WO2015000921A1 - Activateurs de la voie ptgds et utilisation dans des pathologies caractérisées par une altération de la myélinisation dans le snc - Google Patents

Activateurs de la voie ptgds et utilisation dans des pathologies caractérisées par une altération de la myélinisation dans le snc Download PDF

Info

Publication number
WO2015000921A1
WO2015000921A1 PCT/EP2014/063995 EP2014063995W WO2015000921A1 WO 2015000921 A1 WO2015000921 A1 WO 2015000921A1 EP 2014063995 W EP2014063995 W EP 2014063995W WO 2015000921 A1 WO2015000921 A1 WO 2015000921A1
Authority
WO
WIPO (PCT)
Prior art keywords
ptgds
activator
receptor
gpr44
myelination
Prior art date
Application number
PCT/EP2014/063995
Other languages
English (en)
Inventor
Carla TAVEGGIA
Amelia TRIMARCO
Original Assignee
Fondazione Centro San Raffaele
Fondazione Italiana Sclerosi Multipla
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Centro San Raffaele, Fondazione Italiana Sclerosi Multipla filed Critical Fondazione Centro San Raffaele
Publication of WO2015000921A1 publication Critical patent/WO2015000921A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/557—Eicosanoids, e.g. leukotrienes or prostaglandins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/28—Neurological disorders
    • G01N2800/285—Demyelinating diseases; Multipel sclerosis

Definitions

  • the present invention relates to an activator of the PTGDS pathway for use in the treatment and/or prevention of a pathology characterized by an altered myelination in the nervous system.
  • the pathology is multiple sclerosis or a peripheral neuropathy such as hereditary neuropathy, inflammatory neuropathy or toxic neuropathy.
  • Myelin the insulating organelle enwrapping the axon in central (CNS) and peripheral nervous system (PNS), is formed by oligodendrocytes (OL) in the central nervous system and Schwann cells in the peripheral nervous system and is essential for rapid conduction of electrical impulses and neuronal survival.
  • OL oligodendrocytes
  • PNS peripheral nervous system
  • OL oligodendrocytes
  • Schwann cells in the peripheral nervous system and is essential for rapid conduction of electrical impulses and neuronal survival.
  • levels of axonal Neuregulin 1 (NRG1) type III a member of the Neuregulin family of growth factors, controls all the aspects linked to Schwann cell development and myelin formation (1).
  • NRG1 type III similarly to other growth factors, is processed in the extracellular region by secretases, namely the beta secretase BACE-1 (2, 3) and the alpha secretase TACE (4), which exert opposite effects on myelin formation (5).
  • NRG1 type III is processed also intramembrane by the ⁇ -secretase complex, thus following a classical regulated intramembrane proteolysis cleavage. Previous studies have shown that the latter cleavage event is regulated by the erbB receptors and generates an intracellular domain that in vitro in hippocampal neurons, represses the expression of pro-apoptotic genes (6).
  • NRG1 intracellular domain can be further processed to generate a smaller fragment that enhances the expression of PSD95 (7).
  • mutations in NRG1 putative transmembrane cleavage domain alter branching of cortical dendrites (8).
  • NRG1 type III undergoes a similar intramembrane proteolysis, but unlike previous studies, the authors found that the generated fragment specifically upregulates the Prostaglandin D2 Synthase (PTGDS) gene.
  • PGTDS Prostaglandin D2 Synthase
  • This enzyme is a part of the prostaglandin synthases' family of protein implicated in the control of several biological events.
  • Prostaglandins are lipid mediator, generated by the processing of arachidonic acid and have been mainly implicated in inflammation.
  • arachidonic acid binds to the catalytic site of the COX enzymes to generate the intermediate prostaglandin H2 (PGH2) (9, 10).
  • PTGDS converts the latter metabolite into different prostaglandins.
  • PTGDS is a N-glycosylated protein highly expressed in several tissues (11). Interestingly, PTGDS can be secreted, and can act following a transcellular mechanism (12, 13).
  • PTGDS catalyzes the conversion of PGH2 into the more stable and functional prostaglandin D2 (PGD2) and is also called L-PGDS (lipocalin-type PGD2 synthase) which could be further dehydrated to PGJ2.
  • PGD2 prostaglandin D2
  • L-PGDS lipocalin-type PGD2 synthase
  • Both PGD2 and PGJ2 can bind specific receptors, the nuclear receptor PPAR-y, and members of the G protein coupled receptor family GPR44 and PTGDR 1 (15). Upon binding to the receptors they activate specific intracellular signaling response that varies depending on the type of receptor initially stimulated (16). In particular PGD2 modulates intracellular messengers such as calcium, cAMP and phosphoinositol concentrations (15, 17).
  • WO2012033069 relates to prostaglandin D synthase inhibitory piperidine compounds and WO2010104024 concerns piperazine compound capable of inhibiting prostaglandin d synthase.
  • Taniike M, et al. (36) indicate that perineuronal oligodendrocytes protect against neuronal apoptosis through the production of lipocalin-type prostaglandin D synthase in a genetic demyelinating model. Taniike et al. have centered their study on a mutant animal model for the human globoid cell leukodystrophy and focused on neuronal survival and anti-apoptotic effects.
  • Huang YC, et al. (38) report that Decreased intrathecal synthesis of prostaglandin D2 synthase in the cerebrospinal fluid of patients with acute inflammatory demyelinating polyneuropathy.
  • AIDP acute inflammatory demyelinating neuropathy
  • CIDP chronic inflammatory demyelinating polyradiculoneuropathy
  • PTGDS is a novel modulator of PNS myelination and of myelin maintenance.
  • sciatic nerves of transgenic animals genetically engineered to lack PTGDS expression are hypomyelinated.
  • the authors show that in a myelinating co-culture system PTGDS acts in neuronal cell autonomous way.
  • PTGDS most likely via the PGD2 prostanoid, modulates the activity of its receptor GPR44 onto Schwann cells. Activation of this G protein coupled receptor leads to intracellular Ca 2+ storage release and nuclear translocation of the transcription factor NFATc4 (18). Accordingly, SC specific knock down of GPR44 hampers PNS myelination.
  • an activator of the PTGDS pathway for use in the treatment and/or prevention of a pathology characterized by an altered myelination in the nervous system.
  • the activator is selected from the group consisting of:
  • the modulator of GPR44 receptor and/or of PTGDR receptor is an agonist of the GPR44 receptor.
  • the agonist of the GPR44 receptor is PGD2 and/or PGJ2 or an analog thereof.
  • the PGD2 analog is 15R-Methyl-Prostaglandin D2 (Cayman Chemicals Item number: 12720) or 15(R)PGD2 (Cayman Chemicals Item number: 101 18).
  • the modulator of GPR44 receptor and/or of PTGDR receptor is an antagonist of the GPR44 receptor.
  • the modulator of GPR44 receptor and/or of PTGDR receptor is an agonist of the PTGDR receptor.
  • the modulator of GPR44 receptor and/or of PTGDR receptor is an antagonist of the PTGDR receptor.
  • the activator of PTGDS is selected from the group consisting of: an activator of PTGDS mRNA expression, an analog of PTGDS, an antibody that specifically activates PTGDS.
  • the activator of the PTGDS pathway as described above is obtainable by means of a gene therapy approach.
  • the activator of PTGDS is a fragment of Neuregulin 1 type III, preferably said fragment has essentially the sequence of SEQ ID no. 1 or synthetic derivative thereof.
  • the pathology characterized by an altered myelination in the nervous system is selected from the group selected from multiple sclerosis or a peripheral neuropathy.
  • peripheral neuropathy is selected from the group consisting of: hereditary or genetic neuropathies, inflammatory neuropathies, acute forms of neuropathies, toxic neuropathies.
  • the peripheral neuropathy is a Charcot Marie Tooth disorder, a diabetic polyneuropathy or a chronic inflammatory demyelinating polyneuropathy.
  • the acute forms of neuropathy is a Guillain-Barre syndrome.
  • the toxic neuropathy follows or is due to chemotherapy treatment.
  • a further embodiment of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising at least one activator of the PTGDS pathway as defined above and suitable pharmaceutically acceptable excipients for use in the treatment and/or prevention of a pathology characterized by an altered myelination in the nervous system.
  • the pharmaceutical composition further comprises at least one therapeutic agent selected from the group consisting of non-steroid anti-inflammatory agents/analgesics or corticosteroids such as cortisone or analogs thereof.
  • a further embodiment of the invention is a method for the diagnostic and/or prognostic of a pathology characterized by an altered myelination in the nervous system and/or to monitor the efficacy of a therapy for a pathology characterized by an altered myelination in the nervous system comprising detecting the presence and/or measuring the amount of PTGDS and/or measuring the expression level of at least one receptor selected from the group of: GPR44 receptor or PTGDR receptor in a biological sample.
  • the biological sample is selected from the group consisting of: blood, plasma, CSF, urine, saliva, tissue biopsy.
  • a further embodiment of the invention is a kit for the diagnostic and/or prognostic of a pathology characterized by an altered myelination in the nervous system and/or to monitor the efficacy of a therapy for a pathology characterized by an altered myelination in the nervous system comprising detecting and /or quantifying means of PTGDS and/or of expression of at least one receptor selected from the group of: GPR44 receptor or PTGDR receptor.
  • a further embodiment of the invention is a method of treatment of a pathology characterized by an altered myelination in the nervous system comprising administering an effective amount of an activator of the PTGDS pathway as defined above or of the pharmaceutical composition as defined above in a subject in need thereof.
  • a further embodiment of the invention is a method of treatment of a pathology characterized by an altered myelination in the nervous system comprising introducing an expression vector able to restore PTGDS and/or PGD2 and/or PGJ2 activity in a subject in need thereof.
  • the PTGDS pathway comprises a group of molecules/proteins specifically induced following PTGDS activation and production of its metabolites (PGD2 and PGJ2).
  • PGD2 and PGJ2 can bind to different classes of receptor (PPARg, PTGDR and GPR44) and depending on the type of receptor initially stimulated the intracellular response can vary. Specifically it has been reported that PPAR- ⁇ , upon activation, translocates into the nucleus and together with retinoic acid receptor, directly stimulates gene transcription. GPR44 inhibits the adenyl cyclase and reduces the levels of intracellular cAMP.
  • PTGDR stimulates adenylyl cyclase and increases intracellular levels of cAMP to modulate gene transcription.
  • An activator of the PTGDS pathway may act on one or more of the molecules/protein involved in the above described pathway.
  • an activator of PTGDS is a molecule (protein/compound) that positively activates PTGDS with a subsequent production of PGD2 and/or PGJ2, thus favoring the activation of the above described signaling pathways.
  • an agonist of PTGDS metabolite receptor is a molecule (protein/compound) that mimics PGD2 and/or PGJ2 and binds to GPR44 and/or PTGDR receptors to stimulate their functional activities, thus favoring the activation of the above described signaling pathways.
  • a pathology characterized by an altered myelination in the nervous system comprises pathologies of the central nervous system (CNS) and/or peripheral nervous system (PNS).
  • the pathology is a pathology of the central nervous system.
  • the pathology is a pathology of the peripheral nervous system.
  • the disorders affecting the CNS include: Multiple sclerosis, together with Devic's disease and other disorders with immune system involvement called inflammatory demyelinating diseases.
  • CNS Neuropathies like those produced by Vitamin B12 deficiency.
  • Optic neuritis and Transverse myelitis which are inflammatory conditions, because inflammation and demyelination are frequently associated.
  • Demyelinating diseases of the peripheral nervous system include: Guillain-Barre syndrome and its chronic counterpart, chronic inflammatory demyelinating polyneuropathy, Anti-MAG peripheral neuropathy, Charcot-Marie-Tooth Disease, Copper deficiency and Progressive inflammatory neuropathy.
  • a demyelinating disease is any disease of the nervous system in which the myelin sheath of neurons is damaged. This damage impairs the conduction of signals in the affected nerves. In turn, the reduction in conduction ability causes deficiency in sensation, movement, cognition, or other functions depending on which nerves are involved.
  • demyelinating diseases are caused by genetics, some by infectious agents, some by autoimmune reactions, and some by unknown factors.
  • a pathology characterized by an altered myelination in the nervous system comprises pathologies where a hypermyelination or a hypomyelination (or demyelination) is observed.
  • hypermyelination it is intended an increase in the number of myelin lamellae surrounding the axons.
  • hypomyelination it is intended a decrease in the number of myelin lamellae surrounding the axons.
  • Both hyper- and hypo-myelination can be assessed by determining the g ratio value. This is a conserved value in normal myelination and is provided by calculating the ratio between axon diameter and fiber diameter. Increased g ratio values indicate hypomyelination, whereas a decrease is a redout of hypermyelination.
  • a pathology characterized by an altered myelination in the nervous system comprises an inflammatory demyelinating disease, such as multiple sclerosis wherein alteration in the central nervous system are observed.
  • a pathology characterized by an altered myelination in the peripheral nervous system also comprises a PNS disorder in which alteration (lack of myelin, demyelination or dysmyelination) of myelination can have dramatic consequences, such as peripheral neuropathies.
  • Peripheral neuropathies can be of genetic origin as in the case of Charcot Marie Tooth disorders, secondary to metabolic alterations as in the case of diabetic polyneuropathy, of inflammatory origin as in the case of CIDP (chronic inflammatory demyelinating polyneuropathy), acute forms of peripheral neuropathy as in the case of Guillain-Barre syndrome or toxic neuropathies as those developing following chemotherapy treatments.
  • an activator of PTGDS may be any suitable therapy to reintroduce the enzyme via a gene therapy approach or to modulate PTGDS activity by antibody treatment.
  • PTGDS substrates, arachidonic acid and PGH2 are activators of PTGDS.
  • one therapeutic strategy consists in increasing the production of PGD2 and/or PGJ2 or the activity of PGD2 and/or PGJ2, for instance by using analogs thereof, for instance 15(R)PGD2 or 15R-Methyl-Prostaglandin D2, a potent PGD2 analog that is capable of specifically activating GPR44 (39).
  • PGD2 analogs include BW245C, PGD3, and PGD2 methyl ester, 1 1- deoxy-1 1 -methylene PGD2.
  • an agonist of GPR44 is defined as a molecule that can activate the receptor and the downstream signaling pathway
  • an antagonist of GPR44 is defined as a molecule that can inhibit the receptor and the downstream signaling pathway
  • an agonist of PTGDR is defined as a molecule that can activate the receptor and the downstream signaling pathway
  • an antagonist of PTGDR is defined as a molecule that can inhibit the receptor and the downstream signaling pathway
  • a fragment of Neuregulin 1 type III originates from the rat sequence (GenBank accession number AAG28427.1). In particular it may be the fragment from lysine 340 to the stop codon, amino acid 714 having the following sequences:
  • NRGl type III undergoes a regulated intramembrane proteolysis cleavage that is Schwann cell dependent
  • a) Rat DRG neurons infected with full length NRGl type III protein, tagged at the C terminus with EGFP were stained for GFP (fluorescein) and Neurofilament (rhodamine).
  • GFP fluorescein
  • rhodamine Neurofilament
  • Schwann cell addition induces clearance while in the presence of 10 ⁇ ⁇ -secretase inhibitor Compound E (CpE)
  • CpE 10 ⁇ ⁇ -secretase inhibitor Compound E
  • Rat DRG nuclei were infected with a lentivirus expressing NRGl ICD tagged with a FLAG epitope at the C terminus.
  • the FLAG tag (rhodamine) is expressed in the nuclei, as shown by colocalization with nuclear staining (D API-blue). Neurofilament staining is also indicated (fluorescein), c) Rat DRG nuclei were infected with a lentivirus expressing full length NRGl type III tagged with a FLAG epitope at the C terminus. In the presence of Schwann cells the FLAG tag (rhodamine) is expressed in the nuclei, as shown by colocalization with nuclear staining (D API-blue). Neurofilament staining is also indicated (fluorescein).
  • PTGDS is the only gene significantly upregulated in neurons infected with NRGl ICD (intracellular domain), a) Graph indicating all genes that were significantly upregulated in the Illumina analyses in NRGl ICD infected neurons. Only PTGDS showed a 9-fold change of activation (p ⁇ 0.01). Results are from three different independent experiments, b) RT-PCR on mRNA prepared from DRG neurons not infected, infected with a lentivirus expressing NRGl ICD or EGFP as control. PTGDS is upregulated only in neurons overexpressing NRGl ICD. qRT-PCR analyses confirm specific upregulation of PTGDS in DRG neurons expressing NRGl ICD.
  • the amount of PGD2 was determined by HPLC-MS in conditioned media of DRG neurons overexpressing NRG1 ICD and in wild type neurons, which serves as control. The graph is representative of three different experiments. The amount of PGD2 was normalized to the internal control PGEM d6.
  • H- and L- PGDS double null mice are hypomyelinated.
  • a-c) Morphological analyses of P7 wild type and H/L null sciatic nerves, a) Electron micrographs and b) g ratio analyses confirmed hypomyelination in H/L null tissues, g ratio as a function of axon diameter are significantly different between wild type (red line) and H/L null P7 mice (black line) (p ⁇ 0.0001). The graph represent the g ratio obtained from more than myelinated 100 axons (total of 3 animals per genotype), c) Distribution of myelinated fibers is similar in H/L null and wild type P7 sciatic nerves (p not significant).
  • L- PGDS single null mice are hypomyelinated.
  • FIG. 6 PTGDS enzymatic activity is important for PNS myelination and maintenance
  • AT-56 treatment was started the day before ascorbic acid addition and the compound freshly added every other day. After 21 days in myelinating conditions cultures were fixed and stained for MBP (rhodamine), Neurofilament (fluorescein) and nuclei (D API-blue). AT-56 treatment significantly impairs myelination.
  • MBP rhodamine
  • Neurofilament fluorescein
  • nuclei D API-blue
  • AT-56 treatment in already myelinated cultures induces myelin degeneration
  • MBP rhodamine
  • Neurofilament fluorescein
  • DAPI-blue nuclei
  • FIG. 8 PGD2 induced NFATc4 dephosphorylation in primary Schwann cells
  • Schwann cells lysates were tested by western blotting analyses for Calcineurin Bl (a), PKA phosphorylation and total PKA levels (b) and NFATc4 phosphorylation (c).
  • PGD2 similarly to NRGl treatment, induces dephosphorylation of NFATc4, while Calcineurin Bl and PKA phosphorylation levels are not modified.
  • Figure 9 Model representing PTGDS activity.
  • NRGl ICD upon generation, translocates into the nucleus to specifically activate PTGDS mRNA expression.
  • PTGDS protein is then released in the media were it is enzymatically active.
  • PGD2 a PTGDS metabolite, binds to and activate glial GPR44 that results in dephosphorylation and nuclear translocation of NFATc4 to promote myelin gene expression.
  • FIG 10 PTGDS protein is not retained in DRG neurons.
  • Figure 11 AT-56 treatment impairs early myelination. Immunofluorescence (a) and Western blotting (b) analyses of mouse organotypic co-cultures treated with 25 ⁇ AT-56 for 7 days in myelinating conditions. AT-56 treatment was started the day before ascorbic acid addition. Cultures were fixed and stained for MBP (rhodamine), Neurofilament (fluorescein) and DAPI (blue).
  • MBP rhodamine
  • Neurofilament fluorescein
  • DAPI blue
  • FIG. 12 PTGDR and PPARy expression
  • FIG 13 GPR44 modulates myelination in organotypic cultures
  • a) Co-cultures of organotypic rat Schwann cells DRG neurons infected with GPR44 specific shRNAs and scramble (shscr) lentiviruses were maintained in myelinating conditions for 7 d, fixed and stained for MBP (rhodamine) and neurofilament (fluorescein). Less myelin segments are evident in shGPR44-infected cultures.
  • GPR44 sh3 has no effect on myelination. In agreement it didn't reduced GPR44 expression in isolated Schwann cells (see Fig 6b).
  • Schwann cells were then treated with 2.5 ng/ml RGipi , 10 nM Cyclosporin A, 10 ⁇ DMSO, 10 ⁇ recombinant PGD2, 2.5 ⁇ forskolin, 10 ⁇ PGD2 together with 2.5 ⁇ forskolin.
  • Schwann cells lysates were tested by western blotting analyses for AKT-1 phosphorylation (ser 473) and total AKT-1 levels (a) and p44/p42 phosphorylation and total p44/p42 levels (b). PGD2 does not activate AKT-1 and MAPK pathways.
  • H-PGDS is expressed in sciatic nerves. Two months old wild type, L-PGDS null and H-PGDS null sciatic nerve cross sections were stained for H-PGDS (rhodamine). H-PDGS is expressed in wild type and not upregulated in PTGDS null tissues. Sections were also stained for neurofilament (fluorescein) and nuclei (DAPI). Bar: 50 ⁇ .
  • Figure 18 The number of myelinated axons and Remak fibers are normal in H/L double null sciatic nerves, a) The total number of myelinated axons per area is similar in 1 month old motor roots wild type and H/L double knock out mice. Myelinated fibers were counted over the entire reconstructed roots, (p not significant), b) The total number of myelinated axons per area is similar in 1 month old sensory roots of wild type and H/L double knock out mice. Myelinated fibers were counted over the entire reconstructed roots, (p not significant), c) The total number of myelinated axons per area is similar in 6 month old motor roots wild type and H/L double knock out mice.
  • Myelinated fibers were counted over the entire reconstructed roots, (p not significant), d) The total number of myelinated axons per area is similar in 6 month old sensory roots of wild type and H/L double knock out mice. Myelinated fibers were counted over the entire reconstructed roots, (p not significant), e) The total number of myelinated axons per area is similar in 9 month old sciatic nerves of wild type and H/L double knock out mice.
  • H/ and L/PTGDS null mice has been previously described (L-PGDS [31]; H-PGDS [40]). Double null mice were obtained by crossing single null mice. Mice were genotyped by PCR using the following primers. Wild type alleles: 5' -GAGTTGCT GCATCTGACCTTTTC -3' (SEQ ID No. 3) and 5'- T AGCGAATAATTTCGGCTCTTCC-3 ' (SEQ ID No. 4) for H-PGDS (773bp) and 5' - TGTCAGGAATGTGGT ATGCTC-3 ' (SEQ ID No. 5) and 5'- AATACAGCTTTCTTCTCCCGGAAC -3 ' (SEQ ID No.
  • mice were genotyped by PCR using the following primers.
  • DP2 -C 5' TGGGGTCAAACTCAGCTCCTCACG-3' (SEQ ID No. 1 1)
  • DP2-E 5 * CGCGCGGCTAACAAGTCGGATAG-3 * (SEQ ID No. 12)
  • DP2-GFP 5 * CTCGCCGGACACGCTGAACTTGT-3 * (SEQ ID No. 13) and the following PCR cycling conditions: 93°C for 30 s, 55 °C for 30 s and 72°C for 180 s (35 cycles).
  • NRG1 type III lentivirus (pL6/V5 NRG1) was generated as described (19).
  • the pL6/V5- NRG1 -EGFP3' plasmid was obtained by cloning in frame into the unique Xho I restriction site of pL6/V5 NRGl EGFP cDNA.
  • NRGl stop codon and EGFP ATG were mutated by standard PCR mutagenesis.
  • pL6/V5-NRGl-EGFP5' was obtained by standard PCR mutagenesis by cloning the EGFP sequence in frame and without its ATG between amino acid 26 and 27 of NRGl type III cDNA, to avoid interference with putative NRGl signal peptide.
  • pL6/V5 NRGl ICD-EGFP was obtained by cloning the intracellular domain of rat NRGl type III, from K 1020 to V 2100, without the stop codon, in the pL6/V5 plasmid by topoisomerase. Upstream K1020 we inserted an ATG by standard PCR mutagenesis. The EGFP cDNA was cloned in frame into the unique Xho I restriction site of pL6/V5 NRG1-ICD. NRGl stop codon and EGFP ATG were mutated by standard PCR mutagenesis.
  • pL6/V5 -NRGl -FLAG and pL6/V5-NRGl -ICD-FLAG plasmids were obtained by replacing the EGFP epitope into pL6/V5 NRG1 -EGFP3' and pL6/V5 NRGl ICD-EGFP3' with the 3XFLAG epitope.
  • the 3X FLAG epitope was amplified by PCR from the p3XFLAG-CMV-14 expression vector (Sigma-Aldrich). Specifically, the authors introduced the Xhol and SacII restriction sites in the p3XFLAG-CMV-14 vector upstream and downstream the 3XFLAG sequence respectively by PCR mutagenesis. All constructs were obtained following standard molecular biology techniques and confirmed by sequencing.
  • Mouse and rat DRG neurons were isolated from E14.5 or E16.5 embryos and established on collagen-coated glass coverslips as described (19). Explants were cycled either with FUDR to eliminate all non-neuronal cells or in some experiments endogenous SC were maintained. Neuronal media was supplemented with 50 ng/ml NGF (Harlan, Bioproducts for Science). Primary rat Schwann cells were prepared as described (19) and maintained in DMEM (Invitrogen), 10% FBS (Invitrogen), 2 mM L-glutamine (Invitrogen), until used. Rat Schwann cells were added (200,000 cells/coverslip) to establish explant cultures of DRG neurons and myelination was initiated by supplementing media with 50 ⁇ g/ml ascorbic acid (Sigma-Aldrich).
  • the percentage of Caspase 3+ cells treated with AT56 was determined by standard immunofluorescence analyses. Isolated Schwann cells treated with AT-56 or Schwann cells-DRG neuronal co -cultures were treated with different concentrations of AT56 and then fixed and stained for Caspase 3 and nuclear marker (DAPI). The total number of Caspase 3+ cells was assessed on the entire coverslips and expressed relative to the total number of cells (3 covers lip/experiment; 3 different experiments).
  • the number of MBP+ cells was determined in control and AT56 treated cultures 7 d after induction of myelination. Quantitation was performed on the entire culture (total of 39 coverlips/ condition; 3 different experiments).
  • Digitized non-overlapping semithin sections images from corresponding levels of the sciatic nerve were obtained with a digital camera (Leica DFC300F) using a 100 x objective, g-ratio measurements were performed on digitized non overlapping electron micrographs images, g-ratio was determined by dividing the mean diameter of an axon without myelin by the mean diameter of the same axon with myelin. More than a 100 randomly chosen fibers per animal were analyzed for P7, 1 month and 9 months g-ratio measurements.
  • BeadChips were imaged using the Illumina ® BeadArray Reader, a two-channel 0.8 ⁇ resolution confocal laser scanner.
  • the software Illumina ® GenomeStudio version 2011.1 was used to take fluorescent hybridization signals and to assess the system quality controls, such as biological specimen control, hybridization controls, signal generation controls and negative controls.
  • system quality controls such as biological specimen control, hybridization controls, signal generation controls and negative controls.
  • For each experimental condition four biological replicates have been analysed, and technical replicates have been tested in 4/16 samples.
  • the mean correlation coefficient value of technical replicates was 0.993 (SD: 0.005) and of biological ones was 0.967 (SD: 0.013).
  • Sample clustering analysis based on the absolute correlation metric parameter was also performed, and the graphical representation of the dendrogram further supported the technical validity of the data.
  • RNA isolation and measurements Total RNA was isolated from purified rat Schwann cells and rat purified DRG neurons, using Trizol (Roche), according to manufacturer's instruction. Total RNA was retro-transcribed to cDNA as previously described (34). Aliquots of RT products were tested in parallel using primers pair for PTGDS (5 '-GAGAAGAAAGAGCTACTGTTTATGTGC-3 ' (SEQ ID No. 14) and 5'- CTAAAGGTGATGAATTTCTCCTTCAG -3' (SEQ ID No.
  • qRT-PCR PCR analyses were performed using Sso Fast EvaGreen Supermix (Biorad) according to manufacturer's instructions.
  • the genes of interest and housekeeping genes were amplified using the same reaction protocol.
  • PTGDS 5 '-GAGAAGAAAGAGCTACTGTTTATGTGC -3' (SEQ ID No. 14) and 5 '-CTAAAGGTGATGAATTTCTCCTTCAG-3 ' (SEQ ID No. 15);
  • GAPDH 5'- GGTCT ACATGTTCCAGTATGACTCTA-3 ' (SEQ ID No. 17) and 5'- CTTGAGGGAGTTGTCATATTTCTC-3 ' (SEQ ID No. 18);
  • PCR cycling conditions were 95°C for 30 s, 56°C for 60 s 72°C for 90 s (41 cycles).
  • GAPDH GAPDH
  • PCR cycling conditions were: 95°C for 30 s, 58°C for 60 s, 72°C for 90 s (41 cycles).
  • GPR177 5 '-AACAACCAAATCAGAGAAAATGCAG-3 ' (SEQ ID No. 27) and 5 '-AGCAAACCATACCTTAGTGAAACCTC-3 ' (SEQ ID No. 28);
  • NFATc4 5'- CAGGTCTACTTTTTATGTCTCCAATGG-3 ' (SEQ ID No. 29) and 5'- ATCCGTAGGCCAGATCTATAAGACG-3 ' (SEQ ID No. 30); SOD3 5'- TTCTTGTTCTGCAACCTGCT ACT-3 ' (SEQ ID No. 31) and 5 '-
  • AAATAGCAGTGATCCGAGAATACTCC-3' (SEQ ID No. 35); GAPDH 5'-
  • CTTGAGGGAGTTGTCATATTTCTC-3 ' (SEQ ID No. 37).
  • PCR cycling conditions were: 95°C for 30 s, 56°C for 60 s (NFATC4, SOD3 and GAPDH) and 54°C for 60 s (GPR177 and JAG2), 72°C for 90 s (41 cycles).
  • the pellet was resuspended with 50 ⁇ 1 of water (10% of acetronitrile) and injected into a LC/MS/MS system.
  • the LC/MS/MS system consisted into a Waters Alliance 2795 LC coupled to a Micromass Quattro Pt triple-quadrupole mass spectrometer (TQuattro-Pt, Waters) equipped with a Z-Spray ESI source, operated in negative ion mode.
  • the HPLC column was a Synergy HydroRP (150 x 1mm, 4 ⁇ ) (Phenomenex) maintained at 25°C.
  • the mobile phase was acetonitrile (solvent A) and water (solvent B) (both added with 0.005% acetic acid) at a flow rate of 0.070ml/min.
  • the gradient timetable was the following: injection at 10% A; 70% A at 25 min; 10% A at 26 min; 10% A at 40 min.
  • the ionization mode of MS was electrospray in negative polarity (ES).
  • the transitions monitored are 380>186 for the endogenous compound and 391>342 for the internal standard.
  • the collision energy used was 14 eV. In these conditions, we observed a characteristic bifid peak at the retention time of 18 min.
  • Tissues and cell lysates were prepared as described (19). Supematants were aliquoted and stored at -
  • Mouse monoclonal antibodies included anti-MBP (SMI-94, SMI-99), neurofilament (SMI-31 and SMI-32) (Sternberger Monoclonals), GFP (Roche).
  • Rabbit polyclonal antibodies included anti-NRG sc348 (Santa Cruz), actin, FLAG and Calnexin (Sigma-Aldrich), PTGDS (Abnova), phospho-AKT (ser 473), and total AKT, phospho-ERK (p44, p42) and total ERK, NFAT3, PLCy, phospho-PKA and total PKA, phosho PKC, H-PGDS (LSBio) and total PKC, Calcineurin Bl (Cell Signaling).
  • Chicken antibodies include anti-neurofllament M (Covance), MPZ (Millipore). Rat MBP hybridoma was a generous gift of Dr. Virginia Lee (University of Pennsylvania).
  • NRGl type III intracellular domain (ICD) is cleaved by y-secretase and specifically activates PTGDS
  • NRGl type III activity is modulated by competitive extracellular cleavage between BACEl and TACE.
  • NRGl type III is also intracellularly processed by ⁇ -secretase, suggesting that it might function as a bidirectional molecule (6).
  • the authors generated two lentiviral vectors expressing NRGl type III tagged with a EGFP epitope either at the N terminal (N- NRGl) or at the C terminal end (C-NRGl).
  • NRGl ICD constitutively cleaved form of NRGl tagged with a FLAG epitope at the C terminus
  • NRGl ICD physiologically translocates into the nucleus
  • the authors generated a lentivirus expressing full length NRGl type III also tagged with a FLAG epitope at the C terminus.
  • the authors infected rat primary dorsal root ganglia (DRG) neurons. Since previous experiments suggest that SC are implicated in the intracellular processing of NRGl type III, the authors added rat primary SC to DRG neurons 7 days after infection, to allow sufficient expression of the lentivirus (19) and monitored FLAG localization by immunofluorescence.
  • the authors detected the FLAG epitope in the nucleus of DRG infected neurons (Fig. lc), confirming that NRGl type III physiologically undergoes classical intramembrane proteolysis.
  • NRGl ICD nuclear translocation modify gene transcription To evaluate whether NRGl ICD nuclear translocation modify gene transcription, the authors performed genome wide expression analysis on an Illumina platform. They compared mRNA from DRG neurons infected with a lentivirus expressing NRGl ICD, not infected or infected with a lentivirus expressing only EGFP as controls. Among all genes upregulated with a fold change cut-off of 2.0 (p ⁇ 0.01), only the PTGDS, also known as L-PGDS, mRNA was the most upregulated in DRG neurons over-expressing NRGl ICD unlike controls (Fig 2a, Fig. 15 and data not shown).
  • the authors grew both NRGl ICD infected and not infected neurons in defined media (neurobasal), to avoid the possibility that the serum might interfere with PTGDS expression.
  • the authors then collected the media at different time points and determined PTGDS expression by western blotting analyses.
  • the authors detected PTGDS protein in conditioned media of neurons infected with NRGl ICD or PTGDS (Fig 3a), but also in limited amount in conditioned media of not infected DRG neurons (Fig 3a), indicating that PTGDS is constitutively released at the protein level and that its synthesis is upregulated by NRGl ICD expression.
  • PGD2 is the product of two different enzymes, H-PGDS essentially expressed in inflammatory cells and in the brain in microglial cells and PTGDS, whose expression is instead enriched in the brain and sensory neurons.
  • H-PGDS essentially expressed in inflammatory cells and in the brain in microglial cells and PTGDS, whose expression is instead enriched in the brain and sensory neurons.
  • the authors analyzed nerve morphology in transgenic mice lacking PTGDS. These mice display various abnormalities, including glucose intolerance and insulin resistance (22), sleep inhibition (23), acceleration of beta-amyloid deposition (24) and aberrant Sertoli cells maturation (25).
  • PTGDS null mice H/L double null mice. These mice displays various abnormalities, including glucose intolerance and insulin resistance (22), sleep inhibition (23), acceleration of beta-amyloid deposition (24) and aberrant Sertoli cells maturation (25).
  • H-PGDS H-PGDS null sciatic nerves
  • AT-56 is a selective, competitive, and highly bioavailable inhibitor of L-PGDS with a K; value of 75 ⁇ . It inhibits the production of PGD 2 by L-PGDS purified from human CSF and recombinant mouse cells with an IC 50 value of 95 ⁇ . At concentrations as high as 100 ⁇ in vitro or 30 mg/kg in vivo, AT-56 does not affect the production of PGE 2 , PGF 2a , or H-PGDS-catalyzed PGD 2 (26). Of note, AT-56 could efficiently inhibit PTGDS activity with a broad concentration ranging between 10 and 250 ⁇ (26).
  • the authors first titrated the amount of AT-56 and compared it to DMSO vehicle-only treated cultures. Specifically, they treated isolated rat primary SC, purified mouse DRG neurons and non myelinating SC-DRG neuronal co-cultures with 10, 20, 30, 40, 50 and 60 ⁇ AT-56 for 14 days (isolated Schwann cells) or 25 and 50 uM AT-56 for 14 days (Schwann cells-neuronal cocultures) and monitored cell death by active caspase 3 staining (Fig 19 a,b). From these studies the authors found that 50 ⁇ AT-56 could induce massive neuronal cell death in Schwann cells upon prolonged treatment, while 25 ⁇ AT-56 was well tolerated and did not induce any cell sufferance or death.
  • the authors treated organotypic SC-DRG neuronal co-cultures with 25 ⁇ AT-56, by freshly adding the inhibitor to the culture media every other day.
  • the authors treated organotypic cultures only after the peak of proliferation, starting the day before addition of ascorbic acid and for 7 (Fig. 1 1) or 21 days (Fig. 6).
  • Immunofluorescence (Fig. 6a, c) and western blot analyses (Fig. 6b) show that AT-56 treatment significantly inhibits myelination as compared to untreated or vehicle only treated cultures, but has no effect on internodal length (Fig. 6d).
  • AT-56 inhibition of myelination is dose dependent (Fig. 19c).
  • Glial GPR44 modulates PTGDS activity
  • PPAR- ⁇ which is mainly intracellularly located, GPR44, also known as DP2 or CRTH2 and PTGDR also known as DPI .
  • GPR44 also known as DP2 or CRTH2
  • PTGDR also known as DPI .
  • NRGl type III specifically activates the PI-3 kinase pathway (19, 27), recent studies showed that ablation of components of the ERK/MAPK pathways prevents PNS myelination (28). Further, PLC- ⁇ activation, via the NRGl/ErbB pathway, facilitates the translocation of the transcription factor NFAT-c3/c4 in SC nuclei (18) to induce myelination. Finally, elevation of cAMP in primary rat SC activates transcription of myelin genes (29, 30). Of note activation of PGD2 receptors, can modulate intracellular levels of cAMP and Ca2+ release with subsequent activation of PLC- ⁇ .
  • NRGl type III similarly to other growth factors, is processed following a regulated intra- membrane proteolysis mechanism. This is a highly conserved mechanism allowing fast communication from the plasma membrane to the cell nucleus, where the response to extracellular stimuli is normally achieved by activating transcription of specific gene(s).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Neurosurgery (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un activateur de la voie PTGDS pour son utilisation dans le traitement et/ou la prévention d'une pathologie caractérisée par une altération de la myélinisation dans le système nerveux central. La maladie est en particulier la sclérose en plaques ou une neuropathie périphérique telle qu'une neuropathie héréditaire, une neuropathie inflammatoire ou une neuropathie toxique.
PCT/EP2014/063995 2013-07-01 2014-07-01 Activateurs de la voie ptgds et utilisation dans des pathologies caractérisées par une altération de la myélinisation dans le snc WO2015000921A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13174544 2013-07-01
EP13174544.0 2013-07-01

Publications (1)

Publication Number Publication Date
WO2015000921A1 true WO2015000921A1 (fr) 2015-01-08

Family

ID=48699653

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/063995 WO2015000921A1 (fr) 2013-07-01 2014-07-01 Activateurs de la voie ptgds et utilisation dans des pathologies caractérisées par une altération de la myélinisation dans le snc

Country Status (1)

Country Link
WO (1) WO2015000921A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022046605A1 (fr) * 2020-08-25 2022-03-03 City Of Hope Compositions et procédés de détection du récepteur 44 couplé à la protéine g

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007047489A2 (fr) * 2005-10-18 2007-04-26 Acadia Pharmaceuticals Inc. Compositions et procedes utilises dans le traitement du cancer
WO2010104024A1 (fr) 2009-03-09 2010-09-16 大鵬薬品工業株式会社 Composé de pipérazine capable d'inhiber la prostaglandine d synthase
WO2012033069A1 (fr) 2010-09-07 2012-03-15 大鵬薬品工業株式会社 Composés de pipéridine inhibiteurs de la prostaglandine d synthase

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007047489A2 (fr) * 2005-10-18 2007-04-26 Acadia Pharmaceuticals Inc. Compositions et procedes utilises dans le traitement du cancer
WO2010104024A1 (fr) 2009-03-09 2010-09-16 大鵬薬品工業株式会社 Composé de pipérazine capable d'inhiber la prostaglandine d synthase
WO2012033069A1 (fr) 2010-09-07 2012-03-15 大鵬薬品工業株式会社 Composés de pipéridine inhibiteurs de la prostaglandine d synthase

Non-Patent Citations (47)

* Cited by examiner, † Cited by third party
Title
BACHMANN ET AL., NEUROSURGERY, vol. 50, 2002, pages 571 - 576
BAO, J ET AL., J CELL BIOL, vol. 161, 2003, pages 1133 - 1141
BAO, J. ET AL., NAT NEUROSCI, vol. 7, 2004, pages 1250 - 1258
BEUCKMANN, C. T. ET AL., J COMP NEUROL, vol. 428, 2000, pages 62 - 78
BEUCKMANN, C. T. ET AL., JNEUROSCI, vol. 16, 1996, pages 6119 - 6124
BIRCHMEIER, C. ET AL., GLIA, vol. 56, 2008, pages 1491 - 1497
BOLIS, A. ET AL., JNEUROSCI, vol. 29, 2009, pages 8858 - 8870
CHANG-CHIEH WU ET AL: "Involvement of the prostaglandin D2 signal pathway in retinoid-inducible gene 1 (RIG1)-mediated suppression of cell invasion in testis cancer cells", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - MOLECULAR CELL RESEARCH, vol. 1823, no. 12, 1 December 2012 (2012-12-01), pages 2227 - 2236, XP055144814, ISSN: 0167-4889, DOI: 10.1016/j.bbamcr.2012.08.013 *
CHEN, Y. ET AL., J NEUROSCI, vol. 30, 2010, pages 9199 - 9208
EGUCHI, N. ET AL., PROC NATL ACAD SCI USA, vol. 96, 1999, pages 726 - 730
GIACOMELLI, S. ET AL., BIOCHIM BIOPHYS ACTA, vol. 1310, 1996, pages 269 - 276
HASKEW-LAYTON, R. E. ET AL., JNEUROCHEM, vol. 124, 2013, pages 536 - 547
HORIUCHI, K. ET AL., DEV BIOL, vol. 283, 2005, pages 459 - 471
HU, X. ET AL., NAT NEUROSCI, vol. 9, 2006, pages 1520 - 1525
HUANG Y C ET AL: "Decreased intrathecal synthesis of prostaglandin D2 synthase in the cerebrospinal fluid of patients with acute inflammatory demyelinating polyneuropathy", JOURNAL OF NEUROIMMUNOLOGY, ELSEVIER SCIENCE PUBLISHERS BV, NL, vol. 206, no. 1-2, 3 January 2009 (2009-01-03), pages 100 - 105, XP025767915, ISSN: 0165-5728, [retrieved on 20081202], DOI: 10.1016/J.JNEUROIM.2008.10.011 *
HUANG YC ET AL., J NEUROIMMUNOL., vol. 206, no. 1-2, 1 March 2009 (2009-03-01), pages 100 - 5
IRIKURA, D. ET AL., J BIOL CHEM, vol. 284, 2009, pages 7623 - 7630
KANEKIYO, T. ET AL., PROC NATL ACAD SCI U S A, vol. 104, 2007, pages 6412 - 6417
KAO, S. C. ET AL., SCIENCE, vol. 323, 2009, pages 651 - 654
KERR, B. J.; GIROLAMI, E. I.; GHASEMLOU, N.; JEONG, S. Y.; DAVID, S, GLIA, vol. 56, 2008, pages 436 - 448
KOSTENIS, E.; ULVEN, T, TRENDS MOL MED, vol. 12, 2006, pages 148 - 158
LA MARCA, R. ET AL., NAT NEUROSCI, vol. 14, 2011, pages 857 - 865
MELEGOS D N ET AL: "Prostaglandin D Synthase Concentration in Cerebrospinal Fluid and Serum of Patients with Neurological Disorders", PROSTAGLANDINS, BUTTERWORTH, STONEHAM, MA, US, vol. 54, no. 1, 1 July 1997 (1997-07-01), pages 463 - 474, XP004087867, ISSN: 0090-6980, DOI: 10.1016/S0090-6980(97)00062-2 *
MICHAEL G. HARRINGTON ET AL: "Prostaglandin D Synthase Isoforms from Cerebrospinal Fluid Vary with Brain Pathology", DISEASE MARKERS, vol. 22, no. 1-2, 1 January 2006 (2006-01-01), pages 73 - 81, XP055145311, ISSN: 0278-0240, DOI: 10.1155/2006/241817 *
MOHRI, I. ET AL., JNEUROSCI, vol. 26, 2006, pages 4383 - 4393
MONIOT, B. ET AL., DEVELOPMENT, vol. 136, 2009, pages 1813 - 1821
MONJE, P. V.; ATHAUDA, G.; WOOD, P. M, JBIOL CHEM, vol. 283, 2008, pages 34087 - 34100
MONNERET G ET AL: "15R-METHYL-PROSTAGLANDIN D2 IS A POTENT AND SELECTIVE CRTH2/DP2 RECEPTOR AGONIST IN HUMAN EOSINOPHILS", JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, AMERICAN SOCIETY FOR PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, US, vol. 304, no. 1, 1 January 2003 (2003-01-01), pages 349 - 355, XP008017457, ISSN: 0022-3565, DOI: 10.1124/JPET.102.042937 *
MONNERET G. ET AL., J. OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 304, 2003, pages 349 - 355
NELSON, AM. ET AL., J INV DERMATOL, vol. 133, 2013, pages 881 - 889
NEWBERN, J. M. ET AL., NEURON, vol. 69, 2011, pages 91 - 105
OGATA, T. ET AL., JNEUROSCI, vol. 24, 2004, pages 6724 - 6732
QU, W. M. ET AL., PROC NATL ACAD SCI U S A, vol. 103, 2006, pages 17949 - 17954
QUATTRINI, A. ET AL., GLIA, vol. 17, 1996, pages 294 - 306
RAFF, M. C.; ABNEY, E.; BROCKES, J. P.; HORNBY-SMITH, A, CELL, vol. 15, 1978, pages 813 - 822
RAGOLIA, L. ET AL., JBIOL CHEM, vol. 280, 2005, pages 29946 - 29955
SAMY, E. T. ET AL., ENDOCRINOLOGY, vol. 141, 2000, pages 710 - 721
TANIIKE M ET AL., J. NEUROSCI., vol. 22, no. 12, 15 June 2002 (2002-06-15), pages 4885 - 96
TAVEGGIA, C. ET AL., NEURON, vol. 47, 2005, pages 681 - 694
TEJ K. PAREEK ET AL., LETTERIO SCI REP., vol. 1, 2011, pages 201
TOOTLE, T. L, INT JBIOCHEM CELL BIOL, vol. 45, 2013, pages 1629 - 1632
TRIVEDI ET AL., PNAS, vol. 103, pages 5179 - 5184
URADE, Y.; EGUCHI, N, ROSTAGLANDINS OTHER LIPID MEDIAT, 2002, pages 68 - 69,375-382
URADE, Y.; HAYAISHI, O, VITAM HORM, vol. 58, 2000, pages 89 - 120
WILLEM, M. ET AL., SCIENCE, vol. 314, 2006, pages 664 - 666
WRABETZ, L. ET AL., JNEUROBIOL, vol. 34, 1998, pages 10 - 26
XIANG ZHONGMIN ET AL: "15d-PGJ2 induces apoptosis of mouse oligodendrocyte precursor cells", JOURNAL OF NEUROINFLAMMATION, BIOMED CENTRAL LTD., LONDON, GB, vol. 4, no. 1, 16 July 2007 (2007-07-16), pages 18, XP021030253, ISSN: 1742-2094, DOI: 10.1186/1742-2094-4-18 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022046605A1 (fr) * 2020-08-25 2022-03-03 City Of Hope Compositions et procédés de détection du récepteur 44 couplé à la protéine g

Similar Documents

Publication Publication Date Title
Zhang et al. CXCL1 contributes to β-amyloid-induced transendothelial migration of monocytes in Alzheimer’s disease
Askarova et al. Role of Aβ-receptor for advanced glycation endproducts interaction in oxidative stress and cytosolic phospholipase A2 activation in astrocytes and cerebral endothelial cells
Wyneken et al. Kainate-induced seizures alter protein composition and N-methyl-D-aspartate receptor function of rat forebrain postsynaptic densities
Tortoriello et al. Miswiring the brain: Δ9‐tetrahydrocannabinol disrupts cortical development by inducing an SCG 10/stathmin‐2 degradation pathway
Trimarco et al. Prostaglandin D2 synthase/GPR44: a signaling axis in PNS myelination
Uchigashima et al. Subcellular arrangement of molecules for 2-arachidonoyl-glycerol-mediated retrograde signaling and its physiological contribution to synaptic modulation in the striatum
Wen et al. VPS35 haploinsufficiency increases Alzheimer’s disease neuropathology
Chen et al. CDKL5, a protein associated with rett syndrome, regulates neuronal morphogenesis via Rac1 signaling
Zhang et al. Ablating ErbB4 in PV neurons attenuates synaptic and cognitive deficits in an animal model of Alzheimer's disease
Buys et al. Regulation of intraocular pressure by soluble and membrane guanylate cyclases and their role in glaucoma
US9486521B2 (en) Therapeutic applications targeting SARM1
Mattioli et al. Altered modulation of lamin A/C‐HDAC2 interaction and p21 expression during oxidative stress response in HGPS
Iovino et al. Trafficking of the glutamate transporter is impaired in LRRK2-related Parkinson’s disease
Li et al. MicroRNA-125b mimic inhibits ischemia reperfusion-induced neuroinflammation and aberrant p53 apoptotic signalling activation through targeting TP53INP1
JP2021523888A (ja) パーキンソン病におけるｐｋｃ経路
Zhao et al. RPS23RG1 is required for synaptic integrity and rescues Alzheimer’s disease–associated cognitive deficits
McGregor et al. Age-dependent regulation of excitatory synaptic transmission at hippocampal temporoammonic-CA1 synapses by leptin
Cammalleri et al. Vascular endothelial growth factor up‐regulation in the mouse hippocampus and its role in the control of epileptiform activity
Yokoyama et al. Multiple transcripts of Ca2+ channel α1-subunits and a novel spliced variant of the α1C-subunit in rat ductus arteriosus
Zhang et al. Sirt1 attenuates astrocyte activation via modulating Dnajb1 and chaperone-mediated autophagy after closed head injury
Saia et al. Phosphorylation of the transcription factor Sp4 is reduced by NMDA receptor signaling
Hui et al. Nonenzymatic function of DPP4 promotes diabetes-associated cognitive dysfunction through IGF-2R/PKA/SP1/ERp29/IP3R2 pathway-mediated impairment of Treg function and M1 microglia polarization
Kastriti et al. Differential modulation of the juxtaparanodal complex in multiple sclerosis
Cao et al. Intrafusal-fiber LRP4 for muscle spindle formation and maintenance in adult and aged animals
WO2015000921A1 (fr) Activateurs de la voie ptgds et utilisation dans des pathologies caractérisées par une altération de la myélinisation dans le snc

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14734171

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14734171

Country of ref document: EP

Kind code of ref document: A1