WO2014209105A1

WO2014209105A1 - Taqman genotyping assays for the screening of common beta thalassemia mutations in malaysian malays

Info

Publication number: WO2014209105A1
Application number: PCT/MY2014/000203
Authority: WO
Inventors: Chua Kek HENG; Mary Anne TAN JIN AI
Original assignee: University Of Malaya
Priority date: 2013-06-24
Filing date: 2014-06-19
Publication date: 2014-12-31
Also published as: MY165829A

Abstract

The present invention discloses a rapid, sensitive and cost-effective in-house TaqMan genotyping assay for the screening of common β-thalassemia mutations in the Malaysian Malays. The present invention comprises of four sets of forward and reverse primers for DNA amplification of the five common β-thalassemia mutations in Malaysian Malays and five sets of normal and mutant probes. The probes were designed with minor groove binder (MGB) and non-fluorescent quencher (NFQ) at the 3' end, whereas the 5' end contains fluorescence reporter dyes selected from the group of 2-chloro-7-phenyl-l,4-dichloro-6-carboxyfluorescein (VIC), 6- carboxyfluorescein (FAM) or the like.

Description

TAQMAN GENOTYPING ASSAYS FOR THE SCREENING OF COMMON BETA THALASSEMIA MUTATIONS IN MALAYSIAN MALAYS

INCORPORATION OF SEQUENCE LISTING

A paper copy of the Sequence Listing and a computer readable form of the sequence containing the file named "PIC557_UM574.txt", which is 4,096 bytes in size on disk (as measured in Microsoft Windows 7), are provided herein and are herein incorporated by reference. This Sequence Listing consists of SEQ ID NO: 1 - 18. FIELD OF THE INVENTION

The present invention provides a convenient assay for high throughput molecular confirmation of 5 common β-thalassemia mutations in Malaysia Malays. More specifically, the present invention relates to an in-house TaqMan genotyping assay for screening the mutations in a target nucleic acid which is cost and time-effective with high sensitivity and specificity for characterization of β-thalassemia mutations in the Malaysian Malay ethnic group.

BACKGROUND OF THE INVENTION

Malaysia is a multi-racial country with a population of 28.6 million. The Malays form the largest ethnic group and make up around 65% of the population, β-thalassemia is a public health problem in Malaysia and approximately 4.5% of the Malays and Chinese are β-thalassemia carriers (George et al, 2010). Beta-thalassemia is mainly caused by point mutations and small deletions which lead to reduced (β+) or absence (β°) of β-globin chain synthesis. Beta-thalassemia major patients are unable to survive into adulthood without life-long monthly blood transfusions and iron chelation therapies (Weatherall et al, 2001).

Since 1990, the amplification refractory mutation system (ARMS) has been widely used in β-thalassemia mutation detection using primers that are complementary to the normal and mutant DNA sequences (Old et al, 1990). Although this technique is sensitive in mutation detection, ARMS can be time-consuming due to the many assays that need to be carried out for detection of different mutations. Restriction fragment length polymorphism and reverse dot-blot hybridization have also been used in mutation characterization, but these techniques can also be time-consuming (Settin et al, 2006, da Silveira et al, 201 1 ). Another approach, quantitative real-time PCR (qPCR) using saturated dye coupled with high resolution melt-curve analysis has been used for characterization of thalassemia mutations (Pomprasert et al, 2008, Quek et al, 2007). However, different mutations may produce similar melting curves or very small differences in melting temperatures that lead to ambiguous results. Probe-based assays coupled with melting curve analysis are still necessary to deliver results with superior accuracy (Liu et al, 2010, Xiong et ai, 201 1).

Rapid and accurate molecular assays are essential for characterization of β- thalassemia mutations in affected families. Sensitive and specific prenatal diagnosis allows couples at risk of producing a β-thalassemia major child to make informed decisions with regard to affected pregnancies. The present invention provides five genotyping assays targeting the common β-thalassemia mutations in the Malaysian Malays which are IVS l- 1 (HBB:c.92+l G>T), IVS1 -5 (HBB:c.92+5G>C), CD41/42 (HBB:c. l27_130delCTTT), Poly A (HBB:c.*+l 12A>G) and CD26 (HBB:c.79G>A) by using TaqMan probes. These the mutations are responsible for 81% of β- thalassemia in this ethnic group.

The present invention is highly needed to develop a rapid, sensitive and cost-effective approach for characterization of β-thalassemia mutations using custom-made TaqMan genotyping as the selected platform. SUMMARY

An object of the present invention is to provide a novel TaqMan genotyping assay for the screening of five common β-thalassemia mutations in the Malaysian Malays ethnic group. The assay according to the present invention provides five genotyping assays targeting the common β-thalassemia mutations in the Malaysian Malays which are IVS l -1 (HBB:c.92+l G>T), IVS1 -5 (HBB:c.92+5G>C), CD41/42 (HBB:c. l27_130delCTTT), Poly A (HBB:c.*+l 12A>G) and CD26 (HBB:c.79G>A). These mutations are responsible for 81% of β-thalassemia in this ethnic group. Another object of the present invention is to provide the use of a combination of 4 nucleotide fragment pair comprising base sequence represented by the following sequences (SEQ ID NO: 1) and (SEQ ID NO: 8) or the base sequence complementary thereto for DNA amplification of the five common β-thalassaemia mutations in the Malaysian Malays comprising the following nucleotide fragments: ' -GGTGAACGTGGATGAAGTTGGT-3 ' (SEQ ID NO: 1) ' -GCCC AGTTTCTATTGGTCTCCTTAA-3 ' (SEQ ID NO: 2) ' -GCTGGTGGTCTACCCTTGGA-3 ' (SEQ ID NO: 3) ' - ACAGC ATC AGGAGTGGAC AGATC-3 ' (SEQ ID NO: 4) ' -GGGCCTTGAGCATCTGGATT-3 ' (SEQ ID NO: 5) '-CCCACATTCCCTTTTTAGTAAAATATTCAGAAATAAT-3' (SEQ ID NO: 6) ' -GC AAGGTGAACGTGGATG AA-3 ' (SEQ ID NO: 7) '-GTCTCCTTAAACCTGTCTTGTAACCT-3' (SEQ ID NO: 8)

A further object of the present invention is to provide 5 sets of TaqMan genotyping assays probes to allow precise hybridization with the normal and mutant DNA sequences of the five common β-thalassemia mutations in the Malaysian Malays. The probes were designed with minor groove binder (MGB) and non-fluorescent quencher (NFQ) at the 3' end, whereas the 5' end contained the fluorescence reporter dyes. The fluorescence reporter dyes (FRD) used in the present invention is selected from the group of 2-chloro-7-phenyl-l ,4-dichloro-6-carboxyfluorescein (VIC), 6- carboxyfluorescein (FAM) or the like. In the preferably embodiment, VIC fluorescence reporter dyes (FRD) is used in normal DNA sequence detection probes and FAM fluorescence reporter dyes (FRD) is used in mutant DNA sequence detection probes.

In the specific embodiment, the normal and mutant probes for TaqMan genotyping of the five common β-thalassaemia mutations in Malaysian Malays comprise the following DNA sequences: 5'-FRD-CTGGGCAGGTTGGTAT-MGB-NFQ-3' (SEQ ID NO: 9) 5 '-FRD-CTGGGCAGTTTGGTAT-MGB-NFQ-3 ' (SEQ ID NO: 10) 5 ' -FRD-C AGGTTGGTATC AAGG-MGB-NFQ-3 ' (SEQ ID NO: 1 1 ) 5 ' -FRD-CAGGTTGCTATC AAGG-MGB-NFQ-3 ' (SEQ ID NO: 12)

5 '-FRD-CCAGAGGTTCTTTGAGTC-MGB-NFQ-3 ' (SEQ ID NO: 13)

5'-FRD-CAGAGGTTGAGTCCT-MGB-NFQ-3' (SEQ ID NO: 14) 5 ' -FRD-TGCCTAATA AAAAAC A-MGB-NFQ-3 ' (SEQ ID NO: 15) 5'-FRD-CTGCCTAATAGAAAACA-MGB-NFQ-3' (SEQ ID NO: 16) 5'-FRD-TGGTGGTGAGGCCCT-MGB-NFQ-3' (SEQ ID NO: 17) 5 ' -FRD-TTGGTGGTAAGGCCCT-MGB-NFQ-3 ' (SEQ ID NO: 18)

Wherein FRD representing the fluorescence reporter dyes selected from the group of 2-chloro-7-pheny 1- 1 ,4-dichloro-6-carboxyfluorescein (VIC), 6-carboxyfluorescein (FAM) or the like.

A further object of the present invention is to provide a method to detect the β- thalassemia mutations in Malaysian Malays by using a combination of 4 nucleotide fragment pair comprising base sequence represented by the following sequences (SEQ ID NO: 1 ) and (SEQ ID NO: 8) or the base sequence complementary for DNA amplification of the five common β-thalassaemia mutations in the Malaysian Malays and 5 sets of TaqMan genotyping assays probes sequence represented by the following sequences (SEQ ID NO: 9) and (SEQ ID NO: 18) to allow precise hybridization with the normal and mutant DNA sequences of the five common β- thalassemia mutations in Malaysian Malays.

A further object, features and advantages of the present invention will be readily apparent from the following description.

BRIEF DESCRIPTION OF THE DRAWING/FIGURES

The accompanying drawings, which are included to provide a further understanding of the present invention are incorporated in and constitute a part of this specification, illustrate embodiments of the invention, and together with the description serve to explain the principles of the present invention.

Figure 1 shows the binding of primers and probes on the DNA template for detection of IVS l-1 (G-T). (a) Normal probe of IVSl-1 and primer hybridized to the DNA template. Fluorescence signal is released from the VIC dye when cleaved by Taq DNA polymerase, (b) Mutant probe of IVSl-1 and primer hybridized to the DNA template. Fluorescence signal is released from the FAM dye when cleaved by Taq DNA polymerase.

Figure 2 shows the allelic discrimination plots of TaqMan genotyping assays for the five β-thalassemia mutations; normal allele at x-axis and mutant allele at y-axis. Black dots indicate no amplification (non-template PCR control), red dots indicate individuals negative for the mutation, green dots indicate individuals heterozygous for the mutation and blue dots indicate individuals homozygous for the mutation, (a) IVS l -1. (b) IVS 1 -5. (c) CD41/42. (d) Poly A. (e) CD26 (HbE).

Figure 3 shows the scatter plots of TaqMan genotyping assays for the 5 mutations with VIC dye fluorescence at x-axis and FAM dye fluorescence at y-axis. Squares indicate controls, (a) IVSl -1 , (b) IVS 1 -5, (c) CD41/42 and (d) CD26 (HbE), red dots indicate individuals who do not possess the specific mutation, green dots indicate carriers and blue dots indicate individuals homozygous for the mutations; (e) Poly A, blue dots indicate individuals who do not possess the Poly A mutation and green dots indicate carriers.

DETAIL DESCRIPTION OF THE PRESENT INVENTION

In the following detailed description, reference is made to various specific embodiments in which the present invention may be practiced. These embodiments are described with sufficient detail to enable those methods in the present invention to be practice, and it is to be understood that other embodiments may be employed and that structural and logical changes may be made without departing from the spirit or scope of the present invention. In general, the present invention disclosed an in-house TaqMan genotyping assay targeting the common β-thalassemia mutations in the Malaysian Malay population which are IVS l -1 (HBB:c.92+l G>T), IVS1 -5 (HBB:c.92+5G>C), CD41/42 (HBB:c. l27_130delCTTT), Poly A (HBB:c.*+l 12A>G) and CD26 (HBB:c.79G>A) mutations. The present invention is able to help in screening the common β- thalassemia mutations in the Malaysian Malays in an effective way.

In another embodiment of the present invention, the present invention disclosed a use of five TaqMan genotyping assays combination to detect the five common β- thalassemia mutations in Malaysian Malays. The assays are different from those assays developed in other countries due to the different mutations in the Malaysian population. In the assays according to the present invention, similar forward and reverse primer sequences represented by the sequences (SEQ ID NO: 1 ) and (SEQ ID NO: 2) or the base sequence complementary thereto are used in the IVS l-1 and IVS1 - 5 genotyping assays as the location of both mutations are very close to each other. Primer sequences represented by sequence (SEQ ID NO: 1) is the forward primer sequence for DNA amplification of IVSl-1 and IVS 1 -5 mutations and primer sequences represented by sequence (SEQ ID NO: 2) is the reverse primer sequence for DNA amplification of I VS 1 - 1 and IVS 1 -5 mutations.

Different primer pairs are designed and used for the amplification of CD41/42, Poly A and CD26 mutations. Primer sequences represented by the sequences (SEQ ID NO: 3) and (SEQ ID NO: 4) or the base sequence complementary thereto are used for the amplification of CD41/42 mutation. In detail, primer sequence represented by sequence (SEQ ID NO: 3) is the forward primer sequence for DNA amplification of CD41/42 mutation and primer sequence represented by sequence (SEQ ID NO: 4) is the reverse primer sequence for DNA amplification of CD41/42 mutation. Primer sequences represented by the sequences (SEQ ID NO: 5) and (SEQ ID NO: 6) or the base sequence complementary thereto are used for the amplification of the Poly A mutation. In detail, primer sequences represented by sequence (SEQ ID NO: 5) is the forward primer sequence for DNA amplification of the Poly A mutation and primer sequences represented by sequence (SEQ ID NO: 6) is the reverse primer sequence for DNA amplification of the Poly A mutation. Primer sequences represented by the sequences (SEQ ID NO: 7) and (SEQ ID NO: 8) or the base sequence complementary thereto are used for the amplification of the CD26 mutation. In detail, primer sequences represented by sequence (SEQ ID NO: 7) is the forward primer sequence for DNA amplification of the CD26 mutation and primer sequences represented by sequence (SEQ ID NO: 8) is the reverse primer sequence for DNA amplification of the CD26 mutation.

In yet another embodiment of the present invention, specific probes are designed for each mutation to allow precise hybridization with the normal and mutant DNA sequences. The probes are specifically designed with lower annealing temperatures compared with the primers to allow probe binding before primer binding. The 3' end of the probes contained the non-fluorescent quencher (NFQ) which quenched the fluorescence dye at the 5' end. In addition, the probes are particularly designed with a minor groove binder (MGB) at the 3' end which fitted into the minor groove of duplex DNA. This additional feature in the probe construction allows enhanced stabilization during probe annealing (Kutyavin et al., 2000).

The fluorescence dye attached to the 5' end of the probes is the reporter dye preferably selected from the group of 2'-chloro-7'-phenyl-l ,4-dichloro-6-carboxyfluorescein (VIC), 6-carboxyfluorescein (FAM) or any other fluorescence reporter dye with the same function. In one specific embodiment according to the present invention, for normal probes, the 5' end of the probes is covalently attached with VIC dye, whereas, for mutant probes, the 5' end of the probes is covalently attached with FAM dye. The VIC fluorescence dye will release the green signal and FAM fluorescence dye will release blue signal when cleaved by Taq DNA polymerase. The VIC fluorescence dye and FAM fluorescence dye used in the present invention are only to further illustrate the fluorescence reporter dyes function in greater detail and not by way of limitation. The fluorescence reporter dyes may be replaced with any other fluorescence dye with the same function.

Probes with DNA sequences represented by the sequences (SEQ ID NO: 9) and (SEQ ID NO: 10) are used for the hybridization with the normal and mutant DNA sequences of I VS 1 -1. In detail, probe with DNA sequences represented by sequence (SEQ ID NO: 9) is the normal probe for IVS l-1 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probe is covalently attached with VIC dye. Probe with DNA sequence represented by sequence (SEQ ID NO: 10) is the mutant probe for IVSl -1 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probes is covalently attached with FAM dye.

Probes with DNA sequence represented by the sequences (SEQ ID NO: 1 1 ) and (SEQ ID NO: 12) are used for the hybridization with the normal and mutant DNA sequences of IVS 1 -5. In detail, probe with DNA sequence represented by sequence (SEQ ID NO: 1 1 ) is the normal probe for IVS1 -5 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probe is covalently attached with VIC dye. Probe with DNA sequence represented by sequence (SEQ ID NO: 12) is the mutant probe for IVS1 -5 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probes is covalently attached with FAM dye.

Probes with DNA sequences represented by the sequences (SEQ ID NO: 13) and (SEQ ID NO: 14) are used for the hybridization with the normal and mutant DNA sequences of CD41/42. In detail, probe with DNA sequence represented by sequence (SEQ ID NO: 13) is the normal probe for CD41/42 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probe is covalently attached with VIC dye. Probe with DNA sequence represented by sequence (SEQ ID NO: 14) is the mutant probe for CD41/42 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probes is covalently attached with FAM dye. Probes with DNA sequences represented by the sequences (SEQ ID NO: 15) and (SEQ ID NO: 16) are used for the hybridization with the normal and mutant DNA sequences of Poly A. In detail, probe with DNA sequence represented by sequence (SEQ ID NO: 15) is the normal probe for Poly A mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probe is covalently attached with VIC dye. Probe with DNA sequence represented by sequence (SEQ ID NO: 16) is the mutant probe for Poly A mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probes is covalently attached with FAM dye. Probes with DNA sequences represented by the sequences (SEQ ID NO: 17) and (SEQ ID NO: 18) are used for the hybridization with the normal and mutant DNA sequences of CD26. In detail, probe with DNA sequence represented by sequence (SEQ ID NO: 17) is the normal probe for CD26 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probe is covalently attached with VIC dye. Probe with DNA sequence represented by sequence (SEQ ID NO: 18) is the mutant probe for CD26 mutation, the 3' end of the probe is covalently attached with MGB-NFQ and the 5' end of the probes is covalently attached with FAM dye.

Figure 1 shows the binding of the primers and probes using IVS l -1 mutation as an example. The final step in the TaqMan genotyping assay involves the cleaving of the probe by Taq DNA polymerase followed by release of the fluorescent signal by the fluorescent dye. With reference to figure 1 (a), the normal probe of I VS 1 -1 (SEQ ID NO: 9) and primer hybridized to the DNA template. Fluorescence signal is released from VIC dye when cleaved by Taq DNA polymerase. With reference to figure 1 (b), the mutant probe of IVS l -1 (SEQ ID NO: 10) and primer hybridized to the DNA template. Fluorescence signal is released from FAM dye when cleaved by Taq DNA polymerase.

To further illustrate the present invention in greater detail and not by way of limitation, the following examples will be given. EXAMPLE

TaqMan Genotyping Materials

TaqMan GTXpress™ Master Mix which contains PCR buffer, AmpliTaq Gold DNA Polymerase, deoxyrinucleotides triphosphates (dNTPs) and 6-carboxy-X-rhodamine (ROX) passive reference dye were purchased from Applied Biosystems (Foster City, CA, USA). TaqMan genotyping assays were specifically customized to detect the five common β-thalassemia mutations in Malaysian Malays. Initially, the β-globin gene sequence was obtained from GenBank, followed by thorough primer and probe design using the Primer Express software. The primer sequences constructed were further tested using in silico PCR to ensure that they were targeted to the exact loci (Chua et al, 201 1 , Ng et ah, 2012). The TaqMan genotyping assay (40X) contained 36 μΜ forward primer, 36 μΜ reverse primer and two probes (8 μΜ for each probe). The forward and reverse primers represented by the sequences (SEQ ID NO: 1) to (SEQ ID NO: 8) were designed to specifically amplify the regions where the mutations are located as shown in Table 1. Two probes were designed for each mutation which is one for hybridization to the normal DNA sequence and the second probe for hybridization to DNA with the mutation. The present invention aims to detect five mutations, thus, 10 probes represented by the sequences (SEQ ID NO: 9) to (SEQ ID NO: 18) were designed and listed in Table 2. As indicated in Table 2, the sequence differences between normal and mutant probes are underlined.

Table 1

Amplicon

Mutation Forward primer sequence (5'-3") Reverse primer sequence(5'-3') size (bp)

IVS1-1

(G-η GGTGAACGTGGATGAAGTTGGT GCCCAGTTTCTATTGGTCTCCTTAA

90

IVS1-5 (SEQ ID NO: 1) (SEQ ID NO: 2)

(G-C)

CD41/42 GCTGGTGGTCTACCCTTGGA ACAGCATCAGGAGTGGACAGATC

69

(-CTTT) (SEQ ID NO: 3) (SEQ ID NO: 4)

CCCACATTCCC I 1 1 1 1 AGTAAAATATTCAGA/¹

Poly A GGGCCTTGAGCATCTGGATT

96 AAT

(A-G) (SEQ ID NO: 5)

(SEQ ID NO: 6)

CD26 (HbE) GCAAGGTGAACGTGGATGAA GTCTCCTTAAACCTGTCTTGTAACCT

79

(G-A) (SEQ ID NO: 7) (SEQ ID NO: 8) Table 2

Mutation Normal probe (5'-3') Mutant probe (5'-3')

IVS1-1 VIC-CTGGGCAGGTTGGTAT-MGB-NFQ FAM-CTGGGCAGTTTGGTAT-MGB-NFQ

(G-T) (SEQ ID NO: 9) (SEQ ID NO: 10)

IVS1-5 VIC-CAGGTTGGTATCAAGG-MGB-NFQ FAM-CAGGTTGCTATCAAGG- GB-NFQ

(G-C) (SEQ ID NO: 11) (SEQ ID NO: 12)

CD41/42 VIC-CCAGAGGTTCTTTGAGTC-MGB-NFQ FAM-CAGAGGTTGAGTCCT-MGB-NFQ

(-CTT7) (SEQ ID NO: 13) (SEQ ID NO: 14)

Poly A VIC-TGCCTAATAAAAAACA-MGB-NFQ FA -CTGCCTAATAGAAAACA-MGB-NFQ

(A-G) (SEQ ID NO: 15) (SEQ ID NO: 16)

CD26 (HbE) VIC-TGGTGGTGAGGCCCT-MGB-NFQ FAM-TTGGTGGTAAGGCCCT-MGB-NFQ

(G-A) (SEQ ID NO: 17) (SEQ ID NO: 18)

DNA Extraction

Blood samples were obtained from β-thalassemia major patients (n = 21 ), β- thalassemia carriers (n = 74) and normal individuals (n = 25) with written consent. This study was approved by the Medical Ethics Committee of University Malaya Medical Centre in accordance with the Declaration of Helsinki. Human genomic DNA was extracted from blood samples using a simplified phenol-chloroform method (Tan et al, 2010). The DNA samples were diluted to 20 ng/μΐ-. and used as templates for qPCR. DNA containing the five β-globin gene mutations used for development of the TaqMan genotyping assays was previously characterized by established techniques— ARMS, RFLP, gap-PCR and genomic sequencing.

Development of TaqMan Genotyping Assays

Ninety-five characterized DNA and 25 normal control DNA samples were used in the assay development. The list of DNA samples from individuals who are compound heterozygous, homozygous and heterozygous for β-thalassemia are shown in Table 3. Table 3

Compound Heterozygotes Homozygotes Heterozygotes

Mutation Number Mutation Number Mutation

Number

IVSl -1 and CD26 2 IVSl-1 1 IVSl-1 8

IVSl-1 and CD41/42 1 IVS1-5 2 IVS1-5 19

IVS1-5 and CD26 1 CD41/42 10 CD41/42 19

CD41/42 and CD26 1 CD26 2 Poly A 8

CD41/42 and Poly A 1 CD26 20

Total 6 15 74 Real-time PCR was performed in a real-time thermal cycler (Applied Biosystems 7500 Fast). Cycling conditions involved an initial cycle at 95 °C (20 seconds), followed by 40 cycles of denaturation at 95 °C (3 seconds) and annealing and extension at 60 °C (30 seconds). The final reaction mixture was 10 which consists of 5 TaqMan GTXpress™ Master Mix, 0.5 TaqMan genotyping assay (20X), 1 μΙ DNA sample and 3.5 μί double distilled water.

Evaluation of TaqMan Genotyping Assays

Validation was carried out using 219 "blinded" DNA samples in order to determine the sensitivity and specificity of the TaqMan genotyping assays. The 219 "blinded" DNA samples were from 35 normal individuals and 184 previously characterized β- thalassemia patients.

Results

The accuracy of the newly designed TaqMan genotyping assays for β-thalassemia was assessed using 120 previously characterized DNA samples. The results were analyzed from the allelic discrimination plots generated by the 7500 Software v2.0.6 (Applied Biosystems, Figure 2). The allelic discrimination plot for a particular mutation will show four regions which indicate no amplification (non-template PCR control), individuals without the specific mutation, individuals heterozygous for the mutation or individuals homozygous for the mutation. The developed TaqMan genotyping assays were able to successfully characterize the β-thalassemia mutations in all the 120 known DNA samples. Figure 2 explains the allelic discrimination plots of TaqMan genotyping assays for the five β-thalassemia mutations; normal allele at x-axis and mutant allele at y-axis. Black dots indicate no amplification (non-template PCR control), red dots indicate individuals negative for the mutation, green dots indicate individuals heterozygous for the mutation and blue dots indicate individuals homozygous for the mutation. The five β-thalassemia mutations are indicated by the reference letter (a) IVS l -1 ; (b) IVS 1 -5; (c) CD41/42; (d) Poly A and (e) CD26 (HbE).

Evaluation of the TaqMan Genotyping Assays

The in-house designed assays were evaluated by carrying out qPCR using 219 "blinded" previously characterized DNA samples. The results obtained were analyzed using the TaqMan Genotyper Software vl .2 (Applied Biosystems). Characterized DNA samples were used as controls for each assay. The fluorescent signals for each of the five β-thalassemia mutations were plotted in the scatter plot as indicated in Figure 3. The results showed 100% concordance with results previously obtained using the established ARMS technique. This clearly indicates that the newly designed TaqMan genotyping assays produce 100% sensitivity and specificity for the five common Malay β-thalassemia mutations. Figure 3 shows the scatter plots of TaqMan genotyping assays for the 5 mutations with VIC dye fluorescence at x-axis and FAM dye fluorescence at y-axis. Squares indicated controls. For the four β-thalassemia mutations indicated by the reference letter (a) IVS l -1 ; (b) IVS 1 -5; (c) CD41/42 and (d) CD26 (HbE), the red dots indicate individuals who do not possess the specific mutation, green dots indicate carriers and blue dots indicate individuals homozygous for the mutation; (e) Poly A, blue dots indicate individuals who do not possess the Poly A mutation and green dots indicate carriers.

In summary, the TaqMan genotyping assays according to the present invention only require a single qPCR to differentiate between normal, carriers and individuals homozygous for a mutation, whereas ARMS requires two reactions - DNA amplification for normal sequence and another reaction for mutant sequence. Thus, ARMS is more time-consuming and even though multiplex-ARMS has been developed, this assay has its limitation of non-specificity. Since 1 μί of DNA with concentration of 20 ngl iL is required in qPCR, whereas 1 iL of DNA with concentration of 1 ng/^L is required in ARMS, qPCR using TaqMan genotyping assay is a more valuable assay for prenatal diagnosis and preimplantation diagnosis. The rapidity and cost-effectiveness of the TaqMan genotyping assays according to the present invention will also allow for high throughput screening of β-thalassemia mutations in Malaysia and Southeast Asia where a similar spectrum of mutations is present.

Conclusions

Five TaqMan genotyping assays which allow rapid confirmation of common thalassemia in Malaysian Malays were developed in the present invention. The assays showed 100% sensitivity and specificity. This assay system is reproducible and time- effective. Large-scale β-thalassemia mutation screening together with genetic counseling will certainly lead to a reduction in the birth of β-thalassemia major children.

List of references

George, E.; Tan, J.A.M.A. Genotype-phenotype diversity of beta-thalassemia in Malaysia: Treatment options and emerging therapies. Med. J. Malays. 2010, 65, 256- 260.

Weatherall, D.J.; Clegg, J.B. The Thalassemia Syndromes, 4th ed.; Blackwell Scientific: Oxford, UK, 2001.

Old, J.M.; Varawalla, N.Y.; Weatherall, D.J. Rapid detection and prenatal diagnosis of beta-Thalassemia: Studies in Indian and Cypriot populations in the UK. Lancet 1990, 336, 834-837.

Settin, A.A.; Al-Haggar, M.M.; Neamatallah, M.; A-Said, A.M.; Hafez, M.M. Detection of beta-thalassemia mutations using primer-specific amplification compared to reversed dot blot hybridization techniques in Egyptian cases. Haema 2006, 9, 401^109. da Silveira, Z.M.; das Vitorias, B.M.; de Medeiros, F.T.A.; imura, E.M.; Costa, F.F.; de Fatima, S.M.; Rebecchi, I.M.; de Medeiros, T.M. Characterization of beta- thalassemia mutations in patients from the state of Rio Grande do Norte, Brazil. Genet. Mol. Biol. 201 1 , 34, 425-428.

Pornprasert, S.; Phusua, A.; Suanta, S.; Saetung, R.; Sanguansermsri, T. Detection of alpha-Thalassemia-1 Southeast Asian type using real-time gap-PCR with SYBR Green 1 and high resolution melting analysis. Eur. J. Haematol. 2008, 80, 510-514.

Quek, D.L.; Ng, Y.Y.; Wang, W.; Tan, A.S.C.; Tang-Lim, G.I.; Ng, I.S.L.; Law, H.Y.; Chong, S.S. Rapid carrier screening for β-thalassemia by single-step allele-specific PCR and detection. Clin. Biochem. 2007, 40, 427^30.

Liu, X.; Law, H.Y.; Tan, Y.M.; Hong, Y. High-throughput beta-thalassemia carrier screening by allele-specific Q-primer real-time polymerase chain reaction. Anal. Biochem. 2010, 404, 97-99.

Xiong, F.; Huang, Q.; Chen, X.; Zhou, Y.; Zhang, X.; Cai, R.; Chen, Y.; Xie, J.; Feng, S.; Wei, X.; Xiao, Q.; Zhang, T.; Luo, S.; Yang, X.; Hao, Y.; Qu, Y.; Li, Q.; Xu, X. A melting curve analysis— based PCR assay for one-step genotyping of β-thalassemia mutations a multicenter validation. J. Mol. Diagn. 201 1 , 13, MI-MS.

Kutyavin, I.V.; Afonina, I.A.; Mills, A.; Gorn, V.V.; Luk tanov, E.A.; Belousov, E.S.; Singer, M.J.; Walburger, D. .; Lokhov, S.G.; Gall, A.A.; et al. 3'-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000, 28, 655-661. Chua, .H.; Puah, S.M.; Chew, C.H.; Wong, C.H.; Goh, K.L. Interaction between a novel intronic IVS3+172 variant and N29I mutation in PRSS l gene is associated with pancreatitis in a Malaysian Chinese family. Pancreatology 201 1 , 1 1 , 441^144. Ng, Z.X.; Kuppusamy, U.R.; Tajunisah, I.; Fong, .C.; Koay, A.C.; Chua, K.H. 2245 G/A polymorphism of the receptor for advanced glycation end-products (RAGE) gene is associated with diabetic retinopathy in the Malaysian population. Br. J. Ophthalmol. 2012, 96, 289-292. Tan, J.A.M.A.; Lee, P.C.; Wee, Y.C.; Tan, K.L.; Mahali, N.F.; George, E.; Chua, K.H. High prevalence of alpha and beta-thalassemia in the kadazandusuns in east malaysia: Challenges in providing effective health care for an indigenous group. J. Biomed. Biotechnol. 2010, doi: 10.1 155/2010/706872.

Claims

We claim:

1. A novel TaqMan genotyping assay for the screening of five common β- thalassemia mutations in Malaysian Malays ethnic group consisting of 4 pairs of primers comprising base sequence represented by sequences (SEQ ID NO: 1 ) to (SEQ ID NO: 8) or the base sequence complementary thereto and 5 pairs of probes comprising DNA sequences represented by the sequences (SEQ ID NO: 9) to (SEQ ID NO: 18).

2. The assay according to claim 1 , wherein the five common β-thalassemia mutations in Malaysian Malays ethnic group is selected from the group of IVS l -1 (HBB:c.92+l G>T), IVS1 -5 (HBB:c.92+5G>C), CD41/42 (HBB:c. l 27_130delCTTT), Poly A (HBB:c.*+l 12A>G) and CD26 (HBB:c.79G>A).

3. The assay according to claim 1 , wherein the 4 pairs of primers are used for DNA amplification of the five common β-Thalassaemia mutations in the Malaysian Malay ethnic group.

4. The assay according to claim 1 , wherein the 5 pairs of probes are used for precise hybridization with the normal and mutant DNA sequences of the five common β-Thalassaemia mutations in the Malaysian Malay ethnic group.

5. The assay according to claim 1 , wherein the 5 pairs of probes comprising minor groove binder (MGB) and non-fluorescent quencher (NFQ) at the 3' end and a fluorescence reporter dyes (FRD) at the 5' end.

6. The assay according to claim 5, wherein the fluorescence reporter dyes is selected from the group of 2-chloro-7-phenyl-l ,4-dichloro-6- carboxyfluorescein (VIC), 6-carboxyfluorescein (FAM) or the like.

7. Use of 4 pairs of primers comprising base sequence represented by sequences (SEQ ID NO: 1) to (SEQ ID NO: 8) or the base sequence complementary thereto and 5 pairs of probes comprising DNA sequences represented by the sequences (SEQ ID NO: 9) to (SEQ ID NO: 18) for detection of five common β-thalassemia mutations in Malaysian Malays ethnic group.

8. The use according to claim 6, wherein the five common β-thalassemia mutations in Malaysian Malay ethnic group is selected from the group of IVS l-1 (HBB:c.92+l G>T), IVS 1 -5 (HBB:c.92+5G>C), CD41/42 (HBB:c. l 27_130delCTTT), Poly A (HBB:c.*+l 12A>G) and CD26 (HBB:c.79G>A).

9. The use according to claim 7, wherein the 5 pairs of probes comprising minor groove binder (MGB) and non-fluorescent quencher (NFQ) at the 3' end and a fluorescence reporter dyes (FRD) at the 5' end.

10. The use according to claim 9, wherein the fluorescence reporter dyes is selected from the group of 2-chloro-7-phenyl-l ,4-dichloro-6- carboxyfluorescein (VIC), 6-carboxyfluorescein (FAM) or the like.

1 1. The use according to claim 6, wherein the primer sequences represented by the sequences (SEQ ID NO: 1 ) is the forward primer sequence and the sequences (SEQ ID NO: 2) is the reverse primer sequence used for the amplification of IVS l -1 and IVS1 -5 mutations; wherein the primer sequences represented by the sequences (SEQ ID NO: 3) is the forward primer sequence and the sequences (SEQ ID NO: 4) is the reverse primer sequence used for the amplification of CD41/42 mutation; wherein the primer sequences represented by the sequences (SEQ ID NO: 5) is the forward primer sequence and the sequences (SEQ ID NO: 6) is the reverse primer sequence used for the amplification of Poly A mutation; and wherein the primer sequences represented by the sequences (SEQ ID NO: 7) is the forward primer sequence and the sequences (SEQ ID NO: 8) is the reverse primer sequence used for the amplification of CD26 mutation.

12. The use according to claim 6, wherein the probes with DNA sequences represented by the sequences (SEQ ID NO: 9) and (SEQ ID NO: 10) are used for the hybridization with the normal and mutant DNA sequences of IVSl -1 respectively; wherein the probes with DNA sequences represented by the sequences (SEQ ID NO: 1 1 ) and (SEQ ID NO: 12) are used for the hybridization with the normal and mutant DNA sequences of IVS1-5 respectively; wherein the probes with DNA sequences represented by the sequences (SEQ ID NO: 13) and (SEQ ID NO: 14) are used for the hybridization with the normal and mutant DNA sequences of CD41/42 respectively; wherein the probes with DNA sequences represented by the sequences (SEQ ID NO: 15) and (SEQ ID NO: 16) are used for the hybridization with the normal and mutant DNA sequences of Poly A respectively; and wherein the probes with DNA sequences represented by the sequences (SEQ ID NO: 17) and (SEQ ID NO: 18) are used for the hybridization with the normal and mutant DNA sequences of CD26 respectively.