WO2014201394A2 - Methods and compositions for the construction of prokaryotic organisms having multiple chromosomes - Google Patents
Methods and compositions for the construction of prokaryotic organisms having multiple chromosomes Download PDFInfo
- Publication number
- WO2014201394A2 WO2014201394A2 PCT/US2014/042363 US2014042363W WO2014201394A2 WO 2014201394 A2 WO2014201394 A2 WO 2014201394A2 US 2014042363 W US2014042363 W US 2014042363W WO 2014201394 A2 WO2014201394 A2 WO 2014201394A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- chromosome
- prokaryotic
- chromosomes
- replication
- modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
Definitions
- the disclosure generally relates to the field of prokaryotic cell biology.
- Genomatica's 1,4-butanediol, Amyris' artemisinin, and biofuels made by BP, Exxon, and Dupont (Tsuruta et al. PLoS One 4, e4489, 2009; Yim et al., Nature chemical biology 7, 445-452, 2011).
- These and other commercial projects require extensive genome remodeling, which involves the generation and transfer of very large genetic elements including chromosomes. Proof of principle of some of these procedures has been achieved only in the context of relatively small chromosomes such as those of
- Mycoplasma species (0.6 to 1.08 Mbp) and Prochlorococcus marinus (1.66Mb), which had been assembled in the yeast Saccharomyces cerevisiae (Gibson et al., Science 329, 52-56, 2010; Tagwerker et al., Nucleic Acids Res 40, 10375-10383, 2012. Analyses of various large chromosomes, including concatemers of the above, suggested that yeast can stably maintain foreign DNA molecules of up to 2 Mbp (Benders, G. A., Methods Mol Biol 852, 165-180, 2012).
- the invention relates, in part, to compositions and methods for the preparation of viable prokaryotic organisms having two or more autonomous replicating chromosomes of reduced size.
- the invention further relates to prokaryotic organisms comprising chromosomes wherein each chromosome may be small enough to be assembled in its entirety within an assembly host and wherein the complete chromosome set may be able to generate a viable cell.
- the invention also relates methods of adding or enhancing the properties of the prokaryotic organism having two or more chromosomes by replacing at least one of the chromosomes with a chromosome encoding for the added or enhanced property.
- the invention relates to a method of making a viable prokaryotic organism comprising two or more chromosomes by
- a fragmentation site is a site on a chromosome which may be cleaved leading to a double stranded break in the chromosome.
- the fragmentation site is a telomerase occupancy site (tos).
- the break may be blunt ended, have an overhang or terminate in a hair pin structure.
- the fragmentation site may be a site specific recombination site recognized by one or more recombinase proteins.
- the origin of replication to be inserted may be the wild type origin of replication of the prokaryotic organism.
- the origins of replication may be heterologous to the prokaryotic organism.
- the sequence of each of the origins of replication may be the same and in other embodiments the sequence of the origins of replication may be different.
- one or more of the origins of replication may be derived from Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
- one or more partitioning elements may be inserted.
- fragmentation sites, origins of replication and selectable markers are inserted into the chromosome such that when the chromosome is cleaved at the fragmentation sites, each of the resulting chromosomes comprises at least one origin of replication and at least one selectable marker.
- the chromosome is cleaved at the fragmentation sites by a protein which specifically recognizes the fragmentation site.
- the protein is expressed endogeneously, in alternate embodiments the protein is expressed from a plasmid which is transfected, transformed,
- the plasmid may be transferred by phage or viral infection.
- the fragmentation site may be a telomerase occupancy site (tos) which is cleaved by a protelomerase protein (TelN).
- the fragmentation site may be an inverted repeat sequence of 44 bp to 180 kb found in Streptomyces and recognized by Tap and Tp proteins.
- a prokaryotic cell comprising two or more chromosomes as produced by methods discussed herein, wherein each chromosome is capable of replicating independently, and wherein each chromosome further comprises one or more selectable markers.
- the two or more chromosomes may be linear or circular or any combination of linear and circular.
- the two or more chromosomes may each have a unique origin or replication.
- the two or more chromosomes may each be 1 Kbp to 13 Mbp, 1 Kbp to 10 Mbp, 1 Kbp to 5 Mbp, 1 Kbp to 4 Mbp, 1 Kbp to 3 Mbp, 1 Kbp to 2 Mbp, 1 Kbp to 1 Mbp, 10 Kbp to 13 Mbp, 100 Kbp to 13 Mbp, 500 Kbp to 13 Mbp, 1 Mbp to 13 Mbp, 2 Mbp to 13 Mbp, 3 Mbp to 13 Mbp, 4 Mbp to 13 Mbp, 5 Mbp to 13 Mbp, or 10 Mbp to 13 Mbp in size.
- a prokaryotic organism comprising two or more chromosomes may be modified by
- the chromosome of the prokaryotic organism to be modified may be counter selected for using a negative selection marker.
- FIG. 1 Shows alternate methods of fragmenting a chromosome.
- FIG. 1A depicts the use of a recombinase to produce two daughter chromosomes.
- FIG IB depicts the use of tos sites and a telN protein to produce two daughter chromosomes.
- FIG. 2 Shows one embodiment of a method for the production of a modified prokaryotic organism by replacing one chromosome.
- FIG. 3A depicts the location of Ori and tos sites within the E. coli strain
- FIG. 3B depicts the genotype of the different E. coli strains 1-22.
- FIG 3C depicts PCR analysis of strain 22.
- FIG. 3D depicts southern blot analysis of strain 22.
- FIG. 3E depicts pulse field gel electrophoresis of strain 22.
- FIG. 3F depicts the proposed structure of the two chromosomes of strain 22.
- FIG. 4A depicts the growth of parental strain MG1655 compared to strain
- FIG. 4B depicts the morphology of the parental strain MG1655 with strain 22.
- FIG. 4C depicts PCR analysis of strain 22 after 100 generations.
- FIG. 4D depicts PCR analysis of strain 22 after 4 successive re-streaks on LB agar.
- nucleotide As used herein, a nucleotide is a base- sugar-phosphate combination. Nucleotides are monomeric units of a nucleic acid molecule (DNA and RNA).
- the term nucleotide includes ribonucleoside triphosphates ATP, UTP, CTG, GTP and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [S]dATP, 7-deaza-dGTP and 7-deaza-dATP.
- a "nucleotide” may be unlabeled or detectably labeled by well known techniques. Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
- nucleic acid molecule refers to a covalently linked sequence of nucleotides or bases (e.g., ribonucleotides for RNA and deoxyribonucleotides for DNA but also include DNA/RNA hydrids where the DNA is in separate strands or in the same strands) in which the 3' position of the pentose of one nucleotide is joined by a phosphodiester linkage to the 5' position of the pentose of the next nucleotide. Nucleic acid molecules may be single- or double-stranded or partially double-stranded.
- Nucleic acid molecules may appear in linear or circularized form in a supercoiled or relaxed formation with blunt or sticky ends and may contain "nicks". Nucleic acid molecule may be composed of completely complementary single strands or of partially complementary single strands forming at least one mismatch of bases. Nucleic acid molecules may further comprise two self-complementary sequences that may form a double-stranded stem region, optionally separated at one end by a loop sequence. The two regions of nucleic acid molecule which comprise the double-stranded stem region are substantially complementary to each other, resulting in self -hybridization. However, the stem can include one or more mismatches, insertions or deletions.
- Nucleic acid molecules may comprise chemically, enzymatically, or metabolically modified forms of nucleic acid molecules or combinations thereof.
- Chemically synthesized nucleic acid molecules may refer to nucleic acids typically less than or equal to 150 nucleotides long (e.g., between 5 and 150, between 10 and 100, between 15 and 50 nucleotides in length) whereas enzymatically synthesized nucleic acid molecules may encompass smaller as well as larger nucleic acid molecules as described elsewhere in the application. Enzymatic synthesis of nucleic acid molecules may include stepwise processes using enzymes such as polymerases, ligases, exonucleases, endonucleases or the like or a combination thereof. Thus, the invention provides, in part, compositions and combined methods relating to the enzymatic assembly of chemically synthesized nucleic acid molecules.
- Nucleic acid molecule also refers to short nucleic acid molecules, often referred to as, for example, primers or probes. Primers are often referred to as single- stranded starter nucleic acid molecules for enzymatic assembly reactions whereas probes may be typically used to detect at least partially complementary nucleic acid molecules.
- a nucleic acid molecule has a "5'-terminus” and a "3'-terminus” because nucleic acid molecule phosphodiester linkages occur between the 5' carbon and 3' carbon of the pentose ring of the substituent mononucleotides. The end of a nucleic acid molecule at which a new linkage would be to a 5' carbon is its 5' terminal nucleotide.
- nucleic acid molecule sequence even if internal to a larger nucleic acid molecule (e.g., a sequence region within a nucleic acid molecule), also can be said to have 5'- and 3'-ends.
- Fragmentation site is a particular sequence in a DNA molecule to which a protein, chemical compound, DNA, or RNA molecule (e.g., endonuclease , restriction endonuclease, a topoisomerase, a modification methylase, or a recombinase) recognizes and binds resulting in the double strand cleavage of the DNA molecule at the fragmentation site.
- the cleavage may result in a blunt end or an end with an overhang.
- the overhang may comprise complementary regions allowing the overhang to self anneal forming a hairpin structure at the terminus.
- a fragmentation site may be a site specific recombination site.
- selectable marker is a nucleic acid segment that allows one to select for or against a molecule (e.g., a replicon) or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like.
- selectable markers include but are not limited to: (1) nucleic acid segments that encode products which provide resistance against otherwise toxic compounds (e.g., antibiotics); (2) nucleic acid segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) nucleic acid segments that encode products which suppress the activity of a gene product; (4) nucleic acid segments that encode products which can be readily identified (e.g., phenotypic markers such as ( ⁇ -galactosidase, green fluorescent protein (GFP), and cell surface proteins); (5) nucleic acid segments that bind products which are otherwise detrimental to cell survival and/or function; (6) nucleic acid segments that otherwise inhibit the activity of any of the nucleic acid segments described in Nos.
- phenotypic markers such as ( ⁇ -galactosidase, green fluorescent protein (GFP), and cell surface proteins
- nucleic acid segments that bind products that modify a substrate e.g. restriction endonucleases
- nucleic acid segments that can be used to isolate or identify a desired molecule e.g. specific protein binding sites
- nucleic acid segments that encode a specific nucleotide sequence which can be otherwise nonfunctional e.g., for PCR amplification of subpopulations of molecules
- nucleic acid segments, which when absent, directly or indirectly confer resistance or sensitivity to particular compounds and/or (11) nucleic acid segments or negative selection markers that encode products which are toxic in recipient cells.
- Examples of such toxic gene products are well known in the art, and include, but are not limited to, restriction endonucleases (e.g., Dpnl), apoptosis-related genes (e.g. ASKl or members of the bcl-2/ced-9 family), retroviral genes including those of the human immunodeficiency virus (HIV), defensins such as NP-1, inverted repeats or paired palindromic nucleic acid sequences, bacteriophage lytic genes such as those from (X174 or bacteriophage T4; antibiotic sensitivity genes such as rpsL, antimicrobial sensitivity genes such as pheS, plasmid killer genes, eukaryotic transcriptional vector genes that produce a gene product toxic to bacteria, such as GATA-1, and genes that kill hosts in the absence of a suppressing function, e.g., sacB, rpsL(strA), tetAR, pheS, thy
- Chromosome As used herein, a chromosome is a linear or circular double stranded nucleic acid segment comprising at least one origin of replication and is capable of independent replication within the cytoplasm of a prokaryotic cell. A chromosome is typically at least 1 Kpb in size.
- Origin of Replication (Ori): As used herein, an Ori is a DNA sequence from which replication of the DNA molecule begins. Replication from the Ori may proceed in a unidirectional or bidirectional manner.
- Recombination site refers to a recognition sequence on a nucleic acid molecule which participates in an
- Recombination sites are discrete sections or segments of nucleic acid on the participating nucleic acid molecules that are recognized and bound by a site-specific recombination protein during the initial stages of integration or recombination.
- the recombination site for Cre recombinase is loxP which is a 34 base pair sequence comprised of two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence.
- recognition sequences include the attB, attP, attL, and attR sequences, and mutants, fragments, variants and derivatives thereof, which are recognized by the recombination protein ⁇ Int and by the auxiliary proteins integration host factor (IHF), FIS and excisionase (Xis). (See Landy, Curr. Opin. Biotech. 3:699-707 (1993).)
- Site-Specific Recombinase refers to a type of recombinase which typically has at least the following four activities (or combinations thereof): (1) recognition of specific nucleic acid sequences; (2) cleavage of said sequence or sequences; (3) topoisomerase activity involved in strand exchange; and (4) ligase activity to reseal the cleaved strands of nucleic acid.
- four activities or combinations thereof: (1) recognition of specific nucleic acid sequences; (2) cleavage of said sequence or sequences; (3) topoisomerase activity involved in strand exchange; and (4) ligase activity to reseal the cleaved strands of nucleic acid.
- Conservative site-specific recombination is distinguished from homologous
- the strand exchange mechanism involves the cleavage and rejoining of specific nucleic acid sequences in the absence of DNA synthesis (Landy, A. (1989) Ann. Rev. Biochem. 58:913-949).
- recognition sequence refers to a particular sequence to which a protein, chemical compound, DNA, or RNA molecule (e.g., restriction endonuclease, a modification methylase, or a recombinase) recognizes and binds.
- a recognition sequence will usually refer to a recombination site.
- the recognition sequence for Cre recombinase is loxP which is a 34 base pair sequence comprising two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence. (See FIG.
- AttB is an approximately 25 base pair sequence containing two 9 base pair core-type Int binding sites and a 7 base pair overlap region.
- attP is an approximately 240 base pair sequence containing core-type Int binding sites and arm-type Int binding sites as well as sites for auxiliary proteins integration host factor (IHF), FIS and excisionase (Xis).
- IHF auxiliary proteins integration host factor
- FIS FIS
- Such sites may also be engineered according to the present invention to enhance production of products in the methods of the invention.
- engineered sites may lack the PI or Hi domains to make the recombination reactions irreversible (e.g., attR or attP)
- such sites may be designated attR' or attP' to show that the domains of these sites have been modified in some way.
- a fundamental need of the synthetic biology field is a genome engineering toolbox with corresponding reagents that allows the manipulation of chromosomes with the same simplicity and confidence as plasmids are modified. Fragmentation of a prokaryotic genome into smaller viable units harboring essential functions makes such a toolbox possible.
- This task may be performed by transient induction of a variety of phage recombinases, widely used in genome engineering (Groth et al., J Mol Biol 335, 667-678, 2004.).
- This approach requires that the recombination sequences be added in pairs, rather than individually. Further, to avoid unwanted rearrangements, the recombination sequence pairs must be perfectly orthogonal. DNA recognition sequences for recombination may also be referred to as fragmentation sites.
- the site specific recombination approach is most efficient when site specific recombinases are expressed at levels sufficient to complete the recombination reactions and are removed, or no longer expressed, after recombination is complete so that further recombination reactions do not occur. It may be necessary to remove native or pseudo recognition sequences in the genome to prevent unintended fragmentation of the chromosome.
- FIG. IB An alternative approach would be to fragment the chromosome by means of the introduction of multiple "fragmentation" sites.
- One specific non-limiting example of this approach is the fragmentation of the E. coli chromosome at a single site using two components of bacteriophage N15, the telomerase occupancy site element (tos) and the protelomerase protein (TelN) (Cui et al., EMBO reports 8, 181-187, 2007).
- the tos element is recognized and cut at staggered positions at an internal palindromic region by the TelN protein; next, the single- stranded DNA regions are self- annealed; and finally the nicks are sealed by the TelN protein, producing two termini with hairpin structures (inset in Fig. IB).
- This fragmentation strategy has an advantage of being able to add tos elements individually on a sequential basis to obtain an increasing number of linear subgenomes.
- extended telN expression does not generate genome rearrangements other than those specifically intended.
- E. coli cells with a circular chromosome harboring two active replication origins grow with relatively normal growth rates and cell cycle parameters (Wang et al., Proc Natl Acad Sci U SA 108, E243-250, 2011).
- the telN gene may also be integrated into one or multiple chromosomes thereby avoiding the use of additional chromosomes.
- linear, but not circular chromosomes require only a single plasmid-encoded protein, TraB, to be transferred via conjugation (Vogelmann, J., et al., The EMBO Journal 30, 2246-2254, 2011).
- the growth rate of a strain having multiple chromosomes may be improved when the heterologous Ori is present on a chromosome that is circular. Such a configuration would still be compatible with a prokaryotic cell having multiple chromosomes.
- a circular chromosome would enable the biological function of a bidirectional terminus region (Srivastava, P., et al., J Bacteriol 188, 1060-1070, 2006). Determining the ratio of the copy number of the multiple chromosomes would help determine the rate limiting step in the doubling time of the modified strain.
- FIG. 2 A system for the production of a modified prokaryotic organism having one or more genetically modified organisms is presented in FIG. 2.
- an E. coli organism is depicted but any suitable prokaryotic organism may be used.
- the E. coli chromosome is fragmented. The fragmentation may be accomplished by the use of fragmentation sites including site specific recombination sites as discussed above or by any other method which results in the formation of multiple, independently replicable chromosomes. Genetically modified chromosomes
- E. coli chromosomes may then be constructed in yeast or other suitable assembly host.
- the modified chromosome may then be transferred by transfection, electroporation, conjugation or other method into the E.coli.
- E. coli having a chromosome replaced by the engineered chromosome may be selected for.
- the genetically modified chromosome transferred into the prokaryotic host may encode for one or more improved or new properties of the modified organism.
- These new or improved properties may include, but are not limited to, production of biofuels such as diesel and jet fuel; biobased chemicals such as alcohols, acids and olefins; enzymes with higher yields, greater activity or greater stability; C0 2
- Kbp to 13 Mbp could be mixed and introduced into compatible multi-chromosome prokaryotic hosts using yeast as the DNA assembly organism and a combination of selectable and counterselectable markers.
- the assembled chromosomes may be 1 Kbp to 13 Mbp, 1 Kbp to 10 Mbp, 1 Kbp to 5 Mbp, 1 Kbp to 4 Mbp, 1 Kbp to 3 Mbp, 1 Kbp to 2 Mbp, 1 Kbp to 1 Mbp, 10 Kbp to 13 Mbp, 100 Kbp to 13 Mbp, 500 Kbp to 13 Mbp, 1 Mbp to 13 Mbp, 2 Mbp to 13 Mbp, 3 Mbp to 13 Mbp, 4 Mbp to 13 Mbp, 5 Mbp to 13 Mbp, or 10 Mbp to 13 Mbp in size.
- Additional origins of replications with DNA capacities of over 1 Mbp could be utilized. Examples include those present in a and ⁇ proteobacteria harboring multiple chromosomes such as Agrobacterium tumefaciens, Sinorhizobium meliloti, Rhodobacter sphaeroides, and Burkholderia cepacia among others (Egan et al., Mol Microbiol 56, 1129-1138, 2005). Bacterial artificial
- chromosomes based on the F' episome are restricted to fragment sizes significantly smaller than 1 Mbp due to their limited DNA capacity (Ooi et al., Plasmid 59, 63-71, 2008). Examples
- Example 1 Generation of strains harboring different combinations of genome engineering elements.
- E. coli fragmentation at a single site may be accomplished by using two components of the bacteriophage N15, the telomerase occupancy site element (tos) and the protelomerase protein (TelN) (Cui et al., EMBO reports 8, 181-187, 2007). Briefly, the tos element is recognized and cut at staggered positions at an internal palindromic region by the TelN protein; next, the single- stranded DNA regions are self-annealed; and finally the nicks are sealed by the TelN protein, producing two termini with hairpin structures (inset in Fig. IB).
- tos telomerase occupancy site element
- TelN protelomerase protein
- E. coli strain MG1655 (Blattner et al., Science 277, 1453-1462, 1997) was used as a starting point for the construction of all the engineered strains. Exogenous DNA elements were introduced via lambda red recombineering (Zhang et al., Nat Genet 20, 123-128, 1998). Briefly, the corresponding DNA fragments were linked to a kanamycin selection marker, and pre-cloned into pUC19, from where the final DNA fragments using for recombineering were PCR-amplified. The E.
- coli origin of replication was PCR- amplified from strain MG1655 (nucleotides 3923768 to 3923998 of GenBank accession # U00096).
- the N15 bacteriophage tos element was prepared by de novo gene synthesis based on the published sequence (nucleotides 24474 to 25038 of GenBank accession # AF064539).
- the Vibrio cholerae replication origin of chromosome II was PCR-amplified from genomic DNA of strain 01 biovar El Tor N16961 (ATCC, Manassas, VA
- Table 1 Position of the DNA elements in the MG1655 chromosome.
- E. coli origin of replication (OriC)
- N15 bacteriophage tos element The wild type E. coli OriC [OriC(wt)] is a 232 bp sequence located at the 84.5 min of the chromosome of the MG1655 strain.
- the E. coli origin of replication was PCR- amplified from strain MG1655 using primers
- the N15 bacteriophage tos element is contained within a 564-bp DNA sequence harboring a series of inverted repeats centered on a large palindromic sequence (Rybchin et al., Mol Microbiol 33, 895-903, 1999).
- the tos fragment was PCR amplified using the template above and primers
- tosl Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- tos4 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- tos5 Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- tos7 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- Genomic DNA was isolated from the engineered strains using the
- Probes were PCR- amplified using primers described in Supporting Information and labeled using the BioPrime DNA Labeling System (Life Technologies, Carlsbad, CA). Membranes were processed and DNA was visualized using the BrightStar BioDetect Kit (Life Technologies, Carlsbad, CA).
- Biotinylated 2-Log DNA Ladder (0.1-10 kb) was from New England Biolabs (Ipswich, MA).
- Genomic DNA Plug Kit Bio-Rad, Hercules, CA
- Electrophoresis was performed using a CHEF-DR II System with a cooling module (Bio-Rad, Hercules, CA) with initial and final switching times of 250 sec and 900 sec, respectively. The voltage was set at 3 volts/cm. Following the 50 h run the gel was stained with ethidium bromide and visualized by standard imaging techniques.
- CHEF DNA Size Marker H. wingei Bio-Rad, Hercules, CA
- Probe templates for Southern Blot hybridization were PCR-amplified using primers
- OriCl (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- OriC2 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- OriC3 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- OriC4 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- DOriC(wt) (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- Vibrio cholerae multi chromosome system which has one primary (2.96 Mbp) and one secondary chromosome (1.07 Mbp) (Heidelberg et al., Nature 406, 477-483, 2000).
- primary chromosome 2.96 Mbp
- secondary chromosome 1.07 Mbp
- replication of the secondary chromosome is controlled by its own initiator RctB (Duigouet al., J Bacteriol 188, 6419-6424, 2006).
- the genetic locus involved in replication includes the rctB gene and an array of repeats, which is pronounced to that of some E.
- OriVl Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- OriV2 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- OriV3 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- OriV4 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
- the lysogenic mode is contemplated by two models where in one of them the protelomerase processes the ends before completion of replication (mode 1), whereas in the second one the replication is completed before the molecule is processed generating a head-to-head dimer (mode 2).
- the lytic replication has been proposed to follow a rolling circle strategy originating from the head-to-head dimer described above, and the concatemers are cleaved at the cos sites (mode 3).
- the replication of the chromosomes in strain 22 probably follows Mode 1 as we were unable to detect the head-to-head dimer intermediate required for Mode 2 and 3 (southern blot in Fig. 2 and not shown).
- Histomount mounting solution (Life Technologies, Carlsbad, CA) was applied to the sample and covered by a cover slip.
- the cell morphology was visualized with a 100X oil objective under a bright- field NIKON Eclips E400 microscope.
- a method of making a prokaryotic organism comprising two or more chromosomes comprising:
- the one or more origins of replication are derived from an organism selected from the group consisting of Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
- a method of making a prokaryotic organism comprising two or more chromosomes comprising:
- the one or more origins of replication are derived from an organism selected from the group consisting of Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
- a prokaryotic cell comprising two or more chromosomes as produced by any one of claims 1-10, wherein each chromosome is capable of replicating independently, and wherein each chromosome further comprises one or more selectable markers.
- 12 The prokaryotic cell of claim 11, wherein at least one of the chromosomes is linear.
- each chromosome comprises a unique origin of replication.
- a method of modifying a prokaryotic organism of any one of claims 11-15 comprising:
- modified chromosome confers on the modified prokaryotic organism one or more properties selected from the group consisting of production of biofuels such as diesel and jet fuel; biobased chemicals such as alcohols, acids and olefins; enzymes with higher yields, greater activity or greater stability; C0 2 sequestration methods; production of products for textiles, foods and detergents and synthetic vaccine production.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Disclosed are methods and compositions for producing prokaryotic organisms having multiple chromosomes. The methods and compositions allow for the production of organisms which may have one or more individual chromosomes replaced with a genetically engineered chromosome thereby providing a modified organism with new or improved properties.
Description
Methods and Compositions for the Construction of Prokaryotic Organisms Having Multiple Chromosomes
CROSS-REFERENCE(S) TO RELATED APPLICATION(S)
[0001] This application claims priority under 35 U.S.C.§ 119(e) of U.S.
Provisional Application No. 61/835,279, filed June 14, 2013, the entire contents of which are incorporated herein by reference.
FIELD
[0002] The disclosure generally relates to the field of prokaryotic cell biology.
More specifically, it relates to methods and compositions for producing prokaryotic organisms having multiple chromosomes.
BACKGROUND
[0003] Ever since the genome sequence of the first organisms became available, a number of attempts have been made to simplify, manipulate and even synthesize whole chromosomes to generate artificial microorganisms for a variety of purposes. However, the sheer size and complexity of even the smallest genomes make the tasks above extremely difficult, thereby complicating the prospects of the fields of metabolic engineering and synthetic biology. Further limitations are related to constraints in the maximum size of DNA elements that can be artificially assembled with currently available technologies.
[0004] Most industrial synthetic biology initiatives use E. coli or other related bacteria including prokaryotic algae as production hosts. A few examples are
Genomatica's 1,4-butanediol, Amyris' artemisinin, and biofuels made by BP, Exxon, and Dupont (Tsuruta et al. PLoS One 4, e4489, 2009; Yim et al., Nature chemical biology 7, 445-452, 2011). These and other commercial projects require extensive genome remodeling, which involves the generation and transfer of very large genetic elements including chromosomes. Proof of principle of some of these procedures has been
achieved only in the context of relatively small chromosomes such as those of
Mycoplasma species (0.6 to 1.08 Mbp) and Prochlorococcus marinus (1.66Mb), which had been assembled in the yeast Saccharomyces cerevisiae (Gibson et al., Science 329, 52-56, 2010; Tagwerker et al., Nucleic Acids Res 40, 10375-10383, 2012. Analyses of various large chromosomes, including concatemers of the above, suggested that yeast can stably maintain foreign DNA molecules of up to 2 Mbp (Benders, G. A., Methods Mol Biol 852, 165-180, 2012). Other highly recombinogenic and competent organisms, such as Bacillus subtilis, showed proficiency in chromosome assembly but were not capable to maintain large autonomous replicating molecules (Itaya et al., Nat Methods 5, 41-43, 2008). Overall, no biological platform can both assemble and sustain the replication of chromosomes larger than 2 Mbp, a size which is significantly smaller than the chromosomes of most bacterial species including E. coli, most of Gram (+) bacteria and prokaryotic algae. One aspect of the current disclosure is to address this limitation.
SUMMARY
[0005] The invention relates, in part, to compositions and methods for the preparation of viable prokaryotic organisms having two or more autonomous replicating chromosomes of reduced size. The invention further relates to prokaryotic organisms comprising chromosomes wherein each chromosome may be small enough to be assembled in its entirety within an assembly host and wherein the complete chromosome set may be able to generate a viable cell. The invention also relates methods of adding or enhancing the properties of the prokaryotic organism having two or more chromosomes by replacing at least one of the chromosomes with a chromosome encoding for the added or enhanced property.
[0006] In some embodiments, the invention relates to a method of making a viable prokaryotic organism comprising two or more chromosomes by
a) inserting two or more fragmentation sites into a prokaryotic chromosome,
b) inserting one or more origins of replication into the prokaryotic chromosome, c) inserting one or more selectable markers into the prokaryotic chromosome, and
d) cleaving the chromosome at the one or more fragmentation sites forming two or more daughter chromosomes.
[0007] In specific embodiments, a fragmentation site is a site on a chromosome which may be cleaved leading to a double stranded break in the chromosome. In some embodiments the fragmentation site is a telomerase occupancy site (tos). The break may be blunt ended, have an overhang or terminate in a hair pin structure. In alternate embodiments, the fragmentation site may be a site specific recombination site recognized by one or more recombinase proteins.
[0008] In some embodiments the origin of replication to be inserted may be the wild type origin of replication of the prokaryotic organism. In other embodiments the origins of replication may be heterologous to the prokaryotic organism. In further embodiments the sequence of each of the origins of replication may be the same and in other embodiments the sequence of the origins of replication may be different. In specific embodiments, one or more of the origins of replication may be derived from Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans . In addition to origins of replication, one or more partitioning elements may be inserted.
[0009] In some embodiments, fragmentation sites, origins of replication and selectable markers are inserted into the chromosome such that when the chromosome is cleaved at the fragmentation sites, each of the resulting chromosomes comprises at least one origin of replication and at least one selectable marker.
[00010] In some embodiments, the chromosome is cleaved at the fragmentation sites by a protein which specifically recognizes the fragmentation site. In other embodiments the protein is expressed endogeneously, in alternate embodiments the protein is expressed from a plasmid which is transfected, transformed,
electrotransformed, transplanted, conjugated or otherwise enters the cell. In some embodiments the plasmid may be transferred by phage or viral infection. In specific embodiments the fragmentation site may be a telomerase occupancy site (tos) which is
cleaved by a protelomerase protein (TelN). In alternate embodiments, the fragmentation site may be an inverted repeat sequence of 44 bp to 180 kb found in Streptomyces and recognized by Tap and Tp proteins. (Zhang R, et al. Appl Environ Microbiol. 72(9):5728- 33, 2006; Huang CH, et al. Mol Microbiol. 63(6): 1710-8, 2007; Yang CC, et al. PLoS One. S(2):e56322. doi: 10.1371/journal.pone.0056322, 2013).
[00011] Some embodiments provide for a prokaryotic cell comprising two or more chromosomes as produced by methods discussed herein, wherein each chromosome is capable of replicating independently, and wherein each chromosome further comprises one or more selectable markers. The two or more chromosomes may be linear or circular or any combination of linear and circular. The two or more chromosomes may each have a unique origin or replication. The two or more chromosomes may each be 1 Kbp to 13 Mbp, 1 Kbp to 10 Mbp, 1 Kbp to 5 Mbp, 1 Kbp to 4 Mbp, 1 Kbp to 3 Mbp, 1 Kbp to 2 Mbp, 1 Kbp to 1 Mbp, 10 Kbp to 13 Mbp, 100 Kbp to 13 Mbp, 500 Kbp to 13 Mbp, 1 Mbp to 13 Mbp, 2 Mbp to 13 Mbp, 3 Mbp to 13 Mbp, 4 Mbp to 13 Mbp, 5 Mbp to 13 Mbp, or 10 Mbp to 13 Mbp in size.
[00012] In further embodiments, a prokaryotic organism comprising two or more chromosomes may be modified by
a) constructing a modified chromosome comprising a selectable marker wherein the modified chromosome corresponds to a chromosome of the prokaryotic organism to be modified,
b) transfecting, transforming, electrotransforming, transplantating, or conjugating the modified chromosome into the prokaryotic organism to be modified, and
c) selecting for a transformed prokaryotic organism comprising the modified
chromosome.
[00013] In further embodiments the chromosome of the prokaryotic organism to be modified may be counter selected for using a negative selection marker.
BRIEF DESCRIPTION OF THE FIGURES
[00014] FIG. 1. Shows alternate methods of fragmenting a chromosome. FIG. 1A depicts the use of a recombinase to produce two daughter chromosomes. FIG IB depicts the use of tos sites and a telN protein to produce two daughter chromosomes.
[00015] FIG. 2 Shows one embodiment of a method for the production of a modified prokaryotic organism by replacing one chromosome.
[00016] FIG. 3A depicts the location of Ori and tos sites within the E. coli strain
MG1655. FIG. 3B depicts the genotype of the different E. coli strains 1-22. FIG 3C depicts PCR analysis of strain 22. FIG. 3D depicts southern blot analysis of strain 22. FIG. 3E depicts pulse field gel electrophoresis of strain 22. FIG. 3F depicts the proposed structure of the two chromosomes of strain 22.
[00017] FIG. 4A depicts the growth of parental strain MG1655 compared to strain
22. FIG. 4B depicts the morphology of the parental strain MG1655 with strain 22. FIG. 4C depicts PCR analysis of strain 22 after 100 generations. FIG. 4D depicts PCR analysis of strain 22 after 4 successive re-streaks on LB agar.
DETAILED DESCRIPTION
[00018] Definitions.
[00019] Nucleotide: As used herein, a nucleotide is a base- sugar-phosphate combination. Nucleotides are monomeric units of a nucleic acid molecule (DNA and RNA). The term nucleotide includes ribonucleoside triphosphates ATP, UTP, CTG, GTP and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives include, for example, [S]dATP, 7-deaza-dGTP and 7-deaza-dATP. A "nucleotide" may be unlabeled or detectably labeled by well known techniques. Detectable labels include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
[00020] Nucleic Acid Molecule: As used herein the term "nucleic acid molecule" refers to a covalently linked sequence of nucleotides or bases (e.g., ribonucleotides for RNA and deoxyribonucleotides for DNA but also include DNA/RNA hydrids where the DNA is in separate strands or in the same strands) in which the 3' position of the pentose of one nucleotide is joined by a phosphodiester linkage to the 5' position of the pentose of the next nucleotide. Nucleic acid molecules may be single- or double-stranded or partially double-stranded. Nucleic acid molecules may appear in linear or circularized form in a supercoiled or relaxed formation with blunt or sticky ends and may contain
"nicks". Nucleic acid molecule may be composed of completely complementary single strands or of partially complementary single strands forming at least one mismatch of bases. Nucleic acid molecules may further comprise two self-complementary sequences that may form a double-stranded stem region, optionally separated at one end by a loop sequence. The two regions of nucleic acid molecule which comprise the double-stranded stem region are substantially complementary to each other, resulting in self -hybridization. However, the stem can include one or more mismatches, insertions or deletions.
[00021] Nucleic acid molecules may comprise chemically, enzymatically, or metabolically modified forms of nucleic acid molecules or combinations thereof.
Chemically synthesized nucleic acid molecules may refer to nucleic acids typically less than or equal to 150 nucleotides long (e.g., between 5 and 150, between 10 and 100, between 15 and 50 nucleotides in length) whereas enzymatically synthesized nucleic acid molecules may encompass smaller as well as larger nucleic acid molecules as described elsewhere in the application. Enzymatic synthesis of nucleic acid molecules may include stepwise processes using enzymes such as polymerases, ligases, exonucleases, endonucleases or the like or a combination thereof. Thus, the invention provides, in part, compositions and combined methods relating to the enzymatic assembly of chemically synthesized nucleic acid molecules.
[00022] Nucleic acid molecule also refers to short nucleic acid molecules, often referred to as, for example, primers or probes. Primers are often referred to as single- stranded starter nucleic acid molecules for enzymatic assembly reactions whereas probes may be typically used to detect at least partially complementary nucleic acid molecules. A nucleic acid molecule has a "5'-terminus" and a "3'-terminus" because nucleic acid molecule phosphodiester linkages occur between the 5' carbon and 3' carbon of the pentose ring of the substituent mononucleotides. The end of a nucleic acid molecule at which a new linkage would be to a 5' carbon is its 5' terminal nucleotide. The end of a nucleic acid molecule at which a new linkage would be to a 3' carbon is its 3' terminal nucleotide. A terminal nucleotide or base, as used herein, is the nucleotide at the end position of the 3'- or 5'-terminus. A nucleic acid molecule sequence, even if internal to a larger nucleic acid molecule (e.g., a sequence region within a nucleic acid molecule), also can be said to have 5'- and 3'-ends.
[00023] Fragmentation site: As used herein, a fragmentation site is a particular sequence in a DNA molecule to which a protein, chemical compound, DNA, or RNA molecule (e.g., endonuclease , restriction endonuclease, a topoisomerase, a modification methylase, or a recombinase) recognizes and binds resulting in the double strand cleavage of the DNA molecule at the fragmentation site. The cleavage may result in a blunt end or an end with an overhang. When the cleaved ends comprise an overhang, the overhang may comprise complementary regions allowing the overhang to self anneal forming a hairpin structure at the terminus. A fragmentation site may be a site specific recombination site.
[00024] Selectable marker: As used herein, selectable marker is a nucleic acid segment that allows one to select for or against a molecule (e.g., a replicon) or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like. Examples of selectable markers include but are not limited to: (1) nucleic acid segments that encode products which provide resistance against otherwise toxic compounds (e.g., antibiotics); (2) nucleic acid segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) nucleic acid segments that encode products which suppress the activity of a gene product; (4) nucleic acid segments that encode products which can be readily identified (e.g., phenotypic markers such as (β-galactosidase, green fluorescent protein (GFP), and cell surface proteins); (5) nucleic acid segments that bind products which are otherwise detrimental to cell survival and/or function; (6) nucleic acid segments that otherwise inhibit the activity of any of the nucleic acid segments described in Nos. 1-5 above (e.g., antisense oligonucleotides); (7) nucleic acid segments that bind products that modify a substrate (e.g. restriction endonucleases); (8) nucleic acid segments that can be used to isolate or identify a desired molecule (e.g. specific protein binding sites); (9) nucleic acid segments that encode a specific nucleotide sequence which can be otherwise nonfunctional (e.g., for PCR amplification of subpopulations of molecules); (10) nucleic acid segments, which when absent, directly or indirectly confer resistance or sensitivity to
particular compounds; and/or (11) nucleic acid segments or negative selection markers that encode products which are toxic in recipient cells.
[00025] Examples of such toxic gene products are well known in the art, and include, but are not limited to, restriction endonucleases (e.g., Dpnl), apoptosis-related genes (e.g. ASKl or members of the bcl-2/ced-9 family), retroviral genes including those of the human immunodeficiency virus (HIV), defensins such as NP-1, inverted repeats or paired palindromic nucleic acid sequences, bacteriophage lytic genes such as those from (X174 or bacteriophage T4; antibiotic sensitivity genes such as rpsL, antimicrobial sensitivity genes such as pheS, plasmid killer genes, eukaryotic transcriptional vector genes that produce a gene product toxic to bacteria, such as GATA-1, and genes that kill hosts in the absence of a suppressing function, e.g., sacB, rpsL(strA), tetAR, pheS, thyA, gata-1, or ccdB, the function of which is described in Reyrat et al. Counterselectable Markers: Untapped Tools for Bacterial Genetics and Pathogenesis. Infect Immun. 66(9): 4011-4017 (1998). A toxic gene can alternatively be selectable in vitro, e.g., a restriction site.
[00026] Chromosome: As used herein, a chromosome is a linear or circular double stranded nucleic acid segment comprising at least one origin of replication and is capable of independent replication within the cytoplasm of a prokaryotic cell. A chromosome is typically at least 1 Kpb in size.
[00027] Origin of Replication (Ori): As used herein, an Ori is a DNA sequence from which replication of the DNA molecule begins. Replication from the Ori may proceed in a unidirectional or bidirectional manner.
[00028] Recombination Site: A used herein, the phrase "recombination site" refers to a recognition sequence on a nucleic acid molecule which participates in an
integration/recombination reaction by recombination proteins. Recombination sites are discrete sections or segments of nucleic acid on the participating nucleic acid molecules that are recognized and bound by a site-specific recombination protein during the initial stages of integration or recombination. For example, the recombination site for Cre recombinase is loxP which is a 34 base pair sequence comprised of two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence. (See FIG. 1 of Sauer, B., Curr. Opin. Biotech. 5:521-527 (1994).) Other
examples of recognition sequences include the attB, attP, attL, and attR sequences, and mutants, fragments, variants and derivatives thereof, which are recognized by the recombination protein λ Int and by the auxiliary proteins integration host factor (IHF), FIS and excisionase (Xis). (See Landy, Curr. Opin. Biotech. 3:699-707 (1993).)
[00029] Site-Specific Recombinase: As used herein, the phrase "site-specific recombinase" refers to a type of recombinase which typically has at least the following four activities (or combinations thereof): (1) recognition of specific nucleic acid sequences; (2) cleavage of said sequence or sequences; (3) topoisomerase activity involved in strand exchange; and (4) ligase activity to reseal the cleaved strands of nucleic acid. (See Sauer, B., Current Opinions in Biotechnology 5:521-527 (1994).) Conservative site-specific recombination is distinguished from homologous
recombination and transposition by a high degree of sequence specificity for both partners. The strand exchange mechanism involves the cleavage and rejoining of specific nucleic acid sequences in the absence of DNA synthesis (Landy, A. (1989) Ann. Rev. Biochem. 58:913-949).
[00030] Recognition Sequence: As used herein, the phrase "recognition sequence" refers to a particular sequence to which a protein, chemical compound, DNA, or RNA molecule (e.g., restriction endonuclease, a modification methylase, or a recombinase) recognizes and binds. In the present invention, a recognition sequence will usually refer to a recombination site. For example, the recognition sequence for Cre recombinase is loxP which is a 34 base pair sequence comprising two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence. (See FIG. 1 of Sauer, B., Current Opinion in Biotechnology 5:521-527 (1994).) Other examples of recognition sequences are the attB, attP, attL, and attR sequences which are recognized by the recombinase enzyme λ Integrase. attB is an approximately 25 base pair sequence containing two 9 base pair core-type Int binding sites and a 7 base pair overlap region. attP is an approximately 240 base pair sequence containing core-type Int binding sites and arm-type Int binding sites as well as sites for auxiliary proteins integration host factor (IHF), FIS and excisionase (Xis). (See Landy, Current Opinion in Biotechnology 3:699-707 (1993).) Such sites may also be engineered according to the present invention to enhance production of products in the methods of the invention. For example, when
such engineered sites lack the PI or Hi domains to make the recombination reactions irreversible (e.g., attR or attP), such sites may be designated attR' or attP' to show that the domains of these sites have been modified in some way.
[00031] Throughout this document, unless the context requires otherwise, the words "comprise," "comprises" and "comprising" or "contain", "contains" or
"containing" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
[00032] Overview.
[00033] A fundamental need of the synthetic biology field is a genome engineering toolbox with corresponding reagents that allows the manipulation of chromosomes with the same simplicity and confidence as plasmids are modified. Fragmentation of a prokaryotic genome into smaller viable units harboring essential functions makes such a toolbox possible. There are at least two different approaches to split a circular chromosome in vivo into two or more chromosomes. First, unidirectional site-specific recombination may be applied between two or more DNA recognition sequences placed at strategic locations in the chromosome (Fig. 1A). This task may be performed by transient induction of a variety of phage recombinases, widely used in genome engineering (Groth et al., J Mol Biol 335, 667-678, 2004.). This approach requires that the recombination sequences be added in pairs, rather than individually. Further, to avoid unwanted rearrangements, the recombination sequence pairs must be perfectly orthogonal. DNA recognition sequences for recombination may also be referred to as fragmentation sites.
[00034] The site specific recombination approach is most efficient when site specific recombinases are expressed at levels sufficient to complete the recombination reactions and are removed, or no longer expressed, after recombination is complete so that further recombination reactions do not occur. It may be necessary to remove native or pseudo recognition sequences in the genome to prevent unintended fragmentation of the chromosome.
[00035] An alternative approach would be to fragment the chromosome by means of the introduction of multiple "fragmentation" sites (Fig. IB). One specific non-limiting
example of this approach is the fragmentation of the E. coli chromosome at a single site using two components of bacteriophage N15, the telomerase occupancy site element (tos) and the protelomerase protein (TelN) (Cui et al., EMBO reports 8, 181-187, 2007).
Briefly, the tos element is recognized and cut at staggered positions at an internal palindromic region by the TelN protein; next, the single- stranded DNA regions are self- annealed; and finally the nicks are sealed by the TelN protein, producing two termini with hairpin structures (inset in Fig. IB). This fragmentation strategy has an advantage of being able to add tos elements individually on a sequential basis to obtain an increasing number of linear subgenomes. Second, extended telN expression does not generate genome rearrangements other than those specifically intended. In addition, it has been demonstrated that E. coli cells with a circular chromosome harboring two active replication origins grow with relatively normal growth rates and cell cycle parameters (Wang et al., Proc Natl Acad Sci U SA 108, E243-250, 2011).
[00036] The telN gene may also be integrated into one or multiple chromosomes thereby avoiding the use of additional chromosomes. As an added advantage, linear, but not circular chromosomes, require only a single plasmid-encoded protein, TraB, to be transferred via conjugation (Vogelmann, J., et al., The EMBO Journal 30, 2246-2254, 2011).
[00037] The growth rate of a strain having multiple chromosomes may be improved when the heterologous Ori is present on a chromosome that is circular. Such a configuration would still be compatible with a prokaryotic cell having multiple chromosomes. In addition a circular chromosome would enable the biological function of a bidirectional terminus region (Srivastava, P., et al., J Bacteriol 188, 1060-1070, 2006). Determining the ratio of the copy number of the multiple chromosomes would help determine the rate limiting step in the doubling time of the modified strain.
[00038] A system for the production of a modified prokaryotic organism having one or more genetically modified organisms is presented in FIG. 2. In the example shown, an E. coli organism is depicted but any suitable prokaryotic organism may be used. As a first step, the E. coli chromosome is fragmented. The fragmentation may be accomplished by the use of fragmentation sites including site specific recombination sites as discussed above or by any other method which results in the formation of multiple,
independently replicable chromosomes. Genetically modified chromosomes
corresponding to one or more of the fragmented E. coli chromosomes may then be constructed in yeast or other suitable assembly host. The modified chromosome may then be transferred by transfection, electroporation, conjugation or other method into the E.coli. Using appropriate positive and negative selection markers, E. coli having a chromosome replaced by the engineered chromosome may be selected for.
[00039] The genetically modified chromosome transferred into the prokaryotic host may encode for one or more improved or new properties of the modified organism. These new or improved properties may include, but are not limited to, production of biofuels such as diesel and jet fuel; biobased chemicals such as alcohols, acids and olefins; enzymes with higher yields, greater activity or greater stability; C02
sequestration methods; production of products for textiles, foods and detergents and synthetic vaccine production.
[00040] Diverse bacterial subgenome fragments (chromosomes) with sizes from 1
Kbp to 13 Mbp could be mixed and introduced into compatible multi-chromosome prokaryotic hosts using yeast as the DNA assembly organism and a combination of selectable and counterselectable markers. The assembled chromosomes may be 1 Kbp to 13 Mbp, 1 Kbp to 10 Mbp, 1 Kbp to 5 Mbp, 1 Kbp to 4 Mbp, 1 Kbp to 3 Mbp, 1 Kbp to 2 Mbp, 1 Kbp to 1 Mbp, 10 Kbp to 13 Mbp, 100 Kbp to 13 Mbp, 500 Kbp to 13 Mbp, 1 Mbp to 13 Mbp, 2 Mbp to 13 Mbp, 3 Mbp to 13 Mbp, 4 Mbp to 13 Mbp, 5 Mbp to 13 Mbp, or 10 Mbp to 13 Mbp in size. Additional origins of replications with DNA capacities of over 1 Mbp, could be utilized. Examples include those present in a and β proteobacteria harboring multiple chromosomes such as Agrobacterium tumefaciens, Sinorhizobium meliloti, Rhodobacter sphaeroides, and Burkholderia cepacia among others (Egan et al., Mol Microbiol 56, 1129-1138, 2005). Bacterial artificial
chromosomes based on the F' episome, although compatible with this approach, are restricted to fragment sizes significantly smaller than 1 Mbp due to their limited DNA capacity (Ooi et al., Plasmid 59, 63-71, 2008).
Examples
Example 1: Generation of strains harboring different combinations of genome engineering elements.
[00041] E. coli fragmentation at a single site may be accomplished by using two components of the bacteriophage N15, the telomerase occupancy site element (tos) and the protelomerase protein (TelN) (Cui et al., EMBO reports 8, 181-187, 2007). Briefly, the tos element is recognized and cut at staggered positions at an internal palindromic region by the TelN protein; next, the single- stranded DNA regions are self-annealed; and finally the nicks are sealed by the TelN protein, producing two termini with hairpin structures (inset in Fig. IB).
[00042] E. coli strain MG1655 (Blattner et al., Science 277, 1453-1462, 1997) was used as a starting point for the construction of all the engineered strains. Exogenous DNA elements were introduced via lambda red recombineering (Zhang et al., Nat Genet 20, 123-128, 1998). Briefly, the corresponding DNA fragments were linked to a kanamycin selection marker, and pre-cloned into pUC19, from where the final DNA fragments using for recombineering were PCR-amplified. The E. coli origin of replication was PCR- amplified from strain MG1655 (nucleotides 3923768 to 3923998 of GenBank accession # U00096). The N15 bacteriophage tos element was prepared by de novo gene synthesis based on the published sequence (nucleotides 24474 to 25038 of GenBank accession # AF064539). The Vibrio cholerae replication origin of chromosome II was PCR-amplified from genomic DNA of strain 01 biovar El Tor N16961 (ATCC, Manassas, VA
(Heidelberg et al., Nature 406, 477-483, 2000), nucleotides 1069875 to 3190 of GenBank accession # AE003853). The positions of the elements in the MG1655 are shown in Table 1.
[00043] Table 1. Position of the DNA elements in the MG1655 chromosome.
OriC2 4422941
OriC3 343291
OriC4 1989748
OriVl 959401
OriV2 4422941
OriV3 343291
OriV4 2507555
[00044] Numbers refer to the position in the published sequence (GenBank accession # U00096).
[00045] In order to identify the genetic requirements for the fragmentation of an E. coli chromosome, we generated a variety of strains with different replication and DNA processing elements inserted at different genome locations. First, we varied the number and locations of the E. coli origin of replication (OriC) and the N15 bacteriophage tos element. The wild type E. coli OriC [OriC(wt)] is a 232 bp sequence located at the 84.5 min of the chromosome of the MG1655 strain. The E. coli origin of replication was PCR- amplified from strain MG1655 using primers
5 ' -GATCTATTTATTTAGAGATCTGTTCTATTG-3 ' and
5 ' -TC AGGAAGCTTGGATCAACCGGTAG-3 '
and cloned into pUC19, fused to a kanamycin marker. The clone was used as a template to generate all the OriC PCR fragment derivatives used for recombineering We inserted this sequence at several locations of the chromosome, naming those OriCl, OriC2, OriC3, and OriC4 (Fig 3 A.). The N15 bacteriophage tos element is contained within a 564-bp DNA sequence harboring a series of inverted repeats centered on a large palindromic sequence (Rybchin et al., Mol Microbiol 33, 895-903, 1999). (Table 2) The tos DNA element was prepared by de novo gene synthesis employing oligonucleotides designed by DNA Works v3.2.2. The addition of homologous sequences to the kanamycin selection cassette was performed as previously described (Zhang et al., Nat Genet 20, 123-128, 1998) using primers
5 ' - AATTAACCCTC ACTAAAGGGCG-3 ' and
5 ' -TACCCCTTCCCGTTGACGACAAATACC AACGTATTAATACGACTC AC TATAGGGCTC-3 ' .
[00046] The tos fragment was PCR amplified using the template above and primers
5 ' -TTTAACGGTAATGGCATCGGTGTCTTATCACCAATATCCAAAGCGCAACGG TATTACTTACGTTGG-3 ' and
5 ' -CGCCCTTTAGTGAGGGTTAATTTCACAAGCGTGTTGATCAACTCAC-3 ' .
[00047] The two fragments above were recombined into pUC19, which was previously PCR-amplified using primers 5'-
TTGTCGTCAACGGGAAGGGGTAGGTCACATTATTCCAGGGCATGCAAG CTTGGCGTA ATC ATG- 3 ' and
5 ' -GACACCGATGCC ATTACCGTTAAAACTCTATATTACGTACCGAGCTCGAAT TCACTGGCCG-3'
using the GeneArt Seamless Cloning and Assembly Kit (Life Technologies, Carlsbad, CA). This clone was sequence-verified and used as a template to generate the corresponding PCR fragments for recombineering. Depending on the chosen genomic position we named these elements tosl, tos3, tos4, tos7, and tos8 (Fig. 3A). Correct insertion and fragmentation of the chromosomes were verified by PCR, southern blot, and pulse field gel electrophoresis.
[00048] Table 2
[00049] tosl (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
gacctttatactgattgttttacccatgatatatcctaaggttaaaaattgaaqcqcaa cqqtattacttacqttqqtatatttaaaacctaacttaatqattttaaatqataataaa tcataccaattqctatcaaaaqttaaqcqaacatqctqattttcacqctqtttatacac tttqaqqcatctctatctcttccqtctctatattqaaacacaatcaaaqaacatcaatc catqtqacatcccccactatctaaqaacaccataacaqaacacaacataqqaatqcaac attaatqtatcaataattcqqaacatatqcactatatcatatctcaattacqqaacata tcaqcacacaattqcccattatacqcqcqtataatqqactattqtqtqctqataaqqaq aacataaqcqcaqaacaatatqtatctattccqqtqttqtqttcctttqttattctqct attatqttctcttataqtqtqacqaaaqcaqcataattaatcqtcacttqttctttqat
tgtgttacgatatccagagacttagaaacgggggaaccgggatgagcaaggtaaaaatc ggtgagttgatcaacacgcttgtgaaattaaccctcactaaagggcggccgcgaagttc ctattctctagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaa ggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggc ctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttgg tggccccttcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgc agctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcag atggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagca gctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggc tcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattc tgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcct ttcgacctgcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagta taatacgacaaggtgaggaactaaaccatgggatcggccattgaacaagatggattgca cgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacaga cgatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctt tttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggct atcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaag cgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcac cttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgct tgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgta ctcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctc gcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgt cgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctg gattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggct acccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttta cggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttct tctgagcgggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccct ggcgaattcggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtg tgcggcgcggaagttcctattctctagaaagtataggaacttcctcgagccctatagtg agtcgtattaatttaaaaagaaggctaagaaaatcgaatcgacgttattgccaggtgta
2
[00050] Table 3
[00051] tos3 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
caccgccctttcacggcggtaacaggggttcgaatcccctaggggacgccaaaqcqcaa cggtattacttacgttggtatatttaaaacctaacttaatgattttaaatgataataaa tcataccaattgctatcaaaagttaagcgaacatgctgattttcacgctgtttatacac tttgaggcatctctatctcttccgtctctatattgaaacacaatcaaagaacatcaatc catgtgacatcccccactatctaagaacaccataacagaacacaacataggaatgcaac attaatgtatcaataattcggaacatatgcactatatcatatctcaattacggaacata tcagcacacaattgcccattatacgcgcgtataatggactattgtgtgctgataaggag aacataagcgcagaacaatatgtatctattccggtgttgtgttcctttgttattctgct attatgttctcttatagtgtgacgaaagcagcataattaatcgtcacttgttctttgat tgtgttacgatatccagagacttagaaacgggggaaccgggatgagcaaggtaaaaatc ggtgagttgatcaacacgcttgtgaaattaaccctcactaaagggcggccgcgaagttc ctattctctagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaa ggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggc ctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttgg tggccccttcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgc agctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcag atggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagca gctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggc tcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattc tgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcct ttcgacctgcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagta taatacgacaaggtgaggaactaaaccatgggatcggccattgaacaagatggattgca cgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacaga cgatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctt tttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggct atcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaag cgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcac cttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgct tgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgta ctcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctc
gcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgt cgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctg gattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggct acccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgcttta cggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttct tctgagcgggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccct ggcgaattcggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtg tgcggcgcggaagttcctattctctagaaagtataggaacttcctcgagccctatagtg agtcgtattacttgctggtttgtgagtgaaagtcgccgaccttaatatctcaaaactca tc
[00052] Table 4
[00053] tos4 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
tataatataaagtatgttgttttgattgattgctcaagtagttaaaaatgaagcgcaac ggtattacttacgttggtatatttaaaacctaacttaatgattttaaatgataataaat cataccaattgctatcaaaagttaagcgaacatgctgattttcacgctgtttatacact ttgaggcatctctatctcttccgtctctatattgaaacacaatcaaagaacatcaatcc atgtgacatcccccactatctaagaacaccataacagaacacaacataggaatgcaaca ttaatgtatcaataattcggaacatatgcactatatcatatctcaattacggaacatat cagcacacaattgcccattatacgcgcgtataatggactattgtgtgctgataaggaga acataagcgcagaacaatatgtatctattccggtgttgtgttcctttgttattctgcta ttatgttctcttatagtgtgacgaaagcagcataattaatcgtcacttgttctttgatt gtgttacgatatccagagacttagaaacgggggaaccgggatgagcaaggtaaaaatcg gtgagttgatcaacacgcttgtgaaattaaccctcactaaagggcggccgcgaagttcc tattctctagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaag gcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcc tctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggt ggccccttcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgca gctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcaga tggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcag ctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggct caggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattct
gcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctt tcgacctgcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtat aatacgacaaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcac gcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagac gatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttcttt ttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggcta tcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagc gggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacc ttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgctt gatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtac tcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcg cgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtc gtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctgg attcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggcta cccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttac ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttctt ctgagcgggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctg gcgaattcggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgt gcggcgcggaagttcctattctctagaaagtataggaacttcctcgagccctatagtga gtcgtattacattaacatcgcattcgtaatgcgaaggtcgtaggttcgactcctattat c
[00054] Table 5
[00055] tos5 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
tttcacttgggagaaagggggtgatcgaggtatatctttttctcctttcgaagcgcaac ggtattacttacgttggtatatttaaaacctaacttaatgattttaaatgataataaat cataccaattgctatcaaaagttaagcgaacatgctgattttcacgctgtttatacact ttgaggcatctctatctcttccgtctctatattgaaacacaatcaaagaacatcaatcc atgtgacatcccccactatctaagaacaccataacagaacacaacataggaatgcaaca ttaatgtatcaataattcggaacatatgcactatatcatatctcaattacggaacatat cagcacacaattgcccattatacgcgcgtataatggactattgtgtgctgataaggaga acataagcgcagaacaatatgtatctattccggtgttgtgttcctttgttattctgcta
ttatgttctcttatagtgtgacgaaagcagcataattaatcgtcacttgttctttgatt gtgttacgatatccagagacttagaaacgggggaaccgggatgagcaaggtaaaaatcg gtgagttgatcaacacgcttgtgaaattaaccctcactaaagggcggccgcgaagttcc tattctctagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaag gcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcc tctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggt ggccccttcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgca gctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcaga tggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcag ctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggct caggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattct gcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctt tcgacctgcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtat aatacgacaaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcac gcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagac gatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttcttt ttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggcta tcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagc gggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacc ttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgctt gatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtac tcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcg cgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtc gtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctgg attcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggcta cccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttac ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttctt ctgagcgggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctg gcgaattcggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgt gcggcgcggaagttcctattctctagaaagtataggaacttcctcgagccctatagtga gtcgtattactatacatcctaaggagtatttcggcgtgaaattttgatttatttcacat
[00056] Table 6
[00057] tos7 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
ggtgcccaaagggcaactaacaacaataatgctttgaaccaggtgctgcgaaqcqcaac ggtattacttacgttggtatatttaaaacctaacttaatgattttaaatgataataaat cataccaattgctatcaaaagttaagcgaacatgctgattttcacgctgtttatacact ttgaggcatctctatctcttccgtctctatattgaaacacaatcaaagaacatcaatcc atgtgacatcccccactatctaagaacaccataacagaacacaacataggaatgcaaca ttaatgtatcaataattcggaacatatgcactatatcatatctcaattacggaacatat cagcacacaattgcccattatacgcgcgtataatggactattgtgtgctgataaggaga acataagcgcagaacaatatgtatctattccggtgttgtgttcctttgttattctgcta ttatgttctcttatagtgtgacgaaagcagcataattaatcgtcacttgttctttgatt gtgttacgatatccagagacttagaaacgggggaaccgggatgagcaaggtaaaaatcg gtgagttgatcaacacgcttgtgaaattaaccctcactaaagggcggccgcgaagttcc tattctctagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaag gcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcc tctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggt ggccccttcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgca gctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcaga tggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcag ctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggct caggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattct gcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctt tcgacctgcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtat aatacgacaaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcac gcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagac gatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttcttt ttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggcta tcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagc gggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcacc ttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgctt gatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtac
tcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcg cgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtc gtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctgg attcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggcta cccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttac ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttctt ctgagcgggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctg gcgaattcggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgt gcggcgcggaagttcctattctctagaaagtataggaacttcctcgagccctatagtga gtcgtattagggcattcacggacctcataatcaacttaattttctgtccagattcaaca c
[00058] Southern Blot
[00059] Genomic DNA was isolated from the engineered strains using the
PureLink Genomic DNA kit (Life Technologies, Carlsbad, CA), digested with Hindlll, and run on 1% agarose gels. Transfer onto BrightS tar-Plus Membranes (Life
Technologies, Carlsbad, CA) was performed using the iBlot Dry Blotting System (Life Technologies, Carlsbad, CA) following the manufacturer's directions. Probes were PCR- amplified using primers described in Supporting Information and labeled using the BioPrime DNA Labeling System (Life Technologies, Carlsbad, CA). Membranes were processed and DNA was visualized using the BrightStar BioDetect Kit (Life
Technologies, Carlsbad, CA). Biotinylated 2-Log DNA Ladder (0.1-10 kb) was from New England Biolabs (Ipswich, MA).
[00060] Pulse field gel electrophoresis
[00061] Agarose-embedded genomic DNA was prepared using the CHEF Bacterial
Genomic DNA Plug Kit (Bio-Rad, Hercules, CA) and transferred to the wells of a 0.8% TAE agarose gel. Electrophoresis was performed using a CHEF-DR II System with a cooling module (Bio-Rad, Hercules, CA) with initial and final switching times of 250 sec and 900 sec, respectively. The voltage was set at 3 volts/cm. Following the 50 h run the gel was stained with ethidium bromide and visualized by standard imaging techniques. CHEF DNA Size Marker H. wingei (Bio-Rad, Hercules, CA) was used as a DNA standard (1-3.1 Mb).
[00062] Probe templates for Southern Blot hybridization were PCR-amplified using primers
5 ' -CCGCGCAATTTTCGTGAATGGAGCG-3 ' and
5 ' -GGATATTGGTGATAAGACACCGATGCC-3 ' (tosl, left);
5 ' -GAAGGCTAAGA AAATCGAATCGACG-3 ' and
5 ' -GTCAACTCAGAAGTCCGTCAATCCG-3 ' (tosl, right),
5 ' -GTGTACCTGGGCTGCGATTGCCAATCAG-3 ' and
5 ' -GCACGGCGGTAGTCACAATGCCAGC-3 ' (tos7 left);
5 ' -CTGTCCAGATTCAACACGTTAACGC-3 ' and
5 ' -CGATGCC ATGCTGGATGACGATTCC AC G-3' (tos7, right).
[00063] PCR assays to detect chromosomal fragmentation across the tosl and tos7 sequences were conducted using primers
5'-CCACCGGCCGCCCCAACTGGGG-3' and
5 ' -CGTGACAGGTTCAACTGACAATACGGG-3 ' (tos 1);
5 ' -GGCACGCGACCA AAGGTGTCCGCCG-3 ' and
5 ' -GTCGCCAGCCGGGGCAGAGTATGG-3 (tos7).
[00064] All the strains (Fig. 3B, strains 1 to 14) were viable even when some of them harbored 2 replication origins (Fig 3B, strains 2, 4, 6, 8, 10, 12, and 14). These additional replication origins were confirmed functional, as they were able to sustain chromosome replication in the absence of OriC(wt) (Fig. 3B, strains 3, 5, 7, 9, 11, and 13).
[00065] Table 7
[00066] OriCl (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
ctttatcaaaacgtcggcacattgtcggcgttttttttcggaccttgtgagatctattt atttagagatctgttctattgtgatctcttattaggatcgcactgccctgtggataaca aggatccggcttttaagatcaacaacctggaaaggatcattaactgtgaatgatcggtg atcctggaccgtataagctgggatcagaatgaggggttatacacaactcaaaaactgaa caacagttgttctttggataactaccggttgatccaagcttcctgaaattaaccctcac taaagggcggccgcgaagttcctattctctagaaagtataggaacttcattctaccggg taggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggc
acttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcg ccaaccggctccgttctttggtggccccttcgcgccaccttccactcctcccctagtca ggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagca cgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcct ttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaa ggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaagg tcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctc ctcttcctcatctccgggcctttcgacctgcagcagcacgtgttgacaattaatcatcg gcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatgggatcggc cattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcg gctatgactgggcacaacagacgatcggctgctctgatgccgccgtgttccggctgtca gcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaact gcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctg tgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccgggg caggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc aatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaac atcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcat gcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatgg tggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggc tgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttct atcgccttcttgacgagttcttctgagcgggactctggggttcgaataaagaccgacca agcgacgtctgagagctccctggcgaattcggtaccaataaaagagctttattttcatg atctgtgtgttggtttttgtgtgcggcgcggaagttcctattctctagaaagtatagga acttcctcgagccctatagtgagtcgtattagtcattttgattaatggtagcgtcgctt gtcaatgtaagttgttgataca
[00067] Table 8
[00068] OriC2 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
gaagttgatggtgaccatttctgatgcagttgttcaaaaaaacaccatgagatctattt atttagagatctgttctattgtgatctcttattaggatcgcactgccctgtggataaca
aggatccggcttttaagatcaacaacctggaaaggatcattaactgtgaatgatcggtg atcctggaccgtataagctgggatcagaatgaggggttatacacaactcaaaaactgaa caacagttgttctttggataactaccggttgatccaagcttcctgaaattaaccctcac taaagggcggccgcgaagttcctattctctagaaagtataggaacttcattctaccggg taggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggc acttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcg ccaaccggctccgttctttggtggccccttcgcgccaccttccactcctcccctagtca ggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagca cgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcct ttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaa ggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaagg tcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctc ctcttcctcatctccgggcctttcgacctgcagcagcacgtgttgacaattaatcatcg gcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatgggatcggc cattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcg gctatgactgggcacaacagacgatcggctgctctgatgccgccgtgttccggctgtca gcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaact gcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctg tgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccgggg caggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc aatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaac atcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcat gcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatgg tggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggc tgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttct atcgccttcttgacgagttcttctgagcgggactctggggttcgaataaagaccgacca agcgacgtctgagagctccctggcgaattcggtaccaataaaagagctttattttcatg atctgtgtgttggtttttgtgtgcggcgcggaagttcctattctctagaaagtatagga acttcctcgagccctatagtgagtcgtattatgaagtgtgatgaacttcaaatcagcgt gttagaggttaattgcgaaagg
[00069] Table 9
[00070] OriC3 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
aaagtagcagtaaaacctataacgtaaatttaaattgttaaattaacgccqatctattt atttagagatctgttctattgtgatctcttattaggatcgcactgccctgtggataaca aggatccggcttttaagatcaacaacctggaaaggatcattaactgtgaatgatcggtg atcctggaccgtataagctgggatcagaatgaggggttatacacaactcaaaaactgaa caacagttgttctttggataactaccggttgatccaagcttcctgaaattaaccctcac taaagggcggccgcgaagttcctattctctagaaagtataggaacttcattctaccggg taggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggc acttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcg ccaaccggctccgttctttggtggccccttcgcgccaccttccactcctcccctagtca ggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagca cgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcct ttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaa ggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaagg tcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctc ctcttcctcatctccgggcctttcgacctgcagcagcacgtgttgacaattaatcatcg gcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatgggatcggc cattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcg gctatgactgggcacaacagacgatcggctgctctgatgccgccgtgttccggctgtca gcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaact gcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctg tgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccgggg caggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc aatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaac atcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcat gcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatgg tggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggc tgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttct
atcgccttcttgacgagttcttctgagcgggactctggggttcgaataaagaccgacca agcgacgtctgagagctccctggcgaattcggtaccaataaaagagctttattttcatg atctgtgtgttggtttttgtgtgcggcgcggaagttcctattctctagaaagtatagga acttcctcgagccctatagtgagtcgtattactccagtacacaatacttcacacgttag ttatgagcgatttctgatagtg
[00071] Table 10
[00072] OriC4 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
tatcagagatactttttgagtggctttgctggtgattaaaaattaaggaggatctattt atttagagatctgttctattgtgatctcttattaggatcgcactgccctgtggataaca aggatccggcttttaagatcaacaacctggaaaggatcattaactgtgaatgatcggtg atcctggaccgtataagctgggatcagaatgaggggttatacacaactcaaaaactgaa caacagttgttctttggataactaccggttgatccaagcttcctgaaattaaccctcac taaagggcggccgcgaagttcctattctctagaaagtataggaacttcattctaccggg taggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggc acttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcg ccaaccggctccgttctttggtggccccttcgcgccaccttccactcctcccctagtca ggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagca cgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcct ttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaa ggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaagg tcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctc ctcttcctcatctccgggcctttcgacctgcagcagcacgtgttgacaattaatcatcg gcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatgggatcggc cattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcg gctatgactgggcacaacagacgatcggctgctctgatgccgccgtgttccggctgtca gcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaact gcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctg tgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccgggg caggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgc aatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaac atcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg
gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcat gcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatgg tggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgc tatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggc tgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttct atcgccttcttgacgagttcttctgagcgggactctggggttcgaataaagaccgacca agcgacgtctgagagctccctggcgaattcggtaccaataaaagagctttattttcatg atctgtgtgttggtttttgtgtgcggcgcggaagttcctattctctagaaagtatagga acttcctcgagccctatagtgagtcgtattaggtgtaacgacaagttgcaggcacaaaa aaaccacccgaaggtggtttca
[00073] Table 11
[00074] DOriC(wt) (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
ctcaactttgtcggcttgagaaagacctgggatcctgggtattaaaaagaaaattaacc ctcactaaagggcggccgcgaagttcctattctctagaaagtataggaacttcattcta ccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgc tgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggt aggcgccaaccggctccgttctttggtggccccttcgcgccaccttccactcctcccct agtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaag tagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggta ggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggct gggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgccc gaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctg ttctcctcttcctcatctccgggcctttcgacctgcagcagcacgtgttgacaattaat catcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggga tcggccattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggct attcggctatgactgggcacaacagacgatcggctgctctgatgccgccgtgttccggc tgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaat gaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgc agctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgc cggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggct gatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagc
gaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatg atctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcg cgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatat catggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcgg accgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaa tgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgc cttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaataaagacc gaccaagcgacgtctgagagctccctggcgaattcggtaccaataaaagagctttattt tcatgatctgtgtgttggtttttgtgtgcggcgcggaagttcctattctctagaaagta taggaacttcctcgagccctatagtgagtcgtattacagagttatccacagtagatcgc acgatctgtatacttatttgagtaaat
[00075] Strains were later transformed with the plasmid pJAZZ-OC, which expresses the bacteriophage N15 telN gene (Godiska et al., Nucleic Acids Res 38, e88, 2010) and selected on chloramphenicol LB plates. We expected that the resulting strains should have 1 or 2 linear chromosomes depending on the number of tos elements inserted in their genomes. Only those cells harboring 1 tos element in their genomes resulted in viable cells after transformation (Fig. 3B, strains 1 and 14). These results suggest that at least one of the smaller chromosomes in those strains harboring 2 tos sites is either unable to replicate properly or partition accurately into the two daughter cells.
Insufficient replication and partitioning factors might account for these results in an apparent analogy to plasmids belonging to the same incompatibility group.
Example 2:
[00076] Use of a heterologous origin of replication
[00077] Consequently, we shifted our focus to origins of replication present in bacteria harboring multiple chromosomes. In almost all of the sequenced multipartite genomes, the different chromosomes appear to contain different origins of replication, which may prevent incompatibility between co-resident chromosomes (Egan et al., Mol Microbiol 56, 1129-1138, 2005). We imagined then that an E. coli cell with two essential chromosomes with different replication and partitioning requirements may be viable. For the proof of concept of the hypothesis above we chose the Vibrio cholerae multi
chromosome system, which has one primary (2.96 Mbp) and one secondary chromosome (1.07 Mbp) (Heidelberg et al., Nature 406, 477-483, 2000). Whereas the features of the replication origin of the primary chromosome are essentially the same as those of the E. coli chromosome, replication of the secondary chromosome is controlled by its own initiator RctB (Duigouet al., J Bacteriol 188, 6419-6424, 2006). The genetic locus involved in replication includes the rctB gene and an array of repeats, which is reminiscent to that of some E. coli plasmids (Jha et al., Biochimica et biophysica acta 1819, 826-829, 2012). We then PCR amplified and cloned a 5.6 kb region encompassing the origin of replication of V. cholerae 's secondary chromosome (Egan et al., Cell 114, 521-530, 2003). A fragment containing the Vibrio cholerae replication origin of chromosome II was PCR- amplified from genomic DNA of strain 01 biovar El Tor N16961 (ATCC, Manassas, VA (Heidelberg et al., Nature 406, 477-483, 2000) using primers
5 ' - AAAAAAGGCGAGTTCATTAACGATGTCGGCCC-3 ' and
5 ' -TATCGGCGGTTATTCGGTTCAATGTCAGAC-3 ' .
[00078] The kanamycin fusion approach for the generation of insertion fragments as described above was followed. We inserted this sequence into 4 different locations of the E. coli chromosome naming those OriVl, OriV2, OriV3, and OriV4, combining them with tos elements placed at various sites (Fig. 3B, strains 15 to 22). In a few cases, the wild-type OriC was subsequently knocked out, indicating that OriV can sustain replication of the whole E. coli circular chromosome by its own (Fig. 3B, strains 15 and 21). Upon transformation of the strains with two tos sequences inserted into their genomes with the plasmid pJAZZ-OC, only strains 20 and 22 yielded colonies on LB chloramphenicol plates (Fig. 3B, strains 17 to 22). Out of these two, only strain 22 yielded hundreds of colonies in a consistent fashion when transformed with pJAZZ-OC. The chromosome sizes and cleavage sites of strain 22 could be unequivocally confirmed by PCR, southern blot, and pulse field gel electrophoresis (Fig 3C, 3D, and 3E). The topological characterization of the genome of strain 22 is consistent with a model where the original 4.6 Mbp circular E. coli chromosome is split into 2 linear chromosomes of 3.27 and 1.37 Mbp (Fig. 3F).
[00079] Table 12
[00080] OriVl (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
ctttatcaaaacgtcggcacattgtcggcgttttttttcggaccttgtgaaaaaaaqqc qaqttcattaacqatqtcqqcccaqaaacqctqqcqatttatqaaaaqtactqqcaqcq cctaaqaaaccaataaqqctaaqccccctaaaacqcacaaaqcccqcatcaqcqqqctt tqttatttqaqttqactcaqtttaqcttacqctqcacaaaatcaaqaatatcttqcatc aqctcatcatcaattttcttcaaattcaqcaccaaattattqcctttacqaqcataqct qqcqcqqcctttqatqaqctccaccttcqqtqtttcqqtqcqcttaqqaqqtaacacat cttqaatccaqctttcqataqtttccqtqacttctttqqtaatacqcqccacaccttqa qcttqaqattqctqccacacqaaaccattttcttqatqqcatttcqctaataattqctc acqctqaqcctcattcaqctcqttaaactqtttatqtaatttaacqataqtaqqqcqqc ccaqctcqacaacactcqqatacqcctqcaaaaqctctaqcqqtaaaqcqqcqqctttt aaqqcaccactqaccaatqcctcqctqcactqqaacattttqqcaaqcqctttttqqtc ttccqcttcaccactatcqaqcttqqcttqcatctctttacctttctcatataqaqaaa qaqqtttatqcqcattcqcqacatcaqacaaaaacttaqcqtqctcaqcattqatattt tcaqccacatacaccaaaaactctttqcccqccaaqatacaaqacatqcqacqacqqct accatcaaqcacttcqattttqccatctqcqqttttacqqccaacqqctqqqtattqct qtccacqctcacqcaatqtqqtcaqaacatcaqccaaqqcatqttcqqttaaaaacqcc tqttcacqqqcattttqaqcaaacaccacqqttttttccqcqacttcatcaqccqqaat tcqcatcaqttcaaaqqtcactacctcttcacccqctacaqccaactcaatcatctqtq cttqtqctttcaccqcaqattqcqcttctqcaqqcqtcqttqcacqqcqcttatccqcc tttccaaacaqctttqcqttcaqttcaqaaqttttaattqccataaqttacttacccct qattcaqtqaaqaccaatqtqaatqaaqtacqcqctctaqctctaaaqcacttttttqt accqcatcctqaqcqqtcqccaaqqtttttttaccqccctcqaaatcqttaacqqtcaa atcaaaqacqqtactqtaaqtatccqcacaqqtttcaaacqcacqqctqcqtqqqatqq tqqccatcatqacttqatcqcccaacaaataattcatttcqqtcaqtaccqacacctqc ttcttqttqtcatcctcaaacatqqttqqcatcaqqcqtacaaattcqaqccctttcca atcttcaqqqaacatctcqtacaccqtqqqcaaatqttqqaaqaaattqaccqtaqaaq cccaqtccaqtcqcttcqccqcacaaqqqatcaqtaaqqcattcqaqqcatacatcqcq ttccataccaqtqqatcaacqtqtqqaccaqtatcaatcatqatqatqtcaaaatcqct qqcaattttatcqatcaqcttctctttqaqtaaqcqaacaatatctaqtqattqatttt
gtgagagatattgccacgcctctgcgttaaacatcgcatcttcaggaaacgcagaaatg gttttcaaattcggatattgagttggcaacatcacgtttttgcgcaaaaactcagtgtc cacttgcaccccatctggcacattatccagcatgatatcaaccgcggaatagatattcg tatgctcagccagactgatttgtggattcaagaataggcgtaatgaaccttgtgggtct aagtcaatcaagcagatgcggtaacgcttatccaaattgagcgctaaacaagcggcaag gtgtaccgcggtcattgatttccccgtaccacccttttggttctgcacgttgatgatcc acggtttattctcattattttttttgcgctcatggaatttaggcacgccagcggcatcc atcaacatatgcgcttcggaaagagagatagagtagtgattcgcgttatttttggtaaa ttgatgtcccgcttcttccatcttagcgatagcttcatcaagcttgcgacgtgttaagc ctgaacgagtttccataagggctttagacattggaggaaaatgctcatcacggcgctcc tctaatacaatctcaattcgatcggcctgcacttgttgggtaagttgtgcaagctggta gagattctctatcgtttgttctcttttcattgccaatttccgttattagggctttaaac agattgtacagcatagtttatttaaaacaacaaaaaggtgaacataaaacaatgaatca aaatcacacatattggagtattaacagaaaattgataccaaacgaacaaagttaagtat aaaaaccgcgtttaaataacccacatattcttcgataaggagaaaacattttaaatatt acagtgtcacttatttacaatgtaaagccacgttttgaagtgatgatgaataaataaaa gcgagccgtaagcggaacgattaaaccgagccactaagttacggtgaatgccattctga ttgaaatgatgcgcaggattcaagcaagatgagaaaatgcctatctttcctccagcgaa taggtatcaccgatacgatgatcaagagcagcagcttgatcattcttccgtaaaaaata gagggttaaggaaacatgatcaagagctcatcatggctatgagtcgaggcaagagaatt aacaattgaagatcttcaatcggatcgatgatcaagaggtaaatcgtcgcggaagcatg taaattcattatcaatttacggtcgatgtcaggcagagtaaggctttggctagtcagtg atgaaaaaccgtctatcctaacaagtctcagtcaaaacaagataaacagaacaacagcc atgatcatgctttcgtaatcccgctccgtcaccttggccagcgcaatatggcgctgaag atgtcaattggaagcacaagtcacaagtattcattgcgatatggccaagaaatcatcct ctcttgatcatctttccgtggtcatgagagtacgagaggaaggagatacaacgacctat cttgatgtcatccactcaggttgtggataaactgtgtgagcaccttgatcatgcttaga agcttacgttgatcattgattctgttgactgatgatcatgettagaggaacaaatgate atgctttcgatcttgtattgatcatggtttccatcgatacatgatcatgcttctgaatg gcttaaaataatctcttttaattacaataaattagaactaaagatcgtcacagatcatt agatcactctaatcatatctaattatttaaatcagaaagatcagttatttaaaaacaac aaatttttctttatttgtgatctccttttccttatcctcttggaactatagtgatatta
cggtaagtgtgatacggatctaaccatgagctcagaagaaaaacgattgatcaaattgc caagaactcacaaagatggtcatctttttgaagtctctgaagccgcgattgactggatt gaacagtatcaacactttaaaggtgtcacgaaaagcattgttgaacttttgaatctgat ctcactgcgtggattacgcagtagagatggcttagtttcaaccacagaactgattgatg caaccgatgggcagctgacgcgtgcagccatccagcagcgcttgagagcagcggtagct gttggattgttcaaacaaatcccagtgcgttttgaagaggggctggctggcaaaaccat gctccatcgtttcattaaccccaaccaattgatctcggtactcggctcaaccagcttag tcactgaatcggttaagcaaaatgaaaagcaaaagcgctcaaaagcattagcgcagacg caagtcaatcaacgtttactgcatgagcatggtttaaatacaccgccagccatgaaaga tgaggctgatcagtttgtggtctcaccgactaactgggcagggatcattgatcaagcgt tagcgccacccagaacccgcaagagctaccaaaagtctatggtttcgatatcgggtact cgtgctgtgattgaaacacgatcgtctaaaaacatcatgacggtcgacgatctgatgac tttgtttgccttattcactttaacagtgcaataccatgatcatcaccaagatgattacc atttcaatgctaaacaagcaccaaacaaaacgccgctgtatatcaccgacattctctct ttacgtggcaaaaaagacagcggcccggcacgtgactcgatccgtgacagtattgatcg tattgaatttaccgattttcagttgcatgaactgacgggtcgttggctcagtgagaata tgccagaaggctttaaaagcgatcgttttcgctttttagcgcgcaccatcaccgcttcc gaagaggcacctgtggaaggcagtgatggcgagatccgcatcaaacccaatctgtacat tttggtgtgggagccttcgttttttgaagagctattgacgcgagattatttcttcctat ttccaccggagatcttgaaacaacataccttggtatttcagctctactcctatttccgt agccgaatgtctcgtcgtcataccgatgtaatgatgctgagtgaactcaaccaaaaatt ggccagaaacatcgaatggcgacggttttctatggatctgatccgcgaacttcgtcgtc tctccgaagggaaggggagtgaagatctgtttgtggtcaatctctggggttatcacttg actgtgaaaagcattgaagagaaaggcaaagtggtggattaccaagtcgatatcaaatg tgatgtggaagaggtactgcgctattcacgcgccaaaaccaccaacgcgggtaaacgca atatggctccaaccttgcctaaccctttacgtaacgagctggtttccaagcagaaactg gctgagttatcgagcatcatcgatggtgaatttgaaccaatccagcgcaaagccccttc gccgagaggccgcttaggtcggcgcgtgaagctacgtaaacatcttgtcgaaatcaatg ctgatgaaatcaccattactctatcgcgttatacctctccagaagcgctagaacgcagt ataacggctttagcggctatgactggacacgccccttcatcaatcaaagaagagtgtgt agagctcatagacaagctagattggctgcgtgttgaaaacgatgtgatccaatacccga cattgagcaagctgcttgagctctacaacagccaaaatgagagtaaacatctgtcgatc
gaaaaattgatcgcaggtttagcggtacgccgtaaagtctgtaaattggttcaagatgg gcacattgacgaaacggtgtatcgagccttagatgagatggccgctggagcctaaccaa aacggattaggctgggcgttggttttgtgacttaaacctgacaacagtctgacattgaa ccgaataaccgccgataaattaaccctcactaaagggcggccgcgaagttcctattctc tagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaaggcagtct ggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcc tcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggcccct tcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgcagctcgcg tcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacag caccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgct ccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggc gggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgct tcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacct gcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacga caaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcacgcaggtt ctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacgatcggc tgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaa gaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggc tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagg gactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcc tgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccgg ctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatg gaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagc cgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgaccc atggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatc gactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtga tattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcg ccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctggcgaatt cggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagtgagtcgtat tagtcattttgattaatggtagcgtcgcttgtcaatgtaagttgttgataca
[00081] Table 13
[00082] OriV2 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
gaagttgatggtgaccatttctgatgcagttgttcaaaaaaacaccatgaaaaaaaqqc gagttcattaacgatgtcggcccagaaacgctggcgatttatgaaaagtactggcagcg cctaagaaaccaataaggctaagccccctaaaacgcacaaagcccgcatcagcgggctt tgttatttgagttgactcagtttagcttacgctgcacaaaatcaagaatatcttgcatc agctcatcatcaattttcttcaaattcagcaccaaattattgcctttacgagcatagct ggcgcggcctttgatgagctccaccttcggtgtttcggtgcgcttaggaggtaacacat cttgaatccagctttcgatagtttccgtgacttctttggtaatacgcgccacaccttga gcttgagattgctgccacacgaaaccattttcttgatggcatttcgctaataattgctc acgctgagcctcattcagctcgttaaactgtttatgtaatttaacgatagtagggcggc ccagctcgacaacactcggatacgcctgcaaaagctctagcggtaaagcggcggctttt aaggcaccactgaccaatgcctcgctgcactggaacattttggcaagcgctttttggtc ttccgcttcaccactatcgagcttggcttgcatctctttacctttctcatatagagaaa gaggtttatgcgcattcgcgacatcagacaaaaacttagcgtgctcagcattgatattt tcagccacatacaccaaaaactctttgcccgccaagatacaagacatgcgacgacggct accatcaagcacttcgattttgccatctgcggttttacggccaacggctgggtattgct gtccacgctcacgcaatgtggtcagaacatcagccaaggcatgttcggttaaaaacgcc tgttcacgggcattttgagcaaacaccacggttttttccgcgacttcatcagccggaat tcgcatcagttcaaaggtcactacctcttcacccgctacagccaactcaatcatctgtg cttgtgctttcaccgcagattgcgcttctgcaggcgtcgttgcacggcgcttatccgcc tttccaaacagctttgcgttcagttcagaagttttaattgccataagttacttacccct gattcagtgaagaccaatgtgaatgaagtacgcgctctagctctaaagcacttttttgt accgcatcctgagcggtcgccaaggtttttttaccgccctcgaaatcgttaacggtcaa atcaaagacggtactgtaagtatccgcacaggtttcaaacgcacggctgcgtgggatgg tggccatcatgacttgatcgcccaacaaataattcatttcggtcagtaccgacacctgc ttcttgttgtcatcctcaaacatggttggcatcaggcgtacaaattcgagccctttcca atcttcagggaacatctcgtacaccgtgggcaaatgttggaagaaattgaccgtagaag cccagtccagtcgcttcgccgcacaagggatcagtaaggcattcgaggcatacatcgcg ttccataccagtggatcaacgtgtggaccagtatcaatcatgatgatgtcaaaatcgct ggcaattttatcgatcagcttctctttgagtaagcgaacaatatctagtgattgatttt
gtgagagatattgccacgcctctgcgttaaacatcgcatcttcaggaaacgcagaaatg gttttcaaattcggatattgagttggcaacatcacgtttttgcgcaaaaactcagtgtc cacttgcaccccatctggcacattatccagcatgatatcaaccgcggaatagatattcg tatgctcagccagactgatttgtggattcaagaataggcgtaatgaaccttgtgggtct aagtcaatcaagcagatgcggtaacgcttatccaaattgagcgctaaacaagcggcaag gtgtaccgcggtcattgatttccccgtaccacccttttggttctgcacgttgatgatcc acggtttattctcattattttttttgcgctcatggaatttaggcacgccagcggcatcc atcaacatatgcgcttcggaaagagagatagagtagtgattcgcgttatttttggtaaa ttgatgtcccgcttcttccatcttagcgatagcttcatcaagcttgcgacgtgttaagc ctgaacgagtttccataagggctttagacattggaggaaaatgctcatcacggcgctcc tctaatacaatctcaattcgatcggcctgcacttgttgggtaagttgtgcaagctggta gagattctctatcgtttgttctcttttcattgccaatttccgttattagggctttaaac agattgtacagcatagtttatttaaaacaacaaaaaggtgaacataaaacaatgaatca aaatcacacatattggagtattaacagaaaattgataccaaacgaacaaagttaagtat aaaaaccgcgtttaaataacccacatattcttcgataaggagaaaacattttaaatatt acagtgtcacttatttacaatgtaaagccacgttttgaagtgatgatgaataaataaaa gcgagccgtaagcggaacgattaaaccgagccactaagttacggtgaatgccattctga ttgaaatgatgcgcaggattcaagcaagatgagaaaatgcctatctttcctccagcgaa taggtatcaccgatacgatgatcaagagcagcagcttgatcattcttccgtaaaaaata gagggttaaggaaacatgatcaagagctcatcatggctatgagtcgaggcaagagaatt aacaattgaagatcttcaatcggatcgatgatcaagaggtaaatcgtcgcggaagcatg taaattcattatcaatttacggtcgatgtcaggcagagtaaggctttggctagtcagtg atgaaaaaccgtctatcctaacaagtctcagtcaaaacaagataaacagaacaacagcc atgatcatgctttcgtaatcccgctccgtcaccttggccagcgcaatatggcgctgaag atgtcaattggaagcacaagtcacaagtattcattgcgatatggccaagaaatcatcct ctcttgatcatctttccgtggtcatgagagtacgagaggaaggagatacaacgacctat cttgatgtcatccactcaggttgtggataaactgtgtgagcaccttgatcatgcttaga agcttacgttgatcattgattctgttgactgatgatcatgettagaggaacaaatgate atgctttcgatcttgtattgatcatggtttccatcgatacatgatcatgcttctgaatg gcttaaaataatctcttttaattacaataaattagaactaaagatcgtcacagatcatt agatcactctaatcatatctaattatttaaatcagaaagatcagttatttaaaaacaac aaatttttctttatttgtgatctccttttccttatcctcttggaactatagtgatatta
cggtaagtgtgatacggatctaaccatgagctcagaagaaaaacgattgatcaaattgc caagaactcacaaagatggtcatctttttgaagtctctgaagccgcgattgactggatt gaacagtatcaacactttaaaggtgtcacgaaaagcattgttgaacttttgaatctgat ctcactgcgtggattacgcagtagagatggcttagtttcaaccacagaactgattgatg caaccgatgggcagctgacgcgtgcagccatccagcagcgcttgagagcagcggtagct gttggattgttcaaacaaatcccagtgcgttttgaagaggggctggctggcaaaaccat gctccatcgtttcattaaccccaaccaattgatctcggtactcggctcaaccagcttag tcactgaatcggttaagcaaaatgaaaagcaaaagcgctcaaaagcattagcgcagacg caagtcaatcaacgtttactgcatgagcatggtttaaatacaccgccagccatgaaaga tgaggctgatcagtttgtggtctcaccgactaactgggcagggatcattgatcaagcgt tagcgccacccagaacccgcaagagctaccaaaagtctatggtttcgatatcgggtact cgtgctgtgattgaaacacgatcgtctaaaaacatcatgacggtcgacgatctgatgac tttgtttgccttattcactttaacagtgcaataccatgatcatcaccaagatgattacc atttcaatgctaaacaagcaccaaacaaaacgccgctgtatatcaccgacattctctct ttacgtggcaaaaaagacagcggcccggcacgtgactcgatccgtgacagtattgatcg tattgaatttaccgattttcagttgcatgaactgacgggtcgttggctcagtgagaata tgccagaaggctttaaaagcgatcgttttcgctttttagcgcgcaccatcaccgcttcc gaagaggcacctgtggaaggcagtgatggcgagatccgcatcaaacccaatctgtacat tttggtgtgggagccttcgttttttgaagagctattgacgcgagattatttcttcctat ttccaccggagatcttgaaacaacataccttggtatttcagctctactcctatttccgt agccgaatgtctcgtcgtcataccgatgtaatgatgctgagtgaactcaaccaaaaatt ggccagaaacatcgaatggcgacggttttctatggatctgatccgcgaacttcgtcgtc tctccgaagggaaggggagtgaagatctgtttgtggtcaatctctggggttatcacttg actgtgaaaagcattgaagagaaaggcaaagtggtggattaccaagtcgatatcaaatg tgatgtggaagaggtactgcgctattcacgcgccaaaaccaccaacgcgggtaaacgca atatggctccaaccttgcctaaccctttacgtaacgagctggtttccaagcagaaactg gctgagttatcgagcatcatcgatggtgaatttgaaccaatccagcgcaaagccccttc gccgagaggccgcttaggtcggcgcgtgaagctacgtaaacatcttgtcgaaatcaatg ctgatgaaatcaccattactctatcgcgttatacctctccagaagcgctagaacgcagt ataacggctttagcggctatgactggacacgccccttcatcaatcaaagaagagtgtgt agagctcatagacaagctagattggctgcgtgttgaaaacgatgtgatccaatacccga cattgagcaagctgcttgagctctacaacagccaaaatgagagtaaacatctgtcgatc
gaaaaattgatcgcaggtttagcggtacgccgtaaagtctgtaaattggttcaagatgg gcacattgacgaaacggtgtatcgagccttagatgagatggccgctggagcctaaccaa aacggattaggctgggcgttggttttgtgacttaaacctgacaacagtctgacattgaa ccgaataaccgccgataaattaaccctcactaaagggcggccgcgaagttcctattctc tagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaaggcagtct ggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcc tcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggcccct tcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgcagctcgcg tcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacag caccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgct ccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggc gggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgct tcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacct gcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacga caaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcacgcaggtt ctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacgatcggc tgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaa gaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggc tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagg gactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcc tgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccgg ctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatg gaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagc cgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgaccc atggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatc gactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtga tattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcg ccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctggcgaatt cggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagtgagtcgtat tatgaagtgtgatgaacttcaaatcagcgtgttagaggttaattgcgaaagg
[00083] Table 14
[00084] OriV3 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
aaagtagcagtaaaacctataacgtaaatttaaattgttaaattaacgccaaaaaaqqc qaqttcattaacqatqtcqqcccaqaaacqctqqcqatttatqaaaaqtactqqcaqcq cctaaqaaaccaataaqqctaaqccccctaaaacqcacaaaqcccqcatcaqcqqqctt tqttatttqaqttqactcaqtttaqcttacqctqcacaaaatcaaqaatatcttqcatc aqctcatcatcaattttcttcaaattcaqcaccaaattattqcctttacqaqcataqct qqcqcqqcctttqatqaqctccaccttcqqtqtttcqqtqcqcttaqqaqqtaacacat cttqaatccaqctttcqataqtttccqtqacttctttqqtaatacqcqccacaccttqa qcttqaqattqctqccacacqaaaccattttcttqatqqcatttcqctaataattqctc acqctqaqcctcattcaqctcqttaaactqtttatqtaatttaacqataqtaqqqcqqc ccaqctcqacaacactcqqatacqcctqcaaaaqctctaqcqqtaaaqcqqcqqctttt aaqqcaccactqaccaatqcctcqctqcactqqaacattttqqcaaqcqctttttqqtc ttccqcttcaccactatcqaqcttqqcttqcatctctttacctttctcatataqaqaaa qaqqtttatqcqcattcqcqacatcaqacaaaaacttaqcqtqctcaqcattqatattt tcaqccacatacaccaaaaactctttqcccqccaaqatacaaqacatqcqacqacqqct accatcaaqcacttcqattttqccatctqcqqttttacqqccaacqqctqqqtattqct qtccacqctcacqcaatqtqqtcaqaacatcaqccaaqqcatqttcqqttaaaaacqcc tqttcacqqqcattttqaqcaaacaccacqqttttttccqcqacttcatcaqccqqaat tcqcatcaqttcaaaqqtcactacctcttcacccqctacaqccaactcaatcatctqtq cttqtqctttcaccqcaqattqcqcttctqcaqqcqtcqttqcacqqcqcttatccqcc tttccaaacaqctttqcqttcaqttcaqaaqttttaattqccataaqttacttacccct qattcaqtqaaqaccaatqtqaatqaaqtacqcqctctaqctctaaaqcacttttttqt accqcatcctqaqcqqtcqccaaqqtttttttaccqccctcqaaatcqttaacqqtcaa atcaaaqacqqtactqtaaqtatccqcacaqqtttcaaacqcacqqctqcqtqqqatqq tqqccatcatqacttqatcqcccaacaaataattcatttcqqtcaqtaccqacacctqc ttcttqttqtcatcctcaaacatqqttqqcatcaqqcqtacaaattcqaqccctttcca atcttcaqqqaacatctcqtacaccqtqqqcaaatqttqqaaqaaattqaccqtaqaaq cccaqtccaqtcqcttcqccqcacaaqqqatcaqtaaqqcattcqaqqcatacatcqcq ttccataccaqtqqatcaacqtqtqqaccaqtatcaatcatqatqatqtcaaaatcqct qqcaattttatcqatcaqcttctctttqaqtaaqcqaacaatatctaqtqattqatttt
gtgagagatattgccacgcctctgcgttaaacatcgcatcttcaggaaacgcagaaatg gttttcaaattcggatattgagttggcaacatcacgtttttgcgcaaaaactcagtgtc cacttgcaccccatctggcacattatccagcatgatatcaaccgcggaatagatattcg tatgctcagccagactgatttgtggattcaagaataggcgtaatgaaccttgtgggtct aagtcaatcaagcagatgcggtaacgcttatccaaattgagcgctaaacaagcggcaag gtgtaccgcggtcattgatttccccgtaccacccttttggttctgcacgttgatgatcc acggtttattctcattattttttttgcgctcatggaatttaggcacgccagcggcatcc atcaacatatgcgcttcggaaagagagatagagtagtgattcgcgttatttttggtaaa ttgatgtcccgcttcttccatcttagcgatagcttcatcaagcttgcgacgtgttaagc ctgaacgagtttccataagggctttagacattggaggaaaatgctcatcacggcgctcc tctaatacaatctcaattcgatcggcctgcacttgttgggtaagttgtgcaagctggta gagattctctatcgtttgttctcttttcattgccaatttccgttattagggctttaaac agattgtacagcatagtttatttaaaacaacaaaaaggtgaacataaaacaatgaatca aaatcacacatattggagtattaacagaaaattgataccaaacgaacaaagttaagtat aaaaaccgcgtttaaataacccacatattcttcgataaggagaaaacattttaaatatt acagtgtcacttatttacaatgtaaagccacgttttgaagtgatgatgaataaataaaa gcgagccgtaagcggaacgattaaaccgagccactaagttacggtgaatgccattctga ttgaaatgatgcgcaggattcaagcaagatgagaaaatgcctatctttcctccagcgaa taggtatcaccgatacgatgatcaagagcagcagcttgatcattcttccgtaaaaaata gagggttaaggaaacatgatcaagagctcatcatggctatgagtcgaggcaagagaatt aacaattgaagatcttcaatcggatcgatgatcaagaggtaaatcgtcgcggaagcatg taaattcattatcaatttacggtcgatgtcaggcagagtaaggctttggctagtcagtg atgaaaaaccgtctatcctaacaagtctcagtcaaaacaagataaacagaacaacagcc atgatcatgctttcgtaatcccgctccgtcaccttggccagcgcaatatggcgctgaag atgtcaattggaagcacaagtcacaagtattcattgcgatatggccaagaaatcatcct ctcttgatcatctttccgtggtcatgagagtacgagaggaaggagatacaacgacctat cttgatgtcatccactcaggttgtggataaactgtgtgagcaccttgatcatgcttaga agcttacgttgatcattgattctgttgactgatgatcatgettagaggaacaaatgate atgctttcgatcttgtattgatcatggtttccatcgatacatgatcatgcttctgaatg gcttaaaataatctcttttaattacaataaattagaactaaagatcgtcacagatcatt agatcactctaatcatatctaattatttaaatcagaaagatcagttatttaaaaacaac aaatttttctttatttgtgatctccttttccttatcctcttggaactatagtgatatta
cggtaagtgtgatacggatctaaccatgagctcagaagaaaaacgattgatcaaattgc caagaactcacaaagatggtcatctttttgaagtctctgaagccgcgattgactggatt gaacagtatcaacactttaaaggtgtcacgaaaagcattgttgaacttttgaatctgat ctcactgcgtggattacgcagtagagatggcttagtttcaaccacagaactgattgatg caaccgatgggcagctgacgcgtgcagccatccagcagcgcttgagagcagcggtagct gttggattgttcaaacaaatcccagtgcgttttgaagaggggctggctggcaaaaccat gctccatcgtttcattaaccccaaccaattgatctcggtactcggctcaaccagcttag tcactgaatcggttaagcaaaatgaaaagcaaaagcgctcaaaagcattagcgcagacg caagtcaatcaacgtttactgcatgagcatggtttaaatacaccgccagccatgaaaga tgaggctgatcagtttgtggtctcaccgactaactgggcagggatcattgatcaagcgt tagcgccacccagaacccgcaagagctaccaaaagtctatggtttcgatatcgggtact cgtgctgtgattgaaacacgatcgtctaaaaacatcatgacggtcgacgatctgatgac tttgtttgccttattcactttaacagtgcaataccatgatcatcaccaagatgattacc atttcaatgctaaacaagcaccaaacaaaacgccgctgtatatcaccgacattctctct ttacgtggcaaaaaagacagcggcccggcacgtgactcgatccgtgacagtattgatcg tattgaatttaccgattttcagttgcatgaactgacgggtcgttggctcagtgagaata tgccagaaggctttaaaagcgatcgttttcgctttttagcgcgcaccatcaccgcttcc gaagaggcacctgtggaaggcagtgatggcgagatccgcatcaaacccaatctgtacat tttggtgtgggagccttcgttttttgaagagctattgacgcgagattatttcttcctat ttccaccggagatcttgaaacaacataccttggtatttcagctctactcctatttccgt agccgaatgtctcgtcgtcataccgatgtaatgatgctgagtgaactcaaccaaaaatt ggccagaaacatcgaatggcgacggttttctatggatctgatccgcgaacttcgtcgtc tctccgaagggaaggggagtgaagatctgtttgtggtcaatctctggggttatcacttg actgtgaaaagcattgaagagaaaggcaaagtggtggattaccaagtcgatatcaaatg tgatgtggaagaggtactgcgctattcacgcgccaaaaccaccaacgcgggtaaacgca atatggctccaaccttgcctaaccctttacgtaacgagctggtttccaagcagaaactg gctgagttatcgagcatcatcgatggtgaatttgaaccaatccagcgcaaagccccttc gccgagaggccgcttaggtcggcgcgtgaagctacgtaaacatcttgtcgaaatcaatg ctgatgaaatcaccattactctatcgcgttatacctctccagaagcgctagaacgcagt ataacggctttagcggctatgactggacacgccccttcatcaatcaaagaagagtgtgt agagctcatagacaagctagattggctgcgtgttgaaaacgatgtgatccaatacccga cattgagcaagctgcttgagctctacaacagccaaaatgagagtaaacatctgtcgatc
gaaaaattgatcgcaggtttagcggtacgccgtaaagtctgtaaattggttcaagatgg gcacattgacgaaacggtgtatcgagccttagatgagatggccgctggagcctaaccaa aacggattaggctgggcgttggttttgtgacttaaacctgacaacagtctgacattgaa ccgaataaccgccgataaattaaccctcactaaagggcggccgcgaagttcctattctc tagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaaggcagtct ggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcc tcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggcccct tcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgcagctcgcg tcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacag caccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgct ccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggc gggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgct tcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacct gcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacga caaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcacgcaggtt ctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacgatcggc tgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaa gaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggc tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagg gactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcc tgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccgg ctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatg gaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagc cgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgaccc atggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatc gactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtga tattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcg ccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctggcgaatt cggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagtgagtcgtat tactccagtacacaatacttcacacgttagttatgagcgatttctgatagtg
[00085] Table 15
[00086] OriV4 (Underlined and bolded characters represent the homologous sequences used for recombination into the genome of strain MG1655)
gggcataacaacaacgccggaaaggcaggctccctgtaaatatcgatctgaaaaaaqqc gagttcattaacgatgtcggcccagaaacgctggcgatttatgaaaagtactggcagcg cctaagaaaccaataaggctaagccccctaaaacgcacaaagcccgcatcagcgggctt tgttatttgagttgactcagtttagcttacgctgcacaaaatcaagaatatcttgcatc agctcatcatcaattttcttcaaattcagcaccaaattattgcctttacgagcatagct ggcgcggcctttgatgagctccaccttcggtgtttcggtgcgcttaggaggtaacacat cttgaatccagctttcgatagtttccgtgacttctttggtaatacgcgccacaccttga gcttgagattgctgccacacgaaaccattttcttgatggcatttcgctaataattgctc acgctgagcctcattcagctcgttaaactgtttatgtaatttaacgatagtagggcggc ccagctcgacaacactcggatacgcctgcaaaagctctagcggtaaagcggcggctttt aaggcaccactgaccaatgcctcgctgcactggaacattttggcaagcgctttttggtc ttccgcttcaccactatcgagcttggcttgcatctctttacctttctcatatagagaaa gaggtttatgcgcattcgcgacatcagacaaaaacttagcgtgctcagcattgatattt tcagccacatacaccaaaaactctttgcccgccaagatacaagacatgcgacgacggct accatcaagcacttcgattttgccatctgcggttttacggccaacggctgggtattgct gtccacgctcacgcaatgtggtcagaacatcagccaaggcatgttcggttaaaaacgcc tgttcacgggcattttgagcaaacaccacggttttttccgcgacttcatcagccggaat tcgcatcagttcaaaggtcactacctcttcacccgctacagccaactcaatcatctgtg cttgtgctttcaccgcagattgcgcttctgcaggcgtcgttgcacggcgcttatccgcc tttccaaacagctttgcgttcagttcagaagttttaattgccataagttacttacccct gattcagtgaagaccaatgtgaatgaagtacgcgctctagctctaaagcacttttttgt accgcatcctgagcggtcgccaaggtttttttaccgccctcgaaatcgttaacggtcaa atcaaagacggtactgtaagtatccgcacaggtttcaaacgcacggctgcgtgggatgg tggccatcatgacttgatcgcccaacaaataattcatttcggtcagtaccgacacctgc ttcttgttgtcatcctcaaacatggttggcatcaggcgtacaaattcgagccctttcca atcttcagggaacatctcgtacaccgtgggcaaatgttggaagaaattgaccgtagaag cccagtccagtcgcttcgccgcacaagggatcagtaaggcattcgaggcatacatcgcg ttccataccagtggatcaacgtgtggaccagtatcaatcatgatgatgtcaaaatcgct ggcaattttatcgatcagcttctctttgagtaagcgaacaatatctagtgattgatttt
gtgagagatattgccacgcctctgcgttaaacatcgcatcttcaggaaacgcagaaatg gttttcaaattcggatattgagttggcaacatcacgtttttgcgcaaaaactcagtgtc cacttgcaccccatctggcacattatccagcatgatatcaaccgcggaatagatattcg tatgctcagccagactgatttgtggattcaagaataggcgtaatgaaccttgtgggtct aagtcaatcaagcagatgcggtaacgcttatccaaattgagcgctaaacaagcggcaag gtgtaccgcggtcattgatttccccgtaccacccttttggttctgcacgttgatgatcc acggtttattctcattattttttttgcgctcatggaatttaggcacgccagcggcatcc atcaacatatgcgcttcggaaagagagatagagtagtgattcgcgttatttttggtaaa ttgatgtcccgcttcttccatcttagcgatagcttcatcaagcttgcgacgtgttaagc ctgaacgagtttccataagggctttagacattggaggaaaatgctcatcacggcgctcc tctaatacaatctcaattcgatcggcctgcacttgttgggtaagttgtgcaagctggta gagattctctatcgtttgttctcttttcattgccaatttccgttattagggctttaaac agattgtacagcatagtttatttaaaacaacaaaaaggtgaacataaaacaatgaatca aaatcacacatattggagtattaacagaaaattgataccaaacgaacaaagttaagtat aaaaaccgcgtttaaataacccacatattcttcgataaggagaaaacattttaaatatt acagtgtcacttatttacaatgtaaagccacgttttgaagtgatgatgaataaataaaa gcgagccgtaagcggaacgattaaaccgagccactaagttacggtgaatgccattctga ttgaaatgatgcgcaggattcaagcaagatgagaaaatgcctatctttcctccagcgaa taggtatcaccgatacgatgatcaagagcagcagcttgatcattcttccgtaaaaaata gagggttaaggaaacatgatcaagagctcatcatggctatgagtcgaggcaagagaatt aacaattgaagatcttcaatcggatcgatgatcaagaggtaaatcgtcgcggaagcatg taaattcattatcaatttacggtcgatgtcaggcagagtaaggctttggctagtcagtg atgaaaaaccgtctatcctaacaagtctcagtcaaaacaagataaacagaacaacagcc atgatcatgctttcgtaatcccgctccgtcaccttggccagcgcaatatggcgctgaag atgtcaattggaagcacaagtcacaagtattcattgcgatatggccaagaaatcatcct ctcttgatcatctttccgtggtcatgagagtacgagaggaaggagatacaacgacctat cttgatgtcatccactcaggttgtggataaactgtgtgagcaccttgatcatgcttaga agcttacgttgatcattgattctgttgactgatgatcatgettagaggaacaaatgate atgctttcgatcttgtattgatcatggtttccatcgatacatgatcatgcttctgaatg gcttaaaataatctcttttaattacaataaattagaactaaagatcgtcacagatcatt agatcactctaatcatatctaattatttaaatcagaaagatcagttatttaaaaacaac aaatttttctttatttgtgatctccttttccttatcctcttggaactatagtgatatta
cggtaagtgtgatacggatctaaccatgagctcagaagaaaaacgattgatcaaattgc caagaactcacaaagatggtcatctttttgaagtctctgaagccgcgattgactggatt gaacagtatcaacactttaaaggtgtcacgaaaagcattgttgaacttttgaatctgat ctcactgcgtggattacgcagtagagatggcttagtttcaaccacagaactgattgatg caaccgatgggcagctgacgcgtgcagccatccagcagcgcttgagagcagcggtagct gttggattgttcaaacaaatcccagtgcgttttgaagaggggctggctggcaaaaccat gctccatcgtttcattaaccccaaccaattgatctcggtactcggctcaaccagcttag tcactgaatcggttaagcaaaatgaaaagcaaaagcgctcaaaagcattagcgcagacg caagtcaatcaacgtttactgcatgagcatggtttaaatacaccgccagccatgaaaga tgaggctgatcagtttgtggtctcaccgactaactgggcagggatcattgatcaagcgt tagcgccacccagaacccgcaagagctaccaaaagtctatggtttcgatatcgggtact cgtgctgtgattgaaacacgatcgtctaaaaacatcatgacggtcgacgatctgatgac tttgtttgccttattcactttaacagtgcaataccatgatcatcaccaagatgattacc atttcaatgctaaacaagcaccaaacaaaacgccgctgtatatcaccgacattctctct ttacgtggcaaaaaagacagcggcccggcacgtgactcgatccgtgacagtattgatcg tattgaatttaccgattttcagttgcatgaactgacgggtcgttggctcagtgagaata tgccagaaggctttaaaagcgatcgttttcgctttttagcgcgcaccatcaccgcttcc gaagaggcacctgtggaaggcagtgatggcgagatccgcatcaaacccaatctgtacat tttggtgtgggagccttcgttttttgaagagctattgacgcgagattatttcttcctat ttccaccggagatcttgaaacaacataccttggtatttcagctctactcctatttccgt agccgaatgtctcgtcgtcataccgatgtaatgatgctgagtgaactcaaccaaaaatt ggccagaaacatcgaatggcgacggttttctatggatctgatccgcgaacttcgtcgtc tctccgaagggaaggggagtgaagatctgtttgtggtcaatctctggggttatcacttg actgtgaaaagcattgaagagaaaggcaaagtggtggattaccaagtcgatatcaaatg tgatgtggaagaggtactgcgctattcacgcgccaaaaccaccaacgcgggtaaacgca atatggctccaaccttgcctaaccctttacgtaacgagctggtttccaagcagaaactg gctgagttatcgagcatcatcgatggtgaatttgaaccaatccagcgcaaagccccttc gccgagaggccgcttaggtcggcgcgtgaagctacgtaaacatcttgtcgaaatcaatg ctgatgaaatcaccattactctatcgcgttatacctctccagaagcgctagaacgcagt ataacggctttagcggctatgactggacacgccccttcatcaatcaaagaagagtgtgt agagctcatagacaagctagattggctgcgtgttgaaaacgatgtgatccaatacccga cattgagcaagctgcttgagctctacaacagccaaaatgagagtaaacatctgtcgatc
gaaaaattgatcgcaggtttagcggtacgccgtaaagtctgtaaattggttcaagatgg gcacattgacgaaacggtgtatcgagccttagatgagatggccgctggagcctaaccaa aacggattaggctgggcgttggttttgtgacttaaacctgacaacagtctgacattgaa ccgaataaccgccgataaattaaccctcactaaagggcggccgcgaagttcctattctc tagaaagtataggaacttcattctaccgggtaggggaggcgcttttcccaaggcagtct ggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcc tcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggcccct tcgcgccaccttccactcctcccctagtcaggaagttcccccccgccccgcagctcgcg tcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacag caccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgct ccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggc gggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgct tcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacct gcagcagcacgtgttgacaattaatcatcggcatagtatatcggcatagtataatacga caaggtgaggaactaaaccatgggatcggccattgaacaagatggattgcacgcaggtt ctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacgatcggc tgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaa gaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggc tggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagg gactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcc tgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccgg ctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatg gaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagc cgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgaccc atggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatc gactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtga tattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcg ccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaataaagaccgaccaagcgacgtctgagagctccctggcgaatt cggtaccaataaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagtgagtcgtat taggtcacacaattactttatcgtttcagcaccaattgcagcgatgcctttt
[00087] Lytic and lysogenic replication modes for the bacteriophage N15 have been proposed (Ravin et al., Nucleic Acids Res 31, 6552-6560, 2003; Ravin, et al. Plasmid 65, 102-109, 2011). The lysogenic mode is contemplated by two models where in one of them the protelomerase processes the ends before completion of replication (mode 1), whereas in the second one the replication is completed before the molecule is processed generating a head-to-head dimer (mode 2). The lytic replication has been proposed to follow a rolling circle strategy originating from the head-to-head dimer described above, and the concatemers are cleaved at the cos sites (mode 3). The replication of the chromosomes in strain 22 probably follows Mode 1 as we were unable to detect the head-to-head dimer intermediate required for Mode 2 and 3 (southern blot in Fig. 2 and not shown).
[00088] Grow curves and microscopy
[00089] Overnight cultures of MG1655 + telN, Strain 22, and Strain 22 + telN were inoculated into fresh LB broth at an initial 600OD of 0.01 in the presence or absence of 10 μg/ml Chloramphenicol and shaken at 37°C. Their optical densities at 600nm (600OD) were measured at 1 h intervals. Grow rates (μ) were calculated by applying the formula μ = lnNl - lnN0/(tl-t0), where NO and Nl represent the culture's 600OD at 1 and 2 h (tO and tl) after inoculation. Fifty μΐ of an overnight culture was concentrated to 10 μΐ by centrifugation, following by spreading on a glass slide. After air drying, 50 μΐ of Histomount mounting solution (Life Technologies, Carlsbad, CA) was applied to the sample and covered by a cover slip. The cell morphology was visualized with a 100X oil objective under a bright- field NIKON Eclips E400 microscope.
[00090] The morphology of the colonies of strain 22 + telN was indistinguishable from those of strain MG1655 and strain 22 (not shown). However, the growth rate of strain 22 + telN (56.75 min doubling time) was 1.8 and 2 fold slower than MG1655 + telN (31.55 min) and strain 22 (27.37 min) respectively (Figure 4A). In addition, overnight cultures of strain 22 + telN contained approximately 10% of elongated cells (Figure 4B). These observations suggest that the cells with two linear chromosomes exhibit a slight cell division defect. Fluorescent microscopy studies will be required to determine whether this minor deficiency is related to chromosome duplication, partitioning or cell segmentation. The slower growth rate of these cells would potentially
offer an evolutionary advantage for faster growing suppressors, which might have escaped genome fragmentation, by regenerating a single linear or circular 4.6 Mbp chromosome. In order to test this hypothesis, PCR amplification assays across both tos elements were performed. Whereas strain 22 exhibited in all cases the PCR fragment that indicates integrity of the tos region, we failed to detect the corresponding band when strain 22 + telN was used instead, even after 100 generations or 4 successive re-streaks on LB agar (Fig 4C and 4D). Results remained the same when selective pressure against the source of telN (10 μg/ml cam) was lifted (Fig 4A, 4B and 4D). Overall, despite the slow grow rate, the strain with 2 linear chromosomes did not show any sign of genetic instability.
[00091] Further embodiments may be in accordance with following numbered clauses:
[00092] 1. A method of making a prokaryotic organism comprising two or more chromosomes comprising:
[00093] a) inserting two or more fragmentation sites into a prokaryotic
chromosome,
[00094] b) inserting one or more origins of replication into the prokaryotic chromosome,
[00095] c) inserting one or more selectable markers into the prokaryotic chromosome, and
[00096] d) cleaving the chromosome at the one or more fragmentation sites forming two or more daughter chromosomes.
[00097] 2. The method of claim 1, wherein the fragmentation site is a telomerase occupancy site (tos).
[00098] 3. The method of claim 2 wherein the chromosome is cleaved by expressing a protelomerase protein (telN) .
[00099] 4. The method of any one of the previous claims, wherein the one or more origins of replication are heterologous.
[000100] 5. The method of any one of the previous claims, wherein the one or more origins of replication are derived from an organism selected from the group consisting of Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium
tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
[000101] 6. The method of any one of the previous claims, further comprising circularizing one or more of the daughter chromosomes.
[000102] 7. A method of making a prokaryotic organism comprising two or more chromosomes comprising:
a) inserting two or more site specific recombination sites in orthogonal pairs into a prokaryotic chromosome,
b) inserting one or more origins of replication into the prokaryotic chromosome, c) inserting one or more selectable markers into the prokaryotic chromosome, and d) transiently expressing one or more recombination proteins which recognize the site specific recombination sites such that the chromosome is recombined into two or more daughter chromosomes.
[000103] 8. The method of claim 7, wherein the one or more origins of replication are heterologous.
[000104] 9. The method of claim 7 or 8, wherein the one or more origins of replication are derived from an organism selected from the group consisting of Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
[000105] 10. The method of any one of claims 7-9, further comprising linearizing one or more of the daughter chromosomes.
[000106] 11. A prokaryotic cell comprising two or more chromosomes as produced by any one of claims 1-10, wherein each chromosome is capable of replicating independently, and wherein each chromosome further comprises one or more selectable markers.
[000107] 12. The prokaryotic cell of claim 11, wherein at least one of the chromosomes is linear.
[000108] 13. The prokaryotic cell of claim 11, wherein at least one of the chromosomes is circular.
[000109] 14. The prokaryotic cell of any one of claims 11-13, wherein each chromosome comprises a unique origin of replication.
[000110] 15. The prokaryotic cell of any one of claims 11-14, wherein each chromosome is between 1 Kbp and 13 Mbp in size
[000111] 16. A method of modifying a prokaryotic organism of any one of claims 11-15 comprising:
a) constructing a modified chromosome comprising a selectable marker wherein the modified chromosome corresponds to a chromosome of the prokaryotic organism to be modified,
b) transfecting transforming, electrotransforming, transplantating, or conjugating the modified chromosome into the prokaryotic organism to be modified, and
c) selecting for a transformed prokaryotic organism comprising the modified
chromosome.
[000112] 17. The method of claim 16, further comprising counterselecting the chromosome of the prokaryotic organism to be modified.
[000113] 18. The method of claim 16 or 17, wherein the modified chromosome confers on the modified prokaryotic organism one or more properties selected from the group consisting of production of biofuels such as diesel and jet fuel; biobased chemicals such as alcohols, acids and olefins; enzymes with higher yields, greater activity or greater stability; C02 sequestration methods; production of products for textiles, foods and detergents and synthetic vaccine production.
[000114] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill of those of ordinary skill in the art and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be
incorporated by reference.
[000115] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one of ordinary skill in the art are intended to be included within the scope of the following claims.
Claims
1. A method of making a prokaryotic organism comprising two or more
chromosomes comprising:
a) inserting two or more fragmentation sites into a prokaryotic chromosome,
b) inserting one or more origins of replication into the prokaryotic chromosome, c) inserting one or more selectable markers into the prokaryotic chromosome, and d) cleaving the chromosome at the one or more fragmentation sites forming two or more daughter chromosomes.
2. The method of claim 1, wherein the fragmentation site is a telomerase occupancy site (tos).
3. The method of claim 2 wherein the chromosome is cleaved by expressing a protelomerase protein (telN) .
4. The method of any one of the previous claims, wherein the one or more origins of replication are heterologous.
5. The method of any one of the previous claims, wherein the one or more origins of replication are derived from an organism selected from the group consisting of Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei, Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
6. The method of any one of the previous claims, further comprising circularizing one or more of the daughter chromosomes.
7. A method of making a prokaryotic organism comprising two or more
chromosomes comprising:
a) inserting two or more site specific recombination sites in orthogonal pairs into a prokaryotic chromosome,
b) inserting one or more origins of replication into the prokaryotic chromosome, c) inserting one or more selectable markers into the prokaryotic chromosome, and d) transiently expressing one or more recombination proteins which recognize the site specific recombination sites such that the chromosome is recombined into two or more daughter chromosomes.
8. The method of claim 7, wherein the one or more origins of replication are heterologous.
9. The method of claim 7 or 8, wherein the one or more origins of replication are derived from an organism selected from the group consisting of Vibrio cholera, Vibrio parahaemolyticus, Vibrio vulnificus, Buchnera sp., Agrobacterium tumefaciens, Brucella melitensis, Brucella suis biovar 1, Sinorhizobium meliloti, Burkholderia mallei,
Burkholderia pseudomallei, Burkholderia cepacia, Ralstonia solanacearum, Leptospira interrogans, Rhodobacter sphaeroides and Deinococcus radiodurans .
10. The method of any one of claims 7-9, further comprising linearizing one or more of the daughter chromosomes.
11. A prokaryotic cell comprising two or more chromosomes as produced by any one of claims 1-10, wherein each chromosome is capable of replicating independently, and wherein each chromosome further comprises one or more selectable markers.
12. The prokaryotic cell of claim 11, wherein at least one of the chromosomes is linear.
13. The prokaryotic cell of claim 11, wherein at least one of the chromosomes is circular.
14. The prokaryotic cell of any one of claims 11-13, wherein each chromosome comprises a unique origin of replication.
15. The prokaryotic cell of any one of claims 11-14, wherein each chromosome is between 1 Kbp and 13 Mbp in size
16. A method of modifying a prokaryotic organism of any one of claims 11-15 comprising:
a) constructing a modified chromosome comprising a selectable marker wherein the modified chromosome corresponds to a chromosome of the prokaryotic organism to be modified,
b) transfecting transforming, electrotransforming, transplantating, or conjugating the modified chromosome into the prokaryotic organism to be modified, and
c) selecting for a transformed prokaryotic organism comprising the modified
chromosome.
17. The method of claim 16, further comprising counterselecting the chromosome of the prokaryotic organism to be modified.
18. The method of claim 16 or 17, wherein the modified chromosome confers on the modified prokaryotic organism one or more properties selected from the group consisting of production of biofuels such as diesel and jet fuel; biobased chemicals such as alcohols, acids and olefins; enzymes with higher yields, greater activity or greater stability; C02 sequestration methods; production of products for textiles, foods and detergents and synthetic vaccine production.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361835279P | 2013-06-14 | 2013-06-14 | |
| US61/835,279 | 2013-06-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014201394A2 true WO2014201394A2 (en) | 2014-12-18 |
| WO2014201394A3 WO2014201394A3 (en) | 2015-02-26 |
Family
ID=51177159
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/042363 Ceased WO2014201394A2 (en) | 2013-06-14 | 2014-06-13 | Methods and compositions for the construction of prokaryotic organisms having multiple chromosomes |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014201394A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018039639A1 (en) * | 2016-08-26 | 2018-03-01 | Synthetic Genomics, Inc. | Genetically engineered vibrio sp. and uses thereof |
-
2014
- 2014-06-13 WO PCT/US2014/042363 patent/WO2014201394A2/en not_active Ceased
Non-Patent Citations (9)
| Title |
|---|
| A. A. PROZOROV: "Additional chromosomes in bacteria: Properties and origin", MICROBIOLOGY, vol. 77, no. 4, 1 August 2008 (2008-08-01) , pages 385-394, XP055144828, ISSN: 0026-2617, DOI: 10.1134/S0026261708040012 * |
| C Mackenzie ET AL: "Multiple chromosomes in bacteria. The yin and yang of trp gene localization in Rhodobacter sphaeroides 2.4.1", Genetics, 1 October 1999 (1999-10-01), pages 525-538, XP055144826, UNITED STATES Retrieved from the Internet: URL:http://www.genetics.org/cgi/content/abstract/153/2/525 * |
| JYOTI K JHA ET AL: "Chromosome dynamics in multichromosome bacteria", BBA - GENE REGULATORY MECHANISMS, ELSEVIER, AMSTERDAM, NL, vol. 1819, no. 7, 17 January 2012 (2012-01-17), pages 826-829, XP028519131, ISSN: 1874-9399, DOI: 10.1016/J.BBAGRM.2012.01.012 [retrieved on 2012-01-28] * |
| MICHAEL A. FOGEL ET AL: "Distinct segregation dynamics of the two Vibrio cholerae chromosomes", MOLECULAR MICROBIOLOGY, vol. 55, no. 1, 27 October 2004 (2004-10-27), pages 125-136, XP055145375, ISSN: 0950-382X, DOI: 10.1111/j.1365-2958.2004.04379.x * |
| TAILIN CUI ET AL: "Escherichia coli with a linear genome", EMBO REPORTS, vol. 8, no. 2, 12 January 2007 (2007-01-12), pages 181-187, XP055145017, ISSN: 1469-221X, DOI: 10.1038/sj.embor.7400880 cited in the application * |
| TUE RASMUSSEN ET AL: "The two chromosomes of Vibrio cholerae are initiated at different time points in the cell cycle", THE EMBO JOURNAL, vol. 26, no. 13, 11 July 2007 (2007-07-11) , pages 3124-3131, XP055144821, ISSN: 0261-4189, DOI: 10.1038/sj.emboj.7601747 * |
| VAUGHN S. COOPER ET AL: "Why Genes Evolve Faster on Secondary Chromosomes in Bacteria", PLOS COMPUTATIONAL BIOLOGY, vol. 6, no. 4, 1 April 2010 (2010-04-01), page e1000732, XP055145117, DOI: 10.1371/journal.pcbi.1000732 * |
| X. WANG ET AL: "Replication and segregation of an Escherichia coli chromosome with two replication origins", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 26, 13 June 2011 (2011-06-13), pages E243-E250, XP055145060, ISSN: 0027-8424, DOI: 10.1073/pnas.1100874108 * |
| XIQUAN LIANG ET AL: "Escherichia coli with Two Linear Chromosomes", ACS SYNTHETIC BIOLOGY, vol. 2, no. 12, 20 December 2013 (2013-12-20), pages 734-740, XP055144801, ISSN: 2161-5063, DOI: 10.1021/sb400079u * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018039639A1 (en) * | 2016-08-26 | 2018-03-01 | Synthetic Genomics, Inc. | Genetically engineered vibrio sp. and uses thereof |
| US11203761B2 (en) | 2016-08-26 | 2021-12-21 | Codex Dna, Inc. | Genetically engineered Vibrio sp. and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014201394A3 (en) | 2015-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Riley et al. | Approaches to genetic tool development for rapid domestication of non-model microorganisms | |
| Niu et al. | Expanding the potential of CRISPR-Cpf1-based genome editing technology in the cyanobacterium Anabaena PCC 7120 | |
| US10301613B2 (en) | Targeted remodeling of prokaryotic genomes using CRISPR-nickases | |
| CN107083392B (en) | CRISPR/Cpf1 gene editing system and application thereof in mycobacteria | |
| US20190241899A1 (en) | Methods of Crispr Mediated Genome Modulation in V. Natriegens | |
| US20240229012A9 (en) | Site-specific genome modification technology | |
| US20230340481A1 (en) | Systems and methods for transposing cargo nucleotide sequences | |
| US12188044B2 (en) | Methods for genomic integration for Kluyveromyces host cells | |
| US20240301374A1 (en) | Systems and methods for transposing cargo nucleotide sequences | |
| CN115851664A (en) | I-B type CRISPR-Cascade-Cas3 gene editing system and application | |
| CN104388456A (en) | Construction method of vector capable of simultaneously expressing two sgRNAs | |
| US20240352433A1 (en) | Enzymes with hepn domains | |
| WO2014201394A2 (en) | Methods and compositions for the construction of prokaryotic organisms having multiple chromosomes | |
| Riedl et al. | Novel conditional plasmids regulated by chemical switches provide versatile tools for genetic engineering in Escherichia coli | |
| Bott et al. | Novel technologies for optimal strain breeding | |
| Li et al. | A Versatile Marker-Free Genome Engineering Platform to Overcome Homologous Recombination Bias in Microbes: A Case Study in Synechococcus elongatus UTEX 2973 | |
| Reeves et al. | Transfer of large contiguous DNA fragments onto a low copy plasmid or into the bacterial chromosome | |
| US20080286871A1 (en) | Modular genomes for synthetic biology and metabolic engineering | |
| US20030219902A1 (en) | Methods and vectors for facilitating site-specific recombination | |
| Mougiakos | Feel the burn: a collection of stories on hot’n’sharp DNA engineering | |
| Joseph | Development of Synthetic Biology Tools for Mesophilic Clostridium Species | |
| Flores-Valdez et al. | Construction of Novel Live Genetically Modified BCG Vaccine Candidates Using Recombineering Tools | |
| Finger-Bou | Not so giant steps on tuning protein production and diminished genomes | |
| CN118460446A (en) | A mycoplasma mutant strain and its preparation method and application | |
| Pulkkinen et al. | A set of mini-Mu transposons for versatile cloning of circular DNA and novel dual-transposon strategy for increased efficiency |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14738956 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14738956 Country of ref document: EP Kind code of ref document: A2 |
