WO2014195026A2 - Fret-method for identifying a biomolecule-modulating compound - Google Patents

Fret-method for identifying a biomolecule-modulating compound Download PDF

Info

Publication number
WO2014195026A2
WO2014195026A2 PCT/EP2014/001548 EP2014001548W WO2014195026A2 WO 2014195026 A2 WO2014195026 A2 WO 2014195026A2 EP 2014001548 W EP2014001548 W EP 2014001548W WO 2014195026 A2 WO2014195026 A2 WO 2014195026A2
Authority
WO
WIPO (PCT)
Prior art keywords
hsa
mir
acc
source
hgnc symbol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/001548
Other languages
French (fr)
Other versions
WO2014195026A3 (en
Inventor
Jonathan Hall
Ugo Pradere
Martina Roos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Eidgenoessische Technische Hochschule Zurich ETHZ
Original Assignee
Eidgenoessische Technische Hochschule Zurich ETHZ
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Eidgenoessische Technische Hochschule Zurich ETHZ filed Critical Eidgenoessische Technische Hochschule Zurich ETHZ
Publication of WO2014195026A2 publication Critical patent/WO2014195026A2/en
Publication of WO2014195026A3 publication Critical patent/WO2014195026A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites

Definitions

  • the present invention relates to a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially.
  • the first and second biomolecules are selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids, and more preferably the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecule is selected from the group consisting of polynucleotides, preferably microRNAs (miRNA).
  • miRNA microRNAs
  • the field of the invention relates to the use of Forster resonance energy transfer (FRET), which is a mechanism describing energy transfer between two chromophores.
  • FRET Forster resonance energy transfer
  • fluorophores When both chromophores are fluorescent, i.e. so-called fluorophores, the term “fluorescence resonance energy transfer” is often used instead.
  • FRET Forster resonance energy transfer
  • a fluorophore donor initially in its electronically excited state, may transfer energy to a fluorophore acceptor through non-radiative dipole-dipole coupling. The efficiency of this energy transfer is inversely proportional to the sixth power of the distance between donor and acceptor making FRET extremely sensitive to small distances.
  • FRET efficiency can be used to determine if two fluorophores are within a certain distance of each other, typically in the proximity of 1 to 10 nm. Such measurements are used as research tools in biology and chemistry. FRET is typically determined by measuring the variation in acceptor emission intensity. When the donor and acceptor are in proximity the acceptor emission will increase because of the FRET from the
  • FRET efficiencies can also be inferred from the photobleaching rates of the donor in the presence and absence of an acceptor.
  • FRET can be measured between a fluorophore donor and a dark quencher.
  • a dark quencher is a family of substances that absorbs emission energy from a fluorophore donor and dissipates the energy as non-UV-visible light or heat, whereas a typical "fluorescent quencher” i.e. fluorophore acceptor re-emits much of the "donated” energy as light.
  • Black hole quencher (BHQTM) dyes from Biosearch Technologies, Inc., Novato, California, USA) are examples of members of the dark quencher family. Dark quenchers such as BHQ dyes are used in molecular biology in conjunction with fluorophores. When the two are close together, e.g. 10-100 A, such as in a molecule, e.g. a protein, the donor's emission is at least partially suppressed by the quencher. This effect can be used to study molecular geometry and motion.
  • MicroRNAs are a large class of small non-coding RNAs which modulate protein translation as negative gene regulators by post-transcriptionally repressing gene expression. They are involved in cell differentiation, development and metabolism. MiRNAs can function as tumor suppressors and oncogenes. The dysregulation of miRNA expression has been linked to various human malignancies, in particular human cancers, and therefore miRNAs represent a new class of potential drug targets. Mature miRNAs are produced from long primary miRNA transcripts (pri-miRNAs) through sequential cleavages by the Microprocessor and Dicer complexes to release pre-miRNA and mature miRNA species, respectively. MiRNAs regulate the expression of a large part of the human genome by binding to partially complementary sites in the 3' UTRs of mRNAs and inhibiting protein translation or inducing deadenylation and degradation.
  • Lin28 also called Lin28a and its homologue Lin28b are one of many thousands of RNA binding proteins (RBPs, see list in appended Table 1 ) which bind to a specific motif (GGAG, or GNNG where N is any ribonucleotide) in pri- and pre-let-7 miRNAs inhibiting their processing and depleting cells of mature let-7.
  • RBPs RNA binding proteins
  • GGAG specific motif
  • GNNG GNNG where N is any ribonucleotide
  • ASO methoxy antisense oligonucleotides
  • Yeom et al. (EMBO REPORTS, 12:7, 690-696, 201 1 ) teaches a method for integrating single-molecule fluorescence microscopy and immunopurification to investigate Lin28- mediated microRNA uridylation by TUT4 (terminal uridylyl transferase 4, polyU
  • TUT4 immunoprecipitates together with fluorescent Cy5-labelled miRNA pre-let-7.
  • the real-time analysis of the uridylation by the TUT4 immunoprecipitates suggests that Lin28 functions as a processivity factor of TUT4 in the Lin28/TUT4/let-7 complex.
  • WO 2009/048935 A2 discloses a method for promoting miRNA processing of pri-let-7 miRNA to mature miRNA in a human cancer cell, the method comprising contacting a cell with an agent inhibiting the activity or expression of Lin-28.
  • HTS high throughput screening
  • This objective is solved according to the present invention by a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
  • FRET Form Resonance Energy Transfer
  • compound modulating an interaction between two molecules or two domains of one biomolecule is meant to encompass any type of compound, e.g. small or large molecular weight inorganic or organic compound, amino acid, peptide, polypeptide, lipid, (poly)nucleotide, etc., that is capable of at least partially (decreasing) or fully interrupting (inhibiting) the interaction between the biomolecules or domains, or that is capable of initiating or increasing the interaction between the biomolecules or domains. In other words, the compound will decrease, interrupt, initiate or increase binding between the biomolecules or domains.
  • An interaction between two molecules is regularly understood to encompass covalent, ionic and "weak" bonds such as dipole-dipole interactions, ion-dipole interactions, London dispersion force, van der Waals interactions, charge transfer interactions and hydrogen bonding.
  • biomolecule indicates any molecule existing in a living cell and having a biological function in said cell as well as functional derivatives and fragments thereof.
  • Functional derivatives and fragments of a biomolecule typically share at least 10, 20, 30 or 40 %, preferably at least 50, 60, 70 or 80 %, more preferably at least 90%, most preferably at least 95 % (percent) identity with the structure of the biomolecule in nature and feature the same or a substantially similar biological function as the biomolecule in nature.
  • structural identity for polynucleotides and polypeptides can be determined by standard algorithms that calculate the percentage identity of the sequences and for polynucleotides structural identity can also be determined by hybridization assays.
  • % (percent) identity indicates the degree of relatedness among two or more nucleic acid molecules that is determined by agreement among the sequences.
  • the percentage of "identity” is the result of the percentage of identical regions in two or more sequences while taking into consideration the gaps and other sequence peculiarities.
  • the identity of related nucleic acid molecules can be determined with the assistance of known methods. In general, special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task. Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared.
  • Preferred computer programs for determining the identity among two nucleic acid sequences comprise, but are not limited to, BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410,1990) and LALIGN (Huang and Miller, Adv. Appl. Math., 12, 337-357, 1991 ).
  • the BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894).
  • nucleic acids can also be characterized in that they have the ability to hybridize to a specifically referenced nucleic acid sequence, preferably under stringent conditions.
  • a specifically referenced nucleic acid sequence preferably under stringent conditions.
  • Next to common and/or standard protocols in the prior art for determining the ability to hybridize to a specifically referenced nucleic acid sequence under stringent conditions e.g. Sambrook and Russell, Molecular cloning: A laboratory manual (3 volumes), 2001 )
  • a nucleic acid to hybridize to a related nucleic acid derivative or fragment is confirmed in a Southern blot assay under the following conditions: 6x sodium chloride/sodium citrate (SSC) at 45°C followed by a wash in 0.2x SSC, 0.1% SDS at 65°C.
  • SSC 6x sodium chloride/sodium citrate
  • the percentage identity of amino acid molecules in nature to functional fragments or derivatives thereof can be determined with the assistance of known methods.
  • special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task.
  • Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared.
  • Preferred computer programs for determining the identity among two amino acid sequences comprise, but are not limited to, TBLASTN, BLASTP, BLASTX or TBLASTX (Altschul et al., J. Mol. Biol., 215, 403-410, 1990).
  • BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894).
  • the term "functional derivative" of a compound, in particular a polypeptide or polynucleotide mentioned herein is meant to include any polypeptide, polynucleotide or fragment thereof that has been chemically or genetically modified in its amino acid or nucleotide sequence, e.g. by addition, substitution and/or deletion of amino acid or nucleotide residue(s) and/or has been chemically modified in at least one of its atoms and/or functional chemical groups, e.g.
  • the derivative still has at least one of the biological activities of the original polypeptide or polynucleotide in nature to a measurable extent, e.g. at least about 1 to 10 % of the biological activity of the original unmodified polypeptide or polynucleotide.
  • each of the first and second biomolecules or the biomolecuie with the first and second domains is selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids.
  • the present invention is preferably directed to a method, wherein the first biomolecuie is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecuie is selected from the group consisting of polynucleotides, preferably microRNA (miRNA).
  • the first biomolecuie is selected from the group consisting of polypeptides interacting with polynucleotides
  • the second biomolecuie is selected from the group consisting of polynucleotides, preferably microRNA (miRNA).
  • polypeptide interacting with polynucleotides is selected from any one of the polypeptides listed in Table 1 , preferably a polypeptide interacting with miRNA, preferably selected from
  • PABP protein family members preferably PABPC1 (NM_002568.3 ⁇ NP_002559.2), SFRS1 (NM_001078166.1 ⁇ NP_001071634.1 ), DGCR8 (N _001190326.1 ⁇
  • NP_001013456.1 FXR2 ( M_004860.3 ⁇ NP_004851.2), KHSRP (NM_003685.2 ⁇ NP_003676.2), STAR (NM_000349.2 ⁇ NP_000340.2), AGO protein family members, preferably AG01 (NM_0 2199.2 ⁇ NP_036331.1), TRIM proteins with NHL domain, preferably TRIM1 (NM_012216.3 ⁇ NP_036348.2), ZFP36 (NM_003407.3 ⁇
  • NP_003398.2 PUM1 (NM_001020658.1 ⁇ NP_001018494.1), PUM2 (NM_015317.1 - ⁇ NP_056132.1), DDX5 (NM_004396.3 ⁇ NP_004387.1), DDX6 (NM_001257191.1 ⁇ NP_001244120.1), DDX17 (NM_001098504.1 ⁇ NP_001091974.1), DDX20
  • Lin-28 homologue a (Lin 28a) and its homologue Lin28b are proteins encoded by the LIN28 genes [ NM_024674.4 ⁇
  • Lin28 is meant to encompass any Lin28 homologue such as homologues Lin28a and Lin28b as well as functional derivatives and fragments thereof as defined above.
  • LIN28 encodes a protein that binds to and enhances the translation of the IGF-2 (insulin-like growth factor 2) mRNA. Lin28 has also been shown to bind to the let-7 pre-miRNA and block production of the mature let-7 microRNA in embryonic stem cells.
  • LIN28 In pluripotent embryonic carcinoma cells LIN28 is localized in the ribosomes, P-bodies and stress granules. LIN28 regulates the self-renewal of stem cells.
  • the LIN28 homolog lin-28 is a heterochronic gene that determines the onset of early larval stages of developmental events in Caenorhabditis elegans by regulating the self-renewal of nematode stem cells in the skin (called seam cells) and vulva (called VPCs) during development.
  • seam cells the skin
  • VPCs vulva
  • mice In mice, LIN28 is highly expressed in mouse embryonic stem cells and during early embryogenesis.
  • LIN28 is also highly expressed in human embryonic stem cells and has been used to enhance the efficiency of the formation of induced pluripotent stem (ips) cells from human fibroblasts.
  • LIN28 overexpression in mice has been shown to cause gigantism and a delay in puberty onset, consistent with human genome-wide association studies suggesting that polymorphisms in the human LIN28B gene are associated with human height and puberty timing. Mutations in LIN28B have been found to be associated with precocious puberty.
  • LIN28 can also regulate glucose homeostasis in mammals by increasing insulin- PI3K-mTOR-signaling and insulin sensitivity, thereby promoting resistance to high fat diet- induced obesity and type 2 diabetes.
  • Lin28 homologues are highly relevant targets for designing and screening medically useful compounds, i.e. compounds modulating the interaction of Lin28 homologues with miRNAs and other regulators of cell growth, cell differentiation and cell homeostasis.
  • the polypeptide interacting with miRNA for practicing the method of the present invention is Lin28, preferably selected from the group consisting of mammalian, preferably human, non-human primate, rodent, monkey, mouse, rat, chicken, pig, guinea pig Lin28a and Lin28b, most preferably human Lin28a or l_in28b or a functional fragment or functional derivative thereof.
  • the polynucleotide for practicing the method of the invention is a pri- or pre-miRNA or mature miRNA, preferably selected from the group consisting of hsa-let-7a-1 , hsa-let-7a-2, hsa-let-7a-3 hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa- let-7e, hsa-let-7f-1 , hsa-let-7f-2, hsa-let-7g, hsa-let-7i and functional derivatives or fragments thereof.
  • miRNA is generally meant to include any pri- and pre- precursor molecules of the mature miRNAs, the mature miRNAs as well as any functional fragments and derivatives thereof as defined above.
  • a fluorophore is a fluorescent chemical compound that can re-emit light upon light excitation. Fluorophores typically contain several combined aromatic groups, or planar or cyclic sub-structures with several ⁇ bonds.
  • a fluorophore donor according to the present invention absorbs light energy of a specific wavelength (donor excitation spectrum) and emits light at a longer wavelength (donor emission spectrum). The fluorophore donor "donates" the excitation energy for the fluorophore acceptor (acceptor excitation spectrum), a fluorescent chemical that re-emits the accepted excitation energy at a longer wavelength (acceptor emission spectrum).
  • a dark quencher for practicing the method of the present invention is a substance that at least partially absorbs excitation energy from the fluorophore donor and dissipates the energy as heat.
  • Black hole quencher (BHQTM) dyes are preferred dark quenchers for practicing the method of the present invention.
  • the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are preferably spectrally paired, meaning that they are selected such that the energy spectrum emitted by the fluorophore donor (fluorophore donor emission spectrum) and the energy spectrum absorbed by the fluorophore acceptor (fluorophore acceptor excitation spectrum) or the energy absorbed by the dark quencher (quencher absorption spectrum) overlap at least partially.
  • the fluorophore donor is capable of absorbing radiation having a wavelength between about 300 nm to 900 nm, more preferably between 350 nm and 800 nm and is capable of transferring energy to the fluorophore acceptor or dark quencher acceptor.
  • the acceptor fluorophore or dark quencher is capable of absorbing radiation having a wavelength between about 300 nm to 900 nm, more preferably between 350 nm and 800 nm, and has an excitation spectra overlapping with the emission of the fluorophore donor, such that the energy emitted by the donor can excite the acceptor.
  • the acceptor fluorophore absorbs light at a wavelength which is at least 10 nm higher and more preferably at least 20 nm higher, most preferably at least 30 nm higher than the maximum absorbance wavelength of the donor fluorophore.
  • the dark quencher acceptor absorbs at least 30% of the emitted wavelength by the fluorophore donor, more preferably at least 50%, most preferably all of the emitted wavelength.
  • the spectral overlap for the fluorophore donor emission spectrum and the dark quencher absorption spectrum, preferably black hole quencher (BHQTM) absorption spectrum is at least 30, preferably at least 50, 60 or 70, more preferably at least 80, most preferably at least 95 or 100 %.
  • the at least one fluorophore donor for practicing the method of the invention is selected from fluorescent proteins and small fluorescent dye molecule,
  • blue fluorescent proteins preferably selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP,
  • cyan fluorescent proteins preferably selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl , Midori-lshi Cyan, TagCFP and mTFP1 (Teal),
  • yellow fluorescent proteins preferably selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana,
  • orange fluorescent proteins preferably selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (T1 ), DsRed-Monomer and mTangerine,
  • red fluorescent proteins preferably selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFP1 , JRed, mCherry, HcRedl , mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum and AQ143, and
  • GFP green fluorescent proteins
  • EGFP Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire
  • green fluorescent proteins i.6
  • yellow fluorescent proteins i.3
  • cyanines preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7,
  • fluorones preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosin, Eosin B, Eosin Y or Erythrosine, (11.4) oxazines, preferably Cresyl violet, Nile blue or Nile red,
  • phenanthridines preferably Ethidium bromide, Gelred or Propidium iodide
  • rhodamines preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101 , Sulforhodamine B or Texas red,
  • Green fluorescent protein Green fluorescent protein
  • eGFP Green fluorescent protein
  • Ex max 488nm
  • Green fluorescent protein(s) as used herein is generally meant to include its derivatives, preferably those selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire,
  • acridines preferably acridine orange or acridine yellow
  • cyanines preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 or Cy7,
  • fluorones preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosin, Eosin B, Eosin Y or Erythrosine,
  • oxazines preferably Cresyl violet, Nile blue or Nile red
  • phenanthridines preferably ethidium bromide, Gelred or propidium iodide
  • rhodamines preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101 , Sulforhodamine B or Texas red,
  • the preferred Cy3 compound for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide (1 ), which has the following formula (I):
  • the at least one dark quencher is selected from the group consisting of Dabcyl, Dabsyl, Black Hole Quenchers (BHQTM) dyes, preferably BHQ- 0, BHQ-1 , BHQ-2 or BHQ-3, QXL quenchers, preferably QXL 490, QXL 570, QXL 610, QXL 670, or QXL 680, Iowa Black quenchers, preferably Iowa black FQ or Iowa Black RQ, and IRDyes, preferably IRDye 800, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, more preferably Black Hole Quenchers (BHQTM) dyes, most preferably BHQ-1.
  • BHQTM Black Hole Quenchers
  • Black Hole Quenchers (BHQTM) dyes as used herein is meant to include any functional derivatives.
  • the preferred BHQ1 functional derivative for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide (II), which has the following formula (II):
  • the skilled person can readily select spectrally paired fluorophore donors and fluorophore acceptors or spectrally paired fluorophore donors and dark quenchers based on the known or easily measurable emission spectra for the donors, the known or easily measurable excitation spectra of the acceptors and the known or easily measurable absorption spectra of the dark quenchers.
  • the spectrally paired fluorophore donor and fluorophore acceptor or the spectrally paired fluorophore donor and dark quencher for practicing the method of the invention are selected from the group consisting of (i) protein-protein pairs, preferably selected from the group consisting of ECFP-Citrine, ECFP-Venus, Cerulean-Citrine, Cerulean-Venus, Cerulean-Ypet, Cerulean-YFP, CyPet-EYFP, CyPet-Venus, CyPet-YPet, CyPet-Citrine, mTurquoise-Venus, mTurquoise-Ypet, mTurquoise-Citrine, ECFP-EYFP, TagGFP-TagRFP, mTFP1- Citrine, Citrine-mKate2, mTurquoisel-SEYFP, mTurquoise2-SEY
  • protein-organic dye pairs preferably selected from the group consisting of EGFP- mCherry, SYFP2-mStrawberry, mTFP1-mOrange, Clover-mCherry, GFP-Cy3, YFP- Cy3, ECFP-BHQ-0, EYFP-BHQ-2, EGFP-Cy3 and EGFP-BHQ-1 ,
  • organic dye-organic-dye pairs preferably selected from the group consisting of
  • the first biomolecule for practicing the invention is Lin28(a or b) and the second biomolecule is (pri or pre-)let-7a-2 or functional derivatives or fragments of these biomolecules.
  • a preferred embodiment of a functional derivative of pre- let-7a-2 is shown in the examples below and designated truncated pre-let-7a-2.
  • Pre-let-7a-2 is a member of the let-7 miRNA family. It is an approx. 67 nucleotides long non-coding miRNA precursor which is produced by processing pri-let-7a-2, a long transcript of several hundred nucleotides in length, so-called pri-miRNA.
  • the pre-let-7 family is presently composed of 12 members (12 pre-cursors, but only 9 mature miRNAs).
  • let-7, let-7a, let-7a-2, etc. include the corresponding pri- and pre-precursors, mature miRNAs as well as any functional derivatives or fragments of these biomolecules, meaning pre- and pri- precursors, mature miRNA as well as any derivatives or fragments of these biomolecules having the same or a substantially similar biological activity in a living cell as the
  • functional derivatives of let-7, let-7a, let-7a-2, etc. comprise at least the tetranucleotide hairpin binding region for Lin28, more preferably the tetrapeptide hairpin binding region GGAG.
  • the fluorophore donor of the first biomolecule or first domain of the biomolecule is at least one green or yellow fluorescent protein and/or that the fluorophore acceptor of the second biomolecule or of the second domain of the biomolecule, preferably an miRNA, more preferably pri- or pre-let-7a-2, is at least one Cy3.
  • the fluorophore donor of the first biomolecule or first domain of the biomolecule is at least one green or yellow fluorescent protein and/or that the dark quencher of the second biomolecule or of the second domain of the biomolecule, preferably an miRNA, more preferably pri- or pre-let-7a-2, is at least one dark quencher, preferably at least one black hole quencher (BHQTM), most preferably at least one BHQ-1 or at least one BHQ-2 or a functional derivative tehreof.
  • BHQTM black hole quencher
  • the at least one fluorophore donor preferably at least one GFP, more preferably at least one EGFP
  • the at least one fluorophore acceptor preferably Cy3 and/or at least one dark quencher, preferably black hole quencher (BHQTM), more preferably BHQ1 is bound to at least one of positions 1 to 67, preferably 5 to 60, more preferably 10 to 57, most preferably one of positions 10, 19, 34 and 57 of pri- or pre-let-7a-2 or a functional fragment or derivative thereof.
  • BHQTM black hole quencher
  • Preferred examples of pri- or pre-let-7a-2 mono- and bis Cy3- or BHQ1 -labeled embodiments are: Position 19 mono-Cy3-labeled (pre)-let-7a-2, Position 19 & 34-bis-Cy3- labeled (pre)-let-7a-2, Position 19 mono-BHQ1 -labeled (pre)-let-7a-2, Position 10 & 34-bis- BHQ1-labeled (pre)-let-7a-2 and Position 19 & 34-bis-BHQ1 -labeled (pre)-let-7a-2 as well as truncated fragments thereof.
  • the miRNA is let-7a-2 full sequence (nucleotides 1 to 67) or the truncated sequence thereof (nucleotides 10 to 57).
  • the at least one fluorophore donor preferably GFP, more preferably EGFP is bound to the N- and/or C-terminal position of Lin28a or Lin28b and the at least one fluorophore acceptor, preferably Cy3 and/or at least one dark quencher, preferably a black hole quencher (BHQTM), more preferably BHQ-1 is bound to at least one, preferably at least two of positions 10, 19, 34 and 57 of pre-let-7a-2, preferably to positions 10 and 19 or positions 10 and 34.
  • BHQTM black hole quencher
  • the contacting of the first and second biomolecules or the biomolecule comprising the first and second domains with the compound of interest must be under conditions that allow for FRET (Forster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the fluorophore donor and the dark quencher.
  • FRET Form Resonance Energy Transfer
  • Conditions for molecular interactions between biomolecules such as e.g. polypeptides and nucleotides are common knowledge in the art.
  • the conditions should be chosen to facilitate covalent and/or preferably non-covalent binding of the biomolecules of interest so that the fluorophore donor(s) and the fluorophore acceptors) or dark quencher(s) come into a close distance of about 10 or less nanometers.
  • the conditions should preferably not denature the biomolecules or otherwise affect their natural structure and function. Also, the conditions should not reduce the FRET signal.
  • the compound of interest is identified as a compound modulating, preferably inhibiting or enhancing an interaction between the two biomolecules or the two domains of the biomolecule, if the FRET (Forster Resonance Energy Transfer) between the first and second biomolecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.
  • FRET Form Resonance Energy Transfer
  • the distance of the fluorophore donor and the fluorophore acceptor or the fluorophore donor and the dark quencher will increase, thus decreasing or abolishing the FRET. If the compound enhances the biomolecule interaction the FRET will increase.
  • the FRET in the presence and absence of the compound of interest should be compared.
  • compounds known to modulate the interaction of the first and second biomolecules or the first and second domains are used as further reference and compared to the FRET results with and without the compound of interest.
  • the method of the invention and its preferred embodiments have a number of advantages over the screening methods commonly used to identify compounds of interest that modulate, in particular reduce, inhibit, initiate or increase biomolecule interaction.
  • the inventive method is simple, it only requires contacting the compound of interest with spectrally paired biomolecules or domains under conditions suitable for biomolecule interaction and FRET, and the readout is spectral and therefore easily automated.
  • the method is particularly suitable for screening polypeptide-miRNA interactions, which represent important targets for medical treatment.
  • the method is particularly effective for Lin28 polypeptide - pre-let-7 miRNA family member interactions.
  • the combination of GFPs or YFPs with Cy3 or GFPs or YFP ' s with BHQ1 or BHQ-2 or functional derivatives thereof is very FRET effective in Lin28- miRNA systems.
  • double-labeling miRNA with two or even more fluorophores, preferably Cy3 greatly enhances FRET (around two times).
  • dark quenchers instead of fluorophore acceptors such as Cy3 suppressed spectral bleed through significantly.
  • the use of a black hole quencher, preferably BHQ1 abolished bleed through and maximized the FRET efficiency up to 2.5 times.
  • a further independent aspect of the present invention that is generally applicable to any type of molecule and which is not limited to biomolecules relates to a method for identifying a compound modulating an interaction between two molecules or two domains of one molecule, the first molecule or first domain comprising at least one fluorophore donor and the second molecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the
  • fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
  • identifying the compound of interest as a compound modulating preferably inhibiting or enhancing an interaction between the two molecules or the two domains of the molecule if the FRET (Forster Resonance Energy Transfer) between the first and second molecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second molecules or the first and second domains in the absence of the compound of interest,
  • FRET Form Resonance Energy Transfer
  • the fluorophore donor is a green fluorescent protein, preferably EGFP or a yellow fluorescent protein
  • the fluorophore acceptor is cy3
  • the dark quencher is a black hole quencher (BHQTM), preferably BHQ-1 or BHQ-2 or a functional derivative thereof.
  • fluorophore donor is a green fluorescent protein, preferably EGFP or a yellow fluorescent protein
  • fluorophore acceptor is cy3
  • the dark quencher is a black hole quencher (BHQTM), preferably BHQ-1 or BHQ-2 or a functional derivative thereof
  • Fig. 1 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 10-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 12.3%.
  • Fig. 2 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 19-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 20.9%.
  • Fig. 3 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 34-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 21.5%.
  • Fig. 4 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 57-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 16%.
  • Fig. 5 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 10 and 19 bis-cy3-labeled truncated pre-let-7a-2
  • Fig. 6 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 19 and 34 bis-cy3-labeled truncated pre-let-7a-2
  • Fig. 7 is a graph comparing FRET based on the quenched GFP signal with truncated pre- let-7a-2 mono- and bis-labeled with cy3 in different positions.
  • Fig. 8 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 10-BHQ-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 27.0%.
  • Fig. 9 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 19-BHQ-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 45.2%.
  • Fig. 10 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 34-BHQ-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre- let-7a-2 there is a FRET of 26.4%.
  • Fig. 11 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 10 and 19 bis-BHQ-labeled truncated pre-let- 7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 30.3%.
  • Fig. 12 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 19 and 34 bis-BHQ-labeled truncated pre-let- 7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 42.4%.
  • Fig. 13 is a graph comparing FRET based on the quenched GFP signal with truncated pre- let-7a-2 mono- and bis-labeled with BHQ-1 in different positions.
  • SEQ ID NO: 1 cDNA-Seauence Lin28b from NM_001004317.3:
  • SEQ ID NO: 2 sequence of pre-let-7a-2: U 1 GAG G U AG U A 10 GG U UG U AUAG20U U U AG AAU UA 30 C AUCAAGG G A40GAU AAC UG U AsoCAGCCUCCUAeoGCUUUCC
  • Lin28b cDNA was amplified from Lin28B Human cDNA ORF Clone (Origene) and cloned into the Sacl and Sacll sites of pEGFP-C2 Vector (BD Biosciences Clontech).
  • Primers used for cloning are: forward primer FW: TCGAGCTCAATGGCCGAAGGCGGGGCTA (SEQ ID NO: 3) reverse primer RV: ATCCGCGGGTTATGTC I I I I I CC I I I I I I G
  • AACTGAAGGCCCC (SEQ ID NO: 4).
  • HEK 293T cells/well (ATCC ATCC ® CRL- 11268 TM ) were seeded in a 6well plate and 320 ng pEGFP-C2-Lin28b fusion plasmid was complexed with jetPEI according to manufacturer's procedure and transfected. 72h after transfection cells were checked for fluorescent protein overexpression and lysed in 500ul buffer containing 50mM Tris, 0.1 mM ZnCI2, 200mM MgCI2, 0.5 % Triton X-100 and 0.5mM TCEP. Lysis buffer was spun for 15min at 13 ⁇ 00 rpm and supernatant was used for further FRET assay procedures.
  • HEK 293T cells were transfected as described above. 16h post transfection medium was exchanged to medium supplemented with 1 g/l neomycin (G418, Invitrogen). Medium was exchanged every second day for 14 days. Subsequently, stable cells were trypsinized and diluted to 150 cells/ml. Monoclonal cultures were grown for two weeks in a 96 well plate and checked for proper EGFP and Lin28b overexpression.
  • Cy3 azide was prepared as follows:
  • 1- Azido-4-iodobutane 12 (148759-55-1 ) was prepared following the procedure of Yao et al., J. Org. Chem. 2004, 69, 1720-1722.To a solution of 1-bromo-4-chlorobutane 11 (25g, 146 mmol, 1 equiv.) in 250 mL of DMF was added sodium azide (9.5g, 146 mmol, 1 equiv.). After stirring (20 h) at room temperature, the reaction mixture was poured into 1000 mL of water and extracted three times with Et 2 0 (200 mL).
  • reaction mixture was stirred at 120 °C for 4 h, cooled to room temperature and was directly purified on silica gel flash chromatography with a gradient 1% to 5% MeOH in dichloromethane to afford 2,3,3-Trimethyl-1 -(4-azidobutyl)-3H-indolium 13 as a dark oil (720 mg, 2.8 mmol, 45%).
  • 2,3.3-Trimethyl-1 -(4-sulfonatobuMV3H-indolium 15 was prepared following the procedure of Kvach et al. , Russ. Chem. Bull. 2006, 55, 159-163. To a 25 mL round bottom flash was added successively 2,3,3-trimethylindolenine 14 (3.97g, 25 mmol, 1 equiv.) and ,4-butanesulfone (3.47 g, 25.5 mmol, 1.02 equiv.). The reaction mixture was heated to 120 °C for 4 h until the reaction solidified.
  • N-(2-azidoethv0-N-ethylaniline 18 To a solution of 2-(N-ethylanilino)ethanol 17 (4.9 mL, 30.2 mmol) in Et 2 0 (250 mL) at 0 °C was added triethylamine (4.6 mL, 33.3 mmol, 1.1 equiv.) followed by a slow addition of methane sulfonyl chloride (2.6 mL, 33.3 mmol, 1.1 equiv.). After 1 h stirring at room temperature, the white precipitate was filtered and washed with Et 2 0. The filtrate was concentrated to an oil and dissolved in 100 mL of DMSO.
  • Oligoribonucleotide synthesis Oligoribonucleotides were synthesized with regular 2'-0- TBDMS-phosphoramidites on a 50 nmol scale using 5 mg of CPG (1000A). For 2'-0- propargyl cytidine phosphoramidite, the coupling time was prolonged to 3 x 4 min. After synthesis, the CPG with the alkynyl-modified RNA was suspended in 300 pL of H 2 0/MeOH (1 :1) in an Eppendorf tube.
  • the reaction mixture was shaken for 16 h at 45 °C in an Eppendorf shaker.
  • CPG was filtered, washed three times with 0.5 mL of DMF, 0.1N aqueous EDTA, DMF, MeCN and CHCI 3 .
  • CPG was transferred into an Eppendorf tube and treated with 200 pL of ammonia (25% in H 2 0) and 200 pL of methylamine (40 % in H 2 0) solutions for 5 h at room temperature. After filtration, the remaining RNA was washed from the solid support with 3 x 100 pL H 2 0/EtOH (1 :1 ). To the solution was added 20 pL of 1 N Tris-base and it was evaporated to dryness in a SpeedVac.
  • Desilylation was carried out by treatment with 130 pL of a mixture of NMP (60 pL), TEA (30 pL) and TEA.3HF (40 pL) at 70 °C for 90 min.
  • the reaction was quenched with trimethylethoxysilane (160 pL) for 20 min at room temperature on an Eppendorf shaker.
  • Diethylether (1 mL) was added, the mixture was vortexed and centrifuged at 4 °C for 2 min. The supernatant was taken off and the precipitate was washed twice with 1 mL diethylether, vortexed and centrifuged.
  • the oligonucleotide was dissolved in 200 pL of water and purified DMT-on by RP-HPLC.
  • the isolated product was dried in a SpeedVac, treated for 1 h with 40 % aq. acetic acid at room temperature, dried in a SpeedVac, dissolved in 200 pL of water and purified DMT-off by RP- HPLC.
  • Double amount of azides is used for the homo bis-labelling of RNA hairpin; for poorly water soluble azides such as BHQ-1 , the volume of DMF was increased to 100 ⁇ _ and was mixed with 240 ⁇ _ of a 1 :1 mixture of hbO/MeOH before addition of the reagents
  • FRET measurements were acquired on a QuantaMaster 50 (PMI Photon Technology International) in a 500 ⁇ _ Precision cell made of Quartz SUPRASIL (115F-QS, 10x2 mm, Hellma) cuvette.
  • EGFP-C2-Lin28b containing lysate was diluted with working buffer (25mM Hepes, 300mM NaCI, 0.01 mM ZnCI2, 1% Topbiock, 0.05% Tween and 0.5 mM TCEP) to a concentration of approximately 2 nM.
  • working buffer 25mM Hepes, 300mM NaCI, 0.01 mM ZnCI2, 1% Topbiock, 0.05% Tween and 0.5 mM TCEP
  • Dry cy3 or BHQ-1 labeled truncated pre-let-7a-2 (SEQ ID: NO 2: nucleotides 10 to 57) was diluted with Millipore water to a concentration of 20 ⁇ .
  • Measurements were acquired without and with various concentrations of labeled pre-let-7a- 2 of 0.313nM, 1.25nM, 5nM, 20nM and 80nM. Solutions were incubated for 30 min and their fluorescence spectra were acquired between 475-600 nm after excitation of the sample at 465 nm.
  • the Forster Resonance Energy Transfer was calculated based on the difference of the EGFP emission signal intensity (at 507nm) between the solution containing only the GFP-tagged Iin28 and the solutions containing GFP-tagged Iin28 and various concentrations of labeled pre-let-7a-2.
  • Cy3-based FRET measurements a background signal of Cy3 was subtracted to get rid of the bleach through. Measurements shown represent at least biological duplicates.
  • MKRN2 makorin ring finger protein 2 [Source:HGNC Symbol;Acc:7113]
  • Fox-1 homolog A (Ataxin-2-binding protein l)(Hexaribonucleotide-binding protein 1)
  • Trinucleotide repeat-containing gene 6C protein [Source:UniProt B/Swiss-Prot;Acc:Q9HCI0]
  • EPHA6 EPH receptor A6 [Source:HGNC Symbol;Acc: 19296]
  • PCBP4 poly(rC) binding protein 4 [Source:HGNC Symbol;Acc:8652]
  • PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) [Source:HGNC Symbol;Acc:8557]
  • Mitogen-activated protein kinase kinase kinase MLT (EC 2.7.11.25)(MLK-like mitogen-activated protein triple kinase)(Sterile alpha motif- and leucine zipper-containing kinase AZK)(Leucine zipper- and sterile alpha motif- containing kinase)( Mixed linea /.../ase-related kinase)(MLK-related kinase)(MRK)(Cervical cancer suppressor gene 4 protein)(HCCS-4) [Source:UniProtKB/Swiss-Prot;Acc:Q9NYL2]
  • HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) [Source:HGNC Symbol;Acc:5035]
  • HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) [Source:HGNC Symbol;Acc:5043]
  • HNRNPM heterogeneous nuclear ribonucleoprotein M [Source:HGNC Symbol;Acc:5046]
  • TRMT2A TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24974]
  • P0LDIP3 polymerase DNA-directed, delta interacting protein 3 [SourceiHGNC Symbol;Acc:23782]
  • C14orfl74 SAM domain-containing protein C14orf 174 [Source:UniProt B/Swiss-Prot;Acc:Q9PlV8] SFRS5 splicing factor, arginine/serine-rich 5 [Source:HGNC Symbol;Acc:10787J
  • PABPN1 poly(A) binding protein, nuclear 1 [Source:HGNC Symbol;Acc:8565]
  • PABPC1L poly(A) binding protein, cytoplasmic 1-like [Source:HGNC Symbol;Acc: 15797]
  • RNA binding protein (Drosophila) [Source:HGNC Symbol;Acc: 14015]
  • CSTF2 cleavage stimulation factor 3' pre-RNA, subunit 2, 64kDa [Source:HGNC Symbol;Acc:2484]
  • RBM3 RNA binding motif (RNP1, RRM) protein 3 [Source:HGNC Symbol;Acc:9900]
  • MYEF2 myelin expression factor 2 [Source:HGNC Symbol;Acc:17940]
  • HNRNPL heterogeneous nuclear ribonucleoprotein L [Source:HGNC Symbol;Acc:5045]
  • TRMT1 TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25980]
  • EIF3B eukaryotic translation initiation factor 3, subunit B [Source:HGNC Symbol;Acc:3280]
  • LSM5 LSM5 homolog U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:17162]
  • FUBP3 far upstream element (FUSE) binding protein 3 [Source:HGNC Symbol;Acc:4005]
  • TNKS2 tankyrase TRFl-interacting ankyrin-related ADP-ribose polymerase 2 [Source:HGNC Symbol;Acc:15677]
  • LARP4B La ribonucleoprotein domain family, member 4B [Source:HGNC Symbol;Acc:28987]
  • KRR1 RR1 RR1 small subunit (SSU) processome component, homolog (yeast) [Source:HGNC Symbol;Acc:5176]
  • NCBP2 nuclear cap binding protein subunit 2 20kOa [Source:HGNC Symbol;Acc:7659]
  • Pre-mRNA branch site protein pl4 (SF3B 14 kDa subunit) [Source:UniProtKB/Swiss-Prot;Acc:Q9Y3B4]
  • HDLBP high density lipoprotein binding protein [Source:HGNC Symbol;Acc:4857]
  • TIA1 TIA1 cytotoxic granule-associated RNA binding protein [Source:HGNC Symbol;Acc: 11802]
  • PRPF3 PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17348]
  • PTBP2 polypyrimidine tract binding protein 2 [Source:HGNC Symbol;Acc: 17662]
  • ARAP3 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:24097]
  • TARDBP TAR DNA binding protein [Source:HGNC Symbol;Acc: 11571]
  • AKAP1 A kinase (PRKA) anchor protein 1 [Source:HGNC Symbol;Acc:367]
  • PSPC1 paraspeckle component 1 [Source :HGNC Symbol;Acc:20320]
  • HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 [Source:HGNC Symbol;Acc:5033]
  • RALY RNA binding protein autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) [HGNC;
  • RNA binding motif protein 42 [Source:HGNC Symbol;Acc:28117)
  • LSM7 homolog U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:20470] LSM7
  • RNA binding motif protein 39 [Source:HGNC Symbol;Acc:15923]
  • RNA binding motif protein 8A [Source:HGNC Symbol;Acc:9905]
  • RNA binding motif protein 38 [Source:HGNC Symbol;Acc:15818]
  • RNA binding motif protein X-linked 2 [Source:HGNC Symbol;Acc:24282]
  • insulin-like growth factor 2 mRNA binding protein 3 [Source:HGNC Symbol;Acc:28868] IGF2BP3
  • SSB heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
  • La ribonucleoprotein domain family member IB [Source:HGNC Symbol;Acc:24704]
  • G3BP2 3'-phosphoadenosine 5'-phosphosulfate synthase 1 [Source:HGNC Symbol;Acc:8603]
  • EPHA2 connector enhancer of kinase suppressor of Ras 1 [Source:HGNC Symbol;Acc:19700]
  • HNRPLL small nuclear ribonucleoprotein polypeptide G [Source:HGNC Symbol;Acc:11163]
  • EPHA5 GTPase activating protein (SH3 domain) binding protein 1 [Source:HGNC Symbol;Acc:30292]
  • EPHA1 non-POU domain containing, octamer-binding [Source:HGNC Symbol;Acc:7871]
  • NONO RNA binding motif protein X-linked [Source:HGNC Symbol;Acc:9910]
  • AICF peroxisome proliferator-activated receptor gamma, coactivator-related 1 [Source:HGNC Symbol;Acc:30025]
  • RNA binding protein 1 [Source:HGNC Symbol;Acc:2549]
  • PABPC3 TIA1 cytotoxic granule-associated RNA binding protein-like 1 [Source:HGNC Symbol;Acc:11804]
  • TIAL1 RNA binding motif protein 46 [Source:HGNC Symbol;Acc:28401]
  • BOLL zinc finger protein 36 C3H type-like 2 [Source:HGNC Symbol;Acc:1108]
  • ZFP36L2 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29991]
  • EPHB1 Probable tRNA uracil-0(2)-)-methyltransferase (EC 2.1.1. n2) [Source:UniProtKB/Swiss-Prot;Acc:Q8IYL2]
  • LARPl RNA binding motif protein 45 [Source:HGNC Symbol;Acc:24468]
  • RBPMS protein phosphatase 1, regulatory (inhibitor) subunit 9A [SourceiHGNC Symbol;Acc:14946]
  • IGF2BP1 trinucleotide repeat containing 4 [Source:HGNC Symbol;Acc:11967]
  • RNA binding protein (Drosophila) [Source:HGNC Symbol;Acc:14058]
  • LARP4 ribonucleoprotein, PTB-binding 1 [Source:HGNC Symbol;Acc:30296]
  • RAVER2 far upstream element (FUSE) binding protein 1 [Source:HGNC Symbol;Acc:4004]
  • TIPARP RNA binding motif protein 47 [Source:HGNC Symbol;Acc:30358]
  • U2-associated protein SR140 140 kDa Ser/Arg-rich domain protein [Source:UniProtKB/Swiss-Prot;
  • HNRNPK ankyrin repeat and sterile alpha motif domain containing 6 [Source:HGNC Symbol;Acc:26724]
  • INPPL1 ecto-NOX disulfide-thiol exchanger 2 [Source:HGNC Symbol;Acc:2259]
  • RBPMS2 small nuclear ribonucleoprotein Dl polypeptide 16kDa [Source:HGNC Symbol;Acc:11158]
  • RNA II DNA directed polypeptide G [Source:HGNC Symbol;Acc:9194]
  • HNRNPH1 zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2 [Source:HGNC Symbol;Acc:23019]
  • PCBP1 RNA binding motif protein Y-linked, family 1, member F [Source:HGNC Symbol;Acc:23974]
  • HNRNPF heterogeneous nuclear ribonucleoprotein A3 [Source:HGNC Symbol;Acc:24941]
  • HNRNPA3 A binding motif protein, X-linked-like 2 (Source:HGNC Symbol;Acc:17886]
  • NCBP2L cold shock domain containing C2 RNA binding [Source:HGNC Symbol;Acc:30359]
  • CSDC2 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa [Source:HGNC;Acc:11547] U6 snRNA-associated Sm-like protein LSm2 (snRNP core Sm-like protein Sm-x5)
  • TNKS polyhomeotic homolog 3 (Drosophila) [Source:HGNC Symbol;Acc: 15682]
  • RBM4 La ribonucleoprotein domain family, member 7 [Source:HGNC Symbol;Acc:24912]
  • LARP7 poly(A) binding protein, cytoplasmic 5 [Source:HGNC Symbol;Acc: 13629]
  • PABPC5 ankyrin repeat and sterile alpha motif domain containing 4B [Source:HGNC Symbol;Acc:26795]
  • ANKS4B LSM1 homolog U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:20472]
  • SAMD12 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant [Source:HGNC Symbol;Acc:17086]
  • HNRNPAO zinc finger CCCH-type containing 12D [Source:HGNC Symbol;Acc:21175]
  • HNRNPCL1 makorin ring finger protein 3 [Source:HGNC Symbol;Acc:7114]
  • MKRN3 RNA binding motif protein 15B [Source:HGNC Symbol;Acc:24303]
  • TRNAU1AP splicing factor arginine/serine-rich 2B [Source:HGNC Symbol;Acc:16988]
  • TH0C4 RNA binding motif protein 12B (Source:HGNC Symbol;Acc:32310]
  • RBM12B small nuclear ribonucleoprotein 35kDa (U11/U12) (Source:HGNC Symbol;Acc:30852]
  • SNRNP35 poly(A) binding protein, cytoplasmic 1-like 2B [Source:HGNC Symbol;Acc:31852]
  • PABPC1L2B RALY RNA binding protein-like [Source:HGNC Symbol;Acc:27036]
  • RALYL DEAD Asp-Glu-Ala-Asp box polypeptide 53 (Source:HGNC Symbol;Acc:20083]
  • RBM43 ankyrin repeat and sterile alpha motif domain containing IB [Source:HGNC Symbol;Acc:24600]
  • RBM11 zinc finger protein 36 C3H type-like 1 [Source:HGNC Symbol;Acc:1107]
  • ZFP36L1 YTH domain family member 3 [Source:HGNC Symbol;Acc:26465]
  • PABPC1L2A ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
  • ARAP1 kinesin family member 24 [Source:HGNC Symbol;Acc:19916]
  • RDM1 sterile alpha motif domain containing 11 [Source:HGNC Symbol;Acc:28706]
  • EPHB4 Pumilio domain-containing protein C14orf21 [Source:UniProt B/Swiss-Prot;Acc:Q86U38]
  • PCBP2 zinc finger CCCH-type with G patch domain [Source:HGNC Symbol;Acc:15948]
  • HNRNPAB Putative uncharacterized protein ENSP00000371708Putative uncharacterized protein ENSP00000371856
  • nucleolar protein 8 [Source:HGNC Symbol;Acc:23387]
  • RNA binding motif protein 20 [Source:HGNC Symbol;Acc:27424]
  • Proline-rich protein 3 MHC class I region proline-rich protein CAT56 [Source:UniProtKB/Swiss-Prot;
  • PABPN1L sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
  • HNRNPA1P4 microRNA 1236 [Source:HGNC Symbol;Acc:33925]
  • U2 small nuclear ribonucleoprotein auxiliary factor 35 kDa subunit-related protein 1 (U2(RNU2) small
  • RNA auxiliary factor 1-like 1) (CCCH type zinc finger, RNA-binding motif and serine/arginine
  • RNA binding motif protein 16 [Source:HGNC Symbol;Acc:20959]
  • RNA binding motif protein X-linked-like 1 [Source:HGNC Symbol;Acc:25073]
  • Putative uncharacterized protein ENSP00000383298 [Source:UniProtKB/TrEMBL;Acc:C9JCD7] Putative uncharacterized protein ENSP00000371708Putative uncharacterized protein ENSP00000371856; [Source:llniProtKB/TrEMBL;Acc:A6NM12]
  • Splicing factor arginine/serine-rich 13A (FUS-interacting serine-arginine-rich protein l)(TLS-associated proteirj with Ser-Arg repeats)(TLS-associated protein with SR repeats)(TASR)(TLS-associated serine-arginine protein) (TLS-associated SR protein)( /.../ SR-repressor protein)(SRrp40)(Splicing factor SRp38) (Source:UniProtKB/ Swiss-Prot;Acc:075494]
  • RNA binding motif protein Y-linked, family 2, member B pseudogene [Source:HGNC Symbol;Acc:9918]
  • RNA binding motif protein Y-linked, family 1, member J [Source:HGNC Symbol;Acc:23917]
  • Serine/threonine-protein phosphatase 1 regulatory subunit 10 Phosphatase 1 nuclear targeting subunit
  • SNRPEU MHC class I region proline-rich protein CAT53
  • FB19 protein FB19 protein
  • PPl-binding protein of 114 kDa p99
  • Proline-rich protein 3 MHC class I region proline-rich protein CAT56 [Source:UniProtKB/Swiss-Prot;
  • Proline-rich protein 3 MHC class I region proline-rich protein CAT56 [Source:UniProtKB/Swiss-Prot;
  • microRNA 1236 [Source:HGNC Symbol;Acc:33925]
  • Serine/threonine-protein phosphatase 1 regulatory subunit 10 Phosphatase 1 nuclear targeting subunit
  • microRNA 1236 [Source:HGNC Symbol;Acc:33925]
  • PABPC4L Proline-rich protein 3 (MHC class 1 region proline-rich protein CAT56) [Source:UniProtKB/Swiss-Prot;
  • microRNA 1236 [Source:HGNC Symbol;Acc:33925]
  • RDBP RNA binding motif protein Y-linked, family 1, member Al [Source:HGNC Symbol;Acc:9912]
  • RBMY1A1 Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit)
  • Serine/threonine-protein phosphatase 1 regulatory subunit 10 Phosphatase 1 nuclear targeting subunit
  • MHC class 1 region proline-rich protein CAT53 MHC class 1 region proline-rich protein CAT53
  • FB19 protein FB19 protein
  • Pl-binding protein of 114 kDa P99
  • MKRNP5 RNA binding motif protein 14 [Source:HGNC Symbol;Acc:14219]
  • HNRNPA1L2 RNA binding motif protein Y-linked, family 1, member B [Source:HGNC Symbol;Acc:23914]
  • TLR2 poly (ADP-ribose) polymerase family member 10 [Source:HGNC Symbol;Acc:25895]
  • PAR P 14 poly (ADP-ribose) polymerase family member 14 (Source:HGNC Symbol;Acc:29232]
  • GTF3A general transcription factor MIA [Source:HGNC Symbol;Acc:4662]
  • NUFIP1 nuclear fragile X mental retardation protein interacting protein 1 [Source:HGNC Symbol;Acc:8057]
  • UPF1 UPF1 regulator of nonsense transcripts homolog (yeast) [Source:HGNC Symbol;Acc:9962]
  • ZNF239 zinc finger protein 239 [Source:HGNC Symbol;Acc:13031]
  • IREB2 iron-responsive element binding protein 2 [Source:HGNC Symbol;Acc:6115]
  • TEP1 telomerase-associated protein 1 [Source:HGNC Symbol;Acc:11726]
  • GW182 Trinucleotide repeat-containing gene 6A protein [Source: UniProtKB, Acc: Q8NDV7)
  • TNRC6B Trinucleotide repeat-containing gene 6B protein [Source: UniProtKB, Acc: Q9UPQ9)
  • TNRC6C Trinucleotide repeat-containing gene 6C protein [Source: UniProtKB, Acc: Q9HCJ0]
  • TARBP2 RISC-loading complex subunit TARBP2 [Source: UniProtKB, Acc: Q 15633]
  • DGCR8 Microprocessor complex subunit DGCR8 [Source: UniProtKB, Acc: Q8WYQ5]
  • MOV10 Putative helicase MOV- 10 [Source: UniProtKB, Acc: Q9HCE1]
  • DDx42 ATP-dependent RNA helicase DDX24 [Source: UniProtKB, Acc: Q9GZR7] Table 2a (preferred miRNAs for practicing the present invention) miRNA designation (e.g. has-let-7a-l), sequence reference (Ml%)
  • MI0014237 •1231 MI0006321 hsa-m -197 MI0000239 hsa-m -3193 MI0014238 ⁇ 1233-1 MI0006323 hsa-m -1972-1 MI0009982 hsa-m -3194 MI0014239 •1233-2 MI0015973 hsa-m -1972-2 MI0015977 hsa-m -3195 MI0014240 ⁇ 1234 MI0006324 hsa-m -1973 MI0009983 hsa-m -3196 MI0014241
  • MI0006384 hsa-m •205 MI0000285 hsa-m -320d-1 MI0008190
  • MI0006392 hsa-m ⁇ 21 10 MI0010629 hsa-m •331 MI0000812 125a MI0000469 hsa-m 21 13 MI0003939 hsa-m 335 MI0000816 125b-1 MI0000446 hsa-m -21 14 MI0010633 hsa-m -337 MI0000806 hsa-mir -125b-2 MI0000470 hsa-m r-21 15 MI0010634 hsa-mir-338 MI0000814 hsa-mir -126 MI0000471 hsa-m r-21 16 M 10010635 hsa-mir-339 MI0000815 hsa-mir -1260a MI0006394 hsa-m r-21 17 MI0010636 hsa-mir-33a I0000091 hsa-mir -1260b MI0014197 hsa-m r-212 MI0000288 hsa-mir-33b
  • hsa-mir-4454 MI0016800 hsa-mir-4721 MI0017356 hsa-mir-522 MI0003177 hsa-mir-4455 MI0016801 hsa-mir-4722 MI0017357 hsa-mir-523 MI0003153 hsa-mir-4456 MI0016802 hsa-mir-4723 MI0017359 hsa-mir-524 MI0003160 hsa-mir-4457 MI0016803 hsa-mir-4724 MI0017361 hsa-mir-525 MI0003152 hsa-mir-4458 MI0016804 hsa-mir-4725 MI0017362 hsa-mir-526a-1 MI0003157 hsa-mir-4459 MI0016805 hsa-mir-4726 MI0017363 hsa-mir-526a-2 Ml 0003168 hsa-mir-4460 MI0016806 hsa-mir-4727
  • hsa-mir -632 Ml 0003647 hsa-mir-6723 MI0022558 hsa-mir-633 MI0003648 hsa-mir-6724 MI0022559 hsa-mir-634 MI0003649 hsa-mir-675 MI0005416 hsa-mir-635 I0003650 hsa-mir-676 MI0016436 hsa-mir-636 MI0003651 hsa-mir-708 MI0005543 hsa-mir-637 l 0003652 hsa-mir-7-1 MI0000263 hsa-mir-638 MI0003653 hsa-mir-711 MI0012488 hsa-mir-639 MI0003654 hsa-mir-718 MI0012489 hsa-mir-640 MI0003655 hsa-mir-7-2 Ml 0000264

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention relates to a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially. Preferably, the first and second biomolecules are selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids, and more preferably the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecule is selected from the group consisting of polynucleotides, preferably microRNAs (miRNA).

Description

FRET-Method for identifying a biomolecule-modulating compound
The present invention relates to a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially. Preferably, the first and second biomolecules are selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids, and more preferably the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecule is selected from the group consisting of polynucleotides, preferably microRNAs (miRNA).
Background of the invention
The field of the invention relates to the use of Forster resonance energy transfer (FRET), which is a mechanism describing energy transfer between two chromophores. When both chromophores are fluorescent, i.e. so-called fluorophores, the term "fluorescence resonance energy transfer" is often used instead. In order to avoid an erroneous interpretation of the phenomenon that is always a non-radiative transfer of energy (even when occurring between two fluorophores), the name "Forster resonance energy transfer" is preferred. A fluorophore donor, initially in its electronically excited state, may transfer energy to a fluorophore acceptor through non-radiative dipole-dipole coupling. The efficiency of this energy transfer is inversely proportional to the sixth power of the distance between donor and acceptor making FRET extremely sensitive to small distances.
Measurements of FRET efficiency can be used to determine if two fluorophores are within a certain distance of each other, typically in the proximity of 1 to 10 nm. Such measurements are used as research tools in biology and chemistry. FRET is typically determined by measuring the variation in acceptor emission intensity. When the donor and acceptor are in proximity the acceptor emission will increase because of the FRET from the
CONFIRMATION COPY
l donor to the acceptor (sensitized emission). FRET efficiencies can also be inferred from the photobleaching rates of the donor in the presence and absence of an acceptor.
Alternatively, FRET can be measured between a fluorophore donor and a dark quencher. A dark quencher is a family of substances that absorbs emission energy from a fluorophore donor and dissipates the energy as non-UV-visible light or heat, whereas a typical "fluorescent quencher" i.e. fluorophore acceptor re-emits much of the "donated" energy as light. Black hole quencher (BHQ™) dyes from Biosearch Technologies, Inc., Novato, California, USA) are examples of members of the dark quencher family. Dark quenchers such as BHQ dyes are used in molecular biology in conjunction with fluorophores. When the two are close together, e.g. 10-100 A, such as in a molecule, e.g. a protein, the donor's emission is at least partially suppressed by the quencher. This effect can be used to study molecular geometry and motion.
MicroRNAs (miRNA) are a large class of small non-coding RNAs which modulate protein translation as negative gene regulators by post-transcriptionally repressing gene expression. They are involved in cell differentiation, development and metabolism. MiRNAs can function as tumor suppressors and oncogenes. The dysregulation of miRNA expression has been linked to various human malignancies, in particular human cancers, and therefore miRNAs represent a new class of potential drug targets. Mature miRNAs are produced from long primary miRNA transcripts (pri-miRNAs) through sequential cleavages by the Microprocessor and Dicer complexes to release pre-miRNA and mature miRNA species, respectively. MiRNAs regulate the expression of a large part of the human genome by binding to partially complementary sites in the 3' UTRs of mRNAs and inhibiting protein translation or inducing deadenylation and degradation.
Lin28, also called Lin28a and its homologue Lin28b are one of many thousands of RNA binding proteins (RBPs, see list in appended Table 1 ) which bind to a specific motif (GGAG, or GNNG where N is any ribonucleotide) in pri- and pre-let-7 miRNAs inhibiting their processing and depleting cells of mature let-7. This mechanism appears to be quite general and occurs in about 15% of tumors of different histology and Lin28 and Lin28b activation is associated with advanced disease and poor clinical prognosis (see e.g.
Viswanathan, et al., Nat Gen, 2009, 41 , 843).
Roos et al. (Poster by ETH Zurich, Institute of Pharmaceutical Sciences, Department of Applied Sciences: "Antisense oligonucleotides inhibit LIN28 binding to pre-let-7"
Keystone Conference, "Noncoding RNAs in Development and Cancer", January 20-25, 2013, Vancouver, Canada) designed and tested methoxy antisense oligonucleotides (ASO) to specifically antagonize Lin28 from binding to the terminal loop region of pre-let-7 in order to elevate processing by Dicer and Drosha in order to prevent the cell from mature let-7 loss. These ASOs were tested by an RNA-based competition ELISA. Kd-values of a selection of tested ASO were determined by Surface Plasmon Resonance (SPR) measurements. The two best ASOs were tested in a biochemical Dicer assay using HPCL- MS for analysis to ensure a proper pre-let-7a-2 processing by Dicer in presence of ASO.
Yeom et al. (EMBO REPORTS, 12:7, 690-696, 201 1 ) teaches a method for integrating single-molecule fluorescence microscopy and immunopurification to investigate Lin28- mediated microRNA uridylation by TUT4 (terminal uridylyl transferase 4, polyU
polymerase), which also regulates let-7 microRNA biogenesis. TUT4 immunoprecipitates together with fluorescent Cy5-labelled miRNA pre-let-7. The real-time analysis of the uridylation by the TUT4 immunoprecipitates suggests that Lin28 functions as a processivity factor of TUT4 in the Lin28/TUT4/let-7 complex.
WO 2009/048935 A2 discloses a method for promoting miRNA processing of pri-let-7 miRNA to mature miRNA in a human cancer cell, the method comprising contacting a cell with an agent inhibiting the activity or expression of Lin-28.
It is the objective of the present invention to provide an improved and high throughput screening (HTS)-suitable assay for identifying a compound modulating an interaction between two biomolecules such as e.g. polypeptides, sugars, polynucleotides, polyamines and lipids or between two domains of the same biomolecule. In particular it is an objective of the present invention to provide an improved HTS-suitable assay for identifying a compound modulating an interaction between polypeptides and polynucleotides, preferably microRNAs (miRNA).
This objective is solved according to the present invention by a method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
(i) providing the first and second biomolecules or a biomolecule comprising said first and second domains,
(ii) providing a compound of interest, (iii) contacting the first and second biomolecules or the biomolecule comprising the first and second domains with the compound of interest under conditions that allow for FRET (Forster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the fluorophore donor and the dark quencher,
(iv) identifying the compound of interest as a compound modulating, preferably inhibiting or enhancing an interaction between the two biomolecules or the two domains of the biomolecule if the FRET (Forster Resonance Energy Transfer) between the first and second biomolecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.
The term "compound modulating an interaction between two molecules or two domains of one biomolecule" as used herein is meant to encompass any type of compound, e.g. small or large molecular weight inorganic or organic compound, amino acid, peptide, polypeptide, lipid, (poly)nucleotide, etc., that is capable of at least partially (decreasing) or fully interrupting (inhibiting) the interaction between the biomolecules or domains, or that is capable of initiating or increasing the interaction between the biomolecules or domains. In other words, the compound will decrease, interrupt, initiate or increase binding between the biomolecules or domains. An interaction between two molecules is regularly understood to encompass covalent, ionic and "weak" bonds such as dipole-dipole interactions, ion-dipole interactions, London dispersion force, van der Waals interactions, charge transfer interactions and hydrogen bonding.
The term "biomolecule" as used herein indicates any molecule existing in a living cell and having a biological function in said cell as well as functional derivatives and fragments thereof. Functional derivatives and fragments of a biomolecule typically share at least 10, 20, 30 or 40 %, preferably at least 50, 60, 70 or 80 %, more preferably at least 90%, most preferably at least 95 % (percent) identity with the structure of the biomolecule in nature and feature the same or a substantially similar biological function as the biomolecule in nature. For example, structural identity for polynucleotides and polypeptides can be determined by standard algorithms that calculate the percentage identity of the sequences and for polynucleotides structural identity can also be determined by hybridization assays.
For polynucleotides the term "% (percent) identity" as known to the skilled artisan and used herein indicates the degree of relatedness among two or more nucleic acid molecules that is determined by agreement among the sequences. The percentage of "identity" is the result of the percentage of identical regions in two or more sequences while taking into consideration the gaps and other sequence peculiarities. The identity of related nucleic acid molecules can be determined with the assistance of known methods. In general, special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task. Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared. Preferred computer programs for determining the identity among two nucleic acid sequences comprise, but are not limited to, BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410,1990) and LALIGN (Huang and Miller, Adv. Appl. Math., 12, 337-357, 1991 ). The BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894).
The structural identity of related nucleic acids can also be characterized in that they have the ability to hybridize to a specifically referenced nucleic acid sequence, preferably under stringent conditions. Next to common and/or standard protocols in the prior art for determining the ability to hybridize to a specifically referenced nucleic acid sequence under stringent conditions (e.g. Sambrook and Russell, Molecular cloning: A laboratory manual (3 volumes), 2001 ), it is preferred to analyze and determine the ability to hybridize to a specifically referenced nucleic acid sequence under stringent conditions by comparing the nucleotide sequences, which may be found in gene databases (e.g. http://www.ncbi.nlm.- nih.gov/entrez/query.fcgi?db=nucleotide) with alignment tools, such as e.g. the above-mentioned BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410,1990) and LALIGN alignment tools.
Preferably the ability of a nucleic acid to hybridize to a related nucleic acid derivative or fragment is confirmed in a Southern blot assay under the following conditions: 6x sodium chloride/sodium citrate (SSC) at 45°C followed by a wash in 0.2x SSC, 0.1% SDS at 65°C.
The percentage identity of amino acid molecules in nature to functional fragments or derivatives thereof can be determined with the assistance of known methods. In general, special computer programs are employed that use algorithms adapted to accommodate the specific needs of this task. Preferred methods for determining identity begin with the generation of the largest degree of identity among the sequences to be compared. Preferred computer programs for determining the identity among two amino acid sequences comprise, but are not limited to, TBLASTN, BLASTP, BLASTX or TBLASTX (Altschul et al., J. Mol. Biol., 215, 403-410, 1990). The BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST handbook, Altschul et al., NCB NLM NIH Bethesda, MD 20894). The term "functional derivative" of a compound, in particular a polypeptide or polynucleotide mentioned herein is meant to include any polypeptide, polynucleotide or fragment thereof that has been chemically or genetically modified in its amino acid or nucleotide sequence, e.g. by addition, substitution and/or deletion of amino acid or nucleotide residue(s) and/or has been chemically modified in at least one of its atoms and/or functional chemical groups, e.g. by additions, deletions, rearrangement, oxidation, reduction, etc. as long as the derivative still has at least one of the biological activities of the original polypeptide or polynucleotide in nature to a measurable extent, e.g. at least about 1 to 10 % of the biological activity of the original unmodified polypeptide or polynucleotide.
In a preferred embodiment each of the first and second biomolecules or the biomolecuie with the first and second domains is selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids.
Even though the invention is applicable to any type of biomolecuie capable of interacting, i.e. binding to some extent to any other type of biomolecuie or capable of interacting with at least two domains on the same biomolecuie, the present invention is preferably directed to a method, wherein the first biomolecuie is selected from the group consisting of polypeptides interacting with polynucleotides and the second biomolecuie is selected from the group consisting of polynucleotides, preferably microRNA (miRNA).
In a more preferred embodiment the polypeptide interacting with polynucleotides is selected from any one of the polypeptides listed in Table 1 , preferably a polypeptide interacting with miRNA, preferably selected from
(i) the group consisting of FOX protein family members (Fox1 : NM_001142333.1→
NP_001135805.1 ; Fox2: NM_001031695.2→ NP_001026865.1 ; Fox3:
NM_001082575.2→ NP_001076044.1), DAZ protein family members (BOLL:
N _033030.5→ NP_149019.1; DAZL: N _001277863.1→ NP_001264792.1 ; DAZ1 : NM_004081.5→ NP_004072.3) , DND1 (NM_194249.2→ NP_919225.1), ELAV1 and ELAV-like protein family members (preferably ELAV1 : NM_001419.2→ NP_001410.2), GW182 protein family members (GW182: N _0010111 6.1→ NP_001011116.1 ; TNRC6B: NM_001024843.1→ NP_001020014.1 ; TNRC6C: NM_001 42640.1→ NP_001136112.1 ), hnRNP protein family members, preferably hnRNPAI
(NM_002136.2→ NP_002127.1), IGF2BP1 (NM_001160423.1→ NP_001153895.1), PABP protein family members, preferably PABPC1 (NM_002568.3→ NP_002559.2), SFRS1 (NM_001078166.1→ NP_001071634.1 ), DGCR8 (N _001190326.1→
NP_001177255.1 ), Dicerl (NM_001195573.1→ NP_00 182502.1), Drosha
(NM_001100412.1→ NP_001093882.1), TARBP2 (NM_004178.4→ NP_004169.3), FMR1 (NM_001185075.1→ NP_001172004.1 ), FXR1 (NM_001013438.2→
NP_001013456.1 ), FXR2 ( M_004860.3→ NP_004851.2), KHSRP (NM_003685.2→ NP_003676.2), STAR (NM_000349.2→ NP_000340.2), AGO protein family members, preferably AG01 (NM_0 2199.2→ NP_036331.1), TRIM proteins with NHL domain, preferably TRIM1 (NM_012216.3→ NP_036348.2), ZFP36 (NM_003407.3→
NP_003398.2), PUM1 (NM_001020658.1→ NP_001018494.1), PUM2 (NM_015317.1 -→ NP_056132.1), DDX5 (NM_004396.3→ NP_004387.1), DDX6 (NM_001257191.1 → NP_001244120.1), DDX17 (NM_001098504.1→ NP_001091974.1), DDX20
(NM_007204.4 -→ NP_009135.4), DDX42 (NM_007372.2→ NP_031398.2), MOV10 (NM_001 130079.1 (mRNA)→ NP_001123551.1), Lin28a (NM_024674.4→
NP_078950.1 ) and Lin28b (NM_001004317.3→ NP_001004317.1),
(ii) preferably the group consisting of hnRNPAI , KHSRP, Fox1 and Fox2, Lin28a and
Lin28b,
(iii) more preferably the group consisting of Lin28b or Lin28a.
The above and below mentioned reference numbers refer to the NCBI (National Center for Biotechnology Information) reference number code (www.ncbi.nlm.nih.gov).
The biomolecules Lin28, also referred to as Lin-28 homologue a (Lin 28a) and its homologue Lin28b are proteins encoded by the LIN28 genes [ NM_024674.4→
NP_078950.1 and NM_001004317.3→ NP_001004317.1 ; for a review see: Viswanathan & Daley, Lin28: A MicroRNA Regulator with a Macro Role, Cell, 2010/ Lehrbach & Miska, Regulation of pre-miRNA Processing, Chapter 7, Springer 2010/ Thornton et al., How does Lin28 let-7 control development and disease, Trends in Cell Biology, 2012)].
As defined herein, the term Lin28 is meant to encompass any Lin28 homologue such as homologues Lin28a and Lin28b as well as functional derivatives and fragments thereof as defined above.
Human Lin28a sequence information is available under ref. nos. 79729, UniProt:
Q9H9Z2, NM_024674 (mRNA), NP_078950 and mouse Lin28a sequence information is available under ref. nos. 83557, UniProt: Q8K3Y3, NM_145833 (mRNA), NP_665832. The cDNA-Sequence of human Lin28b from NM 001004317.3 is shown below as SEQ ID NO: 1. LIN28 encodes a protein that binds to and enhances the translation of the IGF-2 (insulin-like growth factor 2) mRNA. Lin28 has also been shown to bind to the let-7 pre-miRNA and block production of the mature let-7 microRNA in embryonic stem cells. In pluripotent embryonic carcinoma cells LIN28 is localized in the ribosomes, P-bodies and stress granules. LIN28 regulates the self-renewal of stem cells. In nematodes, the LIN28 homolog lin-28 is a heterochronic gene that determines the onset of early larval stages of developmental events in Caenorhabditis elegans by regulating the self-renewal of nematode stem cells in the skin (called seam cells) and vulva (called VPCs) during development. In mice, LIN28 is highly expressed in mouse embryonic stem cells and during early embryogenesis. LIN28 is also highly expressed in human embryonic stem cells and has been used to enhance the efficiency of the formation of induced pluripotent stem (ips) cells from human fibroblasts. LIN28 overexpression in mice has been shown to cause gigantism and a delay in puberty onset, consistent with human genome-wide association studies suggesting that polymorphisms in the human LIN28B gene are associated with human height and puberty timing. Mutations in LIN28B have been found to be associated with precocious puberty. LIN28 can also regulate glucose homeostasis in mammals by increasing insulin- PI3K-mTOR-signaling and insulin sensitivity, thereby promoting resistance to high fat diet- induced obesity and type 2 diabetes. In summary, Lin28 homologues are highly relevant targets for designing and screening medically useful compounds, i.e. compounds modulating the interaction of Lin28 homologues with miRNAs and other regulators of cell growth, cell differentiation and cell homeostasis.
In a most preferred embodiment the polypeptide interacting with miRNA for practicing the method of the present invention is Lin28, preferably selected from the group consisting of mammalian, preferably human, non-human primate, rodent, monkey, mouse, rat, chicken, pig, guinea pig Lin28a and Lin28b, most preferably human Lin28a or l_in28b or a functional fragment or functional derivative thereof.
In a further preferred embodiment the polynucleotide for practicing the method of the invention is a pri- or pre-miRNA or mature miRNA, preferably selected from the group consisting of hsa-let-7a-1 , hsa-let-7a-2, hsa-let-7a-3 hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa- let-7e, hsa-let-7f-1 , hsa-let-7f-2, hsa-let-7g, hsa-let-7i and functional derivatives or fragments thereof.
Sequence information for the above and further preferred miRNA embodiments can be found on the miRBase site (http://www.mirbase.org/) and is well-known to the skilled person:
hsa-let-7a-1 MI0000060, hsa-let-7a-2 MI0000061 ; hsa-let-7a-3 MI0000062; hsa-let-7b MI0000063; hsa-let-7c MI0000064; hsa-let-7d MI0000065; hsa-let-7e MI0000066; hsa-let- 7f-1 MI0000067; hsa-let-7f-2 MI0000068; hsa-let-7g MI0000433; hsa-let-7i MI0000434; hsa- mir-106a MI0000113; hsa-mir-106b MI0000734; hsa-mir-107 MI00001 14; hsa-mir-10a MI0000266; hsa-mir-155 MI0000681 ; hsa-mir-181 b-1 MI0000270; hsa-mir-181b-2
MI0000683; hsa-mir-181c MI0000271 ; hsa-mir-181d MI0003139; hsa-mir-10b MI0000267; hsa-mir-18a MI0000072; hsa-mir-18b MI0001518; hsa-mir-19a MI0000073; hsa-mir-19b-1 MI0000074; hsa-mir-19b-2 MI0000075; hsa-mir-19a MI0000073; hsa-mir-19b-1 MI0000074; hsa-mir-19b-2 MI0000075; hsa-mir-32 MI0000090; hsa-mir-20a MI0000076; hsa-mir-20b MI0001519; hsa-mir-21 MI0000077; hsa-mir-34a MI0000268; hsa-mir-34b MI0000742; hsa- mir-34c MI0000743; hsa-mir-9-1 I0000466; hsa-mir-9-2 MI0000467; hsa-mir-9-3
MI0000468; hsa-mir-98 M 10000100.
As used herein the term miRNA is generally meant to include any pri- and pre- precursor molecules of the mature miRNAs, the mature miRNAs as well as any functional fragments and derivatives thereof as defined above.
A fluorophore is a fluorescent chemical compound that can re-emit light upon light excitation. Fluorophores typically contain several combined aromatic groups, or planar or cyclic sub-structures with several π bonds. A fluorophore donor according to the present invention absorbs light energy of a specific wavelength (donor excitation spectrum) and emits light at a longer wavelength (donor emission spectrum). The fluorophore donor "donates" the excitation energy for the fluorophore acceptor (acceptor excitation spectrum), a fluorescent chemical that re-emits the accepted excitation energy at a longer wavelength (acceptor emission spectrum).
A dark quencher for practicing the method of the present invention is a substance that at least partially absorbs excitation energy from the fluorophore donor and dissipates the energy as heat. Black hole quencher (BHQ™) dyes are preferred dark quenchers for practicing the method of the present invention.
For practicing the method of the invention the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are preferably spectrally paired, meaning that they are selected such that the energy spectrum emitted by the fluorophore donor (fluorophore donor emission spectrum) and the energy spectrum absorbed by the fluorophore acceptor (fluorophore acceptor excitation spectrum) or the energy absorbed by the dark quencher (quencher absorption spectrum) overlap at least partially.
Preferably, the fluorophore donor is capable of absorbing radiation having a wavelength between about 300 nm to 900 nm, more preferably between 350 nm and 800 nm and is capable of transferring energy to the fluorophore acceptor or dark quencher acceptor.
Preferably the acceptor fluorophore or dark quencher is capable of absorbing radiation having a wavelength between about 300 nm to 900 nm, more preferably between 350 nm and 800 nm, and has an excitation spectra overlapping with the emission of the fluorophore donor, such that the energy emitted by the donor can excite the acceptor.
Preferably, the acceptor fluorophore absorbs light at a wavelength which is at least 10 nm higher and more preferably at least 20 nm higher, most preferably at least 30 nm higher than the maximum absorbance wavelength of the donor fluorophore. Preferably, the dark quencher acceptor absorbs at least 30% of the emitted wavelength by the fluorophore donor, more preferably at least 50%, most preferably all of the emitted wavelength.
In a further preferred embodiment the spectral overlap for the fluorophore donor emission spectrum and the dark quencher absorption spectrum, preferably black hole quencher (BHQ™) absorption spectrum is at least 30, preferably at least 50, 60 or 70, more preferably at least 80, most preferably at least 95 or 100 %.
In a preferred embodiment the at least one fluorophore donor for practicing the method of the invention is selected from fluorescent proteins and small fluorescent dye molecule,
(i) preferably fluorescent proteins selected from the group consisting of
(1.1 ) blue fluorescent proteins, preferably selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP,
(1.2) cyan fluorescent proteins, preferably selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl , Midori-lshi Cyan, TagCFP and mTFP1 (Teal),
(1.3) yellow fluorescent proteins, preferably selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana,
(1.4) orange fluorescent proteins, preferably selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (T1 ), DsRed-Monomer and mTangerine,
(1.5) red fluorescent proteins, preferably selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFP1 , JRed, mCherry, HcRedl , mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum and AQ143, and
(1.6) green fluorescent proteins (GFP), preferably selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire,
more preferably green fluorescent proteins (i.6) and yellow fluorescent proteins (i.3), most preferably EGFP;
(ii) preferably small fluorescent dye molecules selected from the group consisting of ii.1 ) acridines, preferably acridine orange or acridine yellow,
(11.2) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7,
(11.3) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosin, Eosin B, Eosin Y or Erythrosine, (11.4) oxazines, preferably Cresyl violet, Nile blue or Nile red,
(11.5) phenanthridines, preferably Ethidium bromide, Gelred or Propidium iodide, and
(11.6) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101 , Sulforhodamine B or Texas red,
(iii) more preferably cyanine and rhodamine dyes.
The above fluorophore donors are common knowledge in the art. For example, they are cited under e.g. fluirophores.org.
The most preferred fluorophore donor is Green fluorescent protein (GFP), which features 238 amino acids and exhibits bright green fluorescence (eGFP, Exmax=488nm, Emmax=509 nm) upon excitation. The term Green fluorescent protein(s) as used herein is generally meant to include its derivatives, preferably those selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire,
In a preferred embodiment the at least one fluorophore acceptor is selected from the group consisting of
(i) acridines, preferably acridine orange or acridine yellow,
(ii) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 or Cy7,
(iii) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosin, Eosin B, Eosin Y or Erythrosine,
(iv) oxazines, preferably Cresyl violet, Nile blue or Nile red,
(v) phenanthridines, preferably ethidium bromide, Gelred or propidium iodide, and
(vi) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101 , Sulforhodamine B or Texas red,
preferably cyanines (ii), more preferably Cy3.
Cyanine 3 (Cy3) is a small molecule fluorophore featuring a bright pink fluorescence (Exmax=550nm, Emmax=570nm) upon excitation.
The preferred Cy3 compound for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide (1 ), which has the following formula (I):
Figure imgf000013_0001
Cy3 azide (I)
In another preferred embodiment the at least one dark quencher is selected from the group consisting of Dabcyl, Dabsyl, Black Hole Quenchers (BHQ™) dyes, preferably BHQ- 0, BHQ-1 , BHQ-2 or BHQ-3, QXL quenchers, preferably QXL 490, QXL 570, QXL 610, QXL 670, or QXL 680, Iowa Black quenchers, preferably Iowa black FQ or Iowa Black RQ, and IRDyes, preferably IRDye 800, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, more preferably Black Hole Quenchers (BHQ™) dyes, most preferably BHQ-1.
The term Black Hole Quenchers (BHQ™) dyes as used herein is meant to include any functional derivatives. Black hole quencher 1 (BHQ1 ) is a small molecule that absorbs fluorescence when excited (broad range, Ex=480 to 580nm). The preferred BHQ1 functional derivative for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide (II), which has the following formula (II):
Figure imgf000013_0002
BHQ-1 azide (II)
The skilled person can readily select spectrally paired fluorophore donors and fluorophore acceptors or spectrally paired fluorophore donors and dark quenchers based on the known or easily measurable emission spectra for the donors, the known or easily measurable excitation spectra of the acceptors and the known or easily measurable absorption spectra of the dark quenchers.
In a preferred embodiments the spectrally paired fluorophore donor and fluorophore acceptor or the spectrally paired fluorophore donor and dark quencher for practicing the method of the invention are selected from the group consisting of (i) protein-protein pairs, preferably selected from the group consisting of ECFP-Citrine, ECFP-Venus, Cerulean-Citrine, Cerulean-Venus, Cerulean-Ypet, Cerulean-YFP, CyPet-EYFP, CyPet-Venus, CyPet-YPet, CyPet-Citrine, mTurquoise-Venus, mTurquoise-Ypet, mTurquoise-Citrine, ECFP-EYFP, TagGFP-TagRFP, mTFP1- Citrine, Citrine-mKate2, mTurquoisel-SEYFP, mTurquoise2-SEYFP and clover- mRuby2,
(ii) protein-organic dye pairs, preferably selected from the group consisting of EGFP- mCherry, SYFP2-mStrawberry, mTFP1-mOrange, Clover-mCherry, GFP-Cy3, YFP- Cy3, ECFP-BHQ-0, EYFP-BHQ-2, EGFP-Cy3 and EGFP-BHQ-1 ,
(iii) organic dye-organic-dye pairs, preferably selected from the group consisting of
mOrange-mCherry, Alexa488-Alexa555, Alexa488-Cy3, Alexa 568-Alexa633, Cy3- Cy5, Alexa 488-Alexa514, Alexa488-Alexa532, Alexa488-546, Alexa488-610, Alexa647-Alexa 680, Alexa647-Alexa680, Alexa647-Aelxa700, Alexa647-Alexa750, BHQ-1-FAM, BHQ-1-TET, BHQ-1-JOE, BHQ-1-HEX, BHQ-1-Oregon green, BHQ-2- TAMRA, BHQ-2-ROX, BHQ-2-Cy3, BHQ-2-Cy3.5, BHQ-2-CAL Red, BHQ-2-Red 640, BHQ-3-Cy5, or BHQ-3-Cy5.5, Dabcyl-Edans and Dabsyl-Edans, fluorescine.
In a further preferred embodiment the first biomolecule for practicing the invention is Lin28(a or b) and the second biomolecule is (pri or pre-)let-7a-2 or functional derivatives or fragments of these biomolecules. A preferred embodiment of a functional derivative of pre- let-7a-2 is shown in the examples below and designated truncated pre-let-7a-2.
Pre-let-7a-2 is a member of the let-7 miRNA family. It is an approx. 67 nucleotides long non-coding miRNA precursor which is produced by processing pri-let-7a-2, a long transcript of several hundred nucleotides in length, so-called pri-miRNA. The pre-let-7 family is presently composed of 12 members (12 pre-cursors, but only 9 mature miRNAs).
As already generally indicated above for miRNAs in general, the terms let-7, let-7a, let-7a-2, etc. include the corresponding pri- and pre-precursors, mature miRNAs as well as any functional derivatives or fragments of these biomolecules, meaning pre- and pri- precursors, mature miRNA as well as any derivatives or fragments of these biomolecules having the same or a substantially similar biological activity in a living cell as the
corresponding native miRNA in said cell. Preferably, functional derivatives of let-7, let-7a, let-7a-2, etc. comprise at least the tetranucleotide hairpin binding region for Lin28, more preferably the tetrapeptide hairpin binding region GGAG.
It is preferred that the fluorophore donor of the first biomolecule or first domain of the biomolecule, preferably Lin28, is at least one green or yellow fluorescent protein and/or that the fluorophore acceptor of the second biomolecule or of the second domain of the biomolecule, preferably an miRNA, more preferably pri- or pre-let-7a-2, is at least one Cy3.
It is also preferred that the fluorophore donor of the first biomolecule or first domain of the biomolecule, preferably Lin28, is at least one green or yellow fluorescent protein and/or that the dark quencher of the second biomolecule or of the second domain of the biomolecule, preferably an miRNA, more preferably pri- or pre-let-7a-2, is at least one dark quencher, preferably at least one black hole quencher (BHQ™), most preferably at least one BHQ-1 or at least one BHQ-2 or a functional derivative tehreof.
In a most preferred embodiment for practicing the method of the present invention the at least one fluorophore donor, preferably at least one GFP, more preferably at least one EGFP, is bound to the N- and/or C-terminal position of Lin28a or Lin28b or a functional derivative or fragment thereof, and the at least one fluorophore acceptor, preferably Cy3 and/or at least one dark quencher, preferably black hole quencher (BHQ™), more preferably BHQ1 is bound to at least one of positions 1 to 67, preferably 5 to 60, more preferably 10 to 57, most preferably one of positions 10, 19, 34 and 57 of pri- or pre-let-7a-2 or a functional fragment or derivative thereof.
Preferred examples of pri- or pre-let-7a-2 mono- and bis Cy3- or BHQ1 -labeled embodiments are: Position 19 mono-Cy3-labeled (pre)-let-7a-2, Position 19 & 34-bis-Cy3- labeled (pre)-let-7a-2, Position 19 mono-BHQ1 -labeled (pre)-let-7a-2, Position 10 & 34-bis- BHQ1-labeled (pre)-let-7a-2 and Position 19 & 34-bis-BHQ1 -labeled (pre)-let-7a-2 as well as truncated fragments thereof. In a more preferred embodiment the miRNA is let-7a-2 full sequence (nucleotides 1 to 67) or the truncated sequence thereof (nucleotides 10 to 57).
In another most preferred embodiment for practicing the method of the present invention the at least one fluorophore donor, preferably GFP, more preferably EGFP is bound to the N- and/or C-terminal position of Lin28a or Lin28b and the at least one fluorophore acceptor, preferably Cy3 and/or at least one dark quencher, preferably a black hole quencher (BHQ™), more preferably BHQ-1 is bound to at least one, preferably at least two of positions 10, 19, 34 and 57 of pre-let-7a-2, preferably to positions 10 and 19 or positions 10 and 34.
For practicing the method of the invention the contacting of the first and second biomolecules or the biomolecule comprising the first and second domains with the compound of interest must be under conditions that allow for FRET (Forster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the fluorophore donor and the dark quencher. Conditions for molecular interactions between biomolecules such as e.g. polypeptides and nucleotides are common knowledge in the art. The conditions should be chosen to facilitate covalent and/or preferably non-covalent binding of the biomolecules of interest so that the fluorophore donor(s) and the fluorophore acceptors) or dark quencher(s) come into a close distance of about 10 or less nanometers. And the conditions should preferably not denature the biomolecules or otherwise affect their natural structure and function. Also, the conditions should not reduce the FRET signal.
When practicing the method of the invention the compound of interest is identified as a compound modulating, preferably inhibiting or enhancing an interaction between the two biomolecules or the two domains of the biomolecule, if the FRET (Forster Resonance Energy Transfer) between the first and second biomolecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.
If the compound inhibits the biomolecule interaction, the distance of the fluorophore donor and the fluorophore acceptor or the fluorophore donor and the dark quencher will increase, thus decreasing or abolishing the FRET. If the compound enhances the biomolecule interaction the FRET will increase. For positively identifying the compound of interest as a modulator of the first and second molecule or first and second domain the FRET in the presence and absence of the compound of interest should be compared. Preferably, compounds known to modulate the interaction of the first and second biomolecules or the first and second domains are used as further reference and compared to the FRET results with and without the compound of interest.
The method of the invention and its preferred embodiments have a number of advantages over the screening methods commonly used to identify compounds of interest that modulate, in particular reduce, inhibit, initiate or increase biomolecule interaction. The inventive method is simple, it only requires contacting the compound of interest with spectrally paired biomolecules or domains under conditions suitable for biomolecule interaction and FRET, and the readout is spectral and therefore easily automated. The method is particularly suitable for screening polypeptide-miRNA interactions, which represent important targets for medical treatment.
The method is particularly effective for Lin28 polypeptide - pre-let-7 miRNA family member interactions. In particular the combination of GFPs or YFPs with Cy3 or GFPs or YFP's with BHQ1 or BHQ-2 or functional derivatives thereof is very FRET effective in Lin28- miRNA systems. It was surprisingly found that double-labeling miRNA with two or even more fluorophores, preferably Cy3 greatly enhances FRET (around two times). Using dark quenchers instead of fluorophore acceptors such as Cy3 suppressed spectral bleed through significantly. And also surprisingly, the use of a black hole quencher, preferably BHQ1 , abolished bleed through and maximized the FRET efficiency up to 2.5 times.
A further independent aspect of the present invention, that is generally applicable to any type of molecule and which is not limited to biomolecules relates to a method for identifying a compound modulating an interaction between two molecules or two domains of one molecule, the first molecule or first domain comprising at least one fluorophore donor and the second molecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the
fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
(i) providing the first and second molecules or a molecule comprising said first and second domains,
(ii) providing a compound of interest,
(iii) contacting the first and second molecules or the molecule comprising the first and second domains with the compound of interest under conditions that allow for FRET (Forster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor,
(iv) identifying the compound of interest as a compound modulating, preferably inhibiting or enhancing an interaction between the two molecules or the two domains of the molecule if the FRET (Forster Resonance Energy Transfer) between the first and second molecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second molecules or the first and second domains in the absence of the compound of interest,
wherein the fluorophore donor is a green fluorescent protein, preferably EGFP or a yellow fluorescent protein, the fluorophore acceptor is cy3 and the dark quencher is a black hole quencher (BHQ™), preferably BHQ-1 or BHQ-2 or a functional derivative thereof.
Another independent aspect of the present invention that is not limited to biomolecules in particular relates to the use of a fluorophore donor / acceptor or a fluorophore donor / dark quencher pair for FRET measurement in general, wherein the fluorophore donor is a green fluorescent protein, preferably EGFP or a yellow fluorescent protein, the fluorophore acceptor is cy3 and the dark quencher is a black hole quencher (BHQ™), preferably BHQ-1 or BHQ-2 or a functional derivative thereof Figures
Fig. 1 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 10-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 12.3%.
Fig. 2 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 19-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 20.9%.
Fig. 3 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 34-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 21.5%.
Fig. 4 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 57-cy3-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 16%.
Fig. 5 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 10 and 19 bis-cy3-labeled truncated pre-let-7a-2
(nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre- let-7a-2 there is a FRET of 32.9%.
Fig. 6 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 19 and 34 bis-cy3-labeled truncated pre-let-7a-2
(nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre- let-7a-2 there is a FRET of 37.2%.
Fig. 7 is a graph comparing FRET based on the quenched GFP signal with truncated pre- let-7a-2 mono- and bis-labeled with cy3 in different positions.
Fig. 8 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 10-BHQ-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 27.0%.
Fig. 9 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 19-BHQ-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 45.2%.
Fig. 10 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of position 34-BHQ-labeled truncated pre-let-7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre- let-7a-2 there is a FRET of 26.4%.
Fig. 11 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 10 and 19 bis-BHQ-labeled truncated pre-let- 7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 30.3%.
Fig. 12 is a graph showing the percentage of the GFP signal quenched at 507nm depending on the concentration of positions 19 and 34 bis-BHQ-labeled truncated pre-let- 7a-2 (nucleotides 10 to 57 of SEQ ID NO: 2 above). At a 80nM concentration of truncated pre-let-7a-2 there is a FRET of 42.4%.
Fig. 13 is a graph comparing FRET based on the quenched GFP signal with truncated pre- let-7a-2 mono- and bis-labeled with BHQ-1 in different positions.
In the following the embodiments of the present invention will be illustrated by examples, none of which are intended to be interpreted as limiting to the scope of the claims as appended.
Examples
For sequence information regarding Lin28 and let-7a-2 reference is made to the following sequence listings:
SEQ ID NO: 1 : cDNA-Seauence Lin28b from NM_001004317.3:
ATGGCCGAAGGCGGGGCTAGCAAAGGTGGTGGAGAAGAGCCCGGGAAGCTGCCGGA
GCCGGCAGAGGAGGAATCCCAGGTTTTGCGCGGAACTGGCCACTGTAAGTGGTTCAA
TGTGCGCATGGGATTTGGATTCATCTCCATGATAAACCGAGAGGGAAGCCCCTTGGAT
ATTCCAGTCGATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCCT
AAAAGAAGGAGAACCAGTGGAATTCACATTTAAAAAATCTTCCAAAGGCCTTGAGTCAA
TACGGGTAACAGGACCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGAAGACCCAAAG
GGAAGACACTACAGAAAAGAAAACCAAAGGGAGATAGATGCTACAACTGTGGTGGCCT
TGATCATCATGCTAAGGAATGTAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTC
AGAGCATCATGCACATGGTGGCAAACTGCCCACATAAAAATGTTGCACAGCCACCCGC
GAGTTCTCAGGGAAGACAGGAAGCAGAATCCCAGCCATGCACTTCAACTCTCCCTCGA
GAAGTGGGAGGCGGGCATGGCTGTACATCACCACCGTTTCCTCAGGAGGCTAGGGCA
GAGATCTCAGAACGGTCAGGCAGGTCACCTCAAGAAGCTTCCTCCACGAAGTCATCTA
TAGCACCAGAAGAGCAAAGCAAAAAGGGGCCTTCAGTTCAAAAAAGGAAAAAGACATA
A
SEQ ID NO: 2: sequence of pre-let-7a-2: U 1 GAG G U AG U A10GG U UG U AUAG20U U U AG AAU UA30C AUCAAGG G A40GAU AAC UG U AsoCAGCCUCCUAeoGCUUUCC
The subscripts in SEQ ID NO: 2 indicate the positions referenced above, in the examples below and the claims as appended. The tetranucleotide hairpin binding region GGAG of pre-let-7a-2 for Lin 28 is underlined.
Example 1: GFP-tagged Iin28
Cloning PEGFP-C2 Lin28b
Lin28b cDNA was amplified from Lin28B Human cDNA ORF Clone (Origene) and cloned into the Sacl and Sacll sites of pEGFP-C2 Vector (BD Biosciences Clontech). Primers used for cloning are: forward primer FW: TCGAGCTCAATGGCCGAAGGCGGGGCTA (SEQ ID NO: 3) reverse primer RV: ATCCGCGGGTTATGTC I I I I I CC I I I I I I G
AACTGAAGGCCCC (SEQ ID NO: 4).
Recombinant Protein overexpression
For recombinant protein expression 160Ό00 HEK 293T cells/well (ATCC ATCC® CRL- 11268™) were seeded in a 6well plate and 320 ng pEGFP-C2-Lin28b fusion plasmid was complexed with jetPEI according to manufacturer's procedure and transfected. 72h after transfection cells were checked for fluorescent protein overexpression and lysed in 500ul buffer containing 50mM Tris, 0.1 mM ZnCI2, 200mM MgCI2, 0.5 % Triton X-100 and 0.5mM TCEP. Lysis buffer was spun for 15min at 13Ό00 rpm and supernatant was used for further FRET assay procedures.
Generating stable cell lines
For stable overexpression of EGFP-C2-Lin28b fusion plasmid HEK 293T cells were transfected as described above. 16h post transfection medium was exchanged to medium supplemented with 1 g/l neomycin (G418, Invitrogen). Medium was exchanged every second day for 14 days. Subsequently, stable cells were trypsinized and diluted to 150 cells/ml. Monoclonal cultures were grown for two weeks in a 96 well plate and checked for proper EGFP and Lin28b overexpression.
Example 2: Synthesis of Cy3 and BHQ-1 labeled truncated pre-let-7a-2
Cy3 azide was prepared as follows:
Figure imgf000020_0001
Figure imgf000020_0002
1- Azido-4-iodobutane 12 (148759-55-1 ) was prepared following the procedure of Yao et al., J. Org. Chem. 2004, 69, 1720-1722.To a solution of 1-bromo-4-chlorobutane 11 (25g, 146 mmol, 1 equiv.) in 250 mL of DMF was added sodium azide (9.5g, 146 mmol, 1 equiv.). After stirring (20 h) at room temperature, the reaction mixture was poured into 1000 mL of water and extracted three times with Et20 (200 mL). The combined organic layers were washed twice with water (100 mL), once with brine (100 mL), dried over Na2S04, filtered and evaporated to dryness. The residue was dissolved in acetone (300 mL) in a 500 mL round bottom flask and sodium iodide (43.8 g, 292 mmol, 2 equiv.) was added. The reaction mixture was stirred for 48 h at reflux, cooled to room temperature, poured into 1000 mL of water and extracted three times with Et20 (200 mL). The combined organic layers were dried over Na2SC>4, filtered and evaporated to dryness to give 1-Azido-4-iodobutane 12 as a slightly yellow oil (27.7g, 123 mmol, 84% yield). 1H-NMR (400 MHz, CDCI3) δ=3.33 (t, J=6.7 Hz, 2H), 3.21 (t, J=6.8 Hz, 2H), 1.95-1 .88 (m, 2H), 1.75-1 .68 (m, 2H). 13C-NMR (100 MHz, DMSO-d6) δ=50.30, 30.42, 29.69, 5.61 .
2,3.3-Trimethyl-1-(4-azidobutyl)-3/-/-indolium 13 To a 5 mL round bottom flask was added 2,3,3-trimethylindolenine 14 (1 g, 6.3 mmol, 1 equiv.) and 1-azido-4-iodobutane 12 (1.55g, 6.9 mmol, 1.1 equiv.). The reaction mixture was stirred at 120 °C for 4 h, cooled to room temperature and was directly purified on silica gel flash chromatography with a gradient 1% to 5% MeOH in dichloromethane to afford 2,3,3-Trimethyl-1 -(4-azidobutyl)-3H-indolium 13 as a dark oil (720 mg, 2.8 mmol, 45%). 1H-NMR (400 MHz, CDCI3) 5=7.70-7.66 (m, 1 H), 7.46-7.38 (m, 3H), 4.52 (t, J=7.5 Hz, 2H), 3.27 (t, J=6.5 Hz, 2H), 2.95 (s, 3H), 1.91 (quin, J=7.9 Hz, 2H), 1.65 (quin, J=7.5 Hz, 2H), 1.45 (s, 6H). 13C-NMR (100 MHz, CDCI3)
5=195.35, 140.85, 140.09, 129.54, 128.92, 122.83, 1 15.00, 54.06, 49.91 , 48.49, 25.38, 24.74, 22.51 , 16.45. ESI-MS: positive mode 257.00 ([M+H]+). Calc: 256.17.
2,3.3-Trimethyl-1 -(4-sulfonatobuMV3H-indolium 15 (54136-26-4) was prepared following the procedure of Kvach et al. , Russ. Chem. Bull. 2006, 55, 159-163. To a 25 mL round bottom flash was added successively 2,3,3-trimethylindolenine 14 (3.97g, 25 mmol, 1 equiv.) and ,4-butanesulfone (3.47 g, 25.5 mmol, 1.02 equiv.). The reaction mixture was heated to 120 °C for 4 h until the reaction solidified. The solid was triturated with ether (20 mL), filtered and washed three times with acetone (10 mL) to give 2,3,3-Trimethyl-1-(4-sulfonatobutyl)- 3H-indolium 15 as a reddish solid (6.5 g, 22 mmol, 88%). 1 H-NMR (400 MHz, CDCI3) δ=7.83-7.81 (m, 1 H), 7.51 -7.48 (m, 3H), 4.70 (t, J=7.9 Hz, 2H), 2.97 (s, 3H), 2.82 (t, J=7.9 Hz, 2H), 2.1 1 (quin, J=7.5 Hz, 2H), 1.95 (quin, J=7.0 Hz, 2H), 1.54 (s, 6H). 3C-NMR (100 MHz, CDCI3) δ=196.20, 141.48, 141.1 1 , 129.66, 129.46, 122.87, 1 15.74, 54.34, 49.85, 48.32, 26.35, 22.87, 22.70, 22.34, 14.63. ESI-MS: positive mode 295.98 ([M+H]+). Calc: 295.12.
2- r2-(Acetylphenylamino)ethenyll-3.3-dimethyl-1 -(4-sulfobutylV3H-indolium 16 (876746-16- 6) To a stirred solution of compound 15 (1g, 3.39 mmol, 1 equiv.) in acetic anhydride (15 mL) was added Λ/,/V-diphenylformamidine (797 mg, 4.1 mmol, 1.2 equiv.). After 30 min stirring at 120 °C, the reaction mixture was evaporated to dryness and dissolved in dichloromethane (5 mL). Ether (100 mL) was added and the resulting gum was filtered. The gum was dissolved in dichloromethane (5 mL) and precipitated by addition of ether (100 mL) affording hemicyanine 16 (1.24g, 2.8 mmol, 83% yield) as a brown solid, which was directly used in the following reaction without further purification. 2-r341.3-Dihvdro-3.3-dimethyl-1^
dimethyl-1-(4-azidobutyl)-3/- -lndolium 1 (Cv3 azide) To solution of hemicyanine 16 (171.8 mg, 0.39 mmol, 1 equiv.) and compound X (100mg, 0.39 mmol, 1 equiv.) in EtOH (10 mL) was added triethylamine (0.15 mL, 1.16 mmol, 3 equiv.). The reaction mixture was refluxed for 30 min, cooled to room temperature and evaporated to dryness. The residue was purified by flash chromatography with a gradient 5% to 8% MeOH in dichloromethane to afford Cy3 azide 1 (148 mg, 0.26 mmol, 68% yield) as a purple solid. 1H-NMR (400 MHz, CDCI3) δ=8.38 (t, J=13.4 Hz, 2H), 7.40-7.32 (m, 5H), 7.24-7.19 (m, 2H), 7.15-7.07 (m, 3H), 4.32-4.23 (m, 4H), 3.46 (t, J=5.5 Hz, 2H), 3.05 (t, J=7.4 Hz, 2H), 2.21 (quin, J=6.8 Hz, 2H), 2.00 (quin, =7.6 Hz, 2H), 1.95-1.91 (m, 4H), 1.69 (d, J=3.2Hz, 12H). 3C-NMR (100 MHz, CDCI3) δ=173.80, 173.26, 151.10, 142.15, 142.03, 140.71 , 140.60, 128.85, 128.75, 125.10, 124.84, 121.97, 121.89, 1 11.04, 110.59, 105.62, 104.73, 51.28, 51.00, 48.78, 48.67, 44.50, 43.85, 28.15, 28.04, 26.38, 25.92, 24.79, 22.82. ESI-HRMS calculated for C31 H40 N5 03 S positive mode ([M+H]+) 562.2849. Calc.: 562.2846.
Preparation of BHQ-1 azide
Figure imgf000022_0001
N-(2-azidoethv0-N-ethylaniline 18 To a solution of 2-(N-ethylanilino)ethanol 17 (4.9 mL, 30.2 mmol) in Et20 (250 mL) at 0 °C was added triethylamine (4.6 mL, 33.3 mmol, 1.1 equiv.) followed by a slow addition of methane sulfonyl chloride (2.6 mL, 33.3 mmol, 1.1 equiv.). After 1 h stirring at room temperature, the white precipitate was filtered and washed with Et20. The filtrate was concentrated to an oil and dissolved in 100 mL of DMSO.
Sodium azide (3.9 g, 60.5 mmol, 2 equiv.) was added and the mixture was stirred at 80 °C for 3h. The reaction mixture was cooled to room temperature, diluted with water (400 mL) and extracted three times with 100 mL of Et20. The combined organic layer was washed with brine (100 mL), dried over Na2S04, filtered and evaporated to dryness to afford N-(2- azidoethyl)-N-ethylaniline 18 as a colorless oil (5.6 g, 29.5 mmol, 98% yield). 1H-NMR (400 MHz, CDCI3) δ=7.34 (t, J=7.8 Hz, 2H), 6.84-6.81 (m, 3H), 3.59-3.49 (m, 6H), 1.27 (t, J=7.1 Hz, 3H). 13C-NMR (100 MHz, CDCI3) δ=147.05, 129.25, 116.46, 112.14, 49.43, 48.81 , 45.33, 12.01. ESI-MS: positive mode 190.72 ([M+H]+). Calc: 190.12.
BHQ-1 azide 2 To a solution of Fast Corinth salt zinc chloride double salt (500 mg, 1 mmol, 1 equiv.) in DMF (100 mL) was added dropwise a solution of N-(2-azidoethyl)-N-ethylaniline 18 (209 mg, 1.1 mmol, 1.1 equiv.) in DMF (100 mL). The reaction mixture was stirred for 3h at room temperature and evaporated to dryness. The residue was dissolved in CH2CI2 (200 mL) and washed once with 0.5 M HCI (80 mL) and once with brine (80 mL). The organic layer was dried over Na2S04, filtered and evaporated to dryness. The residue was purified by flash column chromatography with a gradient 5 to 25% of EtOAc in hexanes to give BHQ-1 azide 3 as a dark solid (205 mg, 0.41 mmol, 42% yield). 1H-NMR (400 MHz, CDCI3) 5=7.92 (d, J=9.1 Hz, 2H), 7.69 (s, 1H), 7.66 (d, J=7.7 Hz, 1 H), 7.57 (s, 1 H), 7.45 (dd, J=8.2, 1.0 Hz, 1H), 7.39 (s, 1 H), 6.76 (d, J=9.2 Hz, 2H), 4.02 (s, 3H), 3.61-3.58 (m, 2H), 3.56-3.51 (m, 4H), 2.70 (s, 3H), 2.49 (m, 3H), 1.24 (t, J=7.1 Hz, 3H). 13C-NMR (100 MHz, CDCI3)
5=154.80, 151.05, 149.98, 147.41 , 145.18, 144.80, 143.35, 141.55, 133.43, 132.90, 125.89, 124.24, 118.99, 1 18.92, 1 11.42, 99.36, 56.26, 49.51 , 48.93, 45.80, 21.22, 16.67, 12.26. ESI-HRMS calculated for C25 H28 N9 03 positive mode ([M+H]+) 502.2311. Calc:
502.2310.
Oligoribonucleotide synthesis: Oligoribonucleotides were synthesized with regular 2'-0- TBDMS-phosphoramidites on a 50 nmol scale using 5 mg of CPG (1000A). For 2'-0- propargyl cytidine phosphoramidite, the coupling time was prolonged to 3 x 4 min. After synthesis, the CPG with the alkynyl-modified RNA was suspended in 300 pL of H20/MeOH (1 :1) in an Eppendorf tube. Subsequently, DMF (40 pL) and a freshly-prepared solution of the azide (20 equiv., 1 pmol in 20 pL of DMF), TBTA (10 equiv., 500 nmol, 0.27 mg in 20 pL of DMF), Na-ascorbate (10 equivalents, 500 nmol, 10 pL of a solution containing 10 mg in 1 mL of H20) and CuS04.5H20 (1 equiv., 50 nmol, 10 pL of a solution containing 12.5 mg in 10 mL of H20) were added to the suspension, in this order. All solutions were prepared as stock solutions directly prior use. The reaction mixture was shaken for 16 h at 45 °C in an Eppendorf shaker. CPG was filtered, washed three times with 0.5 mL of DMF, 0.1N aqueous EDTA, DMF, MeCN and CHCI3. CPG was transferred into an Eppendorf tube and treated with 200 pL of ammonia (25% in H20) and 200 pL of methylamine (40 % in H20) solutions for 5 h at room temperature. After filtration, the remaining RNA was washed from the solid support with 3 x 100 pL H20/EtOH (1 :1 ). To the solution was added 20 pL of 1 N Tris-base and it was evaporated to dryness in a SpeedVac. Desilylation was carried out by treatment with 130 pL of a mixture of NMP (60 pL), TEA (30 pL) and TEA.3HF (40 pL) at 70 °C for 90 min. The reaction was quenched with trimethylethoxysilane (160 pL) for 20 min at room temperature on an Eppendorf shaker. Diethylether (1 mL) was added, the mixture was vortexed and centrifuged at 4 °C for 2 min. The supernatant was taken off and the precipitate was washed twice with 1 mL diethylether, vortexed and centrifuged. The oligonucleotide was dissolved in 200 pL of water and purified DMT-on by RP-HPLC. The isolated product was dried in a SpeedVac, treated for 1 h with 40 % aq. acetic acid at room temperature, dried in a SpeedVac, dissolved in 200 pL of water and purified DMT-off by RP- HPLC. (Double amount of azides is used for the homo bis-labelling of RNA hairpin; for poorly water soluble azides such as BHQ-1 , the volume of DMF was increased to 100 μΙ_ and was mixed with 240 μΙ_ of a 1 :1 mixture of hbO/MeOH before addition of the reagents
Example 3: FRET
Materials
FRET measurements were acquired on a QuantaMaster 50 (PMI Photon Technology International) in a 500μΙ_ Precision cell made of Quartz SUPRASIL (115F-QS, 10x2 mm, Hellma) cuvette.
Solutions
EGFP-C2-Lin28b containing lysate was diluted with working buffer (25mM Hepes, 300mM NaCI, 0.01 mM ZnCI2, 1% Topbiock, 0.05% Tween and 0.5 mM TCEP) to a concentration of approximately 2 nM.
Dry cy3 or BHQ-1 labeled truncated pre-let-7a-2 (SEQ ID: NO 2: nucleotides 10 to 57) was diluted with Millipore water to a concentration of 20μΜ.
Protocol
Measurements were acquired without and with various concentrations of labeled pre-let-7a- 2 of 0.313nM, 1.25nM, 5nM, 20nM and 80nM. Solutions were incubated for 30 min and their fluorescence spectra were acquired between 475-600 nm after excitation of the sample at 465 nm. The Forster Resonance Energy Transfer was calculated based on the difference of the EGFP emission signal intensity (at 507nm) between the solution containing only the GFP-tagged Iin28 and the solutions containing GFP-tagged Iin28 and various concentrations of labeled pre-let-7a-2. For Cy3-based FRET measurements a background signal of Cy3 was subtracted to get rid of the bleach through. Measurements shown represent at least biological duplicates.
3.1 Fret measurements
3.1.1 Measurements with cv3-labeled truncated pre-let-7a-2
The results of the FRET measurements with mono- and bis-cy3-labeled truncated pre-let- 7a-2 are shown in Figs. 1 to 7
3.1.2 Measurements with BHQ-1-labeled truncated pre-let-7a-2
The results of the FRET measurements with mono- and bis-BHQ-1 -labeled truncated pre- let-7a-2 are shown in Figs. 8 to 13. Table 1 Preferred polypeptides interacting with nucleotides (RBPs, ribonucleotide-binding polypeptides)
Figure imgf000025_0001
SART3 squamous cell carcinoma antigen recognized by T cells 3 [Source:H6NC Symbol;Acc:16860]
MKRN2 makorin ring finger protein 2 [Source:HGNC Symbol;Acc:7113]
RBM7 RNA binding motif protein 7 [Source:HGNC Symbol;Acc:9904]
RBMS2 RNA binding motif, single stranded interacting protein 2 [Source:HGNC Symbol;Acc:9909]
MBNL3 muscleblind-like 3 (Drosophila) [Source:HGNC Symbol;Acc:20564]
DG D diacylglycerol kinase, delta 130kDa [Source:HGNC Symbol;Acc:2851]
SNRPA small nuclear ribonucleoprotein polypeptide A [Source:HGNC Symbol;Acc:11151]
SYNJ2 synaptojanin 2 [Source:HGNC Symbol;Acc:11504]
Fox-1 homolog A (Ataxin-2-binding protein l)(Hexaribonucleotide-binding protein 1)
A2BP1
[Swiss-Prot;Acc:Q9NWBl]
Trinucleotide repeat-containing gene 6C protein [Source:UniProt B/Swiss-Prot;Acc:Q9HCI0]
TP73 tumor protein p73 [Source:HGNC Symbol;Acc: 12003]
DDX43 DEAD (Asp-Glu-Ala-Asp) box polypeptide 43 [Source:HGNC Symbol;Acc:18677]
EPHA6 EPH receptor A6 [Source:HGNC Symbol;Acc: 19296]
KIAA0020 KIAA0020 [Source:HGNC Symbol;Acc:29676]
CNOT4 CCR4-NOT transcription complex, subunit 4 [Source:HGNC Symbol;Acc:7880]
YTHDC1 YTH domain containing 1 [Source:HGNC Symbol;Acc:30626]
PPIE peptidylprolyl isomerase E (cyclophilin E) [Source:HGNC Symbol;Acc:9258]
DDHD2 DDHD domain containing 2 [Source:HGNC Symbol;Acc:29106]
CHERP calcium homeostasis endoplasmic reticulum protein [Source:HGNC Symbol;Acc: 16930]
RBM22 RNA binding motif protein 22 [Source:HGNC Symbol;Acc:25503]
KHSRP H-type splicing regulatory protein [Source:HGNC Symbol;Acc:6316]
FUS fused in sarcoma [Source:HGNC Symbol;Acc:4010]
RBM41 RNA binding motif protein 41 [Source:HGNC Symbol;Acc:25617]
PCBP4 poly(rC) binding protein 4 [Source:HGNC Symbol;Acc:8652]
PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) [Source:HGNC Symbol;Acc:8557]
TNRC6A trinucleotide repeat containing 6A [Source:HGNC Symbol;Acc:11969]
RBM27 RNA binding motif protein 27 [Source:HGNC Symbol;Acc:29243]
Mitogen-activated protein kinase kinase kinase MLT (EC 2.7.11.25)(MLK-like mitogen-activated protein triple kinase)(Sterile alpha motif- and leucine zipper-containing kinase AZK)(Leucine zipper- and sterile alpha motif- containing kinase)( Mixed linea /.../ase-related kinase)(MLK-related kinase)(MRK)(Cervical cancer suppressor gene 4 protein)(HCCS-4) [Source:UniProtKB/Swiss-Prot;Acc:Q9NYL2]
HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) [Source:HGNC Symbol;Acc:5035]
DAZL deleted in azoospermia-like [Source:HGNC Symbol;Acc:2685]
HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) [Source:HGNC Symbol;Acc:5043]
SETD1A SET domain containing 1A [Source:HGNC Symbol;Acc:29010]
CIRBP cold inducible RNA binding protein [Source:HGNC Symbol;Acc:1982]
HNRNPM heterogeneous nuclear ribonucleoprotein M [Source:HGNC Symbol;Acc:5046]
SHANK3 SH3 and multiple ankyrin repeat domains 3 [Source:HGNC Symbol;Acc: 14294]
TRMT2A TRM2 tRNA methyltransferase 2 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:24974]
SF3A1 splicing factor 3a, subunit 1, 120kDa [Source:HGNC Symbol;Acc:10765]
SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 18kDa [Source:HGNC Symbol;Acc: 11160]
P0LDIP3 polymerase (DNA-directed), delta interacting protein 3 [SourceiHGNC Symbol;Acc:23782]
ZMAT5 zinc finger, matrin type 5 [Source:HGNC Symbol;Acc:28046]
FOXl RNA binding motif protein 9 [SourceiHGNC Symbol;Acc:9906]
ZC3H7B zinc finger CCCH-type containing 7B [SourceiHGNC Symbol;Acc:30869]
RBM23 RNA binding motif protein 23 [Source:HGNC Symbol;Acc:20155]
C14orfl74 SAM domain-containing protein C14orf 174 [Source:UniProt B/Swiss-Prot;Acc:Q9PlV8] SFRS5 splicing factor, arginine/serine-rich 5 [Source:HGNC Symbol;Acc:10787J
ZC3H14 zinc finger CCCH-type containing 14 [Source:HGNC Symbol;Acc:20509]
ACINI apoptotic chromatin condensation inducer 1 [Source:HGNC Symbol;Acc: 17066]
PABPN1 poly(A) binding protein, nuclear 1 [Source:HGNC Symbol;Acc:8565]
PABPC1L poly(A) binding protein, cytoplasmic 1-like [Source:HGNC Symbol;Acc: 15797]
SA HD1 SAM domain and HD domain 1 [Source:HGNC Symbol;Acc:15925]
BRUN0L4 bruno-like 4, RNA binding protein (Drosophila) [Source:HGNC Symbol;Acc: 14015]
CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Source:HGNC Symbol;Acc:2484]
ZC3H12B zinc finger CCCH-type containing 12B [Source:HGNC Symbol;Acc:17407]
FMR1 fragile X mental retardation 1 [SourceiHGNC Symbol;Acc:3775]
SC L2 sex comb on midleg-like 2 (Drosophila) [Source:HGNC Symbol;Acc:10581]
HTATSF1 HIV-1 Tat specific factor 1 [Source:HGNC Symbol;Acc:5276]
RBM3 RNA binding motif (RNP1, RRM) protein 3 [Source:HGNC Symbol;Acc:9900]
DGKH diacylglycerol kinase, eta [Source:HGNC Symbol;Acc:2854]
ESRP2 epithelial splicing regulatory protein 2 [SourceiHGNC Symbol;Acc:26152]
MTHFSD methenyltetrahydrofolate synthetase domain containing [Source:HGNC Symbol;Acc:25778]
BFAR Afunctional apoptosis regulator [Source:HGNC Symbol;Acc:17613]
DNAJC17 DnaJ (Hsp40) homolog, subfamily C, member 17 [Source:HGNC Symbol;Acc:25556]
MYEF2 myelin expression factor 2 [Source:HGNC Symbol;Acc:17940]
ESRP1 epithelial splicing regulatory protein 1 [Source:HGNC Symbol;Acc:25966]
HNRNPL heterogeneous nuclear ribonucleoprotein L [Source:HGNC Symbol;Acc:5045]
SNRNP70 small nuclear ribonucleoprotein 70kDa (Ul) [Source:HGNC Symbol;Acc:11150]
SFRS16 splicing factor, arginine/serine-rich 16 [Source:HGNC Symbol;Acc:17731]
TRMT1 TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:25980]
N0VA2 neuro-oncological ventral antigen 2 [Source:HGNC Symbol;Acc:7887]
SF4 splicing factor 4 [Source:HGNC Symbol;Acc:18643]
ZC3HAV1 zinc finger CCCH-type, antiviral 1 [Source:HGNC Symbol;Acc:23721]
EPHB6 EPH receptor B6 [Source:HGNC Symbol;Acc:3396]
EIF3B eukaryotic translation initiation factor 3, subunit B [Source:HGNC Symbol;Acc:3280]
RBM28 RNA binding motif protein 28 [SourceiHGNC Symbol;Acc:21863]
LSM5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:17162]
EIF4H eukaryotic translation initiation factor 4H [Source:HGNC Symbol;Acc: 12741]
ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) [Source:HGNC Symbol;Acc:3313]
FUBP3 far upstream element (FUSE) binding protein 3 [Source:HGNC Symbol;Acc:4005]
SEC23IP SEC23 interacting protein [Source:HGNC Symbol;Acc:17018]
TNKS2 tankyrase, TRFl-interacting ankyrin-related ADP-ribose polymerase 2 [Source:HGNC Symbol;Acc:15677]
CPEB3 cytoplasmic polyadenylation element binding protein 3 [Source:HGNC Symbol;Acc:21746]
LARP4B La ribonucleoprotein domain family, member 4B [Source:HGNC Symbol;Acc:28987]
SUPT6H suppressor of Ty 6 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:11470]
STIM2 stromal interaction molecule 2 [Source:HGNC Symbol;Acc:19205]
PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha |Source:HGNC Symbol;Acc:9237]
PPFIBP1 PTPRF interacting protein, binding protein 1 (liprin beta 1) [Source:HGNC Symbol;Acc:9249]
MIR1279 microRNA 1279 [Source:HGNC Symbol;Acc:35357]
CPSF6 microRNA 1279 [SourceiHGNC Symbol;Acc:35357]
KRR1 RR1, small subunit (SSU) processome component, homolog (yeast) [Source:HGNC Symbol;Acc:5176]
PHC1 polyhomeotic homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3182] SFRS9 splicing factor, arginine/serine-rich 9 [Source:HGNC Symbol;Acc:10791]
SASH1 SAM and SH3 domain containing 1 [Source:HGNC Symbol;Acc:19182]
SFRS3 splicing factor, arginine/serine-rich 3 [Source:HGNC Symbol;Acc:10785]
RBM24 RNA binding motif protein 24 [Source:HGNC Symbol;Acc:21539]
HDRBS2 KH domain containing, RNA binding, signal transduction associated 2 [Source:HGNC Symbol;Acc:18114]
QKI quaking homolog, KH domain RNA binding (mouse) [Source :HGNC Symbol;Acc:21100]
CPEB4 cytoplasmic polyadenylation element binding protein 4 [Source:HGNC Symbol;Acc:21747]
FXR1 fragile X mental retardation, autosomal homolog 1 [Source:HGNC Symbol;Acc:4023]
NCBP2 nuclear cap binding protein subunit 2, 20kOa [Source:HGNC Symbol;Acc:7659]
NCL nucleolin [Source:HGNC Symbol;Acc:7667]
Pre-mRNA branch site protein pl4 (SF3B 14 kDa subunit) [Source:UniProtKB/Swiss-Prot;Acc:Q9Y3B4]
HDLBP high density lipoprotein binding protein [Source:HGNC Symbol;Acc:4857]
SFRS7 splicing factor, arginine/serine-rich 7, 35kOa [Source:HGNC Symbol;Acc:10789]
PN01 partner of NOB1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:32790]
TIA1 TIA1 cytotoxic granule-associated RNA binding protein [Source:HGNC Symbol;Acc: 11802]
EPHA4 EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
SFRS4 splicing factor, arginine/serine-rich 4 [Source:HGNC Symbol;Acc:10786]
SFPQ splicing factor proline/glutamine-rich (polypyrimidine tract binding protein associated)
[Source:HGNC;Acc:10774]
SFRS11 splicing factor, arginine/serine-rich 11 [Source:HGNC Symbol;Acc: 10782]
PRPF3 PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17348]
PTBP2 polypyrimidine tract binding protein 2 [Source:HGNC Symbol;Acc: 17662]
ROD1 RODl regulator of differentiation 1 (S. pombe) [Source:HGNC Symbol;Acc: 10253]
RBM18 RNA binding motif protein 18 [Source:HGNC Symbol;Acc:28413]
SRA stem-loop-interacting RNA-binding protein, mitochondrial Precursor [Source:UniProtKB/Swiss-Prot; C14orfl56
Acc:Q9GZT3]
RBM25 RNA binding motif protein 25 [Source:HGNC Symbol;Acc:23244]
ARAP3 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:24097]
ENOX1 ecto-NOX disulfide-thiol exchanger 1 [Source:HGNC Symbol;Acc:25474]
TARDBP TAR DNA binding protein [Source:HGNC Symbol;Acc: 11571]
AKAP1 A kinase (PRKA) anchor protein 1 [Source:HGNC Symbol;Acc:367]
PSPC1 paraspeckle component 1 [Source :HGNC Symbol;Acc:20320]
ZCCHC17 zinc finger, CCHC domain containing 17 [Source:HGNC Symbol;Acc:30246]
KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 [Source:HGNC Symbol;Acc:18116]
SASH 3 SAM and SH3 domain containing 3 [Source:HGNC Symbol;Acc:15975]
ZC3H7A zinc finger CCCH-type containing 7A [Source:HGNC Symbol;Acc:30959]
HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 [Source:HGNC Symbol;Acc:5033]
BICC1 bicaudal C homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19351]
RBM19 RNA binding motif protein 19 [Source:HGNC Symbol;Acc:29098]
ZC3H13 zinc finger CCCH-type containing 13 [Source:HGNC Symbol;Acc:20368]
SFRS6 splicing factor, arginine/serine-rich 6 [Source:HGNC Symbol;Acc:10788]
RNF113A ring finger protein 113A [Source:HGNC Symbol;Acc:12974]
S RPD2 small nuclear ribonucleoprotein D2 polypeptide 16.5kDa [Source:HGNC Symbol;Acc:11159]
SNRPB small nuclear ribonucleoprotein polypeptides B and Bl [SourceiHGNC Symbol;Acc:11153]
SNRPB2 small nuclear ribonucleoprotein polypeptide B" [Source :HGNC Symbol;Acc:11155]
HNRNPR heterogeneous nuclear ribonucleoprotein R [SourceiHGNC Symbol;Acc:5047]
RALY RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) [HGNC;
Acc:15921] RNA binding motif protein 42 [Source:HGNC Symbol;Acc:28117)
RBM42
heterogeneous nuclear ribonucleoprotein H2 (Η') [Source:HGNC Symbol;Acc:5042]
HNRNPH2
zinc finger protein 36, C3H type, homolog (mouse) [Source:HGNC Symbol;Acc: 12862] ZFP36
N(alpha)-acetyltransferase 38, NatC auxiliary subunit [SourcerHGNC Symbol;Acc:20471] NAA38
small nuclear ribonucleoprotein polypeptide N [Source:HGNC Symbol;Acc: 11164]
SNRPN
fragile X mental retardation, autosomal homolog 2 [Source:HGNC Symbol;Acc:4024] FXR2
scaffold attachment factor B2 [Source:HGNC Symbol;Acc:21605]
SAFB2
LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:20470] LSM7
l_SM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:17259] LSM4
sterile alpha motif domain containing 10 [Source:HGNC Symbol;Acc:16129]
SAMD10
zinc finger CCCH-type containing 4 [Source:HGNC Symbol;Acc:17808]
ZC3H4
eukaryotic translation initiation factor 3, subunit G [Source:HGNC Symbol;Acc:3274] EIF3G
small nucleolar RNA, H/ACA box 56 [Source:HGNC Symbol;Acc:32650]
SNORA56
small nucleolar RNA, H/ACA box 56 [Source:HGNC Symbol;Acc:32650]
DKC1
peptidylprolyl isomerase (cyclophilin)-like 4 [Source:HGNC Symbol;Acc:15702]
PPIL4
RNA binding motif protein 39 [Source:HGNC Symbol;Acc:15923]
RBM39
raftlin, lipid raft linker 1 [Source:HGNC Symbol;Acc:30278]
RF Nl
ankyrin repeat and KH domain containing 1 [Source:HGNC Symbol;Acc:24714]
ANKHD1-EIF4E] Bl
ankyrin repeat and KH domain containing 1 [Source:HGNC Symbol;Acc:24714]
AN HD1
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), PPFIA1 alpha 1 [HGNC Symbol;Acc:9245]
KH domain containing, RNA binding, signal transduction associated 3 [Source:HGNC Symbol;Acc: 18117]
KHDRBS3
RNA binding motif protein 8A [Source:HGNC Symbol;Acc:9905]
RBM8A
lin-28 homolog (C elegans) [Source:HGNC Symbol;Acc:15986]
LIN 28
G-rich RNA sequence binding factor 1 [Source:HGNC Symbol;Acc:4610]
GRSF1
ankyrin repeat domain 17 [Source:HGNC Symbol;Acc:23575]
ANKRD17
unkempt homolog (Drosophila) [Source:HGNC Symbol;Acc:29369]
UNK
nuclear import 7 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24328]
NIP7
target of EGR1, member 1 (nuclear) [Source:HGNC Symbol;Acc:15954]
TOEl
RNA binding motif protein 38 [Source:HGNC Symbol;Acc:15818]
RBM38
EPH receptor B2 [Source:HGNC Symbol;Acc:3393]
EPHB2
serine/arginine repetitive matrix 1 [Source:HGNC Symbol;Acc:16638]
SRRM1
makorin ring finger protein 1 [Source:HGNC Symbol;Acc:7112]
MKRN1
eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa [Source:HGNC Symbol;Acc:3265] EIF2S1
THUMP domain containing 3 [Source:HGNC Symbol;Acc:24493]
THU PD3
RNA binding motif protein, X-linked 2 [Source:HGNC Symbol;Acc:24282]
RBMX2
pumilio homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:14957]
PUM1
polyhomeotic homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3183]
PHC2
musashi homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:7330]
MSI1
synaptotagmin binding, cytoplasmic RNA interacting protein [Source:HGNC Symbol;Acc:16918] SYNCRIP
EPH receptor A7 [Source:HGNC Symbol;Acc:3390]
EPHA7
zinc finger CCCH-type containing 10 [Source:HGNC Symbol;Acc:25893]
ZC3H10
heterogeneous nuclear ribonucleoprotein Al [Source:HGNC Symbol;Acc:5031]
HNRNPA1
ring finger and CCCH-type zinc finger domains 1 [Source:HGNC Symbol;Acc:29434]
RC3H1
insulin-like growth factor 2 mRNA binding protein 3 [Source:HGNC Symbol;Acc:28868] IGF2BP3
nucleoporin like 2 [Source:HGNC Symbol;Acc:17010]
NUPL2
splicing factor, arginine/serine-rich 1 [Source:HGNC Symbol;Acc:10780] SFRS1 transformer 2 beta homolog (Drosophila) [Source:HGNC Symbol;Acc: 10781]
TRA2B cytoplasmic polyadenylation element binding protein 2 [Source:HGNC Symbol;Acc:21745]
CPEB2 alkB, alkylation repair homolog 8 (E. coli) [Source:HGNC Symbol;Acc:25189]
ALKBH8 SAFB-like, transcription modulator [Source:HGNC Symbol;Acc:20709]
SLTM polyribonucleotide nucleotidyltransferase 1 [Source:HGNC Symbol;Acc:23166]
PNPT1 THUMP domain containing 2 [Source:HGNC Symbol;Acc:14890]
THUMPD2 activating signal cointegrator 1 complex subunit 1 [Source:HGNC Symbol;Acc:24268]
ASCC1 Sjogren syndrome antigen B (autoantigen La) [Source:HGNC Symbol;Acc:11316]
SSB heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
[Source:HGNC Symbol;Acc:5036]
HNRNPD
La ribonucleoprotein domain family, member IB [Source:HGNC Symbol;Acc:24704]
LARP1B GTPase activating protein (SH3 domain) binding protein 2 [SourcerHGNC Symbol;Acc:30291]
G3BP2 3'-phosphoadenosine 5'-phosphosulfate synthase 1 [Source:HGNC Symbol;Acc:8603]
PAPSS1 zinc finger CCHC-type and RNA binding motif 1 [Source:HGNC Symbol;Acc:29620]
ZCRB1 protein tyrosine phosphatase, receptortype, f polypeptide (PTPRF), interacting protein (Iiprin), alpha 2
[Source:HGNC Symbol;Acc:9246]
PPFIA2
small nuclear ribonucleoprotein polypeptide F [Source:HGNC Symbol;Acc: 11162]
SNRPF Heterogeneous nuclear ribonucleoprotein Al-like protein 2 (hnRNP core protein Al-like protein 2)
[Source:UniProt B/Swiss-Prot;Acc:Q32P51]
SET domain containing IB [Source:HGNC Symbol;Acc:29187]
SETD1B RNA binding motif protein 26 [Source:HGNC Symbol;Acc:20327]
RBM26 muscleblind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16746]
MBNL2 ring finger protein 113B [Source:HGNC Symbol;Acc:17267]
RNF113B neuro-oncological ventral antigen 1 [Source:HGNC Symbol;Acc:7886]
NOVAl bruno-like 6, RNA binding protein (Drosophila) [Source:HGNC Symbol;Acc:14059]
BRUN0L6 Putative uncharacterized protein ENSP00000269724 Fragment [Source:UniProtKB/T rEMBL;Acc:C9JNJ0] dihydrouridine synthase 3-like (S. cerevisiae) [Source:HGNC Symbol;Acc:26920]
DUS3L EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
EPHA2 connector enhancer of kinase suppressor of Ras 1 [Source:HGNC Symbol;Acc:19700]
CNKSR1 splicing factor 3b, subunit 4, 49kDa [Source:HGNC Symbol;Acc:10771]
SF3B4 ligatin [Source:HGNC Symbol;Acc:6583]
LGTN protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (Iiprin), alpha 4
[SourceiHGNC Symbol;Acc:9248]
PPFIA4
heterogeneous nuclear ribonucleoprotein L-like [Source:HGNC Symbol;Acc:25127]
HNRPLL small nuclear ribonucleoprotein polypeptide G [Source:HGNC Symbol;Acc:11163]
SNRPG zinc finger CCCH-type containing 8 [Source:HGNC Symbol;Acc:30941]
ZC3H8 RNA binding motif, single stranded interacting protein [Source:HGNC Symbol;Acc:13427]
RB S3 EPH receptor A5 [Source:HGNC Symbol;Acc:3389]
EPHA5 GTPase activating protein (SH3 domain) binding protein 1 [Source:HGNC Symbol;Acc:30292]
G3BP1 sex comb on midleg-like 4 (Drosophila) [Source:HGNC Symbol;Acc:21397]
SCML4 EPH receptor Al [Source:HGNC Symbol;Acc:3385]
EPHA1 non-POU domain containing, octamer-binding [Source:HGNC Symbol;Acc:7871]
NONO RNA binding motif protein, X-linked [Source:HGNC Symbol;Acc:9910]
RBMX leucine rich repeat and sterile alpha motif containing 1 [Source:HGNC Symbol;Acc:25135]
LRSAM1 APOBEC1 complementation factor [Source:HGNC Symbol;Acc:24086]
AICF peroxisome proliferator-activated receptor gamma, coactivator-related 1 [Source:HGNC Symbol;Acc:30025]
PPRC1 programmed cell death 11 [Source:HGNC Symbol;Acc:13408]
PDCD11 terminal uridylyl transferase 1, U6 snRNA-specific [Source:HGNC Symbol;Acc:26184] EEF1G terminal uridylyl transferase 1, U6 snRNA-specific [Source:HGNC Symbol;Acc:26184]
TUT1 CUG triplet repeat, RNA binding protein 1 [Source:HGNC Symbol;Acc:2549]
CUGBP1 ribosomal protein S3 [Source:HGNC Symbol;Acc:10420]
RPS3 zinc finger CCCH-type containing 12C [Source:HGNC Symbol;Acc:29362]
ZC3H12C cleavage and polyadenylation specific factor 7, 59kDa [Source:HGNC Symbol;Acc:30098]
CPSF7 YTH domain family, member 1 [Source:HGNC Symbol;Acc: 15867]
YTHDF1 connector enhancer of kinase suppressor of Ras 2 [Source:HGNC Symbol;Acc:19701]
CNKSR2 poly(A) binding protein, cytoplasmic 3 [Source:HGNC Symbol;Acc:8556]
PABPC3 TIA1 cytotoxic granule-associated RNA binding protein-like 1 [Source:HGNC Symbol;Acc:11804]
TIAL1 RNA binding motif protein 46 [Source:HGNC Symbol;Acc:28401]
RBM46 U2AF homology motif (UHM) kinase 1 [Source:HGNC Symbol;Acc:19683]
UHM 1 bol, boule-like (Drosophila) [Source:HGNC Symbol;Acc: 14273]
BOLL zinc finger protein 36, C3H type-like 2 [Source:HGNC Symbol;Acc:1108]
ZFP36L2 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29991]
PAN 3 muscleblind-like (Drosophila) [Source:HGNC Symbol;Acc:6923]
MBNL1 heterogeneous nuclear ribonucleoprotein D-like [Source:HGNC Symbol;Acc:5037]
HNRPDL calcium regulated heat stable protein 1, 24kDa [Source:HGNC Symbol;Acc: 17150]
CARHSP1 RNA binding motif, single stranded interacting protein 1 [Source:HG C Symbol;Acc:9907]
RBMS1 CNKSR family member 3 [Source:HGNC Symbol;Acc:23034]
CNKSR3 splicing factor, arginine/serine-rich 12 [Source:HGNC Symbol;Acc:17882]
SFRS12 musashi homolog 2 (Drosophila) [Source:HGNC Symbol;Acc: 18585]
MSI 2 splicing factor, arginine/serine-rich 13B [Source:HGNC Symbol;Acc:21220]
SFRS13B l(3)mbt-like 4 (Drosophila) [Source:HGNC Symbol;Acc:26677]
L3MBTL4 EPH receptor Bl [Source:HGNC Symbol;Acc:3392]
EPHB1 Probable tRNA (uracil-0(2)-)-methyltransferase (EC 2.1.1. n2) [Source:UniProtKB/Swiss-Prot;Acc:Q8IYL2]
C4orf23 SAM domain, SH3 domain and nuclear localization signals 1 [Source:HGNC Symbol;Acc:10528]
SAMSN1 MKI67 (FHA domain) interacting nucleolar phosphoprotein [Source:HGNC Symbol;Acc:17838]
MKI67IP La ribonucleoprotein domain family, member 1 [Source:HGNC Symbol;Acc:29531]
LARPl RNA binding motif protein 45 [Source:HGNC Symbol;Acc:24468]
RBM45 peroxisome proliferator-activated receptor gamma, coactivator 1 beta [Source:HGNC Symbol;Acc:30022]
PPARGC1B LSM11, U7 small nuclear RNA associated [Source:HGNC Symbol;Acc:30860]
LSM11 splicing factor, arginine/serine-rich 15 [Source:HGNC Symbol;Acc:19304]
SFRS15 sterile alpha motif domain containing 8 [Source:HGNC Symbol;Acc:26320]
SAMD8 RNA binding protein with multiple splicing [Source:HGNC Symbol;Acc:19097]
RBPMS protein phosphatase 1, regulatory (inhibitor) subunit 9A [SourceiHGNC Symbol;Acc:14946]
PPP1R9A zinc finger CCCH-type containing 18 [Source:HGNC Symbol;Acc:25091]
ZC3H18 synaptojanin 1 [Source:HGNC Symbol;Acc:11503]
SYNJ1 insulin-like growth factor 2 mRNA binding protein 1 [Source:HGNC Symbol;Acc:28866]
IGF2BP1 trinucleotide repeat containing 4 [Source:HGNC Symbol;Acc:11967]
TNRC4 U2 small nuclear RNA auxiliary factor 1 [SourcerHGNC Symbol;Acc:12453]
U2AF1 scaffold attachment factor B [SourceiHGNC Symbol;Acc: 10520]
SAFB cleavage and polyadenylation specific factor 4, 30kDa [Source:HGNC Symbol;Acc:2327]
CPSF4 bruno-like 5, RNA binding protein (Drosophila) [Source:HGNC Symbol;Acc:14058]
BRUNOL5 U2 small nuclear RNA auxiliary factor 1-like 4 [Source:HGNC Symbol;Acc:23020]
U2AF1L4 splicing factor, arginine/serine-rich 2 [SourcerHGNC Symbol;Acc:10783]
SFRS2 SH3 and multiple ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:15474] SHANK1 La ribonucleoprotein domain family, member 4 [Source:HGNC Symbol;Acc:24320]
LARP4 ribonucleoprotein, PTB-binding 1 [Source:HGNC Symbol;Acc:30296]
RAVER 1 SH3 and multiple ankyrin repeat domains 2 [Source:HGNC Symbol;Acc:14295]
SHAN 2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) [Source:HGNC Symbol;Acc:3315]
ELAVL4 ribonucleoprotein, PTB-binding 2 [Source:HGNC Symbol;Acc:25577]
RAVER2 far upstream element (FUSE) binding protein 1 [Source:HGNC Symbol;Acc:4004]
FUBP1 RNA binding motif protein 15 [Source:HGNC Symbol;Acc:14959]
RBM15 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 |Source:HGNC Symbol;Acc:20086]
DHX57 tudor domain containing 10 [Source:HGNC Symbol;Acc:25316]
TDRD10 TCDD-inducible poly(ADP-ribose) polymerase (Source:HGNC Symbol;Acc:23696]
TIPARP RNA binding motif protein 47 [Source:HGNC Symbol;Acc:30358]
U2-associated protein SR140 (140 kDa Ser/Arg-rich domain protein) [Source:UniProtKB/Swiss-Prot;
RBM47
Acc:O15042]
SR140
tetratricopeptide repeat domain 14 [Source:HGNC Symbol;Acc:24697]
TTC14 Scm-like with four mbt domains 1 [Source:HGNC Symbol;Acc:20255]
SFMBT1 LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:17017]
LSM6 sterile alpha motif domain containing 3 [Source:HGNC Symbol;Acc:21574]
SAMD3 transformer 2 alpha homolog (Drosophila) [Source:HGNC Symbol;Acc:16645]
TRA2A deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
DLC1 microRNA 7-1 [Source:HGNC Symbol;Acc:31638]
MIR7-1 microRNA 7-1 [Source:HGNC Symbol;Acc:31638]
HNRNPK ankyrin repeat and sterile alpha motif domain containing 6 [Source:HGNC Symbol;Acc:26724]
ANKS6 inositol polyphosphate phosphatase-like 1 [SourceiHGNC Symbol;Acc:6080]
INPPL1 ecto-NOX disulfide-thiol exchanger 2 [Source:HGNC Symbol;Acc:2259]
EN0X2 La ribonucleoprotein domain family, member 6 [Source:HGNC Symbol;Acc:24012]
LARP6 PTPRF interacting protein, binding protein 2 (liprin beta 2) [Source:HGNC Symbol;Acc:9250]
PPFIBP2 KIAA0430 [Source:HGNC Symbol;Acc:29562]
IAA0430 RNA binding protein with multiple splicing 2 [Source:HGNC Symbol;Acc:19098]
RBPMS2 small nuclear ribonucleoprotein Dl polypeptide 16kDa [Source:HGNC Symbol;Acc:11158]
SNRPD1 sterile alpha motif domain containing 14 [Source:HGNC Symbol;Acc:27312]
SAMD14 Fox-1 homolog C [Source:UniProtKB/Swiss-Prot;Acc:A6NFN3]
stromal interaction molecule 1 [Source:HGNC Symbol;Acc: 11386]
STIM1 CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
CASKIN1 polymerase (RNA) II (DNA directed) polypeptide G [Source:HGNC Symbol;Acc:9194]
POLR2G splicing factor 1 [Source:HGNC Symbol;Acc:12950]
SF1 ankyrin repeat and sterile alpha motif domain containing 3 [Source:HGNC Symbol;Acc:29422]
A KS3 heterogeneous nuclear ribonucleoprotein HI (H) [Source:HGNC Symbol;Acc:5041]
HNRNPH1 zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2 [Source:HGNC Symbol;Acc:23019]
ZRSR2 poly(rC) binding protein 1 [Source:HGNC Symbol;Acc:8647]
PCBP1 RNA binding motif protein, Y-linked, family 1, member F [Source:HGNC Symbol;Acc:23974]
RBMY1F heterogeneous nuclear ribonucleoprotein F (Source:HGNC Symbol;Acc:5039]
HNRNPF heterogeneous nuclear ribonucleoprotein A3 [Source:HGNC Symbol;Acc:24941]
HNRNPA3 R A binding motif protein, X-linked-like 2 (Source:HGNC Symbol;Acc:17886]
RBMXL2 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc: 17874)
LSM3 nuclear cap binding protein subunit 2-like [Source:HGNC Symbol;Acc:31795)
NCBP2L cold shock domain containing C2, RNA binding [Source:HGNC Symbol;Acc:30359]
CSDC2 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa [Source:HGNC;Acc:11547] U6 snRNA-associated Sm-like protein LSm2 (snRNP core Sm-like protein Sm-x5)
TAF15
(Small nuclear ribonuclear protein D homolog)( Protein G7b) [Source:UniProt B/Swiss-Prot;Acc:Q9Y333] tankyrase. TRFl-interacting ankyrin-related ADP-ribose polymerase [Source:HGNC Symbol;Acc: 11941]
TNKS polyhomeotic homolog 3 (Drosophila) [Source:HGNC Symbol;Acc: 15682]
PHC3 RNA binding motif protein 4B [Source:HGNC Symbol;Acc:28842]
RBM48 RNA binding motif protein 4 [Source:HGNC Symbol;Acc:9901]
RBM4 La ribonucleoprotein domain family, member 7 [Source:HGNC Symbol;Acc:24912]
LARP7 poly(A) binding protein, cytoplasmic 5 [Source:HGNC Symbol;Acc: 13629]
PABPC5 ankyrin repeat and sterile alpha motif domain containing 4B [Source:HGNC Symbol;Acc:26795]
ANKS4B LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:20472]
LSM1 RNA binding motif protein, X-linked-like 3 [Source:HGNC Symbol;Acc:26859]
RBMXL3 mex-3 homolog C (C. elegans) [Source:HGNC Symbol;Acc:28040]
MEX3C CASK interacting protein 2 [Source:HGNC Symbol;Acc: 18200]
CAS IN2 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
[Acc:9247]
PPFIA3
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
SAMD9L RNA binding motif protein 44 [Source:HGNC Symbol;Acc:24756]
RBM44 sterile alpha motif domain containing 12 [Source:HGNC Symbol;Acc:31750]
SAMD12 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant [Source:HGNC Symbol;Acc:17086]
CSTF2T heterogeneous nuclear ribonucleoprotein AO (Source:HGNC Symbol;Acc:5030]
HNRNPAO zinc finger CCCH-type containing 12D [Source:HGNC Symbol;Acc:21175]
ZC3H12D sterile alpha motif domain containing 4B [Source:HGNC Symbol;Acc:25492]
SAMD4B heterogeneous nuclear ribonucleoprotein C-like 1 [Source:HGNC Symbol;Acc:29295]
HNRNPCL1 makorin ring finger protein 3 [Source:HGNC Symbol;Acc:7114]
MKRN3 RNA binding motif protein 15B [Source:HGNC Symbol;Acc:24303]
RBM15B poly-U binding splicing factor 60KDa [Source:HGNC Symbol;Acc:17042]
PUF60 tRNA selenocysteine 1 associated protein 1 [Source:HGNC Symbol;Acc:30813]
TRNAU1AP splicing factor, arginine/serine-rich 2B [Source:HGNC Symbol;Acc:16988]
SFRS2B mex-3 homolog D (C. elegans) (Source:HGNC Symbol;Acc: 16734]
EX3D LSM10, U7 small nuclear RNA associated [Source :HGNC Symbol;Acc:17562]
LSMIO small nuclear ribonucleoprotein polypeptide E [Source:HGNC Symbol;Acc: 11161]
SNRPE Usher syndrome 1G (autosomal recessive) [Source:HGNC Symbol;Acc:16356]
USH1G tudor and KH domain containing [Source:HGNC Symbol;Acc: 11713]
TDRKH EPH receptor B3 [Source:HGNC Symbol;Acc:3394]
EPHB3 RNA binding motif protein 10 [Source:HGNC Symbol;Acc:9896]
RBM10 leukocyte receptor cluster (LRC) member 9 [Source:HGNC Symbol;Acc:16306]
LENG9 Ewing sarcoma breakpoint region 1 [Source:HGNC Symbol;Acc:3508]
EWSR1 l-SM domain containing 1 [SourceiHGNC Symbol;Acc:28212]
LSMD1 Ephrin type-A receptor 10 Precursor (EC 2.7.10.1) [Source:UniProtKB/Swiss-Prot;Acc:Q5JZY3]
dead end homolog 1 (zebrafish) [Source:HGNC Symbol;Acc:23799]
DND1 mex-3 homolog B (C elegans) [Source:HGNC Symbol;Acc:25297]
MEX3B poly(rC) binding protein 3 [Source:HGNC Symbol;Acc:8651]
PCBP3 THO complex 4 [Source:HGNC Symbol;Acc: 19071]
TH0C4 RNA binding motif protein 12B (Source:HGNC Symbol;Acc:32310]
RBM12B small nuclear ribonucleoprotein 35kDa (U11/U12) (Source:HGNC Symbol;Acc:30852]
SNRNP35 poly(A) binding protein, cytoplasmic 1-like 2B [Source:HGNC Symbol;Acc:31852]
PABPC1L2B RALY RNA binding protein-like [Source:HGNC Symbol;Acc:27036] RALYL DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 (Source:HGNC Symbol;Acc:20083]
DDX53 RNA binding motif protein 33 |Source:HGNC Symbol;Acc:27223]
RBM33 RNA binding motif protein 43 [Source:HGNC Symbol;Acc:24790]
RBM43 ankyrin repeat and sterile alpha motif domain containing IB [Source:HGNC Symbol;Acc:24600]
ANKS1B RNA binding motif protein 11 [Source:HGNC Symbol;Acc:9897]
RBM11 zinc finger protein 36, C3H type-like 1 [Source:HGNC Symbol;Acc:1107]
ZFP36L1 YTH domain family, member 3 [Source:HGNC Symbol;Acc:26465]
YTHDF3 RNA-binding region (RNP1, RRM) containing 3 [Source:HGNC Symbol;Acc:18666]
RNPC3 poly(A) binding protein, cytoplasmic 1-like 2A [Source:HGNC Symbol;Acc:27989]
PABPC1L2A ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 |Source:HGNC Symbol;Acc:16925]
ARAP1 kinesin family member 24 [Source:HGNC Symbol;Acc:19916]
IF24 sterile alpha motif domain containing 7 [Source:HGNC Symbol;Acc:25394]
SAMD7 deleted in azoospermia 3 [Source:HGNC Symbol;Acc:15965]
DAZ3 RAD52 motif 1 [Source:HGNC Symbolic: 19950]
RDM1 sterile alpha motif domain containing 11 [Source:HGNC Symbol;Acc:28706]
SAMD11 lin-28 homolog B (C elegans) [Source:HGNC Symbol;Acc:32207]
LIN28B cleavage and polyadenylation specific factor 4-like [Source:HGNC Symbol;Acc:33632]
CPSF4L deleted in azoospermia 1 [Source:HGNC Symbol;Acc:2682]
DAZ1 zinc finger CCCH-type containing 6 [Source:HGNC Symbol;Acc:24762]
ZC3H6 splicing factor, arginine/serine-rich 13A [Source:HGNC Symbol;Acc:16713]
SFRS13A RNA binding motif protein 34 [Source:HGNC Symbol;Acc:28965]
RBM34 ribosomal RNA processing 7 homolog A (S. cerevisiae) [SourceiHGNC Symbol;Acc:24286]
RRP7A Kazrin [Source:UniProt B/Swiss-Prot;Acc:Q674X7]
WD repeat, sterile alpha motif and U-box domain containing 1 [Source:HGNC Symbol;Acc:26697]
WDSUB1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C) [Source:HGNC Symbol;Acc:3314]
ELAVL3 EPH receptor B4 [Source:HGNC Symbol;Acc:3395]
EPHB4 Pumilio domain-containing protein C14orf21 [Source:UniProt B/Swiss-Prot;Acc:Q86U38]
C14orf21 poly(rC) binding protein 2 [Source:HGNC Symbol;Acc:8648]
PCBP2 zinc finger, CCCH-type with G patch domain [Source:HGNC Symbol;Acc:15948]
ZG AT heterogeneous nuclear ribonucleoprotein A/B [Source:HGNC Symbol;Acc:5034]
HNRNPAB Putative uncharacterized protein ENSP00000371708Putative uncharacterized protein ENSP00000371856
[Source:UniProt B TrEMBL;Acc:A6NM12]
nucleolar protein 8 [Source:HGNC Symbol;Acc:23387]
N0L8
helicase with zinc finger [Source:HGNC Symbol;Acc:16878]
HELZ
YTH domain family, member 2 [Source:HGNC Symbol;Acc:31675]
YTHDF2
3'-phosphoadenosine 5'-phosphosulfate synthase 2 [Source:HGNC Symbol;Acc:8604]
PAPSS2
Scm-like with four mbt domains 2 [Source:HGNC Symbol;Acc:20256]
SFMBT2
l(3)mbt-like 3 (Drosophila) [Source:HGNC Symbol;Acc:23035]
L3MBTL3
sphingomyelin synthase 1 [Source:HGNC Symbol;Acc:29799]
SGMS1
sterile alpha motif domain containing 5 [Source:HGNC Symbol;Acc:21180]
SAMD5
mex-3 homolog A (C elegans) [Source:HGNC Symbol;Acc:33482]
MEX3A
RNA binding motif protein 20 [Source:HGNC Symbol;Acc:27424]
RBM20
developmental pluripotency associated 5 [Source:HGNC Symbol;Acc:19201]
DPPA5
sterile alpha motif domain containing 13 [Source:HGNC Symbol;Acc:24582]
SAMD13 microRNA 1236 [Source:HGNC Symbol;Acc:33925]
U6 snRNA-associated Sm-like protein LSm2 (snRNP core Sm-like protein Sm-x5)(Small nuclear hbonuclear
MIR1236
protein D homolog)(Protein G7b) [Source:UniProt B/Swiss-Prot;Acc:Q9Y333] Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit) (MHC class I region proline-rich protein CAT53)(FB19 protein)(PPl-binding protein of 114 kDa)(p99)
PPP1R10
[Source:UniProtKB/Swiss-Prot;Acc:Q96QCO]
Proline-rich protein 3 (MHC class I region proline-rich protein CAT56) [Source:UniProtKB/Swiss-Prot;
Acc:P79522]
PRR3
poly(A) binding protein, nuclear 1-like (cytoplasmic) [Source:HGNC Symbol;Acc:37237]
PABPN1L sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
SAMD9 RNA binding protein SI, serine-rich domain [Source:HGNC Symbol;Acc: 10080]
RNPS1 deleted in azoospermia 2 [Source:HGNC Symbol;Acc:15964]
DAZ2 heterogeneous nuclear ribonucleoprotein Al pseudogene 4 [Source:HGNC Symbol;Acc:32234]
HNRNPA1P4 microRNA 1236 [Source:HGNC Symbol;Acc:33925]
MIR1236 microRNA 1236 [Source:HGNC Symbol;Acc:33925]
MIR1236 Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit)
(MHC class I region proline-rich protein CAT53)(FB19 protein)(PPl-binding protein of 114 kDa)(p99)
[Source:UniProtKB/Swiss-Prot;Acc:Q96QC0]
proline rich 3 [Source:HGNC Symbol;Acc:21149]
U2 small nuclear ribonucleoprotein auxiliary factor 35 kDa subunit-related protein 1 (U2(RNU2) small
PRR3
nuclear RNA auxiliary factor 1-like 1)(CCCH type zinc finger, RNA-binding motif and serine/arginine
ZRSR1
rich protein 1)
[Source:UniProtKB/Swiss-Prot;Acc:Q15695]
RNA binding motif protein 16 [Source:HGNC Symbol;Acc:20959]
RBM16 Putative uncharacterized protein ENSP00000395989 [Source:UniProtKB TrEMBL;Acc:C9JFH9]
Putative uncharacterized protein ENSP00000415385 Fragment [Source:UniProtKB/T rEMBL;Acc:C9JED4]
RNA binding motif protein, X-linked-like 1 [Source:HGNC Symbol;Acc:25073]
RBMXL1 cytoplasmic polyadenylation element binding protein 1 [Source:HGNC Symbol;Acc:21744]
CPEB1 Putative uncharacterized protein ENSP00000381889 [Source:UniProtKB TrEMBL;Acc:A8MVW9]
Putative uncharacterized protein ENSP00000388079 Fragment [Source:UniProtKB TrEMBL;Acc:C9JXI7]
Putative uncharacterized protein ENSP00000383298 [Source:UniProtKB/TrEMBL;Acc:C9JCD7] Putative uncharacterized protein ENSP00000371708Putative uncharacterized protein ENSP00000371856; [Source:llniProtKB/TrEMBL;Acc:A6NM12]
Splicing factor, arginine/serine-rich 13A (FUS-interacting serine-arginine-rich protein l)(TLS-associated proteirj with Ser-Arg repeats)(TLS-associated protein with SR repeats)(TASR)(TLS-associated serine-arginine protein) (TLS-associated SR protein)( /.../ SR-repressor protein)(SRrp40)(Splicing factor SRp38) (Source:UniProtKB/ Swiss-Prot;Acc:075494]
Proline-rich protein 3 (MHC class I region proline-rich protein CAT56) [Source: Swiss-Prot;Acc:P79522]
Proline-rich protein 3 (MHC class I region proline-rich protein CAT56) [Source: Swiss-Prot;Acc:P79522]
RNA binding motif protein, Y-linked, family 2, member B pseudogene [Source:HGNC Symbol;Acc:9918]
RBMY2BP LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc: 13940)
Putative uncharacterized protein ENSP00000371708Putative uncharacterized protein ENSP00000371856; LSM2 [Source:UniProtKB/TrEMBL;Acc:A6NM12]
U6 snRNA-associated Sm-like protein LSm2 (snRNP core Sm-like protein Sm-x5)(Small nuclear ribonuclear protein D homologK Protein G7b) [Source:UniProtKB/Swiss-Prot;Acc:Q9Y333]
RNA binding motif protein, Y-linked, family 1, member J [Source:HGNC Symbol;Acc:23917]
RBMY1J small nuclear ribonucleoprotein polypeptide E-like l [Source:HGNC Symbol;Acc:20733]
Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit) SNRPEU (MHC class I region proline-rich protein CAT53)(FB19 protein)(PPl-binding protein of 114 kDa)(p99)
[Source:UniProt B/Swiss-Prot;Acc:Q96QC0]
Proline-rich protein 3 (MHC class I region proline-rich protein CAT56) [Source:UniProtKB/Swiss-Prot;
Acc:P79522]
Proline-rich protein 3 (MHC class I region proline-rich protein CAT56) [Source:UniProtKB/Swiss-Prot;
Acc:P79522]
microRNA 1236 [Source:HGNC Symbol;Acc:33925]
Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit)
MIR1236
(MHC class I region proline-rich protein CAT53)(FB19 protein)(PPl-binding protein of 114 kDa)(p99) [Source:UniProtKB/Swiss-Prot;Acc:Q96QC0J
microRNA 1236 [Source:HGNC Symbol;Acc:33925]
MIR1236
Putative uncharacterized protein ENSP00000403004 [Source:UniProtKB TrEMBL;Acc:C9JHJ9]
U6 snRNA-associated Sm-like protein LSm2 (snRNP core Sm-like protein Sm-x5)(Small nuclear ribonuclear protein D homolog)(Protein G7b) [Source:UniProt B/Swiss-Prot;Acc:Q9Y333]
protein phosphatase 1, regulatory (inhibitor) subunit 10 [Source:HGNC Symbol;Acc:9284]
PPP1R10
Putative uncharacterized protein ENSP00000394145 Fragment [Source:UniProtKB/TrEMBL;Acc:C9JK19] malignant T cell amplified sequence 1 [Source:HGNC Symbol;Acc:23357]
MCTS1
poly(A) binding protein, cytoplasmic 4-like [Source:HGNC Symbol;Acc:31955]
PABPC4L Proline-rich protein 3 (MHC class 1 region proline-rich protein CAT56) [Source:UniProtKB/Swiss-Prot;
Acc:P79522]
microRNA 1236 [Source:HGNC Symbol;Acc:33925]
MIR1236 microRNA 1236 [Source:HGNC Symbol;Acc:33925]
RDBP RNA binding motif protein, Y-linked, family 1, member Al [Source:HGNC Symbol;Acc:9912]
RBMY1A1 Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit)
(MHC class 1 region proline-rich protein CAT53)(FB19 protein)(PPl-binding protein of 114 kDa)(p99)
[Sou rce : U ni ProtK B/Swiss-Prot;Acc:Q96QC0]
U6 snRNA-associated Sm-like protein LSm2 (snRNP core Sm-like protein Sm-x5)(Small nuclear ribonuclear protein D homolog)(Protein G7b) [Source:UniProtKB/Swiss-Prot;Acc:Q9Y333]
Serine/threonine-protein phosphatase 1 regulatory subunit 10 (Phosphatase 1 nuclear targeting subunit) (MHC class 1 region proline-rich protein CAT53)(FB19 protein)(PPl-binding protein of 114 kDa)(p99)
[Sou rce : U ni ProtK B/Swiss-Prot;Acc:Q96QC0]
makorin ring finger protein pseudogene 5 [Source:HGNC Symbol ;Acc:7115]
MKRNP5 RNA binding motif protein 14 [Source:HGNC Symbol;Acc:14219]
RBM14 NOP2/Sun domain family, member 6 [Source:HGNC Symbol;Acc:23529]
NSUN6 unkempt homolog (Drosophila)-like [Source:HGNC Symbol;Acc:14184]
UNKL RNA binding motif protein, Y-linked, family 1, member E [Source:HGNC Symbol;Acc:23916]
RBMY1E heterogeneous nuclear ribonucleoprotein Al-like 2 [Source:HGNC Symbol;Acc:27067]
HNRNPA1L2 RNA binding motif protein, Y-linked, family 1, member B [Source:HGNC Symbol;Acc:23914]
RBMY1B RNA binding motif protein, Y-linked, family 1, member D [Source:HGNC Symbol;Acc:23915]
RBMY1D RNA binding motif protein 12 [Source:HGNC Symbol;Acc:9898]
RBM12 deleted in azoospermia 4 [Source:HGNC Symbol;Acc:15966]
DAZ4 diacylglycerol kinase, theta HOkDa [Source:HGNC Symbol;Acc:2856]
DGKQ family with sequence similarity 59, member A [Source:HGNC Symbol;Acc:26136]
FAM59A
AC021231.2 RNA binding motif protein 17 [Source:HGNC Symbol;Acc: 16944]
RBM17
AC026410.4 minichromosome maintenance complex component 3 associated protein [Source:HGNC Symbol;Acc:6946]
MCM3AP poly(A)-specific ribonuclease (deadenylation nuclease) [Source:HGNC Symbol;Acc:8609]
PAR l(3)mbt-like (Drosophila) [Source:HGNC Symbol;Acc: 15905]
L3MBTL polyhomeotic homolog IB (Drosophila) [Source:HGNC Symbol;Acc:34502]
PHC1B family with sequence similarity 59, member B [Source:HGNC Symbol;Acc:27172]
FAM59B toll-like receptor 2 [Source:HGNC Symbol;Acc:11848]
TLR2 poly (ADP-ribose) polymerase family, member 10 [Source:HGNC Symbol;Acc:25895]
PARP10 MovlOll, Moloney leukemia virus 10-like 1, homolog (mouse) [Source:HGNC Symbol;Acc:7201]
OV10L1 cell division cycle and apoptosis regulator 1 [Source:HGNC Symbol;Acc:24236]
CCAR1 LEM domain containing 3 [Source:HGNC Symbol;Acc:28887]
LEMD3 UPF3 regulator of nonsense transcripts homolog B (yeast) [Source:HGNC Symbol;Acc:20439]
UPF3B zinc finger, CCHC domain containing 14 [Source:HGNC Symbol;Acc:24134]
ZCCHC14 CAN2 regulator of calcineurin 2 [Source:HGNC Symbol;Acc:3041]
SRRT serrate RNA effector molecule homolog (Arabidopsis) [SourceiHGNC Symbol;Acc:24101]
ASZ1 ankyrin repeat, SAM and basic leucine zipper domain containing 1 [Source:HGNC Symbol;Acc:1350]
ZC3H12A zinc finger CCCH-type containing 12A [Source:HGNC Symbol;Acc:26259]
ZC3HAV1L zinc finger CCCH-type, antiviral 1-like [Source:HGNC Symbol;Acc:22423]
PAR P 14 poly (ADP-ribose) polymerase family, member 14 (Source:HGNC Symbol;Acc:29232]
TMEM63A transmembrane protein 63A [Source:HGNC Symbol;Acc:29118]
STARD13 StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
GTF3A general transcription factor MIA [Source:HGNC Symbol;Acc:4662]
NUFIP1 nuclear fragile X mental retardation protein interacting protein 1 [Source:HGNC Symbol;Acc:8057]
SRRM2 serine/arginine repetitive matrix 2 [Source:HGNC Symbol;Acc:16639]
APTX aprataxin [Source:HGNC Symbol;Acc: 15984]
ZFR zinc finger RNA binding protein [Source:HGNC Symbol;Acc:17277]
UPF1 UPF1 regulator of nonsense transcripts homolog (yeast) [Source:HGNC Symbol;Acc:9962]
KIN KIN, antigenic determinant of recA protein homolog (mouse) [Source:HGNC Symbol;Acc:6327]
ZNF239 zinc finger protein 239 [Source:HGNC Symbol;Acc:13031]
ZNF74 zinc finger protein 74 [Source:HGNC Symbol;Acc:13144]
SNRPC small nuclear ribonucleoprotein polypeptide C [Source:HGNC Symbol;Acc:11157]
Clorf25 TRMl-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q7Z2T5]
ZFR2 zinc finger RNA binding protein 2 [Source:HGNC Symbol;Acc:29189]
IREB2 iron-responsive element binding protein 2 [Source:HGNC Symbol;Acc:6115]
ACOl aconitase 1, soluble [SourceiHGNC Symbol;Acc:117]
TR0VE2 TROVE domain family, member 2 [Source:HGNC Symbol;Acc:11313]
TEP1 telomerase-associated protein 1 [Source:HGNC Symbol;Acc:11726]
GAPDH glyceraldehyde-3-phosphate dehydrogenase [Source:HGNC Symbol;Acc:4141]
ZRANB2 zinc finger, RAN- binding domain containing 2 [Source:HGNC Symbol;Acc:13058]
SLBP stem-loop binding protein [Source:HGNC Symbol;Acc:10904]
GW182 Trinucleotide repeat-containing gene 6A protein [Source: UniProtKB, Acc: Q8NDV7)
TNRC6B Trinucleotide repeat-containing gene 6B protein [Source: UniProtKB, Acc: Q9UPQ9)
TNRC6C Trinucleotide repeat-containing gene 6C protein [Source: UniProtKB, Acc: Q9HCJ0]
TARBP2 RISC-loading complex subunit TARBP2 [Source: UniProtKB, Acc: Q 15633]
STAR Steroidogenic acute regulatory protein, mitochondrial [Source: UniProtKB, Acc: P49675]
AGOl Protein AGOl [Source: UniProtKB, Acc: Q5TA58]
TRIM1 Probable E3 ubiquitin-protein ligase MID2 [Source: UniProtKB, Acc: Q9UJV3]
FOX1 RNA binding protein fox-1 homolog 1 [Source: UniProtKB, Acc: Q9NWB1]
FOX2 RNA binding protein fox-1 homolog 2 [Source: UniProtKB, Acc: 043251]
FOX3 Polyprotein [Source: UniProtKB, Acc: Q8QNU0]
DGCR8 Microprocessor complex subunit DGCR8 [Source: UniProtKB, Acc: Q8WYQ5]
Dicerl Endoribonuclease Dicer, Helicase with RNase motif [Source: UniProtKB, Acc: Q9UPY3]
Drosha Ribonuclease 3 [Source: UniProtKB, Acc: Q9NRR4]
DDx6 Probable ATP-dependent RNA helicase DDX6 [Source: UniProtKB, Acc: P26196]
DDxl7 Probable ATP-dependent RNA helicase DDX17 [Source: UniProtKB, Acc: Q92841]
MOV10 Putative helicase MOV- 10 [Source: UniProtKB, Acc: Q9HCE1]
DDx20 Probable ATP-dependent RNA helicase DDX20 [Source: UniProtKB, Acc: Q9UHI6]
DDx42 ATP-dependent RNA helicase DDX24 [Source: UniProtKB, Acc: Q9GZR7] Table 2a (preferred miRNAs for practicing the present invention) miRNA designation (e.g. has-let-7a-l), sequence reference (Ml...)
49 MI0000478 hsa-mi r-3 149 MI0014176 50 MI0000479 hsa-mi r-3 150a I0014177 51 a MI0000809 hsa-mi r-3 150b MI0016426 51 b MI0003772 hsa-mi r-3 151 MI0014178 52 MI0000462 hsa-mi r-3 152 MI0014179 53-1 MI0000463 hsa-mi r-3 153 MI0014180 53-2 MI0000464 hsa-mi r-3 154 MI0014182 537 MI0007258 hsa-mi r-3 155a MI0014183 538 MI0007259 hsa-mi r-3 155b M 10016839 539 MI0007260 hsa-mi r-3 156-1 MI0014184 54 MI0000480 hsa-mi r-3 156-2 MI0014230 55 M 10000681 hsa-mi r-3 156-3 MI0014242 587 MI0016905 hsa-mi r-3 157 MI0014185 5a MI0000069 hsa-mi r-3 158-1 MI0014186 5b MI0000438 hsa-mi r-3 158-2 MI0014187 6-1 MI0000070 hsa-mi r-3 159 MI0014188 6-2 MI00001 15 hsa-mi r-3 160-1 MI0014189 7 MI0000071 hsa-mi r-3' 160-2 MI0014190 81 a-1 MI0000289 hsa-mi r-3" 61 MI0014191 81 a-2 MI0000269 hsa-mi r-3" 62 MI0014192 81 b-1 MI0000270 hsa-mi r-3" 63 MI0014193 81 b-2 MI0000683 hsa-mi r-3' 64 MI0014194 81 c MI0000271 hsa-mi r-3' 65 MI0014195 81 d MI0003139 hsa-mi r-3" 66 MI0014196 82 MI0000272 hsa-mi r-3' 67 MI0014198 825 MI0008193 hsa-mi r-3' 68 MI0014199 827 MI0008195 hsa-mi r-31 69 M 10014200 83 MI0000273 hsa-mi r-31 70 M 10014201 84 MI0000481 hsa-mi r-31 71 MI0014202 85 M 10000482 hsa-mi r-31 73 M 10014204 86 M 10000483 hsa-mi '-31 74 M 10014208 87 MI0000274 hsa-mi '-31 75 M 10014209 88 M 10000484 hsa-mi '-31 76 MI0014210 8a MI0000072 hsa-mi '-31 77 MI001421 1 8b MI0001518 hsa-mi ■-31 78 MI0014212 908 MI0008329 hsa-mii •-31 79-1 M10014213 909 MI0008330 hsa-mii ■-31 79-2 MI0014216 90a MI0000486 hsa-mii •-31 79-3 MI0014221 90b MI0005545 hsa-mii •-31 80-1 MI0014214 91 MI0000465 hsa-mii •-31 80-2 MI0014215 910 MI0008331 hsa-mir -31 80-3 MI0014217 91 1 MI0008332 hsa-mir -31 80-4 MI0016408
Figure imgf000038_0001
912 MI0008333 hsa-mir -31 80-5 MI0016409 ■1204 MI0006337 hsa-m -1913 MI0008334 hsa-m -3181 MI0014223 ■1205 MI0006338 hsa-m -1914 MI0008335 hsa-m -3182 MI0014224 •1206 MI0006339 hsa-m -1915 MI0008336 hsa-m -3183 MI0014225 ■1207 MI0006340 hsa-m -192 MI0000234 hsa-m -3184 MI0014226 ■1208 MI0006341 hsa-m -193a MI0000487 hsa-m -3185 MI0014227 •122 MI0000442 hsa-m -193b MI0003137 hsa-m -3186 MI0014229 ■1224 MI0003764 hsa-m -194-1 MI0000488 hsa-m -3187 MI0014231 ■1225 MI0006311 hsa-m -194-2 MI0000732 hsa-m -3188 MI0014232 •1226 MI0006313 hsa-m -195 MI0000489 hsa-m -3189 MI0014233 •1227 MI0006316 hsa-m -196a-1 MI0000238 hsa-m -3190 MI0014235
1228 MI0006318 hsa-m -196a-2 MI0000279 hsa-m -3191 MI0014236
1229 MI0006319 hsa-m -196b MI0001150 hsa-m -3192 MI0014237 •1231 MI0006321 hsa-m -197 MI0000239 hsa-m -3193 MI0014238 ■1233-1 MI0006323 hsa-m -1972-1 MI0009982 hsa-m -3194 MI0014239 •1233-2 MI0015973 hsa-m -1972-2 MI0015977 hsa-m -3195 MI0014240 ■1234 MI0006324 hsa-m -1973 MI0009983 hsa-m -3196 MI0014241
1236 MI0006326 hsa-m -1976 MI0009986 hsa-m -3197 MI0014245
1237 MI0006327 hsa-m -198 MI0000240 hsa-m -3198-1 MI0014246
1238 MI0006328 hsa-m -199a-1 MI0000242 hsa-m -3198-2 MI0017335 124-1 MI0000443 hsa-m -199a-2 MI0000281 hsa-m -3199-1 MI0014247 124-2 MI0000444 hsa-m -199b MI0000282 hsa-m -3199-2 MI0014248 124-3 MI0000445 hsa-m -19a MI0000073 hsa-m -32 MI0000090 1243 MI0006373 hsa-m -19b-1 MI0000074 hsa-m -3200 MI0014249 1244-1 MI0006379 hsa-m -19b-2 MI0000075 hsa-m -3201 MI0014250 1244-2 MIOO 15974 hsa-m -200a MI0000737 hsa-m -3202-1 MI0014252 1244-3 MI0015975 hsa-m -200b MI0000342 hsa-m -3202-2 MI0014253 1245a MI0006380 hsa-m -200c MI0000650 hsa-m -320a MI0000542 1245b MIO017431 hsa-m -202 M 10003130 hsa-m -320b-1 MI0003776
1246 MI0006381 hsa-m -203a MI0000283 hsa-m -320b-2 MI0003839
1247 MI0006382 hsa-m ■203b MIO017343 hsa-m -320C-1 MI0003778
1248 MI0006383 hsa-m ■204 MI0000284 hsa-m -320C-2 MI0008191
1249 MI0006384 hsa-m •205 MI0000285 hsa-m -320d-1 MI0008190
1250 MI0006385 hsa-m •2052 MI0010486 hsa-m -320d-2 MI0008192
1251 MI0006386 hsa-m ■2053 MI0010487 hsa-m -320e IO014234
1252 MI0006434 hsa-m ■2054 MIO010488 hsa-m -323a MI0000807
1253 MI0006387 hsa-m ■206 MI0000490 hsa-m -323b MIO014206 1254-1 MI0006388 hsa-m •208a MI0000251 hsa-m -324 MI0000813 1254-2 MI0016747 hsa-m ■208b MI0005570 hsa-m -325 MI0000824 1255a MI0006389 hsa-m ■20a MI0000076 hsa-m -326 MI0000808 1255b-1 MI0006435 hsa-m ■20b MI0001519 hsa-m -328 MI0000804 1255b-2 MI0006436 hsa-m 21 MI0000077 hsa-m -329-1 MI0001725
1256 MI0006390 hsa-m •210 MI0000286 hsa-m -329-2 MI0001726
1257 MI0006391 hsa-m 211 MI0000287 hsa-m ■330 MI0000803
1258 MI0006392 hsa-m ■21 10 MI0010629 hsa-m •331 MI0000812 125a MI0000469 hsa-m 21 13 MI0003939 hsa-m 335 MI0000816 125b-1 MI0000446 hsa-m -21 14 MI0010633 hsa-m -337 MI0000806 hsa-mir -125b-2 MI0000470 hsa-m r-21 15 MI0010634 hsa-mir-338 MI0000814 hsa-mir -126 MI0000471 hsa-m r-21 16 M 10010635 hsa-mir-339 MI0000815 hsa-mir -1260a MI0006394 hsa-m r-21 17 MI0010636 hsa-mir-33a I0000091 hsa-mir -1260b MI0014197 hsa-m r-212 MI0000288 hsa-mir-33b I0003646 hsa-mir -1261 MI0006396 hsa-m r-214 MI0000290 hsa-m ir-340 MI0000802 hsa-mir -1262 MI0006397 hsa-m r-215 MI0000291 hsa-m ir-342 MI0000805 hsa-mir -1263 MI0006398 hsa-m r-216a MI0000292 hsa-m ir-345 MI0000825 hsa-mir -1264 MI0003758 hsa-m r-216b MI0005569 hsa-m ir-346 MI0000826 hsa-mir -1265 MI0006401 hsa-m r-217 MI0000293 hsa-mir-34a MI0000268 hsa-mir -1266 MI0006403 hsa-m r-218-1 MI0000294 hsa-mir-34b MI0000742 hsa-mir -1267 MI0006404 hsa-m r-218-2 I0000295 hsa-mir-34c MI0000743 hsa-mir -1268a MI0006405 hsa-m r-219-1 MI0000296 hsa-mir-3529 MI0017351 hsa-mir -1268b MI0016748 hsa-m r-219-2 MI0000740 hsa-mir-3591 MI0017383 hsa-mir -1269a MI0006406 hsa-m r-22 MI0000078 hsa-mir-3605 MI001 5995 hsa-mir -1269b MI0016888 hsa-m r-221 MI0000298 hsa-mir-3606 MI001 5996 hsa-mir -127 MI0000472 hsa-m r-222 MI0000299 hsa-mir-3607 MI0015997 hsa-mir -1270-1 MI0006407 hsa-m r-223 MI0000300 hsa-mir-3609 MI0015999 hsa-mir -1270-2 MI0015976 hsa-m r-224 MI0000301 hsa-mir-361 MI0000760 hsa-mir -1271 MI0003814 hsa-m r-2276 M 1001 1282 hsa-mir-3610 MI0016000 hsa-mir -1272 MI0006408 hsa-m r-2277 M 1001 1284 hsa-mir-361 1 MI0016001 hsa-mir -1273a MI0006409 hsa-m r-2278 M 1001 1285 hsa-mir-3612 M 10016002 hsa-mir -1273c MI0014171 hsa-m r-2355 M 10015873 hsa-mir-3613 MI0016003 hsa-mir -1273d MI0014254 hsa-m r-2392 I0016870 hsa-mir-3614 MI0016004 hsa-mir -1273e MI0016059 hsa-m '-23a MI0000079 hsa-mir-3615 MI0016005 hsa-mir -1273f M 10018002 hsa-m •-23b MI0000439 hsa-mir-3616 MI0016006 hsa-mir -1273g MI0018003 hsa-m --23c MI0016010 hsa-mir-3617 MI0016007 hsa-mir -1275 MI0006415 hsa-m •-24-1 MI0000080 hsa-mir-3618 MI0016008 hsa-mir -1276 MI0006416 hsa-m -24-2 M 10000081 hsa-mir-3619 MI0016009 hsa-mir -1277 MI0006419 hsa-m ■-2467 M 10017432 hsa-mir-362 MI0000762 hsa-mir -1278 MI0006425 hsa-m -25 MI0000082 hsa-mir-3620 MI001601 1 hsa-mir -1279 MI0006426 hsa-m -2681 M 10012062 hsa-mir-3621 MI0016012 hsa-mir -128-1 MI0000447 hsa-m •-2682 M 10012063 hsa-mir-3622a MI0016013 hsa-mir -1281 MI0006428 hsa-m -26a-1 MI0000083 hsa-mir-3622b MI0016014 hsa-mir -128-2 MI0000727 hsa-m -26a-2 MI0000750 hsa-mir-363 MI0000764 hsa-mir -1282 MI0006429 hsa-m 1•-26b MI0000084 hsa-mir-3646 I0016046 hsa-mir- 1283-1 MI0003832 hsa-m i -27a MI0000085 hsa-mir-3648 MI0016048 hsa-mir- 1283-2 MI0006430 hsa-mi -27b MI0000440 hsa-mir-3649 MI0016049 hsa-mir- -1284 MI0006431 hsa-m i -28 MI0000086 hsa-mir-3650 MI0016050 hsa-mir- 1285-1 MI0006346 hsa-mi -2861 MIO013006 hsa-mir-3651 I0016051 hsa-mir- 1285-2 MI0006347 hsa-mi -2909 MI0013083 hsa-mir-3652 MI0016052 hsa-mir- 1286 MI0006348 hsa-mi -296 MI0000747 hsa-mir-3653 MI0016053 hsa-mir- 1287 MI0006349 hsa-mi -2964a M 10017299 hsa-mir-3654 MI0016054 hsa-mir- 1288 MI0006432 hsa-mi -297 MI0005775 hsa-m ir-3655 MIO016055 hsa-mir- 1289-1 MI0006350 hsa-mi -298 MI0005523 hsa-mir-3656 MI0016056 hsa-mir- 1289-2 MI0006351 hsa-mi -299 MI0000744 hsa-mir-3657 MI0016057 hsa-mir- 1290 MI0006352 hsa-mi -29a MI0000087 hsa-mir-3658 MI0016058 hsa-mir -129-1 MI0000252 hsa-mi r-29b-1 MI0000105 hsa-mir-3659 I0016060 hsa-mir -1291 MI0006353 hsa-mi r-29b-2 I0000107 hsa-mir-365a I0000767 hsa-mir -129-2 MI0000473 hsa-mi r-29c MI0000735 hsa-mir-365b MI0000769 hsa-mir -1292 MI0006433 hsa-mi r-300 MI0005525 hsa-mir-3660 MI0016061 hsa-mir -1293 MI0006355 hsa-mi r-301 a MI0000745 hsa-mir-3661 MI0016062 hsa-mir -1294 MI0006356 hsa-mi r-301 b I0005568 hsa-mir-3662 MI0016063 hsa-mir -1295a MI0006357 hsa-mi r-302a MI0000738 hsa-mir-3663 MI0016064 hsa-mir -1295b MI0019146 hsa-mi r-302b MI0000772 hsa-mir-3664 M 10016065 hsa-mir -1296 MI0003780 hsa-mi r-302c MI0000773 hsa-mir-3665 MI0016066 hsa-mir -1297 MI0006358 hsa-mi r-302d MI0000774 hsa-mir-3666 MI0016067 hsa-mir -1298 MI0003938 hsa-mi r-302e MI0006417 hsa-mir-3667 M 10016068 hsa-mir -1299 MI0006359 hsa-mi r-302f M 10006418 hsa-mir-3668 M 10016069 hsa-mir -1301 MI0003815 hsa-mi r-3064 M 10017375 hsa-mir-3669 MI0016070 hsa-mir -1302-1 MI0006362 hsa-mi r-3065 MI0014228 hsa-mir-367 MI0000775 hsa-mir -1302-10 MI001597S hsa-mi r-3074 MI0014181 hsa-mir-3670-1 MI0016071 hsa-mir -1302-1 1 MI001598C hsa-mi r-30a MI0000088 hsa-mir-3670-2 MI0019112 hsa-mir -1302-2 MI0006363 hsa-mi r-30b MI0000441 hsa-mir-3671 MI0016072 hsa-mir -1302-3 MI0006364 hsa-mi r-30c-1 MI0000736 hsa-mir-3672 MI0016073 hsa-mir -1302-4 MI0006365 hsa-mi r-30c-2 MI0000254 hsa-mir-3673 MI0016074 hsa-mir -1302-5 I0006366 hsa-mi r-30d MI0000255 hsa-mir-3674 MI0016075 hsa-mir -1302-6 MI0006367 hsa-mi r-30e MI0000749 hsa-mir-3675 MI0016076 hsa-mir -1302-7 I0006368 hsa-mi r-31 MI0000089 hsa-mir-3676 M 10016077 hsa-mir -1302-8 MI0006369 hsa-mi r-3115 MI0014127 hsa-mir-3677 MI0016078 hsa-mir -1302-9 MI0015978 hsa-mi r-31 16-1 MI0014128 hsa-mir-3678 M 10016079 hsa-mir -1303 MI0006370 hsa-mi r-31 16-2 MI0014129 hsa-mir-3679 MI0016080 hsa-mir -1304 MI0006371 hsa-mi r-31 17 MI0014130 hsa-mir-3680-1 MI0016081 hsa-mir -1305 MI0006372 hsa-mi r-31 18-1 MI0014131 hsa-mir-3680-2 MI00191 13 hsa-mir -1306 MI0006443 hsa-mi r-3118-2 MI0014132 hsa-mir-3681 MI0016082 hsa-mir -1307 MI0006444 hsa-mi r-31 18-3 MI0014133 hsa-mir-3682 MIO016083 hsa-mir -130a MI0000448 hsa-mi r-3118-4 MI0014207 hsa-mir-3683 MI0016084 hsa-mir -130b MI0000748 hsa-mi r-3118-5 MI0014243 hsa-mir-3684 MI0016085 hsa-mir -132 MI0000449 hsa-mi r-3118-6 MI0015981 hsa-mir-3685 MI0016086 hsa-mir -1321 MI0006652 hsa-mi r-3119-1 MI0014134 hsa-mir-3686 MI0016087 hsa-mir -1322 MI0006653 hsa-mi r-31 19-2 MI0014135 hsa-mir-3687 MI0016088 hsa-mir -1323 MI0003786 hsa-mi r-3120 MI0014136 hsa-mir-3688-1 MI0016089 hsa-mir -1324 MI0006657 hsa-mi r-3121 MI0014137 hsa-mir-3688-2 MI0017447 hsa-mir -133a-1 MI0000450 hsa-mi r-3122 MI0014138 hsa-mir-3689a M 10016090 hsa-mir -133a-2 MI0000451 hsa-mi r-3123 MI0014139 hsa-mir-3689b MI001641 1 hsa-mir -133b MI0000822 hsa-mi r-3124 MI0014140 hsa-mir-3689c M 10016832 hsa-mir- -134 MI0000474 hsa-mi r-3125 I0014142 hsa-mir-3689d-1 MI0016834 hsa-mir- -1343 MI0017320 hsa-mi r-3126 MI0014143 hsa-mir-3689d-2 MI0016835 hsa-mir- 135a-1 MI0000452 hsa-mi r-3127 MI0014144 hsa-mir-3689e M 10016836 hsa-mir- 135a-2 MI0000453 hsa-mi r-3128 MI0014145 hsa-mir-3689f MI0016837 hsa-mir- 135b MI0000810 hsa-mi r-3129 MI0014146 hsa-mir-369 MI0000777 hsa-mir- 136 MI0000475 hsa-mi r-3130-1 MI0014147 hsa-mir-3690-1 MI0016091 hsa-mir- 137 MI0000454 hsa-mi '-3130-2 MI0014148 hsa-mir-3690-2 MI0023561 hsa-mir- 138-1 MI0000476 hsa-mir-3131 MI0014151 hsa-mir-3691 MI0016092 hsa-mir-138-2 MI0000455 hsa-mir-3132 MI0014152 hsa-mir-3692 M 10016093 hsa-mir-139 MI0000261 hsa-mir-3133 MI0014153 hsa-mir-370 MI0000778 hsa-mir-140 MI0000456 hsa-mir-3134 MI0014155 hsa-mir-3713 MI0016134 hsa-mir-141 MI0000457 hsa-mir-3135a MI0014156 hsa-mir-3714 MI0016135 hsa-mir-142 MI0000458 hsa-mir-3135b MI0016809 hsa-mir-371a MI0000779 hsa-mir-143 MI0000459 hsa-mir-3136 MI0014158 hsa-mir-371b MI0017393 hsa-mir-144 MI0000460 hsa-mir-3137 MI0014160 hsa-mir-372 MI0000780 hsa-mir-145 MI0000461 hsa-mir-3138 MI0014161 hsa-mir-373 MI0000781 hsa-mir-1468 MI0003782 hsa-mir-3139 MI0014162 hsa-mir-374a MI0000782 hsa-mir-1469 MI0007074 hsa-mir-3140 MI0014163 hsa-mir-374b MI0005566 hsa-mir-146a MI0000477 hsa-mir-3141 MI0014165 hsa-mir-374c MI0016684 hsa-mir-146b MI0003129 hsa-mir-3142 MI0014166 hsa-mir-375 MI0000783 hsa-mir-1470 MI0007075 hsa-mir-3143 MI0014167 hsa-mir-376a-1 MI0000784 hsa-mir-1471 MI0007076 hsa-mir-3144 MI0014169 hsa-mir-376a-2 MI0003529 hsa-mir- 147a MI0000262 hsa-mir-3145 MI0014170 hsa-mir-376b MI0002466 hsa-mir-147b MI0005544 hsa-mir-3146 MI0014172 hsa-mir-376c MI0000776 hsa-mir-148a MI0000253 hsa-mir-3147 MI0014173 hsa-mir-377 MI0000785 hsa-mir-148b MI0000811 hsa-mir-3148 MI0014175 hsa-mir-378a MI0000786
Table 2b
hsa-mir-4454 MI0016800 hsa-mir-4721 MI0017356 hsa-mir-522 MI0003177 hsa-mir-4455 MI0016801 hsa-mir-4722 MI0017357 hsa-mir-523 MI0003153 hsa-mir-4456 MI0016802 hsa-mir-4723 MI0017359 hsa-mir-524 MI0003160 hsa-mir-4457 MI0016803 hsa-mir-4724 MI0017361 hsa-mir-525 MI0003152 hsa-mir-4458 MI0016804 hsa-mir-4725 MI0017362 hsa-mir-526a-1 MI0003157 hsa-mir-4459 MI0016805 hsa-mir-4726 MI0017363 hsa-mir-526a-2 Ml 0003168 hsa-mir-4460 MI0016806 hsa-mir-4727 MI0017364 hsa-mir-526b MI0003150 hsa-mir-4461 MI0016807 hsa-mir-4728 MI0017365 hsa-mir-527 MI0003179 hsa-mir-4462 MI0016810 hsa-mir-4729 MI0017366 hsa-mir-532 MI0003205 hsa-mir-4463 MI0016811 hsa-mir-4730 MI0017367 hsa-mir-539 MI0003514 hsa-mir-4464 MI0016812 hsa-mir-4731 MI0017368 hsa-mir-541 MI0005539 hsa-mir-4465 MI0016816 hsa-mir-4732 MI0017369 hsa-mir-542 MI0003686 hsa-mir-4466 MI0016817 hsa-mir-4733 MI0017370 hsa-mir-543 MI0005565 hsa-mir-4467 MI0016818 hsa-mir-4734 MI0017371 hsa-mir-544a MI0003515 hsa-mir-4468 MI0016819 hsa-mir-4735 MI0017372 hsa-mir-544b MI0014159 hsa-mir-4469 MI0016820 hsa-mir-4736 MI0017373 hsa-mir-545 MI0003516 hsa-mir-4470 MI0016821 hsa-mir-4737 MI0017374 hsa-mir-548a-1 MI0003593 hsa-mir-4471 MI0016822 hsa-mir-4738 MI0017376 hsa-mir-548a-2 Ml 0003598 hsa-mir-4472-1 MI0016823 hsa-mir-4739 MI0017377 hsa-mir-548a-3 Ml 0003612 hsa-mir-4472-2 MI0016824 hsa-mir-4740 MI0017378 hsa-mir-548aa-1 Ml 0016689 hsa-mir-4473 MI0016825 hsa-mir-4741 MI0017379 hsa-mir-548aa-2 MI0016690 hsa-mir-4474 MI0016826 hsa-mir-4742 MI0017380 hsa-mir-548ab MI0016752 hsa-mir-4475 MI0016827 hsa-mir-4743 MI0017381 hsa-mir-548ac Ml 0016762 hsa-mir-4476 MI0016828 hsa-mir-4744 MI0017382 hsa-mir-548ad Ml 0016770 hsa-mir-4477a MI0016829 hsa-mir-4745 MI0017384 hsa-mir-548ae-1 MI0016779 sa-mir-4477b MI0016830 hsa-mir-4746 MI0017385 hsa-mir-548ae-2 Ml 0016780 hsa-mir-4478 MI0016831 hsa-mir-4747 MI0017386 hsa-mir-548ag-1 MI0016793 hsa-mir-4479 MI0016838 hsa-mir-4748 MI0017387 hsa-mir-548ag-2 Ml 0016794 hsa-mir-448 MI0001637 hsa-mir-4749 MI0017388 hsa-mir-548ah MI0016796 hsa-mir-4480 MI0016841 hsa-mir-4750 MI0017389 hsa-mir-548ai MI0016813 hsa-mir-4481 MI0016842 hsa-mir-4751 MI0017390 hsa-mir-548aj-1 MI0016814 hsa-mir-4482 MI0016843 hsa-mir-4752 MI0017391 hsa-mir-548aj-2 Ml 0016815 hsa-mir-4483 MI0016844 hsa-mir-4753 MI0017392 hsa-mir-548ak MI0016840 hsa-mir-4484 MI0016845 hsa-mir-4754 MI0017394 hsa-mir-548al MI0016851 hsa-mir-4485 MI0016846 hsa-mir-4755 MI0017395 hsa-mir-548am Ml 0016904 hsa-mir-4486 MI0016847 hsa-mir-4756 MI0017397 hsa-mir-548an MI0016907 hsa-mir-4487 MI0016848 hsa-mir-4757 MI0017398 hsa-mir-548ao MI0017871 hsa-mir-4488 MI0016849 hsa-mir-4758 MI0017399 hsa-mir-548ap MI0017875 hsa-mir-4489 MI0016850 hsa-mir-4759 MI0017400 hsa-mir-548aq MI0019130 hsa-mir-4490 MI0016852 hsa-mir-4760 MI0017401 hsa-mir-548ar MI0019131 hsa-mir-4491 MI0016853 hsa-mir-4761 MI0017402 hsa-mir-548as MI0019132 hsa-mir-4492 MI0016854 hsa-mir-4762 MI0017403 hsa-mir-548at MI0019137 hsa-mir-4493 MI0016855 hsa-mir-4763 MI0017404 hsa-mir-548au MI0019145 hsa-mir-4494 MI0016856 hsa-mir-4764 MI0017405 hsa-mir-548av MI0019152 hsa-mir-4495 MI0016857 hsa-mir-4765 MI0017406 hsa-mir-548aw Ml 0019283 hsa-mir-4496 MI0016858 hsa-mir-4766 MI0017407 hsa-mir-548ax Ml 0019286 hsa-mir-4497 MI0016859 hsa-mir-4767 MI0017408 hsa-mir-548ay MI0022210 hsa-mir-4498 MI0016860 hsa-mir-4768 MI0017409 hsa-mir-548az MI0022212 hsa-mir-4499 MI0016862 hsa-mir-4769 MI0017410 hsa-mir-548b MI0003596 hsa-mir-449a MI0001648 hsa-mir-4770 MI0017411 hsa-mir-548c MI0003630 hsa-mir-449b MI0003673 hsa-mir-4771 -1 MI0017412 hsa-mir-548d-1 MI0003668 hsa-mir-449c MI0003823 hsa-mir-4771 -2 MI0017413 hsa-mir-548d-2 MI0003671 hsa-mir-4500 MI0016863 hsa-mir-4772 MI0017414 hsa-mir-548e MI0006344 hsa-mir-4501 MI0016864 hsa-mir-4773-1 MI0017415 hsa-mir-548f-1 MI0006374 hsa-mir-4502 MI0016865 hsa-mir-4773-2 MI0017416 hsa-mir-548f-2 MI0006375 hsa-mir-4503 MI0016866 hsa-mir-4774 MI0017417 hsa-mir-548f-3 MI0006376 hsa-mir-4504 MI0016867 hsa-mir-4775 MI0017418 hsa-mir-548f-4 MI0006377 hsa-mir-4505 MI0016868 hsa-mir-4776-1 MI0017419 hsa-mir-548f-5 MI0006378 hsa-mir-4506 MI0016869 hsa-mir-4776-2 MI0017420 hsa-mir-548g MI0006395 hsa-mir-4507 MI0016871 hsa-mir-4777 MI0017421 hsa-mir-548h-1 MI000641 1 hsa-mir-4508 MI0016872 hsa-mir-4778 MI0017422 hsa-mir-548h-2 MI0006412 hsa-mir-4509-1 MI0016873 hsa-mir-4779 MI0017423 hsa-mir-548 -3 MI0006413 hsa-mir-4509-2 MI0016874 hsa-mir-4780 MI0017424 hsa-mir-548h-4 MI0006414 hsa-mir-4509-3 MI0016875 hsa-mir-4781 I0017426 hsa-mir-548h-5 MI0016751 hsa-mir-450a-1 I0001652 hsa-mir-4782 MI0017427 hsa-mir-548i-1 MI0006421 hsa-mir-450a-2 MI0003187 hsa-mir-4783 MI0017428 hsa-mir-548i-2 I0006422 hsa-mir-450b MI0005531 hsa-mir-4784 MI0017429 hsa-mir-548i-3 MI0006423 hsa-mir-4510 MI0016876 hsa-mir-4785 MI0017430 hsa-mir-548i-4 MI0006424 hsa-mir-4511 MI0016877 hsa-mir-4786 I0017433 hsa-mir-548j MI0006345 hsa-mir-4512 MI0016878 hsa-mir-4787 MI0017434 hsa-mir-548k I0006354 hsa-mir-4513 MI0016879 hsa-mir-4788 MI0017435 hsa-mir-548l Ml 0006361 hsa-mir-4514 MI0016880 hsa-mir-4789 MI0017436 hsa-mir-548m Ml 0006400 hsa-mir-4515 MI0016881 hsa-mir-4790 I0017437 hsa-mir-548n MI0006399 hsa-mir-4516 I0016882 hsa-mir-4791 MI0017438 hsa-mir-548o MI0006402 hsa-mir-4517 MI0016883 hsa-mir-4792 MI0017439 hsa-mir-548o-2 MI0016746 hsa-mir-4518 MI0016884 hsa-mir-4793 MI0017440 hsa-mir-548p MI0006420 hsa-mir-4519 MI0016885 hsa-mir-4794 MI0017441 hsa-mir-548q MI0010637 hsa-mir-451a MI0001729 hsa-mir-4795 MI0017442 hsa-mir-548s MI0014141 hsa-mir-451b MI0017360 hsa-mir-4796 MI0017443 hsa-mir-548t MI0014164 hsa-mir-452 MI0001733 hsa-mir-4797 MI0017444 hsa-mir-548u MI0014168 hsa-mir-4520a MI0016886 hsa-mir-4798 MI0017445 hsa-mir-548v MI0014174 hsa-mir-4520b I0017358 hsa-mir-4799 MI0017446 hsa-mir-548w MI0014222 hsa-mir-4521 MI0016887 hsa-mir-4800 MI0017448 hsa-mir-548x MI0014244 hsa-mir-4522 MI0016889 hsa-mir-4801 MI0017449 hsa-mir-548x-2 Ml 0016833 hsa-mir-4523 MI0016890 hsa-mir-4802 MI0017450 hsa-mir-548y MI0016595 hsa-mir-4524a MI0016891 hsa-mir-4803 MI0017451 hsa-mir-548z MI0016688 hsa-mir-4524b MI0019114 hsa-mir-4804 MI0017452 hsa-mir-549a MI0003679 hsa-mir-4525 MI0016892 hsa-mir-483 MI0002467 hsa-mir-550a-1 MI0003600 hsa-mir-4526 MI0016893 hsa-mir-484 MI0002468 hsa-mir-550a-2 Ml 0003601 hsa-mir-4527 MI0016894 hsa-mir-485 MI0002469 hsa-mir-550a-3 Ml 0003762 hsa-mir-4528 MI0016895 hsa-mir-486 MI0002470 hsa-mir-550b-1 MI0016686 hsa-mir-4529 MI0016896 hsa-mir-487a MI0002471 hsa-mir-550b-2 MI0016687 hsa-mir-4530 MI0016897 hsa-mir-487b MI0003530 hsa-mir-551a MI0003556 hsa-mir-4531 MI0016898 hsa-mir-488 MI0003123 hsa-mir-551b MI0003575 hsa-mir-4532 MI0016899 hsa-mir-489 MI0003124 hsa-mir-552 MI0003557 hsa-mir-4533 MI0016900 hsa-mir-490 MI0003125 hsa-mir-553 MI0003558 hsa-mir-4534 MI0016901 hsa-mir-491 MI0003126 hsa-mir-554 MI0003559 hsa-mir-4535 MI0016903 hsa-mir-492 MI0003131 hsa-mir-555 MI0003561 hsa-mir-4536-1 MI0016906 hsa-mir-493 MI0003132 hsa-mir-556 MI0003562 hsa-mir-4536-2 MI0019149 hsa-mir-494 MI0003134 hsa-mir-557 MI0003563 hsa-mir-4537 MI0016908 hsa-mir-495 MI0003135 hsa-mir-5571 MI0019115 hsa-mir-4538 MI0016909 hsa-mir-496 MI0003136 hsa-mir-5572 MI0019117 hsa-mir-4539 MI0016910 hsa-mir-497 MI0003138 hsa-mir-5579 MI0019133 hsa-mir-454 MI0003820 hsa-mir-498 MI0003142 hsa-mir-558 MI0003564 hsa-mir-4540 MI0016911 hsa-mir-4999 MI0017865 hsa-mir-5580 MI0019135 hsa-mir-455 MI0003513 hsa-mir-499a MI0003183 hsa-mir-5581 MI0019136 hsa-mir-4632 MI0017259 hsa-mir-499b MI0017396 hsa-mir-5582 MI0019138 hsa-mir-4633 MI0017260 hsa-mir-5000 MI0017866 hsa-mir-5583-1 MI0019139 hsa-mir-4634 MI0017261 hsa-mir-5001 MI0017867 hsa-mir-5583-2 MI0019140 hsa-mir-4635 MI0017262 hsa-mir-5002 MI0017868 hsa-mir-5584 MI0019141 hsa-mir-4636 MI0017263 hsa-mir-5003 MI0017869 hsa-mir-5585 MI0019142 hsa-mir-4637 MI0017264 hsa-mir-5004 MI0017870 hsa-mir-5586 MI0019143 hsa-mir-4638 MI0017265 hsa-mir-5006 MI0017873 hsa-mir-5587 MI0019144 hsa-mir-4639 MI0017266 hsa-mir-5007 Ml 0017874 hsa-mir-5588 MI0019147 hsa-mir-4640 MI0017267 hsa-mir-5008 MI0017876 hsa-mir-5589 MI0019148 hsa-mir-4641 MI0017268 sa-mir-5009 MI0017877 hsa-mir-559 Ml 0003565 hsa-mir-4642 MI0017269 hsa-mir-500a MI0003184 hsa-mir-5590 MI0019150 hsa-mir-4643 MI0017270 hsa-mir-500b MI0015903 hsa-mir-5591 MI0019151 hsa-mir-4644 MI0017271 hsa-mir-501 MI0003185 hsa-mir-561 MI0003567 hsa-mir-4645 MI0017272 hsa-mir-5010 MI0017878 hsa-mir-562 Ml 0003568 hsa-mir-4646 MI0017273 hsa-mir-5011 MI0017879 hsa-mir-563 MI0003569 hsa-mir-4647 MI0017274 hsa-mir-502 MI0003186 hsa-mir-564 MI0003570 hsa-mir-4648 MI0017275 hsa-mir-503 MI0003188 hsa-mir-566 MI0003572 hsa-mir-4649 MI0017276 hsa-mir-504 MI0003189 hsa-mir-567 MI0003573 hsa-mir-4650-1 MI0017277 hsa-mir-5047 MI0017932 hsa-mir-568 MI0003574 hsa-mir-4650-2 MI0017278 hsa-mir-505 MI0003190 hsa-mir-5680 MI0019280 hsa-mir-4651 MI0017279 hsa-mir-506 MI0003193 hsa-mir-5681a MI0019281 hsa-mir-4652 MI0017280 hsa-mir-507 MI0003194 hsa-mir-5681 b MI0019293 hsa-mir-4653 MI0017281 hsa-mir-508 MI0003195 hsa-mir-5682 MI0019282 hsa-mir-4654 MI0017282 hsa-mir-5087 MI0017976 hsa-mir-5683 MI0019284 hsa-mir-4655 MI0017283 hsa-mir-5088 MI0017977 hsa-mir-5684 MI0019285 hsa-mir-4656 MI0017284 hsa-mir-5089 MI0017978 hsa-mir-5685 MI0019287 hsa-mir-4657 MI0017285 hsa-mir-5090 MI0017979 hsa-mir-5686 MI0019290 hsa-mir-4658 MI0017286 hsa-mir-509-1 Ml 0003196 hsa-mir-5687 MI0019291 hsa-mir-4659a MI0017287 hsa-mir-5091 MI0017980 hsa-mir-5688 MI0019292 hsa-mir-4659b MI0017291 hsa-mir-509-2 Ml 0005530 hsa-mir-5689 MI0019294 hsa-mir-466 MI0014157 hsa-mir-5092 MI0017981 hsa-mir-569 MI0003576 hsa-mir-4660 MI0017288 hsa-mir-509-3 MI0005717 hsa-mir-5690 MI0019295 hsa-mir-4661 MI0017289 hsa-mir-5093 MI0017982 hsa-mir-5691 MI0019296 hsa-mir-4662a MI0017290 hsa-mir-5094 MI0017983 hsa-mir-5692a-1 MI0019297 hsa-mir-4662b MI0017293 hsa-mir-5095 MI0018001 hsa-mir-5692a-2 Ml 0019298 hsa-mir-4663 MI0017292 hsa-mir-5096 MI0018004 hsa-mir-5692b MI0019311 hsa-mir-4664 MI0017294 hsa-mir-510 MI0003197 hsa-mir-5692c-1 MI0019288 hsa-mir-4665 MI0017295 hsa-mir-5100 MI0019116 hsa-mir-5692c-2 MI0019289 hsa-mir-4666a MI0017296 hsa-mir-511 -1 MI0003127 hsa-mir-5693 MI0019300 hsa-mir-4666b MI0019299 hsa-mir-511 -2 MI0003128 hsa-mir-5694 MI0019301 hsa-mir-4667 MI0017297 hsa-mir-512-1 MI0003140 hsa-mir-5695 MI0019302 hsa-mir-4668 MI0017298 hsa-mir-512-2 MI0003141 hsa-mir-5696 MI0019303 hsa-mir-4669 MI0017300 hsa-mir-513a-1 MI0003191 hsa-mir-5697 MI0019304 hsa-mir-4670 MI0017301 hsa-mir-513a-2 MI0003192 hsa-mir-5698 MI0019305 hsa-mir-4671 MI0017302 hsa-mir-513b MI0006648 hsa-mir-5699 MI0019306 hsa-mir-4672 MI0017303 hsa-mir-513c MI0006649 hsa-mir-570 MI0003577 hsa-mir-4673 MI0017304 hsa-mir-514a-1 Ml 0003198 hsa-mir-5700 MI0019307 hsa-mir-4674 MI0017305 hsa-mir-514a-2 MI0003199 hsa-mir-5701-1 MI0019308 hsa-mir-4675 MI0017306 hsa-mir-514a-3 MI0003200 hsa-mir-5701-2 Ml 0019593 hsa-mir-4676 MI0017307 hsa-mir-514b MI0014251 hsa-mir-5702 MI0019309 hsa-mir-4677 MI0017308 hsa-mir-515-1 MI0003144 hsa-mir-5703 MI0019310 hsa-mir-4678 MI0017309 isa-mir-515-2 MI0003147 hsa-mir-5704 MI0019312 hsa-mir-4679-1 MI0017310 isa-mir-516a-1 MI0003180 hsa-mir-5705 MI0019313 hsa-mir-4679-2 MI001731 1 isa-mir-516a-2 MI0003181 hsa-mir-5706 MI0019314 hsa-mir-4680 MI0017312 isa-mir-516b-1 MI0003172 hsa-mir-5707 MI0019315 hsa-mir-4681 MI0017313 isa-mir-516b-2 Ml 0003167 hsa-mir-5708 MI0019316 hsa-mir-4682 MI0017314 hsa-mir-517a MI0003161 hsa-mir-571 MI0003578 hsa-mir-4683 MI0017315 hsa-mir-517b MI0003165 hsa-mir-572 MI0003579 hsa-mir-4684 MI0017316 hsa-mir-517c MI0003174 hsa-mir-573 MI0003580 hsa-mir-4685 MI0017317 hsa-mir-5186 MI0018165 hsa-mir-5739 MI0019412 hsa-mir-4686 MI0017318 hsa-mir-5187 MI0018166 hsa-mir-574 MI0003581 hsa-mir-4687 MI0017319 hsa-mir-5188 MI0018167 hsa-mir-575 MI0003582 hsa-mir-4688 MI0017321 sa-mir-5189 MI0018168 hsa-mir-576 MI0003583 hsa-mir-4689 MI0017322 sa-mir-518a-1 MI0003170 hsa-mir-577 MI0003584 hsa-mir-4690 MI0017323 sa-mir-518a-2 MI0003173 hsa-mir-578 MI0003585 hsa-mir-4691 MI0017324 sa-mir-518b MI0003156 hsa-mir-5787 MI0019797 hsa-mir-4692 MI0017325 hsa-mir-518c MI0003159 hsa-mir-579 MI0003586 hsa-mir-4693 MI0017326 hsa-mir-518d MI0003171 hsa-mir-580 MI0003587 hsa-mir-4694 MI0017327 hsa-mir-518e MI0003169 hsa-mir-581 MI0003588 hsa-mir-4695 MI0017328 hsa-mir-518f MI0003154 hsa-mir-582 MI0003589 hsa-mir-4696 MI0017329 hsa-mir-5190 MI0018169 hsa-mir-583 MI0003590 hsa-mir-4697 MI0017330 hsa-mir-5191 MI0018170 hsa-mir-584 MI0003591 hsa-mir-4698 MI0017331 hsa-mir-5192 MI0018171 hsa-mir-585 MI0003592 hsa-mir-4699 MI0017332 hsa-mir-5193 MI0018172 hsa-mir-586 MI0003594 hsa-mir-4700 MI0017333 hsa-mir-5194 MI0018173 hsa-mir-587 MI0003595 hsa-mir-4701 MI0017334 hsa-mir-5195 MI0018174 hsa-mir-588 MI0003597 hsa-mir-4703 MI0017336 hsa-mir-5196 MI0018175 hsa-mir-589 Ml 0003599 hsa-mir-4704 MI0017337 hsa-mir-5197 MI0018176 hsa-mir-590 Ml 0003602 hsa-mir-4705 MI0017338 hsa-mir-519a-1 Ml 0003178 hsa-mir-591 MI0003603 sa-mir-4706 MI0017339 hsa-mir-519a-2 Ml 0003182 hsa-mir-592 MI0003604 hsa-mir-4707 MI0017340 hsa-mir-519b MI0003151 hsa-mir-593 MI0003605 hsa-mir-4708 MI0017341 hsa-mir-519c MI0003148 hsa-mir-595 MI0003607 hsa-mir-4709 MI0017342 hsa-mir-519d MI0003162 hsa-mir-596 MI0003608 hsa-mir-4710 MI0017344 hsa-mir-519e MI0003145 hsa-mir-597 MI0003609 hsa-mir-4711 MI0017345 hsa-mir-520a MI0003149 hsa-mir-598 MI0003610 hsa-mir-4712 MI0017346 hsa-mir-520b MI0003155 hsa-mir-599 MI0003611 hsa-mir-4713 MI0017347 hsa-mir-520c MI0003158 hsa-mir-600 MI0003613 hsa-mir-4714 MI0017348 hsa-mir-520d MI0003164 hsa-mir-601 MI0003614 hsa-mir-4715 MI0017349 hsa-mir-520e MI0003143 hsa-mir-602 MI0003615 hsa-mir-4716 MI0017350 hsa-mir-520f MI0003146 hsa-mir-603 MI0003616 hsa-mir-4717 MI0017352 hsa-mir-520g MI0003166 hsa-mir-604 MI0003617 hsa-mir-4718 MI0017353 hsa-mir-520h MI0003175 hsa-mir-605 MI0003618 hsa-mir-4719 MI0017354 hsa-mir-521 -1 MI0003176 hsa-mir-606 MI0003619 hsa-mir-4720 MI0017355 hsa-mir-521 -2 MI0003163 hsa-mir-6068 MI0020345 hsa-mir-6069 MI0020346 hsa-mir-641 MI0003656 hsa-mir-7-3 MI0000265 hsa-mir-607 MI0003620 hsa-mir-642a Ml 0003657 hsa-mir-744 MI0005559 hsa-mir-6070 MI0020347 hsa-mir-642b MI0016685 hsa-mir-758 MI0003757 hsa-mir-6071 MI0020348 hsa-mir-643 Ml 0003658 hsa-mir-759 MI0004065 hsa-mir-6072 MI0020349 hsa-mir-644a MI0003659 hsa-mir-760 MI0005567 hsa-mir-6073 MI0020350 hsa-mir-645 MI0003660 hsa-mir-761 MI0003941 hsa-mir-6074 MI0020351 hsa-mir-646 MI0003661 hsa-mir-762 MI0003892 hsa-mir-6075 MI0020352 hsa-mir-647 MI0003662 hsa-mir-764 MI0003944 hsa-mir-6076 MI0020353 hsa-mir-648 MI0003663 hsa-mir-765 MI0005116 hsa-mir-6077-1 MI0020354 hsa-mir-649 MI0003664 hsa-mir-766 MI0003836 hsa-mir-6077-2 MI0023562 hsa-mir-6499 MI0022209 hsa-mir-767 MI0003763 hsa-mir-6078 MI0020355 hsa-mir-650 MI0003665 hsa-mir-769 MI0003834 hsa-mir-6079 MI0020356 hsa-mir-6500 MI0022211 hsa-mir-770 MI0005118 hsa-mir-608 MI0003621 hsa-mir-6501 MI0022213 hsa-mir-802 MI0003906 hsa-mir-6080 MI0020357 hsa-mir-6502 MI0022214 hsa-mir-873 MI0005564 hsa-mir-6081 MI0020358 hsa-mir-6503 MI0022215 hsa-mir-874 MI0005532 hsa-mir-6082 MI0020359 hsa-mir-6504 MI0022216 hsa-mir-875 MI0005541 hsa-mir-6083 MI0020360 hsa-mir-6505 MI0022217 hsa-mir-876 MI0005542 hsa-mir-6084 MI0020361 hsa-mir-6506 MI0022218 hsa-mir-877 MI0005561 hsa-mir-6085 MI0020362 hsa-mir-6507 MI0022219 hsa-mir-885 MI0005560 hsa-mir-6086 MI0020363 hsa-mir-6508 MI0022220 hsa-mir-887 MI0005562 hsa-mir-6087 MI0020364 hsa-mir-6509 MI0022221 hsa-mir-888 MI0005537 hsa-mi r-6088 Ml 0020365 hsa-mir-651 MI0003666 hsa-mir-889 MI0005540 hsa-mi r-6089-1 Ml 0020366 hsa-mir-6510 MI0022222 hsa-mir-890 MI0005533 hsa-mi r-6089-2 Ml 0023563 hsa-mir-651 1a-1 MI0022223 hsa-mir-891a MI0005524 hsa-mi r-609 MI0003622 hsa-mir-651 1a-2 MI0023564 hsa-mir-891 b MI0005534 hsa-mi r-6090 Ml 0020367 hsa-mir-651 1a-3 Ml 0023565 hsa-mir-892a MI0005528 hsa-mi r-610 MI0003623 hsa-mir-651 1a-4 MI0023566 hsa-mir-892b MI0005538 hsa-mi r-61 1 MI0003624 hsa-mir-651 1b- 1 MI0022552 hsa-mir-892c MI0022560 hsa-mi r-612 MI0003625 hsa-mir-6512 MI0022224 hsa-mir-9-1 Ml 0000466 hsa-mi r-6124 MI0021258 hsa-mir-6513 MI0022225 hsa-mir-9-2 Ml 0000467 hsa-mi r-6125 MI0021259 hsa-mir-6514 MI0022226 hsa-mir-920 MI0005712 hsa-mi r-6126 MI0021260 hsa-mir-6515 MI0022227 hsa-mir-921 MI0005713 hsa-mi r-6127 MI0021271 hsa-mir-652 MI0003667 hsa-mir-922 MI0005714 hsa-mi r-6128 MI0021272 hsa-mir-653 MI0003674 hsa-mir-924 MI0005716 hsa-mi r-6129 MI0021274 hsa-mir-654 MI0003676 hsa-mir-92a-1 MI0000093 hsa-mi r-613 MI0003626 hsa-mir-655 MI0003677 hsa-mir-92a-2 Ml 0000094 hsa-mi r-6130 MI0021275 hsa-mir-656 MI0003678 hsa-mir-92b MI0003560 hsa-mi r-6131 MI0021276 hsa-mir-657 MI0003681 hsa-mir-93 MI0000095 hsa-mi r-6132 MI0021277 hsa-mir-658 MI0003682 hsa-mir-9-3 Ml 0000468 hsa-mi r-6133 MI0021278 hsa-mir-659 MI0003683 hsa-mir-933 Ml 0005755 hsa-mi r-6134 MI0021279 hsa-mir-660 MI0003684 hsa-mir-934 MI0005756 hsa-mi r-614 MI0003627 hsa-mir-661 MI0003669 hsa-mir-935 MI0005757 hsa-mi r-615 MI0003628 hsa-mir-662 MI0003670 hsa-mir-936 MI0005758 hsa-mi r-616 MI0003629 hsa-mir-663a MI0003672 hsa-mir-937 MI0005759 hsa-mi r-6165 MI0021472 hsa-mir-663b MI0006336 hsa-mir-938 MI0005760 hsa-mi r-617 MI0003631 hsa-mir-664a MI0006442 hsa-mir-939 MI0005761 hsa-mi r-618 MI0003632 hsa-mir-664b MI0019134 hsa-mir-940 MI0005762 hsa-mi r-619 MI0003633 hsa-mir-665 MI0005563 hsa-mir-941 -1 MI0005763 hsa-mi r-620 MI0003634 hsa-mir-668 MI0003761 hsa-mir-941 -2 MI0005764 hsa-mi r-621 MI0003635 hsa-mir-670 MI0003933 hsa-mir-941 -3 Ml 0005765 hsa-mi ^-622 Ml 0003636 hsa-mir-671 MI0003760 hsa-mir-941 -4 Ml 0005766 hsa-mi r-623 MI0003637 hsa-mir-6715a MI0022548 hsa-mir-942 Ml 0005767 hsa-mi '-624 MI0003638 hsa-mir-6715b MI0022549 hsa-mir-943 Ml 0005768 hsa-mi --625 Ml 0003639 hsa-mir-6716 MI0022550 hsa-mir-944 Ml 0005769 hsa-mi '-626 MI0003640 hsa-mir-6717 MI0022551 hsa-mir-95 Ml 0000097 hsa-mi '-627 MI0003641 hsa-mir-6718 MI0022553 hsa-mir-96 Ml 0000098 hsa-mi ■-628 MI0003642 hsa-mir-6719 MI0022554 hsa-mir-98 Ml 0000100 hsa-mi -629 MI0003643 hsa-mir-6720 MI0022555 hsa-mir-99a MI0000101 hsa-mii -630 MI0003644 hsa-mir-6721 MI0022556 hsa-mir-99b MI0000746 hsa-mir -631 Ml 0003645 hsa-mir-6722 MI0022557
hsa-mir -632 Ml 0003647 hsa-mir-6723 MI0022558 hsa-mir-633 MI0003648 hsa-mir-6724 MI0022559 hsa-mir-634 MI0003649 hsa-mir-675 MI0005416 hsa-mir-635 I0003650 hsa-mir-676 MI0016436 hsa-mir-636 MI0003651 hsa-mir-708 MI0005543 hsa-mir-637 l 0003652 hsa-mir-7-1 MI0000263 hsa-mir-638 MI0003653 hsa-mir-711 MI0012488 hsa-mir-639 MI0003654 hsa-mir-718 MI0012489 hsa-mir-640 MI0003655 hsa-mir-7-2 Ml 0000264

Claims

Claims
Method for identifying a compound modulating an interaction between two biomolecules or two domains of one biomolecule, the first biomolecule or first domain comprising at least one fluorophore donor and the second biomolecule or second domain comprising at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher overlap at least partially, comprising the steps of
(i) providing the first and second biomolecules or a biomolecule comprising said first and second domains,
(ii) providing a compound of interest,
(iii) contacting the first and second biomolecules or the biomolecule comprising the first and second domains with the compound of interest under conditions that allow for FRET (Forster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the fluorophore donor and the dark quencher,
(iv) identifying the compound of interest as a compound modulating, preferably inhibiting or enhancing an interaction between the two biomolecules or the two domains of the biomolecule if the FRET (Forster Resonance Energy Transfer) between the first and second biomolecules or the first and second domains differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.
Method according to claim 1 , wherein each of the first and second biomolecules or the biomolecule with the first and second domains is selected from the group consisting of polypeptides, sugars, polynucleotides, polyamines and lipids.
The method of claim 2, wherein the first biomolecule is selected from the group consisting of polypeptides interacting with polynucleotides and the second
biomolecule is selected from the group consisting of polynucleotides, preferably microRNA (miRNA).
4. The method of claim 3, wherein the polypeptide interacting with polynucleotides, preferably miRNA, is selected from
(i) the group consisting of FOX protein family members (Fox1 : NM_001142333.1→ NP_001135805.1 ; Fox2: NM_001031695.2→ NP_001026865.1 ; Fox3: NM_001082575.2→ NP_001076044.1), DAZ protein family members (BOLL: NM_033030.5→ NP_149019.1 ; DAZL: NM_001277863.1→ NP_001264792.1 ; DAZ1 : NM_004081.5→ NP_004072.3) , DND1 (NM_ 194249.2→ NP_919225.1), ELAV1 and ELAV-like protein family members (preferably ELAV1 : NM_001419.2 → NP_001410.2), GW182 protein family members (GW182: NM_001011116.1→ NP_001011116.1 ; TNRC6B: NM_001024843.1→ NP_001020014.1 ; TNRC6C: NM_001142640.1→ NP_001 36112.1), hnRNP protein family members, preferably hnRNPAI ( M_002136.2→ NP_002127.1), IGF2BP1
(NM_001160423.1→ NP_001153895.1), PABP protein family members, preferably PABPC1 (NM_002568.3→ NP_002559.2), SFRS1 (NM_001078166.1 → NP_001071634.1), DGCR8 (NM_001 90326.1→ NP_001177255.1), Dicerl (NM_001195573.1→ NP_001182502.1), Drosha (NM_001100412.1→ NP_001093882.1 ), TARBP2 (NM_004178.4→ NP_004169.3), FMR1
(NM_001185075.1→ P_001172004.1 ), FXR1 (NM_001013438.2→
NP_001013456.1 ), FXR2 (NM_004860.3→ NP_004851.2), KHSRP
(NM_003685.2→ NP_003676.2), STAR (NM_000349.2→ NP_000340.2), AGO protein family members, preferably AG01 (NM_012199.2→ NP_036331.1), TRIM proteins with NHL domain, preferably TRIM1 (NM_012216.3→ NP_036348.2), ZFP36 (NM_003407.3→ NP_003398.2), PUM1 (NM_001020658.1→
NP_001018494.1 ), PUM2 (NM_015317.1→ NP_056132.1), DDX5
(NM_004396.3→ NPJD04387.1), DDX6 (NM_001257191.1→
NP_001244120.1 ), DDX17 (NM_001098504.1→ NP_001091974.1), DDX20 (NM_007204.4→ NP_009135.4), DDX42 (NM_007372.2→ NP_031398.2), MOV10 (NM_001130079.1 (mRNA)→ NP_001123551.1), Lin28a (NM_024674.4 → NP_078950.1) and Lin28b (NM_0010043 7.3→ NP_001004317.1),
(ii) preferably the group consisting of hnRNPAI , KHSRP, Fox1 and Fox2, Lin28a and Lin28b,
(iii) more preferably the group consisting of Lin28b or Lin28a. The method of claim 4, wherein the polypeptide interacting with miRNA is Lin28, preferably selected from the group consisting of mammalian, preferably human, non- human primate, rodent, monkey, mouse, rat, chicken, pig, guinea pig Lin28a and Lin28b, most preferably human Lin28a or Lin28b or a functional fragment or functional derivative thereof.
The method of any of claims 2 to 5, wherein the polynucleotide is a pri- or pre-miRNA or mature miRNA, preferably selected from the group consisting of hsa-let-7a-1 , hsa- let-7a-2, hsa-let-7a-3 hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1 , hsa- let-7f-2, hsa-let-7g, hsa-let-7i, and functional derivatives or fragments thereof.
The method of any of claims 1 to 6, wherein the fluorophore donor is selected from fluorescent proteins and small fluorescent dye molecule,
(i) preferably fluorescent proteins selected from the group consisting of
(1.1 ) blue fluorescent proteins, preferably selected from the group consisting of EBFP, EBFP2, Azurite and imTagBFP,
(1.2) cyan fluorescent proteins, preferably selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl , Midori-lshi Cyan, TagCFP and mTFP1 (Teal),
(1.3) yellow fluorescent proteins, preferably selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana,
(1.4) orange fluorescent proteins, preferably selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (T1 ), DsRed-Monomer and mTangerine,
(1.5) red fluorescent proteins, preferably selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFP1 , JRed, mCherry, HcRedl , mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum and AQ143, and
(1.6) green fluorescent proteins (GFP), preferably selected from the group
consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire,
more preferably green fluorescent proteins (i.6) and yellow fluorescent proteins (i.3), most preferably EGFP;
(ii) preferably small fluorescent dye molecules selected from the group consisting of ii.1 ) acridines, preferably acridine orange or acridine yellow, (11.2) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7,
(11.3) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosin, Eosin B, Eosin Y or Erythrosine,
(11.4) oxazines, preferably Cresyl violet, Nile blue or Nile red,
(11.5) phenanthridines, preferably Ethidium bromide, Gelred or Propidium iodide, and
(11.6) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101 , Sulforhodamine B or Texas red,
(iii) more preferably cyanine and rhodamine dyes.
8. The method of any of claims 1 to 7, wherein the fluorophore acceptor is selected from the group consisting of
(i) acridines, preferably acridine orange or acridine yellow,
(ii) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 or Cy7,
(iii) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosin, Eosin B, Eosin Y or Erythrosine,
(iv) oxazines, preferably Cresyl violet, Nile blue or Nile red,
(v) phenanthridines, preferably ethidium bromide, Gelred or propidium iodide, and
(vi) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G,
Rhodamine B, Auramine, Sulforhodamine 101 , Sulforhodamine B or Texas red, preferably cyanines (ii), more preferably Cy3.
9. The method of any of claims 1 to 8, wherein the dark quencher selected from the
group consisting of Dabcyl, Dabsyl, Black Hole Quencher (BHQ™) dyes, preferably BHQ-0, BHQ-1 , BHQ-2 or BHQ-3, QXL quenchers, preferably QXL 490, QXL 570, QXL 610, QXL 670, or QXL 680, Iowa Black quenchers, preferably Iowa black FQ or Iowa Black RQ, and IRDyes, preferably IRDye 800, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, more preferably Black Hole Quencher (BHQ™) dyes, most preferably BHQ-1.
10. The method of any of claims 1 to 9, wherein the spectrally paired fluorophore donor and fluorophore acceptor or the spectrally paired fluorophore donor and dark quencher are selected from the group consisting of protein-protein pairs, preferably selected from the group consisting of ECFP- Citrine, ECFP-Venus, Cerulean-Citrine, Cerulean-Venus, Cerulean-Ypet, Cerulean-YFP, CyPet-EYFP, CyPet-Venus, CyPet-YPet, CyPet-Citrine, mTurquoise-Venus, mTurquoise-Ypet, mTurquoise-Citrine, ECFP-EYFP, TagGFP-TagRFP, mTFP1 -Citrine, Citrine-mKate2, mTurquoisel-SEYFP, mTurquoise2-SEYFP and clover-mRuby2,
protein-organic dye pairs, preferably selected from the group consisting of EGFP-mCherry, SYFP2-mStrawberry, mTFP1-mOrange, Clover-mCherry, GFP- Cy3, YFP-Cy3, ECFP-BHQ-0, EYFP-BHQ-2, EGFP-Cy3 and EGFP-BHQ-1 , organic dye-organic-dye pairs, preferably selected from the group consisting of mOrange-mCherry, Alexa488-Alexa555, Alexa488-Cy3, Alexa 568-Alexa633, Cy3-Cy5, Alexa 488-Alexa514, Alexa488-Alexa532, Alexa488-546, Alexa488- 610, Alexa647-Alexa 680, Alexa647-Alexa680, Alexa647-Aelxa700, Alexa647- Alexa750, BHQ-1-FAM, BHQ-1-TET, BHQ-1-JOE, BHQ-1-HEX, BHQ-1 -Oregon green, BHQ-2-TAMRA, BHQ-2-ROX, BHQ-2-Cy3, BHQ-2-Cy3.5, BHQ-2-CAL Red, BHQ-2-Red 640, BHQ-3-Cy5, or BHQ-3-Cy5.5, Dabcyl-Edans and Dabsyl- Edans, fluorescine.
1 1. The method of any of claims 1 to 10, wherein the first biomolecule is Lin28(a or b) and the second biomolecule is pri- or pre-let-7a-2 or functional derivatives or fragments of these biomolecules.
12. The method of claim 11 , wherein the fluorophore donor is at least one green
fluorescent protein or yellow fluorescent protein and the fluorophore acceptor is at least one Cy3.
13. The method of claim 11 , wherein the fluorophore donor is at least one green
fluorescent protein or yellow fluorescent protein and the dark quencher is at least one dark quencher, preferably at least one black hole quencher (BHQ™), more preferably at least one BHQ-1.
14. The method of claim 11 , wherein the at least one fluorophore donor is bound to the N- and/or C-terminal position of Lin28a or Lin28b and the at least one fluorophore acceptor and/or at least one black quencher (BHQ™) dye is bound to at least one of positions 1 to 67, preferably 5 to 60, more preferably 10 to 57, most preferably one of positions 10, 19, 34 and 57 of pri- or pre-let-7a-2.
15. The method of claim 14, wherein the at least one fluorophore donor, preferably GFP, more preferably EGFP is bound to the N- and/or C-terminal position of Lin28a or Lin28b and the at least one fluorophore acceptor, preferably Cy3 and/or at least one black hole quencher (BHQ™), preferably BHQ-1 is bound to at least one, preferably at least two of positions 10, 19, 34 and 57 of pri- or pre-let-7a-2, preferably to positions 10 and 19 or positions 10 and 34.
PCT/EP2014/001548 2013-06-07 2014-06-06 Fret-method for identifying a biomolecule-modulating compound Ceased WO2014195026A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13002949.9A EP2811298A1 (en) 2013-06-07 2013-06-07 FRET-Method for identifying a biomolecule-modulating compound
EP13002949.9 2013-06-07

Publications (2)

Publication Number Publication Date
WO2014195026A2 true WO2014195026A2 (en) 2014-12-11
WO2014195026A3 WO2014195026A3 (en) 2015-03-19

Family

ID=48628236

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/001548 Ceased WO2014195026A2 (en) 2013-06-07 2014-06-06 Fret-method for identifying a biomolecule-modulating compound

Country Status (2)

Country Link
EP (1) EP2811298A1 (en)
WO (1) WO2014195026A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117070620A (en) * 2023-07-31 2023-11-17 苏州京脉生物科技有限公司 A marker and method for identifying girls with central precocious puberty in vitro

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BE1022918B1 (en) * 2015-05-12 2016-10-17 Silvema Bvba METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS
EP3418348A1 (en) * 2017-06-21 2018-12-26 Université de Strasbourg Dye-loaded fluorescent polymeric nanoparticles as nano-antenna

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009048935A2 (en) 2007-10-08 2009-04-16 Hale John T Method, apparatus, and magnet for magnetically treating fluids

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE112005002567T5 (en) * 2004-10-19 2007-11-22 Wallac Oy A new probe and its use in bioaffinity analyzes
US20060257915A1 (en) * 2005-05-13 2006-11-16 Pronucleotein Biotechnologies, Llc Methods of producing competitive aptamer fret reagents and assays

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009048935A2 (en) 2007-10-08 2009-04-16 Hale John T Method, apparatus, and magnet for magnetically treating fluids

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
ALTSCHUL ET AL., J. MOL- BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL.: "BLAST handbook", NCB NLM NIH
HUANG; MILLER, ADV. APPL. MATH., vol. 12, 1991, pages 337 - 357
KVACH ET AL., RUSS. CHEM. BULL., vol. 55, 2006, pages 159 - 163
LEHRBACH; MISKA: "Regulation of pre-miRNA Processing", 2010, SPRINGER
MACRO ROLE, CELL, 2010
ROOS ET AL.: "Antisense oligonucleotides inhibit LIN28 binding to pre-let-7' Keystone Conference", NONCODING RNAS IN DEVELOPMENT AND GANCER, 20 January 2013 (2013-01-20)
SAMBROOK; RUSSELL: "Molecular cloning: A laboratory manual", vol. 3, 2001
THORNTON ET AL.: "How does Lin28 let-7 control development and disease", TRENDS IN CELL BIOLOGY, 2012
VISWANATHAN ET AL., NAT GEN, vol. 41, 2009, pages 843
YAO ET AL., J. ORG. CHEM., vol. 69, 2004, pages 1720 - 1722
YEOM, EMBO REPORTS, vol. 12, no. 7, 2011, pages 690 - 696

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117070620A (en) * 2023-07-31 2023-11-17 苏州京脉生物科技有限公司 A marker and method for identifying girls with central precocious puberty in vitro

Also Published As

Publication number Publication date
WO2014195026A3 (en) 2015-03-19
EP2811298A1 (en) 2014-12-10

Similar Documents

Publication Publication Date Title
Truesdell et al. MicroRNA-mediated mRNA translation activation in quiescent cells and oocytes involves recruitment of a nuclear microRNP
Lim et al. Discovery of a small-molecule inhibitor of protein–microRNA interaction using binding assay with a site-specifically labeled Lin28
Zhang et al. Caged circular siRNAs for photomodulation of gene expression in cells and mice
Lee et al. In situ single step detection of exosome microRNA using molecular beacon
Van Etten et al. Human Pumilio proteins recruit multiple deadenylases to efficiently repress messenger RNAs
Wang et al. Live-cell RNA imaging with metabolically incorporated fluorescent nucleosides
KR101862080B1 (en) Pharmaceutical composition for treating cancer comprising miRNA
Haizel et al. 5′-UTR recruitment of the translation initiation factor eIF4GI or DAP5 drives cap-independent translation of a subset of human mRNAs
Xu et al. Target-induced structure switching of hairpin aptamers for label-free and sensitive fluorescent detection of ATP via exonuclease-catalyzed target recycling amplification
Prasanth et al. Nuclear organization and dynamics of 7SK RNA in regulating gene expression
Wang et al. SP1‐SYNE1‐AS1‐miR‐525‐5p feedback loop regulates Ang‐II‐induced cardiac hypertrophy
Chauderlier et al. Tau/DDX6 interaction increases microRNA activity
Dou et al. Genetically encoded dual-color light-up RNA sensor enabled ratiometric imaging of MicroRNA
US20200393447A1 (en) Biosensors for measuring cell signaling in stressed and healthy cells
Zhou et al. Deregulation of miRNA-181c potentially contributes to the pathogenesis of AD by targeting collapsin response mediator protein 2 in mice
Ziemniak et al. Synthesis and evaluation of fluorescent cap analogues for mRNA labelling
Kanoksinwuttipong et al. Shrimp pmo-miR-750 regulates the expression of sarcoplasmic calcium-binding protein facilitating virus infection in Penaeus monodon
EP2811298A1 (en) FRET-Method for identifying a biomolecule-modulating compound
Liu et al. Insights into the repression of fibroin modulator binding protein-1 on the transcription of fibroin H-chain during molting in Bombyx mori
Hu et al. Quantitative proteomics reveals diverse roles of miR-148a from gastric cancer progression to neurological development
Yoon et al. Interleukin-10 control of pre-miR155 maturation involves CELF2
US10584340B2 (en) Tau protein-binding DNA aptamers with capture/detection and therapeutic utilities in tauopathy-related neurodegenerative disorders
Lu et al. The non-specific binding of fluorescent-labeled MiRNAs on cell surface by hydrophobic interaction
de Mendonça Amarante et al. The DNA chaperone HMGB1 potentiates the transcriptional activity of Rel1A in the mosquito Aedes aegypti
Fuller-Pace et al. DEAD-box RNA helicases as transcription cofactors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14737139

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 14737139

Country of ref document: EP

Kind code of ref document: A2