17" refers to the haplotype of the CYP2C19 gene comprising two single-nucleotide polymorphisms, a thymidine (T) at position -3402 (position 1526 of SEQ ID NO: 9), as compared to a cytidine (C) in the * 1 haplotype sequence (c.-3402OT), and a thymidine (T) at position -806 (position 4122 of SEQ ID NO: 9), as compared to a cytidine (C) in the * 1 haplotype sequence (c.-806OT). The * 17 haplotype of CYP2C19 is a gain-of function haplotype. The C.-806OT SNP results in increased transcription of the CYP2C19 gene and increased levels of the CYP2C19 polypeptide.

SEQ ID NO: 10 is the human wild-type genomic nucleic acid sequence corresponding to the sense strand of the *4B haplotype of the CYP2C19 gene (9600 lbp). The nucleic acid bases are written in the 5 ' to 3 ' direction.

As used herein, refers to the haplotype of the CYP2C19 gene comprising the *4 allele SNP (c. lA>G) in combination with the *17 allele SNPs on the same haplotype. The *4B haplotype comprises the single-nucleotide polymorphisms, a thymidine (T) at position - 3402 (position 1526 of SEQ ID NO: 10), as compared to a cytidine (C) in the *1 haplotype sequence (c.-3402OT), a thymidine (T) at position -806 (position 4122 of SEQ ID NO: 10), as compared to a cytidine (C) in the *1 haplotype sequence (c.-806OT), and a guanosine (G) present at position +1 (position 4928 of SEQ ID NO: 10), as compared to an adenosine (A) in the *1 haplotype sequence (c. lA>G). The *4B haplotype of CYP2C19 is a loss-of function haplotype. The c. lA>G SNP results in a GTG initiation codon and loss of protein expression, the effect is dominant over the increased transcription effect of the *17 haplotype.

The present invention provides compositions and methods to determine the *4A, *4B and *17 haplotypes of the CYP2C19 gene of a subject. For example, the combination in one individual of their two haplotypes, one from each chromosome, is known as a diplotype. In some embodiments, the diplotype of the subject is determined using PCR. In some embodiments the present invention provides for nucleic acid compositions, including, but not limited to, oligonucleotides and amplification primers. In some embodiments, the

oligonucleotides are used as amplification primers for PCR amplification to determine the CYP2C19 gene diplotype of a subject. In some embodiments, the oligonucleotides are allele- specific.

As used herein, "position 1 of the CYP2C19 gene" refers to the c. lA>G single- nucleotide polymorphism of the CYP2C19 gene, and can be used to refer to one or both chromosomal copies of the CYP2C19 gene.

As used herein, in reference to position 1 of the CYP2C19 gene,

"adenosine(A)/adenosine(A)" refers to the CYP2C19 gene diplotype comprising an adenosine (A) on both chromosomal copies (homozygous).

As used herein, in reference to position 1 of the CYP2C19 gene,

"adenosine(A)/guanosine(G)" referes to the CYP2C19 gene diplotype comprising an adenosine (A) on one chromosomal copy and a guanosine (G) on the other chromosomal copy (heterozygous).

As used herein, in reference to position 1 of the CYP2C19 gene, "guanosine(G)/ guanosine(G)" referes to the CYP2C19 gene diplotype comprising a guanosine (G) on both chromosomal copies (homozygous).

As used herein, "position -806 of the CYP2C19 gene" refers to the C.-806OT single- nucleotide polymorphism of the CYP2C19 gene, and can be used to refer to one or both chromosomal copies of the CYP2C19 gene.

As used herein, in reference to position -806 of the CYP2C19 gene,

"cytidine(C)/cytidine(C)" referes to the CYP2C19 gene diplotype comprising a cytidine (C) on both chromosomal copies (homozygous).

As used herein, in reference to position -806 of the CYP2C19 gene,

"cytidine(C)/thymidine(T)" referes to the CYP2C19 gene diplotype comprising a cytidine (C) on one chromosomal copy and a thymidine (T) on the other chromosomal copy

(heterozygous).

As used herein, in reference to position -806 of the CYP2C19 gene, "thymidine(T)/ thymidine(T)" referes to the CYP2C19 gene diplotype comprising a thymidine (T) on both chromosomal copies (homozygous).

In one embodiment, the CYP2C19 gene diplotype of a subject comprises

cytidine(C)/cytidine(C) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises

cytidine(C)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein one haplotype of the CYP2C19 gene is *17.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein both haplotypes of the CYP2C19 gene are *17.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises cytidine(C)/ cytidine(C) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein one haplotype of the CYP2C19 gene is *4A.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises cytidine(C)/ thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G) at position 1 of the CYP2C19 gene. This diplotype can correspond to a subject wherein one haplotype of the CYP2C19 gene is *4A, and one haplotype of the CYP2C19 gene is *17. This diplotype can also correspond to a subject wherein one haplotype of the CYP2C19 gene is *4B.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises cytidine(C)/ cytidine(C) at position -806 of the CYP2C19 gene, and guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein both haplotypes of the CYP2C19 gene are *4A.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein both haplotypes of the CYP2C19 gene are *4B. In one embodiment, the CYP2C19 gene diplotype of a subject comprises cytidine(C)/ thymidine(T) at position -806 of the CYP2C19 gene, and guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein one haplotype of the CYP2C19 gene is *4A, and one haplotype of the CYP2C19 gene is *4B.

In one embodiment, the CYP2C19 gene diplotype of a subject comprises

thymidine(T)/ thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/guanosine(G) at position 1 of the CYP2C19 gene. This diplotype corresponds to a subject wherein one haplotype of the CYP2C19 gene is *4B, and one haplotype of the CYP2C19 gene is *17.

A subject can have a diplotype comprising any combination of the CYP2C19 gene alleles which include, but are not limited to the * 1A allele, * 1B allele, * 1C allele, *2A allele, *2B allele, *2C allele, *2D allele, *3A allele, *3B allele, *4A allele, *4B allele, *5A allele, *5B allele, *6 allele, *7 allele, *8 allele, *9 allele, * 10 allele, * 11 allele, * 12 allele, * 13 allele, * 14 allele, * 15 allele, * 16 allele, * 17 allele, * 18 allele, * 19 allele, *20 allele, *21 allele, *22 allele, *23 allele, *24 allele, *25 allele, *26 allele, *27 allele, and *28 allele.

Nucleic Acids of the Invention

Nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and ribonucleic acid (RNA). The term should also be understood to include, as equivalents, derivatives, variants, and analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double- stranded polynucleotides. Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine, and deoxythymidine. When referring herein to a nucleotide of a nucleic acid, which can be DNA or RNA, the terms adenosine (A), cytidine (C), guanosine (G), and thymidine (T) are used to refer to a nucleotide having an adenine, a cytosine, a guanine, or a thymine base respectively. If the nucleic acid is RNA, a nucleotide having a uracil base is uridine (U). The term nucleotide or nucleic acid is intended to refer to ribonucleotides, deoxyribonucleotides, acylic derivatives of nucleotides, and functional equivalents thereof, of any phosphorylation state. Functional equivalents of nucleotides are those that act as substrates for a polymerase as, for example, in an amplification method. Functional equivalents of nucleotides are also those that can be formed into a polynucleotide that retains the ability to hybridize in a sequence specific manner to target polynucleotide.

Polynucleotide includes nucleotides of any number. A polynucleotide includes a nucleic acid molecule of any number of nucleotides including single-stranded RNA, DNA or

complements thereof, double-stranded RNA or DNA, and the like. Nucleic acid molecules can be double-stranded molecules. Reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand.

Reference to an adenosine, a thymidine (uridine), a cytidine, or a guanosine at a particular site of the sense strand of a nucleic acid molecule is also intended to include the thymidine (uridine), adenosine, guanosine, or cytidine (respectively) at the corresponding site on an anti-sense strand of a complementary strand of a nucleic acid molecule. Reference can be made to either strand and still comprise the same polymorphic site and an oligonucleotide can be designed to hybridize to either strand.

Double-stranded nucleic acid molecules can be formed of two polynucleotide chains that are linked together by hydrogen bonds between complementary base pairs along their lengths, with the 3', 5'-phosphodiester bonds of the two chains running in opposite directions. A nucleic acid strand, unless circular, has polarity with one 5' end and one 3 ' end.

The sense strand of a nucleic acid molecule is the strand in double-stranded nucleic acid molecules that contains the same sequence as the bases of the messenger RNA (mRNA) that is transcribed from the DNA, with the exception of thymidine (T) that is replaced by uridine (U) in mRNA. Its complement is the anti-sense strand. The sense strand can also be called the coding strand, the plus strand, the antitemplate strand, the codogenic strand, or the non-transcribing strand.

The anti-sense strand of a nucleic acid molecule is the strand in double-stranded nucleic acid molecules that is complementary in its sequence to the bases to the mRNA that is transcribed from the DNA, with the exception of thymidine (T) that is replaced by uridine (U) in mRNA. Its complement is the sense strand. The anti-sense strand, can also be called the non-coding strand, the minus strand, the complementary strand, the template strand, or the transcribing strand.

The invention further provides for nucleic acids that are complementary to a nucleic acid. Such complementary nucleic acids can comprise nucleic acid sequences, which hybridize to a nucleic acid sequence of the CYP2C19 gene locus, or an allele thereof under stringent hybridization conditions.

As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a probe, primer or oligonucleotide will hybridize to its target sequence, or variants thereof. The precise conditions for stringent hybridization are typically sequence- dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the oligonucleotides complementary to the target sequence hybridize to the target sequence at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60°C for longer probes, primers and oligonucleotides. With regard to

hybridization, conditions that are highly stringent, and means for achieving them, are well known in the art. See, for example, Sambrook et al. (1989) "Molecular Cloning: A

Laboratory Manual" (2nd ed., Cold Spring Harbor Laboratory); and Berger and Kimmel, eds., (1987) "Guide to Molecular Cloning Techniques", In Methods in Enzymology: 152: 467- 469; Current Protocols In Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-7.3.6.

The practice of the present invention will employ, unless indicated specifically to the contrary, conventional methods of molecular biology and recombinant techniques within the skill of the art, many of which are described below for the purpose of illustration. Such techniques, are explained fully in the literature. See, for example, Kashima et al. (1985) Nature 313 :402-404; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y ("Sambrook"); "Nucleic Acid Hybridization: A Practical Approach" (B. Hames & S. Higgins, eds.), IRL Press,

Washington, D.C. (1985); Maniatis et al. Molecular Cloning: A Laboratory Manual (1982); DNA cloning: A Practical Approach, Vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N.Gait, ed., 1984); Transcription and Translation (B. Hames & S. Higgins, eds., 1984);

Perbal, A Practical Guide to Molecular Cloning (1984), which references are incorporated herein by reference.

Encompassed by the invention are oligonucleotide sequences that are capable of hybridizing to the single-nucleotide polymorphisms at postion -806 and position 1 of the CYP2C19 gene * 1, *4A, *4B and * 17 alleles of the CYP2C19 gene, and fragments thereof under various conditions of stringency. In general, stringency of hybridization conditions is determined by the temperature, ionic strength, and concentration of denaturing agents, if any, used in hybridization. The degree to which two nucleic acids hybridize under various conditions of stringency is correlated with the extent of their similarity.

In certain embodiments, the conditions are such that sequences having at least about 50%, 55%, 60%, 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% identity to each other typically remain hybridized to each other. In another embodiment, the conditions are such that sequences with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide mismatches to each other typically remain hybridized to each other.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. "Percent identity" in the context of two or more nucleic acids sequences, refers to the percentage of nucleotides that two or more sequences or subsequences contain which are the same. A specified percentage of nucleotides can be referred to such as: 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity over a specified region. For example, the percent identity refers to the identity over of the entire length of the nucleic acids of SEQ ID Os: l, 2, 3, 4, 1 1, and 12.

PCR Amplification

Amplification is based on the formation of specific hybrids between complementary nucleic acid sequences that serve to initiate nucleic acid reproduction. The nucleic acid primers of the present invention can be used for amplification by many different techniques, including but not limited to, those described herein. Amplification can be performed according to various techniques known in the art, such as by polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols. In one embodiment, the amplification is PCR amplification. In another embodiment, the amplification is allele-specific PCR (ASP).

Polymerase chain reaction (PCR) is well known in the art, for example, U.S. Patent Nos. 4,683, 195, 4,683,202, and 4,800, 159; K.Mullis, Cold Spring Harbor Symp. Quant. Biol, 51 :263-273 (1986); and C.R. Newton & A.Graham, Introduction to Biotechniques: PCR, 2.sup.nd ED., Springer- Verlag (New York, 1997), the disclosures of which are incorporated herein by reference.

PCR can be used to amplify a nucleic acid target sequence by the extension of oligonucleotide primers that hybridize to the nucleic acid target. The oligonucleotide binding sites on the nucleic acid target delimit the region that will be amplified. The oligonucleotide primers are extended, using a DNA polymerase, resulting in an increase in the amount of target nucleic acid. This process is repeated many times, resulting in amplification of the target nucleic acid sequence. Typically, the reaction conditions are cycled between those conducive to hybridization and nucleic acid polymerization, and those that result in the denaturation of duplex molecules. In the first step of the reaction, the target nucleic acid molecules are transiently heated, and then cooled, in order to denature double stranded molecules. Forward and reverse primers are present in the amplification reaction mixture at an excess concentration relative to the nucleic acid target. When the sample is incubated under conditions conducive to hybridization and polymerization, the primers hybridize to the complementary strand of the nucleic acid molecule at a position 3' to the sequence of the region desired to be amplified. The reverse extension primer will have the opposite orientation relative to the forward extension primer. The forward and reverse extension primers thus define a region of DNA that will be amplified when subjected to PCR amplification conditions. Upon hybridization, the 3' ends of the primers are extended by the polymerase. The 3 ' end of the primer will only be extended by the polymerase if it is hybridized to the complementary strand. The extension of the primer results in the synthesis of a DNA molecule having the exact sequence of the complement of the desired nucleic acid sample target. The use of forward and reverse primers that hybridize to opposite strands of the DNA molecule results in amplification of both strands of the DNA target. The PCR reaction is capable of

exponentially amplifying the desired nucleic acid sequences, with a near doubling of the number of molecules having the desired sequence in each cycle. Thus, by permitting cycles of hybridization, polymerization, and denaturation, an exponential increase in the concentration of the desired nucleic acid molecule can be achieved.

The nucleic acid in the sample is denatured using any suitable denaturing method. Physical means for strand separation involves heating the nucleic acid until it is denatured. Typical heat denaturation involves temperatures ranging from about 80°C to about 105°C, for times ranging from about a 5 seconds to about a 5 minutes. The denatured nucleic acid strands are then incubated under conditions that facilitate the binding of primers to the single nucleic acid strands.

Any nucleic acid molecule, in purified or non-purified form, can be used as the starting nucleic acid to be amplified by PCR. The starting nucleic acid can be, for example, DNA or RNA, in single-stranded or double-stranded form. DNA-RNA hybrids, that contain one strand of DNA and one strand of RNA, can also be used. A mixture of any of these nucleic acids may also be used. The nucleic acids produced from a previous amplification reaction, using the same or different primers, can also be utilized. The specific nucleic acid sequence to be amplified can be only a fraction of a larger molecule, for example the about 865bp of the CYP2C19 gene between nucleotide positions -806 (position 4122 of SEQ ID NOs: 7, 8, 9, or, 10) and +1 (position 4928 of SEQ ID NOs: 7, 8, 9, or, 10). The nucleic acid sequence to be amplified can be present in a purified or non-purified form. The nucleic acid can be part of a mixture, such as a portion of the CYP2C19 gene contained within whole human genomic DNA. Nucleic acid templates can be obtained from any source, for example, from plasmids, from cloned DNA or RNA, or from natural DNA or RNA from any source. DNA or RNA can be extracted from blood, or tissue material, by a variety of techniques known in the art (Maniatis et al., Molecular Cloning (1982), 280-281). The nucleic acid contained in the sample can be in the form of genomic DNA, or alternatively can be first reverse transcribed into cDNA. For example genomic DNA can be isolated from a sample from a subject. In one embodiment, the sample comprises a blood sample, a saliva sample, or a buccal swab. In one embodiment, the sample can comprise blood, serum, sputum, lacrimal secretions, semen, vaginal secretions, fetal tissue, skin tissue, muscle tissue, amniotic fluid, chorionic villi, or a combination thereof. In another embodiment, a nucleic acid is extracted from the sample. In a further embodiment, the nucleic acid comprises genomic DNA. In another embodiment, the nucleic acid comprises mRNA, or a cDNA derived therefrom. In one embodiment the nucleic acid extracted from the sample is used as a template for PCR amplification.

Allele-Specific PCR Amplification

The present invention relates to the use of a PCR-based method for determining the presence or absence of a specific known nucleic acid sequence, such as a SNP, called allele- specific PCR (AS-PCR or ASP) or allele-specific amplification (ASA), also known as amplification refractory mutation system (ARMS) and PCR amplification of specific alleles (P-ASA), as described in U.S. Patent No. 5,639,611; U.S. Patent No. 5,595,890, Ruano et al, Nucleic Acids Res 17:8392 (1989) (allele-specific amplification), Ruano et al, Nucleic Acids Res. 19:5887-20 5882 (1991) (coupled amplification and sequencing) and Cheng et al, Nature 368:664-665 (1994); Newton et al, J Med Genet, 1991 ; 28; 248-51. Allele-specific PCR (ASP) can be used to selectively amplify one or more specific predetermined alleles from a sample containing multiple alleles at the same genetic locus. In a typical ASP assay one or more PCR reactions using different PCR extension primers are annealed to the same nucleic acid sample (e.g., a genomic DNA sample). The PCR primers are designed to have a residue at the 3 '-terminus of the primer (complementary to the 5' primer initiation site of the template) that is complementary to the SNP that defines the different alleles. The 3' terminus of the primer will only hybrize to the sample DNA if the SNP it is complementary to is present. The PCR reaction does not extend from a primer having a 3 '-terminal mismatched base, thus a PCR amplification product is only produced when the SNP complementary to the primer is present in the sample. This allows for determination of the alleles present in the nucleic acid sample. A polymerase lacking 3' to 5' proofreading activity, such as Taq DNA polymerase, is normally used in an ASP assay, as it will not attempt to excise and repair any 3' terminal mismatched nucleotides.

Discrimination between specificity of PCR extension from the allele-specific PCR primers can be enhanced by the introduction of deliberate multiple mismatches near the 3'- terminal nucleotide. The destabilization is greater when the mismatch is nearer to the 3'- terminal nucleotide, for example, adjacent to the 3 ' terminal nucleotide. Other factors can affect the stability of the hybridization of PCR primers in an ASP assay include the position of additional mismatches in the primer, the GC content of the 5 or 6 nucleotides preceding the 3' nucleotide, and the discriminatory 3 '-terminal nucleotide, depending on the difference between the alleles and the type of mismatch.

Allele-specific PCR (ASP) can be used to determine the presense and phase of two or more specific predetermined alleles from a sample containing multiple alleles at the different genetic loci. An ASP assay can be used to determine the phase of two or more alleles, by using a forward extension primer that is specific for an allele at a first genetic locus, in combination with a reverse extension primer that is specific for an allele at a second genetic locus. The genetic loci should be close enough to each other to allow reliable extension of the primers by the DNA polymerase. PCR amplification will only proceed if the alleles that are complementary to both the forward and reverse primers are present in the sample. The use of forward and reverse primers that hybridize to opposite strands of the DNA molecule results in amplification of both strands of the DNA target only if both alleles are present. If one of the alleles is not present, amplification will not proceed. The nucleic acid sample can be tested in one or more PCR reactions with different forward and reverse PCR primer combinations that distinguish between the alleles at each loci, enabling the phase of the alleles present in the sample to be tested.

PCR amplification is performed using extension primers that span the region encompassing the alleles of interest. Extension primers must be sufficiently long to prime the synthesis of extension products in the presense of the polymerase. The exact length and composition of the primer will depend on many factors, including temperature of the annealing reaction, and the source and composition of the primer. Primers must be sufficiently complementary to anneal to their respective strands selectively and form stable duplexes. In the present invention, a polynucleotide segment is selectively amplified using the oligonucleotides of the present invention. The primers are combined with a dNTP mixture and appropriate polymerase enzyme, and the polynucleotide segment is amplified under polymerase chain reaction conditions, wherein specificity of the 3' end of the allele-specific extension primer is increased by an additional mismatched nucleotide adjacent to the 3' terminal nucleotide. These conditions result in selective hybridization of the allele-specific extension primer to the target allele and extension of said primer, relative to the variant allele.

In one embodiment, allele-specific PCR is performed for the purpose of

discriminating between two or more alleles (e.g. C.-806OT (*17), and c. lA>G (*4)) of a genetic locus (e.g. CYP2C19 gene) that differ by a single or multiple nucleotide

polymorphism. In a further embodiment, the phase of the alleles is determined (e.g. C.-806C + c. lA; C.-806C + c. lG (*4A); C.-806T + c. lA (*77); -806T + c. lG (*4B)). Forward and reverse extension primers used will be complementary to one SNP but differ from the other alleles. Specifically, the forward extension primer will have a sequence complementary to a region encompassing the target alleles, with the terminal 3 ' nucleotide of the forward extension primer being exactly complementary to one of the known SNPs (e.g. C.-806C, C.-806T) of the target sequence. The nucleotide adjacent to the terminal 3 ' nucleotide contains a mismatch to the target sequence (e.g. is thymidine (T), adenosine (A), or cytidine (C)). If the terminal 3' nucleotide of the primer is complementary to the SNP of the target sequence, the primer will hybridize and extend under appropriate PCR conditions. If there is a nucleotide mismatch between the 3' terminus of the primer and the 5' initiation point of the template, there will be no PCR extension. In another embodiment, the reverse extension primer will have a sequence complementary to a region encompassing the target alleles, with the terminal 3 ' nucleotide of the reverse extension primer being exactly complementary to one of the known SNPs (e.g. c. lA, c. lG) of the target sequence. The nucleotide adjacent to the terminal 3 ' nucleotide contains a mismatch to the target sequence (e.g. is thymidine (T), guanosine (G), or cytidine (C)). If the terminal 3' nucleotide of the primer is complementary to the SNP of the target sequence, the primer will hybridize and extend under appropriate PCR conditions. If there is a nucleotide mismatch between the 3 ' terminus of the primer and the 5' initiation point of the template, there will be no PCR extension. The reverse extension primer will have the opposite orientation relative to the forward extension primer. The forward and reverse extension primers define a region of DNA that will be amplified when subjected to PCR amplification conditions. The PCR product of the amplification reaction can be detected by methods known in the art. Subsequent gel electrophoresis, for example will show the combination of allele-specific primers that produce a PCR product, and allow determination of the phase of the alleles, as well as the diplotype of the sample (e.g., heterozygous or homozygous).

In some embodiments, the result of the ASP assay is the absence of a PCR product. The absence of a PCR product can be due to an allele specific mismatch of 3 ' end of the primers or can be due to a failure of PCR amplification due to other factors, including, but not limited to lack of template, inappropriate buffer conditions, inappropriate temperature cycling, faulty equipment, errors in mixing, lack of DNA polymerase activity, and the like. In some embodiments, a control PCR amplification reaction can be performed simultaneously with the ASP assay. Forward and reverse extension primers having a sequence

complementary to a separate region common to all samples and located at a locus remote from the specific genetic locus of the target alleles. The reverse extension primer will have the opposite orientation relative to the forward extension primer. The forward and reverse extension primers thus define a region of DNA that will be amplified when subjected to PCR amplification conditions. This region of DNA will be amplified in all samples can be used to indicate PCR amplification conditions conducive to formation of a PCR product.

In another embodiment, multiplex PCR procedures using allele-specific primers can be used to simultaneously amplify multiple regions of a target nucleic acid (PCT Application W089/10414), enabling amplification only if a particular allele is present in a sample.

Through the use of multiplex PCR, a multiplicity of regions of a target polynucleotide can be amplified simultaneously. This is particularly advantageous in embodiments where more than one SNP is to be detected. Other embodiments using alternative primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DNA can be used, and have been described (Komher, J. S. et al, Nucl. Acids. Res. 17:7779-7784 (1989); Sokolov, B. P., Nucl. Acids Res. 18:3671 (1990); Syvanen, A.-C, et al., Genomics 8:684-692 (1990);

Kuppuswamy, M. N. et al., Proc. Nad. Acad. Sci. (U.S.A) 88: 1143-1 147 (1991); Bajaj et al. (U.S. Pat. No. 5,846,710); Prezant, T. R. et al, Hum Mutat. 1 : 159-164 (1992); Ugozzoli, L. et al, GATA 9: 107-1 12 47 (1992); Nyr6n, P. et al., Anal. Biochem. 208: 171-175 (1993)).

In a variation of the approach, termed mutagenically separated PCR (MS-PCR) two allele-specific primers of different lengths, one specific for the wild-type allele and one for the SNP mutation are used, to yield PCR procures of different lengths for the normal and mutant alleles (Rust et al, Nucl Acids Res, 1993; 21 ; 3623-9). Subsequent gel electrophoresis, for example will show at least one of the two allelic products, with normal, mutant or both (heterozygote) genes. A further variation of this forms the basis of the Masscode System.TM. (WorldWideWeb at bioserve.com) which uses small molecular weight tags covalently attached through a photo-cleavable linker to the allele-specific primers, with each allele- specific primer labeled with a tag of differing weight (Kokoris et al, 2000, 5; 329-40). A catalogue of numerous tags allows simultaneous amplification/genotyping (multiplexing) of 24 different targets in a single PCR reaction. For any one mutation, genotyping is based on comparison of the relative abundance of the two relevant mass tags by mass spectrometry.

Other known nucleic acid amplification procedures include transcription-based amplification systems (Malek, L. T. et al, U.S. Pat. No. 5, 130,238; Davey, C. et al, European Patent Application 329,822; Schuster et al.) U.S. Pat. No. 5, 169,766; Miller, H. I. et al, PCT-Application W089/06700; Kwoh, D. et al., Proc. Natl. Acad Sci. (U.S.A) 86: 1 173 Z1989); Gingeras, T. R. et al., PCT Application W088/10315)), or isothermal amplification methods (Walker, G. T. et al, Proc. Natl. Acad Sci. (U.S.A) 89:392-396 (1992)) can also be used.

Oligonucleotide primers

The invention provides for a nucleic acid primer, wherein the nucleic acid primer can be complementary to and hybridize specifically to a portion of the sequence (e.g., gene or RNA) of the CYP2C19 gene. Primers of the invention can thus be specific for altered sequences in a gene or RNA of the CYP2C19 gene, such as SNPs. By using such primers, the detection of an amplification product indicates the presence of a SNP in the gene.

Examples of primers of this invention can be single-stranded nucleic acid molecules of about 5 to 60 nucleotides in length, or about 15 to about 35 nucleotides in length. The sequence can be derived directly from the sequence of the CYP2C19 gene. Perfect complementarity is useful, to ensure high specificity. However, certain mismatch can be tolerated. For the nucleic acid primer of the present invention to function in an ASP assay the 3 ' terminal nucleotide is complementary to the allele of interest, and the nucleotide adjacent can be mismatched from the sequence of the CYP2C19 gene. In one embodiment, the primer can be an purified nucleic acid comprising a nucleotide sequence of SEQ ID NOs: 1, 2, 3, or 4. For example, a nucleic acid primer or a pair of nucleic acid primers as described above can be used in a method for determining the haplotype or diplotype of the CYP2C19 gene of a subject.

Nucleic acid sequences, such as oligonucleotides and primers, can be allele-specific. For example, a particular position of an oligonucleotide can be complementary with an allele of a target polynucleotide sequence (e.g., the C.-806OT (*17) and c. lA>G (*4) alleles of CYP2C19 gene), thus allele-specific primers are capable of discriminating between different haplotypes of a target polynucleotide (e.g., the *4A, *4B, *17 haplotypes of CYP2C19 gene). The 3 ' nucleotide of the allele-specific primers is complementary to one allele of a target polynucleotide sequence (e.g., the C.-806OT (*77) and c. lA>G (*4) alleles of CYP2C19 gene). Allele-specific primers can have less than 100% identity to any allele target polynucleotide. Allele-specific primers can include deliberate mismatches (at a different postion than the 3 ' allele-specific nucleobase) such that the oligonucleotide is not exactly complementary to the target polynucleotide. Allele-specific oligonucleotides can facilitate PCR amplification only if the allele to which the 3' nucleobase is complementary to is present. PCR amplification is suppressed if the allele-specific nucleobase is not present.

In certain aspects, the invention is directed to a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C). In certain aspects, the invention is directed to a purified nucleic acid of SEQ ID NO: 1. In certain aspects, the invention is directed to a purified nucleic acid complementary SEQ ID NO: 1. In some embodiments, the purified nucleic acid of SEQ ID NO: 1 comprises a PCR primer, wherein the 3' terminal nucleotide hybridizes only to the C.-806C allele of the CYP2C19 gene (e.g. -806C at position 4122 of SEQ ID NO: 7 or 8). This primer is extended by PCR only if a non- *17 haplotype of the CYP2C19 gene is present in a sample. In some embodiments, the purified nucleic acid of SEQ ID NO: 1 comprises a PCR primer that hybridizes to the anti-sense strand of the CYP2C19 gene.

The nucleic acid sequence of SEQ ID NO: 1, wherein the nucleic acid bases are written in the 5' to 3 ' direction, is:

1 TTTTTCAAATTTGTGTCTTCTGTTCTCAAATC In certain aspects, the invention is directed to a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In certain aspects, the invention is directed to a purified nucleic acid of SEQ ID NO: 2. In certain aspects, the invention is directed to a purified nucleic acid complementary SEQ ID NO: 2. In some embodiments, the purified nucleic acid of SEQ ID NO: 2 comprises a PCR primer, wherein the 3' terminal nucleotide hybridizes only to the c.1A allele of the CYP2C19 gene (e.g. +1A at position 4928 of SEQ ID NOs: 7 or 9). This primer is extended by PCR only if a non- *4 haplotype of the CYP2C19 gene is present in a sample. In some embodiments, the purified nucleic acid of SEQ ID NO: 2 comprises a PCR primer that hybridizes to the sense strand of the CYP2C19 gene.

The nucleic acid sequence of SEQ ID NO: 2, wherein the nucleic acid bases are written in the 5' to 3 ' direction, is:

1 AGAGCACAAGGACCACAAAAGGATCCTT

The nucleic acid sequence of SEQ ID NO: 1 1, wherein the nucleic acid bases are written in the 3 ' to 5' direction, is:

1 TTCCTAGGAAAACACCAGGAACACGAGA

In certain aspects, the invention is directed to a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 3, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C). In certain aspects, the invention is directed to a purified nucleic acid of SEQ ID NO: 3. In certain aspects, the invention is directed to a purified nucleic acid complementary SEQ ID NO: 3. In some embodiments, the purified nucleic acid of SEQ ID NO: 3 comprises a PCR primer, wherein the 3 ' terminal nucleotide hybridizes only to the C.-806T allele of the CYP2C19 gene (e.g., -806T at position 4122 of SEQ ID NO: 9 or 10). This primer is extended by PCR only if the C.-806T containing haplotypes of the CYP2C19 gene are present in a sample. In some embodiments, the purified nucleic acid of SEQ ID NO: 3 comprises a PCR primer that hybridizes to the anti-sense strand of the CYP2C19 gene. The nucleic acid sequence of SEQ ID NO: 3, wherein the nucleic acid bases are written in the 5' to 3 ' direction, is:

1 TTTTTCAAATTTGTGTCTTCTGTTCTCAAATT

In certain aspects, the invention is directed to a purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In certain aspects, the invention is directed to a purified nucleic acid of SEQ ID NO: 4. In certain aspects, the invention is directed to a purified nucleic acid complementary SEQ ID NO: 4. In some embodiments, the purified nucleic acid of SEQ ID NO: 4 comprises a PCR primer, wherein the 3 ' terminal nucleotide hybridizes only to the c. lG allele of the CYP2C19 gene (e.g., +1G at position 4928 of SEQ ID NOs: 8 or 10). This primer is extended by PCR only if the c.1G containing haplotypes of the CYP2C19 gene are present in a sample. In some embodiments, the purified nucleic acid of SEQ ID NO: 4 comprises a PCR primer that hybridizes to the sense strand of the CYP2C19 gene.

The nucleic acid sequence of SEQ ID NO: 4, wherein the nucleic acid bases are written in the 5' to 3 ' direction, is:

1 AGAGCACAAGGACCACAAAAGGATCCTC

The nucleic acid sequence of SEQ ID NO: 12, wherein the nucleic acid bases are written in the 3 ' to 5' direction, is:

1 CTCCTAGGAAAACACCAGGAACACGAGA

In certain aspects, the invention is directed to purified nucleic acid sequence variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least from about 50% to about 55% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least from about 55.1 % to about 60% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 include, but are not limited to, nucleic acid sequences having at least from about 60.1% to about 65% identity to that of SEQ ID NOs: 1, 2, 3, 4, 11, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least from about 65.1 % to about 70% identity to that of SEQ ID NOs: 1, 2, 3, 4, 11, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 include, but are not limited to, nucleic acid sequences having at least from about 70.1% to about 75% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 include, but are not limited to, nucleic acid sequences having at least from about 75.1% to about 80% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least from about 80.1% to about 85% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 include, but are not limited to, nucleic acid sequences having at least from about 85.1% to about 90% identity to that of SEQ ID NOs: 1, 2, 3, 4, 11, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least from about 90.1% to about 95% identity to that of SEQ ID NOs: 1, 2, 3, 4, 11, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 include, but are not limited to, nucleic acid sequences having at least from about 95.1% to about 97% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 include, but are not limited to, nucleic acid sequences having at least from about 97.1% to about 99% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Programs and algorithms for sequence alignment and comparison of % identity and/or homology between nucleic acid sequences are well known in the art, and include BLAST, SIM alignment tool, and so forth.

In certain aspects, the invention is directed to purified nucleic acid sequence variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% identity to that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12.

In certain aspects, the invention is directed to purified nucleic acid sequence variants of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. Variants of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 include, but are not limited to, nucleic acid sequences having at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 nucleotides mismatches from that of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12.

In one embodiment, the invention is directed to a purified nucleic acid sequence comprising from about 15 to about 35 consecutive nucleotides of SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12 or a sequence complementary SEQ ID NOs: 1, 2, 3, 4, 1 1, and 12. In another embodiment, the purified nucleic acid sequence can comprise about 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 consecutive nucleotides from SEQ ID NOs: 1, 2, 3, 4, 11, and 12, or sequences complementary SEQ ID NOs: 1, 2, 3, 4, 11, and 12. In other aspects the invention is directed to purified nucleic acid sequences such as oligonucleotide primers, comprising the nucleic acid sequence of SEQ ID NOs: 1, 2, 3, 4, 11, and 12 or fragments thereof. The purified nucleic acids which can be used as a primer are of sufficient length to allow hybridization with, i.e. formation of duplex with a corresponding target nucleic acid sequence, the CYP2C19 gene (SEQ ID NOs: 7, 8, 9, or 10), or an allele thereof.

The invention is also directed to primers which can be labeled by any suitable molecule and/or label known in the art, for example but not limited to fluorescent tags suitable for use in various PCR amplification reactions, for example TaqMan, cybergreen, TAMRA and/or FAM probes; radiolabels, and so forth. In certain embodiments, the oligonucleotide primers further comprises a detectable non-isotopic label selected from the group consisting of: a fluorescent molecule, a chemiluminescent molecule, an enzyme, a cofactor, an enzyme substrate, and a hapten.

In certain aspects, the invention is directed to primer sets comprising the purified nucleic acids or fragments thereof as described herein, which primer sets are suitable for amplification of nucleic acids from samples which comprise the CYP2C19 gene (SEQ ID NOs:7, 8, 9, or 10), or alleles thereof. Primer sets can comprise any suitable combination of primers which would allow amplification of a target nucleic acid sequences in a sample which comprises the CYP2C19 gene (SEQ ID NOs:7, 8, 9, or 10), or alleles thereof.

Amplification can be performed by any suitable method known in the art, for example but not limited to PCR. In one embodiment, the PCR used is allele-specific PCR. In one embodiment, allele-specific PCR is performed for the purpose of discriminating between two or more haplotypes (e.g. *17 or *4B) of a genetic locus (e.g. CYP2C19 gene) that differ by a single or multiple nucleotide polymorphism. In a further embodiment, the phase of the alleles is determined (e.g. C.-806C + c. lA; C.-806C + c. lG (* ); C.-806T + c. lA (*77); -806T + C. IG (*4B)).

In certain aspects the invention is directed to an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs:7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In some embodiments, the primer pair can amplify about a 865bp fragment of the CYP2C19 gene if the wild-type allele of the CYP2C19 gene is present at both position -806 and at position +1 in a sample. The primer pair will not amplify a fragment of the CYP2C19 gene if the -806T allele is present at position -806, or if the c. lG allele is present at position +1 in the sample. In some embodiments, amplification of a PCR product using the primer pair indicates that at least one haplotype of the CYP2C19 gene is a non- *77, - *4A or - *4B haplotype, for example, but not limited to, *1 or *2 haplotypes of the CYP2C19 gene.

In certain aspects the invention is directed to an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In some embodiments, the primer pair can amplify about a 865bp fragment of the CYP2C19 gene if the C.-806C allele of the CYP2C19 gene is present at position -806 and the c. lG allele of the CYP2C19 gene is present at position +1 in a sample. The primer pair will not amplify a fragment of the CYP2C19 gene if the C.-806T allele is present at position -806, or if the c. lA allele is present at position +1 in the sample. In some embodiments, amplification of a PCR product using the primer pair indicates that at least one haplotype of the CYP2C19 gene is *4A.

In certain aspects the invention is directed to an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In some embodiments, the primer pair can amplify about a 865bp fragment of the CYP2C19 gene if the C.-806T allele of the CYP2C19 gene is present at position -806 and the c.1A allele of the CYP2C19 gene is present at position +1 in a sample. The primer pair will not amplify a fragment of the CYP2C19 gene if the C.-806C allele is present at position -806, or if the c. lT allele is present at position +1 in the sample. In some embodiments, amplification of a PCR product using the primer pair indicates that at least one haplotype of the CYP2C19 gene is *17.

In certain aspects the invention is directed to an oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C). In some embodiments, the primer pair can amplify about a 865bp fragment of the CYP2C19 gene if the C.-806T allele of the CYP2C19 gene is present at position -806 and the c. lG allele of the CYP2C19 gene is present at position +1 in a sample. The primer pair will not amplify a fragment of the CYP2C19 gene if the C.-806C allele is present at position -806, or if the c. lA allele is present at position +1 in the sample. In some embodiments, amplification of a PCR product using the primer pair indicates that at least one haplotype of the CYP2C19 gene is *4B.

In certain aspects, the PCR amplification comprises at least one PCR reaction using at least one of the primers of SEQ ID NOs: 1, 2, 3, or 4, or a combination thereof. In another embodiment, the PCR amplification comprises at least two PCR reactions using at least one of the primers of SEQ ID NOs: 1, 2, 3, or 4, or a combination thereof. In a further embodiment, the PCR amplification comprises at least three PCR reactions using at least one of the primers of SEQ ID NOs: 1, 2, 3, or 4, or a combination thereof. In yet another embodiment, the PCR amplification comprises at least four PCR reactions using at least one of the primers of SEQ ID NOs: 1, 2, 3, or 4, or a combination thereof. In one embodiment, the PCR amplification comprises at least four separate PCR amplifications using the primer pairs, SEQ ID NOs: 1, and 2, SEQ ID NOs: 1 and 4, SEQ ID NOs: 2 and 3, and SEQ ID NOs: 3 and 4. Amplification of a PCR product from only one of the four reactions indicates that the alleles of the CYP2C19 gene are homozygous.

Amplification of a PCR product from two of the four reactions indicates that the alleles of the CYP2C19 gene are heterozygous for the SNPs at at least one of the positions (i.e. -806 or +1).

In some embodiments, the oligonucleotide primer pair of SEQ ID NO: 1 and SEQ ID NO: 2 further comprises a primer having at least about 80% identity to SEQ ID NO: 3, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C); a primer having at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C); or a combination thereof.

In some embodiments, the oligonucleotide primer pair of SEQ ID NO: 3 and SEQ ID NO: 4, further comprising a primer having at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C); a primer having at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C); or a combination thereof.

In some embodiments, the oligonucleotide primers used in a PCR reaction, include, but are not limited to, at least the purified nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. In some embodiments, the oligonucleotide primers used in a PCR reaction, include, but are not limited to, at least the purified nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 4. In some embodiments, the oligonucleotide primers used in a PCR reaction, include, but are not limited to, at least the purified nucleic acids of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO: 4. In some embodiments, the oligonucleotide primers used in a PCR reaction, include, but are not limited to, at least the purified nucleic acids of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. In some embodiments, the oligonucleotide primers used in a PCR reaction, include, but are not limited to, at least the purified nucleic acids of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

In one embodiment, the PCR amplification further comprises adding a control primer pair to the PCR reaction. In one embodiment, the control primer pair amplifies a region of the human genome. In one embodiment, the control primer pair amplifies a region of human chromosome 10q23.33. In another embodiment, the control primer pair amplifies a region of the CYP2C19 gene. In a further embodiment, the amplified region is between 100 and 4000 nucleotides in length. In another embodiment, the control primer pair comprises the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the control primer pair amplifies an about 539bp fragment of exon 4 of the CYP2C19 gene. In further embodiments, the control primer pair amplifies a region of the beta-actin gene, the GAPDH gene, or 18S rRNA.

The nucleic acid sequence of SEQ ID NO: 5, wherein the nucleic acid bases are written in the 5' to 3 ' direction, is:

1 CCAGCTAGGCTGTAATTGTTAATTCG

The nucleic acid sequence of SEQ ID NO: 6, wherein the nucleic acid bases are written in the 5' to 3 ' direction, is:

1 CCTGTGCATAAAATAAAGAACTTTGCCA

PCR conditions

The PCR amplification of the present invention is performed under standard conditions used for PCR. The predicted Tm is calculated using standard algorithms, such as the nearest neighbor algorithm (Von-Ahsen et al, Clinical Chemistry 45(12):2094-2101 (1999)).

Detection of PCR Amplification Products

Allele-specific amplification can be detected during extension of the allele-specific primer using any suitable kinetic PCR platform, or post-PCR by agarose gel electrophoresis, for example. Many methods are known in the art that can be used for detecting PCR amplification products produced during or after amplification.

Methods of Treatment

Cardiovascular disease

In one aspect, the present invention provides a method for treating a cardiovascular disease in a subject, the method comprising: (a) determining the CYP2C19 gene haplotype of the subject by PCR amplification using at least one of the primers comprising SED ID NOS: 1-4, or a combination thereof; (b) determining whether to administer an anti-platelet drug metabolized by CYP2C19 based on the haplotype of the subject; and (c) administering said anti-platelet drug metabolized by CYP2C19 or an alternative therapy to the subject.

In one embodiment, the method further comprises determining the dose of the antiplatelet drug metabolized by CYP2C19 to be administered based on the haplotype of the subject. In another embodiment, the administering step comprises giving an increased dose of an anti-platelet drug metabolized by CYP2C19 to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

In one embodiment, the administering step comprises giving a standard dose of an anti-platelet drug metabolized by CYP2C19 to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In a further embodiment, the method comprises monitoring the subject for bleeding complications if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene.

The dose(s) of an anti-platelet drug metabolized by CYP2C19 to be administered according to the methods described herein can vary, for example, not only depending upon the haplotype of the subject.

The standard dose (s) of an anti-platelet drug metabolized by CYP2C19 to be administered according to the methods described herein can vary, for example, depending upon the identity, size, and condition of the subject being treated and can further depend upon the route by which an anti-platelet drug metabolized by CYP2C19 according to the methods described herein, is to be administered, if applicable, and the effect which the practitioner desires the anti-platelet drug metabolized by CYP2C19 according to the invention to have upon the target of interest. These amounts can be readily determined by one of skill in the art. Any of the therapeutic applications described herein can be applied to any subject in need of such therapy, including, for example, a mammal such as a human.

Appropriate dosing regimens can also be determined by one of skill in the art without undue experimentation, in order to determine, for example, whether to administer the agent in one single dose or in multiple doses, and in the case of multiple doses, to determine an effective interval between doses.

In certain embodiments, a drug metabolized by CYP2C19 to be administered according to the methods described herein can be administered alone, or in combination with other drugs (e.g., aspirin), therapies, small molecules, biologically active or inert compounds, or other additive intended to enhance the delivery, efficacy, tolerability, or function of the anti-platelet drug metabolized by CYP2C19.

Therapy dose and duration will depend on a variety of factors in addition to the haplotype of the subject, such as the disease type, patient age, therapeutic index of the drugs, patient weight, and tolerance of toxicity. The skilled clinician using standard

pharmacological approaches can determine the dose of a particular therapeutic and duration of therapy for a particular patient in view of the above stated factors and the haplotype of the individual. An increased dose(s) of an anti-platelet drug metabolized by CYP2C19 to be administered according to the methods described herein, includes a dose that is higher than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. In one embodiment, an increased dose can be a dose of more than about 75mg per day. In another embodiment, an increased dose can be a dose between about 75mg and about 600mg per day. The response to treatment can be monitored by analysis of coagulation measures, and one of skill in the art, such as a clinician, will adjust the dose and duration of therapy based on the response to treatment revealed by these measurements.

In one embodiment, the cardiovascular disease is acute coronary syndrome. In another embodiment, the cardiovascular disease is acute coronary syndrome with

percutaneous coronary intervention. In another embodiment, the cardiovascular disease is peripheral vascular disease. In a further embodiment, the cardiovascular disease is cerebrovascular disease. In yet another embodiment, the cardiovascular disease is symptomatic atherosclerosis. In one embodiment, the cardiovascular disease is ST elevation myocardial infarction (STEMI). In another embodiment, the cardiovascular disease is coronary thrombosis. In a further embodiment, the cardiovascular disease is recent myocardial infarction. In yet another embodiment, the cardiovascular disease is recent stroke. In another embodiment, the cardiovascular disease is a combination of any of the above stated cardiovascular diseases.

In one embodiment, recent myocardial infarction, or recent stroke, includes but is not limited to a myocardial infarction or stroke in a subject within the last about 24 hours, about 48 hours, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, and about 8 weeks.

In one embodiment, the anti-platelet drug metabolized by CYP2C19 is clopidogrel. In another embodiment, the anti -platelet drug metabolized by CYP2C19 is prasugrel. In a further embodiment, the anti-platelet drug metabolized by CYP2C19 is clopidogrel, prasugrel, or a combination thereof.

The drug clopidogrel, is also known by the brand name "Plavix®", and is a P2Y12 inhibitor. Clopidogrel is a thienopyridine derivative, and binds specifically and irreversibly to the platelet P2RY12 purinergic receptor, inhibiting ADP-mediated platelet activation and aggregation. Clopidogrel is a prodrug that is absorbed in the intestine and activated in the liver. CYP2C19 plays a role in the conversion of clopidogrel from the prodrug to the active metabolite. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at plavix.com.

In one embodiment, the alternative therapy is a P2Y12 inhibitor. In another embodiment, the P2Y12 inhibitor is Prasugrel. In a further embodiment, the P2Y12 inhibitor is Ticagrelor. In yet another embodiment, the P2Y12 inhibitor is, prasugrel, ticagrelor or a combination thereof.

The drug prasugrel, is also known by the brand name "Effient®", and is a P2Y12 inhibitor. Prasugrel is a thienopyridine derivative, and binds specifically and irreversibly to the platelet P2RY12 purinergic receptor, inhibiting ADP-mediated platelet activation and aggregation. Prasugrel is a prodrug that is metabolized to a pharmacologically active metabolite. CYP2C19 does not play a major role in the conversion of prasugrel from the prodrug to the active metabolite.

The drug ticagrelor, is also known by the brand name "Brilinta®", and is a P2Y12 inhibitor. Ticagrelor is a nucleoside analog, and binds reversibly to the platelet P2RY12 purinergic receptor, inhibiting ADP-mediated platelet activation and aggregation. Ticagrelor does not require hepatic activation.

The dose(s) of an alternative therapy to be administered according to the methods described herein can vary, for example, not only depending upon the haplotype of the subject but also the identity, size, and condition of the subject being treated and can further depend upon the route by which the alternative therapy according to the methods described herein, is to be administered, if applicable, and the effect which the practitioner desires the alternative therapy according to the invention to have upon the target of interest. These amounts can be readily determined by one of skill in the art. Any of the therapeutic applications described herein can be applied to any subject in need of such therapy, including, for example, a mammal such as a human.

In certain embodiments, an alternative therapy to be administered according to the methods described herein can be administered alone, or in combination with other drugs, therapies, small molecules, biologically active or inert compounds, or other additive intended to enhance the delivery, efficacy, tolerability, or function of the alternative therapy.

pharmacological approaches can determine the dose of a particular therapeutic and duration of therapy for a particular patient in view of the above stated factors and the haplotype of the individual. The response to treatment can be monitored by analysis of coagulation measures, and one of skill in the art, such as a clinician, will adjust the dose and duration of therapy based on the response to treatment revealed by these measurements.

Gastrointestinal disease

In one aspect, the present invention provides a method for treating a gastrointestinal disease in a subject, the method comprising: (a) determining the CYP2C19 gene haplotype of the subject by PCR amplification using at least one of the primers comprising SED ID NOS: 1-4, or a combination thereof; (b) determining a dose of a proton pump inhibitor to be administered based on the haplotype of the subject; and (c) administering said dose to the subject.

In one embodiment, the administering step comprises giving a standard dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In one embodiment, the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In another embodiment, the administering step comprises giving an increased dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

In one embodiment, the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C),

cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene. In another embodiment, the administering step comprises giving a decreased dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene.

The dose(s) of a proton pump inhibitor to be administered according to the methods described herein can vary, for example, not only depending upon the haplotype of the subject.

The standard dose (s) of a proton pump inhibitor to be administered according to the methods described herein can vary, for example, depending upon the identity, size, and condition of the subject being treated and can further depend upon the route by which a proton pump inhibitor according to the methods described herein, is to be administered, if applicable, and the effect which the practitioner desires the proton pump inhibitor according to the invention to have upon the target of interest. These amounts can be readily determined by one of skill in the art. Any of the therapeutic applications described herein can be applied to any subject in need of such therapy, including, for example, a mammal such as a human.

In certain embodiments, a proton pump inhibitor to be administered according to the methods described herein can be administered alone, or in combination with other drugs, therapies, small molecules, biologically active or inert compounds, or other additive intended to enhance the delivery, efficacy, tolerability, or function of the proton pump inhibitor. Therapy dose and duration will depend on a variety of factors in addition to the haplotype of the subject, such as the disease type, patient age, therapeutic index of the drugs, patient weight, and tolerance of toxicity. The skilled clinician using standard

pharmacological approaches can determine the dose of a particular therapeutic and duration of therapy for a particular patient in view of the above stated factors and the haplotype of the individual. An increased dose(s) of a proton pump inhibitor to be administered according to the methods described herein, includes a dose that is higher than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. A decreased dose(s) of a proton pump inhibitor to be administered according to the methods described herein, includes a dose that is lower than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. In one embodiment, an increased dose can be a dose of more than about 20mg per day. In another embodiment, an increased dose can be a dose between about 20mg and about 400mg per day. In a further embodiment, a decreased dose can be a dose of less than about 40mg per day. In another embodiment, a decreased dose can be a dose between about 5mg and about lOOmg per day. The response to treatment can be monitored by analysis of symptoms, and one of skill in the art, such as a clinician, will adjust the dose and duration of therapy based on the response to treatment revealed by these measurements.

In one embodiment, the gastrointestinal disease is dyspepsia. In another embodiment, the gastrointestinal disease is peptic ulcer disease. In another embodiment, the

gastrointestinal disease is gastroesophageal reflux disease (GERD). In a further embodiment, the gastrointestinal disease is laryngopharyngeal reflux. In yet another embodiment, the gastrointestinal disease is Barrett's esophagus. In one embodiment, the gastrointestinal disease is stress gastritis prevention. In another embodiment, the gastrointestinal disease is gastrinomas. In a further embodiment, the gastrointestinal disease is Zollinger-Ellison syndrome. In yet another embodiment, the gastrointestinal disease is erosive esophagitis. In another embodiment, the gastrointestinal disease is a combination of any of the above stated gastrointestinal diseases.

In one embodiment, the proton pump inhibitor is lansoprazole. In another embodiment, the proton pump inhibitor is omeprazole. In a further embodiment, the proton pump inhibitor is pantoprazole. In yet another embodiment, the proton pump inhibitor is rabeprazole. In another embodiment, the proton pump inhibitor is esomeprazole. In one embodiment, the proton pump inhibitor is selected from the group consisting of lansoprazole, omeprazole, pantoprazole, rabeprazole, and esomeprazole. In another embodiment, the proton pump inhibitor is a combination of any of the above stated proton pump inhibitors.

The drug lansoprazole, is also known by the brand name "Prevacid®", and is a proton pump inhibitor. CYP2C19 can play a role in the metabolism of lansoprazole into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at prevacid.com.

The drug omeprazole, is also known by the brand name "Prilosec OTC®", and is a proton pump inhibitor. CYP2C19 can play a role in the metabolism of omeprazole into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at prilosecOTC.com.

The drug pantoprazole, is also known by the brand name "Protonix®", and is a proton pump inhibitor. CYP2C19 can play a role in the metabolism of pantoprazole into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug rabeprazole, is also known by the brand name "AcipHex®", and is a proton pump inhibitor. CYP2C19 can play a role in the metabolism of rabeprazole into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at aciphex.com.

The drug esomeprazole, is also known by the brand name "Nexium®", and is a proton pump inhibitor. CYP2C19 can play a role in the metabolism of esomeprazole into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at purplepill.com.

Epilepsy

In one aspect, the present invention provides a method for treating epileptic seizures in a subject, the method comprising: (a) determining the CYP2C19 gene haplotype of the subject by PCR amplification using at least one of the primers comprising SED ID NOS: 1-4, or a combination thereof; (b) determining a dose of an anti-epileptic drug to be administered based on the haplotype of the subject; and (c) administering said dose to the subject.

In one embodiment, the administering step comprises giving a standard dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

In one embodiment, the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

The dose(s) of an anti-epileptic drug to be administered according to the methods described herein can vary, for example, not only depending upon the haplotype of the subject.

The standard dose(s) of an anti-epileptic drug to be administered according to the methods described herein can vary, for example, depending upon the the identity, size, and condition of the subject being treated and can further depend upon the route by which an anti- epileptic drug according to the methods described herein, is to be administered, if applicable, and the effect which the practitioner desires the anti-epileptic drug according to the invention to have upon the target of interest. These amounts can be readily determined by one of skill in the art. Any of the therapeutic applications described herein can be applied to any subject in need of such therapy, including, for example, a mammal such as a human.

In certain embodiments, an anti-epileptic drug to be administered according to the methods described herein can be administered alone, or in combination with other drugs, therapies, small molecules, biologically active or inert compounds, or other additive intended to enhance the delivery, efficacy, tolerability, or function of the anti-epileptic drug.

Therapy dose and duration will depend on a variety of factors in addition to the haplotype of the subject, such as the disease type, patient age, therapeutic index of the drugs, patient weight, and tolerance of toxicity. The skilled clinician using standard pharmacological approaches can determine the dose of a particular therapeutic and duration of therapy for a particular patient in view of the above stated factors and the haplotype of the individual. An increased dose(s) of an anti-epileptic drug to be administered according to the methods described herein, includes a dose that is higher than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. A decreased dose(s) of an anti-epileptic drug to be administered according to the methods described herein, includes a dose that is lower than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. The response to treatment can be monitored by analysis of symptoms, and one of skill in the art, such as a clinician, will adjust the dose and duration of therapy based on the response to treatment revealed by these measurements.

In one embodiment, an increased dose can be a dose of diazepam of more than about lOmg per day. In another embodiment, an increased dose of diazepam can be a dose between about lOmg and about lOOmg per day. In a further embodiment, a decreased dose of diazepam can be a dose of less than about 40mg per day. In another embodiment, a decreased dose of diazepam can be a dose between about 2mg and about 40mg per day.

In one embodiment, an increased dose can be a dose of clobazam of more than about 30mg per day. In another embodiment, an increased dose of clobazam can be a dose between about 30mg and about lOOmg per day. In a further embodiment, a decreased dose of clobazam can be a dose of less than about 50mg per day. In another embodiment, a decreased dose of clobazam can be a dose between about 2mg and about 50mg per day.

In one embodiment, an increased dose can be a dose of clonazepam of more than about 4mg per day. In another embodiment, an increased dose of clonazepam can be a dose between about 4mg and about 30mg per day. In a further embodiment, a decreased dose of clonazepam can be a dose of less than about 15mg per day. In another embodiment, a decreased dose of clonazepam can be a dose between about 0. lmg and about 15mg per day.

In one embodiment, an increased dose can be a dose of clorazepate of more than about 40mg per day. In another embodiment, an increased dose of clorazepate can be a dose between about 40mg and about 150mg per day. In a further embodiment, a decreased dose of clorazepate can be a dose of less than about 60mg per day. In another embodiment, a decreased dose of clorazepate can be a dose between about 5mg and about 60mg per day.

In one embodiment, an increased dose can be a dose of phenytoin of more than about 300mg per day. In another embodiment, an increased dose of phenytoin can be a dose between about 300mg and about 3g per day. In a further embodiment, a decreased dose of phenytoin can be a dose of less than about 600mg per day. In another embodiment, a decreased dose of phenytoin can be a dose between about lOmg and about 600mg per day.

In one embodiment, an increased dose can be a dose of fosphenytoin of more than about 300mg per day. In another embodiment, an increased dose of fosphenytoin can be a dose between about 300mg and about 3g per day. In a further embodiment, a decreased dose of fosphenytoin can be a dose of less than about 600mg per day. In another embodiment, a decreased dose of fosphenytoin can be a dose between about lOmg and about 600mg per day.

In one embodiment, an increased dose can be a dose of phenobarbital of more than about 30mg per day. In another embodiment, an increased dose of phenobarbital can be a dose between about 30mg and about 500mg per day. In a further embodiment, a decreased dose of phenobarbital can be a dose of less than about 120mg per day. In another embodiment, a decreased dose of phenobarbital can be a dose between about 5mg and about 120mg per day.

In one embodiment, an increased dose can be a dose of primidone of more than about lOOmg per day. In another embodiment, an increased dose of primidone can be a dose between about lOOmg and about 3g per day. In a further embodiment, a decreased dose of primidone can be a dose of less than about 250mg per day. In another embodiment, a decreased dose of primidone can be a dose between about 5mg and about 250mg per day.

In one embodiment, epilepsy is a syndrome involving episodic abnormal electrical activity in the brain that can result in numerous epileptic seizures. In some embodiments, treatment of epilepsy and epileptic seizures as described herein can result in a decrease in the number and/or duration and/or severity of seizures.

In one embodiment, the anti-epileptic drug is diazepam. In another embodiment, the anti-epileptic drug is clobazam. In a further embodiment, the anti-epileptic drug is clonazepam. In yet another embodiment, the anti-epileptic drug is clorazepate. In another embodiment, the anti-epileptic drug is nordazepam. In one embodiment, the anti-epileptic drug is phenytoin. In another embodiment, the anti-epileptic drug is mephenytoin. In a further embodiment, the anti-epileptic drug is fosphenytoin. In yet another embodiment, the anti-epileptic drug is ethotoin. In another embodiment, the anti-epileptic drug is

phenobarbital. In a further embodiment, the anti-epileptic drug is primidone. In yet another embodiment, the anti-epileptic drug is hexobarbital. In another embodiment, the anti- epileptic drug is methylphenobarbital. In one embodiment, the anti-epileptic drug is selected from the group consisting of diazepam, clobazam, clonazepam, clorazepate, nordazepam, phenytoin, mephenytoin, fosphenytoin, ethotoin, phenobarbital, primidone, hexobarbital, methylphenobarbital. In another embodiment, the anti-epileptic drug is a combination of any of the above stated anti-epileptic drugs.

The drug diazepam, is also known by the brand name "Valium®", and is a benzodiazepine and central nervous system depressant. CYP2C19 can play a role in the metabolism of diazepam into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug clobazam, is also known by the brand name "Onfi®", and is a

benzodiazepine and central nervous system depressant. CYP2C19 can play a role in the metabolism of clobazam into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at onfi.com.

The drug clonazepam, is also known by the brand name "Klonopin®", and is a benzodiazepine and central nervous system depressant. CYP2C19 can play a role in the metabolism of clonazepam into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug clorazepate, is also known by the brand name "Tranxene®", and is a benzodiazepine and central nervous system depressant. CYP2C19 can play a role in the metabolism of clorazepate into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug nordazepam, is also known as desoxydemoxepam, nordiazepam, and desmethyldiazepam, and is a benzodiazepine and central nervous system depressant.

CYP2C19 can play a role in the metabolism of nordazepam into inactive metabolites.

Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug phenytoin, is also known by the brand name "Dilantin®" or "Phenytek®", and is a hydantoin. CYP2C19 can play a role in the metabolism of phenytoin into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at dilantin.com.

The drug mephenytoin is a hydantoin. CYP2C19 can play a role in the metabolism of mephenytoin into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug fosphenytoin, is also known by the brand name "Cerebyx®", and is a hydantoin. Fosphenytoin is a phenytoin prodrug. CYP2C19 can play a role in the metabolism of fosphenytoin into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug ethotoin, is also known by the brand name "Peganone®", and is a hydantoin. CYP2C19 can play a role in the metabolism of ethotoin into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug phenobarbital, is also known by the brand name "Luminal®", and is a barbiturate and central nervous system depressant. CYP2C19 can play a role in the metabolism of phenobarbital into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug primidone, is also known by the brand name "Mysoline®", and is a pyrimidinedione. CYP2C19 can play a role in the metabolism of primidone into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug hexobarbital, is also known as hexobarbitone and is a barbiturate and central nervous system depressant. CYP2C19 can play a role in the metabolism of hexobarbital into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug methylphenobarbital, is also known as mephobarbital, and mephobarbitone, and is also known by the brand name "Mebaral®", and is a barbiturate and central nervous system depressant. CYP2C19 can play a role in the metabolism of methylphenobarbital into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

Mood Disorders

In one aspect, the present invention provides a method for treating a mood disorder in a subject, the method comprising: (a) determining the CYP2C19 gene haplotype of the subject by PCR amplification using at least one of the primers comprising SED ID NOS: 1-4, or a combination thereof; (b) determining a dose of an anti-depressant drug to be

administered based on the haplotype of the subject; and (c) administering said dose to the subject.

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

The dose(s) of an anti-depressant drug to be administered according to the methods described herein can vary, for example, not only depending upon the haplotype of the subject.

The standard dose(s) of an anti-depressant drug to be administered according to the methods described herein can vary, for example, depending upon the the identity, size, and condition of the subject being treated and can further depend upon the route by which an antidepressant drug according to the methods described herein, is to be administered, if applicable, and the effect which the practitioner desires the anti-depressant drug according to the invention to have upon the target of interest. These amounts can be readily determined by one of skill in the art. Any of the therapeutic applications described herein can be applied to any subject in need of such therapy, including, for example, a mammal such as a human.

In certain embodiments, an anti-depressant drug to be administered according to the methods described herein can be administered alone, or in combination with other drugs, therapies, small molecules, biologically active or inert compounds, or other additive intended to enhance the delivery, efficacy, tolerability, or function of the anti-depressant drug. Therapy dose and duration will depend on a variety of factors in addition to the haplotype of the subject, such as the disease type, patient age, therapeutic index of the drugs, patient weight, and tolerance of toxicity. The skilled clinician using standard

pharmacological approaches can determine the dose of a particular therapeutic and duration of therapy for a particular patient in view of the above stated factors and the haplotype of the individual. An increased dose(s) of an anti-depressant drug to be administered according to the methods described herein, includes a dose that is higher than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. A decreased dose(s) of an anti-depressant drug to be administered according to the methods described herein, includes a dose that is lower than would be administered by one of skill in the art, taking into account all of the above stated factors for that individual. The response to treatment can be monitored by analysis of symptoms, and one of skill in the art, such as a clinician, will adjust the dose and duration of therapy based on the response to treatment revealed by these measurements.

In one embodiment, an increased dose can be a dose of amitriptyline of more than about 25mg per day. In another embodiment, an increased dose of amitriptyline can be a dose between about 25mg and about 500mg per day. In a further embodiment, a decreased dose of amitriptyline can be a dose of less than about 150mg per day. In another

embodiment, a decreased dose of amitriptyline can be a dose between about 5mg and about 150mg per day.

In one embodiment, an increased dose can be a dose of clomipramine of more than about 25mg per day. In another embodiment, an increased dose of clomipramine can be a dose between about 25mg and about 300mg per day. In a further embodiment, a decreased dose of clomipramine can be a dose of less than about lOOmg per day. In another embodiment, a decreased dose of clomipramine can be a dose between about 5mg and about lOOmg per day.

In one embodiment, an increased dose can be a dose of imipramine of more than about 30mg per day. In another embodiment, an increased dose of imipramine can be a dose between about 30mg and about 400mg per day. In a further embodiment, a decreased dose of imipramine can be a dose of less than about lOOmg per day. In another embodiment, a decreased dose of imipramine can be a dose between about 5mg and about lOOmg per day.

In one embodiment, an increased dose can be a dose of citalopram of more than about 20mg per day. In another embodiment, an increased dose of citalopram can be a dose between about 20mg and about 50mg per day. In a further embodiment, a decreased dose of citalopram can be a dose of less than about 30mg per day. In another embodiment, a decreased dose of citalopram can be a dose between about 5mg and about 30mg per day.

In one embodiment, an increased dose can be a dose of fluvoxamine of more than about 50mg per day. In another embodiment, an increased dose of citalopram can be a dose between about 50mg and about 400mg per day. In a further embodiment, a decreased dose of citalopram can be a dose of less than about lOOmg per day. In another embodiment, a decreased dose of citalopram can be a dose between about 5mg and about lOOmg per day.

In one embodiment, a mood disorder can include, but is not limited to depressive disorders (e.g., major depressive disorder (also known as clinical depression, or major depression)), bipolar disorders, obsessive compulsive disorder (OCD), anxiety disorders (e.g., panic disorder, post traumatic stress disorder (PTSD), and the like. Mood disorders can affect different parts of the brain and can affect both the physiology of the brain and/or behavorial coping responses and/or the emotional state of an individual. Mood disorders can affect an individuals ability to cope with certain difficult or stressful situations. In some embodiments, treatment of a mood disorder as described herein can result in a change in the physiology of the brain and/or a change in behavioral responses such that an individual is better able to cope with stressful situations.

In one embodiment, the anti-depressant drug is diazepam. In another embodiment, the anti-depressant drug is amitriptyline. In a further embodiment, the anti-depressant drug is clomipramine. In yet another embodiment, the anti-depressant drug is imipramine. In another embodiment, the anti-depressant drug is citalopram. In one embodiment, the antidepressant drug is moclobemide. In another embodiment, the anti-depressant is fluvoxamine. In one embodiment, the anti-depressant drug is selected from the group consisting of diazepam, amitriptyline, clomipramine, imipramine, citalopram, moclobemide, and fluvoxamine. In another embodiment, the antidepressant drug is a combination of any of the above stated anti-depressant drugs.

The drug amitriptyline, is also known by the brand name "Elavil®", and is a tricyclic antidepressant (TCA). CYP2C19 can play a role in the metabolism of amitriptyline into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug clomipramine, is also known by the brand name "Anafranil®", and is a tricyclic antidepressant (TCA). CYP2C19 can play a role in the metabolism of clomipramine into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug imipramine, is also known as melipramine, and by the brand name

"Tofranil®", and is a tricyclic antidepressant (TCA). CYP2C19 can play a role in the metabolism of imipramine into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug citalopram, is also known by the brand name "Celexa®", and is a selective serotonin reuptake inhibitor (SSRI). CYP2C19 can play a role in the metabolism of citalopram into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at celexa.com.

The drug moclobemide is a reversible monoamine oxidase inhibitor (MAOI).

CYP2C19 can play a role in the metabolism of moclobemide into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art.

The drug fluvoxamine, is also known by the brand name "Luvox CR®", and is a selective serotonin reuptake inhibitor (SSRI). CYP2C19 can play a role in the metabolism of fluvoxamine into inactive metabolites. Indications, dosage and methods of administration of this drug are known to one of skill in the art. For additional information, see WorldWideWeb at luvoxcr.com.

Methods of Determining the CYP2C19 Haplotype

In one embodiment, the haplotype of the CYP2C19 gene is determined using PCR amplification. For example, the PCR amplification can be allele-specific PCR. In one embodiment, the purified nucleic acid oligonucleotides of the present invention are used. As disclosed in detail above, the oligonucleotides can be used to determine the diplotype of a sample from a subject. In one embodiment the PCR amplification comprises at least one PCR reaction using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof. In another embodiment, the PCR amplification comprises at least two PCR reactions using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof. In a further embodiment, the PCR amplification comprises at least three PCR reactions using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof. In yet another embodiment, the PCR amplification comprises at least four PCR reactions using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

In one embodiment, the haplotype comprises the presence or absence of the polymorphic c.-806C>T (*17) and c. lA>G (*4) alleles. In one embodiment, the method further comprises determining the presence or absence of one or more additional CYP2C19 polymorphic alleles. In one embodiment, the CYP2C19 gene alleles include, but are not limited to the * 1A allele, * 1B allele, * 1C allele, *2A allele, *2B allele, *2C allele, *2D allele, *3A allele, *3B allele, *4A allele, *4B allele, *5A allele, *5B allele, *6 allele, *7 allele, *8 allele, *9 allele, * 10 allele, * 1 1 allele, * 12 allele, * 13 allele, * 14 allele, * 15 allele, * 16 allele, * 17 allele, * 18 allele, * 19 allele, *20 allele, *21 allele, *22 allele, *23 allele, *24 allele, *25 allele, *26 allele, *27 allele, and *28 allele.

In one embodiment, the subject is a human. In one embodiment, the subject is a cat, dog, horse, or cow.

In one embodiment, the sample comprises a blood sample, a salvia sample, or a buccal swab. In one embodiment, the sample can comprise blood, serum, sputum, lacrimal secretions, semen, vaginal secretions, fetal tissue, skin tissue, muscle tissue, amniotic fluid, or a combination thereof.

In another embodiment, a nucleic acid is extracted from the sample. In a further embodiment, the nucleic acid comprises genomic DNA. In another embodiment, the nucleic acid comprises mRNA, or a cDNA derived therefrom. In one embodiment the nucleic acid extracted from the sample is used as a template for PCR amplification.

In one embodiment, the method further comprises adding a control primer pair to the PCR reaction. In one embodiment, the control primer pair amplifies a region of the human genome. In one embodiment, the control primer pair amplifies a region of human

chromosome 10q23.33. In another embodiment, the control primer pair amplifies a region of the CYP2C19 gene. In a further embodiment, the amplified region is between 100 and 4000 nucleotides in length. In another embodiment, the control primer pair comprises the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6. Methods of Administering

Indications, dosage and methods of administration of the drugs of the present invention are known to one of skill in the art. In some embodiments, a drug of the present invention can be supplied in the form of a pharmaceutical composition, comprising an isotonic excipient prepared under sufficiently sterile conditions for human administration. Choice of the excipient and any accompanying elements of the composition will be adapted in accordance with the route and device used for administration. In some embodiments, a composition comprising a drug of the present invention can also comprise, or be

accompanied with, one or more other ingredients that facilitate the delivery or functional mobilization of the drugs of the present invention.

These methods described herein are by no means all-inclusive, and further methods to suit the specific application are understood by the ordinarily skilled artisan. Moreover, the effective amount of the compositions can be further approximated through analogy to compounds known to exert the desired effect.

According to the invention, a pharmaceutically acceptable carrier can comprise any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Any conventional media or agent that is compatible with the active compound can be used. Supplementary active compounds can also be incorporated into the compositions.

Pharmaceutical compositions for use in accordance with the invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. The therapeutic compositions of the invention can be formulated for a variety of routes of administration, including systemic and topical or localized administration.

Techniques and formulations generally can be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, Pa (20^th ed., 2000), the entire disclosure of which is herein incorporated by reference.

Any of the therapeutic applications described herein can be applied to any subject in need of such therapy, including, for example, a mammal such as a dog, a cat, a cow, a horse, a rabbit, a monkey, a pig, a sheep, a goat, or a human.

Administration of a drug of the present invention is not restricted to a single route, but may encompass administration by multiple routes. Multiple administrations may be sequential or concurrent. Other modes of application by multiple routes will be apparent to one of skill in the art. Methods of Diagnosis

In one aspect, the present invention provides a method for determining a dose of drug inactivated by CYP2C19 to be administered to a subject, the method comprising determing the CYP2C19 haplotype of the subject by PCR amplification using at least one of the primers of SEQ ID NO: 1, 2, 3, 4, or a combination thereof, wherein a CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene indicates that a standard dose of the drug is to be administered to the subject, and wherein a CYP2C19 gene diplotype comprising cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene indicates that an increased dose of the drug is to be administered to the subject, and wherein a

CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/guanosine(G), or guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene indicates that a decreased dose of the drug is to be administered to a subject. In one embodiment, the drug is proton pump inhibitor. In a further embodiment, the drug is an anti- epileptic drug. In another embodiment the drug is an anti-depressant.

In another aspect, the present invention provides a method for determining a course of treatment with an anti-platelet drug metabolized by CYP2C19, the method comprising determing the CYP2C19 haplotype of a subject by PCR amplification using at least one of the primers of SEQ ID NO: 1, 2, 3, 4, or a combination thereof, wherein a CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or

thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene indicates that a standard dose of anti-platelet drug metabolized by CYP2C19 is to be administered to the subject, and wherein a CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C),

cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene indicates that either an increased dose of an anti-platelet drug metabolized by CYP2C19 is to be administered to the subject, or an alternative therapy is to be administered to a subject. In one embodiment, the anti-platelet drug metabolized by CYP2C19 is clopidogrel, or prasugrel. In another embodiment, the course of treatment further comprises monitoring the subject for bleeding complications if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene. In a further embodiment, the alternative therapy is a P2Y12 inhibitor. In another embodiment, the P2Y12 inhibitor is prasugrel, ticagrelor, or a combination thereof.

In another aspect, the present invention provides a method for predicting the metabolizer phenotype of a subject for a drug inactivated by CYP2C19, the method comprising determing the CYP2C19 haplotype of a subject by PCR amplification using at least one of the primers of SEQ ID NO: 1, 2, 3, 4, or a combination thereof, wherein a CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C) at position -806 of the

CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene indicates that a subject is an extensive metabolizer, and wherein a CYP2C19 gene diplotype comprising cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene indicates that a subject is an ultrarapid metabolizer, and wherein a CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or

guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene indicates that a subject is an intermediate or poor metabolizer. In one embodiment, the drug is proton pump inhibitor. In a further embodiment, the drug is an anti-epileptic drug. In another embodiment the drug is an anti-depressant.

In another aspect, the present invention provides a method for predicting the metabolizer phenotype of a subject for an anti-platelet drug metabolized by CYP2C19, the method comprising determing the CYP2C19 haplotype of a subject by PCR amplification using at least one of the primers of SEQ ID NO: 1, 2, 3, 4, or a combination thereof, wherein CYP2C19 gene diplotype comprising cytidine(C)/cytidine(C) at position -806 of the

guanos ine(G)/guanosine(G) at position 1 of the CYP2C19 gene indicates that a subject is an intermediate or poor metabolizer. In one embodiment, the anti-platelet drug metabolized by CYP2C19 is clopidogrel, or prasugrel. In a further embodiment, the alternative therapy is a P2Y12 inhibitor. In another embodiment, the P2Y12 inhibitor is prasugrel, ticagrelor, or a combination thereof.

Kits of the Invention

In one aspect, kits are provided that comprise the nucleic acid sequences of the present invention. As disclosed in detail above, the nucleic acid sequences used in said kits, such as oligonucleotides and primers, can be allele-specific. For example, a particular position of an oligonucleotide can be complementary with an allele of a target polynucleotide sequence (e.g., the C.-806OT (* 17) and c. lA>G (*4) alleles of CYP2C19 gene), thus allele- specific primers are capable of discriminating between different haplotypes of a target polynucleotide (e.g., the *4A, *4B, *17 haplotypes of CYP2C19 gene). The 3 ' nucleotide of the allele-specific primers is complementary to one allele of a target polynucleotide sequence (e.g., C.-806OT and c.1 A>G alleles of CYP2C19 gene). Allele-specific primers can have less than 100% identity to any allele target polynucleotide. Allele-specific primers can include deliberate mismatches (at a different postion than the 3 ' allele-specific nucleobase) such that the oligonucleotide is not exactly complementary to the target polynucleotide. Allele-specific oligonucleotides can facilitate PCR amplification only if the allele to which the 3' nucleobase is complementary to is present. PCR amplification is suppressed if the allele-specific nucleobase is not present. The nucleic acid sequences utilized in kits can include, but is not limited to, any of the nucleic acid sequences disclosed above.

The kits of the invention may also include reagents necessary or useful for the amplification of target nucleic acids, which may include, but is not limited to, DNA polymerase enzymes, primer extension deoxynucleotide triphosphates, and any buffer or other solutions generally used in PCR amplification reactions and kits.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention.

EXAMPLES

A number of Examples are provided below to facilitate a more complete

understanding of the present invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only. Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only, since alternative methods can be utilized to obtain similar results.

EXAMPLE 1 - An Allele-Specific PCR System for Rapid Detection and Discrimination of the CYP2C19*4A, *4B, and *17 Alleles

CYP2C19 is involved in the metabolism of clinically relevant drugs including, but not limited to, the antiplatelet prodrugs clopidogrel and prasugrel, proton-pump inhibitors, anti- epileptic drugs, and anti-depressants which has prompted interest in clinical CYP2C19 genotyping. The CYP2C19*4B allele is defined by both gain-of-function [c.-806OT (*17)] and loss-of-function [c. lA>G (*4)] variants on the same haplotype; however, current genotyping assays are unable to determine the phase of these variants. Thus, an assay was developed that could rapidly detect and discriminate the related *4A, *4B, and *17 alleles.

Two cohorts were used to develop (n=20) and validate (n=135) an allele-specific PCR (ASP) assay comprised of four unique primer mixes that specifically interrogate the defining *17 and *4 variants. Results were confirmed by genotyping and allele-specific cloning and sequencing.

The ASP assay was developed using samples with known genotypes including the *1, *4A, *4B, and/or *17 alleles. The ASP assay was validated by testing 135 blinded samples, and the results correlated completely with previous CYP2C19 genotyping. Importantly, among the six *4 carriers in this cohort, following ASP testing both samples with a *l/*4 genotype were reclassified to *1/*4A, all three samples with a *4/*l 7 genotype were reclassified to *1/*4B, and a sample with a *4/*l 7/*l 7 genotype was reclassified to *4B/*17, which were confirmed by cloning and sequencing.

A robust ASP assay is described that has the ability to refine CYP2C19 genotyping and metabolizer phenotype classification by determining the phase of the defining *17 and *4 variants, which can have utility when testing CYP2C19 for clopidogrel response.

MATERIALS AND METHODS

Samples

Samples informative for the CYP2C19*17 (c.-806OT) and *4 (c. lA>G) alleles were identified from two cohorts. One cohort was from a previously reported healthy population study on multiracial and multi-ethnic CYP2C allele and haplotype frequencies (12) and the second cohort was from a diverse patient population undergoing percutaneous coronary intervention (PCI) and treated with clopidogrel at the Mount Sinai Medical Center (New York, NY). For the healthy population cohort, peripheral blood samples were obtained from the New York Blood Center with institutional review board (IRB) approval as previously described (10, 22). Blood samples were also obtained with informed consent from unrelated healthy 100% AJ individuals from the greater New York metropolitan area (21, 23-25). All personal identifiers were removed, and isolated DNA samples were tested anonymously. For the patient cohort, peripheral blood samples were obtained with IRB approval for genetic analyses and all DNA samples were deidentified prior to genotyping. For both cohorts, genomic DNA was isolated using the Puregene^® DNA Purification kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

Genotyping

The designations of all CYP2C19 alleles refer to those defined by the Cytochrome P450 Allele Nomenclature Committee (WorldWideWeb at cypalleles.ki.se/cyp2cl9.htm) (7). Eleven variant CYP2C19 alleles (*2 - *10, *13, *17) were genotyped using the eSensor^® 2C19 Test (GenMark Diagnostics, Carlsbad, CA) as per the manufacturer's instructions and as previously described (12). The wild-type (*/) CYP2C19 allele was assigned in the absence of other detectable variant alleles and representative positive control samples for the CYP2C19 *17 and *4 alleles were confirmed by bidirectional sequencing using Mutation Surveyor software v4.0 (SoftGenetics).

CYP2C19*4B Confirmation

Potential CYP2C19 *4B carriers were confirmed by cloning and allele-specific sequencing of a 1.2 kb fragment encompassing CYP2C19*17 and *4 as previously described (21).

Allele-Specific PCR (ASP)

An ASP system that used four allele-specific primers and an internal amplification control primer set was developed to detect and discriminate the *4A, *4B, and *17 alleles (FIG. 1.). The ASP technique is also referred to as the amplification-refractory mutation system (ARMS), which is a recognized application for haplotype determination (26). Duplex PCR reactions were performed in 25 μΐ containing -100 ng of DNA, IX PCR buffer (Invitrogen), 3.0 mM MgCl₂, 0.2 mM of each dNTP, forward and reverse primers (Table 1), and 1.0 unit of Platinum^® Taq DNA Polymerase (Invitrogen). Amplification consisted of an initial denaturation step at 94°C for 5 min followed by 35 amplification cycles (94°C for 30 sec, 62°C for 30 sec, and 72°C for 1 min) and a final incubation at 72°C for 5 min. Amplification products were electrophoresed on 1.0% agarose gels and compared to DNA size standards to identify relevant CYP2C19 alleles.

Table 1: Primer Sequences for CYP2C19*4B Allele-Specific PCR (ASP) Analysis

Final Product

Primer Mix Sequence (5'-3')^!

Cone, (bp)

ASP, allele-specific PCR; bp, base pairs; FWD, forward; REV, reverse.

a Penultimate nucleotides (underlined) were mutated to increase amplification specificity; mutation-specific 3' nucleotides are bold.

¹ Primer sequence from Scott et al, 2012 (21). RESULTS

CYP2C19* 17 and *4 Carrier Identification: Specimen Cohorts

Assay development was performed using 20 DNA samples from the healthy blood donor population cohort (12, 21) that were informative for CYP2C19*17, *4A and *4B, and previously confirmed by genotyping and cloning/sequencing: (n=l), *1/*17 (n=l), *17/*17 (n=2), *l/*4B (n=6), *2/*4B (n=5), *4A/*4B (n=l), *4B/*15 (n=l), *4B/*17 (n=3). The ASP system was validated using 135 additional DNA samples from the patient cohort that previously had undergone CYP2C19 genotyping but without cloning or sequencing confirmation. The genotypes in this cohort included: *1/*1 (n=48), *l/*2 (n=28), *l/*4 (n=2), *l/*8 (n=l), *1/*17 (n=32), *2/*2 (n=4), *2/*77 (n=8), *4/*77 (n=3), *9/*77 (n=l), *17/*l 7 (n=7), and *4/*17/*17 (n=l). Prior CYP2C19 genotyping results for the validation patient cohort were blinded to all technical staff performing the assay.

Allele-specific PCR Detection of CYP2C19*4A, *4B, and * 17: Assay Development The amplification strategy of the ASP system to determine the phase of the defining *17, *4A, and *4B variants is illustrated in FIG. 2. Four separate duplex primer mixes were developed that included combinations of forward primers extending from the *17 variant [with the 3' base either C.-806C ('wild-type') or C.-806T ('mutant')] and reverse primers extending from the *4 variant [with the 3 ' base either c. lA ('wild-type') or c. lG ('mutant')], combined with internal amplification control primers (FIGS. 1 and 2). The allele-specific primers amplify an 865 bp fragment and the internal control primers a 539 bp CYP2C19 exon 4 fragment. To increase the specificity of the ASP amplification, the penultimate bases of the allele-specific primers were mutated to create a mismatch with corresponding nucleotides (Table 1 and FIG. 2).

Twenty samples from the healthy population cohort informative for the *17 and *4 alleles were used to develop the ASP assay. Sanger sequence confirmation of representative samples informative for the defining *17 and *4 variants is illustrated in FIG. 3A. FIG. 3B highlights the results from selected samples from the healthy population cohort (n=20) following ASP. All *1/*1 samples specifically amplified an 865 bp product with the wild- type allele-specific primer set and not from the *17, *4A or *4B primer mixes, and all samples that had a *17 allele (i.e., *1/*17, *17/*17, *4B/*17) specifically amplified an 865 bp product with the *17 primer set ('mutant' forward and 'wild-type' reverse). In addition, both the *4A and *4B samples, confirmed by cloning and sequencing, amplified with the appropriate primer sets (*4A: 'wild-type' forward/'mutant' reverse; *4B: 'mutant' forward/' mutant' reverse), including a rare *4A/*4B compound heterozygote (21) that amplified with both primer mixes (FIG. 3B).

Allele-specific PCR Detection of CYP2C19*4A, *4B, and * 17: Assay Validation and Dynamic Range

FIG. 3C highlights the results from selected samples from the validation patient cohort (n=135) following ASP. These samples had undergone previous CYP2C19 genotyping but without additional cloning or sequencing for *4A and/or *4B confirmation. Results from ASP confirmed previous CYP2C19 genotyping for all samples harboring the *1, *2, *4, *8, *9, and *17 alleles. Importantly, among the six *4 carriers in this cohort, both samples with a *l/*4 genotype were reclassified to *1/*4A, all three samples with a *4/*17 genotype were reclassified to *1/*4B, and a sample with the *4/*l 7/*l 7 genotype was reclassified to *4B/*17. These reclassified samples were confirmed by allele-specific cloning and sequencing as previously described (21).

The dynamic range of the ASP assay was tested by serial dilutions using two DNA samples, one *1/*4A and one *1/*4B (FIG. 4). Although the appropriate amplicons could be detected down to 2 ng of template DNA, robust amplification for both samples was consistently observed between 20 and 200 ng of template DNA. No products were detected in the picogram range of template DNA.

DISCUSSION

The identification of the CYP2C19*4B allele in the Ashkenazi Jewish, Caucasian, and Hispanic populations (12, 21) prompted the development of a rapid ASP assay that could detect and discriminate the related *4A, *4B, and *17 alleles. No currently available targeted CYP2C19 genotyping assay or sequencing platform can determine the phase of the c- 806C>T (*17) and c. lA>G (*4) variants, making the described ASP assay a useful test when implementing clinical CYP2C19 testing. The assay was developed and validated using two separate multi-ethnic cohorts (total n=155), with results completely consistent with orthogonal genotyping analyses. Although the ASP assay is a simple amplification and agarose gel electrophoresis test, fluorescently labeled PCR primers and amplicon

visualization using capillary electrophoresis can reduce the turnaround time and simplify the assay further.

Although clinical CYP2C19 genetic testing can be utilized for several indications and related medications (20), one of the most notable examples is for the antiplatelet agent clopidogrel. CYP2C19 is directly involved in the hepatic two-step bioactivation of clopidogrel to its active metabolite. Consequently, CYP2C19 loss-of-function alleles have reproducibly been associated with lower active metabolite levels (27, 28), decreased platelet inhibition among clopidogrel-treated patients (29-32), and increased adverse cardiovascular event rates among clopidogrel-treated patients with acute coronary syndromes (ACS) undergoing PCI (13, 31-36). These data prompted a 2009 product insert label revision by the U.S. Food and Drug Administration (FDA) to include a boxed warning detailing the increased risk among ACS/PCI patients who carry CYP2C19 loss-of-function alleles, particularly for CYP2C19 poor metabolizers.

Although over 25 variant CYP2C19 alleles have been reported and catalogued (7), not all have known effects on CYP2C19 enzymatic activity (4). As such, clinical CYP2C19 genotyping assays typically are limited to variant alleles with established effects on enzyme function. The most commonly tested loss-of-function allele is *2 with allele frequencies of -15% in Caucasians and Africans, and 29-35% in Asians (12, 19). The *3 allele is also often genotyped as it is prevalent among Asians with an allele frequency of 2-9% (12, 19). In addition, some commercial assays and laboratory-developed tests include the *4 - *8 alleles based on extensive in vitro evidence for their respective complete loss-of-function, despite their low frequencies in the general population. Due to the recent identification of the *4B suballele, it is currently unknown what the global *4A and *4B allele frequencies are;

however, initial data suggest that the *4B allele frequency may be as high as 2-3% in some populations (e.g., AJ) (12). Moreover, the recent identification of the *17 gain-of- function allele (37) at high frequencies in several populations (-3-21%) (12, 19) has prompted its inclusion in most commercial assays and laboratory-developed tests. Currently, three CYP2C19 genotyping assays have been approved by the U.S. FDA for in vitro diagnostic use and they include *2 and *3 with or without *17. However, a number of other multiplexed commercial assays are available with more extensive CYP2C19 variant allele panels.

The CYP2C19 *4B allele is unique among all of the other known CYP2C19 variant alleles as it harbors the defining variants for both *17 (c.-806C>T) and *4 (c.1 A>G) on the same haplotype (21), whereas the related *4A allele is defined by c. lA>G without the upstream c.-806C>T variant. As such, when targeted genotyping or sequencing identifies a patient sample as *4/*17, the phase of the c.-806C>T and c. lA>G variants are not known, which could represent either a *4A/*17 or *1/*4B genotype. Moreover, given that U.S. FDA- approved CYP2C19 assays currently include *17 and not *4, some of the *17 carriers identified by these assays will be *4B carriers incorrectly classified as ultrarapid

metabolizers. Given that the *4B allele results in loss-of-function due to the abolished ATG translation start site (21, 38), the predicted metabolizer phenotype for these patients is not ultrarapid, but intermediate or poor metabolizer depending on the second allele. Given that detection of *4A and *4B increases genotyping accuracy and influences metabolizer phenotype classification, we recommend consideration of this ASP assay as a reflex test when *4 and *17 are identified by targeted genotyping.

In conclusion, a robust ASP assay is described that can rapidly detect and discriminate the related CYP2C19*4A, *4B, and *17 alleles. Given that currently available CYP2C19 genotyping and sequencing assays cannot determine the phase of the C.-806OT (*77) and c. lA>G (*4) variants, this assay has the ability to refine CYP2C19 genotyping and subsequent metabolizer phenotype classification. Much of the recent interest in

implementing clinical CYP2C19 testing has been driven by the clopidogrel pharmacogenetics field. As current pharmacogenetic -based antiplatelet therapy recommendations are dependent on predicted metabolizer phenotype status (19, 20), assays that can further refine CYP2C19 genotype results are necessary for optimal utility of CYP2C19 testing.

REFERENCES

1. Daly AK. Pharmacogenetics of the cytochromes p450. Curr Top Med Chem 2004;4: 1733-44.

2. Desta Z, Zhao X, Shin JG, Flockhart DA. Clinical significance of the cytochrome p450 2cl9 genetic polymorphism. Clin Pharmacokinet 2002;41 :913-58.

3. Price MJ, Tantry US, Gurbel PA. The influence of cyp2cl9 polymorphisms on the pharmacokinetics, pharmacodynamics, and clinical effectiveness of p2y(12) inhibitors. Rev Cardiovasc Med 201 1 ;12: 1-12.

4. Scott SA, Sangkuhl K, Shuldiner AR, Hulot JS, Thorn CF, Altman RB, Klein TE.

Pharmgkb summary: Very important pharmacogene information for cytochrome p450, family 2, subfamily c, polypeptide 19. Pharmacogenet Genomics 2012;22: 159- 65.

5. Gray IC, Nobile C, Muresu R, Ford S, Spurr NK. A 2.4-megabase physical map spanning the cyp2c gene cluster on chromosome 10q24. Genomics 1995;28:328-32.

6. Goldstein JA. Clinical relevance of genetic polymorphisms in the human cyp2c subfamily. Br J Clin Pharmacol 2001;52:349-55.

7. Sim SC, Ingelman-Sundberg M. The human cytochrome p450 (cyp) allele nomenclature website: A peer-reviewed database of cyp variants and their associated effects. Hum Genomics 2010;4:278-81.

8. Xie HG, Prasad HC, Kim RB, Stein CM. Cyp2c9 allelic variants: Ethnic distribution and functional significance. Adv Drug Deliv Rev 2002;54: 1257-70.

9. Ross KA, Bigham AW, Edwards M, Gozdzik A, Suarez-Kurtz G, Parra EJ.

Worldwide allele frequency distribution of four polymorphisms associated with warfarin dose requirements. J Hum Genet 2010;55:582-9. Scott SA, Khasawneh R, Peter I, Kornreich R, Desnick RJ. Combined cyp2c9, vkorcl and cyp4£2 frequencies among racial and ethnic groups. Pharmacogenomics 2010; 11 :781-91.

Georgitsi M, Viennas E, Gkantouna V, Christodoulopoulou E, Zagoriti Z, Tafrali C, et al. Population-specific documentation of pharmacogenomic markers and their allelic frequencies in findbase. Pharmacogenomics 201 1; 12:49-58.

Martis S, Peter I, Hulot JS, Kornreich R, Desnick RJ, Scott SA. Multi-ethnic distribution of clinically relevant cyp2c genotypes and haplotypes. Pharmacogenomics J 2012.

Mega JL, Simon T, Collet JP, Anderson JL, Antman EM, Bliden K, et al. Reduced- function cyp2cl9 genotype and risk of adverse clinical outcomes among patients treated with clopidogrel predominantly for pci: A meta-analysis. JAMA 2010;304: 1821-30.

Holmes DR, Jr., Dehmer GJ, Kaul S, Leifer D, O'Gara PT, Stein CM. Accf/aha clopidogrel clinical alert: Approaches to the fda "boxed warning": A report of the american college of cardiology foundation task force on clinical expert consensus documents and the american heart association endorsed by the society for cardiovascular angiography and interventions and the society of thoracic surgeons. J Am Coll Cardiol 2010;56:321-41.

Hulot JS, Collet JP, Cayla G, Silvain J, Allanic F, Bellemain-Appaix A, et al. Cyp2cl9 but not ponl genetic variants influence clopidogrel pharmacokinetics, pharmacodynamics, and clinical efficacy in post-myocardial infarction patients. Circ Cardiovasc Interv 2011 ;4:422-8.

Johnson JA, Roden DM, Lesko LJ, Ashley E, Klein TE, Shuldiner AR. Clopidogrel: A case for indication-specific pharmacogenetics. Clin Pharmacol Ther 2012;91 :774-6. Roberts JD, Wells GA, Le May MR, Labinaz M, Glover C, Froeschl M, et al. Point- of-care genetic testing for personalisation of antiplatelet treatment (rapid gene): A prospective, randomised, proof-of-concept trial. Lancet 2012;379: 1705-1 1.

Pulley JM, Denny JC, Peterson JF, Bernard GR, Vnencak- Jones CL, Ramirez AH, et al. Operational implementation of prospective genotyping for personalized medicine: The design of the vanderbilt predict project. Clinical pharmacology and therapeutics 2012;92:87-95.

Scott SA, Sangkuhl K, Gardner EE, Stein CM, Hulot JS, Johnson JA, et al. Clinical pharmacogenetics implementation consortium guidelines for cytochrome p450-2cl9 (cyp2cl9) genotype and clopidogrel therapy. Clin Pharmacol Ther 201 1;90:328-32. Swen J J, Nijenhuis M, de Boer A, Grandia L, Maitland-van der Zee AH, Mulder H, et al. Pharmacogenetics: From bench to byte— an update of guidelines. Clin Pharmacol Ther 201 1;89:662-73.

Scott SA, Martis S, Peter I, Kasai Y, Kornreich R, Desnick RJ. Identification of cyp2cl9*4b: Pharmacogenetic implications for drug metabolism including clopidogrel responsiveness. Pharmacogenomics J 2012; 12:297-305.

Scott SA, Jaremko M, Lubitz SA, Kornreich R, Halperin JL, Desnick RJ. Cyp2c9*8 is prevalent among african-americans: Implications for pharmacogenetic dosing. Pharmacogenomics 2009; 10: 1243-55. Scott SA, Edelmann L, Kornreich R, Erazo M, Desnick RJ. Cyp2c9, cyp2cl9 and cyp2d6 allele frequencies in the ashkenazi jewish population. Pharmacogenomics 2007;8:721-30.

Scott SA, Edelmann L, Kornreich R, Desnick RJ. Warfarin pharmacogenetics: Cyp2c9 and vkorcl genotypes predict different sensitivity and resistance frequencies in the ashkenazi and sephardi jewish populations. Am J Hum Genet 2008;82:495-500. Scott SA, Edelmann L, Liu L, Luo M, Desnick RJ, Kornreich R. Experience with carrier screening and prenatal diagnosis for 16 ashkenazi jewish genetic diseases. Hum Mutat 2010;31 : 1240-50.

Lo YM, Patel P, Newton CR, Markham AF, Fleming KA, Wainscoat JS. Direct haplotype determination by double arms: Specificity, sensitivity and genetic applications. Nucleic acids research 1991; 19:3561-7.

Brandt JT, Close SL, Iturria SJ, Payne CD, Farid NA, Ernest CS, 2nd, et al. Common polymorphisms of cyp2cl9 and cyp2c9 affect the pharmacokinetic and pharmacodynamic response to clopidogrel but not prasugrel. J Thromb Haemost 2007;5:2429-36.

Collet JP, Hulot JS, Anzaha G, Pena A, Chastre T, Caron C, et al. High doses of clopidogrel to overcome genetic resistance: The randomized crossover clovis-2 (clopidogrel and response variability investigation study 2). JACC Cardiovasc Interv 2011 ;4:392-402.

Hulot JS, Bura A, Villard E, Azizi M, Remones V, Goyenvalle C, et al. Cytochrome p450 2cl9 loss-of-function polymorphism is a major determinant of clopidogrel responsiveness in healthy subjects. Blood 2006; 108:2244-7.

Giusti B, Gori AM, Marcucci R, Saracini C, Sestini I, Paniccia R, et al. Cytochrome p450 2cl9 loss-of-function polymorphism, but not cyp3a4 ivslO + 12g/a and p2yl2 t744c polymorphisms, is associated with response variability to dual antiplatelet treatment in high-risk vascular patients. Pharmacogenet Genomics 2007; 17: 1057-64. Mega JL, Close SL, Wiviott SD, Shen L, Hockett RD, Brandt JT, et al. Cytochrome p-450 polymorphisms and response to clopidogrel. N Engl J Med 2009;360:354-62. Shuldiner AR, O'Connell JR, Bliden KP, Gandhi A, Ryan K, Horenstein RB, et al. Association of cytochrome p450 2c 19 genotype with the antiplatelet effect and clinical efficacy of clopidogrel therapy. JAMA 2009;302:849-57.

Simon T, Verstuyft C, Mary-Krause M, Quteineh L, Drouet E, Meneveau N, et al. Genetic determinants of response to clopidogrel and cardiovascular events. N Engl J Med 2009;360:363-75.

Collet JP, Hulot JS, Pena A, Villard E, Esteve JB, Silvain J, et al. Cytochrome p450 2c 19 polymorphism in young patients treated with clopidogrel after myocardial infarction: A cohort study. Lancet 2009;373:309-17.

Hulot JS, Collet JP, Silvain J, Pena A, Bellemain-Appaix A, Barthelemy O, et al. Cardiovascular risk in clopidogrel-treated patients according to cytochrome p450 2cl9*2 loss-of-function allele or proton pump inhibitor coadministration: A systematic meta-analysis. J Am Coll Cardiol 2010;56: 134-43.

Mega JL, Close SL, Wiviott SD, Shen L, Walker JR, Simon T, et al. Genetic variants in abcbl and cyp2cl9 and cardiovascular outcomes after treatment with clopidogrel and prasugrel in the triton-timi 38 trial: A pharmacogenetic analysis. Lancet 2010;376: 1312-9.

37. Sim SC, Risinger C, Dahl ML, Aklillu E, Christensen M, Bertilsson L, Ingelman- Sundberg M. A common novel cyp2cl9 gene variant causes ultrarapid drug metabolism relevant for the drug response to proton pump inhibitors and antidepressants. Clin Pharmacol Ther 2006;79: 103-13.

38. Ferguson RJ, De Morais SM, Benhamou S, Bouchardy C, Blaisdell J, Ibeanu G, et al.

A new genetic defect in human cyp2cl9: Mutation of the initiation codon is responsible for poor metabolism of s-mephenytoin. The Journal of pharmacology and experimental therapeutics 1998;284:356-61.

All patents, patent applications and publications, and non-patent publications cited herein are hereby incorporated by reference in their entirety as if each individual publication or reference were specifically and individually indicated to be incorporated by reference. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.

This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure as it appears in the U.S. Patent and Trademark Office patent file or records, but otherwise reserves any and all copyright rights.

The present disclosure is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

It is further to be understood that all values are approximate, and are provided for description.

Claims

WHAT IS CLAIMED IS:

1. A purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 1, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, and wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C).

2. A purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 2, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, and wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

3. A purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, and wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C).

4. A purified nucleic acid comprising between about 15 and 35 nucleotides in length having at least about 80% identity to SEQ ID NO: 4, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, and wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

5. An oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs:7 or 9, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

6. An oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 1, wherein the 3' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

7. An oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

8. An oligonucleotide primer pair comprising a forward and a reverse primer, wherein said forward primer comprises at least about 80% identity to SEQ ID NO: 3, wherein the 3' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C), and wherein said reverse primer comprises at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C).

9. The oligonucleotide primer pair of claim 5, further comprising a primer having at least about 80% identity to SEQ ID NO: 3, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 9 or 10, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C); a primer having at least about 80% identity to SEQ ID NO: 4, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4928 of SEQ ID NOs: 8 or 10, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C); or a combination thereof.

10. The oligonucleotide primer pair of claim 8, further comprising a primer having at least about 80% identity to SEQ ID NO: 1, wherein the 3 ' terminal nucleotide is cytidine (C) and is complementary to position 4122 of the antisense strand of SEQ ID NOs: 7 or 8, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), adenosine (A), and cytidine (C); a primer having at least about 80% identity to SEQ ID NO: 2, wherein the 3 ' terminal nucleotide is thymidine (T) and is complementary to position 4928 of SEQ ID NOs: 7 or 9, wherein the nucleotide directly adjacent to the 3 ' terminal nucleotide in the 5' direction is selected from the group consisting of thymidine (T), guanosine (G), and cytidine (C); or a combination thereof.

11. A method for treating a cardiovascular disease in a subject, the method comprising:

(a) determining a CYP2C19 gene diplotype of the subject by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof;

(b) determining whether to administer an anti-platelet drug metabolized by CYP2C19 based on the diplotype of the subject; and

(c) administering said anti-platelet drug metabolized by CYP2C19 or an alternative therapy to the subject.

12. The method of claim 1 1, further comprising determining a dose of the antiplatelet drug metabolized by CYP2C19 to be administered based on the diplotype of the subject.

13. The method of claim 1 1, wherein the cardiovascular disease is acute coronary syndrome, acute coronary syndrome with percutaneous coronary intervention, peripheral vascular disease, cerebrovascular disease, symptomatic atherosclerosis, ST elevation myocardial infarction (STEMI), coronary thrombosis, recent myocardial infarction, recent stroke, or a combination thereof.

14. The method of claim 1 1, wherein the anti-platelet drug metabolized by CYP2C19 is clopidogrel, prasugrel, or a combination thereof.

15. The method of claim 12, wherein the administering step comprises giving a standard dose of an anti-platelet drug metabolized by CYP2C19 to the subject if the

CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

16. The method of claim 15, further comprising monitoring the subject for bleeding complications if the CYP2C19 gene diplotype comprises cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

17. The method of claim 11, wherein the administering step comprises giving an alternative therapy to the subject if the CYP2C19 gene diplotype comprises

cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position - 806 of the CYP2C19 gene, and adenosine(A)/guanosine(G), or guanosine(G)/guanosine(G) at position 1 of the CYP2C19 gene.

18. The method of claim 17, wherein the alternative therapy is a P2Y12 inhibitor.

19. The method of claim 18, wherein the P2Y12 inhibitor is prasugrel, ticagrelor, or a combination thereof.

20. The method of claim 12, wherein the administering step comprises giving an increased dose of an anti-platelet drug metabolized by CYP2C19 to the subject if the CYP2C19 gene diplotype comprises cytidine(C)/cytidine(C), cytidine(C)/thymidine(T), or thymidine(T)/thymidine(T) at position -806 of the CYP2C19 gene, and

21. A method for treating a gastrointestinal disease in a subject, the method comprising:

(a) determining the CYP2C19 gene diplotype of the subject by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof;

(b) determining a dose of a proton pump inhibitor to be administered based on the diplotype of the subject; and

(c) administering said dose to the subject.

22. The method of claim 21, wherein the gastrointestinal disease is dyspepsia, peptic ulcer disease, gastroesophageal reflux disease (GERD), laryngopharyngeal reflux, Barrett's esophagus, stress gastritis prevention, gastrinomas, Zollinger-Ellison syndrome, erosive esophagitis, or a combination thereof.

23. The method of claim 21, wherein the proton pump inhibitor is selected from the group consisting of lansoprazole, omeprazole, pantoprazole, rabeprazole, and esomeprazole, or a combination thereof.

24. A method for treating epileptic seizures in a subject, the method comprising:

(b) determining a dose of an anti-epileptic drug to be administered based on the diplotype of the subject; and

(c) administering said dose to the subject.

25. The method of claim 24, wherein the anti-epileptic drug is selected from the group consisting of diazepam, clobazam, clonazepam, clorazepate, nordazepam, phenytoin, mephenytoin, fosphenytoin, ethotoin, phenobarbital, primidone, hexobarbital,

methylphenobarbital, or a combination thereof.

26. A method for treating a mood disorder in a subject, the method comprising:

(b) determining a dose of an anti-depressant drug to be administered based on the diplotype of the subject; and

(c) administering said dose to the subject.

27. The method of claim 26, wherein the anti-depressant drug is selected from the group consisting of diazepam, amitriptyline, clomipramine, imipramine, citalopram, moclobemide, fluvoxamine, or a combination thereof.

28. The method of claim 21, 24, or 26, wherein the administering step comprises giving a standard dose to the subject if the CYP2C19 gene diplotype comprises

cytidine(C)/cytidine(C) at position -806 of the CYP2C19 gene, and

adenosine(A)/adenosine(A) at position 1 of the CYP2C19 gene.

29. The method of claim 21, 24, or 26, wherein the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises

30. The method of claim 21, 24, or 26, wherein the administering step comprises giving a modified dose to the subject if the CYP2C19 gene diplotype comprises

31. The method of claim 29, wherein the administering step comprises giving an increased dose to the subject if the CYP2C19 gene diplotype comprises

32. The method of claim 30, wherein the administering step comprises giving a decreased dose to the subject if the CYP2C19 gene diplotype comprises

33. The method of claim 1 1, 21, 24, or 26 wherein the PCR amplification comprises at least one PCR reaction using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

34. The method of claim 1 1, 21, 24, or 26, wherein the PCR amplification comprises at least two PCR reactions using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

35. The method of claim 1 1, 21, 24, or 26, wherein the PCR amplification comprises at least three PCR reactions using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

36. The method of claim 1 1, 21, 24, or 26, wherein the PCR amplification comprises at least four PCR reactions using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

37. The method of claim 1 1, 21, 24, or 26, wherein the diplotype comprises the presence or absence of the polymorphic c.-806C>T (* 17) and c. lA>G (*4) alleles.

38. The method of claim 1 1, 21, 24, or 26, wherein the subject is a human.

39. The method of claim 1 1, 21, 24, or 26, wherein the sample comprises a blood sample, a salvia sample, a buccal swab, a serum sample, a sputum sample, a lacrimal secretion sample, a semen sample, a vaginal secretion sample, a fetal tissue sample, a skin tissue sample, a muscle tissue sample, an amniotic fluid sample, a chorionic villi sample, or a combination thereof.

40. The method of claim 39, wherein a nucleic acid is extracted from the sample.

41. The method of claim 40, wherein the nucleic acid comprises genomic DNA.

42. The method of claim 40, wherein the nucleic acid comprises mRNA, or a cDNA derived therefrom.

43. The method of claim 1 1, 21, 24, or 26, further comprising determining the presence or absence of one or more additional CYP2C19 polymorphic alleles.

44. The method of claim 1 1, 21, 24, or 26, further comprising adding a control primer pair to the PCR reaction.

45. The method of claim 44, wherein the control primer pair amplifies a region of the human genome.

46. The method of claim 45, wherein the control primer pair amplifies a region of human chromosome 10q23.33.

47. The method of claim 44, wherein the control primer pair amplifies a region of the CYP2C19 gene.

48. The method of claim 45, 46, or 47 wherein the amplified region is between 100 and 4000 nucleotides in length.

49. The method of claim 44, wherein the control primer pair comprises the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6.

50. A kit for determining whether to administer an anti-platelet drug metabolized by CYP2C19 to a subject, the kit comprising reagents for determining a diplotype of the polymorphic C.-806OT (* 17) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

51. A kit for determining whether to administer a proton pump inhibitor to a subject, the kit comprising reagents for determining a diplotype of the polymorphic c- 806OT (* 17) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

52. A kit for determining whether to administer an anti-epileptic drug to a subject, the kit comprising reagents for determining a diplotype of the polymorphic C.-806OT (* 17) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

53. A kit for determining whether to administer an anti-depressant to a subject, the kit comprising reagents for determining a diplotype of the polymorphic c.-806C>T (* 17) and c. lA>G (*4) alleles of the CYP2C19 gene in a sample from said subject, wherein the diplotype is determined by PCR amplification using at least one of the primers of claim 1, 2, 3, 4, or a combination thereof.

54. The kit according to claim 50, 51, 52, or 53 further comprising a control primer pair.

55. The kit according to claim 50, 51, 52, or 53 wherein the control primer pair amplifies a region of the human genome.

56. The kit according to claim 55, wherein the control primer pair amplifies a region of human chromosome 10q23.33.

57. The kit according to claim 54, wherein the control primer pair amplify a region of the CYP2C19 gene.

58. The kit according to claim 54, 55, or 56, wherein the amplified region is between 100 and 4000 nucleotides in length.

59. The kit according to claim 54, wherein the control primer pair comprises the nucleotide sequence of SEQ ID NO: 5 and the nucleotide sequence of SEQ ID NO: 6.

60. The method of claim 15, 16, 17, 20, 28, 29, 30, 31, or 32, wherein position - 806 of the CYP2C19 gene is a single-nucleotide polymorphism.

61. The method of claim 15, 16, 17, 20, 28, 29, 30, 31, or 32, wherein position 1 of the CYP2C19 gene is a single-nucleotide polymorphism.

62. The purified nucleic acid of claim 1, 2, 3, or 4, wherein the purified nucleic acid is a synthetic oligonucleotide primer.