WO2014197936A1 - Biomarkers and use thereof in identification of b-cell lymphoproliferative disorders - Google Patents

Biomarkers and use thereof in identification of b-cell lymphoproliferative disorders Download PDF

Info

Publication number
WO2014197936A1
WO2014197936A1 PCT/AU2014/000610 AU2014000610W WO2014197936A1 WO 2014197936 A1 WO2014197936 A1 WO 2014197936A1 AU 2014000610 W AU2014000610 W AU 2014000610W WO 2014197936 A1 WO2014197936 A1 WO 2014197936A1
Authority
WO
WIPO (PCT)
Prior art keywords
lymphoma
mirna
cell
subject
dlbcl
Prior art date
Application number
PCT/AU2014/000610
Other languages
French (fr)
Inventor
Maher GHANDI
Original Assignee
The State Of Queensland Acting Through Its Department Of Health
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2013902216A external-priority patent/AU2013902216A0/en
Application filed by The State Of Queensland Acting Through Its Department Of Health filed Critical The State Of Queensland Acting Through Its Department Of Health
Publication of WO2014197936A1 publication Critical patent/WO2014197936A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • THIS INVENTION relates to methods for diagnosis, prognosis and/or disease response monitoring ofB-cell lymphoproliferative disorders. More particularly, this invention relates to detennming expression levels of one or more micro-RNAs correlated with B-cell lyrnphoproliferative disorders in a biological sample from a subject
  • lymphomas such as Diffuse Large B-cell Lymphoma, relative to Hodgkin Lymphoma, the outcome is poor (Coiffier, 2007).
  • PET/CT computerized tomography
  • PET/CT computerized tomography
  • RNA are small non-coding RNA molecules that play key regulatory roles in numerous biological processes, and are ubiquitously dysregulated in malignancies including lymphoma (lorio, M. V and Croce, CM, 2009 and Lawrie, CM, etaL, 2008). They are remarkably stable in blood, are resistant to multiple freeze-thaw cycles and are present in elevated levels within the cell-free compartment of a variety of cancers (Chen, X. et al, 2008; Mitchell P.S. et aL. 2008; Allegra, A. el a/., 2012; and Gilad, S. et at, 2008). Much miRNA biomarker research has focused on identifying signatures, for use in situations where screening biomarkers would be clinically beneficial ⁇ e.g., prostrate and lung cancer).
  • MieroRWAs represent an important class of biomarkers that provide opportunities for clinical translation.
  • the invention is broadly directed to a method of diagnosis, prognosis and/or diseas e response monitor ing of B-cell lymphoproliferative di sorders.
  • the invention provides a method of determining whether or not a subject has a B-cell lymphproliferative disorder, including:
  • determining the expression level of a miRN A biomarker hi a biological sample from a subject wherein the miRNA biomarker is selected from the group consisting of miRNA- 1973, miRNA-638 and raiRNA-494, and wherein a B-cell lymphoproliferative disorder is detected if said one or more miR A biomarkers, is at an elevated level or over expressed in the biological sample.
  • the biological sample comprises tissue, blood, serum, plasma or cerebrospinal fluid.
  • the miRNAs are obtainable from a non-cellular source.
  • the biological sample is, comprises, or is obtained from a non-cellular source.
  • the biological sample may be serum, plasma, or cerebrospinal fluid, although without 1 imitation thereto.
  • the B-cell lymphoproliferative disorder is selected from the group consisting of Diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Mantle cell Lymphom and Burkitt. lymphoma.
  • the B-cell lymphproliferative disorder is classical Hodgkin Lymphoma r Diffuse Large B-cell Lymphoma.
  • the method of the first aspect farther comprises measuring an additional miRNA biomarker selected from the group consisting of miRNA-21 , mtRNA- 2861 , mi A- 155 and miRN A- t o.
  • the expression level of a protein or DNA biomarker may also be determined.
  • the protein or DNA biomarker is selected from the group consisting of CD163, Thymus and Activation-Regulated Cheraokine (TARC), lactate dehydrogenase, Epstein-Ban: Virus DNA, Enterleukin-2 receptor, Attti-fhrombin 111, CXCL13, lL-10, Galeetin-1 , CCL22 macrophage derived chemokme, CCL17 and LAG3.
  • the invention provides a method of evaluating treatment efficacy of a B-celi lymphproliferati ve disorder in a subject including;
  • determining the expression level of a miRNA biomarker in a biological sample from a subject before, during and/or after treatment wherein the miRN A biomarker is selected from the group consisting of miRNA-1973, miRNA-638 and nhRNA-494;
  • the treatment is efficacious.
  • the invention provides a method of treating a B-cell lymphoproliferative disorder in a subject including;
  • the method further comprises selecting a treatment for a B-cell lymphproliferaiive disorder based on the expression level of the miRNA biomarkers.
  • the biological sample comprises tissue, blood, serum, plasma or cerebrospinal fluid.
  • the miRNAs are obtainable from a non-cellular source.
  • the biological sample is, comprises, or is obtained from a non-cellular source.
  • the biological sample may be serum, plasma, or cerebrospinal fluid, although without limitation therefax
  • the B-ceil lymphproliferaiive disorder is selected from the group consisting of Diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, mantle cell lymphoma and Burkitt lymphoma.
  • the B-cell lymp oproliferative disorder is classical Hodgkin Lymphoma or Diffuse Large B-cell Lymphoma,
  • the method of the second and third aspects -further comprises measuring an additional miRNA biotnarker selected from the group consisting of miRNA-21 , miRNA-2861. miRNA- 155 and miRNA- 16.
  • the expression level of a protein or DNA biornarker may also be determined.
  • the protein or DNA biornarker is selected from the group consisting of CD.163, Thymus and Activation-Regulated Chemokine (TARC), lactate dehydrogenase, Epste in- Barr Virus DNA, Inter leukin-2 receptor, Anti-thrombin III, CXCLl 3, IL-10, Galectin-1 , CCL22 macrophage derived chemokine, CCL17 and LAG3.
  • the invention provides a method of determining the prognosis of a subject with a B-cell lynrphoproliferative disorder, including;
  • the biological sample comprises tissue, blood, serum, plasma or cerebrospinal fluid.
  • the rniRNAs are obtainable from a non-cellular source.
  • the biological sample is, comprises, or is obtained from a non-cellular source.
  • the biological sample may be serum, plasma, or cerebrospinal fluid, although without 1 imitation thereto.
  • the B-cell lymphoproliferative disorder is selected from the group consisting of Diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma, classical Hodgkin Lymphoma, and Burkitt lymphoma.
  • the B-cell lymphopiOliferative disorder is classical Hodgkin Lymphoma or Diffuse Large B-cel l Lymphoma.
  • the method of the fourth aspect further comprises measuring an additional miRNA biornarker selected from the grou consisting of miRNA-2 1 , miRNA-2861 , miRNA- 155 and miRNA- 16.
  • the expression level of a protein or DNA biornarker may also be determined.
  • the protein or DNA biornarker is selected from the group consisting of CD 163, Thymus and Activation- Regulated Che okine (TARC), lactate dehydrogenase, Epstein-Barr Virus DNA, Interleukin-2 receptor, Anti-thrombin III, CXCL13, IL-10, Gaiectin-1 , CCL22 macrophage derived cheniokine, CCL1 7 and LAG3.
  • a prediction of prognosis is given by a likelihood score derived from a clinical, such as Hasenclever scores., sub-division into early good risk/early poor risk stages, or International Prognostic Score.
  • the prognosis is used, at least in part, to determine whether the subject would benefit from treatment of the B-cell lymphoproliferative diso rder.
  • the prognosis is used, at least in part, to develop a treatment strategy for the subject.
  • the prognosis is used, at least in part, to determine disease progression in the subject.
  • the prognosis is defined as an estimated time of sun iv l.
  • the method of any one of the above aspects includes determining suitability of the subject for treatment based, at least in part, on the diagnosis and/or prognosis.
  • reduced, down regulated or absent expression levels of miRNA- 1973, miRNA-638 and/or mi NA-494 indicates an effective B-celi lymphopro liferative disorder therapy.
  • the subject is human.
  • FIG 1 Differential expression of human nriRNA in classical Hodgkin Lymphoma (cHL) primary tissue.
  • cHL Hodgkin Lymphoma
  • A Unsupervised clustering of the top 50 differentially expressed human miRNA by mieroarray in a discovery cohort of 14 cHL diseased nodes (MC; mixed cellularity, MS: nodular sclerosing) versus 8 non-malignant lymph nodes (LN). Red denotes high expression.
  • Figure 2 Differential expression of human miR A in cl I L primary tissue.
  • A- G Comparison of miRN A expression in prospective cohort of 27 cOL diseased nodes versus 8 non-malignant lymph nodes by q ' RT-PCR. Error bars represent mean with SEIV1.
  • FIG. 1 Plasma miRNA-494, miRNA- 1973 and miR A-21 levels in cHL.
  • A- C Receiver Operating Characteristic (ROC) plots demonstrate high sensitivity and specificity of pre-therapy cHL versus healthy participant;
  • D-F pie-therapy cHL versus CR six months post-therapy; AUG, area under the curve.
  • Figure 4 Kinetics of circulating miRNA cHL disease response biomarkers.
  • A-C Plasma miRNA levels throughout therapy in cHL patients in CR at sis months post- therapy.
  • D-F Compariso of interim therapy treatment response. cHL patients, restricted to those with paired interim samples that matched interim radiological assessment.
  • FIG. 5 For cHL, circulating miRN A relative to cellular RNA (116).
  • A Plasma U6 levels; and
  • B plasma albumin-DNA levels throughout therapy in cHL patients in CR at six months post-therapy,
  • Figure 7 Table showing associations with cHL clinical prognosticators and pre- therapy absolute levels of miRNA-494, miR A- 1.973 and miRNA-21 .
  • Figure 8 Table showing miRNA-638 in the plasma of 40 patients with Diffuse Large B-cell Lymphoma (40 pre-therapy samples, 37 post-cycle 4 of the chemo immunotherapy regimen 'CHOP-R 1 . with 32 paired pre/post samples), compared to healthy control, participant plasma.
  • Figure 7 A shows a significant drop difference by pair ed-t test, between pre-therapy relative to controls,, as does post-cycle 4 to controls.
  • miRNA- 1973 human sequence (ACCGUGCAAAGGUAGCAUA) miRNA-21 human sequence (UAGCUUAUCAGACUGAUGUUGA). miRNA-494 human sequence (UGAAACAUACACGGGAAACCUC). miRNA-2861 human sequence (GGGGCCtiGGCGGUGGGCGG). nai NA-155 human sequence (UUAAU ' GCU AAUCGUG AUAGG GGU).
  • miRNA-638 human sequence AGGGAUCGCGGGCGGGUGGCGG CCI..: .
  • miRNA-1976 primer sequence (5 'ACCGTGCAAAGGTAGCATAAA-
  • rnIRNA-2861 primer sequence S'-GGCGGTGGGCGGAAA -3'.
  • iniRNA- 1 55 primer sequence (5 '-TTAATGCT AATCGTGATAGGGG TAA.-3').
  • miRNA-638 primer sequence (5 '-CGGGTGGCGGCCTAA-3 ' ).
  • U6 primer sequence (5 * -CAAA.TTCGTGAAGCGTTCCATA-3').
  • Qiage miScript primer raillNA-39 (cel-miR A-39) (5 ! - UCACCGGGUGUAAAUCAGCUUG-3 ')
  • the invention provides methods for assessing subjects with B-cell lympiioproliferative disorders, and particularly to predict, diagnose, and/or monitor B-cell lympiioproliferative disorders in a subject prior to, during and/or after treatment.
  • the methods include determining the expression levels of miRNA biomarkers.
  • biological sample is meant a sample that comprises for example a bodily fluid including whole blood, serum, plasma, cerebrospinal fluid and the like or a sample that comprises tissue, or any other material isolated in whole or in part from a subject
  • a biological sample may include without limitation sections of tissues such as a biopsy and autopsy sample, and frozen sections taken for histological purposes such as blood, plasma, serum, cerebrospinal fluid and the like.
  • Biological samples may also include explants and primary or transformed cell cultures derived from the subject's tissues.
  • the raiRNAs are obtainable from a non-celhiiar source.
  • the biological sample is, comprises, or is obtained f om a non-cellular source.
  • the biological sample may be serum, plasma, or cerebrospinal fluid, although without limitation thereto.
  • control sample typically refers to a biological sample from a (healthy) non- diseased individual not having a B-cell lympiioproliferative disorder.
  • the control sample may be from a subject known to be free of a B-cell ' lympiioproliferative disorder.
  • the control sample may be from a subject in remission from a B-cell lymphoproUferative disorder.
  • the control sample may be a pooled, average or an individual sample.
  • An internal control is a marker from the same biological sample being tested, such as a miRNA biomarker control.
  • determining includes any form of measurement, and includes determining if an element is present or not, tor example an miRNA biomarker.
  • the terms ' ' ' ' ' 'determining", “measuring*, "evaluating , “assessing ' and “assaying' are used interchangeably and include quantitative and qualitative determinations. Determining may be relative or absolute. "Determining the presence of includes determining the amount of something present (e.g.. an miRN A and/or protein biomarker), and/or determining whether it is present or absent.
  • the terms “determining “ “measitrtng” and “assessing” and “assaytog” are used interchangeably and include both quantitative and qualitative determinations.
  • the terms “diagnosis ' “ and “diagnosing” are used herein to refer to methods by which a person of skill in the art can evaluate and/or determine whether or not a subject is suffering from a B-eell lymphoproliferative disorder.
  • mi A, protein and DNA biomarkers refers to the increase in and/or amount or level of at least one or more miRNA, protein and DNA biomarkers, including valiants in a biological sample when compared to a control sample or further biological sample from a subject.
  • the expression level of biomarkers may be relative or absolute.
  • the miRNA, protein and/or DNA biomarkers are increased if their level of expression is more than about 0.5%, ⁇ %, 2%, 3%, 4%, 5%, 10%, 35%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400% or at least about 500% of the level of expression of the corresponding miRNA, protein and/or DNA biomarkers in a control sample or further biological sample from a subject.
  • expression leveF refers to the extent to which a particular miRNA biomarker sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in a biological sample from a subject to be analysed or the concentration of a protein or DNA biomarker in a biological sample from a subject to be analysed.
  • the standard value of the expression levels obtained in several independent measurements of a given sample for example, two, three, five or ten measurements
  • the standard value may be obtained by any method known in the art. For example, a range of mean ⁇ 2 SD (standard deviation) or mean ⁇ 3 SD may be used as standard value.
  • control nucleic acids e.g. housekeeping markers whose expression levels are known not to differ depending on the disease states of the subject from whom the sample was collected.
  • housekeeping markers that may be suitable for miRNA include small RNA 116, miRNA- 16, and C. elegans miRNA-39 synthetic oligonucleotide R A.
  • the control nucleic acid is another miRNA known to be stably expressed in individuals with B-cell lymphoproliferative disorders from whom the sample was collected.
  • control protein o DNA for example, is another protein or DNA known to be stably expressed in individuals with B-cell lymphoproliferative disorders from whom the sample was collected.
  • 'IMCTORNA (including "miRNA' ⁇ l 'mRNA” or “miR") as used herein, is given its ordinary meaning in the art (e.g.. He, L. and Hannon, G. J. 2004).
  • a miRNA denotes an RNA molecule derived from a genomic locus that is processed .from transcripts that can form local RNA precursor miRNA structures.
  • the matiue miRNA is usually 20, 21, 22, 23, 24 or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.
  • prognosis and prognostic are used herein to include making a prognosis, which can provide for predicting a clinical outcome (with or without medical treatment), select ing an appropriate course of treatment (or whether treatment would be effective) and/or monitoring a current treatment and potentially changing the treatment. This may be at least partly based on determining expression levels of the miRNA biomarkers utilised by the methods of the invention, which may be in combination with determining expression, levels of protein and/or other nucleic acid biomarkers.
  • a prognosis may also include a prediction, forecast or anticipation of any lasting or permanent physical or psychological effects of the B- cell lymphoproliferative disorder suffered by the subject after the B-cell lymphoproliferative disorder has been successfully treated or otherwise resolved.
  • prognosis may include one or more of determining metastatic potential, therapeutic responsiveness, implementing appropriate treatment regimes, determining the probability, likelihood or potential for B-cell lymphoproliferative disorder recurrence after therapy and prediction of development of resistance to established therapies (e.g. chemotherapy).
  • therapies e.g. chemotherapy
  • proteitF an amino acid polymer including peptides and polypeptides.
  • the amino acids may be natural or non-natural, D- or L- amino acids as are well understood in the art.
  • proteiiF also includes molecules that contain protein components, such as glycoproteins and lipoproteins although without limitation thereto.
  • the expression level of the biomarkers may be relative or absolute, in some embodiments., the miRNA, protein and/or DNA biomarkers are suppressed, reduced or down regulated if their level of expression is less than about 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001% or 0,0001% of the level of expression of the corresponding miR NA, protein and/or DNA biomarkers in a control sample or further biological sample from a subject.
  • sequence identity is used herein in its broadest sense to include the number of exact nucleotide or amino acid matches hav ing regard to an appropriate alignment using a standard algorithm, having regard to the extent that sequences are identical over a window of comparison.
  • a "percentage of sequence identity' is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G. U) or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (ie., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • sequence identity * may be understood to mean the "match percentage” calculated by the DNASIS computer program (Version 2.5 for windows: available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA).
  • the subject is a mammal.
  • mammals include humans, dogs, cats, horses, cows, sheep, goats and pigs.
  • a subject includes any human or non-human mammal, including for example, a primate, cow, horse, pig, sheep, goat, dog, cat, or rodent, capable of developing a B-cell lymphoproliferative disorder, including humans that are suspected of having a B-cell lymphoproliferative disorder, that have been diagnosed as having a B-cell lymphoproliferative disorder or that have a family history of B- cell lymphoproliferative disorders.
  • Methods of identifying subjects suspected of having a B- cell lymphoproliferative disorder include, but are not limited to: physical examination, family medical history, subject medical history, biopsy and PET-CT scans.
  • the term also relates to an apparently healthy subject i.e., a subject not exhibiting any symptoms or clinical signs or parameters indicative of a B-cell lymphoproliferative disorder.
  • Clearly healthy subjects may be investigated by the method of the present invention as a measure of preventative care or for population screening purposes.
  • the invention provides a method of determining whether or not a subject has a B-cell lymphoproliferative disorder, including:
  • determining the expression level of a miRNA biomarker in a biological sample from a subject wherein the miRNA biomarker is selected, from the group consisting of miRNA- 1973, tniR.NA-638 and miRNA-494, and wherein a B-celi lymphoproliferative disorder is detected if said one or more miR A biomarkers, is at an elevated level or over expressed in the subject's biological sample.
  • the expression level of any combination of the raiRNA biomarkers miRNA- 1973, miRNA-638 and miRNA-494 in a biological sample may be determined, including for example: miRNA- 1973 and miRNA-638; miRNA- 1973 and miRNA-494; miRNA-638 and miRNA-494; or miRNA-1973, miRNA-494 and miRN A-638.
  • the method of diagnosing a B-cell lymphoproliferative disorder in a subject includes determining the expression level of a further miRNA biomarker in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group: miRNA-21, miRNA- 2861 , miRNA- 155, and miRNA- .16, and wherein B-cell lymphoproliferative disorder may be detected if at least one of the miRNA biomarkers is at an elevated level or over expressed in the biological sample.
  • the method of diagnosing a B-cell lymphoproliferative disorder in a subject includes determining the expression level of at least two further miRNA biomarkers in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group: miRNA-21 , miRNA-2861, raiRNA- J 55, and miRNA- 16, and wherein a B-cell lymphoproliferative disorder may be detected if at least the two miRN A biomarkers are at an elevated level or over expressed in the biological sample.
  • the method of diagnosing a B-cell iymphoproliferattve disorder in a subject includes determining the expression level of at least three further miRNA biomarkers in addition to miRNA-1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the raiRNA biomarkers are selected from the following group: miRNA-21, miRNA-2861 , miRNA- 155, and miRNA- 16, and wherein a B-cell. lymphoproliferative disorder may be detected if at least the three miRN A biomarkers are at an elevated level or over expressed in the biological sample.
  • the method of diagnosing a B-cell lymphoproliferative disorder in a subject includes determining the expressio level of at least four further miRN A biomarkers in addition to miRNA-1 73, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are miRNA-21 , miRNA-2861 , miRNA- 155 and miRNA- 16, and wherein a B-cell lymphoproliferative disorder may be detected if all four miRN biomarkers are at an elevated level or over expressed in the biological sample.
  • any number of miRNA biomarkers may be determined, including, but not limited to 1, 2, 3, 4, 5, 10, i 5, 20, 25, 30, 35, 40, 45, 50, 100, 1 0, 200, 250, 300, 400 or 500.
  • variants of the miRNA biomarkers may be suitable for the diagnosis and'or prognosis of a B-cell lymphoproliferative disorder.
  • the expression level of a variant of any of the aforementioned miRNAs may be determined in a biological sample from a subject.
  • Suc variants preferably have a nucleic acid sequence being at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentag sequence identity to any one of SEQ ID NOS: 1 to 7.
  • the methods of the invention inc lude methods of determining the expression level of miRNA biomarkers alone or i combinatio with protein and/or DNA biomarkers which have been identified as being diagnostic for a B-cell lymphoproliferative disorder.
  • the expression level of raiRNA, protein and/or DNA biomarkers can be derived from the same or different samples.
  • the expression level of a miRN A biomarker can be detennined in a blood derived sample and the expression level of a protein biomarker can be determined in a tissue sample.
  • Protein and DNA biomarkers which may be useful for diagnosing a B-cell lymphoproliferative disorder include without limitation, one or more of CD 163 (Jones, K. et al, 2 1 ), Thymus and Activation-Regulated C emokme (TA C) (Jones, K. ei al, 2012), lactate dehydrogenase, Epstein-Barr Virus DNA, fnterleukin-2 receptor (Yang, 201 1 ), Anti- thrombin 111 (Roy, 2008), CXCL.13 (Rubenstein, 2012), lL-10 (Rubenstein, 2012), Galectin-1 (Gandhi M. .
  • CCL22 macrophage derived cheraokine Niens, M. et al, 2008
  • CCL17 Jones, et al., 2013
  • LAG3 Gandhi, M.K. 2006
  • any number of protein or DNA biomarkers may be determined, including, but not limited to 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, ⁇ 00, 150, 200, 250, 300, 400 or 500.
  • variants of the protein or DNA biomarkers may be suitable for the diagnosis of a B-cell lymphoproliferative disorder, including protein or DNA biomarker variants that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentage amino acid sequence identity to the protein biomarkers.
  • Variants, a used herein, include polymorphisms, splice variants, mutations, and the like.
  • B-cell lyrnphoproliferative disorders include, without limitation, malignancies selected from the following group: Diffuse large B-cell. lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma, Mantle-cell lymphoma.
  • Chronic lymphocytic leukemia CLL
  • Marginal-zone lymphoma - nodal LPL
  • extra nodal MALT
  • splenic lymphoplasmacytic lymphoma
  • LPL lymphoplasmacytic lymphoma
  • Hodgkin lymphoma nodular lymphocyte pre-dominant type
  • primary central nervous system lymphoma and post-transplantation lyrnphoproliferative disorders
  • diffuse large B-cell lymphoma (DLBCL) not otherwise specified
  • primary DLBCL of the CNS primary cutaneous DLBCL, leg type
  • T cell/It istiocyte rich large B-cell lymphoma EBV+ DLBC L of the elderly
  • DLBCL associated with chronic inflammation
  • Follicular lymphoma Mucosa-Assoctated Lymphatic Tissue lymphoma
  • M ALT small cell lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia).
  • the B-cell lyrnphoproliferative disorder is classical Hodgkin Lymphoma or
  • Diffuse large B-cell lymphoma (DLBCL).
  • the invention provides a method of evaluating treatment efficacy of a B-cell lymphopro liferative disorder in a subject including;
  • the invention provides a method of treating a B-ce l lymphoproliferative disorder in a subject including;
  • a fourth aspect of the invention provides a method of detenninmg the prognosis of a subject with a B-cell lymphoproliferative disorder, including but not limited to:
  • determining the expression level of a miRNA biomarker in a biological sample from a subject wherein the miRNA biomarker is selected from the group consisting of miRNA- 1 73, miRNA-638 and miRNA-494, to thereby evaluate the prognosis of the B-cell lymphoproliferative disorder in the subject, wherein if said one or more miRNA biomarkers, is at a reduced level, down regulated or absent in the subject's biological sample, the prognosis is positive.
  • the expression level of any combination of the miRNA biomarkers miRNA- 1 73, miRNA-638 and miRNA-494, in a biological sample may be determined, including for example: miRNA- 1973 and miRN A-638; miRNA-1973 and miRNA-494; miRNA-638 and miRNA-494; or miRNA-1973, miRNA-494 and miRNA-638.
  • the method of evaluating treatment efficacy and/or prognosis of a B-ceO lymphoproliferative disorder in a subject includes determining the expression level of a further miRNA biomarker in addition to miRNA-1 73, miRNA-494 and/or miRNA-638 in a biologtcal sample from the subject, wherein the miRNA biomarker is selected from the following group: miRNA-23 , miRNA-2861, miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if at least one miRNA biomarker is at a reduced level or down regulated or absent in the biological sample.
  • the method of evaluating treatment efficacy and/or prognosis of a B-cell lymphoproliferative disorder in a subject includes determining the expression level of at least two further miRNA biomarkers in addition to miRNA-1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group; miRNA-2861 , mlRNA-2 ] , miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if at least two miRN A biomarkers are at a reduced level o down regulated or absent in the biological sample.
  • the method of evaluating treatment efficacy and/or prognosis of a B-ee! lymphoproliferative disorder in a subject includes determining the expression level of at least three farther miRNA biomarkers in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group: miRNA-2861, miRNA-21, miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if at least three miRN A biomarkers are at a reduced level or down regulated or absent in the biological sam le.
  • the method of evaluating treatment efficacy and/or prognosis of a B-cell lymphoproliferative disorder in a subject includes determining the expression level of at least four further miRNA biomarkers in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological, sample from the subject, wherein the miRNA biomarkers are miRNA-2861, mtRNA-21 , miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if all four miRNA biomarkers are at a reduced level or down regulated or absent in the biological sample.
  • any number of miRNA biomarkers may be determined, including, but not limited to 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 400 or 500.
  • variants of the miR A biomarkers may be suitable for evaluating treatment efficacy and/or prognosis of a B-cell lymphoproliferative disorder.
  • miR As . may be determined in a biological sample from a subject.
  • preferabl have a nucleic acid sequence being at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentage sequence identity to any one of SEQ ID NOs: 1 to 7.
  • the methods of the invention include methods of determining the expression level of miRNA biomarkers alone or in combination with protein and'Or DMA biomarkers which have been identified as being suitable .for evaluating treatment efficacy and/or prognosis for a B-cell lymphoproliferative disorder.
  • the expression level of miRNA, protein and/or DNA biomarkers can be derived from ihe same or difFerent samples.
  • the expression level of an miRNA biomarker can be determined in a b!ood derived sample and the expression level of a protein biomarker can be determined in a tissue sample.
  • Protein and DNA biomarkers which may be useful for evaluating treatment efficacy and/or prognosis of a B ⁇ cell lymphoproliferative disorder include without limitation, one or more of CD 163 (Jones, I et al, 2013), Thymus and Activation-Regulated Chemokine (TARC) (Jones, K. et al, 2012), lactate dehydrogenase, Epstein-Ban: Virus DNA, Interleukin- 2 receptor (Yang, 201 1 ), Anti-thrombin Hi (Roy, 2008), CXCL 1.3 (Rubenstein, 201.2), I.L- 10 (Ru enstein, 2012), Galectm-1 (Gandhi, M.K. et al,. 2007), CCL22 macrophage derived chemokine (Mens, M. et al, 2008), CCL17 (Jones, et al, 2013 ) and LAG3 (Gandhi, M.K. 2006).
  • CD 163 Jone
  • any number of protein or DN A biomark ers may be determined, including, but not limited to 1 , 2, .3, 4, 5, 10, 15, 20, 2.5, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 400 or 500.
  • variants of the protein and/or DNA biomarkers may be suitable for the diagnosis and/or prognosis of a B-celi lymphoproliferative disorder, including protein or DNA biomarker varients that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentage amino acid sequence identity to the protein biomarkers.
  • Variants include polymorphisms, splice variants, mutations, and the like.
  • B-cell lymphoproliferative disorders include, without limitation, malignancies selected from the following group: diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma, Mantle-cell lymphoma, Chronic lymphocytic leukemia iCLL), Marginal-zone lymphoma - nodal, extra nodal ( MALT) and splenic, iymphoplasmacytic lymphoma (LPL), Hodgkin lymphoma (nodular lymphocyte pre-dominant type), primary central nervous system lymphoma and post-transplantation lymphoproliferative disorders, diffuse large B-cell lymphoma (DLBCL), not otherwise specified, primary DLBCL of the CNS, primary cutaneous DLBCL, leg type, T cell histiocyte rich large B-cell lymphoma, EBV+ DLBCL of the elderly, DLBCL associated with
  • Follicular lymphoma Mucosa-Associated Lymphatic Tissue lymphoma (MALT), small cell lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia), Mantle cell lymphoma, Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macroglobulinemia, Nodal marginal zone B cell lymphoma (NMZL), Splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, Lymphomatoid granulomatosis, Large B-cell lymphoma arising in HHV-8- associated multicentric Castleman Disease, ALK-positive large B-cell lymphoma, AIDS- related lymphoma.
  • MALT Mucosa-Associated Lymphatic Tissue lymphoma
  • small cell lymphocytic lymphoma overlaps with Chronic lymphocytic leukemia
  • Mantle cell lymphoma Burkitt lymph
  • PTLD Post- Transplantation Lymphoproiiferative Disorders
  • PCN ' SL Primary Central Nervous System Lymphoma
  • Classic Hodgkin's lymphoma nodular lymphocyte predominant Hodgkin's lymphoma
  • B-cell lymphoma unclassifiable, with features intermediate between DLBCL and Burfcitt lymphoma
  • B-cell lymphoma anclassiftable, with features intermediate between DLBCL and classical Hodgkin lymphoma.
  • the B-cell lymphoproiiferative disorder is classical Hodgkin Lymphoma or Diffuse large B-cell lymphoma (DLBCL ⁇ .
  • a diagnostic, prognostic and/or treatment tniRNA, protein and/or DNA expression level is correlated to a B-cell lymphoproiiferative disorder by merely its presence Or absence.
  • a threshold level of a diagnostic, prognostic and or treatment mi N A, protein and ' or DNA expression level can be established, and the level of the miRN A, protei and/or DNA in a. subject's biological sample can simply be compared to the threshold level.
  • a prediction of prognosis and/or treatment outcome is given by a. likelihood score derived from a clinical such as Hasenclever scores or sub-division into early good risk/early poor risk, advanced stages for Hodgkin Lymphoma, or International Prognostic Score for Diffuse Large B-cell Lymphoma, or Follicular Lymphoma International Prognostic Index for Follicular Lymphoma (Hansclever, D et al, 1998; So al-Celigny, P. et al., 2004; Sehn, L. FL, etal, 2011 ; Hoster, E. 2008; Caillared. i. etal,, 2013; Ferreri, A. et al, 2003; Morel, P. et al, 2009: Binet, J.L. et al, 1981 ; and Rai, .R. et al, 1987).
  • a. likelihood score derived from a clinical such as Hasenclever scores or sub-division
  • the prognosis is used, at least in part, to determine whether the subject, would benefit f om treatment of the B-cell lymphoproiiferative disorder. In addition to determining treatment benefit, the prognosis may be used, at least in part, to develop a treatment strategy for the subject. In one embodiment, the prognosis is used at least in part, to determine disease progression in the subject, prognosis and/or an estimated time of survival.
  • B-cell lymphoproiiferative disorder treatments vary with the type of B-cel! lymphoproiiferative disorder to be treated.
  • B-cell lymphoproiiferative disorder treatments most commonly used include without limitation, chemotherapy (e.g., cliemotherapeittic drugs including, but not limited, to alkylating agents, anthracy lines, corticosteroids, vincaalkaloids, platinum agents, antimetabolites, topoisomerase inhibitors, taxanes, immunotherapies, monoclonal antibodies or other anti-tumour agents), surgery, radiation treatment, or a combination of two or more of these treatments.
  • Less commonly used treatments for B-celi lymphoproliferative disorders include laser treatment and cryosurgery.
  • B-cell lymphoproliferative disorder treatments may also be utilised.
  • multiple time points prior to, during and/or after treatment of a subject with a B-cell lymphoproliferative disorder may be selected to determine the expression level of at least one or more miRNA biomarkers, protein biomarkers and/or DNA biomarkers to determine a diagnosis, prognosis or treatment efficacy.
  • the expression level of specific miRNA biomarkers, protein biomarkers and/or DNA biomarkers can be determined at an initial time point and then again at one, two, three or more time points.
  • the time points may be selected throughout a treatment cycle or over a desired time period. Over a desired time period, for example, the time points ma be prior to treatment, mid way through treatment and/or after treatment has been completed.
  • an increase or elevation in the expression level of at least one or more miRNA biomarkers utilised by the methods of the invention from the first to second and/or third time points may provide a poor prognosis for a subject with a B-cell lymphoproliferative disorder.
  • a decrease or down regulation in the expression level of at least one or more miRNA biomarkers utilised by the methods of the invention from the first to second and/or third time points may provide a positive prognosis for a subject with a B-cell lymphoproliferative disorder.
  • the change in expression level of one or more miRNA biomarkers, protein biomarkers and/or DNA biomarkers may be related to the severity, stage, or progression of the B-cell lymphoproliferative disorder and/or the efficacy of the treatment,
  • biological samples may be transportedrced and/or collected from a subject at diagnosis and then prior to each cycle of treatment.
  • the treatment cycles may be close together, spread out over a period of time and/or intense cycles at defined time points over a period of time, or any combination of the above.
  • samples may be taken both during treatment and/or afte treatment has been completed.
  • samples may be so arced from a subject at any time point after treatment has been completed, examples of which include 1 , 2, 3, 4, 5, 10, 15, 20, 25 and/or 30 days post treatment, 1, 2 and/or 3 weeks post treatment and/or 1 , 3, 6 and/or 9 months post treatment and/or 1, 2, 3, 4, 5, 10, 15, 20 and/or 30 years post treatment.
  • the treatment may be completed once the subject is in remission or after at least one or more treatment cycles, depending on the subject and the B-cell lymphoproliferative disorder.
  • subjects are sampled every three to six months and/or every year post treatment. It will be understood by a person of skill in the art that a subject may be in remission or may have non-responsive or relapsed B-cell lymphoproliferative disorder. If subjects have non-responsive or relapsed disease, then monitoring may be more frequent.
  • an increase or no change in the expression level of one or more miRNA biomarkers wherein at least one miRNA biomarker is miRNA- 1 73, miRNA-638 or miRNA-494 in a second, third, fourth and/or fifth etc., biological sample from a subject collected either after treatment or during treatment as compared to the expression level in a first earlier sample, may indicate progression of the B-cell lymphoproliferative disorder or failure of the treatment.
  • a decrease, reduction or absence in the expression level of one or more miRNA biomarkers, wherein at least one of the miRNA biomarkers is miRNA-1973, miRNA-638 or miRNA-494 in biological samples from a subject undergoing treatment may indicate that the treatment is efficacious.
  • the level of miRNA biomarker expression can be measured using the same miRNA biomarker at different time points, it is also possible to measure tire level of different miRN A biomarkers expression at a first and second time point and a comparison of the expression levels can provide diagnostic, prognostic and/or treatment efficac information.
  • the biological sample comprises tissue, (e.g., biopsy), blood, serum, plasma and/or cerebrospinal fluid.
  • tissue e.g., biopsy
  • the miRNAs are obtainable from a non- cellular source.
  • the biological sample is, comprises, or is obtained from a non- cellular source.
  • the biological sample may be serum, plasma, or cerebrospinal fluid, although without limitation thereto. More preferably, the biological sam le comprises serum or plasma.
  • the sample can be fresh, frozen and fixed or embedded for tissue samples.
  • a biological sample is obtained from a subject that has tested positive for a B-cell lymphoproliferative disorder.
  • a biological sample is obtained from a subject that is suspected of ha ving a B-cell lymphoproliferat ive disorder or at. risk of developing a B-cell lymphoproliferative disorder or from an apparently healthy subject.
  • the volume of the biological sample may vary, dependin on the subject and the clinical intent.
  • the biological sample is obtained from a subject who has commenced treatment for a B-cell lymphoproliferative disorder.
  • Samples may be obtained at any time point before, during and/or after treatment depending on a number of factors. including but not limited to type of treatment, stage of disease, subject type etc.
  • a previously isolated sample e.g., isolated by another person, at another time, and/or for another purpose may also be used in the methods described in this invention.
  • blood may be drawn into a collection tube using standard methods and allowed to clot, after which time the serum is separated from the cellular portion of the coagulated blood and collected.
  • blood may be collected by venipuncture and processed. It is well known in the art that serum and plasma may be frozen after separation from the cellular portion of the blood and stored.
  • Blood collection tubes are commercially available from many sources and in a variety of formats (e.g., Becton Dicksenson Vacutainer ⁇ tubes— SST i M , glass serum tubes, or plastic serum tubes).
  • the biological sample should generally be collected in a clinically acceptable manner, preferably in a way that ensures RNA is preserved and not degraded
  • RNA may be extracted from serum or plasma and purified using methods known in the art. Many methods are known for isolating total RNA, or for specifically extracting small RNA, including miR A (e.g., Ausubel et a!. 1997). The RNA may be extracted using commercially available kits (e.g... Perfect RNA Total RNA isolation kits etc.). Alternatively, RN A extraction methods for the extraction of mammalian RNA may ⁇ be adapted for extraction of RNA from plasma or serum. In some embodiments, methods for RNA extraction from paraffin embedded tissues ma be used as disclosed, for example in Rupp and Locker, 1987.
  • miRNA in a biological sample may be purified in a first step.
  • the total RNA may be separated by polyacrylamide gel electrophoresis and in a third step, the fraction of small RNA may be purified from the polyacrylamide gel.
  • a combination of phenol/guanidine-based lysis and silicamembrane- based purification may be used for the isolation of cell-free NA from biological samples, preferably serum samples,
  • miRNA amplification Before proceeding to detect miRNA in a biological sample, it may be necessary to amplify the miRNA.
  • Methods of miRNA amplification are well known in the art and include such methods as reverse transcription CRT); polymerase chain reaction (PGR); real-time PCR (quantitative PCR), nucleic acid sequence-based amplification (NASBA), ligase chain reaction, multiplex ligatable probe amplification, invader technology, rolling circle replication to name hut a few.
  • PGR polymerase chain reaction
  • NASBA real-time PCR
  • ligase chain reaction ligase chain reaction
  • multiplex ligatable probe amplification invader technology
  • rolling circle replication rolling circle replication to name hut a few.
  • more than one amplification method may be used depending on the sample and miRN A biomarker.
  • At least one miRNA is amplified, alternatively, two or more miRN A biomarkers may be amplified at the same time.
  • a PCR reaction includes multiple amplification steps, or cycles that selectively amplif target nucleic acid species: a denaturing step in which a target nucleic acid is denatured; an annealing step in which a set of PCR primers (forward and reverse) anneal to complementary DNA strands; and an elongation step in which thermostable DNA polymerase elongates the primers.
  • a DNA fragment is amplified to produce an amplicon, corresponding to the target DN A sequence.
  • PCR reactions include 20 or more cycles of dsnaturation, annealing and elongation. Since mature miRNAs are single stranded, a reverse transcription reaction (which produces a complementary cDNA sequence) may be performed prior to the PCR reaction.
  • Some techniques of reverse transcription of miRNA use a targeted stem- loop primer to prime reverse transcriptio of the miRNA into a DAN template.
  • the cDNA template may- then be used as a primer for any type of PCR including any type of quant itative PCR.
  • the level of a miRNA in a biological sample can be measured using any technique that is suitable for detecting miRNA expressio levels. Suitable techniques (e.g., Northern blot analysis, RT-PCR, in situ hybridization, microarray analysis, R Ase protection assay; quantitative PCR, quantitative RT-PCR, direct sequencing of genomic DNA) for determining miRN A expression levels in a biological sample (e.g., serum and plasma) are well known to those of skill in the art .
  • a biological sample e.g., serum and plasma
  • PCR-Based Methods PC is a useful technique for detecting transcripts from a sample.
  • RT-PCR is a sensitive quantitative method that can be used to compare miRNA levels in one or more biological samples.
  • m A is isolated from a sample and may be amplified as exem lified by the methods described above and well known in the art.
  • RNA may then be reverse transcribed into cDNA.
  • the cDNA is amplified in a PCR reaction.
  • a variety of reverse transcriptases are known in the art.
  • extracted RNA can be reverse-transcribed using a Gene Amp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions, The derived cDNA can then be used as a template in the subsequent PCR reaction.
  • a third oligonucleotide, or probe is used to detect a nucleotide sequence located between the two PCR primers.
  • the probe may be non-extendible by Taq DNA polymerase enzyme, and typically is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
  • the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fiuorophore.
  • One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unq enched reporter dye provides the basis for quantitative analysis.
  • RT-PCR can be performed using commercially available equipment, such as an ABl PRISM 7700. TM. Sequence Detection System (Perkin-Elmer- Applied Biosystems, Foster City, Calif USA), or LightcyclerTM (Roche Molecular Biocheraicals, Mannheim, Germany). Samples can be analyzed using a real-time quantitative PCR device such as the ABl PRISM 7700TM Sequence Detection SystemTM.
  • a variation of the RT-PCR techniq ue is real time quantitative PCR , which measures PCR product accumulation through a dual-labeled fiuorigenic probe, such as a TaqManTM probe.
  • Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
  • the le vel of at least one miRNA may be detected using Northern blot analysis.
  • miRNA can be purified from serum in the presence of nucleic acid extraction buffer, followed by eentrifegation. Nucleic acids are precipitated, and DMA is removed by treatment with DNase and precipitation. The RNA molecules are then separated by gel electro phoresis on agarose gels according to standard techniques, and transferred to nitrocellulose filters. The miRNA is then immobilized on the filters by heating. Detection and quantification of specific miRNA is accomplished using appropriately labeled probes complementary to the miRNA in question. See, for example. Molecular Cloning: A Laboratory Manual, J. Sambrook et ah, eds., 2nd edition, Cold Spring Harbor Laboratory- Press, 1989, Chapter 7. the entire disclosure of which is incorporated by reference .
  • Suitabl probes for Northern blot hybridization of a given miR A bioniarker can be produced and include, but are not limited to, probes having at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% complementarity to a miR bioniarker of interest, as well as probes that have complete complementarity to a miR biomarker of interest.
  • Methods for preparation of labeled RNA probes, and the conditions for hybridization thereof to target nucleotide sequences are described in Molecular Cloning; A Laboratory Manual, .1. Sambrook et aL 1989, Chapters 10 and 1.1, the disclosures of which are incorporated herein by reference.
  • the nucleic acid probe can be labeled with, e.g., a radionuclide, such as ' 3 ⁇ 4, ⁇ "?, ",3 P, 1 C, or 15 S; a heavy metal; a ligand capable of functioning as a specific binding pair member for a labeled ligand ⁇ e.g., biotin. avidin or an antibody); a fluorescent molecule; a chemikimiiiescent molecule; an enzyme or the like.
  • Probes can be labeled to high specific activity by either the nick translation method of Rigby et al, ( ⁇ 977) or by the random priming method of Fienberg et a/., (1 83), the entire disclosures of whic h are incorporated herein by reference.
  • the latter method may be used for synthesizing '"P-iabeled probes of high specific activity from single-stranded DNA or from RNA templates. For example, by replacing preexisting nucleotides with highly radioactive nucleotides according to the nick translation method, it is possible to prepare ' -labeled nucleic acid probes with a specific activity well in excess of 10 h cprn microgram.
  • Autoradiographic detection of hybridization can then be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of miR levels. Using another approach, miR levels can be quantified by computerized imaging systems, such as the Molecular Dynamics 40G-B 2D Phosphoriniager available from Amersham Biosciences, Piscataway, Nj.
  • the random- primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N- (N-biotmy!- ⁇ triphosphate, into the probe molecule.
  • analogue for example, the dTTP analogue 5-(N- (N-biotmy!- ⁇ triphosphate
  • the biotinylated probe oligonucleotide can be detected by reaction with biotin- binding proteins, such as avidin, streptavidin and antibodies (e.g., anti-hiotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.
  • a microarray may be constructed containing a set of oligonucleotide (e.g., oligodeoxynueleotide) probes that are specific for a set of miRNAs.
  • oligonucleotide e.g., oligodeoxynueleotide
  • the expression level of multiple microRNAs in a biological sample can be determined by reverse transcribin the RNAs to generate a set of target oligodeoxynucleotides, and hybridizing them to probe the oligonucleotides on the microarray to generate a hybridization, or expression, profile.
  • the hybridization profile of the test sample can then be compared to that of a control sample to determine which microRNAs have an altered expression level in biological samples form subjects with a B-cell lymphoproliferative disorder.
  • an "expression profile” or "hybridization profile” of a particular sample is essentially a fingerprint of the state of the sample; while two states may have any particular miRNA similarly expressed, the evaluation of a number of miRNA simultaneously allows the generation of an expression profile that is unique to the state of that sample. That is, a biological sample from a subject with a B-cell lymphoproliferative disorder may be distinguished from a biological sample front a subject without a B-cell iymphopfoliferative disorder. Furthermore, different prognosis states (for example, good or poor long term survival prospects) may also be determined. The identification of miRNA biomarkers which are aberrantly expressed resulting in different prognostic outcomes, allows the use of this information in a number of ways. For example, a particular treatment regime may be evaluated (e.g., to determine whether a chemotherapeutic drug acts to improve the long-term prognosis in a particular subject).
  • RNA may be purified and reverse transcribed from a biological sample obtained from a subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample, wherein an increase of at least one or more miRNAs, wherein the at least one miRNA is miRNA- 1 73, miRNA-638 and/or mtRNA-494 is indicative of the subject having a B-cell lymphoproliferative disorder.
  • the microarray comprises miRNA-specit c probe oligonucleotides for one or more further miRNAs selected from the group consisting of miKNA-21, rniRNA- 155, miRNA-2861 , miR A- 16 and combinations thereof.
  • the array may contain controls, such as one or more mouse sequences differing from human or hologs by only a few bases, which can serve as controls for hybridization stringency conditions.
  • tR As and other RNAs e.g., rRNAs, mRNAs
  • rRNAs e.g., rRNAs, mRNAs
  • One or more appropriate controls for non-specific hybridization may also be included on the microchip. For this purpose, sequences are selected based upon the absence of any homology with any known miRNAs.
  • the microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length, e.g., 40 nucleotides, are 5 ! -araine modified at position C6 and printed using commercially available microarray systems, e.g., the GeneMachme OmniGridTM 100 Microarrayer and Aniersham CodeLfakTM activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/D ' NA hybrids are denatured to degrade the RNA templates.
  • the labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, e.g., 6X SSPE/30% fotmaniide at 25°C for 18 hours, followed by washing in 0.75X TNT at 37 C 'C for 40 minutes.
  • hybridizing conditions e.g., 6X SSPE/30% fotmaniide at 25°C for 18 hours, followed by washing in 0.75X TNT at 37 C 'C for 40 minutes.
  • hybridization occurs at positions on th array where the immobilized probe DMA recognizes a com lementary target cDNA in the sample.
  • the labeled target eDNA marks the exact position on the arra where binding occurs, allowing automatic detection and quantification.
  • the output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary miRs, i the subject's biological sample.
  • Protein bio markers described herein may be detected by any protein detection method known in the art.
  • protein detection methods include, without limitat ion, detection by way of antibodies or antibody fragments, such as by immunohistochemistfy, ELISA, flow cytometric analysis, immunoblotting or Western blotting, immunoassays including competithe and non-competitive immunoassays such as CEIA, liposome immunoassays and radioimmunoassay.
  • the detection method may include the use of an antibodies or antibody fragments specific for each said protein bio marker.
  • the antibodies may be labeled.
  • a labeled secondary antibody may be used for detection of the specific antibody (Kurien B.T. et a/., 2009;).
  • the label may include a radio label, digoxigenin biotin, a fluorochrome, a visible particle or an enzyme to facilitate detection.
  • enzymes include horseradish peroxidas and alkaline phosphatase, although without limitation thereto.
  • fluorochromes include FITC, Texas Red, R-phy oerythrin and Cy3, although without limitation thereto.
  • a suitable radiolabel may be ⁇ m I, Cr and 9 Tc, although without limitation thereto.
  • Protein bio markers may also be detected for example usin the following methods well known by a person of skill in the art, including without limitation: HPLC, mass spectrometry, protein microarray analysis, PAGE analysis, isoelectric focusing, 2-D gel electrophoresis, or any enzymatic assay or any method that uses a protein reagent, or other reagent capable of specifically binding to or otherwise recognising a specific protein marker. These methods may be qualitative, semi- uantitative or quantitative assays (El-Aneed, Anas. et al, 2009 and Lilley K.S. et at, 2002).
  • amplification of DNA may include amplification of Epstein-Ban" viral DNA (Tumor-specific but not nonspecific cell-free circulating DNA can be used to monitor disease response in B- cell lymphoproliferative disorders) Jones, K. et a/. ,2012. Plasma Epstein-Barr virus (EBV) DNA i a biomarker for EBV-positive Hodgkm's lymphoma (Gandhi M et ai, 2006).
  • Epstein-Ban viral DNA
  • EBV Plasma Epstein-Barr virus
  • cHL patients Forty-two newly diagnosed cHL patients were enrolled, with exclusion criteria limited to HIV positivity, active Hepatitis B or C infection. AM patients were enrolled before commencement of therapy and serial blood samples were taken at three time-points: pre- therapy, immediately pre-fhtrd therapy and six months post-therapy. Plasma was cryopreserved, thawed and tested in batches as previously outlined (Jones, K. et al, 2012). 21 Tissues ftom diagnostic tumour biopsies were tested when available. Clinical parameters including the Hasendever prognostic score were prospectively recorded (Hasen ever, D, et al, 1998 and Franklin, J. et al, 2000).
  • MiRNA extraction and qRT- PCR Tissue miRNA was extracted from all available formalin-fixed, paraffin-embedded (FFPE) tumour biopsies using Recover AllTM Total Nucleic Acid Isolation kit (Ambion). Plasma miRNA was extracted from plasma ( ⁇ ) using mirVanaTM ParisTM kit (Ambion) and DNase I treated using TURBO DNA-freeTM kit (Ambion). As previously described, C. elegans iniRNA-39 synthetic oligonucleotide RNA (25fmol in a 5ul total volume) were added to plasma after addition of denaturing solution to control for extraction efficiency (Mitchell, P.S, etal, 2008). All kits were used as per manufacturer's instructions.
  • Qiagen mi Script PGR including miScript reverse transcription kit, SYBR* Green and universal primer
  • plasma and tissue miRNA were quantified on a Rotorgene 3000 qRT-PC (Corbett Research). Each reaction contained the equivalent of either 3ng tissue RNA or 0.2 ⁇ 1 plasma cDNA, all run in duplicate 20 ⁇ reactions.
  • Two Qiagen miScript primers were used: C. Elegans miRNA-39 (cel-miRNA-39) and miRNA- ⁇ ⁇ (Qiagen Catalogue numbers: MS0Q 19789 and MS00031493).
  • miRNA-21 (5 '-CGTAGCTTATC AGACTGATGTTGAA-3 ')
  • miRNA- 155 5'- TTAATGCTAATCGTGATAGG GGTAA-3 '
  • miRNA-494 5 '- gaaaeataeacgggaaaccteaaa- 3' miRNA-638 (5'-cgggtggcggcctaa-3 5 ), miR A- .
  • T wo standards one for tissue and one for plasma, were prepared on mass and stored in aliqitots to avoid freeze/thawing (Nourse, J.P. et a/., 2012).
  • PBMC peripheral blood mononuclear cells
  • EBV-tissue positivity was determined by EBV encoded RNA in situ hybridization (EBER-ISH) in conjunction with hematoxylin and eosin staining (Gandhi, M. . et al , 2006).
  • EBV-DNA BALF5
  • human genomic DNA Albumin
  • Microarray data was quantile normalized using Genespring GX and analyzed using GenePattern (Broad institute). Comparative marker selection analysis was performed using Genepattern to identify significantly different microRNAs between Hodgkin and healthy lymph nodes. Wikoxon matched-pairs signed rank T-tests were used to compare matched samples. Otherwise the Mann Whitney T-test was used. Correlations were determined using the Spearman test. Receiver Operating Curve (ROC) analysis was used to determine sensitivity and specificity. Statistical analysis was performed using Graphpad Prism 5.0 (Graphpad Software Inc, California).
  • Agilent array profiling of > 1000 human microR A was performed on a discovery cohort of 23 primary DLBCL tissues and 8 healthy lymph nodes. Following quantile normalization, 2 of the top 50 differentially over-expressed micro RNA were selected: miRN A-638 and miRNA-494. Expression of these was correlated by qPCR.
  • Plasma was derived from blood taken pre-therapy and near the time of centrally-reviewed (day 17-20) interim- PET/CT after cycle 4 R-CHOP ehemo- immunotherapy.
  • Elegans prior to RNA extraction Spiked-in C. Elegans miRNA was amplified together with the target miRN As and results normalized to plasma volume and C. Elegans miRNA. Values were quantified relative to the quantity of the relevant iniRNA from a healthy control participants peripheral blood mononuclear cells.
  • cHL patients Forty-two cHL patients were accrued (mean age: 36 years, range; 18-79; female: male ratio 20:22). Patient characteristics are provided in Figure 6. Interim therapy (immediately prior to third therapy) samples were available for 38 of these patients and post-therapy samples were available for 37. Of these 37 cHL patients, 32 achieved CR by the six months post-therapy time-point. Matching biopsy tissue was available for 26 cHL patients. As controls, 20 healthy participant blood samples were used (mean age: 42 years, range: 22-68; female: male ratio 8: 12). In addition, a miRNA discovery cohort of 14 cHL diagnostic biopsy (6 mixed cellularity and 8 nodular sclerosing) and 8 non-malignant lymph node tissues were used.
  • the top five miRNA were selected with elevated expression in cHL tissue for further analysis fay qRT-PCR (miRNA-2861 , miRNA-638, miRNA-494, miR.NA-663b and nuR.NA-1 73).
  • miRNA-2861 miRNA-638, miRNA-494, miR.NA-663b and nuR.NA-1 73.
  • miRNA-155, miRNA-2I and miRN A- 16 known to be over-expressed in HRS cells and to have a functional role in lymphomagenesis (Van Vlierberghe, P. et a/., 2009; Gibcus, J.H. et al, 2008; Navarro, A. et aL, 2008; Lawrie, CM., 2013; and Volinia, S.
  • MiRNA- 16 has also been used as a reference miRNA in previous studies (Lawrie, C.H. et al, 2008). None of these three mi NA were significantly elevated in cHL nodes compared to healthy nodes as demonstrated by the microarray analysis.
  • RNA-663b was dropped from the analysts, as it was unable to be amplify by qRT-PCR with high-specificity.
  • Circulating miRNA are elevated in plasma of patients with cHL at diagnosis and are associated with Hasenclever Score
  • Plasma miR A were quantified in all pre-therapy cHL patient samples and in healthy participant plasma by comparative quantification qRT-PCR (miRNA-2861 , miRNA-638, miRNA-494. miRNA- 1973, miRNA- 1 55, miRNA-21 and miRNA- 16, as well as controls 116 and cel-tTiiS.39), In this analysis of plasma miRNA, results were normalized to the spike-in control cel-miRNA-39 (but not U6).
  • the small RNA U6 was also elevated (P 0.01 17).
  • MiRNA-494, miRNA- 1973, ami miRNA-21 are hiomarkers of disease response in cHL
  • Receiver operating curve (ROC) analysis to determine the sensitivity and specificity at defined time-points was performed.
  • cut-off values for miRNA-494, miRNA- 1973 and miR2 l were defined as follows: 3.0xI0 3 miRNA-494 copies/ul plasma with 85% sensitivity and 60% specificity, 1.6x10'' miRNA- 1973 copies/ul plasma with 75% sensitivity and 67% specificity, I.Gxl O 6 miRNA-21 copies ul plasma with 95% sensitivity and 86% specificity.
  • the associations with clinical prognosticators and pre-therapy absolute levels of miRNA-494, miRNA-1973 and raiRNA-2 l are shown in Table 2.
  • Figure 3A-C illustrates the differing kinetics of miRNA-494, miRNA-1973, and miRNA-21 throughout therapy.
  • miRNA-494 and miRNA-1973 drop to levels equivalent with healthy controls by the interim time-point.
  • miRNA-21 interim therapy levels remain equivalent to pre-therapy and elevated compared to healthy controls, dropping to normal levels by six months post-therapy.
  • pre-therapy samples with paired interim samples delineated as either CR or PR by radiological assessment were compared.
  • miRNA-494 and miRNA- 1973 there was no significant difference between pre-therapy samples and those in PR at the interim time-point.
  • miRNA-494 and miRNA- 1973 were equivalent to both interim PR and CR levels (Fig. 3F).
  • Plasma levels of the small RNA U6 may be used to represent levels of cellular RNA in the plasma.
  • Plasma U6 levels were elevated pre-therapy compared to healthy controls (P ⁇ 0.0001, Figure 4A) and remained elevated throughout therapy despite patients achieving CR.
  • cHL-associated miRNA were tested for utility as disease response bio markers in a prospective cohort of cHL patients. Following testing in serial plasma samples, in comparison with healthy samples and with reference to radiological assessment, the kinetics of these miRNA during therapy were assessed Three miRNA (miRNA-494, miRNA- 1973 and miRNA-21) showed promise as disease response biomarkers.
  • MicroRNA that was identified as over-expressed in the diseased node relative to healthy nodes was tested. These were evaluated in unison with previously identified cHL- associared miRNA s. Of these, levels of miRN A-494, miRNA- 1973 and miRN A-21 miRNA were higher in patients than healthy control participants' plasma and all three miRNA returned to normal at remission, initially, comparative quantification was used to identify promising miRNA biomarkers. Once identified., absolute quantification was used to determine exact miRNA copy number per volume of plasma. Reporting results in absolute terms is critical for inter-laboratory comparisons and standardization, both important for this test to be implemented in the clinical setting.
  • MiRNA-494 and miRNA- 1973 levels were strongly correlated with each other (but not with miRNA-21.) and both reflected interim therapy response with reduction being more pronounced in patients achieving com lete versus partial responses.
  • rai NA-21 showed no relationship to radiological response during therapy.
  • MiRNA- 1 has been used, however, some studies found it to be inconsistent (Lawrie, C.H. et al, 2008; Chen, X. et al, 2008; and Huang, Z. et al, 2012). Circulating miRNA- 16 levels need to be interpreted with caution as miRNA-16 is highly expressed in red blood cells and hemolysis increases miRNA- 16 plasma levels by up to 30-fold (McDonald, J.S. et al, 201 1 ; Pritchard, C.C. et al, 2012; and Kirschner. M.B.
  • miRNA-16 is an inappropriate cell-free house-keeping gene for cHL.
  • MiRNA-16 values were significantly elevated pre- therapy compared to healthy control participants and gradually declined to normal levels by six months post-therapy.
  • RNA extraction efficiency is frequently utilized.
  • the inventors selected cel-miRNA-39 based on. published literature that normalizing to the mean of 3 exogenous miRNAs did not improve precision, as compared with normalizing to cekmiRNA-39 alone (McDonald, J.S. er a/., 201 1 ).
  • the small RNA U6 has also been advocated as a reference for mi RNA, However, in the study pre-therapy U6 levels were strongly associated with LDH and correlated with cell-free albumi DNA levels. The inventors have previously shown the latter is elevated at pre-therapy in lymphomas, but remains elevated during and following therapy (Jones, , et al, 2012).
  • MiRNA-1973 is newly identified and has no known validated targets, but is expressed in B-cell acute lymphoblastic leukemia cells (Schotte, D. et al., 2009).
  • MiRNA-494 is over-expressed in follicular lymphoma tissue and functionally contributes to cancer persistence (Arribas, A.J. et al, 2012; Romano, G. et al, 2012; and Liu, Y. et al, 2012).
  • miRNA-494 is implicated in chemo-resistance and is required for the accumulation and function of tumour-expanded granulocytic and monocytic myeloid- derived suppressor cells (Romano., G. et at, 2012; and Liu, Y. et al, 2032).
  • MiRNA-21 is ubiquitously expressed in a variety of cell-types and miRNA- 155 is known to be up-regulated in hematopoietic cells (Landgraf, P. et al, 2007). Both miRNA-21 and miRNA- 155 are dysregulated in a variety of cancers, however, in a study of miRNA expression in solid tumours, only miRNA-21 was up-regulated in all cancers evaluated (Volini , S.
  • BotJi miRNA- 155 and miRNA-21 are involved in B-cell activation and, in two separate studies, induction of miRNA-21 and rniRNA-155 in mouse-models resulted in lymphoma development (Vigorito, E. et al, 2007; Tliapa, D.R. et al, 2012; Medina, P.P. ei al, 2010; and Babar, I. A. et al, 20.12).
  • the inventors have confirmed the findings of Navotro and colleagues that miRNA- 155 was not over-expressed in cHL patient versus healthy nodes (Navarro, A. et al, 2008). In contrast to that group, the inventors did not find miRNA-21 was elevated (values were approximately two-fold higher in cHL nodes but. this did not reach significance).
  • Binet 3.L., Auquier, A., Dighiero, G., Cnastang, C, Piguet, H., Goasguen, J., Vaugier, G., et al, new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis, .1981 , 48( 3 );. 1.98-206).
  • Cheson BD Horning S3, Coiffier B, et al. R eport of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working Group, journal of clinical oncology : Official Journal of the American Society of Clinical Oncology. 1999; 1 7: 1244. Cheson BD, Pfistner B, Juweid ME, et al Revised response criteria for malignant lymphoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology- 2007;25:579-586.
  • Tumor-specific but not nonspecific cell- free circulating DNA can be used to monitor disease response in lymphoma. Am J Hematol. 2012;87:258-265.
  • Kaniper P Bendix
  • Hamilion-Dutoit S. Oonore B Hamilion-Dutoit S. Oonore B, Nyengaard JR, d' Amorc F.
  • Tumor-infiltrating macrophages correlate with adverse prognosis and Epstein-Barr virus status in classical Hodgkin's lymphoma. Haematologica. 201 I ;96:269-276.
  • Kirschner MB Kao SC, Edehnan JJ, etal. Haemolysis during sample preparation alters microRNA content of plasma.
  • microENA-2.1 -induced pre-B-cell lymphoma. Nature. 2010;467:86-90.
  • Pritchard CC Kroh E, Wood B, et aL Blood cell origin of circulating microRNAs: a cautionary note for cancer biomarker studies. Cancer prevention research. 2012;5:492-497.
  • R-IPI revised international Prognostic Index
  • Thapa DR, Bhatia , Bream JH, et al B-cell activation induced micro RNA-21 is elevated in circulating B cells preceding the diagnosis of A! DS-related non-Hpdgkin

Abstract

A method of determining whether or not a subject has a B-cell lymphproliferative disorder, includes determining the expression, level of one or more of miRNA.-l.973., rni.RNA.-638 and tmRNA-494, wherein a B-cell lymphoproiiferative disorder is associated with elevated levels of the miRNAs. Measurement of expression levels of these miRNAs may he useful in a method of evaluating treatment eftlcacy of a B-cell lymphproliferative disorder, a method of treating a B-cell lymphoproliferative disorder and/or a method of determining the prognosis of a subject with a B-cell lymphoproliferative disorder. Examples of B-cell lymphproliferative disorders include Diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma, classical Hodgkin Lymphoma and Burkitt lymphoma.

Description

PC
J j E
BIOMARKERS AND USE THEREOF IN IDENTIFICATION OF B-CELL
LYMPHOPROLIFERATIVE .DISORDERS TECHNICAL FIELD
THIS INVENTION relates to methods for diagnosis, prognosis and/or disease response monitoring ofB-cell lymphoproliferative disorders. More particularly, this invention relates to detennming expression levels of one or more micro-RNAs correlated with B-cell lyrnphoproliferative disorders in a biological sample from a subject
BACKGROUND
Long-term disease control of certain B-cell lymphpro .iterative disorders such as for example classical Hodgkin Lymphoma is relatively high (Evens, A.M. et a/., 2008). Thus for Hodgkin Lymphoma the emerging issue is to minimize treatment related complications such as secondary cancer, cardiopulmonary complications, stroke and infertility (Armitage, J. 0.; 2010 and Krutl, .R. et a!,, 2012). Paradoxically, there remains a significant minority with refractory disease. In these patients prolonged exposure to first-line agents can induce chenio- resistance and unnecessary toxicity, and alternate rescue strategies should be instituted early. In other lymphomas, such as Diffuse Large B-cell Lymphoma, relative to Hodgkin Lymphoma, the outcome is poor (Coiffier, 2007). In all B-ee!l lymphoproliferative disorders the challenge remains to accurately predict and monitor response to therapy, so that a early risk-stratified approach can be commenced. Although positron emission tomography combined with computerized tomography (PET/CT) has a high negative predictive value, its positive predictive value is more modest (Gallamini A et a/., 2007). Furthermore, it is impractical to perform PET/CT prior to each follow-up visit. New approaches such as biomarkers, in particular blood bio-markers, might assist interpretation of conventional measures of disease response, to better identify those that could be spared excessive treatment., and those where change in therap should be expedited (Jones, K et a/, 2013 and Plattel, W.J. et aL, 2012). Circulating disease response biomarkers have the added advantage of being non- invasive and practical for frequent testing. Should easily measurable diagnostic, prognostic and/or therapy outcome biomarkers be identified, they have the potential to assist therapeutic decision-making both when PET/CT is and isn't available.
MicroRNA (intRNA) are small non-coding RNA molecules that play key regulatory roles in numerous biological processes, and are ubiquitously dysregulated in malignancies including lymphoma (lorio, M. V and Croce, CM, 2009 and Lawrie, CM, etaL, 2008). They are remarkably stable in blood, are resistant to multiple freeze-thaw cycles and are present in elevated levels within the cell-free compartment of a variety of cancers (Chen, X. et al, 2008; Mitchell P.S. et aL. 2008; Allegra, A. el a/., 2012; and Gilad, S. et at, 2008). Much miRNA biomarker research has focused on identifying signatures, for use in situations where screening biomarkers would be clinically beneficial {e.g., prostrate and lung cancer).
SUMMARY
MieroRWAs represent an important class of biomarkers that provide opportunities for clinical translation. The invention is broadly directed to a method of diagnosis, prognosis and/or diseas e response monitor ing of B-cell lymphoproliferative di sorders.
In work leading to the present invention, specific miRNA biomarkers were discovered which proved to be useful in the diagnosis, prognosis and/or disease monitoring of B-cell lymphproliferative disorders, in particular classical Hodgkin Lymphoma and Diffuse Large B- cell Lymphonia. Subsequently, methods have been developed to diagnose subjects with B-cell lymphproliferative disorders and to provide a prognostic and/or therapy outcome determination.
In a first aspect, the invention provides a method of determining whether or not a subject has a B-cell lymphproliferative disorder, including:
determining the expression level of a miRN A biomarker hi a biological sample from a subject, wherein the miRNA biomarker is selected from the group consisting of miRNA- 1973, miRNA-638 and raiRNA-494, and wherein a B-cell lymphoproliferative disorder is detected if said one or more miR A biomarkers, is at an elevated level or over expressed in the biological sample.
in one embodiment, the biological sample comprises tissue, blood, serum, plasma or cerebrospinal fluid. Typically, the miRNAs are obtainable from a non-cellular source. Accordingly, the biological sample is, comprises, or is obtained from a non-cellular source. The biological sample may be serum, plasma, or cerebrospinal fluid, although without 1 imitation thereto.
In an embodiment, the B-cell lymphoproliferative disorder is selected from the group consisting of Diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Mantle cell Lymphom and Burkitt. lymphoma. Preferably, the B-cell lymphproliferative disorder is classical Hodgkin Lymphoma r Diffuse Large B-cell Lymphoma. In another embodiment, the method of the first aspect farther comprises measuring an additional miRNA biomarker selected from the group consisting of miRNA-21 , mtRNA- 2861 , mi A- 155 and miRN A- t o.
in yet another embodiment, the expression level of a protein or DNA biomarker may also be determined. Suitably, the protein or DNA biomarker is selected from the group consisting of CD163, Thymus and Activation-Regulated Cheraokine (TARC), lactate dehydrogenase, Epstein-Ban: Virus DNA, Enterleukin-2 receptor, Attti-fhrombin 111, CXCL13, lL-10, Galeetin-1 , CCL22 macrophage derived chemokme, CCL17 and LAG3.
in a second aspect, the invention provides a method of evaluating treatment efficacy of a B-celi lymphproliferati ve disorder in a subject including;
determining the expression level of a miRNA biomarker in a biological sample from a subject before, during and/or after treatment, wherein the miRN A biomarker is selected from the group consisting of miRNA-1973, miRNA-638 and nhRNA-494;
to thereby evaluate the treatment efficacy of the B-cell lymphproliferati ve disorder in the subject, wherein if said one or more miRNA biomarkers, is at a reduced level down regulated or absent in the subject's biological sample., the treatment is efficacious.
In a third aspect, the invention provides a method of treating a B-cell lymphoproliferative disorder in a subject including;
determining the expression level of a miRNA biomarker in a biological sample from a subject, before, during and/or after treatment of the B-cell lymphoproliferati ve disorder, wherein the miRNA biomarker is selected from the group consisting of miRNA-1973, miRNA-638 and miRNA-494 and based on the determination made, initiating, continuing or modifying a treatment of the a B-cell lymphoproliferative disorder.
In one embodiment, of the second and third aspects, the method further comprises selecting a treatment for a B-cell lymphproliferaiive disorder based on the expression level of the miRNA biomarkers.
In one embodiment, the biological sample comprises tissue, blood, serum, plasma or cerebrospinal fluid. Typically, the miRNAs are obtainable from a non-cellular source. Accordingly, the biological sample is, comprises, or is obtained from a non-cellular source. The biological sample may be serum, plasma, or cerebrospinal fluid, although without limitation therefax
ln an embodiment, the B-ceil lymphproliferaiive disorder is selected from the group consisting of Diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, mantle cell lymphoma and Burkitt lymphoma. Preferably, the B-cell lymp oproliferative disorder is classical Hodgkin Lymphoma or Diffuse Large B-cell Lymphoma,
In another embodiment, the method of the second and third aspects -further comprises measuring an additional miRNA biotnarker selected from the group consisting of miRNA-21 , miRNA-2861. miRNA- 155 and miRNA- 16.
in yet another embodiment, the expression level of a protein or DNA biornarker may also be determined. Suitably, the protein or DNA biornarker is selected from the group consisting of CD.163, Thymus and Activation-Regulated Chemokine (TARC), lactate dehydrogenase, Epste in- Barr Virus DNA, Inter leukin-2 receptor, Anti-thrombin III, CXCLl 3, IL-10, Galectin-1 , CCL22 macrophage derived chemokine, CCL17 and LAG3.
In a fourth aspect, the invention provides a method of determining the prognosis of a subject with a B-cell lynrphoproliferative disorder, including;
determining the expression .level of a miRNA biornarker in a biological sample obtained from a subject, before, during and/or after treatment, wherein at least one miRNA biornarker is selected from the group consisting of miRNA- 1973, miRNA-638 and miRNA-494, to thereby evaluate the prognosis of the B-cell lymphoproliferative disorder in the subject, wherein if the expression level of said one or more miRNA biomarkers, is reduced, down regulated or absent in the biological sample, the prognosis is positive.
in one embodiment, the biological sample comprises tissue, blood, serum, plasma or cerebrospinal fluid. Typically, the rniRNAs are obtainable from a non-cellular source. Accordingly, the biological sample is, comprises, or is obtained from a non-cellular source. The biological sample may be serum, plasma, or cerebrospinal fluid, although without 1 imitation thereto.
in one embodiment, the B-cell lymphoproliferative disorder is selected from the group consisting of Diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma, classical Hodgkin Lymphoma, and Burkitt lymphoma. Preferably, the B-cell lymphopiOliferative disorder is classical Hodgkin Lymphoma or Diffuse Large B-cel l Lymphoma.
In particular embodiments, the method of the fourth aspect, further comprises measuring an additional miRNA biornarker selected from the grou consisting of miRNA-2 1 , miRNA-2861 , miRNA- 155 and miRNA- 16.
In a further embodiment, the expression level of a protein or DNA biornarker may also be determined. Suitably, the protein or DNA biornarker is selected from the group consisting of CD 163, Thymus and Activation- Regulated Che okine (TARC), lactate dehydrogenase, Epstein-Barr Virus DNA, Interleukin-2 receptor, Anti-thrombin III, CXCL13, IL-10, Gaiectin-1 , CCL22 macrophage derived cheniokine, CCL1 7 and LAG3.
in one embodiment, a prediction of prognosis is given by a likelihood score derived from a clinical, such as Hasenclever scores., sub-division into early good risk/early poor risk stages, or International Prognostic Score.
In one embodiment, the prognosis is used, at least in part, to determine whether the subject would benefit from treatment of the B-cell lymphoproliferative diso rder.
in another embodiment, the prognosis is used, at least in part, to develop a treatment strategy for the subject.
In yet another embodiment, the prognosis is used, at least in part, to determine disease progression in the subject.
In an embodiment, the prognosis is defined as an estimated time of sun iv l.
In one embodiment, the method of any one of the above aspects includes determining suitability of the subject for treatment based, at least in part, on the diagnosis and/or prognosis.
In one embodiment, reduced, down regulated or absent expression levels of miRNA- 1973, miRNA-638 and/or mi NA-494 indicates an effective B-celi lymphopro liferative disorder therapy.
In one embodiment of the above aspects, the subject is human.
Throughout this specification, unless the context requires otherwise, the words "comprise", "comprises1' and "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
BRIEF DESCRIPTION OF THE FIGURES
Reference is made to the following Figures which assist in understanding non-limiting embodiments of the invention described in detail hereinafter.
Figure 1 . Differential expression of human nriRNA in classical Hodgkin Lymphoma (cHL) primary tissue. (A) Unsupervised clustering of the top 50 differentially expressed human miRNA by mieroarray in a discovery cohort of 14 cHL diseased nodes (MC; mixed cellularity, MS: nodular sclerosing) versus 8 non-malignant lymph nodes (LN). Red denotes high expression. Figure 2. Differential expression of human miR A in cl I L primary tissue. (A- G) Comparison of miRN A expression in prospective cohort of 27 cOL diseased nodes versus 8 non-malignant lymph nodes by q'RT-PCR. Error bars represent mean with SEIV1.
Figure 3. Plasma miRNA-494, miRNA- 1973 and miR A-21 levels in cHL. (A- C) Receiver Operating Characteristic ( ROC) plots demonstrate high sensitivity and specificity of pre-therapy cHL versus healthy participant; (D-F) pie-therapy cHL versus CR six months post-therapy; AUG, area under the curve.
Figure 4. Kinetics of circulating miRNA cHL disease response biomarkers.
(A-C) Plasma miRNA levels throughout therapy in cHL patients in CR at sis months post- therapy. (D-F) Compariso of interim therapy treatment response. cHL patients, restricted to those with paired interim samples that matched interim radiological assessment. (D..E) mjRNA-494 and miRNA- 1973 levels show a significant difference between paired pre- therapy and CR interim, therapy (P=0.0438, P=0.001:2 respectively) while no significant difference was seen between paired pre-therapy and PR interim therapy (P=NS for both). (F) miRN A-21 levels show no significant difference between paired pre-therapy versus CR or PR interim therapy. Error bars represent mean with SEM, P<0.001=***, P<0.0 i=**, P<0,05™*.. P>0,05-NS.
Figure 5. For cHL, circulating miRN A relative to cellular RNA (116). (A) Plasma U6 levels; and (B) plasma albumin-DNA levels throughout therapy in cHL patients in CR at six months post-therapy, (C-E) Plasma miRNA levels relative to plasma cellular RNA (U6) levels. Error bars represent mean with SEM. P<0.001 =***, P<Q.0 J=**, P<0.05=*, PX).05=NS.
Figure 6. Table showing cHL patient characteristics.
Figure 7. Table showing associations with cHL clinical prognosticators and pre- therapy absolute levels of miRNA-494, miR A- 1.973 and miRNA-21 .
Figure 8. Table showing miRNA-638 in the plasma of 40 patients with Diffuse Large B-cell Lymphoma (40 pre-therapy samples, 37 post-cycle 4 of the chemo immunotherapy regimen 'CHOP-R1. with 32 paired pre/post samples), compared to healthy control, participant plasma. Figure 7 A shows a significant drop difference by pair ed-t test, between pre-therapy relative to controls,, as does post-cycle 4 to controls. Figure 7B is restricted to 23 paired patient samples, all of whom had had a positive Positron Emission Tomogram / Computer Assisted Tomogram (PET/CT) scan at pre-therap which had become positive after post-cycle 4, showing a significant decline by paired t-test in miRNA-638. The decline in the 9 paired samples of patients remaining PET/CT positive post-cycle 4 did not reach significance (p=Q,78).
BRIEF DESCRIPTION OF THE. SEQUENCES
miRNA- 1973 human sequence (ACCGUGCAAAGGUAGCAUA) miRNA-21 human sequence (UAGCUUAUCAGACUGAUGUUGA). miRNA-494 human sequence (UGAAACAUACACGGGAAACCUC). miRNA-2861 human sequence (GGGGCCtiGGCGGUGGGCGG). nai NA-155 human sequence (UUAAU'GCU AAUCGUG AUAGG GGU).
miRNA-638 human sequence (AGGGAUCGCGGGCGGGUGGCGG CCI..: .).
U6 sequence (GUGCUCGCUUCGGCAGCACAUAUACUAAAA UUGGAACGAUACAGAGAAGAUtTAGCAUGGCCCCUGCGCAA GGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUU).
miRNA-1976 primer sequence (5 'ACCGTGCAAAGGTAGCATAAA-
3 ')- miRNA-21 primer sequence (5 '-CGTAGCTT ATCAGACTGATGT TGAA-3')- miRNA-494 primer sequence (5 !- GAAACATACACGGGAAACCTC
AAA-3 ' }.
rnIRNA-2861 primer sequence (S'-GGCGGTGGGCGGAAA -3'). iniRNA- 1 55 primer sequence (5 '-TTAATGCT AATCGTGATAGGGG TAA.-3').
miRNA-638 primer sequence (5 '-CGGGTGGCGGCCTAA-3 ' ).
U6 primer sequence (5*-CAAA.TTCGTGAAGCGTTCCATA-3'). Qiage miScript primer raillNA-39 (cel-miR A-39) (5 !- UCACCGGGUGUAAAUCAGCUUG-3 ')
DETAILED DESCRIPTION
The invention provides methods for assessing subjects with B-cell lympiioproliferative disorders, and particularly to predict, diagnose, and/or monitor B-cell lympiioproliferative disorders in a subject prior to, during and/or after treatment. In particular, the methods include determining the expression levels of miRNA biomarkers.
Definitions
Unless contraindicated or noted otherwise, in these descriptions and throughout this specification, the terms "a" and lW mean one or more.
By "biological sample" is meant a sample that comprises for example a bodily fluid including whole blood, serum, plasma, cerebrospinal fluid and the like or a sample that comprises tissue, or any other material isolated in whole or in part from a subject, A biological sample may include without limitation sections of tissues such as a biopsy and autopsy sample, and frozen sections taken for histological purposes such as blood, plasma, serum, cerebrospinal fluid and the like. Biological samples may also include explants and primary or transformed cell cultures derived from the subject's tissues. Typically, the raiRNAs are obtainable from a non-celhiiar source. Accordingly, the biological sample is, comprises, or is obtained f om a non-cellular source. Preferably, the biological sample may be serum, plasma, or cerebrospinal fluid, although without limitation thereto.
By "consisting of is meant including, and limited to, whatever follows the phrase "consisting of" Thus, the phrase "consisting of indicates that the listed elements are required or mandatory, and that no other elements may be present.
The term "control sample typically refers to a biological sample from a (healthy) non- diseased individual not having a B-cell lympiioproliferative disorder. In one embodiment, the control sample may be from a subject known to be free of a B-cell 'lympiioproliferative disorder. Alternatively, the control sample may be from a subject in remission from a B-cell lymphoproUferative disorder. The control sample may be a pooled, average or an individual sample. An internal control is a marker from the same biological sample being tested, such as a miRNA biomarker control.
The term "determining" includes any form of measurement, and includes determining if an element is present or not, tor example an miRNA biomarker. The terms ''''determining", "measuring*, "evaluating , "assessing' and "assaying' are used interchangeably and include quantitative and qualitative determinations. Determining may be relative or absolute. "Determining the presence of includes determining the amount of something present (e.g.. an miRN A and/or protein biomarker), and/or determining whether it is present or absent. As used herein, the terms "determining " "measitrtng" and "assessing" and "assaytog" are used interchangeably and include both quantitative and qualitative determinations. The terms "diagnosis'" and "diagnosing" are used herein to refer to methods by which a person of skill in the art can evaluate and/or determine whether or not a subject is suffering from a B-eell lymphoproliferative disorder.
By "enhanced or "increased" as used herein to describe the expression level of mi A, protein and DNA biomarkers, refers to the increase in and/or amount or level of at least one or more miRNA, protein and DNA biomarkers, including valiants in a biological sample when compared to a control sample or further biological sample from a subject. The expression level of biomarkers may be relative or absolute. In some embodiments, the miRNA, protein and/or DNA biomarkers are increased if their level of expression is more than about 0.5%, \%, 2%, 3%, 4%, 5%, 10%, 35%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400% or at least about 500% of the level of expression of the corresponding miRNA, protein and/or DNA biomarkers in a control sample or further biological sample from a subject.
The term "expression leveF, as used herein, refers to the extent to which a particular miRNA biomarker sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in a biological sample from a subject to be analysed or the concentration of a protein or DNA biomarker in a biological sample from a subject to be analysed. In specific embodiments, the standard value of the expression levels obtained in several independent measurements of a given sample (for example, two, three, five or ten measurements) and/or several measurements within several samples or control samples are used for analysis. The standard value may be obtained by any method known in the art. For example, a range of mean ± 2 SD (standard deviation) or mean ± 3 SD may be used as standard value. The difference between the expression levels obtained from biological samples from subjects with B-cell lymphoproliferative disorders and control samples ma be normalized to the expression level of further control nucleic acids, e.g. housekeeping markers whose expression levels are known not to differ depending on the disease states of the subject from whom the sample was collected. Exemplary housekeeping markers that may be suitable for miRNA include small RNA 116, miRNA- 16, and C. elegans miRNA-39 synthetic oligonucleotide R A. In preferred embodiments, the control nucleic acid is another miRNA known to be stably expressed in individuals with B-cell lymphoproliferative disorders from whom the sample was collected. Furthermore, the control protein o DNA for example, is another protein or DNA known to be stably expressed in individuals with B-cell lymphoproliferative disorders from whom the sample was collected. As used herein, the term 'IMCTORNA" (including "miRNA'\ l'mRNA" or "miR") as used herein, is given its ordinary meaning in the art (e.g.. He, L. and Hannon, G. J. 2004). Accordingly, a miRNA denotes an RNA molecule derived from a genomic locus that is processed .from transcripts that can form local RNA precursor miRNA structures. The matiue miRNA is usually 20, 21, 22, 23, 24 or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.
The terms "prognosis and "prognostic" are used herein to include making a prognosis, which can provide for predicting a clinical outcome (with or without medical treatment), select ing an appropriate course of treatment (or whether treatment would be effective) and/or monitoring a current treatment and potentially changing the treatment. This may be at least partly based on determining expression levels of the miRNA biomarkers utilised by the methods of the invention, which may be in combination with determining expression, levels of protein and/or other nucleic acid biomarkers. A prognosis may also include a prediction, forecast or anticipation of any lasting or permanent physical or psychological effects of the B- cell lymphoproliferative disorder suffered by the subject after the B-cell lymphoproliferative disorder has been successfully treated or otherwise resolved. Furthermore, prognosis may include one or more of determining metastatic potential, therapeutic responsiveness, implementing appropriate treatment regimes, determining the probability, likelihood or potential for B-cell lymphoproliferative disorder recurrence after therapy and prediction of development of resistance to established therapies (e.g. chemotherapy).
By "proteitF is meant an amino acid polymer including peptides and polypeptides. The amino acids may be natural or non-natural, D- or L- amino acids as are well understood in the art. The term "proteiiF also includes molecules that contain protein components, such as glycoproteins and lipoproteins although without limitation thereto.
The terms, "reduced* and "down .regulated*, as used herein to describe the expression level of miRNA, protein and DNA biomarkers, refer to a reduction in and/or amount or level of at least one or more miRNA, protein and DNA biomarkers, including variants in a biological sample when compared to a control sample or further biological sample from a subject The expression level of the biomarkers may be relative or absolute, in some embodiments., the miRNA, protein and/or DNA biomarkers are suppressed, reduced or down regulated if their level of expression is less than about 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001% or 0,0001% of the level of expression of the corresponding miR NA, protein and/or DNA biomarkers in a control sample or further biological sample from a subject. In one embodiment the expression of any one or more of the miRN A, protein and/or DMA biomarkers may be completely absent from a biological sample.
The term ''sequence identity is used herein in its broadest sense to include the number of exact nucleotide or amino acid matches hav ing regard to an appropriate alignment using a standard algorithm, having regard to the extent that sequences are identical over a window of comparison. Thus, a "percentage of sequence identity' is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G. U) or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (ie., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For example, "sequence identity* may be understood to mean the "match percentage" calculated by the DNASIS computer program (Version 2.5 for windows: available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA).
The terms "subject and "patient are used interchangeably in their broadest sense. In a preferred embodiment, the subject is a mammal. Non-limiting examples of mammals include humans, dogs, cats, horses, cows, sheep, goats and pigs. Preferably, a subject includes any human or non-human mammal, including for example, a primate, cow, horse, pig, sheep, goat, dog, cat, or rodent, capable of developing a B-cell lymphoproliferative disorder, including humans that are suspected of having a B-cell lymphoproliferative disorder, that have been diagnosed as having a B-cell lymphoproliferative disorder or that have a family history of B- cell lymphoproliferative disorders. Methods of identifying subjects suspected of having a B- cell lymphoproliferative disorder include, but are not limited to: physical examination, family medical history, subject medical history, biopsy and PET-CT scans. However, the term also relates to an apparently healthy subject i.e., a subject not exhibiting any symptoms or clinical signs or parameters indicative of a B-cell lymphoproliferative disorder. Apparently healthy subjects may be investigated by the method of the present invention as a measure of preventative care or for population screening purposes.
Methods of Diagnosis, Prognosis and Evaluating Treatment Efficacy
In a first aspect the invention provides a method of determining whether or not a subject has a B-cell lymphoproliferative disorder, including:
determining the expression level of a miRNA biomarker in a biological sample from a subject, wherein the miRNA biomarker is selected, from the group consisting of miRNA- 1973, tniR.NA-638 and miRNA-494, and wherein a B-celi lymphoproliferative disorder is detected if said one or more miR A biomarkers, is at an elevated level or over expressed in the subject's biological sample.
Suitably, the expression level of any combination of the raiRNA biomarkers miRNA- 1973, miRNA-638 and miRNA-494 in a biological sample may be determined, including for example: miRNA- 1973 and miRNA-638; miRNA- 1973 and miRNA-494; miRNA-638 and miRNA-494; or miRNA-1973, miRNA-494 and miRN A-638.
In one embodiment the method of diagnosing a B-cell lymphoproliferative disorder in a subject includes determining the expression level of a further miRNA biomarker in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group: miRNA-21, miRNA- 2861 , miRNA- 155, and miRNA- .16, and wherein B-cell lymphoproliferative disorder may be detected if at least one of the miRNA biomarkers is at an elevated level or over expressed in the biological sample.
In one embodiment the method of diagnosing a B-cell lymphoproliferative disorder in a subject includes determining the expression level of at least two further miRNA biomarkers in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group: miRNA-21 , miRNA-2861, raiRNA- J 55, and miRNA- 16, and wherein a B-cell lymphoproliferative disorder may be detected if at least the two miRN A biomarkers are at an elevated level or over expressed in the biological sample.
In. one embodiment the method of diagnosing a B-cell iymphoproliferattve disorder in a subject includes determining the expression level of at least three further miRNA biomarkers in addition to miRNA-1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the raiRNA biomarkers are selected from the following group: miRNA-21, miRNA-2861 , miRNA- 155, and miRNA- 16, and wherein a B-cell. lymphoproliferative disorder may be detected if at least the three miRN A biomarkers are at an elevated level or over expressed in the biological sample.
In one embodiment the method of diagnosing a B-cell lymphoproliferative disorder in a subject includes determining the expressio level of at least four further miRN A biomarkers in addition to miRNA-1 73, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are miRNA-21 , miRNA-2861 , miRNA- 155 and miRNA- 16, and wherein a B-cell lymphoproliferative disorder may be detected if all four miRN biomarkers are at an elevated level or over expressed in the biological sample.
Suitably, any number of miRNA biomarkers may be determined, including, but not limited to 1, 2, 3, 4, 5, 10, i 5, 20, 25, 30, 35, 40, 45, 50, 100, 1 0, 200, 250, 300, 400 or 500.
In one embodiment, variants of the miRNA biomarkers may be suitable for the diagnosis and'or prognosis of a B-cell lymphoproliferative disorder. Suitably, the expression level of a variant of any of the aforementioned miRNAs may be determined in a biological sample from a subject. Suc variants preferably have a nucleic acid sequence being at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentag sequence identity to any one of SEQ ID NOS: 1 to 7.
It would be understood by a person of skill in the art that the expression level of one or more miRNA biomarkers in a biological sample could be compared with that of a control sample or that of a farther sample from the same subject or a different subject.
It will be appreciated that the methods of the invention inc lude methods of determining the expression level of miRNA biomarkers alone or i combinatio with protein and/or DNA biomarkers which have been identified as being diagnostic for a B-cell lymphoproliferative disorder. Suitably, when the expression level of raiRNA, protein and/or DNA biomarkers are determined, they can be derived from the same or different samples. For example, the expression level of a miRN A biomarker can be detennined in a blood derived sample and the expression level of a protein biomarker can be determined in a tissue sample.
Protein and DNA biomarkers which may be useful for diagnosing a B-cell lymphoproliferative disorder include without limitation, one or more of CD 163 (Jones, K. et al, 2 1 ), Thymus and Activation-Regulated C emokme (TA C) (Jones, K. ei al, 2012), lactate dehydrogenase, Epstein-Barr Virus DNA, fnterleukin-2 receptor (Yang, 201 1 ), Anti- thrombin 111 (Roy, 2008), CXCL.13 (Rubenstein, 2012), lL-10 (Rubenstein, 2012), Galectin-1 (Gandhi M. . et al., 2007), CCL22 macrophage derived cheraokine (Niens, M. et al, 2008), CCL17 (Jones, et al., 2013) and LAG3 (Gandhi, M.K. 2006).
Suitably, any number of protein or DNA biomarkers may be determined, including, but not limited to 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, Ϊ 00, 150, 200, 250, 300, 400 or 500.
In one embodiment, variants of the protein or DNA biomarkers may be suitable for the diagnosis of a B-cell lymphoproliferative disorder, including protein or DNA biomarker variants that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentage amino acid sequence identity to the protein biomarkers. Variants, a used herein, include polymorphisms, splice variants, mutations, and the like.
Suitably, B-cell lyrnphoproliferative disorders include, without limitation, malignancies selected from the following group: Diffuse large B-cell. lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma, Mantle-cell lymphoma. Chronic lymphocytic leukemia (CLL), Marginal-zone lymphoma - nodal, extra nodal (MALT) and splenic, lymphoplasmacytic lymphoma (LPL), Hodgkin lymphoma (nodular lymphocyte pre-dominant type), primary central nervous system lymphoma and post-transplantation, lyrnphoproliferative disorders, diffuse large B-cell lymphoma (DLBCL), not otherwise specified, primary DLBCL of the CNS, primary cutaneous DLBCL, leg type, T cell/It istiocyte rich large B-cell lymphoma, EBV+ DLBC L of the elderly, DLBCL associated with chronic inflammation, Follicular lymphoma, Mucosa-Assoctated Lymphatic Tissue lymphoma (M ALT), small cell lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia). Mantle cell lymphoma, Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macrogiobulraemia, Nodal marginal zone B cell lymphoma (NMZL), Splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, Lymphomatoid granulomatosis, Large B-cell lymphoma arising in HHV-8- associated multicentric Castleman Disease, ALK-positive large B-cell lymphoma, AIDS- related lymphoma, Post-Transplantation Lyrnphoproliferative Disorders (PTLD), Primary Central Nervous System Lymphoma (PCNS.L), Classic Hodgkin's lymphoma, nodular lymphocyte predominant Hodgkin's lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and classical Hodgkin lymphoma.
Preferably, the B-cell lyrnphoproliferative disorder is classical Hodgkin Lymphoma or
Diffuse large B-cell lymphoma (DLBCL).
In a second aspect, the invention provides a method of evaluating treatment efficacy of a B-cell lymphopro liferative disorder in a subject including;
determining the expression level of a miRNA biomarker in a biological sample from a subject before, during and/or after treatment, wherein the miRNA biomarker is selected from the group consisting of miRNA- 1973, mi NA-638 and miRNA-494; to thereby evaluate treatment efficacy of the B-ce!l lymphoproliferative disorder in the subject, wherein if said one or more miRNA biomarkers, is at a reduced level, down regulated or absent in the subject's biological sam le, the treatment is efficacious.
in a third aspect, the invention provides a method of treating a B-ce l lymphoproliferative disorder in a subject including;
determining the expression level of a miRNA biomarker in a biological sample from a subject, before, during and/or after treatment of the B-cell lymphoproliferative disorder, wherein the miRNA biomarker is selected from the group consisting of miRNA-1973, mi.RNA-638 and miRNA-494 and based on the determination, initiating, continuing or modifying th treatment.
A fourth aspect of the invention provides a method of detenninmg the prognosis of a subject with a B-cell lymphoproliferative disorder, including but not limited to:
determining the expression level of a miRNA biomarker in a biological sample from a subject, wherein the miRNA biomarker is selected from the group consisting of miRNA- 1 73, miRNA-638 and miRNA-494, to thereby evaluate the prognosis of the B-cell lymphoproliferative disorder in the subject, wherein if said one or more miRNA biomarkers, is at a reduced level, down regulated or absent in the subject's biological sample, the prognosis is positive.
Suitably, the expression level of any combination of the miRNA biomarkers miRNA- 1 73, miRNA-638 and miRNA-494, in a biological sample may be determined, including for example: miRNA- 1973 and miRN A-638; miRNA-1973 and miRNA-494; miRNA-638 and miRNA-494; or miRNA-1973, miRNA-494 and miRNA-638.
In one embodiment the method of evaluating treatment efficacy and/or prognosis of a B-ceO lymphoproliferative disorder in a subject includes determining the expression level of a further miRNA biomarker in addition to miRNA-1 73, miRNA-494 and/or miRNA-638 in a biologtcal sample from the subject, wherein the miRNA biomarker is selected from the following group: miRNA-23 , miRNA-2861, miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if at least one miRNA biomarker is at a reduced level or down regulated or absent in the biological sample.
In one embodiment the method of evaluating treatment efficacy and/or prognosis of a B-cell lymphoproliferative disorder in a subject includes determining the expression level of at least two further miRNA biomarkers in addition to miRNA-1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group; miRNA-2861 , mlRNA-2 ] , miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if at least two miRN A biomarkers are at a reduced level o down regulated or absent in the biological sample.
in one embodiment the method of evaluating treatment efficacy and/or prognosis of a B-ee!! lymphoproliferative disorder in a subject includes determining the expression level of at least three farther miRNA biomarkers in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological sample from the subject, wherein the miRNA biomarkers are selected from the following group: miRNA-2861, miRNA-21, miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if at least three miRN A biomarkers are at a reduced level or down regulated or absent in the biological sam le.
in one embodiment the method of evaluating treatment efficacy and/or prognosis of a B-cell lymphoproliferative disorder in a subject includes determining the expression level of at least four further miRNA biomarkers in addition to miRNA- 1973, miRNA-494 and/or miRNA-638 in a biological, sample from the subject, wherein the miRNA biomarkers are miRNA-2861, mtRNA-21 , miRNA- 155, and miRNA- 16, and wherein the prognosis may be positive if all four miRNA biomarkers are at a reduced level or down regulated or absent in the biological sample.
Suitably, any number of miRNA biomarkers may be determined, including, but not limited to 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 400 or 500.
In one embodiment, variants of the miR A biomarkers may be suitable for evaluating treatment efficacy and/or prognosis of a B-cell lymphoproliferative disorder. Suitably, the expression level of a variant of any of the aforementioned. miR As .may be determined in a biological sample from a subject. Such variants, preferabl have a nucleic acid sequence being at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentage sequence identity to any one of SEQ ID NOs: 1 to 7.
It would be understood by a person of skill in the art that the expression level of one or more miRNA biomarkers in a biological sample could be compared with that of a control sample or that of a further sample from the same subject or a different subject.
it will be appreciated that the methods of the invention include methods of determining the expression level of miRNA biomarkers alone or in combination with protein and'Or DMA biomarkers which have been identified as being suitable .for evaluating treatment efficacy and/or prognosis for a B-cell lymphoproliferative disorder. Suitably, when the expression level of miRNA, protein and/or DNA biomarkers are determined, they can be derived from ihe same or difFerent samples. For example, the expression level of an miRNA biomarker can be determined in a b!ood derived sample and the expression level of a protein biomarker can be determined in a tissue sample.
Protein and DNA biomarkers which may be useful for evaluating treatment efficacy and/or prognosis of a B~cell lymphoproliferative disorder include without limitation, one or more of CD 163 (Jones, I et al, 2013), Thymus and Activation-Regulated Chemokine (TARC) (Jones, K. et al, 2012), lactate dehydrogenase, Epstein-Ban: Virus DNA, Interleukin- 2 receptor (Yang, 201 1 ), Anti-thrombin Hi (Roy, 2008), CXCL 1.3 (Rubenstein, 201.2), I.L- 10 (Ru enstein, 2012), Galectm-1 (Gandhi, M.K. et al,. 2007), CCL22 macrophage derived chemokine (Mens, M. et al, 2008), CCL17 (Jones, et al, 2013 ) and LAG3 (Gandhi, M.K. 2006).
Suitably, any number of protein or DN A biomark ers may be determined, including, but not limited to 1 , 2, .3, 4, 5, 10, 15, 20, 2.5, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 400 or 500.
In one embodiment, variants of the protein and/or DNA biomarkers may be suitable for the diagnosis and/or prognosis of a B-celi lymphoproliferative disorder, including protein or DNA biomarker varients that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% percentage amino acid sequence identity to the protein biomarkers. Variants, as used herein, include polymorphisms, splice variants, mutations, and the like.
Suitably, B-cell lymphoproliferative disorders include, without limitation, malignancies selected from the following group: diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma, Mantle-cell lymphoma, Chronic lymphocytic leukemia iCLL), Marginal-zone lymphoma - nodal, extra nodal ( MALT) and splenic, iymphoplasmacytic lymphoma (LPL), Hodgkin lymphoma (nodular lymphocyte pre-dominant type), primary central nervous system lymphoma and post-transplantation lymphoproliferative disorders, diffuse large B-cell lymphoma (DLBCL), not otherwise specified, primary DLBCL of the CNS, primary cutaneous DLBCL, leg type, T cell histiocyte rich large B-cell lymphoma, EBV+ DLBCL of the elderly, DLBCL associated with chronic inflammation. Follicular lymphoma, Mucosa-Associated Lymphatic Tissue lymphoma (MALT), small cell lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia), Mantle cell lymphoma, Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macroglobulinemia, Nodal marginal zone B cell lymphoma (NMZL), Splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, Lymphomatoid granulomatosis, Large B-cell lymphoma arising in HHV-8- associated multicentric Castleman Disease, ALK-positive large B-cell lymphoma, AIDS- related lymphoma. Post- Transplantation Lymphoproiiferative Disorders (PTLD), Primary Central Nervous System Lymphoma (PCN'SL), Classic Hodgkin's lymphoma, nodular lymphocyte predominant Hodgkin's lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burfcitt lymphoma, B-cell lymphoma, anclassiftable, with features intermediate between DLBCL and classical Hodgkin lymphoma.
Preferably, the B-cell lymphoproiiferative disorder is classical Hodgkin Lymphoma or Diffuse large B-cell lymphoma (DLBCL}.
In some embodiments, a diagnostic, prognostic and/or treatment tniRNA, protein and/or DNA expression level is correlated to a B-cell lymphoproiiferative disorder by merely its presence Or absence. In other embodiments, a threshold level of a diagnostic, prognostic and or treatment mi N A, protein and'or DNA expression level can be established, and the level of the miRN A, protei and/or DNA in a. subject's biological sample can simply be compared to the threshold level.
in one embodiment, a prediction of prognosis and/or treatment outcome is given by a. likelihood score derived from a clinical such as Hasenclever scores or sub-division into early good risk/early poor risk, advanced stages for Hodgkin Lymphoma, or International Prognostic Score for Diffuse Large B-cell Lymphoma, or Follicular Lymphoma International Prognostic Index for Follicular Lymphoma (Hansclever, D et al, 1998; So al-Celigny, P. et al., 2004; Sehn, L. FL, etal, 2011 ; Hoster, E. 2008; Caillared. i. etal,, 2013; Ferreri, A. et al, 2003; Morel, P. et al, 2009: Binet, J.L. et al, 1981 ; and Rai, .R. et al, 1987).
In some embodiments, the prognosis is used, at least in part, to determine whether the subject, would benefit f om treatment of the B-cell lymphoproiiferative disorder. In addition to determining treatment benefit, the prognosis may be used, at least in part, to develop a treatment strategy for the subject. In one embodiment, the prognosis is used at least in part, to determine disease progression in the subject, prognosis and/or an estimated time of survival.
B-cell lymphoproiiferative disorder treatments vary with the type of B-cel! lymphoproiiferative disorder to be treated. B-cell lymphoproiiferative disorder treatments most commonly used include without limitation, chemotherapy (e.g., cliemotherapeittic drugs including, but not limited, to alkylating agents, anthracy lines, corticosteroids, vincaalkaloids, platinum agents, antimetabolites, topoisomerase inhibitors, taxanes, immunotherapies, monoclonal antibodies or other anti-tumour agents), surgery, radiation treatment, or a combination of two or more of these treatments. Less commonly used treatments for B-celi lymphoproliferative disorders include laser treatment and cryosurgery. Other B-cell lymphoproliferative disorder treatments ma also be utilised. In some embodiments, multiple time points prior to, during and/or after treatment of a subject with a B-cell lymphoproliferative disorder may be selected to determine the expression level of at least one or more miRNA biomarkers, protein biomarkers and/or DNA biomarkers to determine a diagnosis, prognosis or treatment efficacy. For example, the expression level of specific miRNA biomarkers, protein biomarkers and/or DNA biomarkers can be determined at an initial time point and then again at one, two, three or more time points.
Suitably, the time points may be selected throughout a treatment cycle or over a desired time period. Over a desired time period, for example, the time points ma be prior to treatment, mid way through treatment and/or after treatment has been completed. Suitably, an increase or elevation in the expression level of at least one or more miRNA biomarkers utilised by the methods of the invention from the first to second and/or third time points may provide a poor prognosis for a subject with a B-cell lymphoproliferative disorder. Alternatively, a decrease or down regulation in the expression level of at least one or more miRNA biomarkers utilised by the methods of the invention from the first to second and/or third time points may provide a positive prognosis for a subject with a B-cell lymphoproliferative disorder. Furthermore, the change in expression level of one or more miRNA biomarkers, protein biomarkers and/or DNA biomarkers may be related to the severity, stage, or progression of the B-cell lymphoproliferative disorder and/or the efficacy of the treatment,
in one embodiment, biological samples may be soitrced and/or collected from a subject at diagnosis and then prior to each cycle of treatment. Suitably, there may be any number of treatment cycles, depending on the subject and the nature and/or stage of the B-cell lymphoproliferative disorder, including but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 and/or 20 cycles. The treatment cycles may be close together, spread out over a period of time and/or intense cycles at defined time points over a period of time, or any combination of the above. in further embodiments, samples may be taken both during treatment and/or afte treatment has been completed. Suitably, samples may be so arced from a subject at any time point after treatment has been completed, examples of which include 1 , 2, 3, 4, 5, 10, 15, 20, 25 and/or 30 days post treatment, 1, 2 and/or 3 weeks post treatment and/or 1 , 3, 6 and/or 9 months post treatment and/or 1, 2, 3, 4, 5, 10, 15, 20 and/or 30 years post treatment. The treatment may be completed once the subject is in remission or after at least one or more treatment cycles, depending on the subject and the B-cell lymphoproliferative disorder.
In some embodiments, subjects are sampled every three to six months and/or every year post treatment. It will be understood by a person of skill in the art that a subject may be in remission or may have non-responsive or relapsed B-cell lymphoproliferative disorder. If subjects have non-responsive or relapsed disease, then monitoring may be more frequent.
In one embodiment, an increase or no change in the expression level of one or more miRNA biomarkers wherein at least one miRNA biomarker is miRNA- 1 73, miRNA-638 or miRNA-494 in a second, third, fourth and/or fifth etc., biological sample from a subject collected either after treatment or during treatment as compared to the expression level in a first earlier sample, may indicate progression of the B-cell lymphoproliferative disorder or failure of the treatment.
In one embodiment, a decrease, reduction or absence in the expression level of one or more miRNA biomarkers, wherein at least one of the miRNA biomarkers is miRNA-1973, miRNA-638 or miRNA-494 in biological samples from a subject undergoing treatment, may indicate that the treatment is efficacious.
It will be understood by a person of skill in the art that, while in certain embodiments the level of miRNA biomarker expression can be measured using the same miRNA biomarker at different time points, it is also possible to measure tire level of different miRN A biomarkers expression at a first and second time point and a comparison of the expression levels can provide diagnostic, prognostic and/or treatment efficac information.
Biological Samples
In one embodiment, the biological sample comprises tissue, (e.g., biopsy), blood, serum, plasma and/or cerebrospinal fluid. Typically, the miRNAs are obtainable from a non- cellular source. Accordingly, the biological sample is, comprises, or is obtained from a non- cellular source. Preferably; the biological sample may be serum, plasma, or cerebrospinal fluid, although without limitation thereto. More preferably, the biological sam le comprises serum or plasma.
The sample can be fresh, frozen and fixed or embedded for tissue samples. A person of skill in the art will recognise that many methods exist for obtaining and preparing a biological sample, in particular a plasma or serum sample, which are well known in the art. in some embodiments, a biological sample is obtained from a subject that has tested positive for a B-cell lymphoproliferative disorder. In other embodiments, a biological sample is obtained from a subject that is suspected of ha ving a B-cell lymphoproliferat ive disorder or at. risk of developing a B-cell lymphoproliferative disorder or from an apparently healthy subject. The volume of the biological sample may vary, dependin on the subject and the clinical intent.
In one embodiment the biological sample is obtained from a subject who has commenced treatment for a B-cell lymphoproliferative disorder. Samples may be obtained at any time point before, during and/or after treatment depending on a number of factors. including but not limited to type of treatment, stage of disease, subject type etc. A previously isolated sample (e.g., isolated by another person, at another time, and/or for another purpose) may also be used in the methods described in this invention.
Generally, for obtaining serum, blood may be drawn into a collection tube using standard methods and allowed to clot, after which time the serum is separated from the cellular portion of the coagulated blood and collected. Alternatively, blood may be collected by venipuncture and processed. It is well known in the art that serum and plasma may be frozen after separation from the cellular portion of the blood and stored. Blood collection tubes are commercially available from many sources and in a variety of formats (e.g., Becton Dicksenson Vacutainer©tubes— SST i M, glass serum tubes, or plastic serum tubes).
The biological sample should generally be collected in a clinically acceptable manner, preferably in a way that ensures RNA is preserved and not degraded
Before analysis, RNA may be extracted from serum or plasma and purified using methods known in the art. Many methods are known for isolating total RNA, or for specifically extracting small RNA, including miR A (e.g., Ausubel et a!. 1997). The RNA may be extracted using commercially available kits (e.g... Perfect RNA Total RNA isolation kits etc.). Alternatively, RN A extraction methods for the extraction of mammalian RNA may¬ be adapted for extraction of RNA from plasma or serum. In some embodiments, methods for RNA extraction from paraffin embedded tissues ma be used as disclosed, for example in Rupp and Locker, 1987.
In specific embodiments, miRNA in a biological sample may be purified in a first step. In a second step the total RNA may be separated by polyacrylamide gel electrophoresis and in a third step, the fraction of small RNA may be purified from the polyacrylamide gel. Suitably, a combination of phenol/guanidine-based lysis and silicamembrane- based purification may be used for the isolation of cell-free NA from biological samples, preferably serum samples,
Figure imgf000024_0001
Before proceeding to detect miRNA in a biological sample, it may be necessary to amplify the miRNA. Methods of miRNA amplification are well known in the art and include such methods as reverse transcription CRT); polymerase chain reaction (PGR); real-time PCR (quantitative PCR), nucleic acid sequence-based amplification (NASBA), ligase chain reaction, multiplex ligatable probe amplification, invader technology, rolling circle replication to name hut a few. In certain embodiments, more than one amplification method may be used depending on the sample and miRN A biomarker.
In one embodiment at least one miRNA is amplified, alternatively, two or more miRN A biomarkers may be amplified at the same time.
Generally, a PCR reaction includes multiple amplification steps, or cycles that selectively amplif target nucleic acid species: a denaturing step in which a target nucleic acid is denatured; an annealing step in which a set of PCR primers (forward and reverse) anneal to complementary DNA strands; and an elongation step in which thermostable DNA polymerase elongates the primers. By repeating these steps multiple times, a DNA fragment is amplified to produce an amplicon, corresponding to the target DN A sequence. Typically PCR reactions include 20 or more cycles of dsnaturation, annealing and elongation. Since mature miRNAs are single stranded, a reverse transcription reaction (which produces a complementary cDNA sequence) may be performed prior to the PCR reaction.
Some techniques of reverse transcription of miRNA use a targeted stem- loop primer to prime reverse transcriptio of the miRNA into a DAN template. The cDNA template may- then be used as a primer for any type of PCR including any type of quant itative PCR.
Detection Methods
miRNA
The level of a miRNA in a biological sample (whether amplified or unamplified) can be measured using any technique that is suitable for detecting miRNA expressio levels. Suitable techniques (e.g., Northern blot analysis, RT-PCR, in situ hybridization, microarray analysis, R Ase protection assay; quantitative PCR, quantitative RT-PCR, direct sequencing of genomic DNA) for determining miRN A expression levels in a biological sample (e.g., serum and plasma) are well known to those of skill in the art .
PCR-Based Methods PC is a useful technique for detecting transcripts from a sample. RT-PCR is a sensitive quantitative method that can be used to compare miRNA levels in one or more biological samples.
To perform RT-PCR, m A is isolated from a sample and may be amplified as exem lified by the methods described above and well known in the art.
RNA may then be reverse transcribed into cDNA. The cDNA is amplified in a PCR reaction. A variety of reverse transcriptases are known in the art. For example, extracted RNA can be reverse-transcribed using a Gene Amp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions, The derived cDNA can then be used as a template in the subsequent PCR reaction.
For quantitative PCR, a third oligonucleotide, or probe, is used to detect a nucleotide sequence located between the two PCR primers. The probe may be non-extendible by Taq DNA polymerase enzyme, and typically is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fiuorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unq enched reporter dye provides the basis for quantitative analysis.
RT-PCR can be performed using commercially available equipment, such as an ABl PRISM 7700. TM. Sequence Detection System (Perkin-Elmer- Applied Biosystems, Foster City, Calif USA), or Lightcycler™ (Roche Molecular Biocheraicals, Mannheim, Germany). Samples can be analyzed using a real-time quantitative PCR device such as the ABl PRISM 7700™ Sequence Detection System™.
A variation of the RT-PCR techniq ue is real time quantitative PCR , which measures PCR product accumulation through a dual-labeled fiuorigenic probe, such as a TaqMan™ probe. Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR.
Northern blot
in one embodiment, the le vel of at least one miRNA may be detected using Northern blot analysis. For example, total. miRNA can be purified from serum in the presence of nucleic acid extraction buffer, followed by eentrifegation. Nucleic acids are precipitated, and DMA is removed by treatment with DNase and precipitation. The RNA molecules are then separated by gel electro phoresis on agarose gels according to standard techniques, and transferred to nitrocellulose filters. The miRNA is then immobilized on the filters by heating. Detection and quantification of specific miRNA is accomplished using appropriately labeled probes complementary to the miRNA in question. See, for example. Molecular Cloning: A Laboratory Manual, J. Sambrook et ah, eds., 2nd edition, Cold Spring Harbor Laboratory- Press, 1989, Chapter 7. the entire disclosure of which is incorporated by reference .
Suitabl probes (e.g., DNA probes, RNA probes) for Northern blot hybridization of a given miR A bioniarker can be produced and include, but are not limited to, probes having at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% complementarity to a miR bioniarker of interest, as well as probes that have complete complementarity to a miR biomarker of interest. Methods for preparation of labeled RNA probes, and the conditions for hybridization thereof to target nucleotide sequences, are described in Molecular Cloning; A Laboratory Manual, .1. Sambrook et aL 1989, Chapters 10 and 1.1, the disclosures of which are incorporated herein by reference.
For example, the nucleic acid probe can be labeled with, e.g., a radionuclide, such as '¾, ·"?, ",3P, 1C, or 15S; a heavy metal; a ligand capable of functioning as a specific binding pair member for a labeled ligand {e.g., biotin. avidin or an antibody); a fluorescent molecule; a chemikimiiiescent molecule; an enzyme or the like.
Probes can be labeled to high specific activity by either the nick translation method of Rigby et al, (Ί 977) or by the random priming method of Fienberg et a/., (1 83), the entire disclosures of whic h are incorporated herein by reference. The latter method may be used for synthesizing '"P-iabeled probes of high specific activity from single-stranded DNA or from RNA templates. For example, by replacing preexisting nucleotides with highly radioactive nucleotides according to the nick translation method, it is possible to prepare ' -labeled nucleic acid probes with a specific activity well in excess of 10h cprn microgram. Autoradiographic detection of hybridization can then be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of miR levels. Using another approach, miR levels can be quantified by computerized imaging systems, such as the Molecular Dynamics 40G-B 2D Phosphoriniager available from Amersham Biosciences, Piscataway, Nj.
Where radionuclide labeling of DNA or RNA probes is not practical, the random- primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N- (N-biotmy!-^ triphosphate, into the probe molecule. The biotinylated probe oligonucleotide can be detected by reaction with biotin- binding proteins, such as avidin, streptavidin and antibodies (e.g., anti-hiotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.
Microarray
In some instances, it may be desirable to simultaneousl determine the expression level of a plurality of different miRNA biomarkers in a sample. In other instances, it may be desirable to determine the expression level of all known miRNA biomai'kers correlated with a B-cell lymphoproliferative disorder.
In order to determine the expression level of multiple miRNA biomarkers, a microarray may be constructed containing a set of oligonucleotide (e.g., oligodeoxynueleotide) probes that are specific for a set of miRNAs. Using such a microarray, the expression level of multiple microRNAs in a biological sample can be determined by reverse transcribin the RNAs to generate a set of target oligodeoxynucleotides, and hybridizing them to probe the oligonucleotides on the microarray to generate a hybridization, or expression, profile. The hybridization profile of the test sample can then be compared to that of a control sample to determine which microRNAs have an altered expression level in biological samples form subjects with a B-cell lymphoproliferative disorder.
An "expression profile" or "hybridization profile" of a particular sample is essentially a fingerprint of the state of the sample; while two states may have any particular miRNA similarly expressed, the evaluation of a number of miRNA simultaneously allows the generation of an expression profile that is unique to the state of that sample. That is, a biological sample from a subject with a B-cell lymphoproliferative disorder may be distinguished from a biological sample front a subject without a B-cell iymphopfoliferative disorder. Furthermore, different prognosis states (for example, good or poor long term survival prospects) may also be determined. The identification of miRNA biomarkers which are aberrantly expressed resulting in different prognostic outcomes, allows the use of this information in a number of ways. For example, a particular treatment regime may be evaluated (e.g., to determine whether a chemotherapeutic drug acts to improve the long-term prognosis in a particular subject).
Accordingly, RNA may be purified and reverse transcribed from a biological sample obtained from a subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample, wherein an increase of at least one or more miRNAs, wherein the at least one miRNA is miRNA- 1 73, miRNA-638 and/or mtRNA-494 is indicative of the subject having a B-cell lymphoproliferative disorder.
In one embodiment, the microarray comprises miRNA-specit c probe oligonucleotides for one or more further miRNAs selected from the group consisting of miKNA-21, rniRNA- 155, miRNA-2861 , miR A- 16 and combinations thereof.
The array may contain controls, such as one or more mouse sequences differing from human or hologs by only a few bases, which can serve as controls for hybridization stringency conditions. tR As and other RNAs (e.g., rRNAs, mRNAs) from both species may also be printed on the microchip, providing an internal, relatively stable, positive control for specific hybridization. One or more appropriate controls for non-specific hybridization may also be included on the microchip. For this purpose, sequences are selected based upon the absence of any homology with any known miRNAs.
The microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length, e.g., 40 nucleotides, are 5!-araine modified at position C6 and printed using commercially available microarray systems, e.g., the GeneMachme OmniGrid™ 100 Microarrayer and Aniersham CodeLfak™ activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/D'NA hybrids are denatured to degrade the RNA templates. The labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, e.g., 6X SSPE/30% fotmaniide at 25°C for 18 hours, followed by washing in 0.75X TNT at 37C'C for 40 minutes. At positions on th array where the immobilized probe DMA recognizes a com lementary target cDNA in the sample, hybridization occurs. The labeled target eDNA marks the exact position on the arra where binding occurs, allowing automatic detection and quantification. The output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary miRs, i the subject's biological sample.
Protein bkanarkers
Protein bio markers described herein may be detected by any protein detection method known in the art. Examples of protein detection methods include, without limitat ion, detection by way of antibodies or antibody fragments, such as by immunohistochemistfy, ELISA, flow cytometric analysis, immunoblotting or Western blotting, immunoassays including competithe and non-competitive immunoassays such as CEIA, liposome immunoassays and radioimmunoassay. The detection method may include the use of an antibodies or antibody fragments specific for each said protein bio marker. In some embodiments, the antibodies may be labeled. In other embodiments, a labeled secondary antibody may be used for detection of the specific antibody (Kurien B.T. et a/., 2009;).
In either embodiment, the label may include a radio label, digoxigenin biotin, a fluorochrome, a visible particle or an enzyme to facilitate detection. Examples of enzymes include horseradish peroxidas and alkaline phosphatase, although without limitation thereto. Examples of fluorochromes include FITC, Texas Red, R-phy oerythrin and Cy3, although without limitation thereto. A suitable radiolabel may be \ mI, Cr and 9Tc, although without limitation thereto.
Protein bio markers may also be detected for example usin the following methods well known by a person of skill in the art, including without limitation: HPLC, mass spectrometry, protein microarray analysis, PAGE analysis, isoelectric focusing, 2-D gel electrophoresis, or any enzymatic assay or any method that uses a protein reagent, or other reagent capable of specifically binding to or otherwise recognising a specific protein marker. These methods may be qualitative, semi- uantitative or quantitative assays (El-Aneed, Anas. et al, 2009 and Lilley K.S. et at, 2002).
DNA hfomarkers
Methods of DNA amplification are well known in the art and include such methods as polymerase chain reaction (PGR) and real-time PG (quantitative PGR). In one embodiment, amplification of DNA may include amplification of Epstein-Ban" viral DNA (Tumor-specific but not nonspecific cell-free circulating DNA can be used to monitor disease response in B- cell lymphoproliferative disorders) Jones, K. et a/. ,2012. Plasma Epstein-Barr virus (EBV) DNA i a biomarker for EBV-positive Hodgkm's lymphoma (Gandhi M et ai, 2006).
So that preferred embodiments o f the invent ion may be folly understood and put into practical effect, reference is made to the following non-limiting examples.
EXAMPLES
EXAMPLE I
Materials and Methods
Patients (Classical Hodgk!n Lymphoma) Forty-two newly diagnosed cHL patients were enrolled, with exclusion criteria limited to HIV positivity, active Hepatitis B or C infection. AM patients were enrolled before commencement of therapy and serial blood samples were taken at three time-points: pre- therapy, immediately pre-fhtrd therapy and six months post-therapy. Plasma was cryopreserved, thawed and tested in batches as previously outlined (Jones, K. et al, 2012).21 Tissues ftom diagnostic tumour biopsies were tested when available. Clinical parameters including the Hasendever prognostic score were prospectively recorded (Hasen ever, D, et al, 1998 and Franklin, J. et al, 2000). Early stage disease was defined according to the Southwest Oncology Group (SWOC and Cancer and Leukemia Group B iCALGB) previously published definition (Ann Arbor stage T or II. without any B symptoms, miradiaphragtnatic presentations or mediastinal masses greater than one third the maximum thoracic diameter), (Specht, L, etal, 2010).
The study was a multi-center. Australia-wide, observational study conducted under the auspices of the Australasian Leukaemia and Lymphoma Group (ALLG). Therapy was applied as per clinician's preference (Figure 6 ). The majority of the patient cohort (85%) was treated with 'ABV'D' (adriamycin, bleomycin, vinblastine, dacarbazine) combination chemotherapy (Bonadortna, G. et at. 1975). Other regimens used were 'BEACOP (bleomycin, etoposide, adriamycrn, cyclophosphamide, procarbazine and prednisolone), (Diehl, V, et al, 2003) ABVD followed by BEACOPP and 'ChlVPP' (chlorambucil, procarbazine, prednisolone and vinblastine), (Mc ertdrick, J.J. er /., 1989).
Initial staging and re-stagin one month after completion of therapy was by PET and CT scans, interim disease response (generally after the third cycle of therapy), and re-staging after completion of therapy was assessed by CT, typically in combination with PET (70% had interim treatment restaging PET). Complete and partial response (CR and PR) were defined as per the International Harmonization response criteria (Cheson, B.D. et al, 2007), or when applicable (i.e., patients that had interim treatment CT scans only) the International Working Group response criteria (Cheson, B.D. et al, 1999).
in addition, a separate retrospective cohort of 14 cHL tissue were obtained form a previous ALLG study (Gandhi, M. . et al, 2007). Twenty healthy age and sex matched participant plasma samples were also used. This stud conformed to the Declaration of Helsinki and written informed consent was provided by all participants and was approved by all participating hospitals/research institute Human Research Ethics Committees.
MiRNA extraction and qRT- PCR Tissue miRNA was extracted from all available formalin-fixed, paraffin-embedded (FFPE) tumour biopsies using Recover All™ Total Nucleic Acid Isolation kit (Ambion). Plasma miRNA was extracted from plasma (όθθιιΐ) using mirVana™ Paris™ kit (Ambion) and DNase I treated using TURBO DNA-free™ kit (Ambion). As previously described, C. elegans iniRNA-39 synthetic oligonucleotide RNA (25fmol in a 5ul total volume) were added to plasma after addition of denaturing solution to control for extraction efficiency (Mitchell, P.S, etal, 2008). All kits were used as per manufacturer's instructions.
MiRNA microarray
Over 1000 human miRNA were quantified by the Ramaciotti Centre (Sydney, Australia) using miRNA Microarray (Agilent Technologies, version 16.0, Gene Expression Onnnubus Accession:). The array tested for numerous miRNA that had not previously been examined in cHL. Assays were performed on 14 cHL diagnostic biopsy tissue (8 nodular sclerosing, 6 mixed cellularity) and 8 non-malignant lymph node biopsies. Expression data was quantile normalized using Genespring GX software and then analyzed using Genepattern software (Broad Institute).
MiRNA quantification by qRT-PCR
Using the Qiagen mi Script PGR system, including miScript reverse transcription kit, SYBR* Green and universal primer, plasma and tissue miRNA were quantified on a Rotorgene 3000 qRT-PC (Corbett Research). Each reaction contained the equivalent of either 3ng tissue RNA or 0.2μ1 plasma cDNA, all run in duplicate 20 μΐ reactions. Two Qiagen miScript primers were used: C. Elegans miRNA-39 (cel-miRNA-39) and miRNA- ί ό (Qiagen Catalogue numbers: MS0Q 19789 and MS00031493). In-house primers were used for miRNA-21 (5 '-CGTAGCTTATC AGACTGATGTTGAA-3 '), miRNA- 155 (5'- TTAATGCTAATCGTGATAGG GGTAA-3 '), miRNA-494 (5 '- gaaaeataeacgggaaaccteaaa- 3' miRNA-638 (5'-cgggtggcggcctaa-35), miR A- . 76 (51-accgtgcaaaggtagcataaa-3 miRNA-2861 (5 '-ggcggtgggcggaaa -3') and U6 (5 '-CAAATTCGTGAAGCGTTCC ATA-3 Initially, comparative quantification was used to determine relative quantities of miRNA. T wo standards, one for tissue and one for plasma, were prepared on mass and stored in aliqitots to avoid freeze/thawing (Nourse, J.P. et a/., 2012). The same peripheral blood mononuclear cells (PBMC) cDNA were used for both standards, with the plasma standard at a 2-fold dilution and containing the spike-in control cel-raiRNA-39 cD A (Mitchell, P.S. et al, 2008). Absolute quantification using standard curves was done on select miRNA. For this, standard curves were made from Qiagen miScript reverse transcribed RN A oligonucleotides (Sigma- Aldrich) specific for each miRNA of interest as well as cel-miRNA-39 and U6. Results are reported as miRNA copy number per μ| of plasma, calculated based on the known copy numbe of cel-imRNA-39 spike-in per plasma volume (25fmol per 600ul plasma is equivalent to 2.508 1 O'copies/jJl of plasma).
EBV- tissue positivtt , plasma EBV-DNA and human genomic DNA quantification
EBV-tissue positivity was determined by EBV encoded RNA in situ hybridization (EBER-ISH) in conjunction with hematoxylin and eosin staining (Gandhi, M. . et al , 2006). EBV-DNA (BALF5) and human genomic DNA (Albumin) were quantified in plasma b qRT-PCR as previously described (Jones, K. et a?., 2012). A threshold of 200 EBV genomes/tnl was used.
Statistics
Microarray data was quantile normalized using Genespring GX and analyzed using GenePattern (Broad institute). Comparative marker selection analysis was performed using Genepattern to identify significantly different microRNAs between Hodgkin and healthy lymph nodes. Wikoxon matched-pairs signed rank T-tests were used to compare matched samples. Otherwise the Mann Whitney T-test was used. Correlations were determined using the Spearman test. Receiver Operating Curve (ROC) analysis was used to determine sensitivity and specificity. Statistical analysis was performed using Graphpad Prism 5.0 (Graphpad Software Inc, California).
Diffuse large B-ceII lymphoma (DLBCL) patients
Agilent array profiling of > 1000 human microR A was performed on a discovery cohort of 23 primary DLBCL tissues and 8 healthy lymph nodes. Following quantile normalization, 2 of the top 50 differentially over-expressed micro RNA were selected: miRN A-638 and miRNA-494. Expression of these was correlated by qPCR.
The inventors prospectively analysed these miRNA as well as miRNA-222 in the plasma of patients with poor-risk DLBCL enrolled in the NHL21 Australasian Leukaemia and Lymphoma Group trial. Plasma was derived from blood taken pre-therapy and near the time of centrally-reviewed (day 17-20) interim- PET/CT after cycle 4 R-CHOP ehemo- immunotherapy.
RNA extraction, efficiency was controlled for by using "spiked-in' synthetic C.
Elegans prior to RNA extraction. Spiked-in C. Elegans miRNA was amplified together with the target miRN As and results normalized to plasma volume and C. Elegans miRNA. Values were quantified relative to the quantity of the relevant iniRNA from a healthy control participants peripheral blood mononuclear cells.
There was a significant elevation m both miRNA pre-therapy compared to healthy plasma (both P<0.OO1 ). MiRNA-638 was tested in 40 pre-therapy and 37 post-cycle 4 samples., of which 32 were paired plasma samples (i. e., both pre-therapy and post-cycle 4 plasma samples are from the same individual). Figure 8 panel B shows a significant decline in the 23 poor-risk DLBCL patients that became irrterim-PBT/CT-ve (P=0.047). However there was no significant difference in miRNA-638 in paired samples from patients that remained interim-PET/CT+ve. These results indicate that miRNA-638 is reflective of tumour burden during therapy.
Results
Patient Characteristics
Forty-two cHL patients were accrued (mean age: 36 years, range; 18-79; female: male ratio 20:22). Patient characteristics are provided in Figure 6. Interim therapy (immediately prior to third therapy) samples were available for 38 of these patients and post-therapy samples were available for 37. Of these 37 cHL patients, 32 achieved CR by the six months post-therapy time-point. Matching biopsy tissue was available for 26 cHL patients. As controls, 20 healthy participant blood samples were used (mean age: 42 years, range: 22-68; female: male ratio 8: 12). In addition, a miRNA discovery cohort of 14 cHL diagnostic biopsy (6 mixed cellularity and 8 nodular sclerosing) and 8 non-malignant lymph node tissues were used.
Differentia! expression of human miRNA in cHL primary tissue compared to normal lymph nodes by mtcraairay
Over one thousand human miRNA were quantified in the discovery cohort of 14 cHL patient biopsy tissue and 8 non-malignant lymph nodes using Agilent raicroarray, version 16. The data were qiiantile normalized using Genespring GX software, analyzed using GenePattern (Broad institute) and ranked based on comparative marker selection analysis. Comparing cITL from normal lymph node tissue, there were 474 differentially expressed human miRNA ( false discover rate <5%), 238 of these had elevated expression in cHL. Figure 1 A shows the top 50 differentially expressed human miRNA. From this ranked data, the top five miRNA were selected with elevated expression in cHL tissue for further analysis fay qRT-PCR (miRNA-2861 , miRNA-638, miRNA-494, miR.NA-663b and nuR.NA-1 73). i addition to these five miRNA, also selected were miRNA- 155, miRNA-2I and miRN A- 16, known to be over-expressed in HRS cells and to have a functional role in lymphomagenesis (Van Vlierberghe, P. et a/., 2009; Gibcus, J.H. et al, 2008; Navarro, A. et aL, 2008; Lawrie, CM., 2013; and Volinia, S. et al, 2006). MiRNA- 16 has also been used as a reference miRNA in previous studies (Lawrie, C.H. et al, 2008). None of these three mi NA were significantly elevated in cHL nodes compared to healthy nodes as demonstrated by the microarray analysis.
qRT-PCR tissue miRNA analysis correlates with microarray results
Using comparative quantification qRT-PCR and adjusting to the levels of the housekeeping small RNA U6, mtRNA-2861 , miRNA-638, miRNA-494 and miRN A- 1973 were quantified, as well as mi RNA- 155, miRNA-21 and miRNA- 16 in 14 cHL biopsy tissue and 8 normal lymph nodes. MiRNA-663b was dropped from the analysts, as it was unable to be amplify by qRT-PCR with high-specificity. The qRT-PCR results associated with matched microarray results for all seven miRNA (Spearman r 0.64-0.89, all P-values <0.001 ), validating the qRT-PCR technique The seven miRNA in 26 cHL tissue from the prospective cHL cohort were then quantified. As shown in Figure IB and consistent with the microarray results, miRNA-2861 (P=0.0002), miRNA-638 (P=0.0027), miRNA-494 (P=0.0001) and miRNA- 1973 (P=0.0035) were also elevated in these cHL tissues compared to controls and miRNA- 1 55 and xnt NA-21 were not. However, miR A- 16 was significantly elevated above normal lymph node levels (P=Q.0247); which was not observed by microarray in the discovery cohort
Circulating miRNA are elevated in plasma of patients with cHL at diagnosis and are associated with Hasenclever Score
Plasma miR A were quantified in all pre-therapy cHL patient samples and in healthy participant plasma by comparative quantification qRT-PCR (miRNA-2861 , miRNA-638, miRNA-494. miRNA- 1973, miRNA- 1 55, miRNA-21 and miRNA- 16, as well as controls 116 and cel-tTiiS.39), In this analysis of plasma miRNA, results were normalized to the spike-in control cel-miRNA-39 (but not U6). All assayed miRNA were significantly elevated in cHL pre-therapy plasma compared to healthy participants (miRNA-2861 P= 0.0034, miRNA-638 P= 0.0348, miRNA-494 P= 0.0041, miRNA- 1973 P= 0.0144, miRNA- 155 P= 0.0025, miRNA-21 PO.0001, miRNA- 16 P=0.0007). The small RNA U6 was also elevated (P= 0.01 17).
Pre-therapy levels of miRNA were analyzed for associations with all clinical c aracteristics listed in Figure 1. Interestingly, Hasenclever scores >3 were associated with increased levels of miRNA-494 (P= 0.031), miRNA-2861 (.P= 0.034), niiRNA-21 (,P= 0.007), miRNA- 155 (P= 0.031 ), and miRNA- .16 (P= 0.044). Lactate dehydrogenase (LDH) levels above the normal range were associated with higher levels of miRNA-494 (P= 0.023) and miRNA-21 (P= 0.020) while patients with leucocytes >15xl0¾/L had increased levels of miRNA-21 (P= 0.001), miRNA- 155 (P= 0.004), and miRNA- 16 (P= 0.006). Patients with Ann Arbor stage >3 were also associated with increased levels of miRNA-494 (P=0.0368). No correlation was found between pre-therapy plasma miRNA lewis and the 26 matched biopsy tissue miRNA levels, in a previous study by the inventors an association between circulating CD 163 and EBV (Jones, K. et at, 2013 and amper, P et at, 2011) was found. In contrast, in this study no association between an circulating miRNA and EB.ER-ISH status or (in those with EBV-related cHL) with plasma EBV-DNA was found.
MiRNA-494, miRNA- 1973, ami miRNA-21 are hiomarkers of disease response in cHL
A match-paired analysis of pre-therapy, interim therapy and post-therapy samples in cHL patients in CR at the six month post-therapy time-point was performed. Strikingly miRNA-494, miRNA-1973. and .miRNA-21 significantly differentiated diseased, pre-therapy plasma ftom matched 6 month complete remission plasma (P=0.0082, P=0.G003 and P<0.Q0G1 , respectively). Plasma miRNA- 16 CR post-therapy levels also significantly decreased compared, to pre-therapy, albeit to a lesser extent (P=0.0314). No other raiRNAs reflected disease response.
In order to quantify exact copy number per volume of plasma, the absolute quantities of circulating miRNA-494, miRNA-1 73, miRNA-21, miRNA- 1.6, U6 and spike-in cel- miRNA-39 were determined. Using reverse-transcribed miRNA oligonucleotide standard curves and known spike-in cel-miRN A-39 copy numbers, results were calculated to copies per μΙ plasma. As it has bee shown to be dysregulated in HRS cells, absolute quantities of miRNA- 155 were also determined, however, as with the relative quantification, levels remained elevated throughout therapy, and thus did not reflect disease response (data not shown). The relative and absolute quantification values highly correlated for all miRNA at all time-points (r=0.87-0.94, pO.OQl ) with absolute values having similar significance between miRNA-494, miRNA-1973, miRNA-21 and miRNA- 16 pre-therapy compared to healthy (P=0.004, P-0.008, PO.0001 , P=0.0107, respectively) and compared to 6 month post-therapy complete remission levels (P=Q.0006, P-0.0002, P<Q.0Q01 , 0.0101 respectively).
Receiver operating curve (ROC) analysis to determine the sensitivity and specificity at defined time-points was performed. Although ROC analysis of miRNA- 16 showed it significantly delineated pre-therapy cHL from healthy participants (AUG 0.70, P=OL01.5 , 95% C.I, 0,5693 to 0,8355), it did not reach significance and had poor specificity and sensitivity for distinguishing pre-therapy from remission samples at six months post-therapy and was excluded from further analysis as a potential disease response biomarker. in contrast, we found that miRNA-494, miRN A- 1973, and miRNA-21 are sensitive and specific markers for delineating pre-therapy cHL from healthy participants (miRNA-494: AUC 0.73. P=0.004, 95% C. I 0.60 to 0.85; miRNA- 1973; AUC 0.71 , P-0.007, 95% C. L 0.57 to 0.85; miRNA-21 : AUC 0.92, P<0.000i , 95% C. I. 0.84 to 0.99; Fig. 2A-C) and pre-therapy from remission samples at si months post-therapy (miRNA-494: AUC 0.65, P=0.03 , 95% C.I 0.52 to 0.77; miRNA- 1973 : AUC 0.75, P=0.0004, 95% C.I. 0.63 to 0.86; miRNA-21 : AUC 0.86, P<0.0001 , 95% C.I. 0.77 to 0.95; Fig. 2D-F).
In order to maximize both sensitivity and specificity compared to healthy controls, cut-off values for miRNA-494, miRNA- 1973 and miR2 l were defined as follows: 3.0xI03 miRNA-494 copies/ul plasma with 85% sensitivity and 60% specificity, 1.6x10'' miRNA- 1973 copies/ul plasma with 75% sensitivity and 67% specificity, I.Gxl O6 miRNA-21 copies ul plasma with 95% sensitivity and 86% specificity. The associations with clinical prognosticators and pre-therapy absolute levels of miRNA-494, miRNA-1973 and raiRNA-2 l are shown in Table 2.
Varying kinetics of plasma miRNA biomarkers
Figure 3A-C illustrates the differing kinetics of miRNA-494, miRNA-1973, and miRNA-21 throughout therapy. Both miRNA-494 and miRNA-1973 drop to levels equivalent with healthy controls by the interim time-point. In contrast, miRNA-21 interim therapy levels remain equivalent to pre-therapy and elevated compared to healthy controls, dropping to normal levels by six months post-therapy. In order to determine how the different interim kinetics of miRNA-494, miRNA- 1973, or miRNA-21 associate with interim therapy response, pre-therapy samples with paired interim samples delineated as either CR or PR by radiological assessment were compared. Interestingly, for both miRNA-494 and miRNA- 1973 there was no significant difference between pre-therapy samples and those in PR at the interim time-point. However, there was a significant difference for miRNA-494 and miRNA- 1973 between pre-therapy and those in CR at the interim time-point ( P-0.0438, 'P-0.G0.12, Fig. 3D, E). In contrast, pre-therapy miRNA-21 levels were equivalent to both interim PR and CR levels (Fig. 3F). Interestingly, miRNA-494 strongly correlated with miRN A- 1973 pre, interim and post-therapy (r=0.77, P<0.0001 ; r=0.62, P=0.0002; r=0.52, P=0.0002, respectively) while miRNA-21 had no correlation to these miRNA. at any time-point. However, raiR.NA-21 did strongly correlate with miRNA- 155 and miRNA- 16 pre-therapy (r=0.72, PO.0001 and r=0.76, P<0.0001 respectively).
Circulating miRNA relative to cellular RNA
Plasma levels of the small RNA U6 may be used to represent levels of cellular RNA in the plasma. However, there is no current consensus on the use of U6 as a reference gene for qRT-PCR miRNA analysis. Plasma U6 levels were elevated pre-therapy compared to healthy controls (P<0.0001, Figure 4A) and remained elevated throughout therapy despite patients achieving CR. Pre-therapy U6 levels were strongly associated with LDH levels greater than 250U/L (P=0.0003). To examine this further, U6 was compared with cell-free human genomic DNA levels (Albumin DNA, Figure 4.B). Notably values were correlated (r=0.6, p<0.000l). Analysis of the miRNA results relative to U6, identified that the significantly increased levels of this non-specific cellular RNA, neutralized the elevated levels of plasma miRNA in pre-therapy samples compared to controls. However, reporting the patient results relative to U6 enhanced the decrease of iniRNA-494, miRNA- 1973, and miRNA-21 levels interim therapy in match-paired analysis (Figure 4 C-E; pre vs. interim therapy: miR494 P<0.0001 , miR 1973 P=0.0007, miR21 P=0.0063).
Discussion
Seven cHL-associated miRNA were tested for utility as disease response bio markers in a prospective cohort of cHL patients. Following testing in serial plasma samples, in comparison with healthy samples and with reference to radiological assessment, the kinetics of these miRNA during therapy were assessed Three miRNA (miRNA-494, miRNA- 1973 and miRNA-21) showed promise as disease response biomarkers.
MicroRNA that was identified as over-expressed in the diseased node relative to healthy nodes was tested. These were evaluated in unison with previously identified cHL- associared miRNA s. Of these, levels of miRN A-494, miRNA- 1973 and miRN A-21 miRNA were higher in patients than healthy control participants' plasma and all three miRNA returned to normal at remission, initially, comparative quantification was used to identify promising miRNA biomarkers. Once identified., absolute quantification was used to determine exact miRNA copy number per volume of plasma. Reporting results in absolute terms is critical for inter-laboratory comparisons and standardization, both important for this test to be implemented in the clinical setting. MiRNA-494 and miRNA- 1973 levels were strongly correlated with each other (but not with miRNA-21.) and both reflected interim therapy response with reduction being more pronounced in patients achieving com lete versus partial responses. By contras rai NA-21 showed no relationship to radiological response during therapy.
There is currently no consensus on a reference gene for circulating miRNA. MiRNA- 1 has been used, however, some studies found it to be inconsistent (Lawrie, C.H. et al, 2008; Chen, X. et al, 2008; and Huang, Z. et al, 2012). Circulating miRNA- 16 levels need to be interpreted with caution as miRNA-16 is highly expressed in red blood cells and hemolysis increases miRNA- 16 plasma levels by up to 30-fold (McDonald, J.S. et al, 201 1 ; Pritchard, C.C. et al, 2012; and Kirschner. M.B. et al, 201 1), Unsurprisingly, given that miRNA-16 was confirmed as disease node-associated, it was found that miRNA-16 is an inappropriate cell-free house-keeping gene for cHL. MiRNA-16 values were significantly elevated pre- therapy compared to healthy control participants and gradually declined to normal levels by six months post-therapy.
Within the field, an exogenous technical control for RNA extraction efficiency is frequently utilized. The inventors selected cel-miRNA-39 based on. published literature that normalizing to the mean of 3 exogenous miRNAs did not improve precision, as compared with normalizing to cekmiRNA-39 alone (McDonald, J.S. er a/., 201 1 ). The small RNA U6 has also been advocated as a reference for mi RNA, However, in the study pre-therapy U6 levels were strongly associated with LDH and correlated with cell-free albumi DNA levels. The inventors have previously shown the latter is elevated at pre-therapy in lymphomas, but remains elevated during and following therapy (Jones, , et al, 2012). Thus the results imply that U6, as with albumin- D A, appears to be a marker of cell-integrity and is unsuitable as a house-keeper in comparisons between cHL patients and healthy individuals, it's use in patients with known cHL remains uncertain. Notably in the tested cohort, the kinetics of 06 normalized assays were similar, although interim levels decreased more rapidly when this normalization was performed.
Relative to miRNA-21 , both miRNA-494 and miRNA- 1973 appear to have a relatively restricted tissue distribution. MiRNA-1973 is newly identified and has no known validated targets, but is expressed in B-cell acute lymphoblastic leukemia cells (Schotte, D. et al., 2009). MiRNA-494 is over-expressed in follicular lymphoma tissue and functionally contributes to cancer persistence (Arribas, A.J. et al, 2012; Romano, G. et al, 2012; and Liu, Y. et al, 2012). Specifically, miRNA-494 is implicated in chemo-resistance and is required for the accumulation and function of tumour-expanded granulocytic and monocytic myeloid- derived suppressor cells (Romano., G. et at, 2012; and Liu, Y. et al, 2032). MiRNA-21 is ubiquitously expressed in a variety of cell-types and miRNA- 155 is known to be up-regulated in hematopoietic cells (Landgraf, P. et al, 2007). Both miRNA-21 and miRNA- 155 are dysregulated in a variety of cancers, however, in a study of miRNA expression in solid tumours, only miRNA-21 was up-regulated in all cancers evaluated (Volini , S. et al, 2006). BotJi miRNA- 155 and miRNA-21 are involved in B-cell activation and, in two separate studies, induction of miRNA-21 and rniRNA-155 in mouse-models resulted in lymphoma development (Vigorito, E. et al, 2007; Tliapa, D.R. et al, 2012; Medina, P.P. ei al, 2010; and Babar, I. A. et al, 20.12). The inventors have confirmed the findings of Navotro and colleagues that miRNA- 155 was not over-expressed in cHL patient versus healthy nodes (Navarro, A. et al, 2008). In contrast to that group, the inventors did not find miRNA-21 was elevated (values were approximately two-fold higher in cHL nodes but. this did not reach significance).
Given the unique nature of cHL nodes and the numerous cell-types that express miRNA, it must be emphasized that miRNA tumour specificity is not absolute, and is more accurately described as a spectrum.. HRS cells and the niicroenvironraent represent different aspects of cHL biology, which is reflected in. the relative distribution of .miRNA within cell- types. Consistent with this and with the inventors previous study of serum proteins in cHL (Jones, K. ei al, 20 Ϊ 3), the three miRNA tested had distinct kinetics following initiation of therapy. As with circulating cell- free CD 163 and TARC, it is likely that disease response is best served by analyzing multiple miRNA simultaneously. Future risk-adapted treatment algorithms combining circulating protein and miRNA biomarkers with inter if n-PET/CT should be evaluated.
Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. It will therefore be appreciated by those of skill in the art that, in light of the instant, disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention.
All computer programs, algorithms, patent and scientific literature referred to herein is incorporated herein by reference. REFERENCES
Allegra A, Alonci A, Campo S, ei al Circulating niicroRNAs: new hiomarkers in diagnosis, prognosis and treatment of cancer (review), Internationa! journal, of oncology. 20.12;4 i : 1897- 1912.
Anas El-Aneed, Aljandro Cohen, Joseph Anoub, Mass Spectrometry, Review of the Basiscs, Applied Spectroscopy Reviews 44: 210-230, 2009
Armitage J.O. Early-stage Hodgkin's lymphoma. The New England Journal of Medicine. 2010;363:653-662.
Arribas A.J., Campos-Martin Y, Gomez-Abad C, et al. Nodal marginal zone lymphoma: gene expression and miRNA profiling identify diagnostic markers and potential therapeutic targets. Blood. 2012;1 19,
Ausubel F, Brent R, Kingston RE, Moore DD, Seidmati 3G, Smith JA, StruM K (eds) (1997) Short protocols i molecular biology. Wiley, New York.
Babar IA, Cheng CJ, Booth CJ, et al Nano article-based therapy in an in vivo micro RNA- 155 (miR-155)-dependent mouse model of lymphoma. Proceedings of the National Academy of Sciences of the United States of America. 2012; 109.
Binet, 3.L., Auquier, A., Dighiero, G., Cnastang, C, Piguet, H., Goasguen, J., Vaugier, G., et al, new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis, .1981 , 48( 3 );. 1.98-206).
Bonadonna G, Zucali R. Monfardini S, De Lena M. Uslenghi C. Combination chemotherapy of Hodgkin's disease with adriamyciti, bleomycin, vinblastine, and imidazole oarboxamide versus MOPP. Cancer. 1 75;36:252-259.
Caillard S, Porcher R, Provot F, Dantal J, Choquet S, Durrbach A, el al, Post- transplantation iymphoproliferative disorder after kidney transplantation: report of a
nationwide French registry and the development of a new prognostic score. J Clin Oncol, 2013 Apr l;3 l( 10): 1302-9.
Chen X, Ba Y, Ma L, et al Characterization of niicroRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Ceil research. 2008;18:997- 1006.
Cheson BD, Horning S3, Coiffier B, et al. R eport of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working Group, journal of clinical oncology : Official Journal of the American Society of Clinical Oncology. 1999; 1 7: 1244. Cheson BD, Pfistner B, Juweid ME, et al Revised response criteria for malignant lymphoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology- 2007;25:579-586.
Coiffieiv Oncogene (2007) 26, 3603-3613.
Diehl V, Franklin J, Pfreundschiih M, et al. Standard and increased-dose BEACOPP chemotherapy compared with COPP-ABVD for advanced Hodgkin's disease. The New
Eng I and jo urnal. of medicine. 2003;348:2386-2395.
Evens AM, Hutchings M, Diehl V. Treatment of Hodgkin lymphoma: the past, present, and future. Nature clinical practice Oncology. 2008;5:543-556.
Ferrer i„ A., Abrey, L,, Blay, J. Y. et al, "Summary Statement on Primary Central
Nervous System Lymphomas from the Eighth International Conference on Malignant Lymphoma: Special Article," Journal of Clinical Oncology, Vol. 21, No. 12, 2003, pp. 2407- 2414.
Fienberg et al. ( 1 83), Anal. Biochem. 132:6-13.
Franklin J, Pau!us If, Lieberz D, Breuer K, Tesch H, Diehl V. Is the international prognostic score for advanced stage Hodgkin's disease applicable to early stage patients?
German Hod.gk.in Lymphoma Study Group. Annals of oncology : Official Journal of the
European Society for Medical Oncology / ESMO. 2000;! 1 :617-623.
Gallamini A, Hutchings M, Rigacci L, et al Early interim 2-[18F]fu.ioro-2-deoxy-D- glucose positron emission tomography is prognostic-ally superior to international prognostic score in advanced-stage Hodgkin's lymphoma: a report from a joint Italian-Danish study.
Journal of clinical oncology : official journal of the American Society of Clinical Oncology.
2007;25:3746-3752,
Gandhi MK, Lamb ley E, Burrows J, et al Plasma Epstein-Barr virus (EBV) DNA is a biomarker for EBV-positive Hodgkin's lymphoma. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006;12:460-464.
MK Gandhi, E Lambley, U Dua, S Elliott, J Duraiswamy, C Smith, D Gill, P Marlton, JF Seymour, R Khanna. Expression of LAG- by Tumor- infiltrating Lymphocytes is Coincident with the Suppression of Latent Membrane Antigen-specific CD8+ T-cell Function in Hodgkin Lymphoma Patients. Blood. 2006, 108 (7) 2280-2289.
Gandhi MK. Moll G, Smith C, et al Galectin- 1, mediated suppression of Epstein-Barr virus specific T-cell immunity in classic Hodgkin lymphoma. Blood. 2007,1 10: 1326- 1329.
Gibcus JH, Tan LP, Harms G, et al. Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia. 2009; 1 1 : 167-176. Gilad S, Mei i E, Yogev Y, et al Serum microRNAs are promising novel biomarkers. PloS one. 2008;3;e 148.
Hasenclever D, Diehl V. A prognostic score for advanced Hodgkin's disease.
International Prognostic Factors Project on Advanced Hodgkin's Disease. The New England journal of medicine. .1 98;339: 1506-1514.
He, L. and Hannon, G.J. (2004) Nat Rev Genet, 5: 522-531.
Hosier, E. Dreyling, M., Klapper. W,, Gisselbtecht, C, van Hoof, A., Kluin- Nelenians, H.C, et a/., A new prognostic index (MIPl) for patients with advanced-stage mantle cell lymphoma. Blood. 2008 Jan. 15:1 ll(2):558-65.
Huang Z„ Huang D, Ni S, Peng Z, Sheng , Du X. Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer. International journal, of cancer Journal international du cancer. 2010: 127: 1 18- 126.
lorio MV, Croce CM. MicroRNAs in cancer; small molecules with a huge impact. J Clin Oncol. 2009;27:5848-5856.
Jones K, Notirse JP, Keane C, et al. Tumor-specific but not nonspecific cell- free circulating DNA can be used to monitor disease response in lymphoma. Am J Hematol. 2012;87:258-265.
Jones K, Van F, Keane C, et al. Serum CD 163 and TARC as Disease Response Biomarkers in Classical Hodgkin Lymphoma. Clinical Cancer Research : an official jour nal of the American Association for Cancer Research. 201 ;1 :731-742.
Kaniper P, Bendix , Hamilion-Dutoit S. Oonore B, Nyengaard JR, d' Amorc F. Tumor-infiltrating macrophages correlate with adverse prognosis and Epstein-Barr virus status in classical Hodgkin's lymphoma. Haematologica. 201 I ;96:269-276.
Kirschner MB, Kao SC, Edehnan JJ, etal. Haemolysis during sample preparation alters microRNA content of plasma. PloS one. 201 1 ;6.
Kruli KR, Sabin ND, Reddick WE, et al. Neurocognitive function and CNS integrity in adu lt survivors of chi ldhood hodgkin lymphoma, Journal of cl inical oncology : official journal of the American Society of Clinical Oncology. 2012;30:3618-3624.
urien BT. Scotleld RH A brief review of other notable protein blotting methods. Methods Mol Biol. 2009;536: 367-84.
Landgraf P, Rusu M, Sheridan R, et al. A mammalian microRNA expression atlas based, on. small RIM A library sequencing. Cell. 2007:129: 1401-1414. Lawrie CO , Gal S, Dimlop H , et aL Detection of elevated levels of tumour- associated microRNAs in serum of patients with diffuse large B-cell lymphoma, Br J
Haematol. 2008;141 :672-675.
Lawrie CH. MicroRNAs and lymphomagenesis: a functional review. British Journal of Haematofogy. 2013;160:571 -581.
Lflley S, Razzaq A, Diipree P.Curr Opin Chem Biol. 2002 Feb;6(l):46-50, Two- dimensional gel electrophoresis: recent advances in sample preparation, detection and quantitation.
Lin Y, Lai L, Chen Q, et al MicroRNA-494 is required for the accumulation and fu nctions of tumor-expanded myelo id-derived suppressor cells via targeting of PTEN. Journal of immunology. 2012; 188:5500-5510.
McDonald JS, Milosevic D, Reddi HV, Grebe SK, Algeciras-Schimnich A. Analysis of circulating microRNA; preanalytical and analytical challenges. Clinical chemistry.
201 1 ;57:833-840.
McKendrick JJ, Mead GM, Sweetenhatn J, et al ChiVPP chemotherapy in advanced
Hodgkin's disease. European journal of cancer & clinical oncology. 1989;25 557-561.
Medina PP, Nolde M, Slack FJ, OncomiR addiction in an in vivo model of
microENA-2.1 -induced pre-B-cell lymphoma. Nature. 2010;467:86-90.
Mitchell PS, Parkin R , Kroh EM. et al Circulating microRNAs as stable blood- based markers for cancer detection. Proceedings of the National Academy of Sc iences of the United States of America. 2008;105: 10513- 10518.
Morel P, Duhamel A, Gobbi P, et al International prognostic scoring system for Waldenstro m tnacroglobulineraia. Blood, 2009;! 13(18);4163-4170,
Navarro A, Gaya A, Martinez A, et al MicroRNA expression profiling in classic Hodgkin lymphoma. Blood. 2008; 1 1 1 :2825-2832.
Niens, M., Visser, L.} Nolte, Ϊ.Μ., et aL, Br. J. Haematol, 2008, 140: 527-536.
ourse JP, Crooks P, Keane Cf et aL Expression profiling of Epstein-Bart virus- encoded microRNAs from paraffin-embedded fbrmalin-fixed primary Epstein-Barr virus- positive B-cell lymphoma samples. Journal of viro logical methods. 2012.
Plattel WJ, van den Berg A, Visser L, et al Plasma thymus and activation-regulated chemokine as an early response marker in classical Hodgkin's lymphoma. Haematologica. 2012;97:410-415.
Pritchard CC, Kroh E, Wood B, et aL Blood cell origin of circulating microRNAs: a cautionary note for cancer biomarker studies. Cancer prevention research. 2012;5:492-497. Rai, K.R., Sawttsky, A., Cronkite, E.P., Chanaiia, A.D., Levy, R.N., and Pasteraack BS, Clinical staging of chronic lymphocytic leukemia, Blood, 1975, 46; 21 -234,
Rigby et aL ( 1977), .!. ol. Biol. 1 13 :237-251.
Romano G, Acunzo M, Garofalo M, et al. MiR-494 is regulated by ER 1 2 and modulates TRAIL- induced apoptosis in non-small-cell lung cancer through BIM down- regulation. Proceedings of the National Academ of Sciences of the United States of America. 20.12; 109: 16570- 16575.
Roy, S., Josephson, S. A,, Fridlyand, J.. arch. J„ Kadoch, C, Karrim, J., Damon, L., Treseler, P., Kunwar, S., Shuman, M. A., Jones, T„ Becker, C. H., Schulman, H.&
Rubenstein, J. L. (2008). Protein biomarker identification in the CSF of patients with CN S lymphoma, j Clin Oncol, Vol.26, No.1 , (January 2008), pp. 96-105.
Rubenstein, James L.s Wong, Valerie S., Kadoch, CigalL, Oao, Hua-Xin., Barajas, Ramon., et «:;/., CXCL13 plus interleukin 10 is highly specific for the diagnosis of CNS lymphoma, Blood, 121 (23): 4740-4748,
Riipp & Locker (1.987) Lab Invest. 56:A67.
Sambrook et aL. Molecalar Cloning: A Laboratory Manual, J. eds., 2nd edition, Cold Spring Harbor Laboratory- Press, 1 89
Schotte D, Chau JC, Sylvester G, et al. Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia. Leukemia.
2009;23:313-322.
Sehn, L.H. et al. The revised international Prognostic Index (R-IPI) is a better predictor of outcome than the standard IPI for patients with diffuse large B-cell lymphoma treated with R-CHOP, 2007, Blood, 2007; 109(5): 1857-61.
Solal-Celigny, P., Roy, P., Coloitibat, P., White, J., et aL, Follicular Lymphoma
International Prognostic Index, Blood, 2004, 104(5): 1258-1265.
Specht L, Haseiiciever D. Prognostic Factors. In: Engert A, Horning SJ, eds. Hodgkin Lymphoma: A Comprehensive Update on Diagnostics and Clinics: Springer; 2010: 108.
Steidl C, Lee T, Shah SP, et al. Tumor-associated macrophages and survival in classic Hodgkin's lymphoma. The New England Journal of Medicine. 2010;362:875-885.
Thapa DR, Bhatia , Bream JH, et al B-cell activation induced micro RNA-21 is elevated in circulating B cells preceding the diagnosis of A! DS-related non-Hpdgkin
lymphomas. AIDS. 2012;26: 1 177- 1 180.
Van Vlierberghe P, De Weer A, Mestdagh P, et aL Comparison of miR A profiles of microdissected Hodgkin Reed-Sternberg cells and Hodgkin cell lines versus CD77+ B-cells reveals a distinct subset of differentially expressed miRNAs. British journal of haernatology. 2009; 147:686-690.
Vigorito E, Perks L, Abreu-Goodger C, et al. microRN A- 155 regulates the
generation of immunoglobulin class-switched plasma cells. Immunity. 2007;27:847-859.
Volmia S, Calin GA, Liu CG, et al. A mieroRNA expression signature of human solid tumors defines cancer gene targets. Proceedings of the National Academy of Sc iences of the United States of America. 2006; 103 2257-2261.
Yang ZZ, Grote DM. Ziesmer SC, et al Soluble lL-2Ralpha facilitates IL-2-mediated immune responses and predicts reduced survival in follicular B-cell non-Hodgkin lymphoma. Blood. 201 1 :1 18:2809-2820.

Claims

1. A method of determining whether or not a subject has a B-ce!l .lympho.proliferati.ve disorder, including: determining the expression level of a miRNA 'biomarker in a biological sample from a subject, wherein the miRNA biomarker is selected from the group consisting of miRN A- 1973, miRNA-638 and mi A-494, and wherein a B-cell lyraphopro Ufeiative disorder is detected if said one or more miRNA biomarkers is at an elevated level or over expressed in. the biological sample.
2. The method of claim 1 , wherein the biological sample is or comprises serum, plasma and/or cerebrospinal fluid.
3. The method of claim I or claim 2, wherein the B-cell l inphoproliferative disorder is selected from the group consisting of diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma. Mantle-cell lymphoma. Chronic lymphocytic leukemia (CLL), Marginal-zone lymphoma - nodal, extra nodal (MALT) and splenic, lymphoplasmacytic lymphoma (LPL), Hodgkin lymphoma (nodular lymphocyte pre-dominant type), primary central nervous system lymphoma and post-transplantation iymphoproliferative disorders, diffuse large B-cell lymphoma (DLBCL), not otherwise specified, primary DLBCL of the CNS, primary cutaneous DLBCL, leg type, T cell histiocyte rich large B-cell lymphoma, EBV+ DLBCL of the elderly, DLBCL associated with chronic inflammation. Follicular lymphoma, Mucosa-Associated Lymphatic Tissue lymphoma (MALT), small cell lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia), Mantle cell lymphoma, Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macroglobulmemia, Nodal marginal zone B cell lymphoma (NMZL), S lenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, Lymphomatoid granulomatosis. Large B-cefl lymphoma arising in HHV-8- associated multicentric Castleman Disease, ALK-positive large B-cell lymphoma, AIDS- related. lymphoma, Post-Transplantation LymphoproHferative Disorders (PTLD), Primary Central Nervous Syste Lymphoma (PCNSL), Classic Hodgkin's lymphoma, nodular lymphocyte predominant Hodgkin's lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and classical Hodgkin lymphoma.
4. The method of claim 3, wherein the B-cell malignancy is classical odgkm Lymphoma or Diffuse large B-cell lymphoma (DLBCL),
5. The method of any one of claims 1 to 4. further comprising measuring an additional miRNA biomarker selected from the group consisting of miRNA-21 , miRNA-2861., miRNA- 155 and miR A- 16.
6. The method of any one of claims 1 to 5, further comprising measuring a protein or DNA marker selected from the group consisting of: CD 1.63, Thymus and Activation- Regulated Chemokine (TARC). lactate dehydrogenase, Epstein-Barr Virus DNA. Interleukin- 2 receptor, Anti-thrombin II I, CXCL 1.3, IL- i O, Galectin- L CCL22 macrophage derived chemokine, C C L i 7 and LAG 3.
7. A method of evaluating treatment efficacy of a B-cell lyraphoproliferative disorder in a subject including;
determining the expression level of a miRNA biomarker in a biological sample from a subject before, during and/or after treatment, wherein the miRNA biomarker is selected from the group consisting of miRNA- 1973, miRNA-638 and raiRNA-494;
to thereby evaluate treatment efficacy of the B-cell lyraphoproliferative disorder in the subject, wherein if said one or more miRNA biomarkers, is at a reduced level, down regulated or absent in. the biological sample, the treatment is efficacious.
8. The method of claim 7, further comprising seleting a treatment or modifying a treatment for a B-cell lymphoproliferative disorder based on the amount of the one or more miRNA biomarkers.
9. A method of treating a B-celi lymphoproliferative disorder in a subject including; determining the expression level of a miRN A biomarker in a biological sample from a subject, before, during and or after treatment of the B-celi lymphoproliferative disorder, wherein the miRNA biomarker is selected from the group consisting of miRNA- 1973, miRNA-638 and raiRN A-494, and based cm the determination, initiating, continuing or modifying the treatment.
10. The method of any one of claims 7 to 9, wherein the biological sample is or comprises serum, plasma and/or cerebrospinal fluid.
1 1. The method of any one of claims 7 to 10, wherein the B-cei! lymphoproiiferative disorder is selected from the group consisting of diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma. Mantle-eel! lymphoma. Chronic lymphocytic leukemia (CLL), Marginal-zone lymphoma - nodal, extra nodal (MALT) and splenic, lymphoplasmaeytic lymphoma (LPL), Hodgkin lymphoma (nodular lymphocyte pie-dominant type), primary central nervous system lymphoma and post-transplantation lymphoproiiferative disorders, diffuse large B-cell lymphoma (DLBCL), not otherwise specified, primary DLBCL of the CMS, primary cutaneous DLBCL, leg type, T cetl histiocyte rich large B-cell lymphoma, EBV+ DLBCL of the elderly, DLBCL associated with chronic inflammation, Follicular lymphoma, Mucosa- Associated Lymphatic Tissue lymphoma (MALT), small cell lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia). Mantle cell lymphoma, Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macrogiobuiinemia. Nodal marginal zone B cell lymphoma (NMZL), Splenic marginal zone lymphoma (SMZL), intravascular large B- cell lymphoma, primary effusion lymphoma, Lymphomatoid granulomatosis. Large B-cell lymphoma arising in HHV-8-associated multicentric Castleman Disease, ALK-positive large B-cell lymphoma, AlDS-related lymphoma, Post-Transplantation Lymphoproiiferative Disorders (PTLD), Primary Central Nervous System Lymphoma (PCNSL), Classic Hodgkin's lymphoma, nodular lymphocyte predominant Hodgkin's lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma, B-cell lymphoma, unclassifiable, with features intermediate between DLBCL and classical Hodgkin lymphoma.
12. The method of claim 1 1, wherein the B-cell malignancy is classical Hodgkin Lymphoma or Diffuse large B-cell lymphoma (DLBCL).
13. The method of any one of claims ? to 12, further comprising measuring an additional miRNA biornarker selected from the group consistin of miRNA-21 , mi NA-2861 , miR A- 155 and miRNA -16.
14. The method of any one of claims 7 to 13, further comprising measuring a protein or DNA markers selected from the group consisting of: CD163, Thymus and Activation- Regulated Chemokine (TARC), lactate dehydrogenase, Epstein-Ban* Virus DNA, Inter leukin- 2 receptor, Anti-thrombm HI, CXCL13, XL- 10, Ga!ectin- 1 , CCL22 macrophage derived chemokine, CCL17 and LAG .
1 5, A method of determining the prognosis of a subject with a B-cell lymphopro liferative disorder, including:
determining the expression level of a miRNA biomaiker in a biological sample from a subject, before, during and/or after treatment, wherein the miRNA biomarker is selected from the group consisting of miRNA- 1973, miRNA-638 and miRNA-494,
to thereby evaluate the prognosis of the B-cell lymphoproliferative disorder in the subject, wherein if said one or more miRNA biomarkers, is at a reduced level, down regulated or absent in the biological sample, the prognosis is positive.
16. The method of claim 15, wherein the biological sample is or comprises serum, plasma and/or cerebrospinal fluid.
17. The method of claim 15 or claim 16, wherein the B-cetl lymphopro liferative disorder is selected from the group consisting of diffuse large B-cell lymphoma, follicular lymphoma, chronic lymphocytic leukemia, classical Hodgkin Lymphoma, Burkitt lymphoma. Mantle-cell lymphoma. Chronic lymphocytic leukemia (CLL), Marginal-zone lymphoma - nodal, extra nodal (MALT) and splenic, iymphoplastnacytic lymphoma (LPL), Hodgkin lymphoma (nodular lymphocyte pre-dominant type), primary central nervous system lymphoma and post-transplantation lymphoproliferative disorders, diffuse large B-cell lymphoma ( DLBCL), no t otherwise specified, primary DLBCL of the CNS, primary cutaneous DLBCL, leg type, T cell histiocyte rich large B-cell lymphoma, EBV+ DLBCL of the elderly, DLBCL associated with chronic inflammation. Follicular lymphoma, Mucosa-Associated Lymphatic Tissue lymphoma (MALT), small cell .lymphocytic lymphoma (overlaps with Chronic lymphocytic leukemia), Mantle cell lymphoma, Burkitt lymphoma, mediastinal large B cell lymphoma, Waldenstrom macroglobulinemia, Nodal marginal zone B cell lymphoma (NMZL), Splenic marginal zone lymphoma (SMZL), intravascular large B-cell lymphoma, primary effusion lymphoma, Lymphomatoid granulomatosis, Large B-cell lymphoma arising in HHV-8- associated multicentric Castleman Disease, ALK-positive large B-cell lymphoma, A1DS- related lymphoma, Post-Transplantation Lymphoproliferative Disorders (PTLD), Primary Central Nervous System Lymphoma. (PCNSL), Classic Hodgkin's lymphoma, nodular lymphocyte predominant Hodgki 's lymphoma, B-cell lymphoma., unclassifiable, with features intermediate between DLBCL and Burkitt lymphoma, B-cell lymphoma, unclassifiable, with features intermediate betwee DLBCL and classical Hodgkin lymphoma.
18. The method of claim 17, wherein the B-celi malignancy is classical Hodgkin Lymphoma or Diffuse large B-cell lymphoma (DLBCL),
19. The method of any one of claims 15 to 18, further comprising measuring an additional miRNA gene product selected from the group consisting of miRNA-21, miRNA-2861 , miRNA- 155 and miRNA- 16.
20. The method of any one of claims 15 to 19, further comprising measuring a protein or DNA markers selected from the group consisting of: CD 163, Thymus and Activation- Regulated Cheraokme (TARC). lactate dehydrogenase, Epstein-Barr Virus DNA. Interleukin- 2 receptor, Anti-fhrombin II I , CXCL13, I L- i O, Galectin- L CCL22 macrophage derived chemokine, C C L 17 and LAG 3.
21. The method of any one of claims 15 to 20, wherein a prediction of prognosis is given by a likelihood score derived from using Hasenclever scores, sub-division into early good risk/early poor risk stages, or International Prognostic Scores.
22. The method of any one of claims 15 to 20, wherein the prognosis is used, at least in part, to determine whether the subject would benefit from treatment of the B-cell lymphoproliferative disorder.
23. The method of any one of claims 15 to 20, wherein the prognosis is used, at least in part, to develop a treatment strategy for the subject.
24. The method of any one of claims 15 to 20, wherein the prognosis is used, at least in part, to determine disease progression in the subject.
25. The method of any one of claims 15 to 20, wherein prognosis is defined as an estimated time of survival,
26. The method of any one of claims 15 to 20, further including determining suitability of the subject for treatment based, at least in part, on the prognosis.
27. The method of any one of claims 15 to 20, wherein decreasing expression levels of at least miRNA- 1973, miRNA-638 and/or miRNA-494 indicates an effective B-eell lymphoproliferative disorder therapy.
28. The method of any one of the preceeding claims, wherein the subject is human.
PCT/AU2014/000610 2013-06-14 2014-06-13 Biomarkers and use thereof in identification of b-cell lymphoproliferative disorders WO2014197936A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2013902216 2013-06-14
AU2013902216A AU2013902216A0 (en) 2013-06-14 Biomarkers and use thereof in identification of b-cell lymphoproliferative disorders

Publications (1)

Publication Number Publication Date
WO2014197936A1 true WO2014197936A1 (en) 2014-12-18

Family

ID=52021493

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2014/000610 WO2014197936A1 (en) 2013-06-14 2014-06-13 Biomarkers and use thereof in identification of b-cell lymphoproliferative disorders

Country Status (1)

Country Link
WO (1) WO2014197936A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108676883A (en) * 2018-05-31 2018-10-19 高波 A kind of lymthoma miRNA chips, preparation method, detection method and purposes
CN110412268A (en) * 2018-04-27 2019-11-05 刘晓健 Diagnose marker and its application of the outer recidivist of knot of classical Hodgkin lymphoma
US10607717B2 (en) 2013-11-06 2020-03-31 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
CN116338210A (en) * 2023-05-22 2023-06-27 天津云检医学检验所有限公司 Biomarker and detection kit for diagnosing primary central nervous system lymphoma
US11725248B2 (en) 2016-04-20 2023-08-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Evaluation of mantle cell lymphoma and methods related thereto

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARRIBAS AJ ET AL.: "Nodal marginal zone lymphoma: gene expression and miRNA profiling identify diagnostic markers and potential therapeutic targets.", BLOOD., vol. 119, no. 3, 19 January 2012 (2012-01-19), pages E9 - E21 *
CARAMUTA S ET AL.: "732: Role of microRNAs and microRNA machinery in the pathogenesis of diffuse large B- cell lymphomas.", EJC SUPPL, vol. 8, no. 5, January 2010 (2010-01-01), pages 1 - 12 *
DI LISIO L ET AL.: "MicroRNA signatures in B- cell lymphomas.", BLOOD CANCER J., vol. 2, no. 2, February 2012 (2012-02-01), pages 1 - 9, XP055238280, DOI: doi:10.1038/bcj.2012.1 *
JONES K ET AL.: "Serum CD 163 and TARC as disease response biomarkers in classical Hodgkin lymphoma.", CLIN CANCER RES., vol. 19, no. 3, 1 February 2013 (2013-02-01), pages 731 - 742 *
JONES K ET AL.: "Tumor-specific but not nonspecific cell -free circulating DNA can be used to monitor disease response in lymphoma.", AM J HEMATOL., vol. 87, no. 3, March 2012 (2012-03-01), pages 258 - 265 *
JUNG I ET AL.: "MicroRNA-155 expression and outcome in diffuse large B- cell lymphoma.", BR J HAEMATOL., vol. 144, no. 1, January 2009 (2009-01-01), pages 138 - 140 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10607717B2 (en) 2013-11-06 2020-03-31 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
US11574704B2 (en) 2013-11-06 2023-02-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
US11725248B2 (en) 2016-04-20 2023-08-15 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Evaluation of mantle cell lymphoma and methods related thereto
CN110412268A (en) * 2018-04-27 2019-11-05 刘晓健 Diagnose marker and its application of the outer recidivist of knot of classical Hodgkin lymphoma
CN108676883A (en) * 2018-05-31 2018-10-19 高波 A kind of lymthoma miRNA chips, preparation method, detection method and purposes
CN116338210A (en) * 2023-05-22 2023-06-27 天津云检医学检验所有限公司 Biomarker and detection kit for diagnosing primary central nervous system lymphoma
CN116338210B (en) * 2023-05-22 2023-08-11 天津云检医学检验所有限公司 Biomarker and detection kit for diagnosing primary central nervous system lymphoma

Similar Documents

Publication Publication Date Title
US20200370127A1 (en) Biomarkers in Peripheral Blood Mononuclear Cells for Diagnosing or Detecting Lung Cancers
US20210222254A1 (en) Methods for subtyping of lung adenocarcinoma
Jones et al. Plasma microRNA are disease response biomarkers in classical Hodgkin lymphoma
JP6720260B2 (en) Methods and kits for diagnosing a subject at risk of developing cancer
US10982282B2 (en) MicroRNAs as biomarkers for endometriosis
US20190316203A1 (en) Gene signature for immune therapies in cancer
US11041214B2 (en) Methods for subtyping of lung squamous cell carcinoma
US20200131586A1 (en) Methods and compositions for diagnosing or detecting lung cancers
CA2889087C (en) Diagnostic method for predicting response to tnf.alpha. inhibitor
US20230366034A1 (en) Compositions and methods for diagnosing lung cancers using gene expression profiles
WO2014197936A1 (en) Biomarkers and use thereof in identification of b-cell lymphoproliferative disorders
US20200216908A1 (en) Methods for subtyping of head and neck squamous cell carcinoma
US20210010090A1 (en) Method and system for predicting recurrence and non-recurrence of melanoma using sentinel lymph node biomarkers
US11851715B2 (en) Detecting cancer cell of origin
Zhang et al. Circulating plasma microRNAs in the detection of esophageal squamous cell carcinoma
US20110275089A1 (en) Methods for predicting survival in metastatic melanoma patients
US20110183859A1 (en) Inflammatory genes and microrna-21 as biomarkers for colon cancer prognosis
WO2014034685A1 (en) Diagnosis of rheumatoid arthritis by microrna
US20160298198A1 (en) Method for predicting development of melanoma brain metastasis
Pan Development of diagnostic methods using cell-free nucleic acids
KR102229647B1 (en) MiRNA bio-marker for non-invasive differential diagnosis of acute rejection in kidney transplanted patients and uses thereof
CN114032308A (en) Use of FAM83A, KPNA2, KRT6A and LDHA in combination as a biomarker for lung adenocarcinoma
Raut et al. Cancer‐specific risk prediction with a serum microRNA signature
CZ31584U1 (en) A diagnostic kit for assessing relapse risk after nephrectomy in patients with non-metastatic renal cell carcinoma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14811209

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14811209

Country of ref document: EP

Kind code of ref document: A1