WO2014205597A1

WO2014205597A1 - Transporter hkt2 with high affinity for potassium ions and which is derived from cotton and the coding gene and use thereof

Info

Publication number: WO2014205597A1
Application number: PCT/CN2013/000750
Authority: WO
Inventors: 崔洪志; 王建胜; 王君丹; 刘捷
Original assignee: 创世纪转基因技术有限公司
Priority date: 2013-06-24
Filing date: 2013-06-24
Publication date: 2014-12-31
Also published as: CN105189535A

Abstract

Disclosed in the present invention are a transporter HKT2 with a high affinity for potassium ions and which is derived from cotton and the coding gene thereof, and the use thereof in cultivating a genetically modified plant with an improved salt tolerance.

Description

Cotton high-affinity potassium ion transporter HKT2 and its coding gene and application

FIELD OF THE INVENTION The present invention relates to plant proteins and their encoding genes and applications, and more particularly to a cotton-derived high affinity potassium ion transporter HKT2 and its encoding gene, and its use in the cultivation of transgenic plants with improved salt tolerance. BACKGROUND OF THE INVENTION Salt stress is one of the most important abiotic stress hazards in agricultural production in the world. Salted soil is usually dominated by sodium salt, calcium salt or magnesium salt, and is a major factor affecting plant growth and causing food and economic crop yield reduction. The world's saline-alkali soil covers an area of about 400 million hectares, accounting for one-third of the irrigated farmland. Saline-alkali land is widely distributed in China, and the existing saline-alkali land area is about 0.4 million hectares. With the increase of population in China and the reduction of cultivated land, the development and utilization of saline-alkali resources has extremely important practical significance. The selection of plant resistance to salt and alkali, drought-tolerant ability and plant species or strains suitable for growth on saline-alkali land with high economic and ecological value is an economical and effective measure to utilize saline-alkali land. For most crops, most plants are poorly tolerant to saline and alkali, and can only grow on soils with a sodium chloride content of 0.3% or less. Excess Na ^{+ in the} soil will be normal to the plant. Growth metabolism produces toxic effects. Therefore, how to increase crop yield in a salted environment has become a very important issue in agricultural production worldwide.

The salt tolerance of plants is a very complex quantitative trait, and its salt tolerance mechanism involves various levels from plants to organs, tissues, physiology and biochemistry to molecules. Scientists from various countries have also done a lot of work for this purpose, and have made a lot of new progress, especially in the use of the model plant Arabidopsis to study the salt-tolerant molecular mechanism of plants, which has made a breakthrough in the research in this field ( Zhu JK. 2002. Salt and drought stress singal transduction in plants. Annu. Rev. Plant Biol. 53 : 1247-1273; Zhang ZL. 201 1. Arabidopsis Floral Initiator SKB 1 Confers High Salt Tolerance by Regulating Transcription and Pre-mRNA Splicing through Altering Histone H4R3 and Small Nuclear Ribonucleoprotein LSM4 Methylation. Plant Cell, 23: 396-41 1). Higher plant cells can sense changes in physicochemical parameters in the external environment through various pathways, thereby transmitting extracellular signals to intracellular signals, and finally transmitting stress signals to the nucleus to activate transcription factors through a series of signal transduction. Activation of the transcription factor acts on the functional gene and initiates the expression of the stress response gene, thereby increasing the tolerance of the plant. Although researchers have conducted a large number of studies from different sides, due to the complexity of its mechanism, many important issues in plant salt resistance remain to be explored. For example, key factors in plant salt resistance have not been found; The molecular mechanism of plant salt tolerance is not well understood. SUMMARY OF THE INVENTION The present inventors cloned a high affinity potassium ion transporter (designated herein as HKT2) encoding gene of cotton using SSH (suppression subtractive hybridization) and RACE (rapid amplification of cDNA ends) and determined Its DNA sequence. Moreover, it was found that the transgenic plants were significantly improved in salt tolerance by transgenic technology and introduced into the plants, and these traits were stably inherited.

The first aspect of the present invention provides a coding gene for a high affinity potassium ion transporter HKT2 of cotton (designated herein as GhHKT2) having the sequence of SEQ ID NO: 2.

A second aspect of the present invention provides a recombinant expression vector comprising the gene of the first aspect of the present invention, which is obtained by inserting the gene into an expression vector, and the nucleotide sequence of the gene The expression control sequence of the recombinant expression vector is operably linked; preferably, the expression vector is pCAMBIA2300 _; preferably, the recombinant expression vector is the 35S-GhHKT2-2300 vector shown in Figure 2.

A third aspect of the invention provides a recombinant cell comprising the gene of the first aspect of the invention or the recombinant expression vector of the second aspect of the invention; preferably, the recombinant cell is a recombinant Agrobacterium cell.

A fourth aspect of the invention provides a method for improving salt tolerance of a plant, comprising: introducing the gene of the first aspect of the invention or the recombinant expression vector of the second aspect of the invention into a plant or plant tissue and expressing the gene Preferably, the plant is Arabidopsis thaliana.

A fifth aspect of the invention provides a method for producing a transgenic plant, comprising: cultivating a plant or plant tissue comprising the gene of the first aspect of the invention or the recombinant expression vector of the second aspect of the invention under conditions effective to produce a plant Preferably, the plant is Arabidopsis thaliana.

A sixth aspect of the present invention provides the gene according to the first aspect of the present invention, the recombinant expression vector of the second aspect of the present invention or the recombinant cell of the third aspect of the present invention for improving salt tolerance of a plant and for use in plant breeding Use; Preferably, the plant is Arabidopsis thaliana.

The seventh aspect of the invention provides the protein encoded by the gene of the first aspect of the invention, the amino acid sequence of which is set forth in SEQ ID NO: 1. DRAWINGS

Figure 1 is a construction flow of the plant expression vector (35S-GhHKT2-2300) of the G 3⁄4r2 gene (Fig. la-lb). Figure 2 is a plasmid map of the plant expression vector (35S-GhHKT2-2300) of the G 3⁄4r2 gene. Fig. 3 is a salt tolerance test result of T1 generation Arabidopsis plants transgenic with GhHKT2 gene, Tlg7 exhibits remarkable salt tolerance, and the results of Tlgll and Tlgl3 are similar thereto, and are not shown here.

Figure 4 shows the results of molecular level detection of the transcription level of GhHKT2 gene in 1\ generation transgenic Arabidopsis plants and non-transgenic control plants by reverse transcription PCR. M is DNA Ladder Marker (DL2000), 1-8 is salt-tolerant T1 transgenic Arabidopsis plants (Tlg7, Tlgll, Tlgl3, respectively), 9 is 35S-GhHKT2-2300 plasmid PCR positive control, 10- 13 is a non-transgenic control Arabidopsis plant. BEST MODE FOR CARRYING OUT THE INVENTION The following examples are provided to facilitate a better understanding of the present invention by those skilled in the art. The examples are for illustrative purposes only and are not intended to limit the scope of the invention.

The unrecognized restriction endonucleases mentioned in the examples below were purchased from New England Biolabs. Example 1. Cotton SSH library construction under salt stress:

The specific method is:

A method according to PCR-select ^TM cDNA Clontech kit Subtraction Kit's instructions shown by suppression subtractive hybridization libraries constructed SSH (suppression subtractive library). The mRNA extracted from the cotton roots treated with salt was used as a sample (Tester) during the experiment, and the mRNA extracted from the untreated cotton root was used as a control. Specific steps are as follows:

(1) Test materials:

African cotton (National Cotton Medium Term Bank, obtained by the China Cotton Research Institute, Uniform No.: ZM-06838) Seeded on sterilized vermiculite, cultured at 25 ° C, light dark cycle 16 h / 8 h, poured 1 per week /2MS liquid medium (containing 9.39 mM KN0 ₃ , 0.625 mM KH2P0 ₄ , 10.3 mM NH ₄ N0 ₃ , 0.75 mMMgS0 ₄ , 1.5 mM CaCl ₂ , 50 μΜΚΙ, 100 μΜΗ ₃ ΒΟ ₃ , 100 MMnSO ₄ , 30 MZnSO ₄ , 1 μΜ Na ₂ Mo0 ₄ , 0.1 MCoCl ₂ , 100 μΜ Na ₂ EDTA, 100 MFeSO ₄ ) — times. It was used for experiments when the seedlings were as long as 25-30 cm.

(2) Material handling:

The test seedlings were divided into 2 groups of 4 plants each. The first group was a control group, cultured at 25 ° C under light, placed in 1/2 MS liquid medium; the second group was treated with 25 ° C, light culture, and placed at a final concentration of 200 mM. Treatment in 1/2 MS liquid medium of NaCl for 6 hours. Cut the two groups in time after processing The roots of the seedlings were quickly frozen with liquid nitrogen and stored in a -70 ° C refrigerator.

(3) Total RNA extraction:

0.5 g of cotton roots of the control and salt-treated groups were taken, and total RNA was extracted using a plant RNA extraction kit (purchased from Invitrogen). The absorbance of total RNA at 260 nm and 280 nm was measured by HITACHI's UV spectrophotometer U-2001. The ratio of OD _26Q / OD _28Q was 1.8-2.0, indicating that the total RNA purity was higher; 1.0% agarose was used for coagulation. Gel electrophoresis detected the integrity of total RNA. The 28S band was approximately twice as bright as the 18S band, indicating good RNA integrity. mRNA was isolated using Qiagen's Oligotex mRNA Purification Kit (purified polyA+ RNA from total RNA).

(4) Suppression of subtractive hybridization:

The method according to Clontech's PCR-select ^TM cDNA Subtraction Kit kit instructions will be shown suppression subtractive hybridization. Driver mRNA and Tester mRNA were reverse transcribed separately (reverse transcription primers were provided as primers) to obtain double-stranded cDNA, and 2 μg of Tester cDNA and 2 μg of Driver cDNA were used as starting materials for subtractive hybridization. . The Tester cDNA and Driver cDNA were digested with Rsa I for 1.5 hours in a 37 ° C water bath, and then the digested Tester cDNA was divided into two equal portions, and the different linkers were ligated, and the Driver cDNA was not ligated. Two tester cDNAs with different adaptors were mixed with excess Driver cDNA for the first forward subtractive hybridization. The products of the two first forward subtractive hybridizations were mixed, and a second forward subtractive hybridization was performed with the newly denatured Driver cDNA, and the differentially expressed genes were amplified by two inhibitory PCR amplifications (PCR). Before, the second forward subtractive hybridization product is end-filled).

(5) Construction and preliminary screening, cloning and identification of subtractive libraries

The second inhibitory PCR amplification product of the second forward subtractive hybridization cDNA fragment (purified using QIAquick PCR Purification Kit, purchased from Qiagen) according to the instructions of the pGEM-T Easy kit (purchased from Promega) The specific steps are linked to the pGEM-T Easy vector as follows: The following components are sequentially added to the 200 l PCR tube: Purified combined positive subtractive hybridization cDNA fragment second inhibitory PCR product 3 μ 1 , 2 X T4 DNA ligase buffer 5 μl, pGEM-T Easy vector 1 μl, Τ4 DNA ligase 1 μl, ligated overnight at 4 °C. Then 10 μ ΐ was added to the reaction product, and added to 100 μl of E. coli JM109 competent cells (purchased from TAKARA), ice bath for 30 minutes, heat shock for 60 seconds, ice bath for 2 minutes, and then 250 l LB liquid medium was added. (containing 1% tryptone (purchased from OXOID), 0.5% yeast extract (Yeast Extract, purchased from OXOID) and P 1% NaCl (purchased from Sinopharm)) and placed in a shaker at 37 ° C to 225 Incubate at rpm for 30 minutes, then inoculate 200 μl of the bacterial solution from 50 μg/ml ampicillin, 40 g/mL X-gal (5-bromo-4-chloro-3-indol-β-D-half Glycosides), 24 g/mL IPTG (isopropyl - LB-D-thiogalactopyranoside) LB (ibid.) on a solid plate (X-gal and IPTG were purchased from TAKARA) and incubated at 37 ° C for 18 hours. Count the clear white and blue colonies with a diameter > 1 mm in the culture plate and randomly pick 300 white colonies (number: Gh-S2-001 to Gh-S2-300). The white colonies picked were inoculated into LB liquid medium (same as above) containing 50 μg/ml ampicillin in 96-well cell culture plate (CORNING), and cultured overnight at 37 ° C, and glycerin was added to the final concentration of glycerol. 20% (by volume), then stored at -80 °C for later use. Nested PCR primer Primer 1 and P Primer 2R (PCR-selectTM cDNA Subtraction Kit from Clontech) were used to perform PCR amplification on the cultured cells, and 231 positive clones were obtained, and then all positive clones were obtained. Send to English Jieji (Shanghai) Trading Co., Ltd. for sequencing.

(6) cDNA sequencing analysis of differential clones:

After removing the vector and the ambiguous sequence and redundant cDNA from the DNA sequencing results, a total of 203 Expressed Sequence Tags (ESTs) (Unigene) were obtained. Example 2 Cloning of cotton high-affinity potassium ion transporter encoding gene GhHKT2

After removing the redundant DNA from the clone designated Gh-S2-092 in the identified cotton SSH library, the sequence was SEQ ID No: 3. Sequence analysis indicated that the protein encoded by the sequence belonged to a high affinity potassium ion transporter. In this paper, the full-length coding gene corresponding to the sequence of SEQ ID No: 3 is named G 3⁄4r2, and the corresponding protein is named

HKT2.

SEQ ID No: 3:

102 1 AGTTTTCTTA AATCACTAGT GATTGT

Cloning of the full-length coding gene of GhHKT2

Based on the sequence of SEQ ID No: 3 that has been obtained, the following two specific primers were designed as the 5'-end specific primer for 3' RACE.

GhHKT2 GSP 1 : SEQ ID No : 4:

GAGGTGGTAA GTGCATATGG TAA

GhHKT2 GSP2 : SEQ ID No _: 5:

TGGGTTATAG TTGCAAGCTA CGA Experimental procedure was performed according to the kit instructions (3 'RACE System for Rapid Amplification of cDNA Ends kit purchased from Invitrogen).

The first round of PCR amplification was carried out using SEQ ID NO: 4 and the universal primer AUAP (provided with the kit), and the cDNA obtained by reverse transcription of the mRNA extracted from the salt-treated group was used as a template. Specific steps are as follows:

50 μ 1 PCR reaction system: 5 μ 1 ΙΟ Χ Εχ Buffer 3 μ 1 2.5 mM dNTP, 2.0 μ 1 cDNA, 1.0 μ 1 Ex Taq (purchased from TAKARA), 10 μM primer SEQ ID NO: 4 and AUAP each 2.0 μ ΐ and 35 μ ΐ double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 1 minute), 72 ° C for 10 minutes.

The obtained PCR product was diluted 50-fold with double distilled water, and 2.0 μL was used as a template, and the second round of PCR amplification was carried out by using SEQ ID NO: 5 and the universal primer AUAP. The specific steps are as follows:

50 yl PCR reaction system: 5 μ 1 lO X Ex Buffer 3 μ 1 2.5 mM dNTP, 2.0 μl diluted first round PCR product, 1.0 μ 1 Ex Taq 10 μM primer SEQ ID NO: 5 and P AUAP Each of 2.0 μ 1 and 35 μl of double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 1 minute), extension at 72 ° C for 10 minutes.

Recover a strip of approximately 350 bp in the second round of PCR product (Gel Extraction Kit was purchased from

OMEGA), and ligated it into pGEM-T Easy vector, then transformed into E. coli JM109 competent cells (the same method as above), and applied the transformed bacterial solution to 50 μlmL ampicillin, 40 ^ glmL Screening was performed on LB solid medium of X-gaK 24 g/mL IPTG. 10 white colonies were randomly picked and inoculated into LB liquid medium containing 50 g/ml ampicillin, and cultured overnight at 37 ° C, glycerol was added to a final concentration of glycerol of 20% (volume ratio), and stored at -80 ° C. . Using SEQ ID NO: 5 with the universal primer AUAP The PCR amplification of the bacterial solution confirmed that 5 positive clones were obtained, and 4 positive clones were sent to Yingjie Jieji (Shanghai) Trading Co., Ltd. for sequencing and sequencing, and the 3' end of the cDNA of the gene was obtained.

Based on the G 3⁄4J2 gene fragment that has been obtained, the following three specific primers were designed as the 3'-end specific primer of 5' RACE.

GhHKT2 GSP3: SEQ ID No _: 6:

GCTAAAGCAA TTATGACTAA GA

GhHKT2 GSP4: SEQ ID No _: 7:

TGTGAATAGG TTTAGTCCTT TGC

GhHKT2 GSP5: SEQ ID No _: 8:

TTAACGTGCT TCGAGCACTT GAA

The experimental procedure was performed according to the kit instructions (5 'RACE System for Rapid Amplification of cDNA Ends kit purchased from Invitrogen).

Using SEQ ID NO: 7 and the universal primer AAP (provided with the kit), the cDNA obtained by reverse transcription of the mRNA extracted from the salt-treated group (reverse transcription primer SEQ ID NO: 6, dCTP plus tail) was used as a template. One round of PCR amplification, the specific steps are as follows:

50 μ 1 PCR reaction system: 5 μ 1 ΙΟΧΕχ Buffer 3 μ 1 2.5 mM dNTP, 2.0 μ 1 cDNA, 1.0 μ 1 Ex Taq (purchased from TAKARA), 10 μM primers SEQ ID NO: 7 and P AAP 2.0 μ 1 and 35 μl of double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, extension at 72 ° C for 1 minute), extension at 72 ° C for 10 minutes.

The obtained PCR product was diluted 50 times with double distilled water, and 2.0 μM was used as a template, and the second round of PCR amplification was carried out by using SEQ ID NO: 8 and the primer AUAP. The specific steps are as follows:

50 l PCR reaction system: 5 μ 1 l OXEx Buffer 3 μ 12.5 mM dNTP, 2.0 μl diluted first round PCR product, 1.0 μ 1 Ex Taq 10 μM primer SEQ ID NO: 8 and P AUAP each 2.0 μ 1 and 35 μl of double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 1 minute), extension at 72 ° C for 10 minutes.

A strip of about 700 bp in the second round of PCR product was recovered (Gel Extraction Kit was purchased from OMEGA), and ligated into pGEM-TEasy vector, and then transformed into E. coli JM109 competent cells (the specific method is the same as above). The transformed bacterial solution was applied to LB solid medium containing 50 μl of ampicillin and 40 μg of mL X-gaK 24 g/mL IPTG for screening. Randomly picked 10 white colonies to inoculate separately After culturing overnight at 37 ° C in LB liquid medium containing 50 g / ml ampicillin, glycerin was added to a final concentration of glycerol of 20% by volume, and stored at -80 ° C until use. Using SEQ ID NO: 8 and primer AUAP to verify the bacterial liquid PCR amplification (reaction system and reaction conditions are the same as above), six positive clones were obtained, and four clones were selected and sent to Yingjie Jieji (Shanghai) Trading Co., Ltd. for sequencing. The 5' end of the cDNA of the gene was obtained. After the obtained 5 'RACE product clone was sequenced, it was spliced with the above 3' RACE product sequencing result and the SEQ ID No: 3 sequence to obtain a GhHKT2 full-length cDNA sequence of SEQ ID No: 9.

A pair of primers were designed according to the sequence of SEQ ID NO: 9 as follows:

SEQ ID No: 10:

ATGTGGTGTA TGAAGATGAA CC SEQ ID No: 11:

TTAAGAAAAC TTCCAAACCA TG The GhHKT2 full-length coding gene was cloned by SEQ ID NO: 10 and SEQ ID NO: 11.

PCR was carried out using TAKARA's PrimeSTAR HS DNA polymerase using the cDNA of the above cotton as a template. 50 l PCR reaction system: 10 l 5XPS Buffer, 3 μ 12.5 mM dNTP, 2.0 μ 1 cDNA 1.0 μ 1 PrimeSTAR HS DNA polymerase, 10 μM primers SEQ ID NO: 10 and SEQ ID NO: 11 each 2.0 μ 1 and 30 μl of double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 2 minutes), extension at 72 ° C for 10 minutes.

PCR amplification product plus A tail: 2.5 times the volume of absolute ethanol was added to the PCR product, placed at -20 ° C for 10 minutes, centrifuged, the supernatant was removed, air-dried, and the resulting precipitate was dissolved in 21 μl of double distilled water. Then, 2.5 μl of OXEx Buffer 0.5 μ 15 mM dATP, 1.0 lExTaq was added thereto. Reaction conditions: The reaction was carried out at 70 ° C for 30 minutes. The obtained 1600 bp DNA fragment was recovered (Omega recovery kit), and ligated into the pGEM T-easy vector to obtain a GhHKT2-pGEM plasmid, and then the ligated product was transformed into E. coli JM109 competent cells (method as above) The transformed bacterial solution was applied to LB solid medium containing 50 g/mL ampicillin and 40 g/mL X-gaK 24 g/mL IPTG for screening. 10 white colonies were randomly picked and inoculated in LB liquid medium containing 50 g/ml ampicillin. After incubation at 37 ° C overnight, glycerol was added to a final concentration of glycerol of 20% (volume ratio), and stored at -80 ° C. . Using SEQ ID NO: 10 and SEQ ID NO: 11 for bacterial liquid PCR amplification (reaction system and reaction conditions as above), 7 positive clones were obtained, and 4 positive clones were selected and sent to Yingjiejie (Shanghai) Trade. Sequencing, the resulting sequence is SEQ ID NO: 2, and the amino acid sequence of the encoded protein is SEQ ID NO: 1.

Amino acid sequence of HKT2 protein: SEQ ID NO: 1

1 MWCMK NQYC SCFHKK PKF

21 LVSLSYSSSK LTRLCHVLSV

41 NPFWTRILYF IFLSLLGFWG

61 LNVLEPRTDS FKPRKFDLFF 81 TSVSATTVSS MSTVEMEILS

101 NPQLI IMTIL MFIGGEVFTS

121 MAGLFFSNFI SEKNNVIDDG

141 EIELGNRKPE NLNPEQLAQN

161 QGEAF 丽 GEH LLYHS IMFLG

181 FVILGYLLIV NILGSAMVFL

201 YVSFVSSARS TLKSKGLNLF

221 TFS I FTTISS FTNCGFI PTN

241 ENMWFNKNS GLLLVI IALA

261 LLGNPLFPMC LRFLIWVMGK

281 CVNKVGDYCD YLLKNTREIG

301 FHHLFTTRRS CCWGTALVF

321 VWQALLFFA MEWNSASLKE

341 LNPFERTIGV LFQSVNTSQA

361 GETIVNLPAM STVILWITI

381 IMYFPPYTS I PFVKDEKKEQ

401 QNQEKRKGKT AKELLTQLAS

421 ICI FVFLICI TERKNMKEDP

441 FNFTPFNFLF EWSAYGNVG

461 YSMGYSCKLR LKDEANCVDK

481 SYGFVGRWSD AGKTVLIWM

501 MLGRLKRYNM VWKFS *

781

841

901

961

1021

1081

1141

1201

1261

1321

1381

1441

1501 ATGCTTGGTA GACTAAAGAG ATACAACATG GTTTGGAAGT TTTCTTAA Example 3 Construction of GhHKT2 gene plant expression vector

The plant binary expression vector pCAMBIA2300 (purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.) was selected as a plant expression vector, and the 35S promoter containing the double enhancer of the ΝΡΤΠ gene was replaced with the Pnos promoter to reduce the expression of prion protein in plants. . The 35S promoter and the Tnos terminator were selected as promoters and terminators of the GhHKT2 gene, respectively. The construction flow chart is shown in Figure 1.

Using primers SEQ ID NO: 12 and SEQ ID NO: 13, the plant expression vector pBI121 plasmid (purchased from Beijing Huaxia Ocean Technology Co., Ltd.) was used as a template to amplify Pnos using TAKARA's PrimeSTAR HS DNA polymerase. 50 lPCR reaction system: 10 l5 XPSBuffer, 3 μ 12.5 mM dNTP, 1.0 μ1 ρΒΙ121 plasmid, 1.0 μl PrimeSTAR HS DNA polymerase, 10 μM primers SEQ ID NO: 12 and SEQ ID NO: 13 each 2.0 μΐ and 31 μΐ Double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 56 ° C for 30 seconds, extension at 72 ° C for 30 seconds), extension at 72 ° C for 10 minutes. The resulting PCR product was digested with EcoRI, Bglll, and ligated into pCAMBIA2300 according to the kit instructions (Promega, T4 ligase kit) to obtain pCAMBIA2300-1.

SEQ ID NO: 12

GCACGAATTC ggcgggaaac gacaatctga

SEQ ID NO: 13

ATCCAGATCTAGATCCGGTGCAGATTATTTG

Tnos was amplified using the primers SEQ ID NO: 14 and SEQ ID NO: 15 with the pBI121 plasmid as a template, using TAKARA's PrimeSTAR HS DNA polymerase. 50 μ 1 PCR reaction system: 10 μ 1 5XPS Buffer 3 μ 1 2.5 mM dNTP, 1.0 μ 1 ρΒΙ121 plasmid, 1.0 μl PrimeSTAR HS DNA polymerase, 10 μM primer SEQ ID NO: 14 and P SEQ ID NO: 15 each 2.0 μ 1 and 31 μl Double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 30 seconds), extension at 72 ° C for 10 minutes. The resulting PCR product was ligated by Kpnl, EcoRI digestion (Promega T4 ligase kit) to pCAMBIA2300-1 to obtain pCAMBIA2300-2.

SEQ ID NO: 14:

AAGGGTACCGAATTTCCCCGATCGTTCAAA SEQ ID NO: 15:

TCAGAATTCCCAGTGAATTCCCGATCTAGTA The 35S promoter was amplified using the primers SEQ ID NO: 16 and SEQ ID NO: 17 using the pCAMBIA2300 plasmid as a template. TAKARA's PrimeSTAR HS DNA polymerase was used. 50 yl PCR reaction system: 10 μ 1 5 X PS Buffer 3 μ 1 2.5 mM dNTP, 1.0 μl pCAMBIA2300 plasmid, 1.0 μl PrimeSTAR HS DNA polymerase, 10 μM primer SEQ ID NO: 16 and P SEQ ID NO: 17 each of 2.0 μ ΐ and 31 μ ΐ double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (94 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 30 seconds), 72 ° C for 10 minutes. The resulting PCR product was ligated by HindIII and Sail (connection method as above) to pCAMBIA2300-2 to obtain pCAMBIA2300-3.

SEQ ID NO: 16:

ACTAAGCTTTAGAGCAGCTTGCCAACATGGTG SEQ ID NO: 17:

TGAGTCGACAGAGATAGATTTGTAGAGAGAGACT The full-length sequence of the G 3⁄4 r2 encoding gene was amplified with primers SEQ ID NO: 18 and SEQ ID NO: 19 (template was the positive GhHKT2-pGEM plasmid obtained in Example 2), using TAKARA's PrimeSTAR HS DNA polymerase. 50 μ ΐ PCR reaction system: 10 l 5 X PS Buffer, 3 μ 1 2.5 mM dNTP, 1.0 μ 1 GhHKT2-pGEM plasmid, 1.0 μ 1 PrimeSTAR HS DNA polymerase, 10 μ Μ primer SEQ ID NO: 18 and SEQ ID NO: 19 each of 2.0 μl and 31 μl of double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 33 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 2 minutes), extension at 72 ° C for 10 minutes. The obtained PCR product was ligated by Sall and Kpnl (connection method as above) to pCAMBIA2300-3, and the plant expression vector 35S-GhHKT2-2300 was obtained after verification (Fig. 2). SEQ ID NO: 18

ACTGTCGAC ATGTGGTGTA TGAAGATGAA CC SEQ ID NO: 19

ACTGGTACC TTAAGAAAAC TTCCAAACCA TG Example 4 35S-GhHKT2-2300 expression vector for transformation of Agrobacterium

Agrobacterium LBA4404 (purchased from Biovector Science Lab, Inc) Preparation of Competent Cells: Agrobacterium LBA4404 was spotted on LB solid medium containing 50 g/ml rifampicin and 50 g/ml streptomycin, 28 Incubate at °C for 1 to 2 days. Single colonies were picked and inoculated into 5 ml of LB liquid medium containing 50 μ _§ /ιη1 rifampicin and 50 μ _§ /ιη1 streptomycin, and cultured overnight (about 12-16 hours) to OD ₆ at 28 °C with shaking. . A value of 0.4 forms a seed broth. 5 ml of culture-activated bacterial solution (1:20 ratio) was inoculated into 100 ml of LB liquid medium containing 50 μ _§ /ιη1 rifampicin and 50 μ _§ /ιη1 streptomycin, and shake culture at 28 °C. -2.5 hours to OD ₆ . . =0.8. The ice bath solution was shaken for 10 minutes every 3 minutes to allow the bacteria to enter the dormant state uniformly. Centrifuge at 4000 g for 10 minutes at 4 ° C, discard the supernatant; resuspend the cells by adding 1 ml of ice pre-cooled 10% (by volume) glycerol, centrifuge at 4000 g for 10 minutes at 4 ° C, collect the precipitate; 10% (by volume) of the pre-cooled glycerin was washed 3-4 times; then the bacterial pellet was resuspended by adding an appropriate amount of ice-cold 10% (by volume) glycerol to prepare LBA4404 competent cells at 40 μΐ/tube. It is packaged and stored at -70 °C for later use.

Transformation of Agrobacterium: The LBA4404 competent cells were thawed on ice, and 1 μM of the plasmid 35S-GhHKT2-2300 obtained in Example 3 was added to 40 μΐ of the competent cells, and the mixture was mixed and ice-cooled for about 10 minutes. The mixture of the competent cells after the ice bath and the 35S-GhHKT2-2300 plasmid was transferred to an ice-cold 0.1 cm size electric shock cup (purchased from Bio-Rad) using a micropipette, and tapped to bring the suspension to an electric shock. The bottom of the cup (be careful not to have bubbles). Place the electric shock cup on the slide of the electric shock chamber, and push the slide to place the electric shock cup to the base electrode of the electric shock chamber. Set the program of MicroPulser (purchased from Bio-Rad) to "Agr" and apply an electric shock once. Immediately remove the electric shock cup and add 200 μΙ Β 预 medium pre-warmed at 28 °C. Quickly and gently mix the competent cells with a micropipette. The suspension was transferred to a 1.5 ml centrifuge tube and incubated at 28 ° C for 1 hour at 225 rpm. 100-200 μL of bacterial solution was applied to the corresponding resistant selection medium plate (LB solid medium containing 50 g/ml rifampicin, 50 μ _§ /ιη1 streptomycin, 50 μ _§ /ιη1 card Natamycin), cultured at 28 °C. Positive transformed clones were screened and their bacterial stocks were stored at -70 °C until use. Example 5 Receptor Material Arabidopsis Culture Select the vermiculite with good water absorption and soft soil to match the nutrient soil (1:1) as the soil for Arabidopsis planting. Using a 9 cm diameter pot, seeded 20-30 Arabidopsis seeds per pot (Columbia type, from the Arabidopsis Bioresources Center, Ohio State University). After sowing, the film is covered with a film to provide a moist environment for plant growth. The temperature was 22 V, the light intensity was 3500-4000 lx, the photoperiod was 12 hours dark/12 hours light culture, and 1/2 MS liquid medium was watered every 7 days. After 30 days of culture, 4-5 plants were kept per pot, and the photoperiod was adjusted to 8 hours dark/16 hours light culture. After most of the plants were bolted, the entire main moss was cut off at the base of the inflorescence, and the top edge was approximated. After 1 week, 4-6 new side mosses grow in the axillary bud, and when the flower buds form part of the flower buds and partially flower or form 1-2 pods, they can be used for transformation. Example 6 Arabidopsis flower leaching transformation

The LBA4404 Agrobacterium liquid of the transformed 35 S-GhHKT2-2300 expression vector obtained in Example 4 was inoculated to an LB liquid medium containing 50 μ _§ /ιη1 kanamycin (kan), and the next morning was pressed. 1 : 50 was inoculated into a new LB medium (1 L) containing 50 μ _§ /ιη1 kanamycin, and cultured for about 8 hours to Agrobacterium OD ₆ . . Between 1.0 and 1.2. Centrifuge at 5000 rpm for 5 minutes at room temperature, discard the supernatant, and suspend the Agrobacterium pellet in the impregnation medium (1/2MS liquid medium and contain 5% sucrose; adjust to pH 5.7 with KOH; 0.02% Silwet L-77) , make OD ₆ . . At around 0.8. The upper part of the Arabidopsis thaliana prepared for transformation prepared in Example 5 was slowly and spirally immersed in the Agrobacterium-containing dyeing medium, and gently shaken clockwise for about 2 minutes, and covered with a transparent plastic cover. Humidity, put in the greenhouse overnight. After 24 hours, remove the plastic transparent cover and pour through the water. After 2-3 weeks, ensure that the plants are hydrated. When the plant stops flowering, the first fruit pod matures and turns yellow, and is covered with a paper bag. When all the pods in the paper bag turn yellow, the watering is stopped, and after 1 to 2 weeks of drying, the seeds are collected and the transformants are screened. Untransformed Arabidopsis fruit pods were taken as controls. Example 7 Screening of transgenic positive transformants from Arabidopsis thaliana

Seed disinfection: Soak for 10 minutes with 70% ethanol, and occasionally suspend the seeds; then wash with sterile water four times, and occasionally suspend the seeds. Then, the treated seeds were uniformly coated on the surface of 1/2MS solid screening medium containing 50 μ _§ /ιη1 kanamycin (a maximum of 1500 seeds were seeded in a 150 mm diameter plate), and vernalized at 4 °C. After 2 days, it was cultured for 7-10 days at a constant temperature of 22 ° C, an illumination intensity of 3500-4000 k, and a photoperiod of 12 hours of darkness/12 hours of light. After germination of the transgenic seeds on the screening medium for 2 weeks, the plants capable of germination and normal growth were transferred to soil for further cultivation. 1-2 leaves of each plant capable of normal growth on the screening medium were extracted, DNA was extracted as a template, and PCR was carried out using SEQ ID NO: 18 and SEQ ID NO: 19 as primers. Detection (reaction system and conditions are the same as above), PCR-negative plants are removed, and the seeds of PCR-positive plants are collected and numbered (T0gl-T0g25) and stored. Example 8 Planting of transgenic Arabidopsis thaliana T1 plants overexpressing GhHKT2

Choose the rock with good water absorption and soft soil and the nutrient soil (1: 1) as the soil for Arabidopsis planting. Will number

Each transformant of T0gl-T0g25 and non-transgenic control Arabidopsis seeds were sown in 2 pots (20-30 seeds per pot). After sowing, the film is covered with a film to provide a moist environment for plant growth. Constant temperature 22 ° C, light intensity 3500-4000 lx, photoperiod of 12 hours dark / 12 hours light culture, 1/2 MS liquid medium per 7 days. After culturing for 25 days, 1-2 leaves were cut per plant and DNA was extracted as a template, and PCR was carried out using SEQ ID NO: 18 and SEQ ID NO: 19 as primers (reaction system and conditions are the same as above). PCR-negative plants were removed, and 7-8 PCR-positive vaccines were retained in each pot. After 10 days of culture, 5-7 transgenic Arabidopsis thaliana or non-transgenic control Arabidopsis thaliana seedlings with uniform size were kept in each pot for salt tolerance experiments. Example 9 Salt tolerance test of transgenic Arabidopsis T1 plants overexpressing GhHKT2

In Example 8, the transgenic Arabidopsis thaliana and the control Arabidopsis thaliana each retained a pot of plants for no treatment, normal watering

1/2MS liquid medium, one pot of each plant was irrigated with 1/2MS liquid medium containing 150 mM NaCl, constant temperature 22 ° C, light intensity 3500-4000 k, 12 hours light culture / 12 hours dark culture cycle, 14 The results of the experiment were observed after the day. The salt tolerance of T1 transgenic plants (plants grown from seeds of TO transgenic plants) showed that the T1 transgenic plants Tlg7, Tlgl, and Tlgl3 showed significant salt tolerance (see Figure 3, Tlg7 cases, Tlgl l, Tlgl3 results are similar, not shown here). Example 10 Verification of expression of the G 3⁄4r2 gene at the transcriptional level

Eight T1 transgenic plants with good salt tolerance in Example 9 were randomly selected (one of the above-mentioned Tlg7, Tlgl and Tlgl3 salt-tolerant strains), and the control plants in Example 9 were randomly selected from 4 plants. Total leaves were treated with salt (150 mM NaCl) for 15 days, and total RNA was extracted using a plant RNA extraction kit (Invitrogen). The absorbance values of total RNA obtained at 260 nm and 280 nm were determined by ultraviolet spectrophotometry, and the respective RNA concentrations were calculated. Reverse transcription was carried out according to the method shown by Invitrogen reverse transcription assay L1 box Superscript III Reverse Transcriptase, and 1 total RNA was used as a template, and the reverse transcription primer was SEQ ID NO: 11. The GhffK fragment was amplified using primers SEQ ID NO: 10 and SEQ ID NO: 20 (SEQ ID NO: 20: ACTTCCAAAC CATGTTGTAT C), and its transcription was examined. The PCR reaction was carried out using the TAKARA PrimeSTAR HS DNA polymerase using the cDNA obtained by the above reverse transcription as a template. 50 μl ΡΟ Reaction system: 10 μΐ 5 ><PS Buffer, 3 μΐ 2.5 mM dNTP, 2.0 μΐ cDNA, 1.0 μΐ PrimeSTAR HS DNA polymerase, 10 μΜ primer SEQ ID NO: 10 and P SEQ ID NO: 20 2.0 μl, and 30 μΐ double distilled water. PCR reaction conditions: pre-denaturation at 94 ° C for 5 minutes, 32 cycles (denaturation at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, extension at 72 ° C for 2 minutes), extension at 72 ° C for 10 minutes.

The electrophoresis results of the PCR products are shown in Figure 4: M is the DNA Ladder Marker (DL2000, purchased from Shenzhen Ruizhen Biotechnology Co., Ltd.), and 1-8 is the salt-tolerant T1 transgenic Arabidopsis plants (Tlg7, Tlgl, respectively). Three strains of Tlgl3), 9 is a 35S-GhHKT2-2300 plasmid PCR positive control, and 10-13 are non-transgenic control Arabidopsis plants. The size of the band shown is the same as the size of the positive control (approximately 1500 bp). The results showed that G 3⁄4J2 was significantly transcribed in the salt-tolerant T1 transgenic Arabidopsis plants, and there was no transcription of GhHKT2 in non-transgenic control Arabidopsis plants.

Claims

claims

1. A high-affinity potassium ion transporter from cotton, its sequence is SEQ ID N0: 1.

2. The gene encoding the high-affinity potassium ion transporter of claim 1, whose sequence is SEQ ID NO: 2.

3. A recombinant expression vector obtained by inserting the gene of claim 2 into an expression vector, and the nucleotide sequence of the gene is operably linked to the expression control sequence of the expression vector For connection, preferably, the expression vector is pCAMBIA2300.

4. The vector according to claim 3, which is the 35S-GhHKT2-2300 vector shown in Figure 2.

5. A recombinant cell containing the gene of claim 2 or the recombinant expression vector of claim 3 or 4; Preferably, the recombinant cell is a recombinant Agrobacterium cell.

6. A method for improving salt tolerance of plants, comprising: introducing the gene of claim 2 or the recombinant expression vector of claim 3 or 4 into a plant or plant tissue and expressing the gene; preferably, The plant in question is Arabidopsis thaliana.

7. A method for preparing transgenic plants, comprising: cultivating plants or plant tissues containing the gene of claim 2 or the recombinant expression vector of claim 3 or 4 under conditions that are effective for producing plants.

8. The method of claim 7, wherein the plant is Arabidopsis thaliana.

9. The use of the gene of claim 2, the recombinant expression vector of claim 3 or 4, or the recombinant cell of claim 5 for improving plant salt tolerance and for plant breeding.

10. The use of claim 9, wherein the plant is Arabidopsis thaliana.