WO2014209230A1 - Preparation of enantiopure vicinal diols and alpha-hydroxyketones from racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations - Google Patents

Preparation of enantiopure vicinal diols and alpha-hydroxyketones from racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations Download PDF

Info

Publication number
WO2014209230A1
WO2014209230A1 PCT/SG2014/000299 SG2014000299W WO2014209230A1 WO 2014209230 A1 WO2014209230 A1 WO 2014209230A1 SG 2014000299 W SG2014000299 W SG 2014000299W WO 2014209230 A1 WO2014209230 A1 WO 2014209230A1
Authority
WO
WIPO (PCT)
Prior art keywords
coli
bdha
epoxide
enzyme
racemic
Prior art date
Application number
PCT/SG2014/000299
Other languages
French (fr)
Inventor
Zhi Li
Tianwen WANG
Jiandong ZHANG
Original Assignee
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Of Singapore filed Critical National University Of Singapore
Publication of WO2014209230A1 publication Critical patent/WO2014209230A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
    • C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones

Definitions

  • Enantiopure vicinal diols and a-hydroxyketones are important and valuable intermediates for the synthesis of many biologically active compounds and pharmaceuticals.
  • Several chemical methods have been developed for the preparation of these types of enantiopure compounds, but these suffer from the use of toxic and expensive catalysts and reagents, moderate enantioselectivity, and narrow substrate scope.
  • biocatalytic methods offer greener alternatives.
  • the enantioselectivity and efficiency of known bio- preparation of neither enantiopure vicinal diols nor enantiopure a-hydroxyketones are satisfactory. Accordingly, a need exists for methods of making enantiopure vicinal diols and ⁇ -hydroxyketones by biocatalysis with high yield, purity, and substrate scope.
  • the invention provides methods of making enantiopure vicinal diols and ⁇ -hydroxyketones by biocatalysis with high yield, purity, and substrate scope.
  • novel and efficient methods and process for the production of enantiopure vicinal diols and ⁇ -hydroxyketones from the easily available and cheap racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations have been developed.
  • the method is based on the use of an enantioselective hydrolase to hydrolyze an epoxide to give the enantioenriched vicinal diol and the use of one or more enantioselective oxideoreductase(s) to oxidize the minor enantiomer of the diol to increase the ee of the vicinal diol or the use of a enantioselective oxideoreductase to oxidize the major enantiomer of the diol to give the corresponding a-hydroxyketones in high ee.
  • Pseudomonas medocina TA5 and CDDHRh from Rhodococcus sp. Moj-3449 are also suitable enzyme for the oxidation step.
  • Preparation of enantiopure a- hydroxyketones from the corresponding racemic epoxide via cascade biocatalysis was demonstrated with (i?)-2-hydroxytetralone as the target compound.
  • Cascade biotransformation of racemic 1,2-epoxytetralin with the resting cells of E. coli (SpEH) and E. coli (bdhA) gave (7?)-2-hydroxytetralone in 99.9% ee and 35% yield.
  • Recombinant E. coli (SpEH-bdhA) co-expressing SpEH and bdhA was also a good catalyst. Resting cells of this strain were used to convert 50 mM cyclohexene oxide to (i?)-a-hydroxycyclohexanone in 99% ee and 86% yield and 100 mM cyclopene oxide to (i?)-a-hydroxycyclopantanone in 97.1% ee and 65% yield. The transformation of racemic 1 ,2-epoxytetralin to (i?)-2-hydroxytetralone was also achieved with the recombinant E. coli (SpEH-bdhA), giving 99.0% product ee and 38.0% yield.
  • An aqueous-organic two-phase system can be used to avoid potential substrate inhibition and/or product inhibition.
  • cascade
  • the suitable catalyst system for this invention includes one or more of the following components: cells containing the necessary enzymes, cell-free extracts containing the necessary enzymes, isolated enzymes, immobilized enzymes, and immobilized cells containing the necessary enzymes.
  • FIG. 1 illustrates preparation of chiral vicinal diols in high ee from racemic epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
  • FIG. 2 shows examples of racemic epoxide substrates and enantiopure vicinal diol products of tandem biocatalysis via hydrolysis and oxidation in one pot.
  • FIG. 3 illustrates preparation of chiral vicinal diols in high ee from meso- epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
  • FIG. 4 shows examples of the meso-epoxide substrates and enantiopure vicinal diol products of tandem biocatalysis via hydrolysis and oxidations.
  • FIG. 5 illustrates preparation of chiral a-hydroxyketones in high ee from racemic epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
  • FIG. 6 shows examples of the racemic epoxide substrates
  • FIG. 7 illustrates preparation of chiral a-hydroxyketones in high ee from meso-epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
  • FIG. 8 shows examples of the epoxide substrates and enantiopure hydroxyketone products of tandem biocatalysis via hydrolysis and oxidation in one pot.
  • FIG. 9 shows the recombinant plasmids used for the expression of epoxide hydrolase (StEH), alcohol dehydrogenase (alkJ), and aldehyde
  • alkH dehydrogenase
  • FIG. 10 illustrates cell growth of three recombinant E. coli strains expressing epoxide hydrolase (StEH), alcohol dehydrogenase (alkJ), and aldehyde dehydrogenase (alkH), respectively. At 2.2 h, 0.5 mM IPTG was added to induce the enzyme expression.
  • StEH epoxide hydrolase
  • alkJ alcohol dehydrogenase
  • alkH aldehyde dehydrogenase
  • FIG. 11 shows SDS-PAGE analysis of the enzymes expressed in E. coli strains.
  • Lane M protein marker
  • Lane 1 and Lane 5 E. coli strains with empty plasmid as negative control
  • Lane 2 E. coli (pET28aStEH) expressing StEH
  • Lanes 4 and 7 E. coli (pET28aalkJ) expressing alkJ
  • Lane 6 E. coli (pET28aalkH) expressing alkH
  • Lane 8 E. coli (pET28aalkJStEH) co-expressing the StEH and alkJ.
  • 2.5 ⁇ sample was loaded.
  • FIGs. 12A and 12B are reverse phase HPLC chromatograms of the product of the biotransformation of racemic styrene oxide 1 (50 mM) with mixture of cells of E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw/L).
  • FIG. 12A shows 2 hours reaction
  • FIG. 12B shows 22 hours reaction.
  • IS internal standard.
  • FIG. 13A and 13B are chiral HPLC chromatograms of the product of the biotransformation of racemic styrene oxide 1 (50 mM) with mixture of cells of E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw L).
  • FIG. 13A shows 2 hours reaction
  • FIG. 13B shows 22 hours reaction.
  • ⁇ epoxide (20 mM); ⁇ : diol (20 mM); ⁇ : ee (i?)-diol(20 mM).
  • FIG. 15 shows preparation of optically pure (R)- 1 -phenyl- 1 ,2-ethanediol 5 by the biotransformation of racemic styrene oxide 1 (100 mM and 150 mM) by using mixed cells of recombinant E. coli (StEH) (10 g cdw/L), E. coli (pET28aalkJ) (5 g cdw/L), and E. coli (pET28aalkH) (5 g cdw/L).
  • StEH E. coli
  • pET28aalkJ E. coli
  • pET28aalkH E. coli
  • FIG. 16 shows preparation of optically pure (R)- 1 -phenyl- 1 ,2-ethanediol 5 by the biotransformation of racemic styrene oxide 1 (150mM) using mixed cells of recombinant E. coli (StEH) (14 g cdw/L), E. coli (pET28aalkJ) (8 g cdw/L), and E. coli ( P ET28aalkH) (8 g cdw/L).
  • StEH E. coli
  • pET28aalkJ E. coli
  • P ET28aalkH 8 g cdw/L
  • FIG. 17 shows preparation of optically pure (R, i?)-l,2-cyclohexanediol 12 by the cascade biotransformation of cyclohexene oxide 9 using mixtures of cells of recombinant E. coli (pRSF-SpEH) (1 g cdw/L) and free alcohol dehydrogenase (ADH-LK).
  • Reaction volume 10 mL Tris buffer (50 mM, pH8.0); NAD + : 1.5 mM; ADH: 10 mg (0.42 U/mg); cyclohexene oxide: 10 mM.
  • FIG. 18 illustrates enantioselective oxidation of trans-cyclic vicinal diols with E. coli (bdhA) to simultaneously produce enantiopure (i?)-a-hydroxy ketones and (S ⁇ -cyclic vicinal diols.
  • FIG. 19A shows time course of cell growth and specific activity for biooxidation of ( ⁇ )-12 of E. coli (bdhA); ⁇ : cell density; ⁇ : specific activity.
  • FIG. 19B shows SDS-PAGE analysis of the cell-free extracts of E. coli strains; Lane 1 : E. coli (bdhA) with no induction; Lane 2: E. coli (bdhA) after 2 h induction; Lane 3: E. coli (bdhA) after 10 h induction; Lane M: protein marker (in kDa); Lane 4: E. coli (his-tag LDH); Lane 5: E. coli (bdhA); Lane 6: E.
  • FIG. 19C shows time course of enantioselective oxidations of ( ⁇ )-22 (10 mM) with resting cells of E. coli (bdhA) (10 g cdw/L); ⁇ : conversion; 0: ee of (S,S)- 22; ⁇ : ee of (i?)-23.
  • FIG. 19D shows time course of regio- and enantioselective oxidation of ( ⁇ )-26 (10 mM) with resting cells of E.
  • FIG. 20 shows SDS-PAGE analysis of cell free extract of E. coli
  • FIG. 21 shows sequence alignment of bdhA (SEQ ID NO: 7) with CDDHPm (SEQ ID NO: 9) and CDDHRh (SEQ ID NO: 8).
  • the multiple sequence alignment was made using ClustalW2.
  • bhdA from Bacillus subtilis BGSC1 Al (UniProt: 034788); CDDHPm from Pseudomonas medocina TA5, showing 42% identity of amino acid sequence with bdhA; CDDHRh from Rhodococcus sp. Moj- 3449, showing 49% identity of amino acid sequence with bdhA.
  • FIG. 22 shows SDS-PAGE analysis of the cell-free extracts of E. coli strains.
  • Lane 1 Cell free extract of E. coli (SpEH) after 10 h induction;
  • Lane 2 Cell free extract of E. coli (bdhA) after 10 h induction;
  • Lane 3 Cell free extract of E. coli (SpEH-bdhA) after 10 h induction;
  • Lane M protein marker (in kDa).
  • FIG. 23 shows time course of regio- and stereoselective conversion of cyclohexene oxide 9 (200 mM) to (#)-a-hydroxycyclohexanone 19 with resting cells of E. coli (bdhA-SpEH) (16 g cdw/L) in a mixture of Tris buffer (100 mM, pH 8.0) and hexadecane (5:1).
  • ⁇ concentration of (i?)-19;
  • A ee of (i?)-19.
  • compositions comprising an enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a co-factor-regenerating enzyme.
  • These compositions can be in any suitable form, such as a) one or more recombinant microorganisms expressing: the enantioselective oxidative enzyme, the selective epoxide hydrolase, or the co-factor- regenerating enzyme, or a combination thereof, optionally wherein a single recombinant microorganism expresses the enantioselective oxidative enzyme and at least one of the selective epoxide hydrolase and the co-factor-regenerating enzyme; b) a protein extract of the one or microorganisms of a); c) purified enantioselective oxidase and at least one of purified selective epoxide hydrolase and purified complementary reductase; d) purified enanti
  • a "recombinant microorganism” is a product of man that is markedly different from a microorganism (e.g., bacteria, unicellular fungus, protist, et cetera) that exists in nature.
  • a microorganism e.g., bacteria, unicellular fungus, protist, et cetera
  • the recombinant microorganism is markedly different from a microorganism that exists in nature due to the presence of a heterologous nucleic acid (encoding one or more of the enzymes described herein), which may be maintained on an exogenous plasmid or stably maintained in the genome of the microorganism.
  • heterologous refers to materials that are not associated in nature.
  • a heterologous nucleic acid construct includes a nucleic acid (or plurality of nucleic acids) associated with a nucleic acid from another species, but, in other embodiments, can include a recombinant construct where two nucleic acids from the same species are associated together in a non-naturally-occurring way, such as associating different promoters and coding sequences.
  • a "selective epoxide hydrolase” is an enzyme that may be regioselective or enantioselective when hydrolysing an epoxide to a vicinal diol.
  • a selective epoxide hydrolase produces an abundance of one enantiomer, or, if applicable, diastereomer, (at least 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99, 99.5, 99.9% or more of total enantiomers (ee) or diastereomers (de)) when hydrolysing an epoxide to a vicinal diol.
  • the selective epoxide hydrolase is regioselective. In certain embodiments, the selective epoxide hydrolase is enantioselective.
  • Exemplary selective epoxide hydrolases include epoxide hydrolases from Sphingomonas ⁇ see, e.g., SEQ ID NO:l, SpEH), Solarium tuberosum ⁇ see, e.g., SEQ ID NO:2, StEH), and Aspergillus ⁇ see, e.g., SEQ ID NO:3, AnEH).
  • the selective epoxide hydrolase produces an excess of an S enantiomer (or S,S enantiomer from a meso-epoxide) of a vicinal diol. In other embodiments, the selective epoxide hydrolase produces an excess of an R enantiomer (or R,R enantiomer from a meso-epoxide) of a vicinal diol.
  • An "enantioselective oxidative enzyme” preferentially oxidizes one enantiomer of, e.g., a vicinal diol— specifically, converting a hydroxyl group to a carbonyl group.
  • an enantioselective oxidative enzyme produces an abundance of one oxidized enantiomer, or, if applicable, diastereomer, e.g., at least 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more of total enantiomers ⁇ ee) or diastereomers ⁇ de) when oxidizing a vicinal diol; more particularly, at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9% or more.
  • Exemplary enantioselective oxidative enzymes for use in the invention include alkJ ⁇ Pseudomonas putida GPol , SEQ ID NO: 4 ), ADH-LK (from
  • Lactobacillus kefir SEQ ID NO: 6
  • BDHA from Bacillus subtilis BGSClAl, SEQ ID NO: 7
  • CDDHPm from Pseudomonas medocina TA5, SEQ ID NO: 8
  • CDDHRh from Rhodococcus sp. Moj-3449, SEQ ID NO: 9
  • Additional enantioselective oxidative enzymes include alkH, e.g., from Pseudomonas putida (SEQ ID NO: 5).
  • a "co-factor-regenerating enzyme” is an oxidoreductase of a molecule that can act as a co-substrate (or, conversely, an oxidoreductase of a co-product) of an enantioselective oxidative enzyme.
  • an enantioselective oxidative enzyme such as an alcohol dehydrogenase, can oxidize a vicinal diol and reduces NAD(P)+ to NAD(P)H in the process.
  • a co-factor-regenerating enzyme consumes NAD(P)H to reduce the complementary molecule, such a 0 2 or pyruvate to H 2 0 or lactate, respectively.
  • co-factor-regenerating enzymes include lactate dehydrogenase (LDH, e.g., from E. coli, SEQ ID NO: 10) and NADH oxidase (NOX, e.g., from Lactobacillus brevis, SEQ ID NO: 11).
  • LDH lactate dehydrogenase
  • NOX NADH oxidase
  • the compositions provided by the invention comprise a selective epoxide hydrolase and the enantioselective oxidative enzyme.
  • the selective epoxide hydrolase is selected from an epoxide hydrolase from Sphingomonas (SpEH), Solarium tuberosum (StEH), Aspergillus (AnEH), or a variant thereof that is at least 60% identical at the amino acid level to the epoxide hydrolase from Sphingomonas, Solanum tuberosum, or Aspergillus.
  • the enantioselective oxidative enzyme may be selected from Pseudomonas putida GPol alkJ,
  • Lactobacillus kefir ADH-LK Bacillus subtilis BGSC 1 A 1 BDH A, Pseudomonas medocina TA5 CDDHPm, Rhodococcus sp. Moj-3449 CDDHRh, or a variant thereof that is at least 60% identical at the amino acid level to any of the foregoing enantioselective oxidases.
  • the composition of any one of the preceding embodiments may further comprise a co-factor-regenerating enzyme.
  • the co-factor-regenerating enzyme is E. coli lactate dehydrogenase (LDH) or Lactobacillus brevis NADH oxidase (NOX), or a variant thereof that is at least 60% identical at the amino acid level to any of the foregoing complementary reductases.
  • any of the compositions provided by the invention may further comprise a racemic epoxide or a meso-epoxide.
  • the composition comprises a racemic epoxide of forumula I, IV, or VII wherein R, R l 5 and R 2 are independently selected from a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group.
  • compositions provided by the invention may further comprise a racemic trans-cyclic vicinal diol.
  • the trans-cyclic vicinal diol can be from about 5-10 carbons and may include functional groups (such as carbonyl, carboxyl, amine, substituted amine, alcohol, alkyloxy, and halogens (F, CI, Br, I)).
  • compositions described herein mayfurther comprise an aldehyde oxidase or aldehyde dehydrogenase.
  • a composition provided by the invention may include one or more recombinant microorganisms expressing, from one or more heterologous nucleic acids: the enantioselective oxidative enzyme, selective epoxide hydrolase, co-factor-regenerating enzyme, or a combination thereof.
  • the recombinant microorganism is a bacterium.
  • the bacterium is E. coli.
  • a composition provided by the invention is a liquid, such as a two-phase liquid, made up of an aqueous phase and a second phase with improved solubility relative to the aqueous phase for: a racemic epoxide, a meso-epoxide, racemic trans-cyclic vicinal diol, or a combination thereof.
  • the liquid is a two-phase liquid, such as an n-hexane-aqueous buffer system in a ratio of, e.g., about: 1 :5, 1:4, 1 :3, 1 :2, 1 :1 , 2:1, 3:1, 4:1, or 5:1.
  • the invention provides methods of producing an enantiomerically pure vicinal diol. These methods entail contacting any of the compositions provided by the invention with a racemic epoxide, a meso-epoxide, or a racemic trans-cyclic vicinal diol under conditions where the enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a
  • complementary oxidoreductase are enzymatically active and incubating the composition for a time sufficient to produce an enantiomerically pure vicinal diol.
  • These methods do not entail any interveining purification steps, e.g., they occur in a single container (i.e., they are single pot reactions).
  • the composition comprises: a) StEH, alkJ, and alkH; b) SpEH and ADH-LK; c) SpEH and one of BDHA, CDDHPm, or CDDHRh; or d) any one of a), b), or c), further including a co-factor-regenerating enzyme.
  • a racemic trans-cyclic vicinal diol is used as starting material, there is no need to add any epoxide hydrolase such as SpEH and the following may be in the composition: e) BDHA and a co-factor-regenerating enzyme; f) CDDHPm and a co-factor-regenerating enzyme; or g) CDDHRh and a co-factor-regenerating enzyme.
  • the enantiomencally pure vicinal diol is (R) or (R,R).
  • the method further comprises producing an enantiomencally pure vicinal diol and in particular embodiments, wherein the enantiomerically pure vicinal diol is (S) or (S,S), e.g., for the case of oxidation of racemic vicinal diol (e.g., by biooxidation using, e.g., BDHAA from Bacillus subtilis BGSC1A1, CDDHPm from Pseudomonas medocina TA5, or CDDHRh from Rhodococcus sp. Moj-3449).
  • the enantiomerically pure vicinal diol is (S) or (S,S), e.g., for the case of oxidation of racemic vicinal diol (e.g., by biooxidation using, e.g., BDHAA from Bacillus subtilis BGSC1A1, CDDHPm from Pseudomonas medocina TA5, or CDDHRh
  • the invention provides methods of producing an enantiomerically pure a-hydroxy ketone. These methods entail contacting a composition provided by the invention with a racemic epoxide, a meso-epoxide, or a racemic trans-cyclic vicinal diol under conditions where the enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a
  • complementary oxidoreductase are enzymatically active and incubating the composition for a time sufficient to produce an enantiomerically pure a-hydroxy ketone.
  • these methods do not entail any interveining purification steps, e.g., they occur in a single container (i.e., they are single pot reactions).
  • the composition comprises: a) StEH, alkJ, and alkH; b) SpEH and ADH-LK; c) SpEh and one of BDHA, CDDHPm, or CDDHRh; d) any one of a), b), or c), further including a co-factor-regenerating enzyme; e) BDHA and a complementary oxidoreductase; f) CDDHPm and a complementary oxidoreductase; or g) CDDHRh and a complementary oxidoreductase.
  • the enantiomerically pure ⁇ -hydroxy ketone is (R).
  • the method further comprises producing an enantiomerically pure vicinal diol that is (S) or (S,S).
  • the methods provided by the invention enable high yield production of enantiomerically pure vicinal diols or ⁇ -hydroxy ketones, such as yields of at least about: 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % or more.
  • the methods provided by the invention also provide high ee or de vicinal diols or ⁇ -hydroxy ketones, such as at least at least about: 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 %, or more, ee or de.
  • the methods provided by the invention provide both high yield and high ee or de of vicinal diols or a-hydroxy ketone.
  • the methods provided by the invention may further entail a step of purifying the enantiomerically pure vicinal diols or a-hydroxy ketones by extraction with an organic solvent, such as toluene, diethyl ether, petroleum ether,
  • reaction conditions such as buffers, pH, temperature, et cetera, can be used consonant with the invention.
  • the conditions are selected to achieve maximal yield and/or ee or de.
  • the conditions are selected to achieve maximal yield and/or ee or de.
  • the methods provided by the invention are performed in a solution with buffers, such as phosphate buffer, citrate buffer, Tris buffer and HEPES buffer.
  • buffers such as phosphate buffer, citrate buffer, Tris buffer and HEPES buffer.
  • the methods provided by the invention are performed in an aqueous system with pH of about 3 to about 12, in more particular embodiments, with pH of from about 6 to about 9.
  • the methods provided by the invention are performed at a temperature of about 0°C to about 90°C, such as from about 20°C to about 40°C. Any combination of these conditions can be used in the methods provided by the invention.
  • the invention provides nucleic acids encoding constructs described above and particular embodiments in the exemplification, including variants thereof, e.g., those with different backbones (origins of replication, selectable markers, et cetera), varied promoters, or variant enzymes as described herein.
  • the invention also provides methods of making any of the products described in the tables, schemes and exemplifications in the application.
  • enantioselectivity to hydrolyze racemic epoxide or meso-epoxide in favor of a particular enantiomer of vicinal diol; however, the enantioselectivity of these hydrolase is not high enough to give very high ee of the diol; further oxidation of the minor enantiomer to aldehyde or acid with one or more oxidation enzymes can increase the ee of the major enantiomer.
  • the process can be performed via cascade biotransformations, including 2 or more enzymes in one pot.
  • enantiopure diols can be prepared in very high ee from corresponding cascade biotransformation of racemic epoxides or meso-epoxides.
  • FIGs. 2 and 4 show possible substrates and products of this invention.
  • the racemic epoxide is a compound of the general formula (I) and enantiopure vicinal diol is a compound of the general formula (II) or (III).
  • R in the general formulae (I), (II), and (III) is selected from the group consisting of a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group.
  • racemic epoxide is rac-1, rac-2, rac-3, or rac-4 and the enantiopure vicinal diol is (/?)-diol-5, (i?)-diol- 6, (R)-diol-7, or (i?)-diol-8.
  • the meso-epoxide is a compound of the general formula (IV) and enantiopure vicinal diol is a compound of the general formula (V) or (VI).
  • Ki in the general formulae (IV), (V), and (VI) is selected from the group consisting of a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group.
  • the meso-epoxide is meso-9, meso-10, or meso-11 and the enantiopure vicinal diol is (R, R)-diol-12, (R,R)-diol-13, or (R,i?)-diol-14.
  • the recombinant E. coli strains expressing or co-expressing StEH, alkJ, and alkH were constructed using the recombinant plasmids shown in FIG. 9.
  • One plasmid is for the expression of three enzymes separately, and the other is for the co- expression of the StEH and alkJ in one strain.
  • the recombinant E. coli strain grew well. As shown in FIG. 10, after 2.2 h cultivation, TPTG (0.5 mM) was added to induce the enzyme expression. The cells were further cultivated for another 6 to 10 h. E. coli (pET28aalkJ) and E. coli (pET28aStEH) grew very quickly compared to E.
  • FIG. 11 shows the SDS-PAGE analysis of the enzymes expressed in E. coli strains; three recombinant enzymes were efficiently expressed in their respective E. coli strains.
  • the E. coli (pET28aalkJStEH) co-expressed StEH and alkJ well.
  • FIG. 14 shows the time course of cascade biotransformation of racemic epoxide 1 (20 mM) with the same catalyst system. The hydrolysis finished at 4 h and ee increased from 96% at 6 h to >99% at 12 h.
  • the method is also useful for preparing other enantiopure vicinal diols from the corresponding racemic epoxides.
  • E. coli pET28aStEH
  • E. coli pET28aalkJ
  • E. coli pET28aalkH
  • the same catalytic system gave (i?)-diol 7 in >99% ee and 79.2% yield from biotransformation of 4-Chloro-styrene epoxide 3.
  • FIG. 15 demonstrates the possibility of using substrate at high
  • FIG. 17 shows the course of the biotransformation.
  • the present invention provides an efficient process with economical advantages compared to other chemical and biological methods for the production of enantiopure vicinal diols.
  • Both racemic and meso-epoxides are suitable substrates, and the enzymes involved are enantioselective epoxide hydrolase and oxidation enzymes.
  • the suitable catalyst system for this invention includes one or more of the following components: cells containing the necessary enzymes, cell-free extracts containing the necessary enzymes, isolated enzymes, immobilized enzymes, and immobilized cells containing the necessary enzymes.
  • the easy engineering of the recombinant strains expressing or co-expressing the necessary enzymes provides cheap and enantioselective catalysts for current invention.
  • Enantiopure a-hydroxy ketones such as (i?)-a-hydroxycyclopentanone 20, (/?)-a-hydroxycyclohexanone 19, and (fl)-a-hydroxy tetralone 17, are highly valuable chiral auxiliaries, ligands, or templates in asymmetric reactions.
  • Chiral a- hydroxyketones can be prepared by chemical methods. The best one is the
  • FIG. 19A the cell growth of E. coli (bdhA) is shown in FIG. 19A.
  • Cells reached a cell density of 6.5 g cdw/L at 12 h, with an activity of 32 U/g cdw for the oxidation of ( ⁇ )-12.
  • FIG. 19B shows clearly the high expression level of bdhA in E. coli (bdhA) after 10 h induction with IPTG. Time courses of
  • E. coli (CDDHRh) and E. coli (CDDHPm) also express the
  • CDDHPm and CDDHRh enantioselective alcohol dehydrogenases
  • FIG. 21 Sequence alignment of bdhA with CDDHPm and CDDHRh is given in FIG. 21.
  • CDDHPm from Pseudomonas medocina TA5 shows 42% identity of amino acid sequence with bhdA from Bacillus subtilis BGSC1 Al ; CDDHRh from Rhodococcus sp.
  • Moj-3449 shows 49% identity of amino acid sequence with bdhA.
  • CDDHPm (CDDHPm) gave 100% regioselectivity and very high enantioselectivity with an E of >1000.
  • the specific activity was 5.1-8.1 U/g cdw.
  • ee was determined by chiral GC analysis.
  • Biotransformation was performed in 10 mL Tris-HCl buffer (pH 8.0, 100 mM) at 30°C and 250 rpm.
  • FIG. 19B demonstrates that both bdhA and LDH were successfully co-expressed.
  • the cell-free extract of the recombinant strain showed 3.9 U/mg protein for the regeneration of NAD + .
  • Table 3 the use of E. coli (bdhA-LDH) in the presence of 20-100 mM sodium pyruvate afforded much higher conversion than that of E. coli (bdhA).
  • Table 5 Cascade biocatalysis for enantioselective conversions of cyclic epoxides to (R)-a-hydroxy ketone by mixture of E. coli (SpEH) and E. coli (bdhA) a
  • Both SpEH and bdhA accept a broad variety of substrates; therefore, the tandem catalysts developed here are generally useful. They are able to convert cyclopentene oxide 10 to (i?)-a-hydroxycyclopatanone 20 in 97% ee and 65% yield.
  • An aqueous-organic two-phase system can be used to avoid potential substrate inhibition and/or product inhibition. For instance, cascade
  • FIG. 23 shows a typical time course with 200 mM substrate.
  • Example 1 Construction of recombinant E. coli strains respectively expressing the StEH, alkJ, and alkH
  • the epoxide hydrolase (StEH) from potato was synthesized by Genscript with an optimization in codon usage for efficient expression in E. coli T7TM.
  • the alkJ and alkH gene were cloned by PCR with the plasmid DNA extracted from Pseudomonas putida (ATCC 29347).
  • Two pairs of specific primers alkJF, 5'- CGCGGATCCTAATAAAAGGAGATATAATGTACGACTATA T AATCGTTGGT-3 ' (SEQ ID NO: 12), alkJR, 5'-
  • thermocycling parameters for cloning of alkJ were 98°C for 2 min, 98°C for 10 s, 60°C for 15 s, 72°C for 1 min, 30 cycles. Incubation at 72°C for 5 min was added as the last step. For alkH, the extension time at 72°C was shortened to 50 s; other parameters were not changed.
  • the cloned genes were inserted into pET28a (+) between Ncol-Xhol (StEH), B rnR l-Hind III (alkJ), Nde I-Xhol (alkH) sites. After a standard transformation and identification process, positive recombinant plasmid was sent to First Base for confirmation by DNA sequence. Recombinant E.
  • E. coli strains expressing StEH E. coli (pET28aEH)
  • alkJ E. coli (pET28aalkJ)
  • alkH E. coli (pET28aalkH)
  • FIG. 6 The growth profiles of the recombinant strains in the rich medium are shown in FIG. 6; after 2.2 h cultivation, IPTG (0.5 mM) was added to the medium to induce the enzyme expression, and the strains were further cultivated for another 6 to 10 h.
  • both the linearized plasmid and PCR product were separately subjected to T4 DNA polymersase treatment in a 1 * buffer provided by the supplier NEB for 30 min at 37°C.
  • the reaction was stopped by adding 1/10 volume of dCTP (10 mM) to the tubes and putting on ice.
  • the treated linearized plasmid and PCR products (1:1 molar ratio, about 500 ng DNA) were mixed in 1 xligation buffer (NEB) and the samples were kept on ice for 30 min. Transformation of the mixture with electroporation into competent cells and subsequent PCR amplification identified the correct
  • E. coli E. coli (pET28aStEH), E. coli (pET28aalkJ), E. coli (pET28aalkH), E. coli (pET28aalkJStEH) were inoculated into respective 50 mL autoclaved rich media (glycerol, 15 g/L, peptone 15 g/L, yeast extract 4 g/L, NaCl 2 g/L, KH 2 P0 4 58 mM, MgS0 4 2 mM, pH6.0). After 1 to 2 h of cultivation at 37°C, OD 60 o reached about 0.6.
  • autoclaved rich media glycerol, 15 g/L, peptone 15 g/L, yeast extract 4 g/L, NaCl 2 g/L, KH 2 P0 4 58 mM, MgS0 4 2 mM, pH6.0.
  • IPTG (0.5 mM) was added to induce the enzyme expression.
  • the cells were harvested by centrifugation at 8,000g x 10 min (4°C). The collected cells could be used for biotransformation directly or temporarily stored at -80°C freezer for future use.
  • Example 4 HPLC or GC analysis of the concentration of vicinal diols
  • the concentration of (R, i?)-diol 12 was determined by GC with HP-5 column, with the GC conditions: 45°C, 1 min, 12°C/min, to 140°C, 0 min, 40°C/min, to 280°C, 2 min. Retention time: 8 min for (R, i?)-diol 12, 5 min for meso-epoxide 9.
  • Samples for reverse phase HPLC analysis to determine the concentration of diols were prepared by the following procedure: needed volume of acetonitrile was added to stop the reaction and to dilute the reaction mixture, then acetonitrile containing 2 mM benzyl alcohol (internal standard) was added (1 :1, v/v). The supernatant after centrifugation was loaded to reverse phase HPLC analysis.
  • l-(3- Chlorophenyl)-! 2-ethanediol 6: Chiralcel OD-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 17.4 min for (R)-6, 19.9 min for (5)-6.
  • l-(4- Chlorophenyl)-l,2-ethanediol 7 Chiralpak OD-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 20.1 min for (S)-7, 17.9 min for (R)-7.
  • l-(4- Fluorophenyl)-l,2-ethanediol 8 Chiralpak OD-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 18.7 min for (S)-8, 16.9 min for (R)-S.
  • the biocatalyst system containing three kinds of cells was prepared by mixing needed amount of cell suspension.
  • To 4 mL of cell suspension mixture (total 10 g cdw/L, StEH:alkJ:alkH 4:3:3), 20-50 mM racA was added (in
  • Example 7 Preparation of (R)-l-(3-chloro-phenyl)-l,2-ethanediol 6 via cascade biotransformation of racemic 3-chIoro-styrene oxide rac-2 using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ) and E. coli (pET28aalkH)
  • the biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension.
  • To 4 mL of cell suspension mixture (total 10 g cdw/L, StEH:alkJ:alkH 4:3:3), rac-2 was added (in DMSO, 1 M stock solution), with the final concentration from 20 to 40 mM.
  • the mixture was shaken at 30°C and 300 rpm.
  • the reaction of rac-2 was followed by taking samples at different reaction time points and analyzing the samples by HPLC. Reactions were stopped when the conversion rate of epoxide 2 reached 100% and the ee of
  • Example 8 Preparation of (R)-l-(4-chIoro-phenyl)-l,2-ethanediol 7 via cascade biotransformation of racemic 4-chloro-styrene oxide rac-3 using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ) and E. coli (pET28aalkH)
  • pET28aalkJ E. coli
  • pET28aalkH E. coli
  • the cell densities (OD 600 ) were measured by a spectrophotometer (Hitachi U-1900 UV-Vis Ratio Beam spectrophotometer).
  • the biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension.
  • To 4 mL of cell suspension mixture (total 10 g cdw/L, StEH:alkJ:alkH 4:3:3), rac-3 was added (in DMSO, 1 M stock solution), with the final concentration from 10 to 20 mM.
  • Example 9 Preparation of (R)-l-(4-fluoro-phenyl)-l,2-ethanedioI 8 via cascade biotransformation of racemic 4-fluro-styrene oxide rac-4 using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
  • rac-4 was added (in DMSO, 1 M stock solution), with the final concentration 10-20 mM. The mixture was shaken at 30°C and 300 rpm. The reaction of rac-4 was followed by taking samples at different reaction time points and analyzing the samples by HPLC. Reactions were stopped when the conversion rate of epoxide 4 reached 100% and the ee of (R)-diol 8 in the reaction mixture was
  • Example 10 Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade biotransformation of racemic styrene oxide rac-1 using recombinant cells of E. coli (pET28aStEH-alkJ)
  • Example 11 Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade biotransformation of racemic styrene oxide rac-1 using mixed cells of E. coli (pET28aStEH-alkJ) and E. coli (pET28aa!kH) [0093] Freshly prepared recombinant cells of E. coli (pET28aStEH-alkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris buffer (50 mM, pH8.5). The biocatalyst system containing the two kinds of cells was prepared by mixing needed amount of cell suspension.
  • Tris buffer 50 mM, pH8.5
  • Example 12 Preparation of (/?)-l-phenyl-l,2-ethanedioI 5 via cascade biotransformation of racemic styrene oxide rac-l using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
  • the biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension.
  • the mixture was shaken at 30°C and 300 rpm.
  • the reaction of rac-l was followed by taking samples at different reaction time points and analyzed by HPLC.
  • Example 13 Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade biotransformation of racemic styrene oxide rac-l using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
  • the biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension.
  • To 4 mL of cell suspension mixture (total 30 g cdw/L, StEH:alkJ:alkH 14:8:8), racemic styrene oxide 1 was added (4 M stock solution in DMSO), with the final concentration to 150 mM.
  • the mixture was shaken at 30°C and 300 rpm.
  • the reaction of r c-l was followed by taking samples at different reaction time points and analyzed by HPLC. Reactions were stopped (12-18 h) when the conversion rate of epoxide 1 reached 100% and the ee of (i?)-diol 5 in the reaction mixture reached >97%.
  • the results are summarized in FIG. 16.
  • the highest yield for (#)-diol 5 was 91.5% for 150 mM substrate after 70 h reaction, and the product ee reached 97%.
  • Example 14 Preparation of (R,R)-l,2-cyclohexanediol 12 via cascade biotransformation of cyclohexane oxide 9 using a mixture of recombinant E. coli cell expressing epoxide hydrolase (SpEH) and free enzyme alcohol dehydrogenase (LKADH)
  • Example 15 HPLC and GC analysis of chiral a-hydroxy ketones 19, 20, 23, 25, 17 and vicinal diols 12, 13, 22, 24, 26 [0097] Concentrations of diols 12, 13, 22, 24 and a-hydroxy ketones 19, 20, 23, 25 were determined using an Agilent 7890A gas chromatograph with an HP-5 column (30mx0.32mmx0.25mm).
  • Retention time 6.9 min for benzylacetone (internal standard), 4.6 min for trans-1,2- dihydroxy-l,2,3,4-tetrahydronaphthalene 26, 5.3 min for ⁇ -hydroxy tetralone 17.
  • Example 16 Engineering of recombinant E. coli (bdhA), E. coli (LDH), E. coli (CDDHPm), E. coli (CDDHRh) and E. coli (bdhA-LDH)
  • bdhA and LDH gene were amplified from genome DNA of Bacillus subtilis BGSC1 Al by PCR (by using Pfu DNA polymerase) with appropriate primers (bdhA-F: CGCGG ⁇ 7CCATGAAGGC AGC AAGATGGCATAACC (SEQ NO: 18) and bdhA-R: CCC 4GC7TTTAGTTAGGTCTAACAAGGATTTTG (SEQ NO: 19) for bdhA; LDH-F:
  • PCR program 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min).
  • the PCR products were isolated and double digested with restriction endonucleases (BamHI and Hindlll for bdhA and Bglll and Xhol for LDH) and ligated to pET28a (+) and pETduet-1 plasmid, respectively.
  • the ligation products were transformed into E. coli T7 Express Competent cells to yield E. coli (bdhA) and E. coli (LDH).
  • the sequence of the insert DNA was
  • a two-plasmid system of E. coli (pET28-bdhA/pETduet-LDH) was constructed for bdhA and LDH co-expression in which each gene was cloned into a different plasmid with the same origin of replication to yield E. coli (bdhA-LDH).
  • CDDHRh and CDDHPm genes were amplified from genome DNA of Rhodococcus sp. Moj-3449 and Pseudomonas medocina TA5 by PCR (using Pfu DNA polymerase) with appropriate primers (CDDHRh-F:
  • GGAATTCC4 TA TGGA AGTC AGACGGAGGA AG AAC (SEQ NO: 22) and CDDHRh-R: CCCA ⁇ G T TTACGACCTGACGAGAATCTTGAC (SEQ NO: 23) for CDDHRh: CDDHPm-F: CGCGG ⁇ TCCATGAACGA
  • PCR program 98°C for 3 min followed by 30 cycles of denaturation at 98°C for 30 sec, annealing at 70°C for 45 sec, extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min).
  • the PCR products were isolated and double digested with restriction endonucleases (BamHI and Hindlll for
  • CDDHPm Ndel and Hindlll for CDDHRh
  • pET28a pET28a (+).
  • the ligation products were transformed into E. coli T7 Express Competent cells to yield E. coli (CDDHRh) and E. coli (CDDHPm).
  • E. coli (bdhA) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 ⁇ g/mL kanamycin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask).
  • the culture was grown until an OD 600 of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • the growth of the culture was continued at 22°C and 250 rpm for 10 h.
  • Cells were harvested by centrifugation at 8,500*g for 10 min at 4°C, washed twice with Tris buffer (100 mM, pH 8.0), and resuspended in the same buffer for activity test or enantioselective biooxidation.
  • the specific oxidation activity of recombinant cell was determined by performing the biotransformation of ( ⁇ )-12 (10 mM) at 30°C and 250 rpm for 30 min with cells harvested and resuspended (10 g cdw/L) in Tris buffer (pH 8.0, 100 mM). The amount of substrate transformed was quantified by GC. One unit was defined as the amount of enzyme transform 1.0 ⁇ substrate per minute under the conditions above. The results are shown in FIG. 19A and Table 2.
  • E. coli (CDDHPm) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 ⁇ g/mL kanamycin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD 600 of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • E. coli (CDDHRh) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 ⁇ g/mL kanamycin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD 600 of 0.6-0.8 was achieved and then induced with isopropyl ⁇ -D-l- thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h.
  • IPTG isopropyl ⁇ -D-l- thiogalactopyranoside
  • E. coli (bdhA-LDH) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 ⁇ g/mL kanamycin and 100 ⁇ g/mL ampicillin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium containing 50 ⁇ g/mL kanamycin and 100 ⁇ g/mL ampicillin (50 mL in 250 mL flask). The culture was grown until an OD 6 oo of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl ⁇ -D-l -thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 12 h. The specific oxidation activity of recombinant cell was determined by performing the
  • One unit of activity was defined as the amount of enzyme which catalyzes the reduction of 1 ⁇ NAD + per minute under standard conditions (25°C, pH 8.0).
  • the assay mixture contained 935 jiL Tris buffer (pH 8.0, 100 mM), 5 iL ( ⁇ )-12 (1 M) in distilled water, 10 ⁇ , NAD + (10 mM) in distilled water and 50 ⁇ , enzyme solution. Reactions were started by addition of the enzyme solution and measured over a period of 1 min. The protein concentration of the enzyme solution was determined by the Bradford method.
  • One unit of activity was defined as the amount of enzyme which catalyzes the oxidation of 1 ⁇ NADH per minute under standard conditions (25°C, pH 8.0).
  • the assay mixture contained 978 x Tris buffer (pH 8.0, 100 mM), 10 pyruvate (500 mM) in distilled water, 10 NADH ( 10 mM) in distilled water and 2 ⁇ L enzyme solution. Reactions were started by addition of the enzyme solution and measured over a period of 3 min. The protein concentration of the enzyme solution was determined by the Bradford method.
  • the wet cells harvested were re-suspended in 20 mL of Tris buffer (pH 8.0, 100 mM) with an OD 6 oo of 20 and disrupted by homogenizer (one time, 21 bar).
  • the cell lysate was centrifuged at 15,000 ⁇ g for 30 min; samples of the enzyme solution were run on a 12% SDS-PAGE gel. 20 ⁇ , of the samples were mixed with an equal volume of 2 ⁇ sample loading buffer, vortexed, and then incubated in a water bath at 95 °C for five minutes. Samples were then centrifuged at 14,000 g for 5 minutes and placed on ice prior to loading on the gel.
  • Example 19 General procedure for biooxidation of ( ⁇ )-12, 13, 22, 24 to (R)-19, 20, 23, 25 [00111]
  • the oxidation of racemic trans-cyclic diols 12, 13, 22, 24 (0.1 -0.2 mmol) was performed with fresh cells (10 g cdw/L) of recombinant strain E. coli (bdhA), E. coli (CDDHRh)-and E. coli (CDDHPm) in 10 mL 100 mM Tris buffer (pH 8.0) at 30°C and 250 rpm. 300 ⁇ , aliquots were taken out at different time points for GC analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na 2 S0 4 before GC
  • Example 20 General procedure for regio- and enantioselective biooxidation of ( ⁇ )-26 to (R)-17
  • Example 21 General procedure for preparation of (J?)-19, 20, 23, 25 and (5, S)- 12, 13, 22, 24 by biooxidation of ( ⁇ )-12, 13, 22, 24
  • E. coli (bdhA) was grown at 37°C in LB medium containing 50 ⁇ g/mL kanamycin overnight, and then inoculated into TB (terrific broth) medium (50 mL) containing kanamycin (50 ⁇ g/mL). When OD 00 reached 0.6 (around 2 h), IPTG (0.5 mM) was added to induce the expression of protein. The cells were grown at 22°C for another 10 h to reach an OD 00 of 16.3 (cell density of 6.5 g cdw/L).
  • reaction solution was centrifuged to remove the cells, and the solutions were saturated with NaCl and extracted with ethyl acetate three times (3 ⁇ 100 mL), and all the organic phases were combined; after drying over Na 2 SO 4 , the solvents were removed by evaporation.
  • E. coli (bdhA-LDH) was grown in LB medium containing kanamycin (50 ⁇ g/mL) and ampicillin (100 ⁇ g/mL) overnight, and then inoculated into TB (terrific broth) medium (50 mL) containing kanamycin (50 ⁇ g/mL) and ampicillin (100 ⁇ g/mL). When OD 600 reached 0.6 (around 2 h), IPTG (0.5 mM) was added to induce the expression of protein. The cells continued to grow for 12 h at 22°C with the cell density at 6.0 g cdw/L.
  • Epoxide hydrolase (SpEH) have been cloned and expressed in E. coli.
  • the SpEH gene was amplified via PCR with primers SpEH-F:
  • the resulting 1146 bp fragment was digested with BamUl and HindUl and then ligated into pETduet-1, which was digested with the same restriction enzymes, generating the construct pETduet-SpEH.
  • Successful ligation into pETduet-1 was confirmed by restriction analysis and determination of SpEH activity in cell-free extracts after recombinant expression in E. coli T7.
  • the transformed strain was abbreviated as E. coli (SpEH).
  • a two-plasmid system E. coli (pET28-bdhA/pETduet-SpEH) was used for bdhA and SpEH co-expression in which each gene was cloned into a different plasmid with the same origin of replication to yield E. coli (SpEH-bdhA).
  • Example 24 Cell growth and specific activity of recombinant E. coli (SpEH) and E. coli (SpEH-bdhA)
  • E. coli (SpEH) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 100 ⁇ g/mL ampicillin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD 600 of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • E. coli (SpEH-bdhA) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 g/mL kanamycin and 100 ⁇ g/mL ampicillin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium containing 50 ⁇ g/mL kanamycin and 100 ⁇ g/mL ampicillin (50 mL in 250 mL flask).
  • the culture was grown until an OD 60 o of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM, The growth of the culture was continued at 22 °C and 250 rpm for 12 h. Resting cells obtained were employed as the whole cell biocatalysts and were stored at 4°C prior to use.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • Example 25 General procedure for enantioselective conversions of epoxides 9, 10, 15 to a-hydroxyl ketones 19, 20, 17 with the mixture of resting cells of E. coli (SpEH) and E. coli (bdh A).
  • Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na 2 S0 4 before GC quantification of ee and concentration of the diols and a-hydroxy ketones. For 15, 100 ⁇ , sample was taken, mixed with 400 iL ACN containing 2 mM benzylacetone as an internal standard, and used for HPLC analysis to determine the concentration of the diols and a-hydroxy ketones.
  • the samples were prepared by taking 200 ih aliquots, removing the cells via centrifugation, and extracting with 200 ⁇ chloroform; chloroform portion was transferred into a clean tube and dried by evaporation; 200 ⁇ , of isopropyl alcohol was added to dissolve the residues in the tube; after centrifugation, the solvents were used for chiral HPLC analysis.
  • Example 26 General procedure for enantioselective conversions of epoxides 9, 10, 15 to (R)-a-hydroxyl ketones 19, 20, 17 with resting cells of E. coli (SpEH- bdhA)
  • Example 27 General procedure for enantioselective conversions of epoxides 9, 10, 15 to (l?)-a-hydroxyl ketones 19, 20, 17 with resting cells of E. coli (SpEH- bdhA) in two phase system
  • E. coli (SpEH-bdhA) cells with required cell density were resuspended in 10 mL 100 mM Tris buffer (pH 8.0); 2 mL hexadecane containing epoxides 9, 10, 15 (0.1-2.0 mmol) was added. The mixture was incubated at 250 rpm and 30°C. For 9 & 10, 300 ⁇ , aqueous phases were taken out at different time points for GC analysis.
  • Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na 2 S0 4 before GC quantification of ee and concentration of the diols and a-hydroxy ketones. For 15, 10 ⁇ L organic and 100 ⁇ . aqueous phases were diluted with 490 and 400 ACN containing 2 mM benzylacetone as an internal standard, respectively. All samples were analyzed by HPLC for determination of concentration of diols and a-hydroxy ketones. The final concentration of each compound was the total concentration of both aqueous and organic phase.
  • the samples were prepared by taking 200 ⁇ ⁇ aqueous phases, removing the cells via centrifugation, and extracting with 200 ⁇ , chloroform; chloroform portion was transferred into a clean tube and dried by evaporation; 200 yl, of isopropyl alcohol was added to dissolve the residues in the tube; after centrifugation, the solvents were used for chiral HPLC analysis.
  • Example 28 Engineerin and cell growth of E. coli (NOX), E. coli (BDHA- NOX) and E. coli (SpEH-BDHA-NOX)
  • E. coli (NOX) NADH oxidase (NOX) gene from Lactobacillus brevis DSM 20054 was synthesized by Genscript Corp (Piscataway, NJ). The gene was PCR amplified further using forward primer NOX-F: GGAAGATCT
  • E. coli T7 competent cells were then transformed into E. coli T7 competent cells and plated on LB plates containing 100 ⁇ g/mL ampicillin. Successful ligation into pETduet was confirmed by restriction analysis and determination of NOX activity in cell-free extracts after recombinant expression in E. coli T7.
  • the transformed strain was abbreviated as E. coli (NOX).
  • NOX coli
  • LB medium 3 mL in 20 mL tube
  • 100 ⁇ g/mL ampicillin overnight.
  • 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask).
  • the culture was grown for 2 h to reach an OD 6 oo of 0.6-0.8 and then induced with isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • E. coli (BDHA-NOX): A two-plasmid system E. coli (pET28a- BDHA/pETduet-NOX) was constructed for BDHA and NOX co-expression in which each gene was cloned into a different plasmid with the same origin of replication to yield E. coli (BDHA-NOX).
  • E. coli SpEH-BDHA-NOX: For E. coli (SpEH-BDHA-NOX), pETduet-SpEH was first digested with Bgill and Xhol, the NOX gene (digested with Bgill and Xhol) was ligated into pETduet-SpEH vector, generating the construct pETduet-SpEH-NOX. Then, a two plasmid system E. coli (pET28a- BDHA/pETduet-SpEH-NOX) was constructed for BDHA, SpEH and NOX co- expression in E. coli.
  • E. coli (BDHA-NOX) and E. coli (SpEH-BDHA-NOX) were grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 ⁇ g/mL kanamycin and 100 ⁇ g/mL ampicillin overnight. 1 mL overnight seed culture was transferred to 50 mL TB-medium containing 50 ⁇ g/mL kanamycin and 100 ⁇ g/mL ampicillin (50 mL in 250 mL flask).
  • the culture was grown until an OD 60 o of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl ⁇ -D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM.
  • IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
  • the growth of the culture was continued at 22°C and 250 rpm for 10-12 h. Resting cells obtained were employed as the whole cell biocatalysts and were stored at 4°C prior to use.
  • Example 29 Enantioselective conversions of meso-epoxides 10 to (R)-a-hydroxy ketone 20 with the mixture of lyophilized cell-free extract of E. coli (SpEH), E. coli (BDHA) and E. coli (LDH)
  • E. coli E. coli
  • BDHA E. coli
  • LDH E. coli
  • E. coli E. coli
  • BDHA E. coli
  • LDH E, coli
  • Example 30 Enantioselective conversions of epoxide 10 to (R)-a-hydroxy ketone 20 with the mixture of resting cells of E. coli (SpEH) and E. coli (BDHA- NOX)
  • E. coli E. coli
  • BDHA-NOX E. coli
  • Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na 2 S0 4 , followed by GC quantification of ee and concentration of the diols and a-hydroxy ketones. After 6 h, (/?)-a-hydroxy ketone 20 in 98% ee was obtained in 84%.
  • Example 31 Enantioselective conversions of epoxide 10 to (R)-a-hydroxy ketone 20 with the resting cells of E. coli (SpEH-BDH A-NOX) alone

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention provides methods of making enantiopure vicinal diols and α-hydroxyketones by biocatalysis with high yield, purity, and substrate scope, e.g., by one-pot biocatalysis. For example, in some embodiments, the invention provides compositions comprising an enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a co-factor-regenerating enzyme that can be employed in the methods provided by the invention.

Description

PREPARATION OF ENANTIOPURE VICINAL DIOLS AND ALPHA- HYDROXYKETONES FROM RACEMIC AND MESO-EPOXIDES BY TANDEM BIOCATALYSIS VIA ENANTIOSELECTIVE HYDROLYSIS AND
OXIDATIONS
RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional Application No. 61/838,981, filed on June 25, 2013. The entire teachings of the above application are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Enantiopure vicinal diols and a-hydroxyketones are important and valuable intermediates for the synthesis of many biologically active compounds and pharmaceuticals. Several chemical methods have been developed for the preparation of these types of enantiopure compounds, but these suffer from the use of toxic and expensive catalysts and reagents, moderate enantioselectivity, and narrow substrate scope. In comparison, biocatalytic methods offer greener alternatives. However, the enantioselectivity and efficiency of known bio- preparation of neither enantiopure vicinal diols nor enantiopure a-hydroxyketones are satisfactory. Accordingly, a need exists for methods of making enantiopure vicinal diols and α-hydroxyketones by biocatalysis with high yield, purity, and substrate scope.
SUMMARY OF THE INVENTION
[0003] The invention provides methods of making enantiopure vicinal diols and α-hydroxyketones by biocatalysis with high yield, purity, and substrate scope. In this invention, novel and efficient methods and process for the production of enantiopure vicinal diols and α-hydroxyketones from the easily available and cheap racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations have been developed. The method is based on the use of an enantioselective hydrolase to hydrolyze an epoxide to give the enantioenriched vicinal diol and the use of one or more enantioselective oxideoreductase(s) to oxidize the minor enantiomer of the diol to increase the ee of the vicinal diol or the use of a enantioselective oxideoreductase to oxidize the major enantiomer of the diol to give the corresponding a-hydroxyketones in high ee.
[0004] The novel concept and technology for the preparation of enantiopure vicinal diols were demonstrated with racemic styrene oxide as substrate and the mixture of epoxide hydrolase (StEH) from Solarium tuberosum as well as the alcohol dehydrogenase (alkJ) and the aldehyde dehydrogenase (alkH) from
Pseudomonas putida GPol as the necessary enzymes. By using cells of three recombinant strains expressing the individual enzyme at a selected ratio, the corresponding (i?)-vicinal diol was obtained in 98.3 % ee and 88.7% yield from 100 raM styrene oxide. Successes were also made for the cascade biotransformation of other substituted styrene oxides to prepare the corresponding (i?)-vicinal diols in >99% ee and 77-88% yield. The preparation of enantiopure vicinal diols from meso-epoxides was demonstrated with cyclohexene oxide as substrate. The use of cells of recombinant E. coli expressing the (SpEH) from Sphingomonas sp. HXN- 200 mixed with a free enzyme, alcohol dehydrogenase (ADH-LK), allowed for the production of ( ?J?)-l,2-cyclohexanediol in 97% ee and 97% yield.
[0005] The novel concept and technology for the preparation of a- hydroxyketones from the corresponding meso-epoxide via cascade biocatalysis was demonstrated with ( ?)-a-hydroxycyclohexanone as the target product, cyclohexene oxide as the substrate, and the mixture of resting cells of E. coli (SpEH) expressing an epoxide hydrolase (SpEH) from Sphingomonas sp. HXN-200 and resting cells of E. coli (bdhA) expressing bdhA from Bacillus subtilis BGSCl Al as the catalyst. At a ratio of cells of E. coli (SpEH) and cells of E. coli (bdhA) of 1 :4, 100 mM cyclohexene oxide was converted to (i?)-a-hydroxycyclohexanone in 99% ee and 85% yield. Both SpEH and bdhA accept a broad variety of substrates; therefore, the tandem catalysts developed here are generally useful. As another example, they were used to convert cyclopentene oxide to (i?)-a-hydroxycyclopatanone in 97% ee and 65% yield. Other alcohol dehydrogenases, such as CDDHPm from
Pseudomonas medocina TA5 and CDDHRh from Rhodococcus sp. Moj-3449, are also suitable enzyme for the oxidation step. Preparation of enantiopure a- hydroxyketones from the corresponding racemic epoxide via cascade biocatalysis was demonstrated with (i?)-2-hydroxytetralone as the target compound. Cascade biotransformation of racemic 1,2-epoxytetralin with the resting cells of E. coli (SpEH) and E. coli (bdhA) gave (7?)-2-hydroxytetralone in 99.9% ee and 35% yield.
[0006] Recombinant E. coli (SpEH-bdhA) co-expressing SpEH and bdhA was also a good catalyst. Resting cells of this strain were used to convert 50 mM cyclohexene oxide to (i?)-a-hydroxycyclohexanone in 99% ee and 86% yield and 100 mM cyclopene oxide to (i?)-a-hydroxycyclopantanone in 97.1% ee and 65% yield. The transformation of racemic 1 ,2-epoxytetralin to (i?)-2-hydroxytetralone was also achieved with the recombinant E. coli (SpEH-bdhA), giving 99.0% product ee and 38.0% yield.
[0007] An aqueous-organic two-phase system can be used to avoid potential substrate inhibition and/or product inhibition. As an example, cascade
biotransformation of 100 mM cyclohexene oxide with resting cells of E. coli (SpEH- bdhA) in a mixture of n-hexadecane-aqueous buffer (1:5) gave (i?)-a- hydroxycyclohexanone in 98.5% ee with 85.4% yield. Increase of substrate concentration to 300 mM afforded 52% yield and 98.0% ee.
[0008] The suitable catalyst system for this invention includes one or more of the following components: cells containing the necessary enzymes, cell-free extracts containing the necessary enzymes, isolated enzymes, immobilized enzymes, and immobilized cells containing the necessary enzymes.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] The foregoing will be apparent from the following more particular description of example embodiments of the invention, as illustrated in the accompanying drawings in which like reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating embodiments of the present invention.
[0010] FIG. 1 illustrates preparation of chiral vicinal diols in high ee from racemic epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
[0011] FIG. 2 shows examples of racemic epoxide substrates and enantiopure vicinal diol products of tandem biocatalysis via hydrolysis and oxidation in one pot. [0012] FIG. 3 illustrates preparation of chiral vicinal diols in high ee from meso- epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
[0013] FIG. 4 shows examples of the meso-epoxide substrates and enantiopure vicinal diol products of tandem biocatalysis via hydrolysis and oxidations.
[0014] FIG. 5 illustrates preparation of chiral a-hydroxyketones in high ee from racemic epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
[0015] FIG. 6 shows examples of the racemic epoxide substrates and
enantiopure a-hydroxyketone products of tandem biocatalysis via hydrolysis and oxidation in one pot.
[0016] FIG. 7 illustrates preparation of chiral a-hydroxyketones in high ee from meso-epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot.
[0017] FIG. 8 shows examples of the epoxide substrates and enantiopure hydroxyketone products of tandem biocatalysis via hydrolysis and oxidation in one pot.
[0018] FIG. 9 shows the recombinant plasmids used for the expression of epoxide hydrolase (StEH), alcohol dehydrogenase (alkJ), and aldehyde
dehydrogenase (alkH).
[0019] FIG. 10 ilustrates cell growth of three recombinant E. coli strains expressing epoxide hydrolase (StEH), alcohol dehydrogenase (alkJ), and aldehyde dehydrogenase (alkH), respectively. At 2.2 h, 0.5 mM IPTG was added to induce the enzyme expression.
[0020] FIG. 11 shows SDS-PAGE analysis of the enzymes expressed in E. coli strains. Lane M: protein marker; Lane 1, Lane 3 and Lane 5: E. coli strains with empty plasmid as negative control; Lane 2: E. coli (pET28aStEH) expressing StEH; Lanes 4 and 7: E. coli (pET28aalkJ) expressing alkJ; Lane 6: E. coli (pET28aalkH) expressing alkH; Lane 8: E. coli (pET28aalkJStEH) co-expressing the StEH and alkJ. On each lane, 2.5 μΐ sample was loaded.
[0021] FIGs. 12A and 12B are reverse phase HPLC chromatograms of the product of the biotransformation of racemic styrene oxide 1 (50 mM) with mixture of cells of E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw/L). FIG. 12A shows 2 hours reaction; FIG. 12B shows 22 hours reaction. IS: internal standard. [0022] FIGs. 13A and 13B are chiral HPLC chromatograms of the product of the biotransformation of racemic styrene oxide 1 (50 mM) with mixture of cells of E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw L). FIG. 13A shows 2 hours reaction; FIG. 13B shows 22 hours reaction.
[0023] FIG.14 shows preparation of optically pure (R)- 1 -phenyl- 1 ,2-ethanediol 5 by the biotransformation of racemic styrene oxide 1 with mixtures of cells of E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw/L) in 50 mM Tris-Cl buffer (pH = 8.5). ■: epoxide (20 mM);▲: diol (20 mM); Δ: ee (i?)-diol(20 mM).
[0024] FIG. 15 shows preparation of optically pure (R)- 1 -phenyl- 1 ,2-ethanediol 5 by the biotransformation of racemic styrene oxide 1 (100 mM and 150 mM) by using mixed cells of recombinant E. coli (StEH) (10 g cdw/L), E. coli (pET28aalkJ) (5 g cdw/L), and E. coli (pET28aalkH) (5 g cdw/L).
[0025] FIG. 16 shows preparation of optically pure (R)- 1 -phenyl- 1 ,2-ethanediol 5 by the biotransformation of racemic styrene oxide 1 (150mM) using mixed cells of recombinant E. coli (StEH) (14 g cdw/L), E. coli (pET28aalkJ) (8 g cdw/L), and E. coli (PET28aalkH) (8 g cdw/L).
[0026] FIG. 17 shows preparation of optically pure (R, i?)-l,2-cyclohexanediol 12 by the cascade biotransformation of cyclohexene oxide 9 using mixtures of cells of recombinant E. coli (pRSF-SpEH) (1 g cdw/L) and free alcohol dehydrogenase (ADH-LK). Reaction volume: 10 mL Tris buffer (50 mM, pH8.0); NAD+: 1.5 mM; ADH: 10 mg (0.42 U/mg); cyclohexene oxide: 10 mM.
[0027] FIG. 18 illustrates enantioselective oxidation of trans-cyclic vicinal diols with E. coli (bdhA) to simultaneously produce enantiopure (i?)-a-hydroxy ketones and (S^-cyclic vicinal diols.
[0028] FIG. 19A shows time course of cell growth and specific activity for biooxidation of (±)-12 of E. coli (bdhA);♦: cell density;■: specific activity. FIG. 19B shows SDS-PAGE analysis of the cell-free extracts of E. coli strains; Lane 1 : E. coli (bdhA) with no induction; Lane 2: E. coli (bdhA) after 2 h induction; Lane 3: E. coli (bdhA) after 10 h induction; Lane M: protein marker (in kDa); Lane 4: E. coli (his-tag LDH); Lane 5: E. coli (bdhA); Lane 6: E. coli (bdhA-LDH) after 10 h induction. FIG. 19C shows time course of enantioselective oxidations of (±)-22 (10 mM) with resting cells of E. coli (bdhA) (10 g cdw/L);■: conversion; 0: ee of (S,S)- 22;□: ee of (i?)-23. FIG. 19D shows time course of regio- and enantioselective oxidation of (±)-26 (10 mM) with resting cells of E. coli (bdhA-LDH) (20 g cdw/L) in the presence of sodium pyruvate (100 mM);■: conversion; 0: ee of (S,S -26; a: ee of(/?)-17.
[0029] FIG. 20 shows SDS-PAGE analysis of cell free extract of E. coli
(CDDHRh) and E. coli (CDDHPm). Lane M: protein marker (in kDa); Lane 1 : E. coli (CDDHRh) with 10 h induction; Lane 2: E. coli (CDDHPm) with 10 h induction.
[0030] FIG. 21 shows sequence alignment of bdhA (SEQ ID NO: 7) with CDDHPm (SEQ ID NO: 9) and CDDHRh (SEQ ID NO: 8). The multiple sequence alignment was made using ClustalW2. bhdA from Bacillus subtilis BGSC1 Al (UniProt: 034788); CDDHPm from Pseudomonas medocina TA5, showing 42% identity of amino acid sequence with bdhA; CDDHRh from Rhodococcus sp. Moj- 3449, showing 49% identity of amino acid sequence with bdhA. Underlined:
putative NAD(P) binding site; Bold, double underline: putative catalytic Zn binding site. "*": the identical amino acids; "!": similar amino acids; ":": highly similar amino acids.
[0031] FIG. 22 shows SDS-PAGE analysis of the cell-free extracts of E. coli strains. Lane 1: Cell free extract of E. coli (SpEH) after 10 h induction; Lane 2: Cell free extract of E. coli (bdhA) after 10 h induction; Lane 3: Cell free extract of E. coli (SpEH-bdhA) after 10 h induction; Lane M: protein marker (in kDa).
[0032] FIG. 23 shows time course of regio- and stereoselective conversion of cyclohexene oxide 9 (200 mM) to (#)-a-hydroxycyclohexanone 19 with resting cells of E. coli (bdhA-SpEH) (16 g cdw/L) in a mixture of Tris buffer (100 mM, pH 8.0) and hexadecane (5:1). ■: concentration of (i?)-19; A : ee of (i?)-19.
DETAILED DESCRIPTION OF THE INVENTION
[0033] A description of example embodiments of the invention follows.
[0034] In a first aspect, the invention provides compositions comprising an enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a co-factor-regenerating enzyme. These compositions can be in any suitable form, such as a) one or more recombinant microorganisms expressing: the enantioselective oxidative enzyme, the selective epoxide hydrolase, or the co-factor- regenerating enzyme, or a combination thereof, optionally wherein a single recombinant microorganism expresses the enantioselective oxidative enzyme and at least one of the selective epoxide hydrolase and the co-factor-regenerating enzyme; b) a protein extract of the one or microorganisms of a); c) purified enantioselective oxidase and at least one of purified selective epoxide hydrolase and purified complementary reductase; d) purified enantioselective oxidase and at least one of purified selective epoxide hydrolase and purified complementary reductase, wherein the purified enzymes are immobilized (e.g., by attaching one or more of the enzymes to solid supports or entrapment, et cetera); or e) any combination of the foregoing.
[0035] A "recombinant microorganism" is a product of man that is markedly different from a microorganism (e.g., bacteria, unicellular fungus, protist, et cetera) that exists in nature. In particular embodiments provided by the invention, the recombinant microorganism is markedly different from a microorganism that exists in nature due to the presence of a heterologous nucleic acid (encoding one or more of the enzymes described herein), which may be maintained on an exogenous plasmid or stably maintained in the genome of the microorganism. "Heterologous" refers to materials that are not associated in nature. In some embodiments, for example, a heterologous nucleic acid construct includes a nucleic acid (or plurality of nucleic acids) associated with a nucleic acid from another species, but, in other embodiments, can include a recombinant construct where two nucleic acids from the same species are associated together in a non-naturally-occurring way, such as associating different promoters and coding sequences.
[0036] A "selective epoxide hydrolase" is an enzyme that may be regioselective or enantioselective when hydrolysing an epoxide to a vicinal diol. In some embodiments, a selective epoxide hydrolase produces an abundance of one enantiomer, or, if applicable, diastereomer, (at least 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99, 99.5, 99.9% or more of total enantiomers (ee) or diastereomers (de)) when hydrolysing an epoxide to a vicinal diol. In some embodiments, the selective epoxide hydrolase is regioselective. In certain embodiments, the selective epoxide hydrolase is enantioselective. Exemplary selective epoxide hydrolases include epoxide hydrolases from Sphingomonas {see, e.g., SEQ ID NO:l, SpEH), Solarium tuberosum {see, e.g., SEQ ID NO:2, StEH), and Aspergillus {see, e.g., SEQ ID NO:3, AnEH). In some embodiments, the selective epoxide hydrolase produces an excess of an S enantiomer (or S,S enantiomer from a meso-epoxide) of a vicinal diol. In other embodiments, the selective epoxide hydrolase produces an excess of an R enantiomer (or R,R enantiomer from a meso-epoxide) of a vicinal diol.
[0037] An "enantioselective oxidative enzyme" preferentially oxidizes one enantiomer of, e.g., a vicinal diol— specifically, converting a hydroxyl group to a carbonyl group. In some embodiments, an enantioselective oxidative enzyme produces an abundance of one oxidized enantiomer, or, if applicable, diastereomer, e.g., at least 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more of total enantiomers {ee) or diastereomers {de) when oxidizing a vicinal diol; more particularly, at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9% or more. Exemplary enantioselective oxidative enzymes for use in the invention include alkJ {Pseudomonas putida GPol , SEQ ID NO: 4 ), ADH-LK (from
Lactobacillus kefir, SEQ ID NO: 6), BDHA (from Bacillus subtilis BGSClAl, SEQ ID NO: 7), CDDHPm (from Pseudomonas medocina TA5, SEQ ID NO: 8), and CDDHRh (from Rhodococcus sp. Moj-3449, SEQ ID NO: 9). Additional enantioselective oxidative enzymes include alkH, e.g., from Pseudomonas putida (SEQ ID NO: 5).
[0038] A "co-factor-regenerating enzyme" is an oxidoreductase of a molecule that can act as a co-substrate (or, conversely, an oxidoreductase of a co-product) of an enantioselective oxidative enzyme. For example, an enantioselective oxidative enzyme, such as an alcohol dehydrogenase, can oxidize a vicinal diol and reduces NAD(P)+ to NAD(P)H in the process. A co-factor-regenerating enzyme consumes NAD(P)H to reduce the complementary molecule, such a 02 or pyruvate to H20 or lactate, respectively. Exemplary co-factor-regenerating enzymes include lactate dehydrogenase (LDH, e.g., from E. coli, SEQ ID NO: 10) and NADH oxidase (NOX, e.g., from Lactobacillus brevis, SEQ ID NO: 11). [0039] In some embodiments, the compositions provided by the invention comprise a selective epoxide hydrolase and the enantioselective oxidative enzyme. In more particular embodiments, the selective epoxide hydrolase is selected from an epoxide hydrolase from Sphingomonas (SpEH), Solarium tuberosum (StEH), Aspergillus (AnEH), or a variant thereof that is at least 60% identical at the amino acid level to the epoxide hydrolase from Sphingomonas, Solanum tuberosum, or Aspergillus.
[0040] In any of the preceding aspects and embodiments, the enantioselective oxidative enzyme may be selected from Pseudomonas putida GPol alkJ,
Lactobacillus kefir ADH-LK, Bacillus subtilis BGSC 1 A 1 BDH A, Pseudomonas medocina TA5 CDDHPm, Rhodococcus sp. Moj-3449 CDDHRh, or a variant thereof that is at least 60% identical at the amino acid level to any of the foregoing enantioselective oxidases.
[0041] In certain embodiments, the composition of any one of the preceding embodiments may further comprise a co-factor-regenerating enzyme. In more particular embodiments, the co-factor-regenerating enzyme is E. coli lactate dehydrogenase (LDH) or Lactobacillus brevis NADH oxidase (NOX), or a variant thereof that is at least 60% identical at the amino acid level to any of the foregoing complementary reductases.
[0042] In some embodiments, any of the compositions provided by the invention may further comprise a racemic epoxide or a meso-epoxide. In more particular embodiments, the composition comprises a racemic epoxide of forumula I, IV, or VII wherein R, Rl 5 and R2 are independently selected from a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group. These substitutions may include functional groups (such as carbonyl, carboxyl, amine, substituted amine, alcohol, alkyloxy, and halogens (F, CI, Br, I)). The Rs are typically about 5-17 carbons, e.g., about 5-11, including cyclic, bicyclic and heterocylic groups. [0043] In certain embodiments, compositions provided by the invention may further comprise a racemic trans-cyclic vicinal diol. The trans-cyclic vicinal diol can be from about 5-10 carbons and may include functional groups (such as carbonyl, carboxyl, amine, substituted amine, alcohol, alkyloxy, and halogens (F, CI, Br, I)).
[0044] Any of the compositions described herein mayfurther comprise an aldehyde oxidase or aldehyde dehydrogenase.
[0045] In certain embodiments, a composition provided by the invention may include one or more recombinant microorganisms expressing, from one or more heterologous nucleic acids: the enantioselective oxidative enzyme, selective epoxide hydrolase, co-factor-regenerating enzyme, or a combination thereof. In some embodiments, the recombinant microorganism is a bacterium. In more particular embodiments, the bacterium is E. coli.
[0046] In some embodiments, a composition provided by the invention is a liquid, such as a two-phase liquid, made up of an aqueous phase and a second phase with improved solubility relative to the aqueous phase for: a racemic epoxide, a meso-epoxide, racemic trans-cyclic vicinal diol, or a combination thereof. In some embodiments, the liquid is a two-phase liquid, such as an n-hexane-aqueous buffer system in a ratio of, e.g., about: 1 :5, 1:4, 1 :3, 1 :2, 1 :1 , 2:1, 3:1, 4:1, or 5:1.
[0047] In related aspects, the invention provides methods of producing an enantiomerically pure vicinal diol. These methods entail contacting any of the compositions provided by the invention with a racemic epoxide, a meso-epoxide, or a racemic trans-cyclic vicinal diol under conditions where the enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a
complementary oxidoreductase are enzymatically active and incubating the composition for a time sufficient to produce an enantiomerically pure vicinal diol. These methods, in some embodiments, do not entail any interveining purification steps, e.g., they occur in a single container (i.e., they are single pot reactions). In certain embodiments, the composition comprises: a) StEH, alkJ, and alkH; b) SpEH and ADH-LK; c) SpEH and one of BDHA, CDDHPm, or CDDHRh; or d) any one of a), b), or c), further including a co-factor-regenerating enzyme. In certain embodiments, if a racemic trans-cyclic vicinal diol is used as starting material, there is no need to add any epoxide hydrolase such as SpEH and the following may be in the composition: e) BDHA and a co-factor-regenerating enzyme; f) CDDHPm and a co-factor-regenerating enzyme; or g) CDDHRh and a co-factor-regenerating enzyme. In more particular embodiments, the enantiomencally pure vicinal diol is (R) or (R,R). In more particular embodiments, the method further comprises producing an enantiomencally pure vicinal diol and in particular embodiments, wherein the enantiomerically pure vicinal diol is (S) or (S,S), e.g., for the case of oxidation of racemic vicinal diol (e.g., by biooxidation using, e.g., BDHAA from Bacillus subtilis BGSC1A1, CDDHPm from Pseudomonas medocina TA5, or CDDHRh from Rhodococcus sp. Moj-3449).
[0048] In another aspect, the invention provides methods of producing an enantiomerically pure a-hydroxy ketone. These methods entail contacting a composition provided by the invention with a racemic epoxide, a meso-epoxide, or a racemic trans-cyclic vicinal diol under conditions where the enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a
complementary oxidoreductase are enzymatically active and incubating the composition for a time sufficient to produce an enantiomerically pure a-hydroxy ketone. Again, these methods, in some embodiments, do not entail any interveining purification steps, e.g., they occur in a single container (i.e., they are single pot reactions). In certain embodiments, the composition comprises: a) StEH, alkJ, and alkH; b) SpEH and ADH-LK; c) SpEh and one of BDHA, CDDHPm, or CDDHRh; d) any one of a), b), or c), further including a co-factor-regenerating enzyme; e) BDHA and a complementary oxidoreductase; f) CDDHPm and a complementary oxidoreductase; or g) CDDHRh and a complementary oxidoreductase. In some embodiments, the enantiomerically pure α-hydroxy ketone is (R). In more particular embodiments, the method further comprises producing an enantiomerically pure vicinal diol that is (S) or (S,S).
[0049] The methods provided by the invention enable high yield production of enantiomerically pure vicinal diols or α-hydroxy ketones, such as yields of at least about: 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 % or more. The methods provided by the invention also provide high ee or de vicinal diols or α-hydroxy ketones, such as at least at least about: 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 %, or more, ee or de. In more particular embodiments, the methods provided by the invention provide both high yield and high ee or de of vicinal diols or a-hydroxy ketone.
[0050] The methods provided by the invention may further entail a step of purifying the enantiomerically pure vicinal diols or a-hydroxy ketones by extraction with an organic solvent, such as toluene, diethyl ether, petroleum ether,
dichloromethane, chloroform, ethyl acetate and the like.
[0051] Various reaction conditions, such as buffers, pH, temperature, et cetera, can be used consonant with the invention. In some embodiments, the conditions are selected to achieve maximal yield and/or ee or de. For example, in some
embodiments, the methods provided by the invention are performed in a solution with buffers, such as phosphate buffer, citrate buffer, Tris buffer and HEPES buffer. In some embodiments, the methods provided by the invention are performed in an aqueous system with pH of about 3 to about 12, in more particular embodiments, with pH of from about 6 to about 9. In some embodiments, the methods provided by the invention are performed at a temperature of about 0°C to about 90°C, such as from about 20°C to about 40°C. Any combination of these conditions can be used in the methods provided by the invention.
[0052] In other aspects, the invention provides nucleic acids encoding constructs described above and particular embodiments in the exemplification, including variants thereof, e.g., those with different backbones (origins of replication, selectable markers, et cetera), varied promoters, or variant enzymes as described herein. The invention also provides methods of making any of the products described in the tables, schemes and exemplifications in the application.
EXEMPLIFICATION
[0053] In this invention, novel and efficient methods and processes for the production of enantiopure vicinal diols from racemic epoxide and meso-epoxides by cascade biotransformation via hydrolysis and oxidations were developed (FIGs. 1 and 3). The invention utilizes, for instance, certain hydrolases with good
enantioselectivity to hydrolyze racemic epoxide or meso-epoxide in favor of a particular enantiomer of vicinal diol; however, the enantioselectivity of these hydrolase is not high enough to give very high ee of the diol; further oxidation of the minor enantiomer to aldehyde or acid with one or more oxidation enzymes can increase the ee of the major enantiomer. The process can be performed via cascade biotransformations, including 2 or more enzymes in one pot. For example, taking advantage of the enantioconvergency of hydrolase for the hydrolysis of epoxides, and enantio- and regio-selectivity of oxidation enzyme(s) for the oxidization of vicinal diols at the terminal hydroxyl group, enantiopure diols can be prepared in very high ee from corresponding cascade biotransformation of racemic epoxides or meso-epoxides.
[0054] FIGs. 2 and 4 show possible substrates and products of this invention. The racemic epoxide is a compound of the general formula (I) and enantiopure vicinal diol is a compound of the general formula (II) or (III). R in the general formulae (I), (II), and (III) is selected from the group consisting of a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group. As an example, the racemic epoxide is rac-1, rac-2, rac-3, or rac-4 and the enantiopure vicinal diol is (/?)-diol-5, (i?)-diol- 6, (R)-diol-7, or (i?)-diol-8.
[0055] The meso-epoxide is a compound of the general formula (IV) and enantiopure vicinal diol is a compound of the general formula (V) or (VI). Ki in the general formulae (IV), (V), and (VI) is selected from the group consisting of a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group. As an example, the meso-epoxide is meso-9, meso-10, or meso-11 and the enantiopure vicinal diol is (R, R)-diol-12, (R,R)-diol-13, or (R,i?)-diol-14.
[0056] The novel concept was demonstrated with racemic styrene oxide 1 as substrate and the mixture of epoxide hydrolase (StEH) from Solarium tuberosum with the alcohol dehydrogenase (alkJ) and the aldehyde dehydrogenase (alkH) from Pseudomonas putida GPol as the necessary enzymes.
[0057] The recombinant E. coli strains expressing or co-expressing StEH, alkJ, and alkH were constructed using the recombinant plasmids shown in FIG. 9. One plasmid is for the expression of three enzymes separately, and the other is for the co- expression of the StEH and alkJ in one strain. The recombinant E. coli strain grew well. As shown in FIG. 10, after 2.2 h cultivation, TPTG (0.5 mM) was added to induce the enzyme expression. The cells were further cultivated for another 6 to 10 h. E. coli (pET28aalkJ) and E. coli (pET28aStEH) grew very quickly compared to E. coli (pET28aalkH): after 11 h cultivation, the OD60o of two recombinant strains reached up to 12 and 13, and the recombinant strain E. coli (pET28aStEH) was 5. FIG. 11 shows the SDS-PAGE analysis of the enzymes expressed in E. coli strains; three recombinant enzymes were efficiently expressed in their respective E. coli strains. The E. coli (pET28aalkJStEH) co-expressed StEH and alkJ well.
[0058] The cascade biocatalysis of styrene oxide 1 was performed with mixed cells of E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw/L) in Tris-Cl buffer (50 mM, pH8.5). HPLC analyses shown in FIGs. 12A-13B confirmed the conversion of racemic epoxide 1 to (i?)-l- phenyl- 1,2-ethanediol 5 as major enantiomer by StEH and the further increase of the diol ee by the oxidation of (S)-5 via alkJ and alkH. Finally, pure (i?)-diol 5 was obtained. FIG. 14 shows the time course of cascade biotransformation of racemic epoxide 1 (20 mM) with the same catalyst system. The hydrolysis finished at 4 h and ee increased from 96% at 6 h to >99% at 12 h.
[0059] More examples are given in Table 1. For 50 mM substrate, high yield (95.3%) and high ee (>98%) was obtained by the system E. coli (pET28aStEH) (4 g cdw/L), E. coli (pET28aalkJ) (3 g cdw/L), and E. coli (pET28aalkH) (3 g cdw/L).
Table 1: Preparation of chiral vicinal diols in high ee from racemic epoxides by tandem biocatalysis via hydrolysis and oxidation in one pot
entry Sub. Cone. E. coli cells (g cdw/L) Time6 Prod. ee Yield
(mM) StEH- »EHb alkJc alkHd (h) (%) (%) alkJa
1 (±)-i 20 4 - ' 3 3 12 (R)-5 98.2 87.4 13 98.6 85.4
2 30 12 (R)-5 94.4 87.7
13 97.1 86.7
3 (±)-l 30 4 3 20 (R)-5 97.6 95.1
4 (±)-i 4 4 - - - 13 (R)-5 >99 90.4
15 >99 89.8
5 8 15 (R)-5 >99 93.8
6 30 20 (R)-5 >99 95.4
7 (±)-i 20 - 4 3 3 12 (R)-5 98.1 92.4
13 98.7 90.9
. 8 30 12 (R)-5 96.8 90.7
13 98.1 89.1
9 50 22 (R)-5 >99 95.3
10 (±)-2 20 - 3.2 2.4 2.4 14 (R)-6 >99 86.1
40 18 >99 87.7
11 (±)-3 10 - 3.2 2.4 2.4 12 (R)-7 >99 73.1
20 17 >99 79.2
12 (±)-4 10 - 3.2 2.4 2.4 12 (R)-8 >99 77.6
20 17 >99 77.4
*E.coli (pET28aalkJStEH); "E.coli (pET28aStEH); ' E.coli (pET28aalkJ); " E.coli (pET28aalkH); ' Reaction conditions: 30°C, 250 rpm
[0060] When cells of E. coli co-expressing StEH and alkJ were used for the cascade biotransformation of racemic epoxide 1 (30 mM), the reactions were also good, giving >99% ee and 95.4% yield of (i?)-diol 5.
[0061] The mixing of cells of E. coli (pET28aStEH-alkJ) and E. coli
(pET28aalkH) also gave high ee and high yield of (i?)-diol 5.
[0062] The method is also useful for preparing other enantiopure vicinal diols from the corresponding racemic epoxides. As given in Table 1 , mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH) catalyzed the transformation of racemic 3-Chloro-styrene epoxide 2 to the corresponding (i?)-diol 6 in >99% ee and 87.7% yield. The same catalytic system gave (i?)-diol 7 in >99% ee and 79.2% yield from biotransformation of 4-Chloro-styrene epoxide 3. 4- Fluoro-styrene epoxide 4 is also a good substrate for the current invention. The use of the mixed cells system above led to the preparation of ( ?)-diol 8 in >99% ee and 77.4% yield. [0063] FIG. 15 demonstrates the possibility of using substrate at high
concentration in the current invention. 100 mM styrene 1 was transformed into (R)- diol 5 in 98.3% ee and 88.7% yield using mixed cells E. coli (pET28aStEH) (10 g cdw/L), E. coli (pET28aalkJ) (5 g cdw/L), and E. coli (pET28aalkH) (5 g cdw/L). Increasing the cell density to 14, 8, and 8 g cdw/L, respectively, allowed for the transformation of 150 mM racemic styrene oxide 1 into (^)-diol 5 in 97% ee and 91.5% yield (FIG. 16).
[0064] The preparation of enantiopure vicinal diols from meso-epoxides was demonstrated with cyclohexene oxide 9 as substrate. The use of cells of
recombinant E. coli expressing the (SpEH) from Sphingomonas sp. HXN-200 mixed with a free enzyme, alcohol dehydrogenase (ADH-LK), allowed for the production of (R,R)- 1 ,2-cyclohexanediol 12 in 97% ee and 97% yield. FIG. 17 shows the course of the biotransformation. While the meso-epoxide 9 was completely hydrolyzed in 30 min by SpEH to give (i?,i?)-diol 12 in 88% ee, the ee was further increased to 97% at 8 h by ADH-L -catalyzed enantioselective oxidation of (S,S)- diol 12.
[0065] Thus, the present invention provides an efficient process with economical advantages compared to other chemical and biological methods for the production of enantiopure vicinal diols. Both racemic and meso-epoxides are suitable substrates, and the enzymes involved are enantioselective epoxide hydrolase and oxidation enzymes. The suitable catalyst system for this invention includes one or more of the following components: cells containing the necessary enzymes, cell-free extracts containing the necessary enzymes, isolated enzymes, immobilized enzymes, and immobilized cells containing the necessary enzymes. The easy engineering of the recombinant strains expressing or co-expressing the necessary enzymes provides cheap and enantioselective catalysts for current invention.
[0066] Enantiopure a-hydroxy ketones, such as (i?)-a-hydroxycyclopentanone 20, (/?)-a-hydroxycyclohexanone 19, and (fl)-a-hydroxy tetralone 17, are highly valuable chiral auxiliaries, ligands, or templates in asymmetric reactions. Chiral a- hydroxyketones can be prepared by chemical methods. The best one is the
Sharpless asymmetric dihydroxylation of enol ethers, giving (R)-19 in 90% ee, and (■/?)-! 7 in 97% ee. However, metal catalyst is toxic, and the product ee is still not high enough for direct application in chiral pharmaceutical syntheses. Asymmetric a-aminoxylation of ketone with nitrosobenzene using (5)-proline as catalyst followed by the treatment CuS04 gave (R)-19 in >99% ee, but the synthesis requires 20 mol% catalyst and stoichiometric amount of the oxidation regent. Enzymatic preparation of chiral cyclic a-hydroxy ketones have been thus far not very enantioselective: kinetic resolution via enantioselective acetylation to give (S)-17 showed an E of 16-35, and reductive kinetic resolution afforded (K)-20 with an E of 10.
[0067] In this invention, novel and efficient methods and processes for the production of enantiopure a-hydroxy ketones from racemic epoxide and meso- epoxides by tandem biocatalysis via hydrolysis and oxidations were developed (FIGs. 5 and 7).
[0068] Highly enantioselective alcohol dehydrogenases bdhA, CDDHPm, and CDDHRh were discovered for the oxidations of racemic trara-cyclic vicinal diols. E. coli (bdhA) and E. coli (bdhA-LDH) were developed as efficient whole-cell biocatalysts for these oxidations, enabling one-pot synthesis of both (i?)-a-hydroxy ketones 19, 20, 23, 25, 17 and (S,S)-cyclic vicinal diols 12, 13, 22, 24, 26 in very high ee at 50% conversion (FIG. 18).
[0069] As an example, the cell growth of E. coli (bdhA) is shown in FIG. 19A. Cells reached a cell density of 6.5 g cdw/L at 12 h, with an activity of 32 U/g cdw for the oxidation of (±)-12. FIG. 19B shows clearly the high expression level of bdhA in E. coli (bdhA) after 10 h induction with IPTG. Time courses of
biooxidations of (±)-12, 13, 22, 24 with resting cells of E. coli (bdhA) were recorded. As shown in FIG. 19C, for biooxidation of (±)-22, the reaction was much faster in the first 30 min and become slower afterwards. This is possibly due to the lesser availability of (R,R)-22 in the late stage and the extremely low reaction rate for the oxidation of (S,S)-22. In practice, this phenomenon is good for controlling the reaction to stop at 50% conversion. During the slow-reaction period, the ee of the unreacted substrate (S,S)-22 increased to a final value of 99.9% at 2 h with a conversion of 49.9%. The ee of the product (R)-23 was very high at the beginning and remained at 99.9% at the end of the reaction. Time courses of biooxidation of other diols are similar to those shown in FIG. 19C. In all cases, both (S,S)-12, 13, 22, 24 and (R)-19, 20, 23, 25 were obtained in >99% ee when the reaction was stopped at 49.9% conversion.
[0070] E. coli (CDDHRh) and E. coli (CDDHPm) also express the
enantioselective alcohol dehydrogenases CDDHPm and CDDHRh, respectively, very well (FIG. 20). Sequence alignment of bdhA with CDDHPm and CDDHRh is given in FIG. 21. CDDHPm from Pseudomonas medocina TA5 shows 42% identity of amino acid sequence with bhdA from Bacillus subtilis BGSC1 Al ; CDDHRh from Rhodococcus sp. Moj-3449 shows 49% identity of amino acid sequence with bdhA.
[0071] Biooxidations of (±)-12, 13, 22, 24, 26 were performed with the resting cells of the recombinant E. coli strains expressing the ADH. As shown in Table 2, E. coli (CDDHRh) demonstrated very high enantio-selectivity for the oxidation of (±)-12, 13, 22 with an enantioselectivity factor (E) of >1000. The specific activity was 2.0-2.7 U/g cdw. In comparison, E. coli (CDDHPm) gave much higher specific activity, with 12-22 U/g cdw for the oxidation of (±)-12, 13, 22, 24. The
enantioselectivity was also very high (E of > 1000) with (±)-12 & 22 as substrates. The best biocatalyst was E. coli (bdhA), which showed an E of > 1000 for the oxidation of (±)-(±)-12, 13, 22, 24 and a high specific activity of 22-32 U/g cdw.
For the oxidation of (±)-26 shown in Table 3, both E. coli (bdhA) and E. coli
(CDDHPm) gave 100% regioselectivity and very high enantioselectivity with an E of >1000. The specific activity was 5.1-8.1 U/g cdw.
Table 2: Enantioselective oxidations of cyclic diols (±)-12, 13, 22, 24 with resting
Figure imgf000019_0001
Cat C (±)-22 20 4 32 49.9 (5,S)-22 99.9 (R)-23 99.9 >1000 Cat C (±)-24 20 6 30 49.9 (S,S)-24 99.9 R)-25 99.1 >1000
" Biotransformation was performed at cell density of 10 g cdw/L in 10 mL Tris-HCl buffer (pH 8.0,
100 mM) at 30°C and 250 rpm.
b Specific activity was determined at 30 min.
ee was determined by chiral GC analysis.
d £ = ln[eeP(l-ees)/(eep+ees)]/ln[eep(l+ ees)/(eeP+ees)]
Table 3: Regio- and enantioselective oxidation of (±)-26 with resting cells of E. coli (CDDHPm) (Cat B), E. coli (bdhA) (Cat C), and E. coli (bdhA-LDH) (Cat D)a
Catalyst (±)-5 Cell Pyruvate Time Activity Conv. (5,S)-26 {R)A1
Cone. density [mM] [h] [U/g [%] ee ee
[mM] [g cdw]b [%r [%]c
cdw/Ll
Cat B 10 15 0 12 5.1 29.4 41.2 99.9 >1000
Cat C 10 15 0 8 8.1 33.6 50.2 99.9 >1000
Cat D 10 10 0 5 3.9 24.5 32.5 99.9 >1000
Cat D 10 10 20 6 6.6 48.3 93.4 99.9 >1000
Cat D 10 20 100 10 5.5 49.0 96.0 99.9 >1000
Cat D 20 20 100 24 14 48.3 93.4 99.9 >1000
" Biotransformation was performed in 10 mL Tris-HCl buffer (pH 8.0, 100 mM) at 30°C and 250 rpm.
b Specific activity was determined at 30 min.
0 ee was determined by chiral HPLC analysis.
d E = ln[eeP( 1 -ees)/(eeP+ees)]/ln[eeP( 1 + ees)/(eeP+ees)]
[0072] As shown in Table 3, biooxidations of (±)-26 with resting cells of E. coli (bdhA) gave only 24.5% conversion. The low conversion is possibly due to the low activity and poor availability of the necessary cofactor. Biooxidations of (±)-26 with the cell-free extract of E. coli (bdhA) suggested NAD+ as the cofactor of bdhA. E. coli (bdhA-LDH) co-expressing bdhA and lactate dehydrogenase (LDH) from
Bacillus subtilis was thus engineered as a more efficient and practical catalyst for the oxidation via intracellular recycling of the cofactor. FIG. 19B demonstrates that both bdhA and LDH were successfully co-expressed. The cell-free extract of the recombinant strain showed 3.9 U/mg protein for the regeneration of NAD+. As shown in Table 3, the use of E. coli (bdhA-LDH) in the presence of 20-100 mM sodium pyruvate afforded much higher conversion than that of E. coli (bdhA).
Finally, 49.0% conversion was achieved to give (S,S)-26 in 96% ee and (R)-17 in
>99% ee. The reaction course is given in FIG. 19D.
[0073] Preparative biotransformation was demonstrated. As summarized in Table 4, oxidations of (±)-12, 13, 22, 24 with E. coli (bdhA) reached 49.8-50.2% conversion and gave both (S,S)-vicinal diols and the corresponding (R)- - hydroxyketones in 99.0-99.9% ee. Simple work-up and purification by column
chromatography afforded these compounds in >99% purity and 31.2%-40.0%
isolated yield. Similarly, oxidations of (±)-26 with E. coli (bdhA-LDH) in the
presence of sodium pyruvate gave 49.0% conversion and produced pure (R)-17 in
99.9% ee and pure (S,S)-26 in 96% ee, with an isolated yield of 35.5% and 40.0%, respectively.
Table 4: Preparation of (R)-a-hydroxyketones 20, 19, 23, 25, 17 and (S )- vicinal diols 13, 12, 22, 24, 26 by selective oxidation with resting cells of E. coli
(bdhA) (Cat C) and E. coli (bdhA-LDH) (Cat D), respectively8
Sub. Sub. Catalyst Time Conv. Prod. Prod. Isolated Prod. Unreacted Sub. Isolated Sut
[mg] [h] [%] ee yield [mg] Sub. ee yield [mj
[%]" [%] [%]b [%]
(±)-13 280 Cat C 2 49.8 (7?)-20 99.8 33.9 95 (S, 5)-13 99.0 32.5 91
(±)-12 232 Cat C 12 50.0 (/?)-19 99.0 40.0 88 (S, S)-12 99.0 38.8 90
(±)-22 260 Cat C 3 50.0 (/f)-23 99.9 36.5 95 (S, S -22 99.9 38.5 IOC
(±)-24 288 Cat C 4 50.2 (R)-25 99.0 31.2 90 (S, S)-24 99.9 38.2 I K
(±)-26 200 Cat D 24 49.0 (/0-17 35.5 71 (S, S)-26 96.0[cl 40.0 80 a Biotransformation was performed in 100 mL Tris-HCl buffer (pH 8.0, 100 mM) at 30°C and 250 rpm. For E. coli (bdhA) (Cat C): 10 g cdw/L; for E. coli (bdhA-LDH) (Cat D): 20 g cdw/L, with 100 mM sodium pyruvate.
b ee was determined by chiral GC analysis.
0 ee was determined by chiral HPLC analysis.
[0074] Preparation of enantiopure a-hydroxyketones from the corresponding
meso-epoxide via cascade biocatalysis was demonstrated with (R)-a- hydroxycyclohexanone 19 as the target compound. Resting cells of E.coli (SpEH) expressing an epoxide hydrolase (SpEH) showed an activity of 879 U/g cdw for the hydrolysis of cyclohexene oxide 9 to (2?,Z?)-cyclohexanediol 12 in 85% ee. Resting cells of E.coli (bdhA) showed an activity of 28.4 U/g cdw for the enantioselective oxidation of cyclohexanediol 12 to (i?)-a-hydroxycyclohexanone 19 in 99% ee.
Combination of the resting cells of E. coli (SpEH) and E. coli (bdhA) at a ratio of
1 :4 allowed for the efficient transformation of 100 mM cyclohexene oxide 9 to (R)- a-hydroxycyclohexanone 19 in 99% ee, with 85% yield (Table 5). The advantage of this catalyst system is that the ratio of the two biocatalysis can be adjusted to
achieve full conversion. Table 5: Cascade biocatalysis for enantioselective conversions of cyclic epoxides to (R)-a-hydroxy ketone by mixture of E. coli (SpEH) and E. coli (bdhA)a
Substrate Cone. E. coli E. coli Time Product Yield Ee
(mM) (SpEH) (bdhA) (h) (%)" (%)b (g cdw/L) (g cdw/L)
9 50 4 16 6 (R)-19 86.2 99.0
9 100 4 16 1 1 (R)-19 84.8 99.0
10 100 4 16 3 (R)-20 64.7 97.0
15 10 4 16 9 (R)-17 35.0C 99.9d a All reactions were carried out in 10 mL Tris buffer (100 mM, pH 8.0) at 30°C and 250 rpm.
b Yield and ee were determined by chiral GC analysis.
Yield was determined by chiral HPLC analysis.
d ee was determined by chiral HPLC analysis.
[0075] Both SpEH and bdhA accept a broad variety of substrates; therefore, the tandem catalysts developed here are generally useful. They are able to convert cyclopentene oxide 10 to (i?)-a-hydroxycyclopatanone 20 in 97% ee and 65% yield.
[0076] Preparation of enantiopure a-hydroxyketones from the corresponding racemic epoxide via cascade biocatalysis was demonstrated with (i?)-2- hydroxytetralone 17 as the target compound. Cascade biotransformation of racemic epoxide 15 with the resting cells of E. coli (SpEH) and E. coli (bdhA) gave (i?)-17 in 99.9% ee and 35% yield.
[0077] SpEH and bdhA were co-expressed in E. coli (FIG. 22), and the recombinant E. coli (SpEH-bdhA) was able to convert 50 mM cyclohexene oxide 9 to (i?)-a-hydroxycyclohexanone 19 in 99% ee with 86% yield (Table 6). It also catalyzed the conversion of 100 mM cyclopene oxide 10 to (R)- - hydroxycyclopantanone 20 in 97.1% ee with 65% yield. The transformation of racemic epoxide 15 to (i?)-2-hydroxytetralone 17 was also achieved with the recombinant E. coli (SpEH-bdhA), with 99.0% product ee and 38.0% yield. These results suggest that recombinant cells co-expressing the two enzymes work as well as the two different kinds of cells combined and each containing one enzyme.
Table 6: Cascade biocatalysis for enantioselective conversions of cyclic epoxides to (R)-a-hydroxy ketones by E. coli (SpEH-bdhA)a
Substrate Cone. Cell density Time Product Yield (%)" Ee (%)"
(mM) (g cdw/L) (h)
9 50 16 6 (R)-19 86.0 99.0 9 100 16 12 (R)-19 57.7 99.0
10 100 12 3 (R)-20 65.0 97.1
15 10 12 9 (R)-17 38.0° 99.0d
a All reactions were carried out in 10 mL Tris buffer (100 mM, pH 8.0) at 30°C and 250 rpm.
b Yield and ee were determined by chiral GC analysis.
c Yield was determined by chiral HPLC analysis.
d ee was determined by chiral HPLC analysis.
[0078] An aqueous-organic two-phase system can be used to avoid potential substrate inhibition and/or product inhibition. For instance, cascade
biotransformation of 100 mM cyclohexene oxide 9 with resting cells of E. coli
(SpEH-bdhA) in a mixture of n-hexadecane-aqueous buffer (1 :5) gave (R)-a- hydroxycyclohexanone 19 in 98.5% ee with 85.4% yield. Increase of substrate concentration to 300 mM afforded 52% yield of (R)-19 in 98.0% ee (Table 7). FIG. 23 shows a typical time course with 200 mM substrate. Conversion of the meso- epoxide 10 and racemic epoxide 15 in the same two-phase system gave (R)- - hydroxycyclopantanone 20 in 98.0% ee with 71% yield and (Jrv)-2-hydroxytetralone 17 in 99.0% ee with 43.5% yield, respectively.
Table 7: Cascade biocatalysis for enantioselective conversions of cyclic epoxides to (R)-a-hydroxy ketone by E. coli (SpEH-bdhA) in two-phase system*
Substrate Cone. Cell density Time Product Yield (%)" Ee (%)
(mM) ( cdw/L) (h)
9 100 16 9 (R)-19 85.4 98.5
9 300 16 9 (R)-19 52.0 98.0
10 100 12 6 (R)-20 71.1 98.0
15 20 16 24 (R)-17 43.5° 99.0d
a All reactions were carried out in 10 mL Tris buffer (100 mM, pH 8.0) and 2 mL hexadecane at 30°C and 250 rpm.
b Yield was determined by chiral GC analysis.
c Yield was determined by chiral HPLC analysis.
d ee was determined by chiral HPLC analysis.
[0079] Thus, a tandem biocatalysts system was successfully developed for the enantioselective bioconversion of meso-epoxides or racemic epoxides to prepare the corresponding a-hydroxy ketones in high ee and good yield. The cascade biocatalysis is highly selective, clean, and green. The concept and methods developed here are generally applicable to the enantioselective conversion of other epoxides to eanatiopure a-hydroxy ketones by selecting and combining the appropriate enzymes in a similar way.
Example 1: Construction of recombinant E. coli strains respectively expressing the StEH, alkJ, and alkH
[0080] The epoxide hydrolase (StEH) from potato was synthesized by Genscript with an optimization in codon usage for efficient expression in E. coli T7TM. The alkJ and alkH gene were cloned by PCR with the plasmid DNA extracted from Pseudomonas putida (ATCC 29347). Two pairs of specific primers (alkJF, 5'- CGCGGATCCTAATAAAAGGAGATATAATGTACGACTATA T AATCGTTGGT-3 ' (SEQ ID NO: 12), alkJR, 5'-
CCCAAGCTTTTACATGCAGACAGCTATCATGGC-3' (SEQ ID NO: 13); alkHF 5 ' - ATTCC ATATGACC ATACC AATT AGCCTAGCC A-3 ' (SEQ ID NO: 14), alkHR 5'-CCGCTCGAG TC AGCTC AAATACTTAACTGTGATAC-3 ' (SEQ ID NO: 15)) were designed according to the sequences in GenBank. The
thermocycling parameters for cloning of alkJ were 98°C for 2 min, 98°C for 10 s, 60°C for 15 s, 72°C for 1 min, 30 cycles. Incubation at 72°C for 5 min was added as the last step. For alkH, the extension time at 72°C was shortened to 50 s; other parameters were not changed. The cloned genes were inserted into pET28a (+) between Ncol-Xhol (StEH), B rnR l-Hind III (alkJ), Nde I-Xhol (alkH) sites. After a standard transformation and identification process, positive recombinant plasmid was sent to First Base for confirmation by DNA sequence. Recombinant E. coli strains expressing StEH (E. coli (pET28aEH)), alkJ (E. coli (pET28aalkJ)), alkH (E. coli (pET28aalkH)) were constructed by transforming the correct recombinant plasmid into respective E. coli BL21 (DE3) competent cells. The growth profiles of the recombinant strains in the rich medium are shown in FIG. 6; after 2.2 h cultivation, IPTG (0.5 mM) was added to the medium to induce the enzyme expression, and the strains were further cultivated for another 6 to 10 h. As shown in FIG. 6, E. coli (pET28aalkJ) and E. coli (pET28aStEH) grew very quickly compared to E. coli (pET28aalkH). After 11 h cultivation, the OD600 of two recombinant strains reached up to 12 and 13, and the OD600 of recombinant strain E. coli (pET28aStEH) reached up to 5. Example 2: Construction of recombinant E. coli strain co-expressing StEH and alkj
[0081] For construction of the recombinant plasmid coexpressing StEH and alkJ, a ligation-independent cloning (SLIC) method was followed. Briefly, the
recombinant plasmid expressing alkJ (pET28aalkJ) was digested with single restriction endonuclease Hind III. The sequence encoding StEH was amplified with the primers JHindlllStEHF, 5'- CTGCATGTAAAAGCTAAG
GAGATATAATGGAGAAAATCGAACAC AAGATG-3 ' (SEQ ID NO: 16), JHindlllStEHR, 5'-GCTCGAGT
GCGGCCGCAAGCTTTAGAATTTTTGAATAAAATCATAGATGT-3' (SEQ ID NO: 17). After necessary purification step with kit from Qiagen, both the linearized plasmid and PCR product were separately subjected to T4 DNA polymersase treatment in a 1 * buffer provided by the supplier NEB for 30 min at 37°C. The reaction was stopped by adding 1/10 volume of dCTP (10 mM) to the tubes and putting on ice. The treated linearized plasmid and PCR products (1:1 molar ratio, about 500 ng DNA) were mixed in 1 xligation buffer (NEB) and the samples were kept on ice for 30 min. Transformation of the mixture with electroporation into competent cells and subsequent PCR amplification identified the correct
recombinant strains carrying plasmid co-expressing StEH and alkJ. Commercial sequencing confirmed that no mutations were found in the cloned genes. The reading frames in recombinant plasmid co-expressing StEH and alkJ constructed with SLIC methods (pET28aalkJStEH) were confirmed correct by sequencing. The optimized combinations of plasmids and expression hosts were established after a comparison of specific activity: E. coli (pET28aEH), E. coli (pET28aalkJ), E. coli (pET28aalkH), E. co/ (pET28aalkJStEH). Expression of each enzyme was analyzed by SDS-PAGE on a 12% gel (FIG. 11). As shown in FIG. 11, the co- expressed enzymes were efficiently expressed.
Example 3: Preparation of cells of recombinant strains for cascade
biotransformation
[0082] To prepare the recombinant whole cells used for cascade biocatalysis, overnight seed culture of E. coli (pET28aStEH), E. coli (pET28aalkJ), E. coli (pET28aalkH), E. coli (pET28aalkJStEH) were inoculated into respective 50 mL autoclaved rich media (glycerol, 15 g/L, peptone 15 g/L, yeast extract 4 g/L, NaCl 2 g/L, KH2P04 58 mM, MgS04 2 mM, pH6.0). After 1 to 2 h of cultivation at 37°C, OD60o reached about 0.6. IPTG (0.5 mM) was added to induce the enzyme expression. Six to ten hours later, the cells were harvested by centrifugation at 8,000g x 10 min (4°C). The collected cells could be used for biotransformation directly or temporarily stored at -80°C freezer for future use.
Example 4: HPLC or GC analysis of the concentration of vicinal diols
[0083] Concentrations of diols 5-8 were determined by using a Shimadzu Prominence HPLC on an Agilent Poroshell 120 EC-C18 column (2.7 μπι, 4.6x 150 mm). Detection: UV at 210 nm. Diol 5 and styrene oxide 1: eluent:
acetonitrile:H20 (4:6); flow rate: 0.40 mL/min; retention time: 4.3 min for diol-5, 5.0 min for benzyl alcohol (internal standard), 7.4 min for styrene oxide 1; diols 6-8 and chloro-/fluoro-substituted styrene oxides 2-4: eluent: acetonitrile:H20 (5:5); flow rate: 0.40 mL/min; retention time: 5.0 min for benzyl alcohol (internal standard), 5.4 min for diol 6, 15.9 min for 2-(3-chlorophenyl)oxirane 2, 5.2 min for diol 7, 15 min for 2-(4-chlorophenyl)oxirane 3, 4.8 min for diol 8, 10.9 min for 2-(4- fluorophenyl)oxirane 4. The concentration of (R, i?)-diol 12 was determined by GC with HP-5 column, with the GC conditions: 45°C, 1 min, 12°C/min, to 140°C, 0 min, 40°C/min, to 280°C, 2 min. Retention time: 8 min for (R, i?)-diol 12, 5 min for meso-epoxide 9.
[0084] Samples for reverse phase HPLC analysis to determine the concentration of diols were prepared by the following procedure: needed volume of acetonitrile was added to stop the reaction and to dilute the reaction mixture, then acetonitrile containing 2 mM benzyl alcohol (internal standard) was added (1 :1, v/v). The supernatant after centrifugation was loaded to reverse phase HPLC analysis.
Example 5: HPLC or GC analysis of the enantiomeric excess of vicinal diols
[0085] The ee of diols 5-8 was analyzed with a Shimadzu Prominence HPLC on a chiral column (Chiral Technologies, 250*4.6 mm, 5 μιη) with a PDA detector. 1- Phenyl-l,2-ethanediol 5: Column: Chiralcel AS-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 21.5 min for (S)-5, 23.0 min for (R)-5. l-(3- Chlorophenyl)-!, 2-ethanediol 6: Chiralcel OD-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 17.4 min for (R)-6, 19.9 min for (5)-6. l-(4- Chlorophenyl)-l,2-ethanediol 7: Chiralpak OD-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 20.1 min for (S)-7, 17.9 min for (R)-7. l-(4- Fluorophenyl)-l,2-ethanediol 8: Chiralpak OD-H, eluent: n-hexane:i-PrOH (95:5), flow rate: 1.0 mL/min, retention time: 18.7 min for (S)-8, 16.9 min for (R)-S.
[0086] Samples were prepared by extracting 200 reaction mixture with equal volume of chloroform. After centrifugation at 21 ,500g x 10 min (4°C), chloroform portion was transferred into a clean tube and dried by evaporation. One hundred of solvent (n-hexane:isopropyl alcohol = 95:5) was added to dissolve the residues in the tube.
[0087] The enantiomeric excess of product 12 was analysed by GC with chiral column chiraldex G-TA after the sample derivatisation with TFAA (trifluoroacetic anhydride); chromatographic conditions: Chiraldex G-TA at an oven temperature of 30°C for 2 min and then programmed to 150°C at a rate of 5°C/min and kept at 150°C for 1 min. Retention time: 22.8 min for (R, #)-diol 12, 23.2 for (S, 5)-diol 12.
Example 6: Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade
biotransformation of racemic styrene oxide rac-X using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
[0088] The freshly harvested cells of E. coli (pET28aStEH), E. coli
(pET28aalkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris buffer (50 mM, pH8.5). The cell densities (OD600) were measured by a spectrophotometer (Hitachi U-1900 UV-Vis Ratio Beam
spectrophotometer). The biocatalyst system containing three kinds of cells was prepared by mixing needed amount of cell suspension. To 4 mL of cell suspension mixture (total 10 g cdw/L, StEH:alkJ:alkH=4:3:3), 20-50 mM racA was added (in
DMSO, 4 M stock solution). The mixture was shaken at 30°C and 300 rpm. The reaction of rac-l was followed by taking samples at different reaction time and analyzed by the HPLC. Reactions were stopped when the conversion rate of epoxide reached 100% and the ee of (i?)-diol in the reaction mixture was >98%. The results are summarized in Table 1. As shown Table 1, the yield of diol 5 was 95.3% for 50 mM substrate, and the ee of (i?)-diol 5 reached to 99%. Example 7: Preparation of (R)-l-(3-chloro-phenyl)-l,2-ethanediol 6 via cascade biotransformation of racemic 3-chIoro-styrene oxide rac-2 using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ) and E. coli (pET28aalkH)
[0089] The freshly harvested cells of E. coli (pET28aStEH), E. coli
(pET28aalkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris buffer (50 mM, pH8.5). The cell densities (OD 0o) were measured by a spectrophotometer (Hitachi U-1900 UV-Vis Ratio Beam
spectrophotometer). The biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension. To 4 mL of cell suspension mixture (total 10 g cdw/L, StEH:alkJ:alkH=4:3:3), rac-2 Was added (in DMSO, 1 M stock solution), with the final concentration from 20 to 40 mM. The mixture was shaken at 30°C and 300 rpm. The reaction of rac-2 was followed by taking samples at different reaction time points and analyzing the samples by HPLC. Reactions were stopped when the conversion rate of epoxide 2 reached 100% and the ee of
(/?)-diol in the reaction mixture was >98%. The results are summarized in Table 1.
As shown in Table 1, the yield of diol 6 was 87.7% for 40 mM substrate, and the ee of(J?)-diol 6 was >99%. "
Example 8: Preparation of (R)-l-(4-chIoro-phenyl)-l,2-ethanediol 7 via cascade biotransformation of racemic 4-chloro-styrene oxide rac-3 using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ) and E. coli (pET28aalkH)
[0090] Freshly prepared recombinant cells of E. coli (pET28aStEH), E. coli
(pET28aalkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris-Cl buffer (50 mM, pH8.5). The cell densities (OD600) were measured by a spectrophotometer (Hitachi U-1900 UV-Vis Ratio Beam spectrophotometer). The biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension. To 4 mL of cell suspension mixture (total 10 g cdw/L, StEH:alkJ:alkH=4:3:3), rac-3 was added (in DMSO, 1 M stock solution), with the final concentration from 10 to 20 mM. The mixture was shaken at 30°C and 300 rpm. The reaction of rac-3 was followed by taking samples at different reaction time points and analyzing the samples by HPLC. Reactions were stopped when the conversion rate of epoxide reached 100% and the ee of (R)- diol in the reaction mixture reached >98%. The results are summarized in Table 1. The yield of diol 7 was 79.2% for 20 mM substrate, and the ee of (J?)-diol 7 was >99%.
Example 9: Preparation of (R)-l-(4-fluoro-phenyl)-l,2-ethanedioI 8 via cascade biotransformation of racemic 4-fluro-styrene oxide rac-4 using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
[0091] Freshly prepared recombinant cells of E. coli (pET28aStEH), E. coli
(pET28aalkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris-Cl buffer (50 mM, pH8.5). The biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension. To 4 mL of cell suspension mixture (total dew 10 g cdw/L,
StEH:alkJ:alkH=4:3:3), rac-4 was added (in DMSO, 1 M stock solution), with the final concentration 10-20 mM. The mixture was shaken at 30°C and 300 rpm. The reaction of rac-4 was followed by taking samples at different reaction time points and analyzing the samples by HPLC. Reactions were stopped when the conversion rate of epoxide 4 reached 100% and the ee of (R)-diol 8 in the reaction mixture was
>98%. The results are summarized in Table 1. The yield of diol was 77.4% and the ee of (^)-diol 8 was >99%.
Example 10: Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade biotransformation of racemic styrene oxide rac-1 using recombinant cells of E. coli (pET28aStEH-alkJ)
[0092] Freshly prepared recombinant cells of E. coli (pET28aStEH-alkJ) were re-suspended in an appropriate volume of Tris buffer (50 mM, pH8.5). Dry cell weight was calculated by the equation 100=0.4 g cdw/L determined previously. To 4 mL of cell suspension mixture (total dew 4 g cdw/L), rac-1 was added (in DMSO, 4 M stock solution); the final concentration was 4-30 mM. The mixture was shaken at 30°C and 300 rpm. The reaction was followed by taking samples at different reaction time points and analyzing the samples by HPLC. The results are summarized in Table 1. When substrate increased to 30 mM, the highest yield (R)- diol 5 was 95.4% after 20 h reaction, and the ee was >99%.
Example 11: Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade biotransformation of racemic styrene oxide rac-1 using mixed cells of E. coli (pET28aStEH-alkJ) and E. coli (pET28aa!kH) [0093] Freshly prepared recombinant cells of E. coli (pET28aStEH-alkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris buffer (50 mM, pH8.5). The biocatalyst system containing the two kinds of cells was prepared by mixing needed amount of cell suspension. To 4 ml of cell suspension mixture (total 10 g cdw/L StEH-alkJ:alkH=4:3), rac-l (in DMSO, 4 M stock solution) was added, with the final concentration being 30 mM. The mixture was shaken at 30°C and 300 rpm. The reaction was followed by taking samples at different reaction time points and analyzing the samples by HPLC. Enantiomeric excess of diol was determined by chiral HPLC. The results are summarized in Table 1. The yield of diol 5 was 95.1%, and the ee of (i?)-diol 5 was 97.6%.
Example 12: Preparation of (/?)-l-phenyl-l,2-ethanedioI 5 via cascade biotransformation of racemic styrene oxide rac-l using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
[0094] Freshly prepared recombinant cells of E. coli (pET28aEH), E. coli
(pET28aalkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris buffer (50 mM, pH8.5). The cell densities (OD60o) were measured by a spectrophotometer (Hitachi U-l 900 UV-Vis Ratio Beam
spectrophotometer). The biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension. To 4 mL of cell suspension mixture (total dew 20 g cdw/L, StEH:alkJ:alkH=10:5:5), racemic styrene oxide 1 was added (in DMSO, 4 M stock solution), with a final concentration of 100- 150 mM. The mixture was shaken at 30°C and 300 rpm. The reaction of rac-l was followed by taking samples at different reaction time points and analyzed by HPLC.
Reactions were stopped (12-18 h) when the conversion rate of epoxide reached
100% and the ee of (i?)-diol in the reaction mixture reached >98%. The results are summarized in FIG. 15. The highest yield of ( ?)-diol 5 was 88.7% for 100 mM substrate after 45 h reaction, and the product ee of (if)-diol 5 was 98.3%.
Example 13: Preparation of (R)-l-phenyl-l,2-ethanediol 5 via cascade biotransformation of racemic styrene oxide rac-l using mixed cells of E. coli (pET28aStEH), E. coli (pET28aalkJ), and E. coli (pET28aalkH)
[0095] Freshly prepared recombinant cells of E. coli (pET28aStEH), E. coli
(pET28aalkJ) and E. coli (pET28aalkH) were re-suspended in an appropriate volume of respective Tris buffer (50 mM, pH8.5). The cell densities (OD600) were measured by a spectrophotometer (Hitachi U-1900 UV-Vis Ratio Beam
spectrophotometer). The biocatalyst system containing the three kinds of cells was prepared by mixing needed amount of cell suspension. To 4 mL of cell suspension mixture (total 30 g cdw/L, StEH:alkJ:alkH=14:8:8), racemic styrene oxide 1 was added (4 M stock solution in DMSO), with the final concentration to 150 mM. The mixture was shaken at 30°C and 300 rpm. The reaction of r c-l was followed by taking samples at different reaction time points and analyzed by HPLC. Reactions were stopped (12-18 h) when the conversion rate of epoxide 1 reached 100% and the ee of (i?)-diol 5 in the reaction mixture reached >97%. The results are summarized in FIG. 16. The highest yield for (#)-diol 5 was 91.5% for 150 mM substrate after 70 h reaction, and the product ee reached 97%.
Example 14: Preparation of (R,R)-l,2-cyclohexanediol 12 via cascade biotransformation of cyclohexane oxide 9 using a mixture of recombinant E. coli cell expressing epoxide hydrolase (SpEH) and free enzyme alcohol dehydrogenase (LKADH)
[0096] Freshly prepared recombinant cells of E. coli (pET28aSpEH) were re- suspended in an appropriate volume of Tris buffer (50 mM, pH 8.0). The cascade biocatalyst system containing the recombinant cells of E. coli (pET28aSpEH) and free enzyme (LKADH) was prepared by mixing needed amount of cell suspension and enzyme. To 10 mL of reaction system (total cell concentration: 1 g cdw/L), 10 mg LKADH and 1.5 mM NAD+, substrate cyclohexene oxide 9 (in DMSO, 1 M stock solution) was added with the final concentration of 10 mM. The mixture was shaken at 30°C and 250 rpm. Diol product yield and enantiomeric excess were determined by GC. Product concentration was analyzed by GC with HP-5 column, and the enantiomeric excess of product was analyzed by GC with chiral column G- TA after the sample derivatisation with TFAA (trifluoroacetic anhydride). The results are shown in FIG. 17. After 8 h reaction, the ee of (R, ?)-diol-12 reached 97.1%, and the product yield was 97.8%.
Example 15: HPLC and GC analysis of chiral a-hydroxy ketones 19, 20, 23, 25, 17 and vicinal diols 12, 13, 22, 24, 26 [0097] Concentrations of diols 12, 13, 22, 24 and a-hydroxy ketones 19, 20, 23, 25 were determined using an Agilent 7890A gas chromatograph with an HP-5 column (30mx0.32mmx0.25mm). Temperature program: 50°C for 1 min, then to 150°C at 20°C min 1 and finally to 280°C at 20°C min"1 for 5 min; Retention time: 9.5 min for phenylacetone (internal standard), 8.4 min for trans-\,2- cyclopentanediol 13, 7.4 min for α-hydroxy cyclopentanone 20, 8.9 min for trans- 1 ,2-cyclohexanediol 12, 8.5 min for a-hydroxycyclohexanone 19, 9.9 min for trans- 1,2-cycloheptanediol 22, 9.3 min for a-hydroxycycloheptanone 23, 10.7 min for tnms-l^-cyclooctanediol 24 and 10.2 min for a-hydroxycyclooctanone 25.
[0098] Concentrations of diol 26 and α-hydroxy tetralone 17 were determined using a Shimadzu Prominence HPLC on an EC-C18 column (2.1-150 mm, 5 μπι). Detection: UV at 210 nm; Eluent: ACN:H20 (70:30); Flow rate: 0.4 mL/min;
Retention time: 6.9 min for benzylacetone (internal standard), 4.6 min for trans-1,2- dihydroxy-l,2,3,4-tetrahydronaphthalene 26, 5.3 min for α-hydroxy tetralone 17.
[0099] The ee of diols 12, 13, 22, 24 and α-hydroxy ketones 19, 20, 23, 25 were determined by an Agilent GC 7890A on a chiral column (Supelco, β-ΟΕΧΤΜ120, 30 m x 0.25 mm χθ.25 mm). Temperature program: 120°C for 80 min; Retention time: 56.6 min for (S, S)-13, 60.7 min for (R, R)-13, 65 min for (5)-20, 75 min for (R)-20, 28.1 min for (S, S)-12, 32.0 min for (R, R)-12, 52.6 min for (S)-19, 59.1 min for (R)-19, 37.1 min for (S, S)-22, 42.7 min for (R, R)-22, 55.3 min for (S)-23, 32.3 min for (Λ)-23, 55.6 min for (S, S)-24, 57.6 min for (R, R)-24, 30.0 min for (S)-25, 22.6 min for (R)-25.
[00100] The ee of diol 26 and α-hydroxy ketone 17 were determined using a Shimadzu Prominence HPLC on a chiral column (Chiral Technologies, Chiralcel OB-H, 250-4.6 mm, 5 um) with a PDA detector. UV detection at 210 nm; eluent: n- hexane:i-PrOH (90:10); flow rate: 0.5 mL/min; retention time: 12.4 min for (S, 5)- 26, 13.7 min for (R, R)-26, 20.4 min for (i?)-17, 24.3 min for (S)-17,
Example 16: Engineering of recombinant E. coli (bdhA), E. coli (LDH), E. coli (CDDHPm), E. coli (CDDHRh) and E. coli (bdhA-LDH)
[00101] The bdhA and LDH gene were amplified from genome DNA of Bacillus subtilis BGSC1 Al by PCR (by using Pfu DNA polymerase) with appropriate primers (bdhA-F: CGCGG^ 7CCATGAAGGC AGC AAGATGGCATAACC (SEQ NO: 18) and bdhA-R: CCC 4GC7TTTAGTTAGGTCTAACAAGGATTTTG (SEQ NO: 19) for bdhA; LDH-F:
GG A/4 GA 7XTC ATG ATGAAC A AAC ATGT A A AT A AAGT (SEQ NO: 20) and LDH-R: CCGCTCGAGTTA GTTGACTTTTTGTTCTGCA (SEQ NO: 21) for LDH. PCR program: 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min). The PCR products were isolated and double digested with restriction endonucleases (BamHI and Hindlll for bdhA and Bglll and Xhol for LDH) and ligated to pET28a (+) and pETduet-1 plasmid, respectively. The ligation products were transformed into E. coli T7 Express Competent cells to yield E. coli (bdhA) and E. coli (LDH). The sequence of the insert DNA was
subsequently confirmed by sequencing.
[00102] A two-plasmid system of E. coli (pET28-bdhA/pETduet-LDH) was constructed for bdhA and LDH co-expression in which each gene was cloned into a different plasmid with the same origin of replication to yield E. coli (bdhA-LDH).
[00103] The CDDHRh and CDDHPm genes were amplified from genome DNA of Rhodococcus sp. Moj-3449 and Pseudomonas medocina TA5 by PCR (using Pfu DNA polymerase) with appropriate primers (CDDHRh-F:
GGAATTCC4 TA TGGA AGTC AGACGGAGGA AG AAC (SEQ NO: 22) and CDDHRh-R: CCCA^G T TTACGACCTGACGAGAATCTTGAC (SEQ NO: 23) for CDDHRh: CDDHPm-F: CGCGG^ TCCATGAACGA
CCTGAGCCACACCCACA (SEQ NO: 24) and CDDHPm-R:
CCGC7U04GTCAGCGCACGCCCGGCGAAACGAT G (SEQ NO: 25) for CDDHPm. PCR program; 98°C for 3 min followed by 30 cycles of denaturation at 98°C for 30 sec, annealing at 70°C for 45 sec, extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min). The PCR products were isolated and double digested with restriction endonucleases (BamHI and Hindlll for
CDDHPm; Ndel and Hindlll for CDDHRh) and ligated to pET28a (+). The ligation products were transformed into E. coli T7 Express Competent cells to yield E. coli (CDDHRh) and E. coli (CDDHPm).
Example 17: Cell growth and specific activity of recombinant E. coli (bdhA), E. coli (CDDHPm), E. coli (CDDHRh) and E. coli (bdhA-LDH) [00104] E. coli (bdhA) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 μg/mL kanamycin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD600 of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl β-D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h. Cells were harvested by centrifugation at 8,500*g for 10 min at 4°C, washed twice with Tris buffer (100 mM, pH 8.0), and resuspended in the same buffer for activity test or enantioselective biooxidation. The specific oxidation activity of recombinant cell was determined by performing the biotransformation of (±)-12 (10 mM) at 30°C and 250 rpm for 30 min with cells harvested and resuspended (10 g cdw/L) in Tris buffer (pH 8.0, 100 mM). The amount of substrate transformed was quantified by GC. One unit was defined as the amount of enzyme transform 1.0 μηιοΐ substrate per minute under the conditions above. The results are shown in FIG. 19A and Table 2.
[00105] E. coli (CDDHPm) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 μg/mL kanamycin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD600 of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl β-D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h. Cells were harvested by centrifugation at 8,500*g for 10 min at 4°C, washed twice with Tris buffer (100 mM, pH 8.0), and resuspended in the same buffer for activity test or enantioselective biooxidation. The specific oxidation activity of recombinant cell was determined by performing the biotransformation of (±)-12 (10 mM) at 30°C and 250 rpm for 30 min with cells harvested and resuspended (10 g cdw/L) in Tris buffer (pH 8.0, 100 mM). The amount of substrate transformed was quantified by GC. The results are shown in Table 2.
[00106] E. coli (CDDHRh) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 μg/mL kanamycin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD600 of 0.6-0.8 was achieved and then induced with isopropyl β-D-l- thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h. Cells were harvested by centrifugation at 8,500xg for 10 min at 4°C, washed twice with Tris buffer (100 mM, pH 8.0), and resuspended in the same buffer for activity test or enantioselective biooxidation. The specific oxidation activity of recombinant cell was determined by performing the biotransformation of (±)-12 (10 mM) at 30°C and 250 rpm for 30 min with cells harvested and resuspended (10 g cdw/L) in Tris buffer (pH 8.0, 100 mM). The results are shown in Table 2.
[00107] E. coli (bdhA-LDH) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 μg/mL kanamycin and 100 μg/mL ampicillin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium containing 50 μg/mL kanamycin and 100 μg/mL ampicillin (50 mL in 250 mL flask). The culture was grown until an OD6oo of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl β-D-l -thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 12 h. The specific oxidation activity of recombinant cell was determined by performing the
biotransformation of (±)-26 (10 mM) at 30°C and 250 rpm for 30 min with cells harvested and resuspended (10 g cdw/L) in Tris buffer (pH 8.0, 100 mM). The amount of substrate transformed was quantified by HPLC. The results are shown in Table 3.
Example 18: Specific activity of bdhA and LDH in crude extracts of
recombinant cell E. coli (bdhA-LDH)
[00108] In order to determine the activity of bdhA in crude extracts of E. coli (bdhA-LDH), the wet cells harvested were re-suspended in 20 mL of Tris buffer (pH 8.0, 100 mM) with an OD60o of 20 and disrupted by homogenizer (one time, 21 bar). The cell lysate was centrifuged at 15,000 χ g for 30 min; the supernatant of cell lysate was used to determine the activity of bdhA. A continuous assay using UV absorbance at 340 nm was employed to monitor the NADH concentration increasing by bdhA. For the enzymatic oxidation, (±)-12 was used as the standard substrate. One unit of activity was defined as the amount of enzyme which catalyzes the reduction of 1 μηιοΐ NAD+ per minute under standard conditions (25°C, pH 8.0). The assay mixture contained 935 jiL Tris buffer (pH 8.0, 100 mM), 5 iL (±)-12 (1 M) in distilled water, 10 μΐ, NAD+ (10 mM) in distilled water and 50 μί, enzyme solution. Reactions were started by addition of the enzyme solution and measured over a period of 1 min. The protein concentration of the enzyme solution was determined by the Bradford method.
[00109] In order to determine the activity of LDH in crude extracts of E. coli (bdhA-LDH), the wet cells harvested were re-suspended in 20 mL of Tris buffer (pH 8.0, 100 mM) with an OD600 of 20 and disrupted by homogenizer (one time, 21 bar). The cell lysate was centrifuged at 15,000 x g for 30 min; the supernatant of cell lysate was used to determine the activity of LDH. A continuous assay using UV absorbance at 340 nm was employed to monitor the NADH concentration reduction by LDH. For the enzymatic reduction, pyruvate was used as the standard substrate. One unit of activity was defined as the amount of enzyme which catalyzes the oxidation of 1 μιηοΐ NADH per minute under standard conditions (25°C, pH 8.0). The assay mixture contained 978 x Tris buffer (pH 8.0, 100 mM), 10 pyruvate (500 mM) in distilled water, 10 NADH ( 10 mM) in distilled water and 2 μL enzyme solution. Reactions were started by addition of the enzyme solution and measured over a period of 3 min. The protein concentration of the enzyme solution was determined by the Bradford method.
[00110] For SDS-PAGE analysis, the wet cells harvested were re-suspended in 20 mL of Tris buffer (pH 8.0, 100 mM) with an OD6oo of 20 and disrupted by homogenizer (one time, 21 bar). The cell lysate was centrifuged at 15,000 χ g for 30 min; samples of the enzyme solution were run on a 12% SDS-PAGE gel. 20 μΐ, of the samples were mixed with an equal volume of 2 χ sample loading buffer, vortexed, and then incubated in a water bath at 95 °C for five minutes. Samples were then centrifuged at 14,000 g for 5 minutes and placed on ice prior to loading on the gel. 10 μΐ, of each sample were loaded into the wells with blank sample buffer added to the empty wells. The gel was run under constant voltage (120 V) for 1.5 hours. At the completion of the electrophoresis run, the gel was washed with three changes of DI water. The gel was then stained with coommassie blue G250 stain for 1 hour and then transferred to DI water to destain for an additional hour. Images were taken in a Bio Imaging System (Syngene Gene Genius) for gel documentation.
Example 19: General procedure for biooxidation of (±)-12, 13, 22, 24 to (R)-19, 20, 23, 25 [00111] The oxidation of racemic trans-cyclic diols 12, 13, 22, 24 (0.1 -0.2 mmol) was performed with fresh cells (10 g cdw/L) of recombinant strain E. coli (bdhA), E. coli (CDDHRh)-and E. coli (CDDHPm) in 10 mL 100 mM Tris buffer (pH 8.0) at 30°C and 250 rpm. 300 μΐ, aliquots were taken out at different time points for GC analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04 before GC
quantification of ee and concentration of the diols and a-hydroxy ketones. The main results of biooxidation of 10 mM (±)-12, 13, 22, 24 are given in Table 2.
Example 20: General procedure for regio- and enantioselective biooxidation of (±)-26 to (R)-17
[00112] A solution of (±)-26 (16.4-32.8 mg, 0.1-0.2 mmol) in DMSO (0.1 mL) was added to a suspensions of resting cells of E. coli (CDDHPm), E. coli (bdhA) and E. coli (bdhA-LDH) (10-20 g cdw/L) in 10 mL Tris buffer (100 mM, pH 8.0). The mixtures were shaken at 250 rpm and 30°C. At regular time intervals, a 100 μί sample was taken, mixed with 400 ACN containing 2 mM benzylacetone as an internal standard, and used for HPLC analysis to determine the concentration of the diols and a-hydroxy ketones. For chiral HPLC analysis of the ee of (S, S)-26 and (i?)-17, the samples were prepared by taking 200 aliquots, removing the cells via centrifugation, and extracting with 200 μΐ, chloroform; chloroform portion was transferred into a clean tube and dried by evaporation; 200 μί. of isopropyl alcohol was added to dissolve the residues in the tube; after centrifugation, the solvents were used for chiral HPLC analysis. The results are given in Table 3.
Example 21: General procedure for preparation of (J?)-19, 20, 23, 25 and (5, S)- 12, 13, 22, 24 by biooxidation of (±)-12, 13, 22, 24
[00113] E. coli (bdhA) was grown at 37°C in LB medium containing 50 μg/mL kanamycin overnight, and then inoculated into TB (terrific broth) medium (50 mL) containing kanamycin (50 μg/mL). When OD 00 reached 0.6 (around 2 h), IPTG (0.5 mM) was added to induce the expression of protein. The cells were grown at 22°C for another 10 h to reach an OD 00 of 16.3 (cell density of 6.5 g cdw/L). Then the cells were harvested by centrifuge (8,500xg, 5 min) and resuspended in 100 mL Tris buffer (100 mM, pH 8.0) to a density of 10 g cdw/L. Substrate (±)-(±)-12, 13, 22, 24 (280 mg for (±)-13, 232 mg for (±)-12, 260 mg for (±)-22, 288 mg for (±)-24) were added. The mixtures were shaken at 250 rpm and 30°C. Once the reaction was finished, the reaction solution was centrifuged to remove the cells, and the solutions were saturated with NaCl and extracted with ethyl acetate three times (3 χ 100 mL), and all the organic phases were combined; after drying over Na2SO4, the solvents were removed by evaporation. The crude products were then purified by flash chromatography on a silica gel column with n-hexane: ethyl acetate = 50:50 [Rf = 0.3 for (i?)-19, 20, 23, 25]. The results are shown in Table 4.
[00114] (R)-20: Obtained as a viscous yellow oil in 33.9% yield (95 mg, >99% ee). [a]D 28 -37.4 (c 1.0, CHC13); Lit. [33]: [a]D 20 -38.4 (c 1.2, CHC13, >99% ee). 1H-NMR (400 MHz, CDC13) δ: 1.62-1.73 (m, 1H), 1.76-1.89 (m, lH), 2.01 -2.09 (m, 1H), 2.15-2.25 (m, 1 H), 2.37-2.47 (m, 2 H), 2.69 (bs, 1H), 4.07 (t, J = 10.0 Hz, 1H). GCMS m/z 100, 82, 72, 57, 50, 44, 39.
[00115] (R)-19: Obtained as a colourless oil in 37.9% yield (88 mg, 99% ee).
[a]D 28 +20.6 (c 1.0, CHC13); Lit. [34]: [a]D 20 +20.8 (c 0.65, CHC13, >99% ee). 1H- NMR (400 MHz, CDC13) δ: 1.44-1.78 (m, 3H), 1.85-1.93 (m, 1H), 2.08-2.15 (m, 1H), 2.32-2.41 (m, 1 H), 2.43-2.50 (m, 1 H), 2.54-2.60 (m, 1H), 3.64 (d, J = 3.2 Hz, 1H), 4.10-4.15 (m, 1H). GCMS m/z 1 14, 96, 70, 44, 31.
[00116] (R)-23: Obtained as a light yellow oil in 36.5% yield (95 mg, >99% ee).
[α]ο28 -86.4 (c 1.0, CHC13). The absolute configuration of compound (i?)-8 was determined by comparison of optical rotation ((+)-(S)-a-hydroxycycloheptanone, 83% ee) with literature [35]. 1H-NMR (CDC13, 400 MHz) δ: 1.29 (m, 1H), 1.49-
1.67 (om, 3H), 1.70-1.86 (om, 3H), 1.99 (m,lH), 2.46 (ddd, J = 11.2, 7.7, 3.6, 1H),
2.68 (m, 1H), 4.29 (dd, J = 9.2, 3.6, lH). GCMS m/z 128, 1 10, 95, 81, 67, 62, 51.
[00117] (R)-25: Obtained as a light yellow oil in 31.2% yield (90 mg, >99% ee).
[α]ο28 -36.5 (c 1.0, CHCI3). The absolute configuration of compound (i?)-9 was determined by comparison of the chiral GC chromatograms; (S, S)-4 was converted to (S)-9 by enzyme ADH-LK, and then the absolute configuration of 9 produced by enantioselective biooxidation of racemic 4 with resting cells of E. coli (bdhA) could be determined as (R)-9. 1H-NMR (400 MHz, CDC13) δ: 0.87-0.97 (m, 1H), 1.33- 1.44 (m, 2H), 1.63-1.86 (m, 4H), 1.94-2.07 (m, 2H), 2.31-2.42 (m, 2H), 2.71 (dt, J= 12.0 Hz, 4.0 Hz, 1H), 4.18 (dd, J= 6.4 Hz, 2.8 Hz, 1H). GCMS m/z 142, 124, 109, 98, 81, 68, 57.
[00118] (5, 5)-13: Obtained as a white solid in 32.5% yield (91 mg, 99% ee).
[a]D 28 +14.3 (c 1.0, CHC13); Lit. [36]: [a]D 20 +24.5 (c 5.4, Ethanol, 96% ee).
[00119] (5, 5)-12: Obtained as a white solid in 38.8% yield (90 mg, 99% ee).
[a]D 28 +36.0 (c 1.0, CHC13); Lit. [37]: [a]D 24 +40.8 (c 0.55, CHC13, >99% ee).
[00120] (S, S)-22: Obtained as a white solid in 38.5% yield (100 mg, >99% ee).
[a]D 28 +10.7 (c 1.0, CHC13); Lit. [37]: [a]D 24 +10.1 (c 0.81, CHC13, >99% ee).
[00121] (5, 5)-24: Obtained as a light oil in 38.2% yield (1 10 mg, >99% ee).
[a]D 28 +14.2 (c 1.0, CHC13); Lit. [37]: [a]D 25 +15.3 (c 1.2, CHC13, >99% ee).
Example 22: General procedure for preparation of (R)-17 and (S> S)-26 by biooxidation of (±)-26
[00122] E. coli (bdhA-LDH) was grown in LB medium containing kanamycin (50 ^g/mL) and ampicillin (100 μg/mL) overnight, and then inoculated into TB (terrific broth) medium (50 mL) containing kanamycin (50 μg/mL) and ampicillin (100 μg/mL). When OD600 reached 0.6 (around 2 h), IPTG (0.5 mM) was added to induce the expression of protein. The cells continued to grow for 12 h at 22°C with the cell density at 6.0 g cdw/L. Cells were harvested and resuspended in 100 mL Tris-buffer (100 mM, pH 8.0) to a density of 20 g cdw/L. Substrate (±)-26 (200 mg, 12 mM) was added, and 100 mM pyurvate was added for cofactor regeneration; the mixture was shaken at 250 rpm and 30°C for 24 h. The product {R)-\l and (S, S)-26 were extracted with ethyl acetate for three times (3 * 100 mL); the organic phases were combined; after drying over Na2S04, the solvents were removed by
evaporation. The crude products were then purified by flash chromatography on a silica gel column with «-hexane:ethyl acetate = 50:50 [i?f=0.5 for (R)-17]. The results are shown in Table 4.
[00123] (R)-17: Obtained as a yellow oil in 35.5% yield (71 mg, >99% ee).
[a]D 28 +38.0 (c 1.0, CHC13); Lit. [38]: [a]D 20 +44.5 (c 1.54, CHC13, 99% ee). 1H- NMR (400 MHz, CDC13) 6:1.97-2.12 (m, 1H, CHOHCH2), 2.49-2.59 (m, 1H, CHOHCH2), 2.99-3.22 (m, 2H, benzylic), 3.91 (d, J= 1.9 Hz, lH, OH), 4.39 (ddd, J = 13.5, 5.4, 1.9 Hz, 1H, CHOH ), 7.25-7.29 (m, 1H), 7.35 (tt, J = 7.6, 1.1 Hz, 1H), 7.52 (td, J =7.5, 1.5 Hz, 1H), 8.04 (dd, J= 7.8, 1.4 Hz, 1H). GCMS m/z 162, 144, 131, 118, 103, 90, 77.
[00124] (S, S)-26: Obtained as a white crystal in 40.0% yield (80 mg, 96% ee). [a]D 28 -103 (c 1.0, CHCI3); Lit. [39]: [a]D 25 -111 (c 1.05, CHC13, >99% ee).
Example 23: Engineering of E. coli (SpEH) and E. coli (SpEH-bdhA)
[00125] Epoxide hydrolase (SpEH) have been cloned and expressed in E. coli. In this study, the SpEH gene was amplified via PCR with primers SpEH-F:
CGCGG^rCCGATGATGAACG TCGAACATATCCG (SEQ NO: 26) and SpEH- R: CC L4GC77TCAAAGATCCATCTGTGCAAAGGC (SEQ NO: 27), using genome DNA from Sphingomonas sp. HXN-200 as the template. The PCR amplifications were performed with Pfu DNA polymerase (New England Biolabs Inc.), with initial denaturation at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1.5 min, followed by a final extension at 72°C for 5 min. The resulting 1146 bp fragment was digested with BamUl and HindUl and then ligated into pETduet-1, which was digested with the same restriction enzymes, generating the construct pETduet-SpEH. Successful ligation into pETduet-1 was confirmed by restriction analysis and determination of SpEH activity in cell-free extracts after recombinant expression in E. coli T7. The transformed strain was abbreviated as E. coli (SpEH).
[00126] A two-plasmid system E. coli (pET28-bdhA/pETduet-SpEH) was used for bdhA and SpEH co-expression in which each gene was cloned into a different plasmid with the same origin of replication to yield E. coli (SpEH-bdhA).
Example 24: Cell growth and specific activity of recombinant E. coli (SpEH) and E. coli (SpEH-bdhA)
[00127] E. coli (SpEH) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 100 μg/mL ampicillin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown until an OD600 of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl β-D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h. Cells were harvested by centrifugation at 8,500xg for 10 min at 4°C, washed twice with Tris buffer (100 mM, pH 8.0), and resuspended in the same buffer for activity test. The specific activity of recombinant cell was determined by performing the
biotransformation of cyclohexene oxide 9 (100 mM) at 30°C and 250 rpm for 10 min with cells harvested and resuspended (2 g cdw/L) in Tris buffer (pH 8.0, 100 mM). The amount of substrate transformed was quantified by GC. One unit was defined as the amount of enzyme transform 1.0 μπιοΐ substrate per minute under the conditions above.
[00128] E. coli (SpEH-bdhA) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 g/mL kanamycin and 100 μg/mL ampicillin overnight; 1 mL overnight seed culture was transferred to 50 mL TB-medium containing 50 μg/mL kanamycin and 100 μg/mL ampicillin (50 mL in 250 mL flask). The culture was grown until an OD60o of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl β-D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM, The growth of the culture was continued at 22 °C and 250 rpm for 12 h. Resting cells obtained were employed as the whole cell biocatalysts and were stored at 4°C prior to use.
Example 25: General procedure for enantioselective conversions of epoxides 9, 10, 15 to a-hydroxyl ketones 19, 20, 17 with the mixture of resting cells of E. coli (SpEH) and E. coli (bdh A).
[00129] The bioconversion of racemic epoxides 9, 10, 15 (0.1-2.0 mmol) was performed with freshly prepared E. coli (SpEH) cells and E. coli (bdhA) cells with required cell density (as indicated in Table 5) in 10 mL 100 mM Tris buffer (pH 8.0) at 30°C and 250 rpm. For 9 & 10, 300 μΐ, aliquots were taken out at different time points for GC analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04 before GC quantification of ee and concentration of the diols and a-hydroxy ketones. For 15, 100 μΐ, sample was taken, mixed with 400 iL ACN containing 2 mM benzylacetone as an internal standard, and used for HPLC analysis to determine the concentration of the diols and a-hydroxy ketones. For chiral HPLC analysis of the product ee, the samples were prepared by taking 200 ih aliquots, removing the cells via centrifugation, and extracting with 200 μΙ< chloroform; chloroform portion was transferred into a clean tube and dried by evaporation; 200 μΐ, of isopropyl alcohol was added to dissolve the residues in the tube; after centrifugation, the solvents were used for chiral HPLC analysis.
Example 26: General procedure for enantioselective conversions of epoxides 9, 10, 15 to (R)-a-hydroxyl ketones 19, 20, 17 with resting cells of E. coli (SpEH- bdhA)
[00130] The bioconversion of racemic epoxides 9, 10, 15 (0.1-1.0 mmol) was performed with freshly prepared E. coli (SpEH-bdhA) Cells with required cell density (as indicated in Table 6) in 10 mL 100 mM Tris buffer (pH 8.0) at 30°C and 250 rpm. For 9 & 10, 300 μΐ, aliquots were taken out at different time points for GC analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1:1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04 before GC
quantification of ee and concentration of the diols and a-hydroxy ketones. For 15, 100 μΙ_, sample was taken, mixed with 400 ih ACN containing 2 mM benzylacetone as an internal standard, and used for HPLC analysis to determine the concentration of the diols and a-hydroxy ketones. For chiral HPLC analysis of the ee of (R)-17, the samples were prepared by taking 200 μΐ, aliquots, removing the cells via centrifugation, and extracting with 200 μΐ, chloroform; chloroform portion was transferred into a clean tube and dried by evaporation; 200 μί, of isopropyl alcohol was added to dissolve the residues in the tube; after centrifugation, the solvents were used for chiral HPLC analysis.
Example 27: General procedure for enantioselective conversions of epoxides 9, 10, 15 to (l?)-a-hydroxyl ketones 19, 20, 17 with resting cells of E. coli (SpEH- bdhA) in two phase system
[00131] The freshly prepared E. coli (SpEH-bdhA) cells with required cell density (as indicated in Table 7) were resuspended in 10 mL 100 mM Tris buffer (pH 8.0); 2 mL hexadecane containing epoxides 9, 10, 15 (0.1-2.0 mmol) was added. The mixture was incubated at 250 rpm and 30°C. For 9 & 10, 300 μΐ, aqueous phases were taken out at different time points for GC analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04 before GC quantification of ee and concentration of the diols and a-hydroxy ketones. For 15, 10 \L organic and 100 μΐ. aqueous phases were diluted with 490 and 400 ACN containing 2 mM benzylacetone as an internal standard, respectively. All samples were analyzed by HPLC for determination of concentration of diols and a-hydroxy ketones. The final concentration of each compound was the total concentration of both aqueous and organic phase. For chiral HPLC analysis of the ee of (R)-17, the samples were prepared by taking 200 μΐ^ aqueous phases, removing the cells via centrifugation, and extracting with 200 μΐ, chloroform; chloroform portion was transferred into a clean tube and dried by evaporation; 200 yl, of isopropyl alcohol was added to dissolve the residues in the tube; after centrifugation, the solvents were used for chiral HPLC analysis.
Example 28: Engineerin and cell growth of E. coli (NOX), E. coli (BDHA- NOX) and E. coli (SpEH-BDHA-NOX)
[00132] E. coli (NOX): NADH oxidase (NOX) gene from Lactobacillus brevis DSM 20054 was synthesized by Genscript Corp (Piscataway, NJ). The gene was PCR amplified further using forward primer NOX-F: GGAAGATCT
CATGAAAGTCACAGTTGTTGGTTGTAC (SEQ NO: 28) and reverse primer NOX-R: CCGCTCGAG TTAAGCGTTAACTGATTGGGCAACT (SEQ NO: 29). The amplified gene was digested with Bgill and Xhol and ligated into pETduet vector. The resulting construct was then transformed into E. coli T7 competent cells and plated on LB plates containing 100 μg/mL ampicillin. Successful ligation into pETduet was confirmed by restriction analysis and determination of NOX activity in cell-free extracts after recombinant expression in E. coli T7. The transformed strain was abbreviated as E. coli (NOX). E. coli (NOX) was grown at 37°C in LB medium (3 mL in 20 mL tube) containing 100 μg/mL ampicillin overnight. 1 mL overnight seed culture was transferred to 50 mL TB-medium (50 mL in 250 mL flask). The culture was grown for 2 h to reach an OD6oo of 0.6-0.8 and then induced with isopropyl β-D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10 h.
[00133] E. coli (BDHA-NOX): A two-plasmid system E. coli (pET28a- BDHA/pETduet-NOX) was constructed for BDHA and NOX co-expression in which each gene was cloned into a different plasmid with the same origin of replication to yield E. coli (BDHA-NOX).
[00134] E. coli (SpEH-BDHA-NOX): For E. coli (SpEH-BDHA-NOX), pETduet-SpEH was first digested with Bgill and Xhol, the NOX gene (digested with Bgill and Xhol) was ligated into pETduet-SpEH vector, generating the construct pETduet-SpEH-NOX. Then, a two plasmid system E. coli (pET28a- BDHA/pETduet-SpEH-NOX) was constructed for BDHA, SpEH and NOX co- expression in E. coli.
[00135] E. coli (BDHA-NOX) and E. coli (SpEH-BDHA-NOX) were grown at 37°C in LB medium (3 mL in 20 mL tube) containing 50 μg/mL kanamycin and 100 μg/mL ampicillin overnight. 1 mL overnight seed culture was transferred to 50 mL TB-medium containing 50 μg/mL kanamycin and 100 μg/mL ampicillin (50 mL in 250 mL flask). The culture was grown until an OD60o of 0.6-0.8 (around 2 h) was achieved and then induced with isopropyl β-D-l-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM. The growth of the culture was continued at 22°C and 250 rpm for 10-12 h. Resting cells obtained were employed as the whole cell biocatalysts and were stored at 4°C prior to use.
Example 29: Enantioselective conversions of meso-epoxides 10 to (R)-a-hydroxy ketone 20 with the mixture of lyophilized cell-free extract of E. coli (SpEH), E. coli (BDHA) and E. coli (LDH)
[00136] The freshly prepared cells of E. coli (SpEH), E. coli (BDHA), and E. coli (LDH) were respectively resuspended in DI water to a cell density of 20 g cdw/L. The cell suspensions were broken at 20 KPSi by Constant Cell Disruption System. The mixture was ultracentrifuged at 15,000 g at 4°C for 30 min to give the supernatant free of cell debris. The protein amount of cell-free extract was determined by Bradford method. For the preparation of lyophilized powder, the cell-free extract was frozen at -80°C overnight, and then it was lyophilized for 48 h to get the lyophilized powder.
[00137] The mixtures of lyophilized cell free-extract of E. coli (SpEH), E. coli (BDHA) and E, coli (LDH) at the concentrations of 5, 10, and 5 g protein/L, respectively, were dissolved in 10 mL 100 mM Tris buffer (pH 7.5) containing pyruvate (200 mM) and NADH 0.002 mM, followed by the addition of 10 (50 mM). The mixture was incubated at 250 rpm and 30°C. 300 μΐ. aliquots were taken out at different time points, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04. After 9 h, product 20 was obtained in 65% yield and 98% (R) determined by GC analysis.
Example 30: Enantioselective conversions of epoxide 10 to (R)-a-hydroxy ketone 20 with the mixture of resting cells of E. coli (SpEH) and E. coli (BDHA- NOX)
[00138] The freshly prepared cells of E. coli (SpEH) and E. coli (BDHA-NOX) were mixed at cell density of 4 and 10 g cdw/L in 10 mL 100 mM Tris buffer (pH 7.5). 10 mL hexadecane containing epoxide 10 (0.1 mmol) was added. The mixture was incubated at 250 rpm and 30°C. 300 aqueous phases were taken out at different time points for analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04, followed by GC quantification of ee and concentration of the diols and a-hydroxy ketones. After 6 h, (/?)-a-hydroxy ketone 20 in 98% ee was obtained in 84%.
Example 31: Enantioselective conversions of epoxide 10 to (R)-a-hydroxy ketone 20 with the resting cells of E. coli (SpEH-BDH A-NOX) alone
[00139] The freshly prepared E. coli (SpEH-BDHA-NOX) cells were
resuspended in 10 mL 100 mM Tris buffer (pH 7.5) to a cell density of 12 g cdw/L.
10 mL hexadecane containing epoxide 20 (0.1 mmol) was added. The mixture was incubated at 250 rpm and 30°C. 300 aqueous phases were taken out at different time points for analysis. Analytic samples were prepared by removal of the cells via centrifugation, saturated with NaCl and extracted with ethyl acetate (1 : 1) containing 5 mM phenylacetone as an internal standard and dried over Na2S04, followed by GC quantification of ee and concentration of the diols and a-hydroxy ketones. After 6 h, (i?)-a-hydroxy ketone 20 in 98% ee was obtained in 79%.
[00140] It should be understood that for all numerical bounds describing some parameter in this application, such as "about," "at least," "less than," and "more than," the description also necessarily encompasses any range bounded by the recited values. Accordingly, for example, the description "at least 1, 2, 3, 4, or 5" also describes, inter alia, the ranges 1-2, 1-3, 1-4, 1-5, 2-3, 2-4, 2-5, 3-4, 3-5, and 4- 5, et cetera.
[00141] For all patents, applications, or other references cited herein, such as nonpatent literature and reference sequence information, it should be understood that they are incorporated by reference in their entirety for all purposes as well as for the proposition that is recited. Also incorporated by reference in its entirety is Wu et al., ACS Catal. 4:409-20 (2014). Where any conflict exists between a document incorporated by reference and the present application, this application will control. All publicly available information associated with reference gene sequences disclosed in this application (such as SEQ ID NOs: 1-16), including, for example, genomic loci, genomic sequences, functional annotations, allelic variants, and reference mRNA (including, e.g., exon boundaries or response elements) and protein sequences (such as conserved domain structures, e.g., as identifiable by ENTREZ conserved domain searches or by multiple sequence alignments of homologous sequences), as well as chemical references (e.g., PubChem compounds, PubChem substances, or PubChem Bioassay entries, including the annotations therein, such as structures and assays, et cetera), are hereby incorporated by reference in their entirety.
[00142] Headings used in this application are for convenience only and do not affect the interpretation of this application.
[00143] Preferred features of each of the aspects provided by the invention are applicable to all of the other aspects of the invention mutatis mutandis and, without limitation, are exemplified by the dependent claims and also encompass
combinations and permutations of individual features (e.g., elements, including numerical ranges and exemplary embodiments) of particular embodiments and aspects of the invention, including the working examples. For example, particular experimental parameters exemplified in the working examples can be adapted for use in the claimed invention piecemeal without departing from the invention. For example, for materials that are disclosed, while specific reference of each of the various individual and collective combinations and permutations of these
compounds may not be explicitly disclosed, each is specifically contemplated and described herein. Thus, if a class of elements A, B, and C is disclosed as well as a class of elements D, E, and F and an example of a combination of elements A-D is disclosed, then, even if each is not individually recited, each is individually and collectively contemplated. Thus, in this example, each of the combinations A-E, A- F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the sub-groups of A-E, B-F, and C- E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. This concept applies to all aspects of this application, including elements of a composition of matter and steps of method of making or using the compositions.
[00144] The forgoing aspects of the invention, as recognized by the person having ordinary skill in the art following the teachings of the specification, can be claimed in any combination or permutation to the extent that they are novel and non- obvious over the prior art— thus, to the extent an element is described in one or more references known to the person having ordinary skill in the art, they may be excluded from the claimed invention by, inter alia, a negative proviso or disclaimer of the feature or combination of features.
[00145] While this invention has been particularly shown and described with references to example embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

CLAIMS What is claimed is:
1. A method of producing an enantiomerically pure vicinal diol, comprising contacting a composition comprising an enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a co-factor-regenerating enzyme with a racemic epoxide, a meso-epoxide, or a racemic trans-cyclic vicinal diol under conditions where the enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a complementary oxidoreductase are enzymatically active and incubating the composition for a time sufficient to produce an enantiomerically pure vicinal diol, wherein the enantiomerically pure vicinal diol is produced without intervening purification steps.
2. The method of Claim 1, wherein the composition comprises:
a) StEH, alkJ, and alkH;
b) SpEH and ADH-LK;
c) SpEH and one of BDHA, CDDHPm, or CDDHRh;
d) any one of a), b), or c), further including a co-factor-regenerating enzyme;
e) BDHA and a co-factor-regenerating enzyme;
f) CDDHPm and a co-factor-regenerating enzyme; or
g) CDDHRh and a co-factor-regenerating enzyme.
3. The method of Claim 1 or 2, wherein the enantiomerically pure vicinal diol is (R) or (R,R), alternatively wherein the method comprises producing an enantiomerically pure vicinal diol that is (S) or (S,S).
4. A method of producing an enantiomerically pure a-hydroxy ketone,
comprising contacting a composition comprising an enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a co- factor-regenerating enzyme with a racemic epoxide, a meso-epoxide, or a racemic trans-cyclic vicinal diol under conditions where the enantioselective oxidative enzyme and at least one of a selective epoxide hydrolase and a complementary oxidoreductase are enzymatically active and incubating the composition for a time sufficient to produce an enantiomencally pure <x- hydroxy ketone, wherein the enantiomerically pure a-hydroxy ketone is produced without intervening purification steps.
The method of Claim 4, wherein the composition comprises:
a) StEH, alkJ, and alkH;
b) SpEH and ADH-LK;
c) SpEh and one of BDHA, CDDHPm, or CDDHRh;
d) any one of a), b), or c), further including a co-factor-regenerating enzyme;
e) BDHA and a complementary oxidoreductase;
f) CDDHPm and a complementary oxidoreductase; or
g) CDDHRh and a complementary oxidoreductase.
The method of Claim 5, wherein the enantiomerically pure α-hydroxy ketone is (R), optionally wherein the method further comprises producing an enantiomerically pure vicinal diol, optionally wherein the enantiomerically pure vicinal diol is (S) or (S,S).
The method of any one of the preceding claims, wherein the composition is in the form of:
a) one or more recombinant microorganisms expressing: the
enantioselective oxidative enzyme, the selective epoxide hydrolase, or the co-factor-regenerating enzyme, or a combination thereof, optionally wherein a single recombinant microorganism expresses the enantioselective oxidative enzyme and at least one of the selective epoxide hydrolase and the co-factor-regenerating enzyme , b) a protein extract of the one or more microorganisms of a);
c) purified enantioselective oxidase and at least one of purified selective epoxide hydrolase and purified complementary reductase; d) purified enantioselective oxidase and at least one of purified selective epoxide hydrolase and purified complementary reductase, wherein the purified enzymes are immobilized; or
e) any combination of the foregoing.
8. The method of any one of the preceding claims, wherein the composition comprises a selective epoxide hydrolase and the enantioselective oxidative enzyme.
9. The method of Claim 8, wherein the selective epoxide hydrolase is selected from an epoxide hydrolase from Sphingomonas (SpEH), Solanum tuberosum (StEH), Aspergillus (AnEH), or a variant thereof that is at least 60% identical at the amino acid level to the epoxide hydrolase from Sphingomonas, Solanum tuberosum, or Aspergillus.
10. The method of Claim 8 or 9, wherein the enantioselective oxidative enzyme is selected from Pseudomonas putida GPol alkJ, Lactobacillus kefir ADH- LK, Bacillus subtilis BGSC1A1 BDHA, Pseudomonas medocina TA5 CDDHPm, Rhodococcus sp. Moj-3449 CDDHRh, or a variant thereof that is at least 60% identical at the amino acid level to any of the foregoing enantioselective oxidases.
11. The method of any one of the preceding claims, wherein the composition further comprises a co-factor-regenerating enzyme.
12. The method of Claim 11, wherein the co-factor-regenerating enzyme is E. coli lactate dehydrogenase (LDH) or Lactobacillus brevis NADH oxidase (NOX), or a variant thereof that is at least 60% identical at the amino acid level to any of the foregoing complementary reductases.
13. The method of any one of the preceding claims, wherein the composition is contacted with a racemic epoxide or a meso-epoxide.
14. The method of Claim 13, wherein the composition comprises a racemic
epoxide of forumula I, IV, or VII, wherein R, R.i, and R2 are independently selected from a variably substituted straight chain or branched alkyl group, a variably substituted straight chain or branched alkenyl group, a variably substituted straight chain or branched alkynyl group, a variably substituted cycloalkyl group as well as cycloalkenyl groups, a variably substituted aryl group, a variably substituted aryl alkyl group, and a variably substituted heterocyclic group, optionally wherein the substitutions may be selected from carbonyl, carboxyl, amine, substituted amine, alcohol, alkyloxy, or halogen.
15. The method of any one of Claims 1-12, wherein the composition is contacted with a racemic trans-cyclic vicinal diol.
16. The method of any one of the preceding claims, wherein the composition further comprises an aldehyde oxidase or aldehyde dehydrogenase.
17. The method of any one of the preceding claims, wherein the composition comprises one or more recombinant microorganisms expressing, from one or more heterologous nucleic acids: the enantioselective oxidative enzyme, selective epoxide hydrolase, co-factor-regenerating enzyme, or a
combination thereof.
18. The method of Claim 17, wherein the recombinant microorganism is a
bacterium.
19. The method of Claim 18, wherein the bacterium is E. coli.
20. The method of any one of the preceding claims, wherein the composition is a liquid, preferably a two-phase liquid, comprising an aqueous phase and a second phase with improved solubility relative to the aqueous phase for: a racemic epoxide, a meso-epoxide, racemic trans-cyclic vicinal diol, or a combination thereof, optionally wherein the liquid is a two-phase liquid, such as an n-hexane-aqueous buffer system, optionally in a ratio of about 1:5.
PCT/SG2014/000299 2013-06-25 2014-06-25 Preparation of enantiopure vicinal diols and alpha-hydroxyketones from racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations WO2014209230A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361838981P 2013-06-25 2013-06-25
US61/838,981 2013-06-25

Publications (1)

Publication Number Publication Date
WO2014209230A1 true WO2014209230A1 (en) 2014-12-31

Family

ID=52142396

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2014/000299 WO2014209230A1 (en) 2013-06-25 2014-06-25 Preparation of enantiopure vicinal diols and alpha-hydroxyketones from racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations

Country Status (1)

Country Link
WO (1) WO2014209230A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109652354A (en) * 2018-12-28 2019-04-19 江南大学 A kind of recombination bacillus coli prepares (R)-to the method for chlorine Styryl oxide
WO2021004614A1 (en) * 2019-07-08 2021-01-14 Symrise Ag Biotechnological production of diols
WO2024010529A1 (en) * 2022-07-08 2024-01-11 National University Of Singapore Production of enantiopure alcohols, amines and acids from racemic epoxides by cascade biotransformation involving epoxide isomerization and dynamic kinetic resolution

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050003500A1 (en) * 2003-06-06 2005-01-06 Daicel Chemical Industries, Ltd. (2S, 3S) -2,3-butanediol dehydrogenase
US20080286832A1 (en) * 2004-04-19 2008-11-20 Adriana Leonora Botes Methods for Obtaining Optically Active Epoxides and Vicinal Diols From 2,2-Disubstituted Epoxides

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050003500A1 (en) * 2003-06-06 2005-01-06 Daicel Chemical Industries, Ltd. (2S, 3S) -2,3-butanediol dehydrogenase
US20080286832A1 (en) * 2004-04-19 2008-11-20 Adriana Leonora Botes Methods for Obtaining Optically Active Epoxides and Vicinal Diols From 2,2-Disubstituted Epoxides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LEE, L. G. ET AL.: "Preparation of Optically Active 1,2-Diols and a-Hydroxy Ketones Using Glycerol Dehydrogenase as Catalyst: Limits to Enzyme-Catalysed Synthesis due to Noncompetitive and Mixed Inhibition by Product", J. ORG. CHEM., vol. 51, 1986, pages 25 - 36 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109652354A (en) * 2018-12-28 2019-04-19 江南大学 A kind of recombination bacillus coli prepares (R)-to the method for chlorine Styryl oxide
WO2021004614A1 (en) * 2019-07-08 2021-01-14 Symrise Ag Biotechnological production of diols
CN114026245A (en) * 2019-07-08 2022-02-08 西姆莱斯有限公司 Biotechnological production of diols
WO2024010529A1 (en) * 2022-07-08 2024-01-11 National University Of Singapore Production of enantiopure alcohols, amines and acids from racemic epoxides by cascade biotransformation involving epoxide isomerization and dynamic kinetic resolution

Similar Documents

Publication Publication Date Title
Muschiol et al. Cascade catalysis–strategies and challenges en route to preparative synthetic biology
Leisch et al. Baeyer− Villiger monooxygenases: more than just green chemistry
Chen et al. Enzymatic synthesis of enantiopure alcohols: current state and perspectives
Hall et al. Enantioenriched compounds via enzyme-catalyzed redox reactions
Bechtold et al. Biotechnological development of a practical synthesis of ethyl (S)-2-ethoxy-3-(p-methoxyphenyl) propanoate (EEHP): over 100-fold productivity increase from yeast whole cells to recombinant isolated enzymes
Zhang et al. Enantioselective cascade biocatalysis via epoxide hydrolysis and alcohol oxidation: one-pot synthesis of (R)-α-hydroxy ketones from meso-or racemic epoxides
US8980592B2 (en) Process for the enantioselective enzymatic reduction of hydroxy keto compounds
Poessl et al. Non‐racemic halohydrins via biocatalytic hydrogen‐transfer reduction of halo‐ketones and one‐pot cascade reaction to enantiopure epoxides
US7465842B2 (en) Enantioselective biotransformation for preparation of protein tyrosine kinase inhibitor intermediates
US7202069B2 (en) (R)-2-octanol dehydrogenases, methods for producing the enzymes, DNA encoding the enzymes, and methods for producing alcohols using the enzymes
JP2002345479A (en) New (r)-2,3-butanediol dehydrogenase, method for producing the same and method for optically active alcohol production using the same
US7750135B2 (en) Molecular design of thermostable alcohol dehydrogenase for synthesis for chiral aromatic alcohols
Chen et al. Multi‐Enzymatic Biosynthesis of Chiral β‐Hydroxy Nitriles through Co‐Expression of Oxidoreductase and Halohydrin Dehalogenase
CA2697038C (en) Process for the enantioselective enzymatic reduction of intermediates
US10294479B2 (en) Candida carbonyl reductase and method for preparing (R)-lipoic acid precursor
Ménil et al. Tuning of the enzyme ratio in a neutral redox convergent cascade: A key approach for an efficient one‐pot/two‐step biocatalytic whole‐cell system
WO2014209230A1 (en) Preparation of enantiopure vicinal diols and alpha-hydroxyketones from racemic and meso-epoxides by tandem biocatalysis via enantioselective hydrolysis and oxidations
Wang et al. An enoate reductase Achr-OYE4 from Achromobacter sp. JA81: characterization and application in asymmetric bioreduction of C= C bonds
JP2016515399A (en) Designer cells for enantioselective reduction of ketones and their use in the efficient production of enantiomerically enriched alcohols
Kim et al. Construction of an engineered biocatalyst system for the production of medium‐chain α, ω‐dicarboxylic acids from medium‐chain ω‐hydroxycarboxylic acids
Velasco-Lozano et al. Hydrolysis and oxidation of racemic esters into prochiral ketones catalyzed by a consortium of immobilized enzymes
WO2014189469A1 (en) Production of enantiopure carboxylic acids from alkenes by cascade biocatalysis
CA2753634C (en) Process for the stereoselective enzymatic reduction of keto compounds
Borowiecki et al. Biocatalytic hydrogen-transfer to access enantiomerically pure proxyphylline, xanthinol, and diprophylline
EP2054510A2 (en) Enantioselective representation of aliphatic acyclic esters and ketones

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14816721

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14816721

Country of ref document: EP

Kind code of ref document: A1