BE1022918B1 - METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS - Google Patents

METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS Download PDF

Info

Publication number
BE1022918B1
BE1022918B1 BE2015/5297A BE201505297A BE1022918B1 BE 1022918 B1 BE1022918 B1 BE 1022918B1 BE 2015/5297 A BE2015/5297 A BE 2015/5297A BE 201505297 A BE201505297 A BE 201505297A BE 1022918 B1 BE1022918 B1 BE 1022918B1
Authority
BE
Belgium
Prior art keywords
mirna
domain
binding
protein
domain binding
Prior art date
Application number
BE2015/5297A
Other languages
Dutch (nl)
Inventor
Karen VERMUYTEN
Original Assignee
Silvema Bvba
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Silvema Bvba filed Critical Silvema Bvba
Priority to BE2015/5297A priority Critical patent/BE1022918B1/en
Application granted granted Critical
Publication of BE1022918B1 publication Critical patent/BE1022918B1/en

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896Neurological disorders, e.g. Alzheimer's disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/02Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders
    • G01N2800/2814Dementia; Cognitive disorders

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

De onderhavige uitvinding heeft betrekking op MicroRNA's (miRNA), hetgeen enkelstrengs niet-coderende RNA's zijn. In het bijzonder het gebruik van een KH-domein bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattende het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH- domein van een proteïne.The present invention relates to MicroRNAs (miRNA), which are single stranded non-coding RNAs. In particular, the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain of a protein.

Description

METHODE VOOR HET IDENTIFICEREN VAN MODULATORS VAN DE INTERACTIE TUSSEN KH-DOMEIN BINDENDE MICRORNA'S EN KH-DOMEIN BEVATTENDE PROTEÏNENMETHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS

ACHTERGROND VAN DE UITVINDINGBACKGROUND OF THE INVENTION

MicroRNA's (miRNA's) zijn enkelstrengs niet-coderende RNA's. Ze zijn een totaal nieuwe klasse van genregulators die kunnen functioneren door het binden van het 3' niet-getranslateerd gebied van doelwit boodschapper-RNA's (mRNA's) leidend tot hetzij suppressie van hun translatie of versnelling van hun degradatie.MicroRNAs (miRNAs) are single-stranded non-coding RNAs. They are a totally new class of gene regulators that can function by binding the 3 'untranslated region of target messenger RNAs (mRNAs) leading to either suppression of their translation or acceleration of their degradation.

De meerderheid van de miRNA's (canoniek biogenesepad) worden eerst door RNA-polymerase II getranscribeerd als primaire transcripties (pri-miRNA's) die verder moeten worden verwerkt om een werkend afgewerkt miRNA op te leveren. Pri-miRNA's worden in de nucleus verwerkt door het RNAse III enzym Drosha, samenwerkend met DGCR8 (in gewervelden) of Pasha (in ongewervelden), en transformeren pri-miRNA's naar kortere dubbelstrengs RNA's (dsRNA's) haarspeldstructuren, genaamd precursor-miRNA's (pre-miRNA's). Pre-miRNA's worden vervolgens vanuit de nucleus naar het cytoplasma getransporteerd en worden door Dicer verwerkt tot volledig afgewerkte miRNA's.The majority of the miRNAs (canonical biogenesis pathway) are first transcribed by RNA polymerase II as primary transcripts (prim-miRNAs) that must be further processed to yield a working-finished miRNA. Pri-miRNAs are processed in the nucleus by the RNAse III enzyme Drosha, cooperating with DGCR8 (in vertebrates) or Pasha (in invertebrates), and transform pri-miRNAs into shorter double-stranded RNAs (dsRNAs) hairpin structures, called precursor miRNAs (pre- miRNAs). Pre-miRNAs are then transported from the nucleus to the cytoplasm and are processed by Dicer into fully finished miRNAs.

Afgewerkte miRNA's treden het effectorcomplex binnen, genaamd het RNA-Induced Silencing Complex (RISC) met als doelwit enkelstrengs complementaire mRNA's voor translatierepressie of mRNA degradatie. miRNA's worden ook geproduceerd via niet-canonieke paden, zoals het spliceosomaal afhankelijk mechanisme.Finished miRNAs enter the effector complex, called the RNA-Induced Silencing Complex (RISC), targeting single-stranded complementary mRNAs for translation repression or mRNA degradation. miRNAs are also produced via non-canonical pathways, such as the spliceosomal dependent mechanism.

MicroRNA's spelen belangrijke rollen in processen zo divers als normale ontwikkeling en cellulaire homeostase. Ze kunnen bij diverse ziektes worden gebruikt als biomarkers.MicroRNAs play important roles in processes as diverse as normal development and cellular homeostasis. They can be used as biomarkers in various diseases.

Echter, data in de voorafgaande stand van de techniek met betrekking tot het gebruik van miR's als biomarkers in monsters van patiënten met neurologische ziektebeelden zijn verwarrend en spreken elkaar tegen. WO2012145363 gepubliceerd op 26 oktober 2012, beschrijft miR-125b en miR-7 als een synaps- of neuriet-miR dat samen met miR-16 in serum kan worden gebruikt om onderscheid te kunnen maken tussen patiënten met milde cognitieve aandoeningen en patiënten met Alzheimer. Van deze miR's wordt gerapporteerd dat ze meer voorkomen. WO2015038593 gepubliceerd op 19 maart 2015, beschrijft de verhoogde aanwezigheid van miR-125b en miR-7 in primaire corticale neuronen. WO2013122918 gepubliceerd op 22 augustus 2013, beschrijft de aanwezigheid van miR-199 in neuroblastoma xenotransplantaties. WO2014152932 gepubliceerd op 25 september 2014, beschrijft een verlaagde expressie van miR-7 in patiënten met glioblastoma. W02013003350 gepubliceerd op 3 januari 2013, beschrijft een verlaagde expressie van miR-15b in plasma van patiënten met Alzheimer. WO2014152243 gepubliceerd op 25 september 2014, beschrijft een verhoogde expressie van miR-15a en miR-16-2 in plasma van honderdjarigen. W02015004413 gepubliceerd op 15 januari 2015, beschrijft een naar boven bijstelling van miR-15a, miR-16-1 en miR-15b in serum van glioblastoma patiënten en een naar beneden bijstelling van miR-16-1 in een glioblastoma cellijn versus normale astrocyten. W02014012047 gepubliceerd op 16 januari 2014, beschrijft een verhoogde expressie van miR-33 in een met lovostatin behandelde medulloblastoom cellijn. KH-domeinen worden genoemd naar HNRNPK, het proteïne waarin ze als eerste werden ontdekt. KH-domeinen zijn structureel geconserveerde reeksen van ongeveer 70 aminozuren. Ze kunnen als meervoudige kopieën in diverse proteïnen voorkomen en in samenwerking of onafhankelijk functioneren. Hun bindingsoppervlak is een spleet waarin standaard slechts vier ongepaarde basen passen. Vanderwaalskrachten, hydrofobe interacties en elektrostatische interacties kunnen bijdragen tot de nucleïnezuurbindings-affiniteit en kunnen derhalve voor verschillende proteïnen en zelfs tussen KH-domeinen van hetzelfde proteïne anders zijn. Interacties en bindingsaffiniteit zijn afhankelijk van de secundaire structuur en volgorde van het mRNA. De zogenaamde 'Vergrootte' KH-domeinen hebben extra bindingsplaatsen. HNRNPK kan binden aan de haarspeld RNA-structuren en aan RNA in uitgestrekte vorm terwijl PCBP1, PCBP2, PCBP3 en PCBP4, RNA in uitgestrekte vorm aan zich binden.However, prior art data regarding the use of miRs as biomarkers in samples from patients with neurological disorders are confusing and contradictory. WO2012145363 published October 26, 2012, describes miR-125b and miR-7 as a synapse or neurite miR that can be used in conjunction with miR-16 in serum to distinguish between patients with mild cognitive disorders and patients with Alzheimer's. These miRs are reported to be more prevalent. WO2015038593 published March 19, 2015, describes the increased presence of miR-125b and miR-7 in primary cortical neurons. WO2013122918 published on August 22, 2013, describes the presence of miR-199 in neuroblastoma xenografts. WO2014152932 published September 25, 2014, describes a reduced expression of miR-7 in patients with glioblastoma. WO2013003350 published January 3, 2013, describes a reduced expression of miR-15b in plasma from patients with Alzheimer's. WO2014152243 published September 25, 2014, describes an increased expression of miR-15a and miR-16-2 in plasma of centenarians. WO2015004413 published January 15, 2015, describes an upward adjustment of miR-15a, miR-16-1 and miR-15b in serum of glioblastoma patients and a downward adjustment of miR-16-1 in a glioblastoma cell line versus normal astrocytes. WO2014012047 published January 16, 2014, describes an increased expression of miR-33 in a lovostatin-treated medulloblastoma cell line. KH domains are named after HNRNPK, the protein in which they were first discovered. KH domains are structurally conserved sets of approximately 70 amino acids. They can occur as multiple copies in various proteins and function in collaboration or independently. Their binding surface is a gap in which only four unpaired bases fit as standard. Vanderwaal forces, hydrophobic interactions and electrostatic interactions may contribute to nucleic acid binding affinity and may therefore be different for different proteins and even between KH domains of the same protein. Interactions and binding affinity depend on the secondary structure and sequence of the mRNA. The so-called 'Enlarged' KH domains have extra binding sites. HNRNPK can bind to the hairpin RNA structures and to extended RNA, while PCBP1, PCBP2, PCBP3 and PCBP4 bind RNA in extended form.

Extracellulair vesicula (EV's) zijn vesicula met een diameter van 50-300 nm die door de meeste cellen worden uitgescheiden en/of afgescheiden in het extracellulaire medium door ofwel de fusie van endosomale compartimenten, genaamd multivesiculaire lichamen, met het plasmamembraan, resulterend in exosoomtype EV's of via directe afscheiding vanuit het plasmamembraan resulterend in ectosoomtype EV's. EV's hebben een belangrijke rol in communicatie tussen cellen, aangetoond hebbende dat de nucleïnezuren die ze bevatten, bij voorkeur van het type RNA, waaronder mRNA's, microRNA (miRNA) en andere RNA's, door de afscheidende en uitscheidende cellen functioneel worden overgedragen en in de specifieke receptorcellen of doelcellen worden ingebouwd waar zij hun functie zullen vervullen. Het feit dat exosomen RNA-type regulerende nucleïnezuren bevatten, wijst op hun belangrijke rol in de overdracht van genetische informatie tussen verschillende cellen in het lichaam. WO2014049125 gepubliceerd op 3 april 2014, onthult het gebruik van geïsoleerde korte reeksmotieven in staat tot het aansturen of verpakken van regulerende nucleïnezuren, bij voorkeur RNA's, in extracellulaire vesiculi, bij voorkeur exosomen.Extracellular vesicles (EVs) are vesicles with a diameter of 50-300 nm that are secreted and / or secreted by most cells into the extracellular medium by either the fusion of endosomal compartments, called multivesicular bodies, with the plasma membrane, resulting in exosome-type EVs or via direct separation from the plasma membrane resulting in ectosome type EVs. EVs play an important role in communication between cells, having demonstrated that the nucleic acids they contain, preferably of the RNA type, including mRNAs, microRNA (miRNA) and other RNAs, are functionally transferred by the secreting and secreting cells and into the specific cells receptor cells or target cells are built in where they will fulfill their function. The fact that exosomes contain RNA type regulatory nucleic acids points to their important role in the transfer of genetic information between different cells in the body. WO2014049125 published April 3, 2014, discloses the use of isolated short series motifs capable of driving or packaging regulatory nucleic acids, preferably RNAs, in extracellular vesicles, preferably exosomes.

Er wordt overwogen gemodificeerde DNA- en/of RNA-oligonucleotiden te gebruiken als de voornaamste wapens voor het in bedwang houden van de werking van kankerverwekkende miRNA's of het nabootsen van tumoronderdrukkende miRNA's. Echter, als aanvulling op de algemene moeilijkheden bij het ontwikkelen van medicijnen, zijn er drie intrinsieke nadelen van deze benadering. Ten eerste hebben deze oligonucleotides een te grote afmeting.The use of modified DNA and / or RNA oligonucleotides is contemplated as the primary weapons for controlling the action of carcinogenic miRNAs or simulating tumor-suppressing miRNAs. However, in addition to the general difficulties in developing drugs, there are three intrinsic disadvantages of this approach. Firstly, these oligonucleotides are too large in size.

Experimenteel gemodificeerde oligonucleotiden getest op knaagdieren en primaten zijn in het algemeen langer dan 15 basen. Daar tegenover staat dat het moleculaire gewicht van de meeste oraal actieve medicijnen voor humaan gebruik niet groter is dan 500 Dalton. Ten tweede worden DNA- en RNA-oligonucleotiden vermoedelijk door het menselijk lichaam beschouwd als vreemd en lokken daardoor een immuunreactie uit. Ten derde zullen gemodificeerde oligonucleotiden zichzelf vermoedelijk gaan gedragen als miRNA's die zich op honderden zo niet duizenden transcripties in mensen kunnen richten, terwijl slechts zeven of acht nucleotiden nodig zijn voor miRNA's om hun doelwitten effectief in bedwang te kunnen houden. WO2013019469 gepubliceerd op 7 februari 2013, beschrijft een methode voor het identificeren van agentia die miRNA-activiteit moduleren. WO2014195026 gepubliceerd op 11 december 2014 beschrijft een FRET voor het identificeren van verbindingen die biologische moleculen moduleren.Experimentally modified oligonucleotides tested on rodents and primates are generally longer than 15 bases. On the other hand, the molecular weight of most orally active drugs for human use does not exceed 500 Dalton. Secondly, DNA and RNA oligonucleotides are presumably considered foreign by the human body and thereby elicit an immune response. Third, modified oligonucleotides are likely to behave as miRNAs that can target hundreds if not thousands of transcriptions in humans, while only seven or eight nucleotides are required for miRNAs to effectively control their targets. WO2013019469 published February 7, 2013, describes a method for identifying agents that modulate miRNA activity. WO2014195026 published December 11, 2014 describes a FRET for identifying compounds that modulate biological molecules.

Naast in vitro screenen kunnen medicijnen ook worden gescreend in cellijnen en organismen zoals gist en bacteriën en deze technieken hebben historisch een belangrijke rol gespeeld bij het identificeren van biologisch actieve moleculen. Het gebruik van deze micro-organismemodellen voor het ontdekken van medicijnen wordt belemmerd door het feit dat eencellige organismen belangrijke families van aangrijpingspunten missen, die worden gevonden in meercelligen (zoals tyrosinekinases, hormoonreceptors in de nucleus). Bovendien, tonen veel medicijnen alleen fysiologische activiteit in meercellige volledige organismen vanwege het complexe netwerk van interacties binnen een biologisch systeem. Het testen op volledige dieren zoals muizen, honden en apen kan ondoenbaar zijn bij het testen van vele duizenden of miljoenen verbindingen vanwege de kosten en tijd voor het opfokken en behuizen, onderhouden en testen van dieren. Daarom zijn dierproeven beperkt tot veel kleinere selectievere screenings.In addition to in vitro screening, drugs can also be screened in cell lines and organisms such as yeast and bacteria and these techniques have historically played an important role in identifying biologically active molecules. The use of these microorganism models for drug discovery is hampered by the fact that single-celled organisms lack important families of targets that are found in multicellular organisms (such as tyrosine kinases, hormone receptors in the nucleus). In addition, many drugs only show physiological activity in multicellular whole organisms because of the complex network of interactions within a biological system. Testing complete animals such as mice, dogs, and monkeys may not be feasible when testing many thousands or millions of compounds due to the cost and time of rearing, housing, maintaining, and testing animals. That is why animal testing is limited to much smaller, more selective screenings.

Recent is voorgesteld een klein snel groeiend organisme te gebruiken als model voor kleine dieren voor het screenen van verbindingen. Microfluïde apparaten die bestaan uit stromings- en regellagen gemaakt van flexibele polymeren waar de stromingslagen microkanalen bevatten voor het manipuleren van kleine dieren, ze te immobiliseren voor het maken van beeldopnamen en het leveren van media en reagentia zijn beschreven. Een belangrijk praktisch probleem is echter een dikke cuticula en intestinale bedekking die een fysieke barrière vormt voor vele chemische stoffen alsmede een groot aantal xenobiotische pompen en detoxificatie-enzymen voor medicijnen die de absorptie van veel verbindingen voorkomt of vertraagt. Om deze reden is een systeem wenselijk dat deze problemen overwint. WO2015038987 gepubliceerd op 19 maart 2015 beschrijft systemen en methoden voor het in korte tijd screenen van heel veel verbindingen in volledige dieren.It has recently been proposed to use a small fast-growing organism as a model for small animals for screening compounds. Microfluidic devices consisting of flow and control layers made of flexible polymers where the flow layers contain microchannels for manipulating small animals, immobilizing them for taking images and supplying media and reagents have been described. An important practical problem, however, is a thick cuticle and intestinal covering that forms a physical barrier to many chemicals as well as a large number of xenobiotic pumps and detoxification enzymes for drugs that prevents or delays the absorption of many compounds. For this reason, a system is desirable that overcomes these problems. WO2015038987 published on March 19, 2015 describes systems and methods for screening very many compounds in complete animals in a short time.

Er blijft dus een behoefte bestaan voor het ontwikkelen van niet alleen verbeterde en beter getypeerde biomarkers, screeningsmethoden en systemen maar ook voor het identificeren van nieuwe en bestaande farmaceutische agentia die kunnen worden gebruikt voor het behandelen van met name tumoren en neurodegeneratie.Thus, there remains a need to develop not only improved and better-typed biomarkers, screening methods and systems, but also to identify new and existing pharmaceutical agents that can be used to treat, in particular, tumors and neurodegeneration.

SAMENVATTING VAN DE UITVINDINGSUMMARY OF THE INVENTION

Onderhavige uitvinding biedt KH-domein bindende miRNA's aan die een interactie aangaan met KH-domein bevattende proteïnen en nuttig kunnen zijn voor het oplossen van het bovenstaand beschreven probleem.The present invention offers KH domain binding miRNAs that interact with KH domain containing proteins and may be useful for solving the problem described above.

Een eerste aspect van onderhavige uitvinding is het gebruik van een KH-domein bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattend het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH-domein van een proteïne. Voornoemd KH-domein bindend miRNA kan een afgewerkt miRNA zijn, een afgewerkt isomeer miRNA, een pre-miRNA, een pri-miRNA of iedere combinatie daarvan.A first aspect of the present invention is the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to modify interaction of said KH domain binding miRNA with a protein KH domain. Said KH domain binding miRNA can be a finished miRNA, a finished isomeric miRNA, a pre-miRNA, a prim-miRNA or any combination thereof.

Bij voorkeur wordt voornoemd KH-domein bindend miRNA geselecteerd uit miRNA-125b-5p, pre-miRNA-125b-l, pri-miRNA-125b-l, miRNA-199b-5p, pre-miRIMA-199b, pri-miRI\IA-199b/ miRIMA-7-2-3p, miRIMA-7-3-3p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri-miRNA-7-3, miR- 3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b of pri-miR-33b. Voornoemd KH-domein bindend miRNA kan onderdeel uitmaken van, groeperen met of complementair zijn met een ander miRNA, een IncRNA, een lincRNA, een piwiRNA, een pseudogen RNA-transcriptie, een gen RNA-transcriptie, een RNA-transcriptie, overlappende gen RNA-transcripties of combinaties daarvan en kan als zodanig een interactie aangaan met het KH-domein bevattende proteïne.Preferably, said KH domain binding miRNA is selected from miRNA-125b-5p, pre-miRNA-125b-1, prim-miRNA-125b-1, miRNA-199b-5p, pre-miRIMA-199b, pri-miRI-IA -199b / miRIMA-7-2-3p, miRIMA-7-3-3p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri-miRNA-7-3 , miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b or pri-miR-33b. Said KH domain binding miRNA can be part of, group with or complementary to another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogen RNA transcription, a gene RNA transcription, an RNA transcription, overlapping gene RNA transcripts or combinations thereof and as such can interact with the KH domain-containing protein.

In een belichaming van het eerste aspect van de uitvinding die meer de voorkeur verdient (a) is het KH-domein bindende miRNA, miRNA-125b-5p, pre-miRNA-125b-l of pri-miRNA-125b-l en (b) is het andere miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2 ; en/of (c) is de gen RNA transcriptie, BLID en/of (d) is het IncRNA, miR-lOOHG.In a more preferred embodiment of the first aspect of the invention, (a) the KH domain is binding miRNA, miRNA-125b-5p, pre-miRNA-125b-1 or prim-miRNA-125b-1 and (b ) the other is miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2; and / or (c) is the gene RNA transcription, BLID and / or (d) is the IncRNA, miR-100HG.

In een verder meer de voorkeur verdienende uitvoering van het eerste aspect van de uitvinding (a) is het KH-domein bindende miRNA, miRNA-199b-5p, pre-miRNA-199b of pri-miRNA-199b, en (b) is het andere miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, pri-miRNA-219a-2; en/of (c) is de gen RNA transcriptie DNM1 of PTGES2.In a further more preferred embodiment of the first aspect of the invention (a), the KH domain is binding miRNA, miRNA-199b-5β, pre-miRNA-199b, or prim-miRNA-199b, and (b) is other miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, prim-miRNA-219a-2; and / or (c) the RNA RNA transcription is DNM1 or PTGES2.

In een andere verder meer de voorkeur verdienende uitvoering van het eerste aspect van de uitvinding (a) is het KH-domein bindende miRNA, miRNA-7-2-3p,miRNA-7-3-3p, pre-miRI\IA-7-2, pre-miRNA-7-3, pri-miRI\IA-7-2 of pri-miRNA-7-3, en/of (b) is het lincRNA, miR-7-3HG.In another further more preferred embodiment of the first aspect of the invention (a) is the KH domain binding miRNA, miRNA-7-2-3p, miRNA-7-3-3p, pre-miRI \ IA-7 -2, pre-miRNA-7-3, prim-miRI-IA-7-2 or prim-miRNA-7-3, and / or (b) is the lincRNA, miR-7-3HG.

In een andere verder meer de voorkeur verdienende uitvoering van het eerste aspect van de uitvinding (a) is het KH-domein bindende miRIMA, miRNA-3613-3p, pre-miRNA-3613 of pri-miRNA-3613, en (b) is het andere miRIMA, miRIMA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-l-3p, miR-16-2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, pri-miRNA-15a, pri-miRIMA-15b, pri-miRNA-16-1 of pri-miRNA-16-2, en/of (c) is de gen RNA transcriptie van TRIM 13 of TRIM59, en/of (d) is het IncRNA DLEU2 of RP11-432B6.3.In another further more preferred embodiment of the first aspect of the invention (a) is the KH domain binding miRIMA, miRNA-3613-3p, pre-miRNA-3613 or prim-miRNA-3613, and (b) is the other miRIMA, miRIMA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-1-3p, miR-16-2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, prim-miRNA-15a, prim-miRIMA-15b, prim-miRNA-16-1, or pri- miRNA-16-2, and / or (c) is the gene RNA transcription of TRIM 13 or TRIM59, and / or (d) is the IncRNA DLEU2 or RP11-432B6.3.

In nog eens een andere verder meer de voorkeur verdienende uitvoering van het eerste aspect van de uitvinding (a) is het KH-domein bindende miRNA, miRNA-33b-3p, pre-miRNA-33b of pri-miRNA-33b, en (b) is de gen RNA transcriptie van SREBF1, en/of (c) is het IncRNA SMCR5.In yet another further more preferred embodiment of the first aspect of the invention (a) is the KH domain binding miRNA, miRNA-33b-3p, pre-miRNA-33b or prim-miRNA-33b, and (b ) is the gene RNA transcription of SREBF1, and / or (c) is the IncRNA SMCR5.

In een tweede aspect van de uitvinding is het KH-domein van een proteïne zoals AKAP1, ANKHD1, ANKRD17, ASCC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 of TDRKH. Bij voorkeur is voornoemd KH-domein van een proteïne zoals BICC1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, PCBP1, PCBP2, PCBP3 of PCBP4. Meest preferent is voornoemd KH-domein van een proteïne zoals BICC1, HDLBP, HNRNPK, PCBP1, PCBP2, PCBP3 of PCBP4.In a second aspect of the invention, the KH domain is of a protein such as AKAP1, ANKHD1, ANKRD17, ASCC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP2, IGF2BP2, IGF2BP2, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 or TDRKH. Preferably, said KH domain is of a protein such as BICC1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, PCBP1, PCBP2, PCBP3 or PCBP4. The most preferred is said KH domain of a protein such as BICC1, HDLBP, HNRNPK, PCBP1, PCBP2, PCBP3 or PCBP4.

In een derde aspect van de uitvinding maakt het KH-domein bindend miRNA deel uit van een complex bestaande uit het KH-domein bevattend proteïne en een of meerdere andere proteïnes, RNA's, DNA's of iedere combinatie daarvan. Voornoemd KH-domein bevattende proteïne kan zijn AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 of TDRKH. Voornoemd ander proteïne kan onderdeel uitmaken van het EGFR pad, het cholesterol pad, het LXR pad of het LRP pad.In a third aspect of the invention, the KH domain binding miRNA is part of a complex consisting of the KH domain-containing protein and one or more other proteins, RNAs, DNAs, or any combination thereof. Said KH domain-containing protein may be AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BPB, IGF2BPB, IGF2BPB, IGF2BPB, IGF2BPB, IGH2 KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 or TDRKH. The aforementioned other protein may be part of the EGFR path, the cholesterol path, the LXR path or the LRP path.

In een vierde aspect van de uitvinding bevat het KH-domein bindende miRNA ten minste één fluorofoordonor en het KH-domein bevattende proteïne ten minste één fluorofooracceptor of een 'dark quencher', waarin de fluorofoordonor en fluorofooracceptor of de fluorofoordonor en 'dark quencher' zodanig spectraal worden gepaard dat het energiespectrum uitgezonden door de fluorofoordonor en het excitatie-energiespectrum van de fluorofooracceptor of het energiespectrum geabsorbeerd door de 'dark quencher' elkaar ten minste gedeeltelijk overlappen, worden volgende stappen omvat (a) het leveren van voornoemd KH-domein bindend miRNA en voornoemd KH-domein bevattend proteïne, (b) het leveren van een potentieel therapeutisch agens, (c) in contact brengen van voornoemd KH-domein bindend miRNA en voornoemd KH-domein bevattend proteïne met het potentiële therapeutische agens onder omstandigheden die FRET (Förster Résonance Energy Transfer) tussen de fluorofoordonor en fluorofooracceptor of de fluorodonor en de dark quencher mogelijk maken, (d) identificeren van het potentiële therapeutische agens als een modulerende verbinding, bij voorkeur een interactie tussen voornoemd KH-domein bindend miRNA en voornoemd KH-domein bevattende proteïne inhiberend of versterkend, indien de FRET (Förster Résonance Energy Transfer) afwijkt in aanwezigheid van de interessante verbinding vergeleken met de FRET in afwezigheid van de interessante verbinding.In a fourth aspect of the invention, the KH domain binding miRNA contains at least one fluorophore donor and the KH domain containing protein at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired with the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the 'dark quencher' at least partially overlapping, the following steps are included (a) supplying said KH domain binding miRNA and said KH domain containing protein, (b) supplying a potential therapeutic agent, (c) contacting said KH domain binding miRNA and said KH domain containing protein with the potential therapeutic agent under conditions that FRET (Förster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the enable fluorodonor and the dark quencher, (d) identify the potential therapeutic agent as a modulating compound, preferably an interaction between said KH domain binding miRNA and said KH domain containing protein inhibiting or enhancing, if the FRET (Förster Résonance Energy Transfer) differs in the presence of the interesting connection compared to the FRET in the absence of the interesting connection.

Een vijfde aspect van de uitvinding heeft betrekking op het gebruik van een KH-domein bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattende het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH-domein bevattend proteïne in een intacte cel waarin het potentieel therapeutische agens in contact wordt gebracht met voornoemde cel. Voornoemd KH-domein bindend miRNA en/of voornoemd KH-domein bevattend proteïne kunnen zijn zoals hierboven gedefinieerd. Voornoemd KH-domein bindend microRNA en/of het KH-domein bevattend proteïne kan endogeen zijn voor de cel. Voornoemd KH-domein bindend microRNA en/of het KH-domein bevattend proteïne kan exogeen zijn voor de cel. Voornoemde cel kan genetisch worden gemodificeerd om het KH-domein bindend microRNA tot expressie te laten komen of het te onderdrukken. Voornoemde cel kan genetisch worden gemodificeerd om het KH-domein bevattend proteïne tot expressie te laten komen of het te onderdrukken.A fifth aspect of the invention relates to the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the potential of a potential therapeutic agent to modify the interaction of said KH domain binding miRNA with a KH domain containing protein in an intact cell in which the potential therapeutic agent is contacted with said cell. Said KH domain binding miRNA and / or said KH domain containing protein may be as defined above. Said KH domain binding microRNA and / or the KH domain containing protein may be endogenous to the cell. Said KH domain binding microRNA and / or the KH domain containing protein may be exogenous to the cell. Said cell can be genetically modified to allow the KH domain binding microRNA to be expressed or suppressed. Said cell can be genetically modified to express or suppress the KH domain-containing protein.

In een zesde aspect van de uitvinding kan het direct of indirect wijzigen van de interactie tussen het KH-domein bindend microRNA en het KH-domein bevattend proteïne leiden tot een gewijzigde oppervlaktelevering, transport, stabiliteit, hergebruik of translatie van een ander proteïne in de cel.In a sixth aspect of the invention, directly or indirectly altering the interaction between the KH domain binding microRNA and the KH domain containing protein can lead to altered surface delivery, transport, stability, reuse or translation of another protein in the cell .

Direct of indirect wijzigen van de interactie tussen het KH-domein bindend microRNA en het KH-domein bevattende proteïne kan leiden tot een gewijzigde oppervlaktelevering, transport, splitsen, transcriptie, stabiliteit of hergebruik van een RNA in de cel. Bij voorkeur heeft het wijzigen van de interactie tussen het KH-domein bindend microRNA en het KH-domein bevattend proteïne direct of indirect een wijziging van de proliferatie, differentiatie, apoptose, nécrosé, autofagie, motiliteit, migratie of invasie van een cel tot gevolg.Direct or indirect alteration of the interaction between the KH domain binding microRNA and the KH domain containing protein can lead to altered surface delivery, transport, cleavage, transcription, stability or reuse of an RNA in the cell. Preferably, altering the interaction between the KH domain binding microRNA and the KH domain containing protein results directly or indirectly in a change in proliferation, differentiation, apoptosis, necrosis, autophagy, motility, migration, or invasion of a cell.

De cel in de bovenstaande aspecten kan een hersentumorcel , een zenuw stelselcel, een hersentumorcel of een cellijn van een zenuwstelsel zijn.The cell in the above aspects can be a brain tumor cell, a nervous system cell, a brain tumor cell or a cell line of a nervous system.

Een zevende aspect van de uitvinding betreft het gebruik zoals hierboven beschreven waarin voornoemde volledige cel een reporterproteïne coderende sequentie bevat functioneel gekoppeld aan een KH-domein bindend microRNA bindende sequentie. Voornoemd reporterproteïne kan uit de groep worden geselecteerd van groen fluorescerende proteïne, rood fluorescerend proteïne, geelfluorescerend proteïne, luciferase, bèta-galactosidase en bèta-glucuronidase. Voornoemd KH-domein bindend microRNA bindende sequentie kan zich stroomafwaarts van de reporterproteïne coderende sequentie of stroomopwaarts van de reporterproteïne coderende sequentie bevinden.A seventh aspect of the invention relates to the use as described above wherein said whole cell contains a reporter protein coding sequence operably linked to a KH domain binding microRNA binding sequence. Said reporter protein can be selected from the group of green fluorescent protein, red fluorescent protein, yellow fluorescent protein, luciferase, beta-galactosidase and beta-glucuronidase. Said KH domain binding microRNA binding sequence may be located downstream of the reporter protein coding sequence or upstream of the reporter protein coding sequence.

Een achtste aspect van de uitvinding heeft betrekking op het gebruik van het KH-domein bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattende het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH-domein bevattend proteïne in een dier waarin het potentieel therapeutisch agens in contact wordt gebracht met voornoemd dier. Voornoemd KH-domein bindend miRNA, voornoemd KH-domein bevattend proteïne en voornoemd ander proteïne kunnen zijn zoals hierboven beschreven. Voornoemd KH-domein bindend microRNA en/of voornoemd KH-domein bevattend proteïne kan voor het dier endogeen of exogeen zijn. Voornoemd dier kan genetisch gemodificeerd zijn voor het tot uitdrukking te laten komen of onderdrukken van het KH-domein bindend microRNA en/of het tot zwijgen te brengen van het KH-domein bevattend proteïne. Wijzigen van de interactie tussen het KH-domein bindend microRNA en het KH-domein bevattend proteïne kan direct of indirect proliferatie, differentiatie, apoptose, nécrosé, autofagie, motiliteit, migratie of invasie van cellen in het dier veroorzaken. Het dier kan worden angebracht in één of meerdere kamers in een microstromingsapparaatmodule en de inhoud van één of meerdere kamers kan op beeld worden opgenomen om in één of meerdere kamers resultaten te krijgen. Het dier kan een volledig dier, een embryo of een larve zijn. Het dier kan een Danio rerio of Drosophila melanogaster zijn. Het dier kan een wild-type of transgeen zijn. Het dier kan een weefselspecifieke, locatie specifieke en/of ontwikkelingsstadiumspecifieke expressie omvatten van het KH-domein bindend miRNA, het KH-domein bevattend proteïne en/of combinaties daarvan.An eighth aspect of the invention relates to the use of the KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the potential of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain containing protein in an animal in which the potential therapeutic agent is contacted with said animal. Said KH domain binding miRNA, said KH domain containing protein and said other protein may be as described above. Said KH domain binding microRNA and / or said KH domain containing protein may be endogenous or exogenous to the animal. Said animal may be genetically modified to express or suppress the KH domain binding microRNA and / or silencing the KH domain containing protein. Altering the interaction between the KH domain binding microRNA and the KH domain containing protein can directly or indirectly cause proliferation, differentiation, apoptosis, necrosis, autophagia, motility, migration or cell invasion into the animal. The animal can be introduced into one or more chambers in a micro-flow device module and the contents of one or more chambers can be recorded on screen to get results in one or more chambers. The animal can be a complete animal, an embryo or a larva. The animal can be a Danio rerio or Drosophila melanogaster. The animal can be a wild type or transgenic. The animal may include tissue-specific, site-specific and / or development-stage-specific expression of the KH domain binding miRNA, the KH domain containing protein, and / or combinations thereof.

In de bovenstaande aspecten van de uitvinding kan het potentieel therapeutische agens worden geselecteerd uit een proteïne, polypeptide, peptide, nucleïnezuur, oligonucleotide, koolwaterstof, lipide, synthetisch molecuul, semi-synthetisch molecuul, klein molecuul of gezuiverd natuurproduct.In the above aspects of the invention, the potential therapeutic agent can be selected from a protein, polypeptide, peptide, nucleic acid, oligonucleotide, hydrocarbon, lipid, synthetic molecule, semi-synthetic molecule, small molecule, or purified natural product.

Een negende aspect van de uitvinding heeft betrekking op het KH-domein bindende miRIMA oligonucleotide dat een sequentie bevat die bindt aan een KH-domein van een proteïne waarin voornoemd KH-domein bindend miRNA wordt geselecteerd uit de groep bestaande uit een afgewerkt miRNA, een afgewerkt isomeer miRNA, een pre-miR, een pri-miR, een miRNA nabootser of een mengsel van miRNA nabootsers, een RNA- of DNA-molecuul coderend voor voornoemd afgewerkt miRNA, voor voornoemd afgewerkt isomeer miRNA, voor voornoemd pre-miR, voor voornoemd pri-miRNA, voor voornoemd miRNA nabootser of mengels van miRNA nabootsers of een combinatie daarvan. Preferent heeft het KH-domein bindend miRNA oligonucleotide een of meerdere van de volgende sequenties die binden aan een KH-domein: 5'-(U/A)C3-4(U/A)-3', 5'-(U/A/C)C3-4(U/A/C)-3', 5'-CCAUC N2-7 (A/U)CCC(A/U) N7-is UCA(C/U)C-3', 5'-CA N2-10 CCC N7-24 CA-3', 5'-(U/A)2 C3-5 (U/A)2-6 C3-5 (U/A)2-6 C3-5 (U/A)2 -3', 5'- C3-5 (N)2-6 C3-5 (N)2-6 C3-5 (N)2 -3', or 5'- C2-5 (N)2-8 C2-5 (N)2-8 C2-5 (N)2 -3' waarin N een van de C, U, A of G kan zijn.A ninth aspect of the invention relates to the KH domain binding miRIMA oligonucleotide that contains a sequence that binds to a KH domain of a protein wherein said KH domain binding miRNA is selected from the group consisting of a finished miRNA, a finished isomer miRNA, a pre-miR, a prim-miR, a miRNA mimic or a mixture of miRNA mimics, an RNA or DNA molecule coding for said finished miRNA, for said finished isomer miRNA, for said pre-miR, for said pri-miRNA, for the aforementioned miRNA mimic or mixtures of miRNA mimic or a combination thereof. Preferably, the KH domain binding miRNA oligonucleotide has one or more of the following sequences that bind to a KH domain: 5 '- (U / A) C3-4 (U / A) -3', 5 '- (U / A A / C) C3-4 (U / A / C) -3 ', 5'-CCAUC N2-7 (A / U) CCC (A / U) N7 - is UCA (C / U) C-3', 5'-CA N2-10 CCC N7-24 CA-3 ', 5' - (U / A) 2 C3-5 (U / A) 2-6 C3-5 (U / A) 2-6 C3-5 (U / A) 2-3 ', 5'-C3-5 (N) 2-6 C3-5 (N) 2-6 C3-5 (N) 2-3', or 5'-C2-5 ( N) 2-8 C2-5 (N) 2-8 C2-5 (N) 2 -3 'wherein N can be one of the C, U, A or G.

Het negende aspect van de uitvinding heeft ook betrekking op een antisense oligonucleotide dat complementair is aan het KH-domein bindende miRNA oligonucleotide zoals hierboven beschreven.The ninth aspect of the invention also relates to an antisense oligonucleotide that is complementary to the KH domain binding miRNA oligonucleotide as described above.

Voornoemd KH-domein bindend miRIMA oligonucleotide of voornoemd antisense oligonucleotide kan worden gebruikt bij de behandeling en/of preventie van een ziekte of stoornis. En dus heeft dit aspect van de uitvinding ook betrekking op een farmaceutische samenstelling die voornoemd KH-domein bindend miRNA oligonucleotide of voornoemde antisense oligonucleotide bevat met als additief een farmaceutisch acceptabele drager.Said KH domain binding miRIMA oligonucleotide or said antisense oligonucleotide can be used in the treatment and / or prevention of a disease or disorder. And so this aspect of the invention also relates to a pharmaceutical composition containing said KH domain binding miRNA oligonucleotide or said antisense oligonucleotide with a pharmaceutically acceptable carrier as additive.

Een tiende aspect van de uitvinding heeft betrekking op een extracellulair vesicula, intracellulair vesicula, deeltje of exosoom dat een KH-domein bindend miRNA bevat. Voornoemd KH-domein bindend miRNA wordt gebonden aan een KH-domein van een proteïne. Voornoemd extracellulair vesicula, intracellulair vesicula, deeltje of exosoom kan worden gebruikt bij de behandeling en/of preventie van een ziekte of stoornis. Bij voorkeur heeft het betrekking op een exosoom.A tenth aspect of the invention relates to an extracellular vesicle, intracellular vesicle, particle or exosome that contains a KH domain binding miRNA. Said KH domain binding miRNA is bound to a KH domain of a protein. The aforementioned extracellular vesicle, intracellular vesicle, particle or exosome can be used in the treatment and / or prevention of a disease or disorder. Preferably it relates to an exosome.

Een elfde aspect van de uitvinding heeft betrekking op het gebruik van een KH-domein bindend miRNA omvattende het selecteren van een behandeling of wijzigen van een behandeling van een ziekte of stoornis gebaseerd op het bepalen van de hoeveelheid KH-domein bindend miRNA in een biologisch monster waarin het KH-domein bindend miRNA is zoals hierboven beschreven . Voornoemd gebruik om te bepalen of men een behandeling van een ziekte of een stoornis in een individu gaat starten, verder zetten of kan bestaan uit: a) analyseren van een serie biologische monsters om in ieder van de biologische monsters een hoeveelheid van een KH-domein bindend miRNA te bepalen en b) vergelijken van een meetbare verandering van de hoeveelheden van een KH-domein bindend miRNA in ieder van de biologische monsters.An eleventh aspect of the invention relates to the use of a KH domain binding miRNA comprising selecting a treatment or changing a treatment for a disease or disorder based on determining the amount of KH domain binding miRNA in a biological sample wherein the KH domain is binding miRNA as described above. The aforementioned use to determine whether to start, continue or continue treatment of a disease or disorder in an individual or may consist of: a) analyzing a series of biological samples to determine an amount of a KH domain in each of the biological samples to determine binding miRNA and b) comparing a measurable change in the amounts of a KH domain binding miRNA in each of the biological samples.

Voornoemd biologisch monster kan worden geselecteerd uit een biologisch weefsemonster, een volledig bloedmonster, een van bloed afgeleid monster, een uitstrijkje, een plasma monster, een serum monster, een speeksel monster, een vaginaal vocht monster, een sperma monster, een keelholte vocht monster, een bronchiën vocht monster, een fecaal vocht monster, een cerebrospinaal vocht monster, een traanvocht monster, een urine monster, een lymfevocht monster, een supernatant van een weefsel-·cultuur monster, een cellulaire fractie, een exosome fractie, een bloedplaatjesfractie of een microdeeltjesfractie. Bij voorkeur is voornoemd monster een exosoomfractie van een serummonster.Said biological sample can be selected from a biological tissue sample, a whole blood sample, a blood-derived sample, a smear, a plasma sample, a serum sample, a saliva sample, a vaginal fluid sample, a sperm sample, a pharynx fluid sample, a bronchi fluid sample, a faecal fluid sample, a cerebrospinal fluid sample, a tear fluid sample, a urine sample, a lymph fluid sample, a supernatant of a tissue culture sample, a cellular fraction, an exosome fraction, a platelet fraction or a microparticle fraction . Preferably, said sample is an exosome fraction of a serum sample.

Het gehalte van voornoemd miRNA kan worden vastgesteld door middel van 'quantitative reverse transcription-polymerase chain réaction' (qRT-PCR) of 'array hybridization’.The content of the aforementioned miRNA can be determined by means of quantitative reverse transcription polymerase chain reaction (qRT-PCR) or array hybridization.

De hierboven beschreven ziekte of stoornis kan een hersenkanker zijn of een neurodegeneratieve ziekte.The disease or disorder described above may be a brain cancer or a neurodegenerative disease.

Voornoemde hersenkanker kan zijn; akoestisch neuroom, astrocytoom, chordoom,Pilocytisch astrocytoom, laaggradig astrocytoom, anaplastisch astrocytoom, glioblastoom, craniopharyngioom, hersenstam glioom, ependymoon, gemengd glioom, glioom aan de optische zenuw, subependymoom, medulloblastoom, meningioom, metastatische hersentumoren, oligodendroglioom, hypofysetumoren, primitieve neuroectodermale tumoren, schwannoom. Voornoemde neurodegeneratieve ziektes kunnen zijn Parkinson, Multipele Systeem Atrophy (MSA), multipele sclerose, amyotrofysische laterale sclerose (ALS), Alzheimer of ziekte van Huntington.The aforementioned brain cancer may be; acoustic neuroma, astrocytoma, chordoma, pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, glioblastoma, craniopharyngioma, brainstem glioma, ependymone, mixed glioma, glioma to the optic nerve, subependymoma, medulioma neuro, hereditary, medulloentomic, hereditary, medulloentomous, hereditary, medulloentomous, hereditary , schwannome. The aforementioned neurodegenerative diseases may be Parkinson's, Multiple System Atrophy (MSA), multiple sclerosis, amyotrophysic lateral sclerosis (ALS), Alzheimer's disease or Huntington's disease.

Een twaalfde aspect van de uitvinding heeft betrekking op een systeem dat nuttig is voor het uitvoeren van het gebruik zoals hierboven beschreven. Dit systeem kan een computerprogramma zijn bestaande uit middelen voor het ontvangen van data die een gewijzigd interactienivau weergeven van ten minste één KH-domein bindend miRNA, middelen voor het ontvangen van data die ten minste één referentiepatroon of controlepatroon weergeven van voornoemd ten minste één KH domein bindend miRNA, middelen voor het vergelijken van voornoemde data en middelen voor het selecteren van een potentieel therapeutisch agens. Voornoemd systeem kan een apparaat zijn voor het uitvoeren van voornoemd gebruik. Voornoemd systeem kan een set zijn, waarin voornoemde set bestaat uit instructies voor het uitvoeren van voornoemd gebruik, een detectiereagens voor het bepalen van de hoeveelheid van ten minste één KH-domein bindend miRNA in een monster van een subject, en referentiestandaarden.A twelfth aspect of the invention relates to a system that is useful for performing the use as described above. This system may be a computer program consisting of means for receiving data representing a modified interaction level of at least one KH domain binding miRNA, means for receiving data representing at least one reference pattern or control pattern of said at least one KH domain binding miRNA, means for comparing said data and means for selecting a potential therapeutic agent. Said system can be a device for carrying out said use. Said system may be a set, wherein said set consists of instructions for performing said use, a detection reagent for determining the amount of at least one KH domain binding miRNA in a sample of a subject, and reference standards.

BEGRIPSOMSCHRIJVINGENDEFINITIONS

Zoals hier gebruikt betekent de term "geïsoleerd" gescheiden van de natuurlijke staat door middel van menselijke tussenkomst. Een natuurlijk voorkomend RNA in een levend dier is bijvoorbeeld niet "geïsoleerd", maar synthetisch miRNA of mRNA gescheiden van coëxisterende materialen van zijn natuurlijke toestand wordt beschouwd als zijnde "geïsoleerd", voor de doeleinden van onderhavige uitvinding. Geïsoleerd nucleïnezuur kan bestaan in substantieel gezuiverde vorm of het kan bestaan in een nietnatuurlijke staat zoals bijvoorbeeld in een cel waarin voornoemd nucleïnezuur is geïntroduceerd.As used herein, the term "isolated" means separate from the natural state through human intervention. For example, a naturally occurring RNA in a living animal is not "isolated", but synthetic miRNA or mRNA separated from coexisting materials from its natural state is considered "isolated" for the purposes of the present invention. Isolated nucleic acid may exist in substantially purified form or it may exist in a non-natural state such as, for example, in a cell into which said nucleic acid has been introduced.

Zoals hier gebruikt verwijst de term "biomarker" naar een stof gebruikt als een indicator van een biologische toestand of een normaal biologisch proces, een toestand van ziekte of een reactie op een behandeling met medicijnen. Voor de doeleinden van onderhavige uitvinding, heeft de term biomarker betrekking op regulerende nucleïnezuren, bij voorkeur op RNA's en bij grotere voorkeur op miRNAs, afgewerkte miRNA's, afgewerkte isomeer miRNA's, pre-miRNA's, pri-miRNA's of iedere combinatie daarvan.As used herein, the term "biomarker" refers to a substance used as an indicator of a biological condition or a normal biological process, a condition of disease, or a response to treatment with drugs. For the purposes of the present invention, the term biomarker refers to regulatory nucleic acids, preferably to RNAs and more preferably to miRNAs, spent miRNAs, spent isomeric miRNAs, pre-miRNAs, prim-miRNAs or any combination thereof.

Zoals hier gebruikt heeft de term "genetisch gemodificeerd" betrekking op ieder proces dat in staat is functioneel genetisch materiaal in een cel in te brengen voor het corrigeren van een genetisch en/of metabolisch, fysiologisch en/of functioneel defect, door hetzij overexpressie of onderexpressie of de cellen te voorzien van een nieuwe functie.As used herein, the term "genetically modified" refers to any process capable of introducing functional genetic material into a cell to correct a genetic and / or metabolic, physiological and / or functional defect, through either overexpression or underexpression or provide the cells with a new function.

Zoals hier gebruikt heeft de "effectieve dosis" betrekking op een minimum dosis in staat tot het produceren van het gewenste effect, of dat nu het omkeren van een ziektetoestand is of het induceren van een specifieke immunorespons, etc.As used herein, the "effective dose" refers to a minimum dose capable of producing the desired effect, whether it is reversing a disease state or inducing a specific immune response, etc.

De term "expressie" zoals hier gebruikt heeft zowel betrekking op de transcriptie van een gensequentie als op de translatie van mRNA naar een resulterend proteïne. Zoals hier gebruikt heeft de term "gen" betrekking op een nucleïnezuur (bijv. DNA of RNA) omvattende een gedeelte van of de volledige lengte van de sequentiecode,noodzakelijk voor het produceren van de sequenties van een polypeptide of een polypeptideprecursor. Zoals hier gebruikt heeft de term "onderdrukken" betrekking op het onderdrukken of inhibitie van de expressie van een specifiek doelgen.The term "expression" as used herein refers to both the transcription of a gene sequence and the translation of mRNA to a resulting protein. As used herein, the term "gene" refers to a nucleic acid (e.g., DNA or RNA) comprising a portion or the full length of the sequence code necessary to produce the sequences of a polypeptide or a polypeptide precursor. As used herein, the term "suppress" refers to the suppression or inhibition of the expression of a specific target gene.

Volgens lang bestaande conventies in het octrooirecht hebben de termen "een" en "de" betrekking op "één of meerdere" wanneer gebruikt in deze aanvraag, inclusief in de conclusies. En dus houdt verwijzen naar "een cel" een meervoud van dergelijke cellen in, enzovoorts.According to long-standing conventions in patent law, the terms "one" and "the" refer to "one or more" when used in this application, including in the claims. And so referring to "a cell" involves a plurality of such cells, and so on.

Zoals hierin gebruikt is de term "KH-domein bindend miRNA" een microRNA dat een sequentie heeft die past in de gleuf van een KH-domein. "Lange niet-coderende RNA's" (lange ncRNA's, IncRNA) zoals hier gebruikt zijn non-proteïne coderende transcripties langer dan 200 nucleotiden. Een bijzondere klasse van IncRNA zijn lange intergenische ncRNA's (lincRNA), waaronder lange non-coderende RNA's worden verstaan die worden getranscribeerd van non-coderende DNA-sequenties tussen proteïnecoderende genen.As used herein, the term "KH domain binding miRNA" is a microRNA that has a sequence that fits into the slot of a KH domain. "Long non-coding RNAs" (long ncRNAs, IncRNA) as used herein are non-protein coding transcripts longer than 200 nucleotides. A special class of IncRNA are long intergenic ncRNAs (lincRNA), which includes long non-coding RNAs that are transcribed from non-coding DNA sequences between protein-coding genes.

Een "piwiRNA" zoals hier gebruikt is een klein non-coderend RNA molecuul dat RNA-proteïnecomplexen vormt door middel van interacties met piwi-proteïnen.A "piwi RNA" as used herein is a small non-coding RNA molecule that forms RNA protein complexes through interactions with piwi proteins.

Een "cluster" zoals hier gebruikt is een set van miRNA, Incrna, lincRNA, piwiRNA, pseudogen RNA-transcriptie, gen-RNA-transcriptie, RNA-transcriptie, overlappende gen-RNA-transcripties die dicht bij elkaar liggen of in het genoom overlappen. Met dicht bij elkaar liggen wordt bedoeld binnen 5 kb, 10 kb, 20kb, 30kb, 40kb, 50kb, 60kb, 70kb, 80kb, 90kb, lOOkb, 200kb, 300kb, 400kb, 500kb, 600kb, 700kb, 900kb, lOOOkb, bij voorkeur tussen 5 tot 200kb.A "cluster" as used herein is a set of miRNA, Incrna, lincRNA, piwiRNA, pseudogen RNA transcription, gene RNA transcription, RNA transcription, overlapping gene RNA transcriptions that are close to each other or overlapped in the genome . By being close together is meant within 5 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 60 kb, 70 kb, 80 kb, 90 kb, 100 kb, 200 kb, 300 kb, 400 kb, 500 kb, 600 kb, 700 kb, 900 kb, 100 kb, preferably 100 kb between 5 to 200kb.

De term "interacties" zoals hier gebruikt heeft betrekking op contacten tot stand gekomen tussen twee of meerdere moleculen als resultaat van biochemische gebeurtenissen en/of elektrostatische krachten. Wanneer de interactie direct is komen de moleculen op een zeker ogenblik fysiek met elkaar in contact. Wanneer de interactie indirect is, beïnvloeden de moleculen eikaars activiteit zonder fysiek met elkaar in contact te zijn. Bij voorkeur wordt aangenomen dat bij de interactie tussen twee moleculen covalente, ion- en zwakke bindingen een rol spelen zoals dipool-dipoolinteracties, ion-dipoolinteracties, Londonkrachten, van der Waals interacties, ladingoverdrachtinteracties en waterstofbinding.The term "interactions" as used herein refers to contacts established between two or more molecules as a result of biochemical events and / or electrostatic forces. When the interaction is direct, the molecules come into physical contact with each other at a certain moment. When the interaction is indirect, the molecules influence each other's activity without being in physical contact with each other. Preferably, covalent, ion and weak bonds play a role in the interaction between two molecules, such as dipole-dipole interactions, ion-dipole interactions, London forces, van der Waals interactions, charge transfer interactions and hydrogen bonding.

De term "expressie" zoals hier gebruikt, heeft betrekking op de transcriptie van een gensequentie alsmede op de translatie van een mRNA naar het resulterende proteïne. Zoals hier gebruikt heeft de term "gen" betrekking op nucleïnezuur (bijv. DIMA of RIMA) bestaande uit een gedeelte van of de volledige lengte van de sequentiecode, de sequenties nodig voor de productie van een polypeptide of een polypeptide precursor.The term "expression" as used herein refers to the transcription of a gene sequence as well as the translation of an mRNA to the resulting protein. As used herein, the term "gene" refers to nucleic acid (e.g., DIMA or RIMA) consisting of a portion or full length of the sequence code, the sequences necessary for the production of a polypeptide or a polypeptide precursor.

Zoals hier gebruikt heeft de term "onderdrukken" betrekking op het onderdrukken of inhibitie van de expressie van een specifiek doelgen. De term onderdrukken houdt niet noodzakelijkerwijs in beperkte transcriptie aangezien het onderdrukken van het gen ook, ten minste in sommige gevallen, kan worden uitgevoerd op het post-transcriptieniveau. De mate van genonderdrukking kan optreden om de productie van het gecodeerde gen te verminderen of ermee te interfereren.As used herein, the term "suppress" refers to the suppression or inhibition of the expression of a specific target gene. The term suppression does not necessarily mean limited transcription since suppressing the gene can also, at least in some cases, be performed at the post-transcription level. The degree of gene suppression can occur to reduce or interfere with the production of the encoded gene.

Met de term " het in staat zijn van een (potentieel) therapeutisch agens tot het wijzigen van de interactie " zoals hier gebruikt wordt bedoeld alle typen verbindingen, zoals anorganische en organische verbindingen van laag en hoog moleculaire massa, aminozuren, peptiden, polypeptiden, lipiden, (poly)nucleotiden, etc. die in staat zijn om ten minste gedeeltelijk (afremmen) of volledig (inhiberen) de interactie tussen de biomoleculen of domeinen te verstoren, of in staat is tot het initiëren of verhogen van de interactie tussen de biomoleculen of domeinen. In andere woorden, de verbinding zal de binding tussen de biomoleculen of domeinen verminderen, onderbreken, initiëren of vergroten.By the term "the ability of a (potential) therapeutic agent to alter the interaction" as used herein is meant all types of compounds, such as inorganic and organic compounds of low and high molecular mass, amino acids, peptides, polypeptides, lipids , (poly) nucleotides, etc. that are capable of at least partially (inhibiting) or completely (inhibiting) disrupting the interaction between the biomolecules or domains, or capable of initiating or increasing the interaction between the biomolecules or domains. In other words, the connection will reduce, interrupt, initiate or increase the binding between the biomolecules or domains.

De term "biomolecuul" zoals hier gebruikt duidt op ieder molecuul dat in een levende cel voorkomt en dat in deze cel een biologische functie heeft alsmede functionele derivaten en fragmenten daarvan. Functionele derivaten en fragmenten van een biomolecuul hebben normaal ten minste 10, 20, 30 of 40 %, bij voorkeur ten minste 50, 60, 70 of 80%, liever ten minste 90%, liefst ten minste 95% (procent) identiteit met de structuur van de biomolecuul in de natuur en tonen dezelfde of een substantieel gelijksoortige biologische werking als het biomolecuul in de natuur. Zo kan bij voorbeeld, structurele identiteit van polynucleotiden en polypeptiden worden bepaald met standaard algoritmen die het percentage identiteit berekenen van de sequenties en voor polynucleotiden kan structurele identiteit ook worden gedetermineerd door hybridisatietesten.The term "biomolecule" as used herein refers to any molecule that occurs in a living cell and that has a biological function in this cell as well as functional derivatives and fragments thereof. Functional derivatives and fragments of a biomolecule normally have at least 10, 20, 30 or 40%, preferably at least 50, 60, 70 or 80%, more preferably at least 90%, most preferably at least 95% (percent) identity with the structure of the biomolecule in nature and show the same or a substantially similar biological effect as the biomolecule in nature. For example, structural identity of polynucleotides and polypeptides can be determined with standard algorithms that calculate the percent identity of the sequences and for polynucleotides, structural identity can also be determined by hybridization tests.

Voor polynucleotiden geeft de term "% (procent) identiteit" zoals bekend bij de vakkundige en hier gebruikt, de mate van verwantschap aan tussen twee of meerdere nucleïnezuur moleculen die wordt bepaald door overeenstemming tussen de sequenties. Het percentage "identiteit" is het resultaat van het percentage identieke gebieden in twee of meerdere sequenties daarbij de hiaten en andere eigenheden van de sequentie in aanmerking nemend. De identiteit van gerelateerde moleculen nucleïnezuren kan worden vastgesteld met behulp van bekende methodes. In het algemeen worden speciale computerprogramma's ingezet die gebruik maken van algoritmen die zijn aangepast aan de specifieke behoeften van deze taak. Preferente methoden voor het bepalen van identiteit beginnen met het genereren van de grootste mate van identiteit tussen de te vergelijken sequenties. Computerprogramma's die de voorkeur hebben voor het bepalen van de mate van identiteit tussen twee nucleïnezuur-isequenties zijn onder andere, maar niet beperkt tot, BLASTN. De BLAST programma's zijn onder andere te verkrijgen bij het National Center for Biotechnology Information (NCBI).For polynucleotides, the term "% (percent) identity" as known to those skilled in the art and used herein, indicates the degree of relationship between two or more nucleic acid molecules that is determined by correspondence between the sequences. The percentage of "identity" is the result of the percentage of identical regions in two or more sequences, taking into account the gaps and other specificities of the sequence. The identity of related molecules of nucleic acids can be established using known methods. In general, special computer programs are used that use algorithms adapted to the specific needs of this task. Preferred methods for determining identity begin by generating the greatest degree of identity between the sequences to be compared. Preferred computer programs for determining the degree of identity between two nucleic acid is sequences include, but are not limited to, BLASTN. The BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI).

De structurele identiteit van gerelateerde nucleïnezuren kan ook worden getypeerd in de mate waarin ze in staat zijn te hybridiseren met specifiek referentie nucleïnezuursequenties, bij voorkeur onder stringente voorwaarden. Naast de algemene en/of standaardprotocollen van de voorgaande stand der techniek voor het bepalen van het hybridisatievermogen met een specifiek referentie nucleïnezuursequentie onder stringente voorwaarden , wordt de voorkeur gegeven aan het analyseren en bepalen van het hybridisatievermogen met een specifiek referentie nucleïnezuursequentie onder stringente voorwaarden door de nucleïnezuursequenties te vergelijken die zijn te vinden in de gen databases (e.g. http://www.ncbi.nlm.- nih.gov/entrez/query. fcgi?db=nucleotide) met uitlijnhulpmiddelen, zoals bijv. de hierboven genoemde BLASTN en ALIGN uitlijnhulpmiddelen.The structural identity of related nucleic acids can also be typified to the extent that they are able to hybridize to specific reference nucleic acid sequences, preferably under stringent conditions. In addition to the general and / or standard protocols of the prior art for determining the hybridization capacity with a specific reference nucleic acid sequence under stringent conditions, preference is given to analyzing and determining the hybridization capacity with a specific reference nucleic acid sequence under stringent conditions by the compare nucleic acid sequences that can be found in the gene databases (eg http: //www.ncbi.nlm.- nih.gov/entrez/query. fcgi? db = nucleotide) with alignment aids, such as the BLASTN and ALIGN mentioned above alignment tools.

Bij voorkeur is het vermogen tot hybridisatie van een nucleïnezuur met een verwant nucleïnezuurderivaat of fragment bevestigd in een Southern Blot test onder de volgende condities: 6x natriumchloride/natriumcitraat (NNC) bij 45°C gevolgd door uitwassen in 0,2x NNC, 0,1% SDS bij 65°C.Preferably, the ability to hybridize a nucleic acid with a related nucleic acid derivative or fragment has been confirmed in a Southern Blot test under the following conditions: 6x sodium chloride / sodium citrate (NNC) at 45 ° C followed by washing out in 0.2x NNC, 0.1 % SDS at 65 ° C.

Het percentage identiteit van aminozuurmoleculen in de natuur met functionele fragmenten of derivaten daarvan kan worden vastgesteld met behulp van bekende methoden. In het algemeen worden speciale computerprogramma's ingezet die gebruik maken van algoritmen aangepast aan de specifieke behoeften van deze taak. Preferente methoden voor het bepalen van identiteit beginnen met het genereren van de grootste mate van identiteit tussen de te vergelijken sequenties. Geprefereerde computerprogramma's voor het bepalen van de mate van identiteit tussen twee aminozuursequenties zijn onder andere, maar niet beperkt tot, TBLASTIM, BLASTP, BLASTX of TBLASTX. De BLAST programma's zijn te verkrijgen bij het National Center for Biotechnology Information (NCBI) en van anderen.The percent identity of amino acid molecules in nature with functional fragments or derivatives thereof can be determined by known methods. In general, special computer programs are used that use algorithms adapted to the specific needs of this task. Preferred methods for determining identity begin by generating the greatest degree of identity between the sequences to be compared. Preferred computer programs for determining the degree of identity between two amino acid sequences include, but are not limited to, TBLASTIM, BLASTP, BLASTX or TBLASTX. The BLAST programs are available from the National Center for Biotechnology Information (NCBI) and from others.

Met de term "functioneel derivaat" van een verbinding, in het bijzonder een polypeptide of polynucleotide, zoals hier genoemd wordt bedoeld alle polypeptides, polynucleotides of fragmenten daarvan met inbegrip van chemisch of genetisch gemodificeerde aminozuur of nucleotide sequentie, bijv. door additie, substitutie en/of verwijderen van aminozuur of nucleotiderest(en) en/of chemisch gemodificeerd in ten minste één of meer van zijn atomen en/of functionele chemische groepen, bijv. door addities, verwijderingen, hergroepering, oxidatie, reductie, enz. zo lang als het derivaat nog steeds een van de biologische activiteiten van het oorspronkelijke polypeptide of polynucleotide in de natuur in meetbare mate heeft, bijv. ten minste ongeveer 1 tot 10% van de biologische activiteit van het oorspronkelijke ongewijzigde polypeptide of polynucleotide.By the term "functional derivative" of a compound, in particular a polypeptide or polynucleotide, as mentioned herein is meant all polypeptides, polynucleotides or fragments thereof including chemically or genetically modified amino acid or nucleotide sequence, e.g. by addition, substitution and / or removal of amino acid or nucleotide residue (s) and / or chemically modified in at least one or more of its atoms and / or functional chemical groups, e.g. by additions, deletions, regrouping, oxidation, reduction, etc. as long as the derivative still has one of the biological activities of the original polypeptide or polynucleotide in nature to a measurable extent, e.g. at least about 1 to 10% of the biological activity of the original unchanged polypeptide or polynucleotide.

Zoals hier gebruikt verwijzen de termen "label" en "detecteerbaar label" naar een molecuul dat kan worden gedetecteerd, met inbegrip maar niet beperkt tot radioactieve isotopen, fluorescentielabels, chemiluminescentielabels, Chromophoren, enzymen, enzymsubstraten, enzymcofactoren, enzyminhibitoren,As used herein, the terms "label" and "detectable label" refer to a molecule that can be detected, including, but not limited to, radioactive isotopes, fluorescent labels, chemiluminescent labels, chromophors, enzymes, enzyme substrates, enzyme co-factors, enzyme inhibitors,

Chromophoren, kleurstoffen, metaalionen, metaalsolen, liganden (bijv., biotine, avidine, strepavidine or haptens) en dergelijke.Chromophors, dyes, metal ions, metal soles, ligands (e.g., biotin, avidin, strepavidin or haptens) and the like.

Zoals hier gebruikt, heeft "soliede drager" betrekking op een solied oppervlak zoals een plastic plaat, magnetisch bolletje, latexbolletje, multititerplaatholte, glasplaat, nylon, agarose, acrylamide, en dergelijke.As used herein, "solid support" refers to a solid surface such as a plastic plate, magnetic bead, latex bead, multi-titre cavity, glass plate, nylon, agarose, acrylamide, and the like.

GEDETAILLEERDE BESCHRIJVING VAN DE UITVINDINGDETAILED DESCRIPTION OF THE INVENTION

Onverwacht werd ontdekt dat miRNA's via specifieke nucleïnezuursequenties kunnen binden met het KH-domein van een proteïne. Het KH-domein bindend miRNA kan een afgewerkt miRNA zijn, een afgewerkt isomeer miRNA, een pre-miRNA of een combinatie daarvan. De specifieke nucleïnezuursequentie die met het KH-domein van een proteïne kan binden kan worden gevonden in een gebied dat codeert voor diverse overlappende of complementaire transcripties. Deze overlappende of complementaire transcripties en alle clusters die ze kunnen vormen via trans- of cis-activering of trans- of cis-onderdrukking, beïnvloeden eikaars actie. En dus kan het KH-domein bindend miRNA van de uitvinding clusteren met of complementair zijn aan een ander miRNA, een IncRNA, een lincRNA, een piwiRNA, een pseudogen RNA-transcript, een gen-RNA-transcript, een RNA-transcript, overlappende gen-RNA-transcripts of iedere combinatie daarvan.It was unexpectedly discovered that miRNAs can bind to the KH domain of a protein via specific nucleic acid sequences. The KH domain binding miRNA can be a finished miRNA, a finished isomeric miRNA, a pre-miRNA or a combination thereof. The specific nucleic acid sequence that can bind to the KH domain of a protein can be found in an area encoding various overlapping or complementary transcripts. These overlapping or complementary transcripts and all clusters that they can form through trans or cis activation or trans or cis suppression influence each other's action. And thus, the KH domain binding miRNA of the invention can cluster with or be complementary to another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogen RNA transcript, a gene RNA transcript, an RNA transcript, overlapping gene RNA transcripts or any combination thereof.

Een aspect van de uitvinding is het gebruik van een KH-domein bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, met inbegrip van het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH-domein van een proteïne.An aspect of the invention is the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to modify the interaction of said KH domain binding miRNA with a KH domain of a protein.

Een ander aspect van de uitvinding is dat bepaalde miRIMA's specifieke KH-domein bindende sequenties bevatten. Daarom heeft dit andere aspect van onderhavige uitvinding betrekking op KH-domein bindend miRNA omvattende KH-domein bindende sequenties onafhankelijk geselecteerd uit een of meerdere van 5'-(U/A)C3-4(U/A)-3', 5'-(U/A/C)C3-4(U/A/C)-3', 5'-CCAUC N2-7 (A/U)CCC(A/U) N7-18 UCA(C/U)C-3', 5'-CA N2-10 CCC N7-24CA-3', 5'-(U/A)2 C3-5 (U/A)2-6 C3-5 (ü/A)2-6 C3-5 (U/A)2 -3', 5'- C3-5 (N)2-6 C3-5 (N)2-6 C3-5 (N)2 -3', or 5'- C2-5 (N)2-8 C2-5 (N)2-8 C2-5 (N)2 -3', waarin N één van C, U, A of G kan zijn.Another aspect of the invention is that certain miRIMAs contain specific KH domain binding sequences. Therefore, this other aspect of the present invention relates to KH domain binding miRNA comprising KH domain binding sequences selected independently from one or more of 5 '- (U / A) C3-4 (U / A) -3', 5 ' - (U / A / C) C3-4 (U / A / C) -3 ', 5'-CCAUC N2-7 (A / U) CCC (A / U) N7-18 UCA (C / U) C -3 ', 5'-CA N2-10 CCC N7-24CA-3', 5 '- (U / A) 2 C3-5 (U / A) 2-6 C3-5 (ü / A) 2-6 C3-5 (U / A) 2-3 ', 5'-C3-5 (N) 2-6 C3-5 (N) 2-6 C3-5 (N) 2-3', or 5'-C2 -5 (N) 2-8 C2-5 (N) 2-8 C2-5 (N) 2 -3 ', wherein N can be one of C, U, A or G.

De huidige uitvinding onthult ook de associatie van KH-domeinbevattende proteïnen en KH-domein bindend miRNA's die beiden binnen de EV's gelokaliseerd kunnen zijn. Voornoemd KH domein bevattende proteïnen samen met de KH-domein bindende miRNA's beschreven in de uitvinding kunnen verantwoordelijk zijn voor het inpakken en/of doorsturen van moleculen in de EV's. Deze KH-domein bevattende proteïnen kunnen worden geSUMOyleerd, of gefosforyleerd en deze posttranslationele modificaties kunnen de binding van KH-domein bevattende miRNA aan KH-domein bindend miRNA controleren.The present invention also discloses the association of KH domain containing proteins and KH domain binding miRNAs, both of which may be located within the EVs. Said KH domain containing proteins together with the KH domain binding miRNAs described in the invention may be responsible for the packaging and / or forwarding of molecules in the EVs. These KH domain-containing proteins can be SUMOylated, or phosphorylated, and these post-translational modifications can control the binding of KH domain-containing miRNA to KH domain-binding miRNA.

Het terrein van de uitvinding is gerelateerd aan het gebruik van Förster Résonance Energy Transfer (FRET), dat een mechanisme is dat energie overdracht beschrijft tussen twee chromoforen. Wanneer beide chromoforen fluorescent zijn, d.w.z. zogenaamde fluoroforen, wordt in plaats daarvan vaak de term "fluorescence résonance energy transfer" gebruikt. Ter vermijding van een verkeerde interpretatie van het fenomeen dat altijd een non-radiatieve transfer van energie is (zelfs wanneer deze plaatsvindt tussen twee fluoroforen), wordt de naam "Förster Résonance Energy Transfer" geprefereerd. Een fluorofoordonor, initieel in zijn elektronische aangeslagen toestand, kan energie overdragen aan een fluorofooracceptor via niet-radiatieve dipool-dipoolkoppeling. De efficiëntie van deze energieoverdracht is omgekeerd evenredig met de zesde macht van de afstand tussen donor en acceptor, hetgeen FRET extreem gevoelig maakt voor kleine afstanden.The field of the invention is related to the use of Förster Resonance Energy Transfer (FRET), which is a mechanism that describes energy transfer between two chromophores. When both chromophores are fluorescent, i.e., so-called fluorophores, the term "fluorescence resonance energy transfer" is often used instead. To avoid a misinterpretation of the phenomenon that is always a non-radiative transfer of energy (even when it occurs between two fluorophores), the name "Förster Résonance Energy Transfer" is preferred. A fluorophore donor, initially in its electronically excited state, can transfer energy to a fluorophore acceptor via non-radiative dipole-dipole coupling. The efficiency of this energy transfer is inversely proportional to the sixth power of the distance between donor and acceptor, which makes FRET extremely sensitive to small distances.

Het veld van de uitvinding heeft betrekking op een methode voor het identificeren van een verbinding die een interactie tussen twee biomoleculen of twee domeinen van eenzelfde biomolecuul moduleert, het eerste biomolecuul of eerste domein omvat ten minste één fluorofoordonor en het tweede biomolecuul of tweede domein omvat ten minste één fluorofooracceptor of een 'dark quencher', waarin de fluorofoordonor en fluorofooracceptor of de fluorofoordonor en 'dark quencher' zodanig spectraal worden gepaard dat het energiespectrum uitgezonden door de fluorofoordonor en het excitatie-energiespectrum van de fluorofooracceptor of het energiespectrum geabsorbeerd door de 'dark quencher' elkaar ten minste gedeeltelijk overlappen, en kan volgende stappen omvatten (i) leveren van de eerste en tweede biomoleculen of een biomolecuul dat voornoemde eerste en tweede domeinen, (ii) leveren van een verbinding die van belang is, (iii) in contact brengen van de eerste en tweede biomoleculen of het biomolecuul dat het eerste en tweede domein omvat met de verbinding die van belang is onder condities die FRET (Förster Résonance Energy Transfer) mogelijk maken tussen de fluorofoordonor en fluorofooracceptor of de fluorofoordonor en de dark quencher, (iv) de verbinding die van belang is identificerend als een verbinding die een interactie moduleert, bij voorkeur inhibeert of versterkt tussen de twee biomoleculen of de twee domeinen van één biomolecuul indien de FRET (Förster Résonance Energy Transfer) tussen de eerste en tweede biomoleculen of de eerste en tweede domeinen verschilt in aanwezigheid van de verbinding die van belang is vergeleken met de FRET tussen de eerste en tweede biomoleculen of de eerste en tweede domeinen in afwezigheid van de verbinding die van belang is.The field of the invention relates to a method for identifying a compound that modulates an interaction between two biomolecules or two domains of the same biomolecule, the first biomolecule or first domain comprises at least one fluorophore donor and the second biomolecule or second domain at at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher 'at least partially overlap each other, and may include following steps (i) supplying the first and second biomolecules or a biomolecule providing said first and second domains, (ii) a compound of interest, (iii) in contact bringing the first and second biomolecules or the biomol molecule comprising the first and second domain with the compound of interest under conditions that allow FRET (Förster Resonance Energy Transfer) between the fluorophor donor and fluorophore acceptor or the fluorophore donor and the dark quencher, (iv) identifying the compound of interest as a compound that modulates an interaction, preferably inhibits or enhances between the two biomolecules or the two domains of one biomolecule if the FRET (Förster Résonance Energy Transfer) differs between the first and second biomolecules or the first and second domains in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.

In de uitvinding wordt het eerste biomolecuul geselecteerd uit de groep die bestaat uit de KH-domein bevattende proteïnen hierin vernoemd en het tweede biomolecuul wordt geselecteerd uit de groep bestaande uit KH-domein bindende miRNA's zoals hierin vernoemd of vice versa.In the invention, the first biomolecule is selected from the group consisting of the KH domain containing proteins mentioned herein and the second biomolecule is selected from the group consisting of KH domain binding miRNAs as mentioned herein or vice versa.

De uitvinding heeft betrekking op een test voor het detecteren van modulatoren van KH-domein bindende miRNA's waarin een miRNA bindingssequentie gekoppeld is aan een nucleïnezuurmolecuul dat voor een reporterprotreïne codeert voor gebruik bij het monitoren van wijzigingen in reporterproteïne-expressie bij blootstelling aan een potentieel therapeutisch agens.The invention relates to a test for detecting modulators of KH domain binding miRNAs in which a miRNA binding sequence is linked to a nucleic acid molecule encoding a reporter protein for use in monitoring changes in reporter protein expression upon exposure to a potential therapeutic agent .

Ter illustratie, de testen kunnen worden toegepast bij het screenen van kleine organische moleculen op agonistische of antagonistische activiteit ten aanzien van miRI\IA-125b-5p, pre-miRNA-125b-l, pri-miRI\IA-125b-l, miRNA-199b-5p, pre-miRI\IA-199b, pri-miRNA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri-miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, of pri-miR-33b. Deze miRNA' s hebben een specifieke sequentie die aan het KH-domein van een proteïne kan binden.For example, the assays can be used in screening small organic molecules for agonistic or antagonistic activity with respect to miRI \ IA-125b-5p, pre-miRNA-125b-1, prim-miRI \ IA-125b-1, miRNA -199b-5p, pre-miRI-IA-199b, pri-miRNA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri -miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, or pri-miR-33b. These miRNAs have a specific sequence that can bind to the KH domain of a protein.

De uitvinding heeft ook betrekking op een methode om te bepalen of profylaxis of behandeling van een hersentumor of een neurodegeneratieve ziekte in een subject moet worden gestart of voortgezet. Deze methode omvat (a) analyseren van een serie biologische monsters om in ieder van de biologische monsters een hoeveelheid te bepalen van een KH-domein bindend microRNA; en (b) vergelijken van iedere meetbare wijziging in de hoeveelheden van het KH-domein bindende microRNA in ieder van de biologische monsters.The invention also relates to a method for determining whether prophylaxis or treatment of a brain tumor or a neurodegenerative disease should be initiated or continued in a subject. This method comprises (a) analyzing a series of biological samples to determine an amount of a KH domain binding microRNA in each of the biological samples; and (b) comparing any measurable change in the amounts of the KH domain binding microRNA in each of the biological samples.

De methode, in een specifieke verdere vorm, omvat (c) bepalen of profylaxis of therapie van de hersen tumor of neurodegeneratieve ziekte moet worden gestart of voortgezet op basis van het omvatten van iedere meetbare wijziging in de hoeveelheden KH-domein bevattend microRNA.The method, in a specific further form, comprises (c) determining whether prophylaxis or therapy of the brain tumor or neurodegenerative disease is to be initiated or continued based on including any measurable change in the amounts of microRNA containing KH domain.

De uitvinding heeft ook betrekking op de methoden en microstromingssystemen waarbij volledige dieren of complete cellen worden gebruikt voor het identificeren van verbindingen die een doel of fenotype dat van belang is moduleren. Deze methoden maken het mogelijk verbeterde experimenten uit te voeren met de microstromingsmodules en nauwkeuriger en meer betrouwbare resultaten te te bekomen tegen lagere kosten en met een hogere snelheid.The invention also relates to the methods and micro-flow systems in which whole animals or whole cells are used to identify compounds that modulate a target or phenotype of interest. These methods make it possible to perform improved experiments with the micro-flow modules and to obtain more accurate and reliable results at lower costs and at a higher speed.

De onderhavige uitvinding biedt een gerobotiseerd microstromingsapparaat voor het onderhouden van zebravis larven of embryo's (Danio rerio) waarbij media en een bibliotheek aan verbindingen wordt aangeleverd aan de dieren, en waarbij hoge doorvoer sortering en screening van volledige dieren wordt gebruikt om verbindingen te identificeren.The present invention provides a robotized micro-flow device for maintaining zebrafish larvae or embryos (Danio rerio) in which media and a library of compounds is supplied to the animals, and wherein high throughput sorting and screening of entire animals is used to identify compounds.

In een aspect van de uitvinding wordt een screeningsmethode voorzien voor het identificeren van verbindingen waar een volgroeid dier of hele cel geplaatst wordt in een kamer in een microstromingsapparaatmodule, waar het dier of de hele cel in contact wordt gebracht met een te testen verbinding en beelden worden opgenomen van de kamer om resultaten te verkrijgen. De methode kan een hoge doorvoer screeningsmethode zijn waar het dier een volledig dier is, een embryo of een larve. Het dier kan wild-type of transgene zebravis larven of embryo's (Danio rerio) zijn waarin de transgene Danio rerio een vergrote biobeschikbaarheid van verbindingen omvat.In one aspect of the invention, a screening method is provided for identifying compounds where a mature animal or whole cell is placed in a room in a micro-flow device module, where the animal or whole cell is contacted with a compound to be tested and images are taken recorded from the room to get results. The method can be a high throughput screening method where the animal is a complete animal, an embryo or a larva. The animal can be wild-type or transgenic zebrafish larvae or embryos (Danio rerio) in which the transgenic Danio rerio comprises an increased bioavailability of compounds.

In een geprefereerde uitvoeringsvorm is het polynucleotide voor het uitvoeren van een methode van de uitvinding een pri- of pre-miRNA of afgewerkt miRNA, bij voorkeur geselecteerd uit de groep bestaande uit miRNA-125b-5p, pre-miRNA-125b-l, pri-miRI\IA-125b-1, miRNA-199b-5p, pre-miRNA-199b, pri-miRI\IA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri-miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, of pri-miR-33b en overlappende transcripties, precursors, functionele derivaten of fragmenten daarvan.In a preferred embodiment, the polynucleotide for carrying out a method of the invention is a pri- or pre-miRNA or finished miRNA, preferably selected from the group consisting of miRNA-125b-5p, pre-miRNA-125b-1, pri -miRI \ IA-125b-1, miRNA-199b-5p, pre-miRNA-199b, prim-miRI \ IA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3 , pri-miRNA-7-2, pri-miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, or prim miR-33b and overlapping transcripts, precursors, functional derivatives or fragments thereof.

In een verdere geprefereerde uitvoeringsvorm is het polypeptide voor het uitvoeren van een methode van de huidige uitvinding een KH-domein bevattend proteïne zoals maar niet beperkt tot AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 of TDRKH of een functioneel fragment of functioneel derivaat daarvan.In a further preferred embodiment, the polypeptide for carrying out a method of the present invention is a KH domain-containing protein such as but not limited to AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3 , FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, Pb, Pbb, Pbb, PCB , QKI, SF1 or TDRKH or a functional fragment or functional derivative thereof.

In nog een andere geprefeerde uitvoeringsvorm voor het uitvoeren van een methode van de huidige uitvinding kan het KH-domein bindend miRNA onderdeel uitmaken van, groeperen met of complementair zijn met een ander miRNA, een IncRNA, een lincRNA, een piwiRNA, een pseudogen RNA-transcriptie, een gen RNA-transcriptie, een RNA-transcriptie, overlappende gen RNA-transcripties of combinaties daarvan.In yet another preferred embodiment for carrying out a method of the present invention, the KH domain binding miRNA can be part of, group with, or complementary to another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogen RNA transcription, an RNA transcription gene, an RNA transcription, overlapping gene RNA transcripts, or combinations thereof.

In een meer preferente uitvoeringsvorm voor het uitvoeren van een methode van de huidige uitvinding (a) is het KFI-domein bindend miRNA, miRNA-125b-5p, pre-miRNA-125b-l of pri-miRNA-125b-l; en (b) is het andere miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2 ; en/of (c) is de gen RNA transcriptie, BLID en/of (d) is het IncRNA miR-lOOFIG.In a more preferred embodiment for carrying out a method of the present invention (a), the KFI domain is binding miRNA, miRNA-125b-5p, pre-miRNA-125b-1 or prim-miRNA-125b-1; and (b) the other is miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2; and / or (c) the gene is RNA transcription, BLID and / or (d) is the IncRNA miR-100FIG.

In een andere meer preferente uitvoeringsvorm voor het uitvoeren van een methode van de huidige uitvinding (a) is het KFI-domein bindende miRNA, miRNA-199b-5p, pre-miRNA-199b of pri-miRNA-199b; en (b) is het andere miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, pri-miRIMA-219a-2; en/of (c) is de gen-RNA-transcriptie DNM1 of PTGES2.In another more preferred embodiment for carrying out a method of the present invention (a), the KFI domain is binding miRNA, miRNA-199b-5β, pre-miRNA-199b, or prim-miRNA-199b; and (b) the other is miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, prim-miRIMA-219a-2; and / or (c) the gene RNA transcription is DNM1 or PTGES2.

In een andere meer preferente uitvoeringsvorm van een methode van de huidige uitvinding (a) is het KH-domein bindend miRNA , miRNA-7-2-3p, miRNA- (b) 7-3-3p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2 of pri-miRNA-7-3; en/of (c) is het lincRNA miR-7-3HG.In another more preferred embodiment of a method of the present invention (a), the KH domain is binding miRNA, miRNA-7-2-3p, miRNA- (b) 7-3-3p, pre-miRNA-7-2 , pre-miRNA-7-3, prim-miRNA-7-2 or prim-miRNA-7-3; and / or (c) the lincRNA is miR-7-3HG.

In een andere meer preferente uitvoeringsvorm van een methode van de huidige uitvinding (a) is het KH-domein bindende miRNA, miRNA-3613-3p, pre-miRNA-3613 of pri-miRNA-3613; en (b) is het andere miRNA, miRNA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-l-3p, miR-16-2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, pri-miRNA-15a, pri-miRNA-15b, pri-miRNA-16-1 of pri-miRNA-16-2; en/of (c) is de gen-RNA-transcriptie van TRIM13 of TRIM59, en/of (d) is het IncRNA is DLEU2 of RP11-432B6.3.In another more preferred embodiment of a method of the present invention (a) the KH domain is binding miRNA, miRNA-3613-3p, pre-miRNA-3613 or prim-miRNA-3613; and (b) the other is miRNA, miRNA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-1-3p, miR-16 -2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, prim-miRNA-15a, prim-miRNA-15b, prim-miRNA-16 -1 or primmiRNA-16-2; and / or (c) is the gene RNA transcription of TRIM13 or TRIM59, and / or (d) the IncRNA is DLEU2 or RP11-432B6.3.

In een andere meer preferente uitvoeringsvorm van een methode van de huidige uitvinding (a) is het KH-domein bindende miRNA, miRNA-33b-3p, pre-miRNA-33b of pri-miRNA-33b; en (b) is de gen RNA transcriptie van SREBF1, en/of (c) is het IncRNA, SMCR5.In another more preferred embodiment of a method of the present invention (a), the KH domain is binding miRNA, miRNA-33b-3β, pre-miRNA-33b, or prim-miRNA-33b; and (b) is the gene RNA transcription of SREBF1, and / or (c) is the IncRNA, SMCR5.

In een andere meer preferente uitvoeringsvorm van de huidige uitvinding,is het KH-domein bindend miRNA onderdeel van een complex dat bestaat uit het KH-domein bevattende proteïne , één of meerdere andere proteïnen, RNA’s, DNA's of iedere combinatie daarvan.In another more preferred embodiment of the present invention, the KH domain binding miRNA is part of a complex consisting of the KH domain containing protein, one or more other proteins, RNAs, DNAs, or any combination thereof.

In een andere meer preferente uitvoeringsvorm voor het uitvoeren van een methode van de huidige uitvinding, maakt het andere proteïne onderdeel uit van het EGFR-pad, het cholesterolpad, het LXR-pad of het LRP-pad.In another more preferred embodiment for carrying out a method of the present invention, the other protein is part of the EGFR path, the cholesterol path, the LXR path or the LRP path.

Sequentiegegevens voor bovenstaande en meer preferente miRNA 10 uitvoeringsvormen zijn te vinden op de miRBase site (http://www.mirbase.org/) en zijn wel bekend bij de vakkundige:Sequence data for the above and more preferred miRNA embodiments can be found on the miRBase site (http://www.mirbase.org/) and are well known to those skilled in the art:

Sequentiegegevens: Potentiële KH-domein bindende locaties kunnen zijn maar zijn niet beperkt tot de sequenties aangegeven in vetSequence data: Potential KH domain binding sites may be but are not limited to the sequences indicated in bold

Seq. 1 >hsa-mir-10a MI0000266Seq. 1> hsa-mir-10a MI0000266

GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGUGAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGU

AAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGUAAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGU

UGACAUAAACACUCCGCUCUUGACAUAAACACUCCGCUCU

Seq. 2 >hsa-mir-10b MI0000267Seq. 2> hsa-mir-10b MI0000267

CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUCCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUU

UGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGAAAAAA

UGGUCGAUGCAAAAACUUCAUGGUCGAUGCAAAAACUUCA

Seq. 3Seq. 3

>hsa-mir-99a MIOOOOIOI> hsa-mir-99a MIOOOOIOI

CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGAC

CGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUGCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG

Seq. 4 >hsa-mir-99b MI0000746Seq. 4> hsa-mir-99b MI0000746

GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACACGGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACAC

AAGCUCGUGUCUGUGGGUCCGUGUCAAGCUCGUGUCUGUGGGUCCGUGUC

Seq. 5 >hsa-mir-100 MI0000102Seq. 5> hsa-mir-100 MI0000102

CC U G U U G CCACAAACCCGUAGAUCCGAACU U G UGG UAU UAG U CCG CACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGGCC U G U U CCACAAACCCGUAGAUCCGAACU U G UGG UAU UAG U CCG CACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG

Seq. 6 >hsa-mir-125a MI0000469Seq. 6> hsa-mir-125a MI0000469

UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUCUGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUC

CAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCC

Seq. 7 >hsa-mir-125b-l MI0000446Seq. 7> hsa-mir-125b-1 MI0000446

UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCUGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACC

GUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCUGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCU

Seq. 8 >hsa-mir-125b-2 MI0000470Seq. 8> hsa-mir-125b-2 MI0000470

ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUU

UAGUAACAUCACAAGÜCAGGCUCUUGGGACCUAGGCGGAGGGGAUAGUAACAUCACAAGÜCAGGCUCUUGGGACCUAGGCGGAGGGGA

Seq. 9 >hsa-let-7c MI0000064Seq. 9> hsa-let-7c MI0000064

GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCGCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACC

CUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

Seq. 10 >hsa-let-7e MI0000066Seq. 10> hsa-let-7th MI0000066

CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAACCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAA

GGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG

Seq. 11 >hsa-mir-199a-l MI0000242Seq. 11> hsa-mir-199a-1 MI0000242

GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGGCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUG

UACAGUAGUCUGCACAUUGGUUAGGCUACAGUAGUCUGCACAUUGGUUAGGC

Seq. 12 >hsa-mir-199a-2 MI0000281Seq. 12> hsa-mir-199a-2 MI0000281

AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUAGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACU

ACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUU

AGACUGGGCAAGGGAGAGCAAGACUGGGCAAGGGAGAGCA

Seq. 13 >hsa-mir-199b MI0000282Seq. 13> hsa-mir-199b MI0000282

CCAG AGG ACACCUCCACU CCG U CU ACCCAG UG U U U AG ACU AU CUGCCAG AGG ACACCUCCACU CCG U CU ACCCAG UG U U U AG ACU AU CUG

UUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGCUUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGCU

GGGCUGGGUUAGACCCUCGGGGGCUGGGUUAGACCCUCGG

Seq. 14 >hsa-mir-33b MI0003646Seq. 14> hsa-mir-33b MI0003646

ATCACCCCATGCGGGCGGCCCCGCGGUGCAUUGCUGUUGCAUUGCATCACCCCATGCGGGCGGCCCCCCGGUGCAUUGCUGUUGCAUUGC

ACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAGCCCGGAGACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAGCCCGGAG

CCGGCCCCUGGCACCACCCGGCCCCUGGCACCAC

Seq. 15 >hsa-mir-7-2 MI0000264Seq. 15> hsa-mir-7-2 MI0000264

CUGGAUACAGAGUGGACCGGCUGGCCCCAUCUGGAAGACUAGUGACUGGAUACAGAGUGUGACACGGCUGGCCCCAUCUGGAAGACUAGUGA

UUUUGUUGUUGUCUUACUGCGCUCAACAACAAAUCCCAGUCUACCUUUUGUUGUUGUCUUACUGCGCUCAACAACAAAUCCCAGUCUACC

UAAUGGUGCCAGCCAUCGCAUAAUGGUGCCAGCCAUCGCA

Seq. 16 >hsa-mir-7-3 MI0000265Seq. 16> hsa-mir-7-3 MI0000265

AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAUAGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAU

UUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGCCUCAUUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGCCUCA

UAGCGCAGACUCCCUUCGACUAGCGCAGACUCCCUUCGAC

Seq. 17 >hsa-mir-3613 MI0016003Seq. 17> hsa-mir-3613 MI0016003

UGGUUGGGUUUGGAUUGUUGUACUUUUUUUUUUGUUCGUUGCAUUGGUUGGGUUUGGAUUGUUGUACUUUUUUUUUUGUUCGUUGCAU

UUUUAGGAACAAAAAAAAAAGCCCAACCCUUCACACCACUUCAUUUUAGGAACAAAAAAAAAAGCCCAACCCUUCACACCACUUCA

Een fluorofoor is een fluorescente chemische verbinding die na lichtexcitatie licht opnieuw kan uitstralen. Fluoroforen bevatten meestal diverse gecombineerde aromatische groepen of platte of cyclische substructuren met diverse ττ-bindingen. Een fluorodonor zoals in overeenstemming met de huidige uitvinding absorbeert lichtenergie van een specifieke golflengte (donorexcitatiespectrum) en zend licht uit met een langere golflengte (donoremissiespectrum). De fluorodonor " doneert" de excitatie-energie aan de fluoroacceptor (acceptorexcitatiespectrum), een fluorescente chemische stof die de geaccepteerde excitatie-energie opnieuw uitzendt op een langere golflengte (emissiespectrum van de ontvanger).A fluorophore is a fluorescent chemical compound that can re-emit light after light excitation. Fluorophores usually contain various combined aromatic groups or flat or cyclic substructures with various ττ bonds. A fluorodonor as in accordance with the present invention absorbs light energy of a specific wavelength (donor excitation spectrum) and emits light with a longer wavelength (donor emission spectrum). The fluorodonor "donates" the excitation energy to the fluoroacceptor (acceptor excitation spectrum), a fluorescent chemical that retransmits the accepted excitation energy at a longer wavelength (emission spectrum of the receiver).

Een dark quencher voor het uitvoeren van de methode van van de huidige uitvinding is een stof die excitatie-energie ten minste gedeeltelijk absorbeert van de fluorofore donor en de energie dissipeert als warmte. Black hole quencher (BHQTM) kleurstoffen zijn preferente dark quenchers voor het uitvoeren van de methode van de huidige uitvinding.A dark quencher for carrying out the method of the present invention is a substance that at least partially absorbs excitation energy from the fluorophore donor and dissipates the energy as heat. Black hole quencher (BHQ ™) dyes are preferred dark quenchers for carrying out the method of the present invention.

Voor het uitvoeren van de methode van de uitvinding worden de fluorofoordonor en fluorofooracceptor of de fluorofoordonor en dark quencher bij voorkeur spectraal gepaard, hetgeen betekent dat ze zodanig worden geselecteerd dat het energiespectrum uitgezonden door de fluorofoordonor (fluorofoor donoremissiespectrum) en het energiespectrum geabsorbeerd door de fluorofooracceptor (fluorofooracceptorexcitatiespectrum) of de energie geabsorbeerd door de dark quencher (quencher-absorptiepectrum) elkaar ten minste gedeeltelijk overlappen.For carrying out the method of the invention, the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are preferably spectrally paired, meaning that they are selected such that the energy spectrum emitted by the fluorophore donor (fluorophore donor emission spectrum) and the energy spectrum are absorbed by the fluorophore acceptor (fluorophore acceptor spectrum) or the energy absorbed by the dark quencher (quencher absorption spectrum) at least partially overlap.

Bij voorkeur is de fluorodonor in staat straling met een golflengte tussen de 300 nm en 900 nm te absorberen, meer preferent tussen de 350 nm en 800 nm en kan het deze energie overdragen aan de fluorofooracceptor of de dark quencher acceptor.Preferably, the fluorodonor is capable of absorbing radiation with a wavelength between 300 nm and 900 nm, more preferably between 350 nm and 800 nm, and can transfer this energy to the fluorophore acceptor or the dark quencher acceptor.

Bij voorkeur is de acceptor of dark quencher in staat straling met een golflengte tussen ongeveer 300 nm en 900 nm te absorberen, meer preferent tussen de 350 nm en 800 nm en heeft deze eenexcitatiespectrum dat overlapt met de emissie van de fluorofoordonor, zodanig dat de energie uitgezonden door de donor, de acceptor kan exciteren.Preferably, the acceptor or dark quencher is capable of absorbing radiation with a wavelength between approximately 300 nm and 900 nm, more preferably between 350 nm and 800 nm, and has an excitation spectrum that overlaps with the emission of the fluorophor donor, such that the energy sent by the donor, the acceptor can excite.

Bij voorkeur absorbeert de fluorofoor acceptor licht op een golflengte die ten minste 10 nm groter is en meer preferent ten minste 20 nm groter, en meest preferent minste 30 nm groter dan de maximale absorptiegolflengte van het donorfluorofoor. Bij voorkeur absorbeert de dark quencher ten minste 30% van de door de fluorofoordonor uitgezonden golflengte, meer preferent ten minste 50%, en meest preferent alles van de uitgezonden golflengte.Preferably, the fluorophore acceptor absorbs light at a wavelength that is at least 10 nm larger and more preferably at least 20 nm larger, and most preferably at least 30 nm larger than the maximum absorption wavelength of the donor fluorophore. Preferably, the dark quencher absorbs at least 30% of the wavelength transmitted by the fluorophor donor, more preferably at least 50%, and most preferably all of the transmitted wavelength.

In een andere preferente uitvoeringsvorm is de spectrale overlapping van het fluorofoordonoremissiespectrum en het dark-quencher-absorptiespectrum, meer preferent het black hole quencher (BHQTM) absorptiespectrum ten minste 30, bij voorkeur ten minste 50, 60 of 70, meer preferent minstens 80, en meest preferent ten minste 95 of 100 %.In another preferred embodiment, the spectral overlap of the fluorophore donor emission spectrum and the dark quencher absorption spectrum, more preferably the black hole quencher (BHQ ™) absorption spectrum is at least 30, preferably at least 50, 60 or 70, more preferably at least 80, and most preferably at least 95 or 100%.

In een preferente uitvoeringsvorm wordt ten minste één fluorofoor voor het uitvoeren van de methode van de uitvinding geselecteerd uit fluorescente proteïnen en kleine fluorescente kleurstofmoleculen, (a) bij voorkeur fluorescente proteïnen geselecteerd uit de groep bestaande uit (1.1) blauwe fluorescente proteïnen, bij voorkeur geselecteerd uit de groep bestaande uit EBFP, EBFP2, Azuriet en mTagBFP, (1.2) cyaan fluorescente proteïnen, bij voorkeur geselecteerd uit de groep bestaande uit ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl , Midori-lshi Cyan, TagCFP en mTFPl (Teal), (1.3) gele fluorescente proteïnen, bij voorkeur geselecteerd uit de groep bestaande uit EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl en mBanana, (1.4) oranje fluorescente proteïnen, bij voorkeur geselecteerd uit de groep bestaande uit Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T,In a preferred embodiment, at least one fluorophore for carrying out the method of the invention is selected from fluorescent proteins and small fluorescent dye molecules, (a) preferably fluorescent proteins selected from the group consisting of (1.1) blue fluorescent proteins, preferably selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP, (1.2) cyan fluorescent proteins, preferably selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-lshi Cyan, TagCFP and mTFP1 (Teal ), (1.3) yellow fluorescent proteins, preferably selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana, (1.4) orange fluorescent proteins, preferably selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T,

DsRed, DsRed2, DsRed-Express (Tl ), DsRed-Monomer en mTangerine, (1.5) rode fluorescente proteïnen, bij voorkeur geselecteerd uit de groep bestaande uit mRuby, mApple, mStrawberry, AsRed2, mRFPl , JRed, mCherry, HcRedl , mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum en AQ143, en (1.6) groene fluorescente proteïnen (GFP), bij voorkeur geselecteerd uit de groep bestaande uit EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen en T-Sapphire, meer preferent groene fluorescente proteïnen (1.6) en gele fluorescente proteïnen (1.3), het best EGFP; (b) bij voorkeur kleine fluorescente kleurstofmoleculen geselecteerd uit de groep bestaande uit (11.1) acridines, bij voorkeur acridine oranje of acridine geel, (11.2) cyaninen, bij voorkeur Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, (11.3) fluoronen, bij voorkeur Fluoresceïne, Carboxyfluoresceïne, Dichlorofluoresceïne, Eosine, Eosine B, Eosine Y of Erythrosine, (11.4) oxazinen, bij voorkeur Cresyl violet, Nijlblauw of Nijlrood, (11.5) phenanthridinen, bij voorkeur Ethidiumbromide,DsRed, DsRed2, DsRed-Express (T1), DsRed-Monomer and mTangerine, (1.5) red fluorescent proteins, preferably selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRedl, mRasberry dKeima-Tandem, HcRed-Tandem, mPlum and AQ143, and (1.6) green fluorescent proteins (GFP), preferably selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire, more preferably green fluorescent proteins (1.6) and yellow fluorescent proteins (1.3), best EGFP; (b) preferably small fluorescent dye molecules selected from the group consisting of (11.1) acridines, preferably acridine orange or acridine yellow, (11.2) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, (11.3) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosine, Eosine B, Eosine Y or Erythrosine, (11.4) oxazines, preferably Cresyl violet, Nile blue or Nile red, (11.5) phenanthridines, preferably Ethidium bromide,

Gelred of Propidiumjodide, en (11.6) rhodamines, bij voorkeur Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101, Sulforhodamine B of Texas red, (c) meer preferent cyanine en rhodamine kleurstoffen.Gelred or Propidium iodide, and (11.6) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101, Sulforhodamine B or Texas Red, (c) more preferably cyanine and rhodamine dyes.

Bovenstaande fluorofoordonors zijn algemeen bekend in het vakgebied. Zij staan bijvoorbeeld vermeld op bijv. fluirophores.org.The above fluorophore donors are well known in the art. For example, they are listed on, for example, fluirophores.org.

De meest geprefeerde fluorofoordonor is Groen fluorescent proteïne (GFP), dat 238 aminozuren bevat en dat bij excitatie felgroen fluorescent licht uitstraalt (eGFP, Exmax=488nm, Emmax=509 nm). Met de term Groen fluorescent proteïne(s) zoals hier gebruikt omvat in het algemeen ook de derivaten ervan, preferent die zijn geselecteerd uit de groep bestaande uit EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen en T-Sapphire.The most preferred fluorophore donor is Green fluorescent protein (GFP), which contains 238 amino acids and which emits bright green fluorescent light on excitation (eGFP, Exmax = 488nm, Emmax = 509 nm). The term Green fluorescent protein (s) as used herein also generally includes its derivatives, preferably selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire.

In een preferente uitvoeringsvorm wordt ten minste één fluorofooracceptor geselecteerd uit de groep bestaande uit (a) acridinen, bij voorkeur acridine oranje of acridine geel, (b) cyaninen, bij voorkeur Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 or Cy7, (c) fluoronen, bij voorkeur Fluoresceïne, Carboxyfluoresceïne, Dichlorofluoresceïne, Eosine, Eosine B, Eosine Y of Erythrosine, (d) oxazinen, bij voorkeur Cresyl violet, Nijlblauw of Nijlrood, (e) phenanthridinen, bij voorkeur Ethidiumbromide, Gelred of Propidiumjodide, en (f) rhodamines, bij voorkeur Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101, Sulforhodamine B of Texasrood, meer preferent cyaninen (b), meest preferent Cy3.In a preferred embodiment, at least one fluorophore acceptor is selected from the group consisting of (a) acridines, preferably acridine orange or acridine yellow, (b) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 or Cy7, (c) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosine, Eosine B, Eosine Y or Erythrosine, (d) oxazines, preferably Cresyl violet, Nile blue or Nile red, (e) phenanthridines, preferably Ethidium bromide, Gelred or Propidium iodide, and (f) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101, Sulforhodamine B or Texas red, more preferably cyanines (b), most preferably Cy3.

Cyanine 3 (Cy3) is een klein molecuul fluorofoor dat bij excitatie een felroze fluorescentie (Exmax=550nm, Emmax=570nm) vertoont.Cyanine 3 (Cy3) is a small molecule of fluorophore that exhibits a bright pink fluorescence (Exmax = 550 nm, Emmax = 570 nm) on excitation.

De meest preferente Cy3 verbinding voor het demonstreren van de methode van de uitvinding wordt bevestigd aan een ribonucleotide in het miRINA door middel van een reactie met een azide.The most preferred Cy3 compound for demonstrating the method of the invention is attached to a ribonucleotide in the miRINA by reaction with an azide.

In een andere preferente uitvoeringsvorm wordt ten minste één dark quencher geselecteerd uit de groep bestaande uit Dabcyl, Dabsyl, Black Hole Quenchers (BHQTM) kleurstoffen; meer preferent BHQ- 0, BHQ-1 , BHQ-2 of BHQ-3, QXL quenchers; meer preferent QXL 490, QXL 570, QXL 610, QXL 670, of QXL 680, Iowa Black quenchers; meer preferent Iowa black FQ of Iowa Black RQ, en IRDyes; meer preferent IRDye 800, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, nog meer preferent Black Hole Quenchers (BHQTM) kleurstoffen, en het meest preferent BHQ-1.In another preferred embodiment, at least one dark quencher is selected from the group consisting of Dabcyl, Dabsyl, Black Hole Quenchers (BHQ ™) dyes; more preferably BHQ-0, BHQ-1, BHQ-2 or BHQ-3, QXL quenchers; more preferably QXL 490, QXL 570, QXL 610, QXL 670, or QXL 680, Iowa Black quenchers; more preferably Iowa black FQ or Iowa Black RQ, and IRDyes; more preferred IRDye 800, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, even more preferred Black Hole Quenchers (BHQTM) dyes, and the most preferred BHQ-1.

De term Black Hole Quenchers (BHQTM) kleurstoffen zoals hier gebruikt, omvat in het algemeen alle functionele derivaten. Black hole quencher 1 (BHQ1 ) is een klein molecuul dat bij excitatie fluorescentie absorbeert (breed bereik, Ex=480 tot 580 nm). Het meest preferente BHQ1 functionele derivaat voor het demonstreren van de methode van de uitvinding zoals geïllustreerd in de voorbeelden wordt bevestigd aan een ribonucleotide in het miRNA door reactie met het azide.The term Black Hole Quenchers (BHQ ™) dyes as used herein generally includes all functional derivatives. Black hole quencher 1 (BHQ1) is a small molecule that absorbs fluorescence upon excitation (wide range, Ex = 480 to 580 nm). The most preferred BHQ1 functional derivative for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide.

De vakkundige persoon kan snel spectraal gepaarde fluorofoordonors en fluorofooracceptors of spectraal gepaarde fluorofoordonors en dark quenchers selecteren gebaseerd op de bekende of eenvoudig meetbare emissiespectra voor de donors, de bekende of eenvoudig meetbare excitatiespectra van de acceptors en de bekende of eenvoudig meetbare absorptiespectra van de dark quenchers. bindende miRNA plaatsvinden onder condities die FRET (Förster Résonance Energy Transfer) mogelijk maken tussen de fluorofoordonor en de fluorofooracceptor of tussen de fluorofoordonor en de dark quencher. Condities voor moleculaire interacties tussen biomoleculen zoals bijv. polypeptiden en nucleotiden zijn algemeen bekend in het vakgebied. De condities moeten zo worden gekozen dat covalente en/of preferent non-covalente binding van de van belang zijnde biomoleculen worden bevorderd zodat de fluorofoordonor(s) en de fluorofooracceptor(s) of dark quencher(s) elkaar op kleine afstand van 10 of minder nanometer naderen,. En de condities moeten bij voorkeur de biomoleculen niet denatureren of allezins hun natuurlijke structuur en functie niet beïnvloeden. Ook moeten de condities het FRET-signaal niet reduceren.The skilled person can quickly select spectrally paired fluorophore donors and fluorophore acceptors or spectrally paired fluorophore donors and dark quenchers based on the known or easily measurable emission spectra for the donors, the known or easily measurable excitation spectra of the acceptors and the known or easily measurable absorption spectra of the dark quenchers . binding miRNA take place under conditions that enable FRET (Förster Résonance Energy Transfer) between the fluorophore donor and the fluorophore acceptor or between the fluorophore donor and the dark quencher. Conditions for molecular interactions between biomolecules such as, for example, polypeptides and nucleotides are well known in the art. The conditions must be chosen in such a way that covalent and / or preferentially non-covalent binding of the biomolecules of interest is promoted so that the fluorophore donor (s) and fluorophore acceptor (s) or dark quencher (s) each other at a small distance of 10 or less approaching nanometers ,. And the conditions should preferably not denature the biomolecules or at least not affect their natural structure and function. The conditions must also not reduce the FRET signal.

Voor het uitvoeren van de methode van de uitvinding wordt de verbinding die van belang is, geïdentificeerd als een verbinding die een interactie tussen de twee biomoleculen of de twee domeinen van de biomoleculen moduleert, bij voorkeur inhibeert of vergroot, indien de FRET (Förster Résonance Energy Transfer) tussen de eerste en tweede biomoleculen of tussen het eerste en tweede domein verschilt in aanwezigheid van de verbinding die van belang is vergeleken met de FRET tussen de eerste en tweede biomoleculen of tussen de eerste en tweede domeinen in afwezigheid van de verbinding die van belang is.For carrying out the method of the invention, the compound of interest is identified as a compound that modulates, preferably inhibits or increases, an interaction between the two biomolecules or the two domains of the biomolecules if the FRET (Förster Résonance Energy Transfer) between the first and second biomolecules or between the first and second domain differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or between the first and second domains in the absence of the compound of interest is.

Indien de verbinding de interactie inhibeert, zal de afstand van de fluorofoordonor en de fluorofooracceptor of van de fluorofoor donor en de dark quencher toenemen, en dus de FRET verlagen of afbreken. Indien de verbinding de biomolecuul interactie vergroot zal de FRET toenemen. Voor het positief identificeren van de verbinding die van belang is als een modulator, van het eerste en tweede biomolecuul of het eerste en tweede domein moet de FRET worden vergeleken in aanwezigheid en afwezigheid van de verbinding die van belang is. Bij voorkeur, zullen verbindingen waarvan bekend is dat ze de interactie van de eerste en tweede biomoleculen of de eerste en tweede domeinen moduleren, worden gebruikt als een verdere referentie en worden vergeleken met de FRET-resultaten met een zonder de verbinding die van belang is.If the compound inhibits the interaction, the distance from the fluorophore donor and the fluorophore acceptor or from the fluorophore donor and the dark quencher will increase, and thus decrease or degrade the FRET. If the compound increases the biomolecule interaction, the FRET will increase. To positively identify the compound of interest as a modulator, of the first and second biomolecules or the first and second domain, the FRET must be compared in the presence and absence of the compound of interest. Preferably, compounds known to modulate the interaction of the first and second biomolecules or the first and second domains will be used as a further reference and compared to the FRET results with one without the compound of interest.

De methode van de uitvinding en zijn preferente uitvoeringsvormen hebben een aantal voordelen ten opzichte van de screeningsmethoden die in het algemeen gebruikt worden voor het identificeren van modulerendeverbindingen die van belang zijn, die in het bijzonder biomolecuulinteractie reduceren, inhiberen, initiëren of vergroten. De inventieve methode is eenvoudig, en vereist enkel het in contact brengen van de verbinding die van belang is met spectraal gepaarde biomoleculen of domeinen onder condities die geschikt zijn voor biomolecuulinteractie en FRET en dat de meetwaarde spectraal is en daarom eenvoudig te automatiseren. De methode is bijzonder geschikt voor het screenen van polypeptide-miRNA-interacties die belangrijke doelen vertegenwoordigen voor medische behandelingen.The method of the invention and its preferred embodiments have a number of advantages over the screening methods that are generally used to identify modulating compounds of interest that, in particular, reduce, inhibit, initiate or increase biomolecule interaction. The inventive method is simple, and only requires contacting the compound of interest with spectrally paired biomolecules or domains under conditions suitable for biomolecule interaction and FRET and that the measured value is spectral and therefore easy to automate. The method is particularly suitable for screening polypeptide-miRNA interactions that represent important goals for medical treatments.

Gezien de rollen van microRNA in en aantal cellulaire processen waaronder normale ontwikkeling, cellulaire homeostatis, kanker en normale of pathologische veroudering of degeneratie, vinden verbindingen die specifiek de werking van microRNA moduleren toepassing in de behandeling van ziektes en condities gerelateerd aan microRNA, bijv. als chemotherapeutica voor de behandeling van kankers zoals hersenkanker of voor de behandeling van neurodegeneratieve ziektes. Bovendien kunnen microRNA modulatoren worden ingezet in het onderzoekskader voor het analyseren van de biogenese, afbraak en werking van microRNA's.Given the roles of microRNA in a number of cellular processes including normal development, cellular homeostatis, cancer and normal or pathological aging or degeneration, compounds that specifically modulate the action of microRNA find application in the treatment of diseases and conditions related to microRNA, e.g. as chemotherapeutic agents for the treatment of cancers such as brain cancer or for the treatment of neurodegenerative diseases. In addition, microRNA modulators can be used in the research framework for analyzing the biogenesis, degradation and functioning of microRNAs.

Eveneens beslaat het terrein van de uitvinding een methode voor het identificeren van microRNA modulators. De microRNA modulator kan een antagonist zijn of de microRNA-modulator kan een agonist zijn. In overeenstemming met deze methode, wordt een cel, met daarin een microRNA en een microRNA bindende sequentie, die operationeel gekoppeld is aan een nucleïnezuurmolecuul dat een reporterproteïne codeert, in contact gebracht met een potentieel therapeutisch agens en wordt bepaald of het agens de expressie van het reporterproteïne verhoogt of verlaagt.The field of the invention also covers a method for identifying microRNA modulators. The microRNA modulator can be an antagonist or the microRNA modulator can be an agonist. In accordance with this method, a cell containing a microRNA and a microRNA binding sequence operably linked to a nucleic acid molecule encoding a reporter protein is contacted with a potential therapeutic agent and it is determined whether the agent expresses the expression of the reporter protein increases or decreases.

In bepaalde uitvoeringsvormen van de uitvinding, zijn het KH-domein bindende microRNA en het KH-domein bevattende proteïne of domein ingezet in de onderhavige test, gerelateerd aan een ziekte of stoornis, waarin een antagonist of agonist voor het KH-domein bindende microRNA of het KH-domein bevattende proteïne of de interactie tussen beiden, nuttig zou zijn bij het voorkomen of behandelen van de ziekte of de conditie.In certain embodiments of the invention, the KH domain binding microRNA and the KH domain containing protein or domain are deployed in the present test, related to a disease or disorder, wherein an antagonist or agonist for the KH domain binding microRNA or the KH domain-containing protein, or the interaction between them, would be useful in preventing or treating the disease or condition.

Voor het monitoren van binding tussen het KH-domein bindende microRNA en de microRNA bindende sequentie, wordt een microRNA bindende sequentie operationeel gekoppeld aan een nucleïnezuurmolecuul dat een reporterproteïne codeert. Zoals hier gebruikt heeft de term "operationeel gekoppeld" betrekking op een koppeling van nucleïnezuurelementen in een functionele relatie. Een nucleïnezuur molecuul dat codeert voor een reporterproteïne dat "operationeel gekoppeld" is aan een microRNA bindende sequentie, houdt in dat voornoemde microRNA bindende sequentie zich op de juiste locatie bevindt en de juiste oriëntatie heeft ten opzichte van de coderende sequentie om, bij het binden door een microRNA, expressie van de coderende sequentie aan te sturen. Bepaalde uitvoeringsvormen van de uitvinding behelzen het operationeel koppelen van de microRNA bindende sequentie stroomafwaarts (d.w.z., 3') van de reporterproteïne coderende sequentie. Meer bepaald bevindt de microRNA bindende sequentie zich in de 3'-UTR van het mRNA dat de reporter codeert. Andere uitvoeringsvormen van de uitvinding behelzen de microRNA bindende sequentie bovenstrooms van de reporterproteïne coderende sequentie, d.w.z. in het 5'-UTR. De microRNA bindende sequentie kan iedere bindende sequentie zijn die informatie kan verstrekken over de interactie tussen het KH-domein bindende microRNA en het KH-domein bindende proteïne.To monitor binding between the KH domain binding microRNA and the microRNA binding sequence, a microRNA binding sequence is operably linked to a nucleic acid molecule encoding a reporter protein. As used herein, the term "operably linked" refers to a coupling of nucleic acid elements in a functional relationship. A nucleic acid molecule encoding a reporter protein that is "operably linked" to a microRNA binding sequence means that said microRNA binding sequence is in the correct location and has the correct orientation with respect to the coding sequence for binding by control a microRNA, expression of the coding sequence. Certain embodiments of the invention involve operably linking the microRNA binding sequence downstream (i.e., 3 ') of the reporter protein coding sequence. In particular, the microRNA binding sequence is in the 3 'UTR of the mRNA encoding the reporter. Other embodiments of the invention involve the microRNA binding sequence upstream of the reporter protein coding sequence, i.e., in the 5 'UTR. The microRNA binding sequence can be any binding sequence that can provide information about the interaction between the KH domain binding microRNA and the KH domain binding protein.

Zoals conventioneel is in het vakgebied, is een reporterproteïne een proteïne dat een detecteerbaar signaal produceert wanneer het tot uitdrukking wordt gebracht. Reporterproteïnen die in de uitvinding worden gebruikt kunnen autofluorescent zijn of een reactie katalyseren die een detecteerbaar product oplevert. Voorbeelden van zulke reporterproteïnen zijn onder andere, maar niet beperkt tot, Groen Fluorescent Proteïne (GFP) , Rood Fluorescent Proteïne (RFP) , Geel Fluorescent Proteïne (YFP) , luciferase, bèta-galactosidase, en bèta-glucuronidase.As is conventional in the art, a reporter protein is a protein that produces a detectable signal when expressed. Reporter proteins used in the invention can be autofluorescent or catalyze a reaction that yields a detectable product. Examples of such reporter proteins include, but are not limited to, Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), Yellow Fluorescent Protein (YFP), luciferase, beta-galactosidase, and beta-glucuronidase.

In het algemeen zal het nucleïnezuurmolecuul dat voor het reporterproteïne codeert zich bevinden in een vector om manipulatie en transformatie gemakkelijk te maken. Iedere geschikte vector, in het bijzonder iedere geschikte expressievector, kan worden gebruikt inclusief chromosomaal, episomaal en van virussen afgeleide vectors, zoals vectors afgeleid van bacteriale plasmiden, van bacteriofagen, van transposonen, van gistepisomen, van invoegelementen, van gistchromosomale elementen, van virussen zoals baculovirussen, papovavirussen, zoals SV40, vaccinia virussen, adenovirussen, vogelpokkenvirussen, pseudorabiësvirussen en retrovirussen en vectors afgeleid van combinaties daarvan, zoals die afgeleid van plasmide en bacteriofaaggenetische elementen, zoals cosmiden en faagmiden. In het algemeen kan ieder systeem of vector in staat tot onderhoudenn, propageren of uitdrukken van een mRNA om een . proteïne te produceren in een gastheer worden gebruik. Wat dit betreft moet de expressievector een promoter bevatten upstream van de coderende sequentie voor het richten van de transcriptie (bijv. conditioneel of constitutief) van het mRNA dat voor het reporterproteïne codeert. Bovendien kan de vector andere regulerende sequenties bevatten zoals polyadenylationsignalen en dergelijke om mRNA transcriptie en translatie van het reporterproteïne aan te sturen. Zulke nucleïnezuurmoleculen kunnen worden ingevoegd in een expressievector door iedere variant van welbekende en routinematige technieken.In general, the nucleic acid molecule encoding the reporter protein will be in a vector to facilitate manipulation and transformation. Any suitable vector, in particular any suitable expression vector, may be used including chromosomal, episomal and virus-derived vectors, such as vectors derived from bacterial plasmids, from bacteriophages, from transposons, from yeast episomes, from insert elements, from yeast chromosomal elements, from viruses such as baculoviruses, papovaviruses, such as SV40, vaccinia viruses, adenoviruses, bird pox viruses, pseudorabies viruses, and retroviruses and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophagegenic elements, such as cosmids and phagemids. In general, any system or vector can be capable of maintaining, propagating, or expressing an mRNA around one. produce protein in a host. In this regard, the expression vector must contain a promoter upstream of the coding sequence to direct the transcription (e.g., conditional or constitutive) of the mRNA encoding the reporter protein. In addition, the vector may contain other regulatory sequences such as polyadenylation signals and the like to direct mRNA transcription and translation of the reporter protein. Such nucleic acid molecules can be inserted into an expression vector by any variant of well-known and routine techniques.

Volgens de huidige methode nuttige cellen kunnen worden geselecteerd voor de expressie van een endogeen KH-domein bindend microRNA of een endogeen KH-domein bevattend proteïne of kunnen genetisch worden gemodificeerd met behulp van conventionele methoden voor het tot expressie brengen van een exogeneen KH domein bindend microRNA of een exogeen KH-domein bevattend proteïne. Het gebruik van cellen in overeenstemming met de huidige methode kunnen worden geselecteerd voor het onderdrukken'van een endogeen KH-domein bindend microRNA of een endogeen KH-domein bevattend proteïne of kunnen genetisch gemodificeerd worden met behulp van conventionele methoden voor het onderdrukken van een endogeen KH domein bindend microRNA of een endogeen KH-domein bevattend proteïne.Useful cells according to the present method can be selected for the expression of an endogenous KH domain binding microRNA or an endogenous KH domain containing protein or can be genetically modified using conventional methods for expressing an exogenous KH domain binding microRNA or an exogenous KH domain-containing protein. The use of cells in accordance with the current method can be selected to suppress an endogenous KH domain binding microRNA or an endogenous KH domain-containing protein or can be genetically modified using conventional methods for suppressing an endogenous KH domain binding microRNA or an endogenous KH domain containing protein.

Cellen van de uitvinding zijn standaard eukaryoot en bij voorkeur afkomstig van zoogdieren meer preferent van mensen. Voorbeelden van geschikte humane gastheercellen zijn onder andere, maar niet beperkt tot SH-SY5Y neuroblastoma cellijn; HT22 neuronale cellijn; 9L gliosarcoma cellijn; A172, U87 XXX, U373, LN229, LN428, LN308 glioblastoma cellijnen; GL261 muisglioma cellijn; BOSC 23 astrocyt cellijn; D283, Daoy medulloblastoma cellijnen of H06/M0313K6-1C oligodendrogliale cellijn, die goed bekend en commercieel beschikbaar zijn in het vakgebied zijn van bronnen zoals maar niet beperkt tot de American Type Culture Collection (Manassas, VA, USA).Cells of the invention are standard eukaryotic and preferably derived from mammals, more preferably from humans. Examples of suitable human host cells include, but are not limited to, SH-SY5Y neuroblastoma cell line; HT22 neuronal cell line; 9L gliosarcoma cell line; A172, U87 XXX, U373, LN229, LN428, LN308 glioblastoma cell lines; GL261 mouse glioma cell line; BOSC 23 astrocyte cell line; D283, Daoy medulloblastoma cell lines or H06 / M0313K6-1C oligodendroglial cell line, which are well known and commercially available in the art from sources such as but not limited to the American Type Culture Collection (Manassas, VA, USA).

Om de methoden waarop aanspraak wordt gemaakt uit te voeren, moeten cellen die een KH-domein bindend microRNA herbergen ook worden getransformeerd of getransfecteerd met de microRNA bindende sequentie die operationeel gekoppeld is aan het nucleïnezuurmolecuul dat het reporterproteïne codeert. In het algemeen kan het introduceren van nuclelïnezuren in zoogdiercellen worden gerealiseerd met methoden beschreven in veel standaard laboratoriumhandleidingen.To implement the claimed methods, cells harboring a KH domain binding microRNA must also be transformed or transfected with the microRNA binding sequence operably linked to the nucleic acid molecule encoding the reporter protein. In general, the introduction of nuclelic acids into mammalian cells can be achieved by methods described in many standard laboratory manuals.

Zulke methoden omvatten bijvoorbeeld calciumfosfaattransfectie„door DEAE-dextran tot stand gebrachte transfectie, transfectie, micro-injectie, door kationische lipiden tot stand gebrachte transfectie, elektroporatie, transductie, 'scrape loading', ballistische inbrengen of infectie.Such methods include, for example, calcium phosphate transfection, DEAE-dextran-mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic insertion, or infection.

Zodra een cel zowel het KH-domein bindend microRNA, de microRNA bindende sequentie operationeel gekoppeld aan een nucleïnezuurmolecuul dat het reporterproteïne codeert en/of het KH-domein bevattende proteïne herbergt, wordt de screeningstest uitgevoerd door de cel met een potentieel therapeutisch agens in contact te brengen.Once a cell contains both the KH domain binding microRNA, the microRNA binding sequence operably linked to a nucleic acid molecule encoding the reporter protein and / or the KH domain containing protein, the screening test is performed by contacting the cell with a potential therapeutic agent. bring.

Potentieel therapeutisch agens die kunnenworden gescreend in overeenstemming met de methode van de huidige uitvinding zijn in het algemeen verkrijgbaar in bibliotheken van agentia of verbindingen. Dergelijke bibliotheken kunnen hetzij collecties van pure agentia bevatten of collecties van mengsels van agentia. Voorbeelden van pure agentia zijn onder andere, maar niet beperkt tot, proteïnen, polypeptiden, peptiden, nucleïnezuren, oligonucleotiden, koolwaterstoffen, lipiden, synthetische of semi-synthetische moleculen, en gezuiverde of gedeeltelijk gezuiverde natuurlijke producten. Voorbeelden van mengsels van agentia zijn onder andere, maar niet beperkt tot, extracten van prokaryotische of eukariotische cellen en weefsels alsmede fermentatievloeistoffen en bovenstaande vloeistoffen van cel- of weefselculturen. In bepaalde uitvoeringsvormen van deze uitvinding is het testagens geen nucleïnezuur of nucleïnezuurmolecuul, bijv. geen antisense RNA, siRNA of dergelijke. In andere uitvoeringsvormen is het testagens een klein organisch molecuul.Potentially therapeutic agents that can be screened in accordance with the method of the present invention are generally available in libraries of agents or compounds. Such libraries can either contain collections of pure agents or collections of mixtures of agents. Examples of pure agents include, but are not limited to, proteins, polypeptides, peptides, nucleic acids, oligonucleotides, hydrocarbons, lipids, synthetic or semi-synthetic molecules, and purified or partially purified natural products. Examples of agent mixtures include, but are not limited to, extracts from prokaryotic or eukariotic cells and tissues as well as fermentation fluids and supernatants from cell or tissue cultures. In certain embodiments of this invention, the test agent is not a nucleic acid or nucleic acid molecule, e.g., no antisense RNA, siRNA, or the like. In other embodiments, the test agent is a small organic molecule.

Bibliotheekscreening kan worden uitgevoerd zoals hier beschreven of in iedere formaat dat een snelle bereiding en verwerking van meerdere reacties toelaat. Voor screeningstesten in vitro kunnen voorraadoplossingen van de testagentia alsmede testcomponenten handmatig worden bereid en alle aansluitende activiteiten zoals pipetteren, verdunnen, mengen, wassen, incuberen, monsterwaarden aflezen en verzamelen van data, kunnen worden uitgevoerd met behulp van in de handel verkrijgbare robotpipetteerapparatuur, automatische werkstations en analyse-instrumenten voor het detecteren van het signaal gegenereerd de test. Voorbeelden van dergelijke detectors zijn onder andere, maar niet beperkt tot, luminometers, spectrofotometers en fluorimeters of ieder ander apparaat dat wijzigingen in de activiteit van reporterproteïnen kan detecteren.Library screening can be performed as described here or in any format that allows rapid preparation and processing of multiple responses. For in vitro screening tests, stock solutions from the test agents as well as test components can be prepared manually and all subsequent activities such as pipetting, diluting, mixing, washing, incubating, reading sample values and collecting data can be performed using commercially available robotic pipetting equipment, automatic workstations and analysis tools for detecting the signal generated by the test. Examples of such detectors include, but are not limited to, luminometers, spectrophotometers, and fluorimeters or any other device that can detect changes in the activity of reporter proteins.

Op het moment dat signalen gegenereerd door het reporterproteïne worden gedetecteerd wordt bepaald of het geteste agens de expressie van het reporterproteïne verhoogt of verlaagt ten opzichte van een controle. Een dergelijke bepaling kan worden uitgevoerd door het signaal dat wordt geproduceerd door een cel in contact met het testagens te vergelijken met het signaal geproduceerd door een controlecel, bijv., een cel die niet met een te testen agens in contact is gebracht of een cel in contact gebracht met het te testen agens maar waarin een microRNA bindende sequentie ontbreekt. Agentia die resulteren in hogere reporterproteïnesignalen zijn indicatief voor agentia met antagonistische werking op het miRNA waardoor ze de expressie van het reporterproteïne vergroten. In contrast daarmee zijn agentia die resulteren in een verlaging van het reporterproteïnesignaal in vergelijking met een controle, indicatief voor agentia met een agonistische werking op het miRNA waardoor ze de expressie van het reporterproteïne verlagen.The moment signals generated by the reporter protein are detected, it is determined whether the agent tested increases or decreases the expression of the reporter protein relative to a control. Such a determination can be made by comparing the signal produced by a cell in contact with the test agent with the signal produced by a control cell, e.g., a cell that has not been brought into contact with a test agent or a cell in brought into contact with the agent to be tested but lacking a microRNA binding sequence. Agents that result in higher reporter protein signals are indicative of agents with antagonistic action on the miRNA thereby increasing the expression of the reporter protein. In contrast, agents that result in a decrease in the reporter protein signal as compared to a control are indicative of agents with an agonistic action on the miRNA thereby reducing the expression of the reporter protein.

Een effectieve hoeveelheid van een antagonistische verbinding is een hoeveelheid die de activiteit van het KH-domein bindende microRNA of reduceren of verlagen of verhogen met 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of 100%. Zulke activiteit kan worden opgevolgd door het niveau van het doel-mRNA of het niveau van het proteïneproduct te detecteren dat vanaf het doel-mRNA is getranslateerd.An effective amount of an antagonistic compound is an amount that reduces or decreases or increases the activity of the KH domain binding microRNA by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or 100%. Such activity can be monitored by detecting the level of the target mRNA or the level of the protein product translated from the target mRNA.

Wanneer een rol van het KH-domein bindend miRNA in diverse ziekten en aandoeningen is geïdentificeerd, kan het inhiberen van de activiteit van een KH-domein bindend microRNA met een microRNA antagonist nuttig zijn bij het selectief analyseren van de biogenese, degradatie en werking van de KH-domein bindende microRNA's alsmede bij het voorkomen of behandelen van ziekten en aandoeningen waarbij deze microRNA's zijn betrokken.When a role of the KH domain binding miRNA in various diseases and conditions has been identified, inhibiting the activity of a KH domain binding microRNA with a microRNA antagonist may be useful in selectively analyzing the biogenesis, degradation, and action of the KH domain binding microRNAs as well as in the prevention or treatment of diseases and conditions involving these microRNAs.

Zoals aangegeven worden agonisten eveneens omvat door dit onderzoek waarin voornoemde agonisten nuttig zijn bij het selectief analyseren van de biogenese, afbraak en functie van het KH-domein bevattende microRNA alsmede in het voorkomen of behandelen van ziekten en aandoeningen waarbij deze microRNA's zijn betrokken.As indicated, agonists are also included in this study in which the aforementioned agonists are useful in selectively analyzing the biogenesis, degradation, and function of the KH domain containing microRNA as well as in the prevention or treatment of diseases and conditions involving these microRNAs.

En dus heeft de huidige uitvinding ook betrekking op methoden waarin de interactie tussen het KH-domein bindende microRNA en het KH-domein bevattende proteïne direct of indirect een gewijzigde oppervlaktelevering, transport, stabiliteit, recycling of translatie veroorzaakt van een proteïne in de cel. Een andere uitvoering van de huidige uitvinding is een methode waarin de interactie tussen het KH-domein bindende microRNA en het KH-domein bevattende proteïne direct of indirect leidt tot een gewijzigde oppervlaktelevering, transport, splitsing, transcriptie, stabiliteit of recycling van een RNA in de cel. En nog een andere uitvoeringsvorm van de huidige uitvinding is een methode waarin het veranderen van de interactie tussen het KH-domein bindende microRNA en het KH-domein bevattende proteïne direct of indirect de proliferatie, differentiatie, apoptose, nécrosé, autofagie, motiliteit, migratie of invasie van een cel verandert.And so the present invention also relates to methods in which the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly causes altered surface delivery, transport, stability, recycling or translation of a protein in the cell. Another embodiment of the present invention is a method in which the interaction between the KH domain binding microRNA and the KH domain containing protein leads directly or indirectly to altered surface delivery, transport, cleavage, transcription, stability or recycling of an RNA in the RNA. cell. And yet another embodiment of the present invention is a method in which changing the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly the proliferation, differentiation, apoptosis, necrosis, autophagia, motility, migration or cell invasion changes.

Geschikte KH-domein bevattende proteïnen kunnen omvatten maar zijn niet beperkt tot: AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 of TDRKH.Suitable KH domain-containing proteins may include but are not limited to: AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPP, IGF2, IGF2, IGF2 IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 or TDRKH.

De A-kinase ankerproteïnen (AKAP's) zijn een groep proteïnen met een diverse structuur die de algemene functie hebben de regulerende subeenheid van proteïnekinase A (PKA) te binden en het holo-enzym in afzonderlijke locaties binnen de cel te verankeren. AKAP1 (A-kinase ankerproteïne 1) codeert een KH-domein bevattend lid van de AKAP-familie. Het gecodeerde proteïne bindt aan type I en type II regulerende subeenheden van PKA en verankert deze aan het mitochondrium. Van dit proteïne wordt vermoed dat het betrokken is bij het cAMP-afhankelijke signaaltransductiepad en in het sturen van RNA naar een specifiek cellulair compartiment.The A-kinase anchor proteins (AKAPs) are a group of proteins with a diverse structure that have the general function of binding the regulatory subunit of protein kinase A (PKA) and anchoring the holoenzyme in separate locations within the cell. AKAP1 (A-kinase anchor protein 1) encodes a KH domain-containing member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors these to the mitochondrium. This protein is thought to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment.

De ankyrin repeat en KH-domein bevattende proteïnen coderen proteïnen met ankyrin repeats en een enkelvoudig KH-domein. Zij worden geassocieerd met proteïne-proteïne-interacties en kunnen functioneren als steigerbouwproteïnen Alternatieve splitsings resulteert in meerdere transcriptievarianten. ANKHD1 en ANKRD17 en hun splitsingsvarianten coderen KH-domein bevattende leden van de ankyrin repeat en KH-domein bevattende proteïnen. ANKHD1 (ankyrin repeat en KH-domein bevattend 1) kan een fusietranscriptie genereren (MASK-BP3) met het stroomafwaarts eIF4E-bindend proteïne 3 (EIF4EBP3) gen, resulterend in een proteïne dat bestaat uit de ANKHD1 sequentie voor het grootste deel van het proteïne en een andere C-terminus vanwege een alternatieve uitlezingskader van de EIF4EBP3 segmenten. Voor ANKRD17 (ankyrin repeat domein 17) zijn er drie transcriptievarianten die coderen voor verschillende isovormen gevonden. ASCC1 (activerend signaalcoïntegrator 1 complex subeenheid 1) codeert een subeenheid van het activerende signaalcoïntegrator 1 (ASC-l)-complex. Het ASC-1 complex is een transcriptionele coactivator die een belangrijke rol speelt in gentransactivering door meervoudige transcriptiefactoren waaronder activerend proteïne 1 (AP-1), nucleaire factor kappa-B (NF-kB) en serumresponsfactor (SRF). Het coderende proteïne bevat een N-terminal KH-type RNA-bindend motief dat vereist is voor AP-1 transactivering door het ASC-1 complex. Alternatief gesplitste transcripties die meerdere isovormen coderen zijn voor dit gen waargenomen. BICC1 (Bicaudal C familie RNA bindend proteïne 1) codeert voor een RNA-bindend proteïne dat actief is in het reguleren van genexpressie door het moduleren van proteïnetranslatie tijdens embryonale ontwikkeling. Treedt op als een negatieve regulator van Wnt signalering. Het is een paralog van HDLBP (High Density Lipoprotein Binding Protein) dat Hoge Dichtheid Lipoproteine (HDL) bindt en als functie kan hebben om te hoge cholesterolniveaus in cellen te reguleren. Het HDLBP-proteïne bindt ook RNA en kan heterochromatine vorming induceren. Drie transcriptievarianten die twee verschillende isovormen coderen zijn voor dit gen gevonden. Het blijkt een rol te spelen in celsterol metabolisme. Het kan functioneren om cellen te beschermen tegen overaccumulatie van cholesterol. BICC1 en HDLBP zijn meer geprefereerde KH-domein bevattende proteïnen van de uitvinding.The ankyrin repeat and KH domain-containing proteins encode proteins with ankyrin repeats and a single KH domain. They are associated with protein-protein interactions and can function as scaffold building proteins. Alternative cleavage results in multiple transcription variants. ANKHD1 and ANKRD17 and their cleavage variants encode KH domain-containing members of the ankyrin repeat and KH domain-containing proteins. ANKHD1 (ankyrin repeat and KH domain containing 1) can generate a fusion transcription (MASK-BP3) with the downstream eIF4E binding protein 3 (EIF4EBP3) gene, resulting in a protein consisting of the ANKHD1 sequence for the majority of the protein and another C-terminus due to an alternative read-out framework of the EIF4EBP3 segments. For ANKRD17 (ankyrin repeat domain 17), three transcription variants encoding different isoforms were found. ASCC1 (activating signal integrator 1 complex subunit 1) encodes a subunit of the activating signal integrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene activation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The coding protein contains an N-terminal KH-type RNA-binding motif that is required for AP-1 transactivation by the ASC-1 complex. Alternative spliced transcripts encoding multiple isoforms have been observed for this gene. BICC1 (Bicaudal C family RNA-binding protein 1) encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Acts as a negative regulator of Wnt signaling. It is a paralog of HDLBP (High Density Lipoprotein Binding Protein) that binds High Density Lipoprotein (HDL) and can serve to regulate high levels of cholesterol in cells. The HDLBP protein also binds RNA and can induce heterochromatin formation. Three transcription variants encoding two different isoforms have been found for this gene. It appears to play a role in cell sterol metabolism. It can function to protect cells against over-accumulation of cholesterol. BICC1 and HDLBP are more preferred KH domain-containing proteins of the invention.

Proteïnen van de DEAD box proteïnefamilie worden gekenmerkt door het bewaarde motief Asp-Glu-Ala-Asp (DEAD) en zijn putatieve RNA-helicases. Ze zijn opgenomen in een aantal cellulaire processen zoals verandering van RNA secundaire structuur, translatie initiëring, nucleaire en mitochondriale splitsing en ribosoom- en spliceosome-assemblage. Het proteïne gecodeerd door DDX43 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 43) is een ATP-afhankelijke RNA helicase in de DEAD-box familie en vertoont tumorspecifieke expressie. DDX53 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 53) is een gen zonder intron. DDX43 en DDX53 en hun splitsvarianten coderen KH-domein bevattend leden van de DEAD box proteïnefamilie. KRR1 (KRR1, kleine subeenheid (SSU) processome component, homoloog (gist)) Dit proteïne coderend gen is vereist voor 40S ribosoombiogenese. Het is betrokken bij nucleolaire verwerking van pre-18S ribosomaal RNA en ribosoomassemblage. DPPA5 (Developmental PluriPotency Associated 5) codeert een proteïne dat kan functioneren in de controle van celpluripotentie en vroege embryogenese. Expressie van dit gen is een specifieke marker voor pluripotente stamcellen. Pseudogenen van dit gen zijn bekend. FMR1 (Fragile X Mental Retardation 1), FXR1 (Fragile X Mental Retardation, autosomaal homoloog 1) en FXR2 (Fragile X Mental Retardation, autosomaal homoloog 2) codeert RNA-bindende proteïnen die een rol spelen in intracellulair RNA-transport en in het reguleren van plaatselijke translatie van doel-mRNA's. Ze kunnen met elkaar en geassocieerde polyribosomen interacties aangaan, voornamelijk met de 60S ribosomale subeenheid. FMR1 codeert een component van het CYFIP1-EIF4E-FMR1 complex dat bindt aan de mRNA cap en translationele repressie medieert. Voor FXR1 zijn er drie transcriptie varianten gevonden dieverschillende isovormen coderen. Het proteïne gecodeerd doorFXR2 is een RNA bindend proteïne dat twee KH-domeinen bevat. GLDl(Putatief glucose-6-fosfaat-l-dehydrogenase), is een cytosoliek putatief glucose-6-fosfaat-l-dehydrogenase.Proteins of the DEAD box protein family are characterized by the preserved motif Asp-Glu-Ala-Asp (DEAD) and its putative RNA helicases. They are included in a number of cellular processes such as alteration of RNA secondary structure, translation initiation, nuclear and mitochondrial cleavage, and ribosome and spliceosome assembly. The protein encoded by DDX43 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 43) is an ATP-dependent RNA helicase in the DEAD-box family and exhibits tumor-specific expression. DDX53 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 53) is a gene with no intron. DDX43 and DDX53 and their cleavage variants encode KH domain containing members of the DEAD box protein family. KRR1 (KRR1, small subunit (SSU) processome component, homologue (yeast)) This protein-encoding gene is required for 40S ribosome biogenesis. It is involved in nucleolar processing of pre-18S ribosomal RNA and ribosome assembly. DPPA5 (Developmental PluriPotency Associated 5) encodes a protein that can function in the control of cell pluripotency and early embryogenesis. Expression of this gene is a specific marker for pluripotent stem cells. Pseudogens of this gene are known. FMR1 (Fragile X Mental Retardation 1), FXR1 (Fragile X Mental Retardation, autosomal homologue 1) and FXR2 (Fragile X Mental Retardation, autosomal homologue 2) encodes RNA-binding proteins that play a role in intracellular RNA transport and in regulation. of local translation of target mRNAs. They can interact with each other and associated polyribosomes, primarily with the 60S ribosomal subunit. FMR1 encodes a component of the CYFIP1-EIF4E-FMR1 complex that binds to the mRNA cap and mediates translational repression. For FXR1, three transcription variants have been found that encode different isoforms. The protein encoded by FXR2 is an RNA binding protein that contains two KH domains. GLD1 (Putative glucose-6-phosphate-1-dehydrogenase), is a cytosolic putative glucose-6-phosphate-1-dehydrogenase.

De hnRNPs (heterogeen nucleair ribonucleoproteïnes) zijn RNA bindende proteïnen en zij complexeren met heterogeen nucleair RNA (hnRNA). Deze proteïnen kunnen met pre-mRNA's in de nucleus associëren en blijken pre-mRNA verwerking en andere aspecten van mRNA metabolisme en transport te beïnvloeden. Sommige van de hnRNP's pendelen tussen de nucleus en het cytoplasma. Zij kunnen verantwoordelijk zijn voor transcriptionele regulering door op te treden als transfactoren in regulerende genexpressie. Zij kunnen met elkaar interacties aangaan en vormen daarbij heterodimers. Ze zijn belangrijk voor RNA-localisatie, oppervlaktelevering en plaatselijke translatieregulering.The hnRNPs (heterogeneous nuclear ribonucleoproteins) are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins can associate with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. Some of the hnRNPs commute between the nucleus and the cytoplasm. They can be responsible for transcriptional regulation by acting as transfactors in regulatory gene expression. They can interact with each other and thereby form heterodimers. They are important for RNA localization, surface delivery and local translation regulation.

De hnRNP proteïnen hebben duidelijk onderscheiden nucleïnezuurbindende eigenschappen. HNRNPK (Heterogeen Nucleair RiboNucleoProteïne K), PCBP1 (poly(rC) bindend proteïne 1) PCBP2 ( poly(rC) bindend proteïne 2), PCBP3 (poly(rC) bindend proteïne 3) en PCBP4 ( poly(rC) bindend proteïne 4) onderscheiden zich duidelijk van andere hnRNP proteïnen in hun bindingsvoorkeur doordat zij hardnekkig aan poly(C) binden. Deze proteïnen hebben ieder drie herhaalde KH-domeinen die aan RNA's binden. De KH-domein bevattende proteïnen van de hnRNP's (heterogeneous nuclear RiboNucleoProteins) zijn een preferente uitvoeringsvorm van de uitvinding. HNRNPK, PCBP1, PCBP2, PCBP3 en/of PCBP4 zijn meer preferende KH-domein bevattende proteïnen van de uitvinding.The hnRNP proteins have clearly distinct nucleic acid binding properties. HNRNPK (Heterogeneous Nuclear RiboNucleoProtein K), PCBP1 (poly (rC) binding protein 2), PCBP3 (poly (rC) binding protein 3) and PCBP4 (poly (rC) binding protein 4) clearly distinguish themselves from other hnRNP proteins in their binding preference in that they persistently bind to poly (C). These proteins each have three repeated KH domains that bind to RNAs. The KH domain-containing proteins of the hnRNPs (heterogeneous nuclear RiboNucleoProteins) are a preferred embodiment of the invention. HNRNPK, PCBP1, PCBP2, PCBP3 and / or PCBP4 are more preferred KH domain-containing proteins of the invention.

Het HNRNPK gecodeerde proteïne bevindt zich in het nucleoplasma. Er wordt vanuit gegaan dat het een rol vervult tijdens celcyclusprogressie. Diverse alternatief gesplitste transcriptievarianten zijn voor dit gen beschreven, maar deze zijn niet allemaal volledig gekarakteriseerd. Het speelt een belangrijke rol in p53/TP53 respons op DNA-schade op het niveau van zowel transcriptieactivatie als repressie. Indien geSUMOylateerd, gedraagt dit proteïne zich als een transcriptionele co-activator van p53/TP53, en speelt daarmee een rol in p21/CDKNlA en 14-3-3 sigma/SFIM inductie. Voor zover het transcriptierepressie betreft, werkt het door interactie met lange intergenisch RNA p21 (MncRNA-p21), een non-coderend RNA geïnduceerd door p53/TP53. Deze interactie is nodig voor de inductie van apoptose, maar niet het stopzetten van de celcylus. Het proteïne promoot tumormetastase door inductie van genen betrokken bij extracellulaire matrix, celverplaatsing en angiogenese. HNRNPK coreguleert posttranscriptioneel meerdere genen voor het cytoskelet nodig voor axonogenese en verlies van hnRNP K verzwakt synaptische plasticiteit in hippocampus neuronen. PCBP1 is een gen zonder intron. PCBP2 heeft meervoudige transcriptievarianten die verschillende isovormen coderen. Het is een enkelstrengs nucleïnezuurbindend proteïne dat preferent bindt aan oligodC maar ook bindt aan poly(rU). Het proteïne van het PCBP3 gen wordt gevonden in het cytoplasma. Het mankeert de nucleaire localisatiesignalen die te vinden zijn in andere subfamilieleden. Alternatieve splitsing resulteert in meerdere transcriptievarianten die verschillende isovormen coderen. PCBP4 wordt geïnduceerd door de p53 tumorsuppressor en het gecodeerde proteïne kan celproliferatie onderdrukken door apoptose en cel cyclusstop te induceren in G(2)-M. Zoals PCBP3 wordt het proteïne van dit gen gevonden in het cytoplasma en mankeert de nucleaire localisatiesignalen gevonden in andere subfamilieleden. Meerdere alternatief gesplitste transcriptievarianten zijn beschreven.The HNRNPK encoded protein is in the nucleoplasm. It is assumed that it plays a role during cell cycle progression. Various alternative spliced transcription variants have been described for this gene, but not all of them have been fully characterized. It plays an important role in p53 / TP53 response to DNA damage at the level of both transcription activation and repression. When SUMOylated, this protein acts as a transcriptional co-activator of p53 / TP53, thereby playing a role in p21 / CDKN1A and 14-3-3 sigma / SFIM induction. As far as transcription repression is concerned, it works by interacting with long intergenic RNA p21 (MncRNA-p21), a non-coding RNA induced by p53 / TP53. This interaction is necessary for the induction of apoptosis, but not for stopping the cell cycle. The protein promotes tumor metastasis by induction of genes involved in extracellular matrix, cell displacement and angiogenesis. HNRNPK post-transcriptively co-regulates multiple genes for the cytoskeleton needed for axonogenesis and loss of hnRNP K weakens synaptic plasticity in hippocampal neurons. PCBP1 is a gene without an intron. PCBP2 has multiple transcription variants that encode different isoforms. It is a single-stranded nucleic acid binding protein that binds preferentially to oligodC but also binds to poly (rU). The protein of the PCBP3 gene is found in the cytoplasm. There is a lack of nuclear localization signals that can be found in other subfamily members. Alternative splitting results in multiple transcription variants encoding different isoforms. PCBP4 is induced by the p53 tumor suppressor and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle stop in G (2) -M. Like PCBP3, the protein of this gene is found in the cytoplasm and the nuclear localization signals are found in other subfamily members. Multiple alternative spliced transcription variants have been described.

De insuline-achtige groeifactor 2 mRNA-bindende protéine familie codeert proteïnen die diverse KH-domeinen bevatten die belangrijk zijn bij de RNA-binding en er is rvan bekend dat ze zijn betrokken bij RNA-synthese en metabolisme. Dit zijn RNA-bindende factoren die doeltransscripties aantrekken voor cytoplasmische proteïne-RNA complexen (mRNP's). Deze transcriptie 'kooien' in mRNP's maakt mRNA-transport en kortstondige opslag mogelijk. Het moduleert ook de snelheid waarmee en locatie waarop doeltranscripties het translatieapparaat tegen komen en schermt ze af van endonuclease-aanvallen of door microRNA bemiddelde degradatie. IGF2BPl(insuline-achtige groeifactor 2 mRNA bindend proteïne 1) codeert een proteïne dat functioneert door het bindien aan de mRNA's van bepaalde genen, waaronder insulin-achtige groeifactor 2, bèta-actine en bèta-transducine repeat-bevattend proteïne en hun translatie reguleert. Voor dit gen zijn twee transcriptievarianten gevonden die verschillende isovormen coderen. Het speelt een directe rol in het transport en de translatie van transcripties vereist voor axonregeneratie in volgroeide sensorische neuronen. Het regelt gelocaliseerd bèta-actine (ACTB) mRNA translatie, een cruciaal proces voor celpolariteit, celmigratie en het uitgroeien van neurieten. Co-transcriptioneel associeert het met ACTB mRNA in de nucleus. Hierbij is een geconserveerd element betrokken van 54 nucleotiden in het ACTB mRNA 3'-UTR, dat bekend staat als de 'zipcode'. Het aldus gevormde RNP wordt naar het cytoplasma geëxporteerd, bindt aan een motorproteïne en wordt langs het cytoskelet naar de celperiferie getransporteerd. Tijdens het transport verhindert ACTB de translatie van mRNA naar een proteïne. Wanneer het RNP complex zijn bestemming dichtbij het plasmamembraan bereikt, wordt IGF2BP1 gefosforyleerd. Dit maakt het mRNA vrij waardoor ribosomaal 40S en 60S subeenheden kunnen assembleren en ACTB proteïne synthese initiëren. Monomeer ACTB assembleert vervolgens in het subcorticale actinecytoskelet (door gelijkvormigheid). Tijdens neuronale ontwikkeling is het een belangrijke regulator van het uitgroeien van neurieten, groeiconusgeleiding en neuronale celmigratie, naar wordt aangenomen via de spatiotemporale fijnafstemming van proteïnesynthese, zoals die van ACTB. Kan mRNA-transport reguleren naar geactiveerde synapsen. Bind aan en stabiliseert ABCB1/MDR-1 mRNA. Het gaat een interactie aan met en stabiliseert PTGS2 transcriptie. Bindt met het 3'-UTR van IGF2 mRNA door een mechanisme van coöperatieve en sequentiele dimerisatie en reguleert IGF2 mRNA subcellulaire localisatie en translatie. Bindt aan MYC mRNA, in de Coding Region instability Determinant (CRD) van het Open Reading Frame (ORF), en voorkomt aldus MYC kloving door endonucleasen en mogelijk microRNA dat zich richt op MYC-CRD. Bindt aan het 3'-UTR van CD44 mRNA en stabiliseert het, en promoot aldus celadhesie en invadopodia formatie in kankercellen. Bindt aan de oncofetal H19 transcriptie en aan het neuronspecifieke TAU mRNA en reguleert hun localisaties. Bindt aan en stabiliseert BTRC/FBW1A mRNA. Bindt aan de adenine-rijke AutoRegulerende Sequentie (ARS) gelocaliseerd in PABPC1 mRNA en onderdrukt de translatie ervan. PABPC1 mRNA-binding wordt gestimuleerd door PABPC1 proteïne. Voorkomt BTRC/FBW1A mRNA degradatie door disruptie van microRNA-afhankelijke interactie met AG02. Bevordert de gestuurde verplaatsing van tumoren afgeleide cellen door fijnafstemming van intracellulaire signalerende netwerken. Bindt aan MAPK4 3'-UTR en inhibeert zijn translatie. Gaat een interactie aan met PTEN-transcriptie Open Reading Frame (ORF) en voorkomt mRNA-verval. Deze gecombineerde actie op MAPK4 (omlaag-regulering) en PTEN (omhoogregulering) antagoniseert HSPB1 fosforylatie, bijgevolg verhindert het G-actine sequestratie door gefosforyleerd HSPB1, waardoor F-actin-polymerisatie mogelijk wordt. Derhalve vergroot het de snelheid van de celmigratie en stimuleert het gestuurde celmigratie door PTEN-gemoduleerde polarisatie.The insulin-like growth factor 2 mRNA-binding protein family encodes proteins that contain various KH domains that are important in RNA binding and are known to be involved in RNA synthesis and metabolism. These are RNA-binding factors that attract target transcripts for cytoplasmic protein-RNA complexes (mRNPs). This transcription 'cages' in mRNPs makes mRNA transport and short-term storage possible. It also modulates the speed and location at which target transcripts encounter the translation device and shields them from endonuclease attacks or microRNA mediated degradation. IGF2BP1 (insulin-like growth factor 2 mRNA binding protein 1) encodes a protein that functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducine repeat-containing protein and regulating their translation. Two transcription variants have been found for this gene that encode different isoforms. It plays a direct role in the transport and translation of transcriptions required for axon regeneration in mature sensory neurons. It controls localized beta-actin (ACTB) mRNA translation, a crucial process for cell polarity, cell migration and neurite outgrowth. Co-transcriptively, it associates with ACTB mRNA in the nucleus. This involves a conserved element of 54 nucleotides in the ACTB mRNA 3 'UTR, known as the' zip code '. The thus formed RNP is exported to the cytoplasm, binds to a motor protein and is transported along the cytoskeleton to the cell periphery. ACTB prevents the translation of mRNA to a protein during transport. When the RNP complex reaches its destination close to the plasma membrane, IGF2BP1 is phosphorylated. This releases the mRNA allowing ribosomal 40S and 60S subunits to assemble and initiate ACTB protein synthesis. Monomer ACTB then assembles in the subcortical actin cytoskeleton (by uniformity). During neuronal development, it is an important regulator of neurite outgrowth, growth cone conduction, and neuronal cell migration, believed to be via the spatial-fine tuning of protein synthesis, such as that of ACTB. Can regulate mRNA transport to activated synapses. Bind and stabilize ABCB1 / MDR-1 mRNA. It interacts with and stabilizes PTGS2 transcription. Binds with the 3 'UTR of IGF2 mRNA through a mechanism of cooperative and sequential dimerization and IGF2 mRNA regulates subcellular localization and translation. Binds to MYC mRNA, in the Coding Region instability Determinant (CRD) of the Open Reading Frame (ORF), and thus prevents MYC cleavage by endonucleases and possibly microRNA that focuses on MYC-CRD. Binds to the 3 'UTR of CD44 mRNA and stabilizes it, thus promoting cell adhesion and invadopodia formation in cancer cells. Binds to the oncofetal H19 transcription and to the neuron-specific TAU mRNA and regulates their localizations. Binds to and stabilizes BTRC / FBW1A mRNA. Binds to the adenine-rich AutoRegulating Sequence (ARS) located in PABPC1 mRNA and suppresses its translation. PABPC1 mRNA binding is stimulated by PABPC1 protein. Prevents BTRC / FBW1A mRNA degradation by disruption of microRNA-dependent interaction with AG02. Promotes the controlled displacement of tumor-derived cells by fine-tuning intracellular signaling networks. Binds to MAPK4 3 'UTR and inhibits its translation. Interacts with Open Reading Frame (ORF) PTEN transcription and prevents mRNA decay. This combined action on MAPK4 (down-regulation) and PTEN (up-regulation) antagonizes HSPB1 phosphorylation, and therefore prevents G-actin sequestration by phosphorylated HSPB1, allowing F-actin polymerization. Therefore, it increases the speed of cell migration and stimulates controlled cell migration by PTEN modulated polarization.

Tijdens celstress, zoals oxidatieve stress of hitteschok, stabiliseert het doel-mRNA's die worden aangetrokken naar stressgranules, waaronder CD44, IGF2, MAPK4, MYC, PTEN, RAPGEF2 en RPS6KA5 transcripties. IGF2BP2: (insulineachtige groeifactor 2 mRNA bindend proteïne 2) Dit gen codeert een onderdeel van de IGF-II mRNA-bindend proteïne (IMP) familie. Flet proteïne gecodeerd door dit gen functioneert door te binden aan het 5' UTR van het insulineachtige groeifactor 2 (IGF2) mRNA en het reguleren van de IGF2 translatie. Alternatieve transcriptionele splitsvarianten, die andere isovormen coderen, zijn gekarakteriseerd. Binden is isovormspecifiek. Binden aan bèta-actine/ACTB en MYC transcripties IGF2BP3; IGF2BP3 (insulineachtige groeifactor 2 mRNA bindend proteïne 3) Het proteïne gecodeerd door dit gen wordt hoofdzakelijk gevonden in de nucleolus, waar het kan binden aan de 5' UTR van het insulineachtige groeifactor II leider 3 mRNA en translatie kan onderdrukken van insulineachtige groeifactor II tijdens late ontwikkeling. Een pseudogeen bestaat op chromosoom 7 en er zijn putatieve pseudogenen op andere chromosomen. Bindt aan het 3'-UTR van CD44 mRNA en stabiliseert het, en derhalve promoot celadhesie en invadopodiavorming in kankercellen. Bindt aan bèta-actine/ACTB- en MYC-transcripties. Bindt aan het 5'-UTR van de insulineachtige groeifactor 2 (IGF2) mRNA's. IGF2BP1, IGF2BP2 en/of IGF2BP3 zijn leden van de insulineachtige groeifactor 2 mRNA bindende proteïnefamilie. Zij zijn preferente KH-domein bevattende proteïnen.During cell stress, such as oxidative stress or heat shock, the target mRNAs that are attracted to stress granules, including CD44, IGF2, MAPK4, MYC, PTEN, RAPGEF2 and RPS6KA5 transcripts. IGF2BP2: (insulin-like growth factor 2 mRNA binding protein 2) This gene encodes a part of the IGF-II mRNA binding protein (IMP) family. Flet protein encoded by this gene functions by binding to the 5 'UTR of the insulin-like growth factor 2 (IGF2) mRNA and regulating IGF2 translation. Alternative transcriptional cleavage variants, encoding other isoforms, have been characterized. Binding is isoform-specific. Binding to beta-actin / ACTB and MYC transcripts IGF2BP3; IGF2BP3 (insulin-like growth factor 2 mRNA binding protein 3) The protein encoded by this gene is mainly found in the nucleolus, where it can bind to the 5 'UTR of the insulin-like growth factor II leader 3 mRNA and suppress translation of insulin-like growth factor II during late development. A pseudogen exists on chromosome 7 and there are putative pseudogens on other chromosomes. Binds to the 3'-UTR of CD44 mRNA and stabilizes it, and therefore promotes cell adhesion and invadopodia formation in cancer cells. Binds to beta-actin / ACTB and MYC transcripts. Binds to the 5 'UTR of the insulin-like growth factor 2 (IGF2) mRNAs. IGF2BP1, IGF2BP2 and / or IGF2BP3 are members of the insulin-like growth factor 2 mRNA binding protein family. They are preferred KH domain-containing proteins.

De K-homologie domeinbevattend, RNA-bindend, signaal transductie geassocierde proteïnen hebben vele functies en kunnen betrokken zijn in diverse cellulaire processen, waaronder alternatieve splitsing, celcyclusregulering, RNA 3'-eindformatie en tumorigenese. KHDRBS1 (KH-domein bevattend, RNA-bindend, signaaltransductie geassocieerd 1). De alternatieve splitsing van dit gen resulteert in meervoudige transcriptievarianten. De proteïnen worden aangetrokken en tyrosine gefosforyleerd door diverse receptorsystemen, bijvoorbeeld de T-cel, leptine- en insulinereceptors. Zodra gefosforyleerd, functioneert het proteïne als een adapterproteïne in signaaltransductie cascades door te binden aan SH2- en SH3-domeinbevattende proteïnen. Het speelt een rol in G2-M progressie in de celcyclus. Onderdrukt CBP-afhankelijke transcriptionele activering door te concurreren met andere nucleaire factoren voor het binden aan CBP. Het reageert als een putatieve regulator van mRNA-stabiliteit en/of translatieomvang en medieert mRNA nucleaire export. Het reguleert in positieve zin de associatie van Constitutief Transport Element (CTE)-bevattend mRNA met grote polyribosomen en translatie-initiatie. Volgens sommige auteurs, is het niet betrokken bij de nucleocytoplasmische export van de ongesplitst (CTE)-bevattende RNA Isoform 3 soort, die enkel wordt uitgedrukt in groeigestopte cellen, inhibeert S fase. KHDRBS2 (KH-domein bevatttend, RNA-bindend, signaaltransductie geassocieerd 3). Het proteïne dat door dit gen wordt gecodeerd is een RNA-bindend proteïne dat een rol speelt bij het reguleren van alternatieve splitsing en locatieselectie voor mRNA-splitsing en exon inclusie beïnvloed. Zijn fosforylatie door FYN inhibeert zijn mogelijkheid tot reguleren van de selectie van de splitsingslocatie. Induceert een verhoogde concentratieafhankelijke incorperatie van exonen in CD44 pre-mRNA door rechtstreekse binding aan purine rijke exonversterker. Kan werken als een adaptorproteïne voor Src kinasen tijdens mitose. Bind zowel poly(A) als poly(U) homopolymeren. Fosforylering door PTK6 inhibeert zijn RNA-bindingsvermogen KHDRBS3 (KH-domein bevattend, RNA-bindend, signaaltransductie geassocieerde 3) codeert voor een RIMA-bindend proteïne dat een rol speelt in de regulering van alternatieve splitsing en de selectie van mRNA splitsingslocatie en exoninclusie beïnvloed. Het kan een rol spelen als een negatief aanvoermechanisme voor celgroei. Het inhibeert celproliferatie. Het is betrokken bij het selecteren van de splitsingslocatie van vasculair endotheliaal groeifactor. Het induceert een verhoogde concentratieafhankelijke incorperatie van exonen in CD44 pre-mRNA door rechtstreekse binding aan purinerijke exonversterker. Zijn RNA- bindingsvermogens worden door tyrosinekinase PTK6 naar beneden toe gereguleerd. KHDRBS1, KHDRBS2 en/of KHDRBS3 maken deel uit van de KH-domein bevattende, RNA-bindende, signaaltransductie geassocieerde proteïnefamilie. Zij zijn de geprefeerde KH-bevattende proteïnen.The K-homology domain-containing, RNA-binding, signal transduction-associated proteins have many functions and can be involved in various cellular processes, including alternative cleavage, cell cycle regulation, RNA 3 'end formation and tumorigenesis. KHDRBS1 (containing KH domain, RNA binding, signal transduction associated 1). The alternative cleavage of this gene results in multiple transcription variants. The proteins are attracted and tyrosine phosphorylated by various receptor systems, for example the T cell, leptin and insulin receptors. Once phosphorylated, the protein functions as an adapter protein in signal transduction cascades by binding to SH2 and SH3 domain-containing proteins. It plays a role in G2-M progression in the cell cycle. Suppresses CBP-dependent transcriptional activation by competing with other nuclear factors for binding to CBP. It reacts as a putative regulator of mRNA stability and / or translation scope and mediates mRNA nuclear export. It positively regulates the association of Constitutive Transport Element (CTE)-containing mRNA with large polyribosomes and translation initiation. According to some authors, it is not involved in nucleocytoplasmic export of the non-spliced (CTE) -containing RNA Isoform 3 species, which is only expressed in growth-arrested cells, inhibits S phase. KHDRBS2 (containing KH domain, RNA binding, signal transduction associated 3). The protein encoded by this gene is an RNA-binding protein that plays a role in regulating alternative cleavage and influencing site selection for mRNA cleavage and exon inclusion affected. Its phosphorylation by FYN inhibits its ability to regulate the selection of the cleavage site. Induces an increased concentration-dependent absorption of exons in CD44 pre-mRNA by direct binding to purine-rich exon enhancer. Can act as an adapter protein for Src kinases during mitosis. Bind both poly (A) and poly (U) homopolymers. Phosphorylation by PTK6 inhibits its RNA binding capacity KHDRBS3 (containing KH domain, RNA binding, signal transduction associated 3) encodes an RIMA binding protein that plays a role in the regulation of alternative cleavage and influences the selection of mRNA cleavage location and exoninclusion. It can play a role as a negative supply mechanism for cell growth. It inhibits cell proliferation. It is involved in selecting the vascular endothelial growth factor cleavage site. It induces an increased concentration-dependent absorption of exons in CD44 pre-mRNA by direct binding to purine-rich exon enhancer. Its RNA binding capabilities are down-regulated by tyrosine kinase PTK6. KHDRBS1, KHDRBS2 and / or KHDRBS3 are part of the KH domain-containing, RNA-binding, signal transduction-associated protein family. They are the preferred KH-containing proteins.

Het Far UpStream Element (FUSE) bindende proteïne kan een interactie aangaan met enkelstrengs DNA van het Far-UpStream Element (FUSE) en kan genexpressie activeren. FUBP1 (far upstream element (FUSE) bindend proteïne 1) codeert een ssDNA bindend proteïne dat het Far UpStream Element (FUSE) van c-myc activeert en expressie stimuleert van c-myc in niet-gedifferentieerde cellen. Regulering van FUSE door FUBP vindt plaats via enkelstrengsbinding van FUBP aan de niet-coderende streng. Van dit proteïne is aangetoond dat het functioneert als een ATP-afhankelijke DNA-helicase. Het reguleert MYC-expressie door te binden aan een enkelstrengs Far-UpStream Element (FUSE) bovenstrooms van de MYC-promotor. Het kan werken als zowel een activator als repressor van transcriptie. KHSRP/FUBP2 (KH-type splitsing regulerend proteïne) codeert een proteïne dat bindt aan het dendritisch doelelement en kan een rol spelen in mRNA-transport. Het is onderdeel van een ternair complex dat bindt aan de DownStream Control sequentie (DCS) van het pre-mRNA. Het medieert exoninclusie in transcripties die onderhevig zijn aan weefselspecifieke alternatieve splitsing. Het is ook betrokken bij de degradatie van inherent instabiele mRNA's die AU-rijke elementen (ARE's) in hun 3'-UTR bevatten, mogelijk door het aantrekken van degradatiemachines naar ARE-bevattende mRNA's. FUBP3 (Far UpStream Element (FUSE) bindend proteïne 3) codeert ook een proteïnecoderend gen. FUBP1, FUBP2 en/of FUBP3 zijn KH-domein bevattende proteïnen die behoren tot de Far UpStream Element bevattende proteïnefamilie.The Far UpStream Element (FUSE) binding protein can interact with single-stranded DNA from the Far-UpStream Element (FUSE) and can activate gene expression. FUBP1 (far upstream element (FUSE) binding protein 1) encodes an ssDNA binding protein that activates the Far UpStream Element (FUSE) of c-myc and stimulates expression of c-myc in undifferentiated cells. Regulation of FUSE by FUBP takes place via single-strand binding of FUBP to the non-coding strand. This protein has been shown to function as an ATP-dependent DNA helicase. It regulates MYC expression by binding to a single-stranded Far-UpStream Element (FUSE) upstream of the MYC promoter. It can work as both an activator and repressor of transcription. KHSRP / FUBP2 (KH-type cleavage regulating protein) encodes a protein that binds to the dendritic target element and can play a role in mRNA transport. It is part of a ternary complex that binds to the DownStream Control sequence (DCS) of the pre-mRNA. It mediates exon inclusion in transcripts that are subject to tissue-specific alternative cleavage. It is also involved in the degradation of inherently unstable mRNAs that contain AU-rich elements (AREs) in their 3 'UTR, possibly by attracting degradation machines to ARE-containing mRNAs. FUBP3 (Far UpStream Element (FUSE) binding protein 3) also encodes a protein coding gene. FUBP1, FUBP2 and / or FUBP3 are KH domain-containing proteins that belong to the Far UpStream Element-containing protein family.

De leden van de mex-3 (muscle excess 3) RNA-bindende familie zijn RNA bindend proteïnen die betrokken kunnen zijn in post-transcriptionele regelmechanismen. MEX3A (mex-3 RNA bindend familielid A) genproduct kan colocaliseren met het genproduct van MEX3B. MEX3B (mex-3 RNA bindend familielid B) codeert een RNA-bindend fosfoproteïne. Het gecodeerde proteïne bevat N-terminale nucleaire export en nucleaire localisatiesignalen en wordt geëxporteerd vanuit het cytoplasma naar de nucleus. Het proteïne bindt met RNA via twee KH-domeinen en colocaliseert ook met DcplA decapperende factor en Argonaut proteïnen binnen P-(processing)lichamen. MEX3C (mex-3 RNA bindend familielid C) codeert een lid van een familie van proteïnen met twee K-homologe (KH) RNA-bindende domeinen en een C-terminaal RING-vingerdomein. Het proteïne gaat een interactie aan met mRNA via de KH-domeinen en het proteïne pendelt tussen de nucleus en het cytoplasma. Het is een E3 ubiquitine ligase verantwoordelijk voor de post-transcriptionele regulering van algemene HLA-A allotypen. Het bindt aan het 3' UTR van HLA-A2 mRNA, en reguleert zijn niveau door het promoten van mRNA-verval. RNA-binding is voldoende om translatie te voorkomen, maar ubiquitineligase activiteit is vereist voor mRNA-degradatie. MEX3D (mex-3 RNA bindend familielid D) is ook een proteïne-coderend gen. MEX3A, MEX3B en/of MEX3C zijn KH-domein bevattende proteïnen behorend bij de mex-3 RNA bindende familie.The members of the mex-3 (muscle excess 3) RNA-binding family are RNA-binding proteins that may be involved in post-transcriptional control mechanisms. MEX3A (mex-3 RNA binding family member A) gene product can colocalize with the gene product of MEX3B. MEX3B (mex-3 RNA-binding family member B) encodes an RNA-binding phosphoprotein. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds with RNA via two KH domains and also colocalisates with DcplA decapping factor and Argonaut proteins within P (processing) bodies. MEX3C (mex-3 RNA-binding family member C) encodes a member of a family of proteins with two K-homologous (KH) RNA-binding domains and a C-terminal RING finger domain. The protein interacts with mRNA via the KH domains and the protein commutes between the nucleus and the cytoplasm. It is an E3 ubiquitin ligase responsible for the post-transcriptional regulation of general HLA-A allotypes. It binds to the 3 'UTR of HLA-A2 mRNA, and regulates its level by promoting mRNA decay. RNA binding is sufficient to prevent translation, but ubiquitin ligase activity is required for mRNA degradation. MEX3D (mex-3 RNA binding family member D) is also a protein-encoding gene. MEX3A, MEX3B and / or MEX3C are KH domain-containing proteins belonging to the mex-3 RNA binding family.

De neuro-oncologische ventrale antigenproteïnen kunnen mogelijks RNA splitsing of metabolisme in een specifieke subset van ontwikkelende neuronen reguleren. NOVA1 (neuro-oncologisch ventraal antigen 1) codeert een neuron-specifiek RNA-bindend proteïne, een lid van de Nova-familie van paraneoplastische ziekte-antigenen, die wordt herkend en geïnhibeerd door paraneoplastische antilichamen. Alternatief gesplitste transcripties die onderscheiden isovormen coderen zijn beschreven. NOVA2 (Neuro-Oncological Ventral Antigen 2) is ook een proteïnecoderend gen. NOVA1 en/of NOVA2 zijn KH-domein bevattende proteïnen die behoren bij de neuro-oncologische ventrale antigenfamilie. NOVA1 en/of NOVA2 zijn preferente KH-domein bevattende proteïnen van de uitvinding. PNOl (partner van NOB1 homoloog (S. cerevisiae)) is een proteïne-coderend gen. PNPT1 (polyribonucleotide nucleotidyltransferase 1). Het proteïne gecodeerd door dit gen behoort bij de evolutionair geconserveerde polynucleotide fosforylasefamilie die bestaat uit fosfaat afhankelijk 3'-tot 5' exoribonucleasen betrokken in RNA-verwerking en degradatie. Dit enzym bevindt zich voornamelijk in de ruimte tussen mitochondriale membranen en is betrokken bij het importeren van RNA in mitochondria. Verwante pseudogenen zijn gevonden. HetThe neuro-oncological ventral antigen proteins may possibly regulate RNA cleavage or metabolism in a specific subset of developing neurons. NOVA1 (neuro-oncologically ventral antigen 1) encodes a neuron-specific RNA-binding protein, a member of the Nova family of paraneoplastic disease antigens, which is recognized and inhibited by paraneoplastic antibodies. Alternative spliced transcripts encoding distinct isoforms have been described. NOVA2 (Neuro-Oncological Ventral Antigen 2) is also a protein coding gene. NOVA1 and / or NOVA2 are KH domain-containing proteins that belong to the neuro-oncological ventral antigen family. NOVA1 and / or NOVA2 are preferred KH domain-containing proteins of the invention. PNO1 (partner of NOB1 homologue (S. cerevisiae)) is a protein-coding gene. PNPT1 (polyribonucleotide nucleotidyl transferase 1). The protein encoded by this gene belongs to the evolutionally conserved polynucleotide phosphorylase family consisting of phosphate dependent 3 'to 5' exoribonucleases involved in RNA processing and degradation. This enzyme is mainly located in the space between mitochondrial membranes and is involved in the import of RNA into mitochondria. Related pseudogens have been found. It

RNA-bindende proteïne is verwikkeld in talloze RNA-metabolische processen. Het katalyseert de fosforolyse van enkelstrengs polyribonucleotiden processief in de 3'-tot-5' richting. Het is een component van het mitochondriale degradosoom (mtEXO)-complex, dat 3' overstek dubbelstrengs RNA met een 3'-tot-5' richting op een ATP-afhankelijke wijze degradeert. Het is vereist voor correcte verwerking en polyadenylatie van mitochondriale mRNA's. Het speelt een rol als een cytoplasmische RNA-importfactor die de translocatie van kleine RNA-componenten medieert, zoals het 5S RNA, de RNA subeenheid van ribonucléase P en het Mitochondriale RNA-Processing (MRP) RNA, naar de mitochondriale matrix. Het speelt een rol in mitochondriale morfogenese en respiratie en reguleert de expressie van de Electron Transport keten (ETC) componenten op het niveau van mRNA en proteïne. Vertoont in het cytoplasma, een 3'-tot-5' exoribonuclease mRNA-degradatie-activiteit. Het degradeert c-myc mRNA bij behandeling met IFNBl/IFN-bèta, resulterend in een groeistop in melanoomcellen. Het speelt een rol in RNA-celbewaking door het opruimen van geoxideerde RNA' s. Bindt aan de RNA-subeenheid van ribonucléase P, MRP RNA en miR-221 microRNA QKI (Quaking Homolog, KH-domein RNA-bindend). Het proteïne gecodeerd door dit gen is een RNA-bindend proteïne dat pre-mRNA splitsing, export van mRNA's vanuit de nucleus, proteïnetranslatie en mRNA-stabiliteit reguleert. Het gecodeerde proteïne is betrokken bij myelinisatie en differentiatie van oligodendrocyten en kan mogelijks een rol spelen bij schizofrenie. Vier transcriptievarianten die verschillende isovormen coderen, zijn voor dit gen gevonden. RNA-bindend proteïne dat een centrale rol speelt bij de myelinisatie. Bindt aan de 5'-ΝΑ€υΑΑΥ-Ν(1,20)-υΑΑΥ-3' RNA-kernsequentie. Werkt door pre-mRNA-splitsing, mRNA export, mRNA-stabiliteit en proteïnetranslatie te reguleren. Vereist voor het beschermen en promoten van stabiliteit van mRNA's zoals MBP en CDKN1B. Regulator van oligodendrocyt-differentiatie en maturatie in de hersens en kan een rol kunnen spelen bij myeline- en oligodendrocytdysfunctie in schizofrenie. Neemt deel aan mRNA-transport door de nucleaire export van MBP mRNA te reguleren. Is ook betrokken bij het reguleren van mRNA-splitsing van MAG pre-mRNA. Fungeert als een translatierepressor. SF1 (splicing factor 1) codeert een nucleair pre-mRNA splitsingsfactor. Het gecodeerde proteïne herkent specifiek de intronvertakkingspunt sequentie en is vereist voor de vroege stadia van spliceosoomassemblage. Alternatieve splitsing resulteert in meervoudige transcriptievarianten. Noodzakelijk voor de ATP-afhankelijke eerste stap van spliceosoomassemblage. Bindt aan de intronvertakkingspuntsequentie (BPS) 5'-UACUAAC-3' van het pre-mRNA. Kan fungeren als transcriptierepressor. SF1 is een preferent KH-domein bevattend proteïne van de uitvinding. TDRKH (tudor en KH-domein bevattend) is een proteïnecoderend gen. Neemt deel aan het primaire piRNA-biogenesepad en is vereist tijdens spermatogenese om transposabele elementen te onderdrukken en hun verdere mobilisatie te voorkomen, hetgeen essentieel is voor de kiemlijn integriteit. Het piRNA metabolische proces medieert de repressie van transposabele elementen tijdens de meiose door het vormen van complexen samengesteld uit piRNA's en Piwi-proteïnen en bestuurt de methylatie en daar opvolgende onderdrukking van transposonen. Nodig voor de eindstappen van de primaire piRNA-biogenese door deel te nemen aan het verwerken van 31-37 nt intermediairen naar afgewerkte piRNA's.RNA-binding protein is involved in numerous RNA-metabolic processes. It catalyzes the phosphorus lysis of single-stranded polyribonucleotides in the 3'-to-5 'direction. It is a component of the mitochondrial degradosome (mtEXO) complex that degrades 3 'overhang double-stranded RNA in a 3' to 5 'direction in an ATP dependent manner. It is required for correct processing and polyadenylation of mitochondrial mRNAs. It plays a role as a cytoplasmic RNA import factor that mediates the translocation of small RNA components, such as the 5S RNA, the RNA subunit of ribonucléase P and the Mitochondrial RNA Processing (MRP) RNA, to the mitochondrial matrix. It plays a role in mitochondrial morphogenesis and respiration and regulates the expression of the Electron Transport chain (ETC) components at the level of mRNA and protein. In the cytoplasm, exhibits a 3 'to 5' exoribonuclease mRNA degradation activity. It degrades c-myc mRNA when treated with IFNB1 / IFN-beta, resulting in a growth stop in melanoma cells. It plays a role in RNA cell monitoring by cleaning up oxidized RNAs. Binds to the RNA subunit of ribonucléase P, MRP RNA and miR-221 microRNA QKI (Quaking Homolog, KH domain RNA binding). The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA cleavage, export of mRNAs from the nucleus, protein translation and mRNA stability. The encoded protein is involved in myelination and differentiation of oligodendrocytes and may possibly play a role in schizophrenia. Four transcription variants encoding different isoforms have been found for this gene. RNA-binding protein that plays a central role in myelination. Binds to the 5'-€Α € υΑΑΥ-Ν (1.20) -υΑΑΥ-3 'RNA core sequence. Works by regulating pre-mRNA cleavage, mRNA export, mRNA stability and protein translation. Required for protecting and promoting stability of mRNAs such as MBP and CDKN1B. Regulator of oligodendrocyte differentiation and maturation in the brain and may play a role in myelin and oligodendrocyte dysfunction in schizophrenia. Participates in mRNA transport by regulating the nuclear export of MBP mRNA. Is also involved in regulating mRNA cleavage of MAG pre-mRNA. Acts as a translation repressor. SF1 (splicing factor 1) encodes a nuclear pre-mRNA cleavage factor. The encoded protein specifically recognizes the intron branching point sequence and is required for the early stages of spliceosome assembly. Alternative splitting results in multiple transcription variants. Necessary for the ATP-dependent first step of spliceosome assembly. Binds to the intron branching point sequence (BPS) 5'-UACUAAC-3 'of the pre-mRNA. Can act as a transcription repressor. SF1 is a preferred KH domain-containing protein of the invention. TDRKH (containing tudor and KH domain) is a protein coding gene. Participates in the primary piRNA biogenesis pathway and is required during spermatogenesis to suppress transposable elements and prevent their further mobilization, which is essential for germline integrity. The piRNA metabolic process mediates the repression of transposable elements during the meiosis by forming complexes composed of piRNAs and Piwi proteins and controls the methylation and subsequent suppression of transposons. Required for the final steps of primary piRNA biogenesis by participating in the processing of 31-37 nt intermediates into finished piRNAs.

De uitvinding is relevant voor systemen en methoden voor het uitvoeren van testen voor het bepalen van de biologische activiteit en farmacologische eigenschappen van één of meer verbindingen, afzonderlijk of in combinatie, door gebruik te maken van volledige dieren en complete cellen. De systemen en methoden zijn in het bijzonder geschikt voor hoge doorvoer screeningstechnieken voor het identificeren van verbindingen die effectief zijn in een systeem gebaseerd op een volledig dier of een complete cel.The invention is relevant to systems and methods for performing tests for determining the biological activity and pharmacological properties of one or more compounds, individually or in combination, by using whole animals and whole cells. The systems and methods are particularly suitable for high throughput screening techniques for identifying compounds that are effective in a whole-animal or whole-cell system.

De uitvinding biedt een geautomatiseerd, robotmicrovloeistofsysteem voor het in stand houden van een enkele cel of meerdere cellen of organismen met minimale of geen handmatige interventie. In dit systeem kunnen organismen en cellen worden verplaatst, gesorteerd, geïmmobiliseerd, blootgesteld aan verbindingen en kunnen opnamen worden gemaakt met microscopie voor anatomisch onderzoek, gedragsonderzoek en door diverse genetisch gecodeerde fluorescente of luminescente reporters te gebruiken kunnen, de concentratie van diverse moleculaire elementen zoals calcium, de elektrische potentiaal, of andere kenmerken worden gemonitord in het levende dier of de complete cel. Fysiologische parameters waaronder, maar niet beperkt tot reproductie, genetische en epigenetische modificaties, ingestie, consumptie van diverse stoffen en metabolieten kunnen worden gemonitord door het systeem te koppelen aan diverse microtitratie en analysetechnieken. De uitvinding biedt screeningsmethoden voor het detecteren en identificeren van substanties die invloed hebben op de levensvatbaarheid van de cel en/of de biobeschikbaarheid van een verbinding en/of ziekte of fenotypeprogressie voorkomen, en/of beschermende effecten verlenen.The invention provides an automated, robot micro-fluid system for maintaining a single cell or multiple cells or organisms with minimal or no manual intervention. In this system, organisms and cells can be moved, sorted, immobilized, exposed to connections and recordings can be made with microscopy for anatomical research, behavioral research and by using various genetically coded fluorescent or luminescent reporters, the concentration of various molecular elements such as calcium , the electrical potential, or other characteristics are monitored in the living animal or the entire cell. Physiological parameters including, but not limited to, reproduction, genetic and epigenetic modifications, ingestion, consumption of various substances and metabolites can be monitored by linking the system to various microtitration and analysis techniques. The invention provides screening methods for detecting and identifying substances that affect cell viability and / or prevent the bioavailability of a compound and / or disease or phenotype progression, and / or confer protective effects.

Microstromingapparaten zijn recent aanvaard en hebben het ontwerp en de implementatie van moderne bioanalysesystemen significant beïnvloed. Deze apparaten kunnen kleine hoeveelheden vloeistofmonster op een veel efficiëntere manier hanteren en manipuleren met de mogelijkheid van snellere testresponstijden, vereenvoudigde analyseprocedures en kleinere monsters benodigd voor analyse. Microstromingapparaten vinden toepassing op een breed gebied variërend van syntheses tot scheidingsprocedures tot analyses in toepassingen zoals immunotesten, 'lab-on-a-chip', snelle nucleotidesequentie-analyse en hoge doorvoer screening.Micro flow devices have recently been accepted and have significantly influenced the design and implementation of modern bioanalysis systems. These devices can handle and manipulate small amounts of fluid sample in a much more efficient manner with the possibility of faster test response times, simplified analysis procedures and smaller samples needed for analysis. Micro-flow devices are used in a wide range ranging from syntheses to separation procedures to analyzes in applications such as immunoassays, 'lab-on-a-chip', fast nucleotide sequence analysis and high throughput screening.

In overeenstemming daarmee heeft een karakteristiek microstromingsapparaat standaard structurele of functionele eigenschappen gedimensioneerd op millimeterschaal of minder, die in staat zijn tot manipuleren van kleine hoeveelheden vloeistoffen. Meestal omvatten deze kenmerken zoals, maar niet beperkt tot, kanalen, voeistofreservoirs, reactiekamers, mengkamers en afscheidingsgebieden. In sommige voorbeelden, hebben de kanalen ten minste één dwarssectionale dimensie in de grootte van ongeveer 0,1 μιη tot ongeveer 500 μιη. Door afmetingen van deze grootteorde te gebruiken kan een groter aantal kanalen in een kleiner gebied worden opgenomen, waardoor kleinere vloeistofvolumes nodig zijn.Accordingly, a typical micro-flow device has standard structural or functional properties dimensioned on a millimeter scale or less, capable of manipulating small amounts of liquids. Typically, these features include, but are not limited to, channels, fluid reservoirs, reaction chambers, mixing chambers, and separation areas. In some examples, the channels have at least one cross-sectional dimension in the size of about 0.1 μιη to about 500 μιη. By using dimensions of this order of magnitude, a larger number of channels can be accommodated in a smaller area, so that smaller liquid volumes are required.

Een microstromingsapparaat kan op zichzelf bestaan of kan onderdeel uitmaken van een microvoeistofsysteem dat bijvoorbeeld en zonder beperking, kan omvatten: pompen voor het inbrengen van vloeistoffen, bijv., monsters, reagentia, buffers, medicijnen, en dergelijke, in een systeem en/of via het systeem; detectieapparatuur of -systemen; dataopslagsystemen; en regelsystemen voor het regelen van vloeistoftransport en/of -richting binnen het apparaat, monitoren en controleren van milieuomstandigheden waaraan de vloeistoffen in het apparaat worden onderworpen, zoals temperatuur, stroming, en dergelijke.A micro-flow device may exist on its own or may be part of a micro-fluid system that may include, for example and without limitation, pumps for introducing fluids, e.g., samples, reagents, buffers, drugs, and the like, into a system and / or via the system; detection equipment or systems; data storage systems; and control systems for controlling fluid transport and / or direction within the device, monitoring and controlling environmental conditions to which the liquids in the device are subjected, such as temperature, flow, and the like.

Een uitvoeringsvorm van de uitvinding, hier beschreven is een microstromingsysteem met een microstromingsapparaatmodule dat een of meerdere verzegelde kamers heeft en waarin de vloeistof in de kamer in verbinding staat met een inlaatkanaal en een uitlaatkanaal voor microstroming. Op deze manier kan een vloeistof door de kamers worden gepompt om nutriënten naar binnen te brengen of biologisch afval te verwijderen dat zich na verloop van tijd kan ophopen. Bovendien kunnen, medicijnen of nutriënten via de microstromingskanalen in de kamers worden gepompt om gebruikt te worden in de cultuur en het onderzoek van volwassen exemplaren, embryo's en larven van meercellige organismen, organen, weefsels, cellen of cellijnen die in de kamers kunnen worden geplaatst en opgekweekt. In één aspect van de uitvinding kan een veelvoud aan microstromingsapparaatmodules, met ieder een of meerdere kamers, aan elkaar worden gekoppeld binnen een groter frame om zo een universeel microstromingsmilieu te realiseren.An embodiment of the invention described herein is a micro-flow system with a micro-flow device module that has one or more sealed chambers and in which the fluid in the chamber communicates with an inlet channel and an outlet channel for micro-flow. In this way, a liquid can be pumped through the chambers to bring in nutrients or remove biological waste that can accumulate over time. In addition, drugs or nutrients can be pumped through the micro-flow channels into the chambers for use in the culture and research of adult specimens, embryos and larvae of multicellular organisms, organs, tissues, cells or cell lines that can be placed in the chambers and grown up. In one aspect of the invention, a plurality of micro-flow device modules, each with one or more chambers, can be coupled together within a larger frame to realize a universal micro-flow environment.

In een andere uitvoeringsvorm van de uitvinding kan het hier beschreven microstromingssysteem gebruikt worden voor het uitvoeren van experimenten op volledige organismen, zoals bijv., C. elegans, fruitvlieglarven of embryo's (Drosophila melanogaster), zebravislarven of embryo's (Danio rerio), en andere kleine metazoë organismen die in de kamers worden geplaatst. De veranderingen in het volledige dier of de ontwikkeling van de embryo's/larven over een periode van dagen kan worden gemonitord, bijvoorbeeld met of zonder blootsteling aan medicijnen of andere verbindingen. Zo kunnen bijvoorbeeld transparante of gedeeltelijk transparante organismen zoals Danio rerio worden gebruikt voor het maken van beelden van celactiviteit of interne processen met of zonder blootstelling aan medicijnen of andere verbindingen. In andere uitvoeringsvormen, kunnen experimenten worden uitgevoerd op een monolaag van cellen, op een membraan, matrix of ander materiaal. De uitvinding is geschikt voor systemen en methoden voor het uitvoeren van testen voor het bepalen van de biologische activiteit en farmacologische eigenschappen van een of meerdere verbindingen, afzonderlijk of in combinatie, door gebruik te maken van volledige dieren of complete cellen. De systemen en methoden zijn in het bijzonder geschikt voor hoge doorvoer screeningstechnieken voor het identificeren van verbindingen die effectief zijn in een systeem gebaseerd op een volledig dier of een complete cel.In another embodiment of the invention, the micro-flow system described herein can be used to perform experiments on whole organisms, such as e.g., C. elegans, fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and other small metazoë organisms that are placed in the chambers. The changes in the entire animal or the development of the embryos / larvae over a period of days can be monitored, for example with or without exposure to drugs or other compounds. For example, transparent or partially transparent organisms such as Danio rerio can be used to take pictures of cell activity or internal processes with or without exposure to drugs or other compounds. In other embodiments, experiments can be performed on a monolayer of cells, on a membrane, matrix, or other material. The invention is suitable for systems and methods for performing tests for determining the biological activity and pharmacological properties of one or more compounds, individually or in combination, by using whole animals or whole cells. The systems and methods are particularly suitable for high throughput screening techniques for identifying compounds that are effective in a whole-animal or whole-cell system.

De uitvinding biedt een geautomatiseerd, robotmicrovloeistofsysteem voor het in stand houden van een enkele cel of meerdere cellen of organismen met minimale of geen handmatige interventie. In dit systeem kunnen organismen en cellen worden verplaatst, gesorteerd, geïmmobiliseerd, blootgesteld aan verbindingen en kunnen microscopisch opnamen worden gemaakt voor anatomisch onderzoek, gedragsonderzoek en door diverse genetisch gecodeerde fluorescente of luminescente reporters te gebruiken kunnen, de concentratie van diverse moleculaire elementen zoals calcium, de elektrische potentiaal, of andere kenmerken worden gemonitord in het levende dier of de complete cel. Fysionlogische parameters waaronder, maar niet beperkt tot, reproductie, genetische en epigenetische modificaties, ingestie, consumptie van diverse stoffen en metabolieten kunnen worden gemonitord door het systeem te koppelen aan diverse microtitratie- en analysetechnieken. De uitvinding biedt screeningsmethoden voor het detecteren en identificeren van substanties die invloed hebben op de levensvatbaarheid van de cel en/of de biobeschikbaarheid van een verbinding en/of ziekte of fenotypeprogressie voorkomen, en/of beschermende effecten verlenen.The invention provides an automated, robot micro-fluid system for maintaining a single cell or multiple cells or organisms with minimal or no manual intervention. In this system organisms and cells can be moved, sorted, immobilized, exposed to connections and microscopic recordings can be made for anatomical research, behavioral research and by using various genetically coded fluorescent or luminescent reporters, the concentration of various molecular elements such as calcium, the electrical potential, or other characteristics, are monitored in the living animal or the entire cell. Physiological parameters including, but not limited to, reproduction, genetic and epigenetic modifications, ingestion, consumption of various substances and metabolites can be monitored by linking the system to various micro-titration and analysis techniques. The invention provides screening methods for detecting and identifying substances that affect cell viability and / or prevent the bioavailability of a compound and / or disease or phenotype progression, and / or confer protective effects.

Microstromingsapparaten zijn recent aanvaard en hebben het ontwerp en de implementatie van moderne bioanalysesystemen significant beïnvloed. Deze apparaten kunnen kleine hoeveelheden vloeistofmonster op een veel efficiëntere manier hanteren en manipuleren met de mogelijkheid van snellere testresponstijden, vereenvoudigde analyseprocedures, en kleinere monsters benodigd voor analyse. Microstromingsapparaten vinden toepassing op een breed gebied variërend van syntheses tot scheidingsprocedures tot analyses in toepassingen zoals immunotesten, 'lab-on-a-chip', snelle nucleotidesequentie-analyse en screening met een hoge doorvoercapaciteit.Micro-flow devices have recently been accepted and have significantly influenced the design and implementation of modern bioanalysis systems. These devices can handle and manipulate small amounts of fluid sample in a much more efficient manner with the possibility of faster test response times, simplified analysis procedures, and smaller samples needed for analysis. Micro-flow devices find application in a wide range ranging from syntheses to separation procedures to analyzes in applications such as immunoassays, 'lab-on-a-chip', fast nucleotide sequence analysis and screening with a high throughput.

In overeenstemming daarmee heeft een karakteristiek microstromingsapparaat standaard structurele of functionele eigenschappen gedimensioneerd op millimeterschaal of minder, die in staat zijn tot manipuleren van kleine hoeveelheden vloeistoffen. Meestal omvatten deze functies zoals, maar niet beperkt tot, kanalen, voeistofreservoirs, reactiekamers, mengkamers en afscheidingsgebieden. In sommige voorbeelden, hebben de kanalen tenminste een dwarssectionale afmeting die ligt in een bereik van ongeveer 0,1 μιη tot ongeveer 500 μιη. Door afmetingen van deze grootteorde te gebruiken kan een groter aantal kanalen in een kleiner gebied worden opgenomen en worden kleinere hoeveelheden vloeistoffen gebruikt.Accordingly, a typical micro-flow device has standard structural or functional properties dimensioned on a millimeter scale or less, capable of manipulating small amounts of liquids. Typically these functions include, but are not limited to, channels, fluid reservoirs, reaction chambers, mixing chambers, and separation areas. In some examples, the channels have at least a cross-sectional dimension that is in a range of about 0.1 μιη to about 500 μιη. By using dimensions of this order of magnitude, a larger number of channels can be accommodated in a smaller area and smaller amounts of liquids are used.

Een microstromingsapparaat kan op zichzelf bestaan of kan onderdeel uitmaken van een microvloeistof systeem dat bijvoorbeeld en zonder beperking, kan omvatten: pompen voor het inbrengen van vloeistoffen, bijv., monsters, reagentia, buffers, medicijnen, en dergelijke, in een systeem en/of via het systeem; detectieapparatuur of -systemen; dataopslagsystemen; en regelsystemen voor het regelen van vloeistoftransport en/of -richting binnen het apparaat, monitoren en controleren van milieuomstandigheden waaraan de vloeistoffen in het apparaat worden onderworpen, zoals temperatuur, stroming,en dergelijke.A micro-flow device may exist on its own or may be part of a micro-fluid system that may include, for example and without limitation, pumps for introducing fluids, e.g., samples, reagents, buffers, drugs, and the like, into a system and / or through the system; detection equipment or systems; data storage systems; and control systems for controlling fluid transport and / or direction within the device, monitoring and controlling environmental conditions to which the liquids in the device are subjected, such as temperature, flow, and the like.

Een uitvoeringsvorm van de uitvinding, hier beschreven is een microstromingssysteem met een microstromingsapparaatmodule dat één of meerdere verzegelde kamers heeft en waarin de vloeistof in de kamer in verbinding staat met een inlaatkanaal en een uitlaatkanaal voor microstroming. Op deze manier kan een vloeistof door de kamers worden gepompt om nutriënten naar binnen te brengen of biologisch afval te verwijderen dat zich na verloop van tijd kan ophopen. Bovendien kunnen medicijnen of nutriënten via de microstromingskanalen in de kamers worden gepompt om gebruikt te worden in de cultuur en het onderzoek van volwassen exemplaren, embryo's en larven van meercellige organismen, organen, weefsels, cellen of cellijnen die in de kamers kunnen worden geplaatst en opgekweekt. In één aspect van de uitvinding kan een veelvoud aan microstromingsapparaatmodules, met ieder een of meerdere kamers, aan elkaar worden gekoppeld binnen een groter frame om zo een universeel microstromingsmilieu te realiseren.An embodiment of the invention described herein is a micro-flow system with a micro-flow device module that has one or more sealed chambers and in which the fluid in the chamber communicates with an inlet channel and an outlet channel for micro-flow. In this way, a liquid can be pumped through the chambers to bring in nutrients or remove biological waste that can accumulate over time. In addition, drugs or nutrients can be pumped through the micro-flow channels into the chambers for use in the culture and research of adult specimens, embryos and larvae of multicellular organisms, organs, tissues, cells or cell lines that can be placed and grown in the chambers . In one aspect of the invention, a plurality of micro-flow device modules, each with one or more chambers, can be coupled together within a larger frame to realize a universal micro-flow environment.

In een andere uitvoeringsvorm van de uitvinding kan het hier beschreven microstromingssysteem gebruikt worden voor het uitvoeren van experimenten op volledige organismen, zoals bijv., C. elegans, fruitvlieglarven of embryo's (Drosophila melanogaster), zebravislarven of embryo's (Danio rerio), en andere kleine metazoë organismen die in de kamers worden geplaatst. De veranderingen in het volledige dier of de ontwikkeling van de embryo's/larven over een periode van dagen kan worden gemonitord, bijvoorbeeld met of zonder blootsteling aan medicijnen of andere verbindingen. Zo kunnen bijvoorbeeld transparante of gedeeltelijk transparante organismen zoals Danio rerio worden gebruikt voor het maken van beelden van celactiviteit of interne processen met of zonder blootstelling aan medicijnen of andere verbindingen. In andere uitvoeringsvormen, kunnen experimenten worden uitgevoerd op een monolaag van cellen, op een membraan, matrix of ander materiaal binnenin de kamer.In another embodiment of the invention, the micro-flow system described herein can be used to perform experiments on whole organisms, such as e.g., C. elegans, fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and other small metazoë organisms that are placed in the chambers. The changes in the entire animal or the development of the embryos / larvae over a period of days can be monitored, for example with or without exposure to drugs or other compounds. For example, transparent or partially transparent organisms such as Danio rerio can be used to take pictures of cell activity or internal processes with or without exposure to drugs or other compounds. In other embodiments, experiments can be performed on a monolayer of cells, on a membrane, matrix, or other material within the chamber.

Het microstromingsapparaat kan een substraat bevatten. Het substraat kan rechthoekig zijn, circelvormig, ovaal of iedere andere vorm hebben. Het substraat kan zijn gemaakt van een geschikt materiaal dat wordt geselecteerd vanwege zijn eigenschappen, zoals goed thermisch geleidingsvermogen, oppervlakte-eigenschappen die uniforme coating en een stabiel reagens mogelijk maken en neutraliteit ten opzichte van het vloeibare medium om interferentie met de test te voorkomen. Voor dit doel geschikt materiaal voor een stevige ondergrond is onder andere flexibel polymeer zoals polydimethylsiloxaan, hardere polymeren, glas, metaal, hydrogel, siliconen, PETG, polyester, polycarbonaat, pvc, polystyreen, SAN, acrylonitrilbutadieenstyreen (ABS), en combinaties en hybriden hiervan, en omvat kralen, membranen, microtiterkuipjes, strings, plastic, strips, of ieder oppervlak waarop volledige organismen kunnen worden gedeponeerd of geïmmobiliseerd. Alternatief en gelijkwaardig, kan een in de handel verkrijgbare gegoten vaste ondergrond worden gebruikt bij het in de praktijk brengen van de uitvinding.The micro-flow device can contain a substrate. The substrate can be rectangular, circular, oval or any other shape. The substrate can be made of a suitable material selected for its properties, such as good thermal conductivity, surface properties that allow uniform coating and a stable reagent, and neutrality to the liquid medium to prevent interference with the test. Suitable materials for a solid substrate for this purpose include flexible polymer such as polydimethylsiloxane, harder polymers, glass, metal, hydrogel, silicone, PETG, polyester, polycarbonate, PVC, polystyrene, SAN, acrylonitrile butadiene styrene (ABS), and combinations and hybrids thereof and includes beads, membranes, microtitre tubs, strings, plastic, strips, or any surface on which entire organisms can be deposited or immobilized. Alternatively and equivalent, a commercially available molded solid substrate can be used in practicing the invention.

Iedere microstromingsmodule kan een of meerdere poorten met negatieve druk (vacuüm) en positieve druk bevatten om de bewegingskracht te leveren aan vloeistoffen, of andere manieren om de vloeistoffen in beweging te brengen, alsmede drukoverbrengende poorten voor het aansturen van on-chip-ventielen.Each micro-flow module can contain one or more ports with negative pressure (vacuum) and positive pressure to provide the movement force to liquids, or other ways of moving the liquids, as well as pressure-transmitting ports for controlling on-chip valves.

Grote dieren waaronder de embryo's en larven van de zebravis kunnen afmetingen hebben in de orde van enkele millimeters. Om kamers te maken met deze afmetingen, kunnen kanalen in een stijf substraat worden uitgefreesd met een freesmachine of een lasersnijder. Voor gebieden die ronde kanalen vereisen, waaronder secties die microstromingsventielen bevatten kan een bolfrees [ball end mill] met een ronde top worden gebruikt.Large animals including the zebrafish embryos and larvae can have dimensions in the order of a few millimeters. To make chambers with these dimensions, channels in a rigid substrate can be milled out with a milling machine or a laser cutter. For areas requiring round channels, including sections that contain micro-flow valves, a ball end mill with a round top can be used.

Het zal worden gewaardeerd dat in de praktijk een microstromingsapparaatmodule 32 kamers, 96 kamers, 869 kamers, of ieder ander aantal kamers kan bevatten dat nodig is. In een ander aspect van de uitvinding, bestaat het microstromingsapparaat uit een set microstroming apparaatmodules, die meestal bestaan uit een constructie van enkelvoudige of multilaags polymeerchips, met een gemeenschappelijke interface van fysieke onderlinge verbindingen, waarmee iedere twee modules met elkaar kunnen worden verbonden. Meerdere chips kunnen binnen een groter frame met elkaar worden verbonden om een universeel microstromingsmilieu te creëren. Het frame kan vlak zijn, zodat apparaten met een vierkante of rechthoekige vorm een plaats kunnen krijgen of het kan drie dimensionaal zijn, zodat rechthoekige prisma- of kubusvormen mogelijk zijn. De fysische interface tussen de modules kan eenvoudig bestaan uit aangrenzende vlakken of deze kan bestaan uit mannetje/vrouwtje-steekverbindingen analoog aan een chipsocket op een elektronische printplaat, messing-en-groefverbindingen, of andere koppelingsconfiguraties of bevestigingsmethoden.It will be appreciated that in practice a micro-flow device module may contain 32 chambers, 96 chambers, 869 chambers, or any other number of chambers required. In another aspect of the invention, the micro-flow device consists of a set of micro-flow device modules, which usually consist of a structure of single or multi-layer polymer chips, with a common interface of physical interconnections, with which any two modules can be connected to each other. Multiple chips can be connected within a larger frame to create a universal micro-flow environment. The frame can be flat, so that devices with a square or rectangular shape can have a place or it can be three-dimensional, so that rectangular prism or cube shapes are possible. The physical interface between the modules can simply consist of adjacent faces or it can consist of male / female plug connections analogous to a chip socket on an electronic printed circuit board, tongue and groove connections, or other coupling configurations or mounting methods.

Door gecoördineerd schakelen van on-chip-ventielen, kunnen dieren worden verplaatst naar andere gedeelten van een apparaat en ook tussen verbonden apparaten. Bovendien kunnen door gecoördineerd schakelen van on-chip of off-chip-ventielen, vloeistoffen naar of weg van de dieren worden verplaatst met als doel het aanleveren van testverbindingen of reagentia, alsook voor het verzamelen van vloeistoffen, weefsel en stofwisselingsproducten voor analyse.By coordinated switching of on-chip valves, animals can be moved to other parts of a device and also between connected devices. In addition, by coordinated switching of on-chip or off-chip valves, liquids can be moved to or away from the animals for the purpose of supplying test compounds or reagents, as well as for collecting liquids, tissue and metabolic products for analysis.

In één aspect van de uitvinding kunnen gespecificeerde microstromingsapparaatmodules worden ontworpen om geometrische uitlijning of fysieke verbinding met apparaten van derden mogelijk te maken, zoals microscoopobject dragers of objectieven om beeldopnamen te kunnen maken.In one aspect of the invention, specified micro-flow device modules can be designed to allow geometric alignment or physical connection to third-party devices, such as microscope object carriers or lenses to enable image recording.

Microstromingsmodules kunnen worden ontworpen om een interface met andere apparaten van derden te hebben zoals complexe objectsorteerders zoals COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers zoals FACS (Fluorescence Activated Cell Sorter), lasers, irradiators en andere detectiesystemen kunnen gelijksoortige microstromingsmodules hebben om een interface met het systeem te hebben.Micro-flow modules can be designed to interface with other third-party devices such as complex object sorters such as COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers such as FACS (Fluorescence Activated Cell Sorter), lasers, irradiators and other detection systems can similar micro-flow modules to have an interface with the system.

Een voorbeeld van een detectsysteem voor geautomatiseerde detectie voor gebruik met de huidige uitvinding en geassocieerde methoden bestaat uit een excitatiebron, een monochromator (of ieder ander apparaat dat lichtcomponenten spectraal kan ontbinden, of een set smallebandfilters) en een detectorpakket. De excitatiebron kan bestaan uit infrarode, blauwe of UV-golflengtes en de excitatiegolflengte kan korter zijn dan te detecteren emissiegolflengte(s). Het detectie systeem kan zijn: een breedband UV-lichtbron, zoals een deuteriumlamp met een filter ervoor; het licht van een witte lichtbron zoals een xenonlamp of een deuteriumlamp nadat dit door een monochromator is gegaan om de gewenste golflengtes te extraheren; of ieder andere van een aantal 'continues wave' (cw) gaslasers, waaronder, maar niet beperkt tot, alle Argon-ionlaserlijnen (457, 488, 514, etc. nm) of een HeCd-laser; vastestof-diodelasers in het blauw zoals GaN en GaAs (verdubbeld) gebaseerde lasers of de verdubbelde of verdrievoudigde output van op YAG of YLF gebaseerde lasers; of iedere pulslaser die blauw licht uitzendt.An example of an automated detection system for use with the present invention and associated methods consists of an excitation source, a monochromator (or any other device that can spectrally decompose light components, or a set of narrow-band filters) and a detector package. The excitation source can consist of infrared, blue or UV wavelengths and the excitation wavelength can be shorter than the emission wavelength (s) to be detected. The detection system can be: a broadband UV light source, such as a deuterium lamp with a filter in front; the light from a white light source such as a xenon lamp or a deuterium lamp after it has passed through a monochromator to extract the desired wavelengths; or any other of a number of 'continue wave' (cw) gas lasers, including, but not limited to, all Argon ion laser lines (457, 488, 514, etc. nm) or a HeCd laser; solid state diode lasers such as GaN and GaAs (doubled) based lasers or the doubled or tripled output of YAG or YLF based lasers; or any pulse laser that emits blue light.

Het door het organisme, het monster of de reagentia in de kamer uitgezonden licht kan worden gedetecteerd met een apparaat dat spectraalgegevens levert over het substraat, bijv. een traliespectrometer, prismaspectrometer, beeldopnamespectrometer, of iets dergelijks, of gebruik maakt van interferentiebandfilters. Door gebruik te maken van een tweedimensionale gebiedsopnameapparaat zoals een ccd-camera, kunnen veel objecten tegelijkertijd op beeld worden gezet. Spectrale gegevens kunnen worden gegenereerd door het verzamelen van meer dan één beeld via verschillende bandfilters, of filters die lange of korte golven doorlaten (interferentiefilter of elektronisch instelbare filters zijn geschikt). Meer dan één beeldopnameapparaat kan worden gebruikt om simultaan data te verzamelen door middel van speciale filters, of de filter aangebracht voor een enkelvoudig opnameapparaat kan worden verwisseld. Op beeldopname gebaseerde systemen, zoals het Biometrie Imaging systeem, scannen een oppervlakte om fluorescentiesignalen te vinden.The light emitted by the organism, sample, or reagents into the chamber can be detected with an apparatus that provides spectral data on the substrate, e.g., a grating spectrometer, prism spectrometer, image recording spectrometer, or the like, or uses interference band filters. By using a two-dimensional area recording device such as a ccd camera, many objects can be displayed simultaneously. Spectral data can be generated by collecting more than one image via different band filters, or filters that transmit long or short waves (interference filter or electronically adjustable filters are suitable). More than one image recording device can be used to collect data simultaneously by means of special filters, or the filter arranged for a single recording device can be exchanged. Image-based systems, such as the Biometrics Imaging system, scan a surface to find fluorescence signals.

Het hier beschreven microstromingssysteem kan gebruikt worden voor het uitvoeren van experimenten op complete cellen zoals bovenstaand en onderstaand beschreven, en/of op organismen zoals bijv.The micro-flow system described here can be used to perform experiments on whole cells as described above and below, and / or on organisms such as e.g.

Caenorhabditis elegans (C. elegans), fruitvlieglarven of embryo's (Drosophila melanogaster), zebravislarven of embryo's (Danio rerio), en andere kleine metazoa organismen of enkelcellige organismen zoals bijv. Saccharomyces cerevisiae (gist), en andere schimmels of protozoa organismen, geplaatst in de kamers. De huidige openbaarmaking zal zich richten op Danio rerio en/of Drosophila melanogaster, maar er zij op gewezen dat waar Danio rerio of Drosophila melanogaster wordt genoemd andere kleine dieren kunnen worden gebruikt.Caenorhabditis elegans (C. elegans), fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and other small metazoa organisms or single-cell organisms such as, for example, Saccharomyces cerevisiae (yeast), and other fungi or protozoa organisms, placed in the rooms. The current disclosure will focus on Danio rerio and / or Drosophila melanogaster, but it should be noted that where Danio rerio or Drosophila melanogaster is mentioned other small animals can be used.

Zo zijn bijvoorbeeld, genen die belangrijk zijn voor het metabolisme in zoogdieren zoals genen voor een insulinesignaleringspad, het EGFR-pad, het cholesterolpad, het LXR-pad, het LRP-pad en/of het galzuurpad aanwezig in Danio rerio. Zo kan bijvoorbeeld de veelheid aan Danio rerio een groot aantal wildtype of genetisch gemodificeerd of transgene Danio rerio omvatten. In een ander voorbeeld kan de veelheid aan zebravissen een groot aantal genetisch gemodificeerde of transgene zebravissen omvatten met een transgen dat een promoter-reportersamenstelling is, waarin de reporter een fluorescent of luminescent proteïne codeert en waarin de Promoter een promoter is van een zebravisgen geïnduceerd in respons op blootstelling aan een toxine of stress.For example, genes important for metabolism in mammals such as genes for an insulin signaling pathway, the EGFR pathway, the cholesterol pathway, the LXR pathway, the LRP pathway and / or the bile acid pathway are present in Danio rerio. For example, the plurality of Danio rerio can include a large number of wild-type or genetically modified or transgenic Danio rerio. In another example, the plurality of zebrafish may include a large number of genetically modified or transgenic zebrafish with a transgene that is a promoter-reporter composition, wherein the reporter encodes a fluorescent or luminescent protein and wherein the Promoter is a promoter of a zebrafish induced in response for exposure to a toxin or stress.

De huidige uitvinding kan zich richten op methoden voor het muteren van een enkelvoudig gen of meerdere genen (bijv. twee of meer) in zebravis om mutante stammen te verkrijgen die een verhoogde permeabiliteit of biologische beschikbaarheid voor verbindingen vertonen. De huidige uitvinding omvat diverse methoden voor het creëren van mutaties in zebravis. In één uitvoeringsvorm is de mutatie een insertie- of invoegmutatie. In een andere uitvoeringsvorm is de mutatie een deletie- of verwijdermutatie. In een andere uitvoeringsvorm is de methode van mutatie het introduceren van een cassette of gen-trap door recombinatie. In een andere uitvoering wordt een kleine nucleïnezuursequentiemodificatie gecreëerd door mutagenese, zoals door middel van het creëren van frameshifts, stopmutaties, substitutiemutaties, kleine insertiemutaties, kleine deletiemutaties, en dergelijke.The present invention can focus on methods for mutating a single gene or multiple genes (e.g., two or more) in zebrafish to obtain mutant strains that exhibit increased permeability or bioavailability for compounds. The present invention includes various methods for creating mutations in zebrafish. In one embodiment, the mutation is an insertion or insertion mutation. In another embodiment, the mutation is a deletion or deletion mutation. In another embodiment, the method of mutation is to introduce a cassette or gene trap by recombination. In another embodiment, a small nucleic acid sequence modification is created by mutagenesis, such as by creating frame shifts, stop mutations, substitution mutations, small insertion mutations, small deletion mutations, and the like.

Mutante stammen die verhoogde permeabiliteit vertonen voor verbindingen kunnen worden geïdentificeerd door parallel een zuivere voorwaartse EMS-mutagenese-screening en een kandidaatgebaseerde screening naar mutanten in genen die permeabiliteit kunnen verlenen, uit te voeren, waaronder maar niet beperkt tot, meervoudig medicijnresistentie proteïnen, P-glycoproteïnen, ABCtransport proteïnen, glycosyltransferases, nucleaire hormoonreceptoren, organische anion transporteurs en vetzuurtransporteurs. De mutante stammen kunnen worden gescreend op permeabiliteitmutanten met behulp van een combinatie van fluorescentie-/luminescentietesten en toegankelijkheidstesten voor verbindingen waarvan bekend is dat ze door wildtype zebravis worden buitengesloten (waaronder maar niet beperkt tot chloroquine, colchicine, nicotine, verapamil en andere calciumkanaal antagonisten, zware metalen, ivermectin). Enkelvoudige mutaties kunnen combinatoir worden gecombineerd en de resulterende stammen op een iteratieve wijze opnieuw gescreend op gezondheid en opname van verbindingen totdat de gewenste set mutaties aan het licht is gebracht. Warmtebepalingen omvatten maar zijn niet beperkt tot motiliteit, reproductie, propidiumjodideopname, levensduur en gedragsanalyses. De toegankelijkheid van kleine moleculen tot cellen en weefsel in de mutante stammen kan worden bepaald door luciferases op een weefselspecifieke manier tot expressie te brengen, vervolgens zebravis te voeden met luciferinecofactor en te screenen op luminescentie. De uitvinding biedt zo een panel van mutante stammen die in meer of mindere mate gevoelig zijn voor medicijnen voor wat betreft de niveaus van cel- en weefsel-toegankelijkheid. Deze stammen kunnen exogene verbindingen toelaten die normalerwijze zouden worden buitengesloten van binnentreden van het lichaam door toegenomen intestinale of cuticulale permeabiliteit, verhoogd intestinaal transport van opgenomen moleculen, toegenomen faryngale pompwerking, verminderde functie van detoxificatie-enzymen of pompen of een combinatie van deze mechanismen, of door een onbekend mechanisme. Deze bibliotheek kan stammen bevatten met permeabiliteit die varieert per weefsel of die varieert afhankelijk van het chemotype van de exogene verbinding. Deze stammen vertonen verhoogde permeabiliteit voor verbindingen zonder een verhoogd achtergrondfenotype. Verhoogde permeabiliteit wordt bepaald in verschillende weefsels en celtypen door fluorescentie en luminescentieonderzoeken en door fenotypescreening op toegankelijkheid voor verbindingen waarvan bekend is dat ze door wildtype-stammen worden buitengesloten. Stammen in deze bibliotheek kunnen ook worden gemodificeerd om samenstellingen te bevatten voor weefselspecifieke, locatiespecifieke en/of ontwikkelingsstadiumspecifieke expressie van endogene of exogene menselijke proteïnen, die kunnen omvat worden in plasmiden of direct geïntroduceerd worden door genoombewerking. Deze transgene stammen kunnen enkelvoudige of meervoudige kopieën van transgenen bevatten die humane proteïnen uitdrukken vertrekkende van extrachromasomale waaiers of in het genoom zijn geïntegreerd.Mutant strains that exhibit increased permeability to compounds can be identified by conducting in parallel pure forward EMS mutagenesis screening and candidate-based screening for mutants in genes that can confer permeability, including but not limited to, multiple drug resistance proteins, P- glycoproteins, ABC transport proteins, glycosyl transferases, nuclear hormone receptors, organic anion transporters and fatty acid transporters. The mutant strains can be screened for permeability mutants using a combination of fluorescence / luminescence tests and accessibility tests for compounds known to be excluded by wild-type zebrafish (including but not limited to chloroquine, colchicine, nicotine, verapamil and other calcium channel antagonists, heavy metals, ivermectin). Single mutations can be combined combinatorically and the resulting strains re-screened in an iterative manner for health and uptake of compounds until the desired set of mutations is revealed. Heat determinations include but are not limited to motility, reproduction, propidium iodide uptake, lifespan, and behavioral analyzes. The accessibility of small molecules to cells and tissue in the mutant strains can be determined by expressing luciferases in a tissue-specific manner, then feeding zebrafish with luciferin co-factor and screening for luminescence. The invention thus provides a panel of mutant strains that are more or less susceptible to drugs with regard to the levels of cell and tissue accessibility. These strains may permit exogenous compounds that would normally be excluded from entry into the body due to increased intestinal or cuticular permeability, increased intestinal transport of incorporated molecules, increased pharyngeal pumping action, decreased function of detoxification enzymes or pumps or a combination of these mechanisms, or by an unknown mechanism. This library may contain strains with permeability that varies per tissue or that varies depending on the chemotype of the exogenous compound. These strains exhibit increased permeability for compounds without an increased background phenotype. Increased permeability is determined in various tissues and cell types by fluorescence and luminescence studies and by phenotype screening for accessibility for compounds known to be excluded by wild-type strains. Strains in this library can also be modified to contain compositions for tissue-specific, location-specific and / or development-stage-specific expression of endogenous or exogenous human proteins, which can be included in plasmids or introduced directly by genomic processing. These transgenic strains may contain single or multiple copies of transgenes expressing human proteins from extrachromasomal ranges or integrated into the genome.

De geselecteerde dieren kunnen worden gesorteerd en verstrekt met behulp van één van de bekende methoden of het microstromingssysteem kan worden gebruikt om de dieren te sorteren en ze naar de juiste kamer te verplaatsen. Bij voorkeur kan met de geselecteerde methode voor het sorteren/toedienen, efficiënte distributie in de kamers plaatsvinden van C. elegans, Danio rerio embryo's of Drosophila melanogaster en kunnen afzonderlijke organismen snel worden gedeponeerd. Verder kan ieder organisme optisch worden geanalyseerd zodat alleen gewenste organismen met bepaalde vooraf bepaalde biologische kenmerken worden gedeponeerd. Hierdoor wordt het mogelijk identiek gefaseerde organismen te selecteren, hetgeen de uniformiteit van de testprocedure aanzienlijk vergroot. Iedere van de bekende sorteer verwerkingsmethoden en in de handel verkrijgbare apparatuur kan worden gebruikt.The selected animals can be sorted and supplied using one of the known methods or the micro-flow system can be used to sort the animals and move them to the correct room. Preferably, with the selected sorting / administration method, efficient distribution can take place in the chambers of C. elegans, Danio rerio embryos or Drosophila melanogaster and individual organisms can be quickly deposited. Furthermore, each organism can be optically analyzed so that only desired organisms with certain predetermined biological characteristics are deposited. This makes it possible to select identically phased organisms, which considerably increases the uniformity of the test procedure. Any of the known sorting processing methods and commercially available equipment can be used.

De transgenische dieren kunnen een label dragen om detectie ervan te vergemakkelijken. In sommige uitvoeringsvormen kan dit een fluorescent label zijn. Ieder dier kan een ander fluorescent label dragen. Het detecteerbare label hoeft echter geen fluorescent maar kan ieder label zijn. Een methode voor het detecteren van het fluorescente label bestaat uit het gebruik van straling met een golflengte specifiek voor het label of het gebruik van andere geschikte verlichtingsbronnen. De fluorescentie van het label kan worden gedetecteerd door een ccd-camera of andere geschikte detectiemethoden.The transgenic animals can carry a label to facilitate detection thereof. In some embodiments, this can be a fluorescent label. Every animal can bear a different fluorescent label. However, the detectable label does not have to be fluorescent but can be any label. A method for detecting the fluorescent label consists of the use of radiation with a wavelength specific to the label or the use of other suitable lighting sources. The fluorescence of the label can be detected by a CCD camera or other suitable detection methods.

De microstromingssystemen en -methoden die hier worden voorzien kunnen voordeel hebben bij robotsystemen en apparatuur voor het opslaan en verplaatsen van deze microstromingsmodules als kamers voor robotsystemen voor het snel toedienen van vloeistoffen in en uit de platen. Door combineren van een geautomatiseerd microstromingsplatform voor het onderhouden, hanteren en testen van organismen met een bibliotheek van synthetische mutanten met een diversiviteit aan permeabiliteitseigenschappen en selectiviteit kan dit systeem het met hoge doorvoercapaciteit screenen van verbindingen op intacte organismen mogelijk maken.The micro-flow systems and methods provided here can be advantageous with robotic systems and equipment for storing and moving these micro-flow modules as chambers for robotic systems for rapidly delivering liquids into and out of the plates. By combining an automated micro-flow platform for maintaining, handling and testing organisms with a library of synthetic mutants with a diversity of permeability properties and selectivity, this system can make it possible to screen compounds with high throughput for intact organisms.

Het robotsysteem omvat programmeerbare robotarmmanipulators voor het installeren, verwijderen en configureren van modules van de microstromingsmodule opstelling. Als ze op hun plaats worden geklikt sluiten de modules nauw aan op andere modules om zo afgedichte microstromingsinterfaces te vormen. Deze interfaces kunnen vast worden gedrukt of zijn bevestigd met mechanische lippen of pennen. Modules kunnen ook worden aangestuurd en in werking gezet door vloeistof, elektrische, magnetische, thermische en mechanische interactie met een actieve bedienings matrix onder het vlak van de moduleopstelling. Deze bedieningsmatrix kan elektrische verbindingen, analoog-digitale interfaces en magnetische en mechanische actuators bevatten, alsmede thermokoppels en vloeistofkoppelingen, en ook uitlaatpoorten voor het verwijderen van vloeibaar en corpusculair afval uit de microstromingsopstelling. De bedieningsmatrix en robotica kunnen worden verbonden met computers voor een softwarematige programmeerbare realtime bediening. Daarbij kunnen de manipulators externe apparatuur zoals videocamera' s en externe apparaten van derden mechanisch manipuleren en bedienen zonder menselijke interventie. Het robotsysteem kan worden aangestuurd met een programmeerbaar software pakket met een interface voor het programmeren van applicaties waardoor deze kan worden gebruikt in combinatie met bestaande softwareprogrammeertalen zoals C, C++, Visual Basic, Python, en MATLAB, alsmede eigen en open source roboticabedieningssoftware.The robotic system includes programmable robotic arm manipulators for installing, removing, and configuring modules of the micro-flow module arrangement. When they are clicked into place, the modules connect closely to other modules to form sealed micro-flow interfaces. These interfaces can be fixed or attached with mechanical lips or pins. Modules can also be controlled and triggered by fluid, electrical, magnetic, thermal and mechanical interaction with an active control matrix below the plane of the module arrangement. This control matrix can contain electrical connections, analog-digital interfaces and magnetic and mechanical actuators, as well as thermocouples and fluid couplings, as well as outlet ports for removing liquid and particulate waste from the micro-flow arrangement. The control matrix and robotics can be connected to computers for software-programmable real-time operation. In addition, the manipulators can mechanically manipulate external equipment such as video cameras and external devices from third parties and operate them without human intervention. The robotic system can be controlled with a programmable software package with an application programming interface allowing it to be used in combination with existing software programming languages such as C, C ++, Visual Basic, Python, and MATLAB, as well as proprietary and open source robotic control software.

Het robotsysteem kan worden gemonitord door middel van video monitoring, laser-/optische sensors, alsmede mechanische, temperatuur en chemische sensors.The robot system can be monitored by means of video monitoring, laser / optical sensors, as well as mechanical, temperature and chemical sensors.

Met meerkleurige fluorescentie kunnen meerdere doelen en cel processen op één enkel scherm worden getoetst. Kruiscorrelatie van cellulaire responses zullen een schat aan informatie geven die nodig is voor het valideren van doelen en optimalisatie van een lead.With multi-colored fluorescence, multiple targets and cell processes can be tested on a single screen. Cross-correlation of cellular responses will provide a wealth of information needed to validate goals and optimize a lead.

De huidige uitvinding biedt een methode voor het analyseren van volledige dieren omvattende een waaier van locaties die meerdere dieren bevatten waarin de dieren één of meerdere fluorescente reporter moleculen bevatten; scannen van meerdere dieren op iedere locatie om fluorescentiesignalen te verkrijgen van de fluorescente reportermoleculen in de dieren; omzetten van de fluorescente signalen in digitale data; en het benutten van de digitale data om de verdeling, de omgeving of de activiteit van de fluorescente reportermoleculen binnenin de dieren te bepalen. In een ander aspect, biedt de onderhavige uitvindng een methode voor het analyseren van volledige dieren omvattende het bieden van een locatie waarin zich een dier bevindt waarin het dier optioneel één of meerdere reportermoleculen kan bevatten; het dier in contact brengen met een bibliotheek van verbindingen; scannen van het dier op meerdere locaties waarin ieder locatie een ander detectiesysteem bevat; het verkrijgen van detectie signalen en het omzetten van de signalen naar digitale data; en het benutten van de digitale data om de verdeling, de omgeving of de activiteit van de reportermoleculen binnenin de dieren te bepalen.The present invention provides a method for analyzing whole animals comprising a range of locations containing multiple animals in which the animals contain one or more fluorescent reporter molecules; scanning multiple animals at each location to obtain fluorescence signals from the fluorescent reporter molecules in the animals; converting the fluorescent signals into digital data; and utilizing the digital data to determine the distribution, environment, or activity of the fluorescent reporter molecules within the animals. In another aspect, the present invention provides a method for analyzing whole animals comprising providing a location in which there is an animal in which the animal can optionally contain one or more reporter molecules; bringing the animal into contact with a library of compounds; scanning the animal at multiple locations in which each location contains a different detection system; obtaining detection signals and converting the signals to digital data; and utilizing the digital data to determine the distribution, environment, or activity of the reporter molecules within the animals.

Als voorbeeld kan het Drosophila melanogaster of een zebravisembryo in de kamer worden geplaatst door een robothanteerder. Het dier kan vrij in de vloeistof in de kamer liggen, of kan zijn ingebed in agarose met een laag smeltpunt, of iedere andere substantie die het dier kan immobiliseren maar het niet beschadigt of gas-/nutriëntuitwisseling verhindert. Iedere kamer zal een constante toevoer hebben van een bepaalde buffer die door zijn microstromingsinlaatkanalen stroomt. Bovendien kunnen medicijnen aan de dieren in de kamer worden toegediend door de microstromingskanalen te gebruiken of met behulp van robotpipet-handlers via een schuifdeksel, dat van plastic of glas kan zijn en kan worden teruggetrokken om de opening toegankelijk te maken voor injectie. De uitvinding is relevant voor systemen en methoden voor het uitvoeren van testen voor het bepalen van de biologische activiteit en farmacologische eigenschappen van één of meerdere verbindingen, afzonderlijk of in combinatie, door gebruik te maken van volledige dieren of complete cellen. De systemen en methoden zijn in het bijzonder geschikt voor hoge doorvoer screeningstechnieken voor het identificeren van verbindingen die effectief zijn in een volledig dier- of een complete cel gebaseerd systeem.As an example, the Drosophila melanogaster or a zebrafish embryo can be placed in the room by a robotizer. The animal may lie freely in the fluid in the chamber, or may be embedded in a low melting point agarose, or any other substance that can immobilize the animal but does not damage it or prevent gas / nutrient exchange. Each chamber will have a constant supply of a certain buffer that flows through its micro-flow inlet channels. In addition, medications can be administered to the animals in the room by using the micro-flow channels or by using robot pipet handlers through a sliding cover, which can be plastic or glass and can be withdrawn to make the opening accessible for injection. The invention is relevant to systems and methods for performing tests for determining the biological activity and pharmacological properties of one or more compounds, individually or in combination, by using whole animals or whole cells. The systems and methods are particularly suitable for high throughput screening techniques for identifying compounds that are effective in a complete animal or a complete cell based system.

De uitvinding biedt een geautomatiseerd, robotmicrovloeistofsysteem voor het in stand houden van een enkele cel of meerdere cellen of organismen met minimale of geen handmatige interventie. In dit systeem kunnen organismen en cellen worden verplaatst, gesorteerd, geïmmobiliseerd, blootgesteld aan verbindingen en kunnen opnamen worden gemaakt via microscopie voor anatomisch onderzoek, gedragsonderzoek en door diverse genetisch gecodeerde fluorescente of luminescente reporters te gebruiken kunnen, de concentratie van diverse moleculaire elementen zoals calcium, de elektrische potentiaal, of andere kenmerken worden gemonitord in het levende dier of complete cel. Fysiologische parameters waaronder, maar niet beperkt tot, reproductie, genetische en epigenetische modificaties, ingestie, consumptie van diverse stoffen en metabolieten kunnen worden gemonitord door het systeem te koppelen aan diverse microtitratie- en analysetechnieken. De uitvinding biedt screeningsmethoden voor het detecteren en identificeren van substanties die invloed hebben op de levensvatbaarheid van de cel en/of de biobeschikbaarheid van een verbinding en/of ziekte of fenotypeprogressie voorkomen, en/of beschermende effecten verlenen.The invention provides an automated, robot micro-fluid system for maintaining a single cell or multiple cells or organisms with minimal or no manual intervention. In this system organisms and cells can be moved, sorted, immobilized, exposed to connections and recordings can be made via microscopy for anatomical research, behavioral research and by using various genetically coded fluorescent or luminescent reporters, the concentration of various molecular elements such as calcium , the electrical potential, or other characteristics are monitored in the living animal or whole cell. Physiological parameters including, but not limited to, reproduction, genetic and epigenetic modifications, ingestion, consumption of various substances and metabolites can be monitored by linking the system to various micro-titration and analysis techniques. The invention provides screening methods for detecting and identifying substances that affect cell viability and / or prevent the bioavailability of a compound and / or disease or phenotype progression, and / or confer protective effects.

Microstromingsapparaten zijn recent aanvaard en hebben het ontwerp en de implementatie van moderne bioanalysesystemen significant beïnvloed. Deze apparaten kunnen kleine hoeveelheden vloeistofmonster op een veel efficiëntere manier hanteren en manipuleren met daarbij de mogelijkheid van snellere testresponstijden, vereenvoudigde analyseprocedures en kleinere monsters benodigd voor analyse. Microstromingsapparaten vinden toepassing op een breed gebied variërend van syntheses tot scheidingsprocedures tot analyses in toepassingen zoals immunotesten, 'lab-on-a-chip', snelle nucleotidesêquentie-analyse en screening met een hoge doorvoercapaciteit.Micro-flow devices have recently been accepted and have significantly influenced the design and implementation of modern bioanalysis systems. These devices can handle and manipulate small amounts of liquid sample in a much more efficient way, with the possibility of faster test response times, simplified analysis procedures and smaller samples needed for analysis. Micro-flow devices are used in a wide range ranging from syntheses to separation procedures to analyzes in applications such as immunoassays, lab-on-a-chip, fast nucleotide sequence analysis and screening with a high throughput.

In overeenstemming daarmee heeft een karakteristiek microstromingsapparaat standaard structurele of functionele eigenschappen gedimensioneerd op millimeterschaal of minder, die in staat zijn tot manipuleren van kleine hoeveelheden vloeistoffen. Meestal omvat dit kenmerken zoals, maar niet beperkt tot, kanalen, voei stof reservoirs, reactiekamers, mengkamers en afscheidingsgebieden. In sommige voorbeelden, hebben de kanalen ten minste één dwarssectionale dimensie in de grootteorde van ongeveer 0,1 μιη tot ongeveer 500 μιη. Door afmetingen van deze grootteorde te gebruiken kan een groter aantal kanalen in een kleiner gebied worden opgenomen, waardoor kleinere vloeistofvolumes nodig zijn.Accordingly, a typical micro-flow device has standard structural or functional properties dimensioned on a millimeter scale or less, capable of manipulating small amounts of liquids. Usually this includes features such as, but not limited to, channels, fluid reservoirs, reaction chambers, mixing chambers, and separation areas. In some examples, the channels have at least one cross-sectional dimension in the order of magnitude of about 0.1 μιη to about 500 μιη. By using dimensions of this order of magnitude, a larger number of channels can be accommodated in a smaller area, so that smaller liquid volumes are required.

Een microstromingsapparaat kan op zichtzelf bestaan of kan onderdeel uitmaken van een microvloeistofsysteem dat bijvoorbeeld maar zonder beperking, kan omvatten:pompen voor het inbrengen van vloeistoffen, bijv., monsters, reagentia, buffers, medicijnen, en dergelijke, in een systeem en/of via het systeem; detectieapparatuur of -systemen; dataopslagsystemen en regelsystemen voor het regelen van vloeistoftransport en/of -richting binnen het apparaat, monitoren en controleren van milieuomstandigheden waaraan de vloeistoffen in het apparaat worden onderworpen, zoals temperatuur, stroming, en dergelijke.A micro-flow device may exist on its own or may be part of a micro-fluid system that may include, for example but without limitation: pumps for introducing fluids, e.g., samples, reagents, buffers, drugs, and the like, into a system and / or via the system; detection equipment or systems; data storage systems and control systems for controlling fluid transport and / or direction within the device, monitoring and controlling environmental conditions to which the fluids in the device are subjected, such as temperature, flow, and the like.

In een uitvoeringsvorm van de uitvinding hier beschreven is een microstromingssysteem met een microstromingsapparaatmodule dat een of meerdere afgedichte kamers heeft en waarin de vloeistof in de kamer in verbinding staat met een inlaatkanaal en een uitlaatkanaal voor microstroming. Op deze manier kan een vloeistof door de kamers worden gepompt om nutriënten naar binnen te brengen of biologisch afval te verwijderen dat zich na verloop van tijd kan ophopen. Bovendien kunnen, medicijnen of nutriënten via de microstromingskanalen in de kamers worden gepompt om gebruik te worden in de kuituur en het onderzoek van volwassen exemplaren, embryo's en larven van meercellige organismen, organen, weefsels, cellen of cellijnen die in de kamers kunnen worden geplaatst en opgekweekt. In één aspect van de uitvinding kan een veelvoud aan microstromingsapparaatmodules, met ieder één of meerdere kamers, aan elkaar worden gekoppeld binnen een groter frame om zo een universeel microstromingsmilieu te realiseren.In one embodiment of the invention described herein is a micro-flow system with a micro-flow device module that has one or more sealed chambers and in which the fluid in the chamber communicates with an inlet channel and an outlet channel for micro-flow. In this way, a liquid can be pumped through the chambers to bring in nutrients or remove biological waste that can accumulate over time. In addition, drugs or nutrients can be pumped through the micro-flow channels into the chambers for use in spawning and examination of adult specimens, embryos and larvae of multicellular organisms, organs, tissues, cells or cell lines that can be placed in the chambers and grown up. In one aspect of the invention, a plurality of micro-flow device modules, each with one or more chambers, can be coupled together within a larger frame to realize a universal micro-flow environment.

In een andere uitvoeringsvorm van de uitvinding kan het hier beschreven microstromingssysteem gebruikt worden voor het uitvoeren van experimenten op volledige organismen, zoals bijv., C. elegans, fruitvlieg larven of embryo's (Drosophila melanogaster), zebravislarven of embryo's (Danio rerio), en andere kleine metazoë organismen die in de kamers worden geplaatst. De veranderingen in het volledige dier of de ontwikkeling van de embryo's/larven over een periode van dagen kan worden gemonitord, bijvoorbeeld met of zonder blootsteling aan medicijnen of andere verbindingen. Zo kunnen bijvoorbeeld de transparante of gedeeltelijk transparante organismen zoals Danio rerio worden gebruikt voor het maken van beelden van celactiviteit of interne processen met of zonder blootstelling aan medicijnen of andereverbindingen. In andere uitvoeringsvormen, kunnen experimenten worden uitgevoerd op een monolaag van cellen, op een membraan, matrix of ander materiaal binnenin een kamer.In another embodiment of the invention, the micro-flow system described herein can be used to perform experiments on entire organisms, such as, e.g., C. elegans, fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and others small metazoe organisms that are placed in the rooms. The changes in the entire animal or the development of the embryos / larvae over a period of days can be monitored, for example with or without exposure to drugs or other compounds. For example, the transparent or partially transparent organisms such as Danio rerio can be used to take pictures of cell activity or internal processes with or without exposure to drugs or other compounds. In other embodiments, experiments can be performed on a monolayer of cells, on a membrane, matrix, or other material within a chamber.

Het microstromingsapparaat kan een substraat bevatten. Het substraat kan rechthoekig zijn, circelvormig, ovaal of iedere andere vorm hebben. Het substraat kan zijn gemaakt van een geschikt materiaal dat wordt geselecteerd vanwege zijn eigenschappen, zoals goed thermisch geleidingsvermogen, oppervlakte-eigenschappen die uniforme coating en een stabiel reactie mogelijk maken en neutraliteit ten opzichte van het vloeibare medium om interferentie met de test te voorkomen. Voor dit doel, geschikt materiaal voor een stevige ondergrond is onder andere een flexibel polymeer zoals polydimethylsiloxaan, harde polymeren, glas, metaal, hydrogel, siliconen, PETG, polyester, polycarbonaat, pvc, polystyreen, SAN, acrylonitrilbutadieenstyreen (ABS) en combinaties en hybriden hiervan, en omvatten kralen, membranen, microtiterkuipjes, strings, plastic, strips, of ieder ander oppervlak waarop volledige organismen kunnen worden gedeponeerd of geïmmobiliseerd. Alternatief en gelijkwaardig, kan een in de handel verkrijgbare gegoten vaste ondergrond worden gebruikt bij het in de praktijk brengen van de uitvinding. ledere microstromingsmodule kan één of meerdere poorten onder negatieve druk (vacuüm) of positieve druk omvatten die bewegingskracht levert aan vloeistoffen, of andere manieren om de vloeistoffen in beweging te brengen, alsmede drukoverbrengende poorten voor het aansturen van on-chip-ventielen.The micro-flow device can contain a substrate. The substrate can be rectangular, circular, oval or any other shape. The substrate can be made of a suitable material selected for its properties, such as good thermal conductivity, surface properties that allow uniform coating and stable reaction, and neutrality to the liquid medium to prevent interference with the test. For this purpose, suitable material for a solid substrate is a flexible polymer such as polydimethylsiloxane, hard polymers, glass, metal, hydrogel, silicone, PETG, polyester, polycarbonate, PVC, polystyrene, SAN, acrylonitrile butadiene styrene (ABS) and combinations and hybrids of these, and include beads, membranes, microtitre tubs, strings, plastic, strips, or any other surface on which entire organisms can be deposited or immobilized. Alternatively and equivalent, a commercially available molded solid substrate can be used in practicing the invention. Each micro-flow module can include one or more ports under negative pressure (vacuum) or positive pressure that provides movement power to liquids, or other ways of moving the liquids, as well as pressure-transmitting ports for controlling on-chip valves.

Grote dieren waaronder de embryo's en larven van de zebravis kunnen afmetingen hebben in de orde van een aantal millimeter. Om kamers te maken met deze afmetingen, kunnen kanalen in een vast substraat worden uitgefreesd met een freesmachine of een lasersnijder. Voor gebieden die ronde kanalen vereisen, waaronder secties die microstromingsventielen bevatten kan een bolfrees [ball end mill] met een ronde top worden gebruikt.Large animals including the zebrafish embryos and larvae can have dimensions in the order of a few millimeters. To make chambers with these dimensions, channels in a solid substrate can be milled out with a milling machine or a laser cutter. For areas requiring round channels, including sections that contain micro-flow valves, a ball end mill with a round top can be used.

Het zal worden gewaardeerd dat in de praktijk een microstromingsapparaatmodule 32 kamers, 96 kamers, 869 kamers, or ieder ander aantal kamers kan bevatten dat nodig is. In een ander aspect van de uitvinding, bestaat het microstromingsapparaat uit een set microstromingsapparaatmodules, die meestal bestaan uit een constructie van enkelvoudige of multilaags polymeerchips, met een gemeenschappelijke interface van fysieke onderlinge verbindingen, waarmee iedere twee modules met elkaar kunnen worden verbonden. Meerdere chips kunnen binnen een groter frame met elkaar worden verbonden om een universeel microstromingsmilieu te creëren. Het frame kan vlak zijn zodat apparaten met een vierkante of rechthoekige vorm een plaats kunnen krijgen of het kan driedimensionaal zijn zodat rechthoekige, prisma- of kubusvormen mogelijk zijn. De fysische interface tussen de modules kan eenvoudig bestaan uit aangrenzende vlakken of deze kan bestaan uit mannetje/vrouwtje-steekverbindingen analoog aan een chipsocket op een elektronische printplaat, messing-en-groefverbindingen en of andere koppelingsconfiguraties of bevestigingsmethoden.It will be appreciated that in practice a micro-flow device module may contain 32 rooms, 96 rooms, 869 rooms, or any other number of rooms that is required. In another aspect of the invention, the micro-flow device consists of a set of micro-flow device modules, which usually consist of a structure of single or multi-layer polymer chips, with a common interface of physical interconnections, with which any two modules can be connected to each other. Multiple chips can be connected within a larger frame to create a universal micro-flow environment. The frame can be flat so that devices with a square or rectangular shape can have a place or it can be three-dimensional so that rectangular, prism or cube shapes are possible. The physical interface between the modules can simply consist of adjacent faces or it can consist of male / female plug connections analogous to a chip socket on an electronic circuit board, tongue and groove connections and or other coupling configurations or mounting methods.

Door gecoördineerd schakelen van on-chip-ventielen, kunnen dieren worden verplaatst naar andere gedeelten van een apparaat en ook tussen verbonden apparaten. Bovendien kunnen door gecoördineerd schakelen van on-chip of off-chip-ventielen, vloeistoffen naar of weg van de dieren worden verplaatst met als doel het aanleveren van testverbindingen of reagentia, alsook voor het verzamelen van vloeistoffen, weefsel en metabolieten voor analyse.By coordinated switching of on-chip valves, animals can be moved to other parts of a device and also between connected devices. In addition, by coordinated switching of on-chip or off-chip valves, liquids can be moved to or away from the animals for the purpose of supplying test compounds or reagents, as well as for collecting liquids, tissue and metabolites for analysis.

In één aspect van de uitvinding kunnen gespecificeerde microstromingsapparaatmodules worden ontworpen om geometrische uitlijning of fysieke verbinding met apparaten van derden mogelijk te maken, zoals microscoopobjectdragers of objectieven om beeldopnamen te kunnen maken.In one aspect of the invention, specified micro-flow device modules can be designed to allow geometric alignment or physical connection to third-party devices, such as microscope object carriers or lenses to enable image recording.

Microstromingsmodules kunnen worden ontworpen om een interface met andere apparaten van derden te hebben zoals complexe objectsorteerders zoals COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers zoals FACS (Fluorescence Activated Cell Sorter), lasers, irradiators en andere detectiesystemen kunnen gelijksoortige microstromingsmodules hebben om een interface te hebben met het systeem.Micro-flow modules can be designed to interface with other third-party devices such as complex object sorters such as COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers such as FACS (Fluorescence Activated Cell Sorter), lasers, irradiators and other detection systems can similar micro-flow modules to have an interface with the system.

Een voorbeeld van een detectsysteem voor geautomatiseerde detectie voor gebruik met de huidige uitvinding en geassocieerde methoden bestaat uit een excitatiebron, een monochromator (of ieder ander apparaat dat lichtcomponenten spectraal kan ontbinden, of een set smallebandfilters) en een detectorpakket. De excitatiebron kan bestaan uit infrarode, blauwe of UV-golflengtes en de excitatiegolflengte kan korter zijn dan te detecteren emissiegolflengte(s). Het detectie systeem kan zijn: een breedband UV-lichtbron, zoals een deuteriumlamp met een filter ervoor; het licht van een witte lichtbron zoals een xenonlamp of een deuteriumlamp nadat dit door een monochromator is gegaan om de gewenste golflengtes te extraheren; of ieder andere van een aantal 'continues wave' (cw) gaslasers, waaronder maar niet beperkt tot alle Argon-ionlaserlijnen (457, 488, 514, etc. nm) of een HeCd-laser; vastestof-diodelasers in het blauw zoals GaN en GaAs (verdubbeld) gebaseerde lasers of de verdubbelde of verdrievoudigde output van op YAG of YLF gebaseerde lasers; of iedere pulslaser die blauw licht uitzendt.An example of an automated detection system for use with the present invention and associated methods consists of an excitation source, a monochromator (or any other device that can spectrally decompose light components, or a set of narrow-band filters) and a detector package. The excitation source can consist of infrared, blue or UV wavelengths and the excitation wavelength can be shorter than the emission wavelength (s) to be detected. The detection system can be: a broadband UV light source, such as a deuterium lamp with a filter in front; the light from a white light source such as a xenon lamp or a deuterium lamp after it has passed through a monochromator to extract the desired wavelengths; or any other of a number of 'continue wave' (cw) gas lasers, including but not limited to all Argon ion laser lines (457, 488, 514, etc. nm) or a HeCd laser; solid state diode lasers such as GaN and GaAs (doubled) based lasers or the doubled or tripled output of YAG or YLF based lasers; or any pulse laser that emits blue light.

Het door het organisme, het monster of de reagentia in de kamer uitgezonden licht kan worden gedetecteerd met een apparaat dat spectraal gegevens levert over het substraat, bijv. een traliespectrometer, prismaspectrometer, beeldopnamespectrometer, of iets dergelijks, of gebruik maakt van interferentiebandfilters. Door gebruik te maken van een tweedimensionale gebiedsopname zoals een ccd-camera, kunnen veel objecten tegelijkertijd op beeld worden gezet. Spectrale gegevens kunnen worden gegenereerd door het verzamelen van meer dan één beeldopname via verschillende bandfilters, of filters die lange of korte golven doorlaten (interferentiefilter of elektronisch instelbare filters zijn geschikt). Meer dan één beeldopnameapparaat kan worden gebruikt om simultaan data te verzamelen door middel van speciale filters, of de filter aangebracht voor een enkelvoudig opnameapparaat kan worden verwisseld. Op beeldopname gebaseerde systemen, zoals het Biometrie Imaging systeem, scannen een oppervlakte om fluorescentiesignalen te vinden.The light emitted by the organism, sample or reagents into the chamber can be detected with an apparatus that provides spectral data on the substrate, e.g. a grating spectrometer, prism spectrometer, image recording spectrometer, or the like, or uses interference band filters. By using a two-dimensional area recording such as a CCD camera, many objects can be displayed simultaneously. Spectral data can be generated by collecting more than one image capture through different band filters, or filters that transmit long or short waves (interference filter or electronically adjustable filters are suitable). More than one image recording device can be used to collect data simultaneously by means of special filters, or the filter arranged for a single recording device can be exchanged. Image-based systems, such as the Biometrics Imaging system, scan a surface to find fluorescence signals.

Het hier beschreven microstromingssysteem kan gebruikt worden voor het uitvoeren van experimenten op volledige cellen zoals bovenstaand en onderstaand beschreven, en/of op organismen zoals bijv. Caenorhabditis elegans (C. elegans), fruitvlieglarven of embryo's (Drosophila melanogaster), zebravislarven of embryo's (Danio rerio), en andere kleine metazoa organismen of enkelcellige organismen zoals bijv. Saccharomyces cerevisiae (gist), en andere schimmels of protozoa organismen, geplaatst in de kamers. De huidige openbaarmaking zal zich richten op Danio rerio en/of Drosophila melanogaster, maar er zij op gewezen dat waar Danio rerio of Drosophila melanogaster wordt genoemd andere kleine dieren kunnen worden gebruikt.The micro-flow system described here can be used to perform experiments on whole cells as described above and below, and / or on organisms such as, for example, Caenorhabditis elegans (C. elegans), fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio) rerio), and other small metazoa organisms or single-cell organisms such as, for example, Saccharomyces cerevisiae (yeast), and other fungi or protozoa organisms placed in the chambers. The current disclosure will focus on Danio rerio and / or Drosophila melanogaster, but it should be noted that where Danio rerio or Drosophila melanogaster is mentioned other small animals can be used.

Zo zijn bijvoorbeeld, genen die belangrijk zijn voor het metabolisme in zoogdieren zoals genen voor een insulinesignaleringspad, het EGFR-pad, het cholesterolpad, het LXR-pad, het LRP-pad en/of het galzuurpad aanwezig in Danio rerio. Zo kan bijvoorbeeld de veelheid aan Danio rerio een groot aantal wildtype of genetisch gemodificeerd of transgene Danio rerio omvatten. In een ander voorbeeld kan de veelheid aan zebravissen een groot aantal genetisch gemodificeerde of transgeen zebravissen omvatten met een transgen dat een promoter-reportersamenstelling is waarin de reporter een fluorescent of luminescent proteïne codeert en waarin de Promoter een promoter is van een zebravisgen geïnduceerd in respons op blootstelling aan een toxine of stress.For example, genes important for metabolism in mammals such as genes for an insulin signaling pathway, the EGFR pathway, the cholesterol pathway, the LXR pathway, the LRP pathway and / or the bile acid pathway are present in Danio rerio. For example, the plurality of Danio rerio can include a large number of wild-type or genetically modified or transgenic Danio rerio. In another example, the plurality of zebrafish may include a large number of genetically modified or transgenic zebrafish with a transgene that is a promoter-reporter composition wherein the reporter encodes a fluorescent or luminescent protein and wherein the Promoter is a promoter of a zebrafish induced in response to exposure to a toxin or stress.

De huidige uitvinding kan zich richten op methoden voor het muteren van een enkelvoudig gen of meerdere genen (bijv. twee of meer) in zebravis om mutante stammen te verkrijgen die een verhoogde permeabiliteit of biologische beschikbaarheid voor verbindingen vertonen. De huidige uitvinding beschouwt diverse methoden voor het creëren van mutaties in zebravis. In één uitvoeringsvorm is de mutatie een insertie- of invoegmutatie. In een andere uitvoeringsvorm is de mutatie een deletie- of verwijdermutatie. In een andere uitvoeringsvorm is de methode van mutatie het introduceren van een cassette of gen-trap door recombinatie. In een andere uitvoeringsvorm wordt een klein nucleïnezuursequentiemodificatie gecreëerd door middel van mutagenese, zoals door middel van het creëren van frameshifts, stopmutaties, substitutiemutaties, kleine insertiemutaties, kleine deletiemutaties, en dergelijke.The present invention can focus on methods for mutating a single gene or multiple genes (e.g., two or more) in zebrafish to obtain mutant strains that exhibit increased permeability or bioavailability for compounds. The present invention contemplates various methods for creating mutations in zebrafish. In one embodiment, the mutation is an insertion or insertion mutation. In another embodiment, the mutation is a deletion or deletion mutation. In another embodiment, the method of mutation is to introduce a cassette or gene trap by recombination. In another embodiment, a small nucleic acid sequence modification is created by mutagenesis, such as by creating frame shifts, stop mutations, substitution mutations, small insertion mutations, small deletion mutations, and the like.

Mutante stammen die verhoogde permeabiliteit vertonen voor verbindingen kunnen worden geïdentificeerd door parallel een zuivere voorwaartse EMS-mutagenese-iscreening en een kandidaatgebaseerde screening naar mutanten in genen die permeabiliteit kunnen verlenen uit te voeren, waaronder maar niet beperkt tot, meervoudig medicijnresistentieproteïnen, P-glycoproteïnen, ABC transport proteïnen, glycosyltransferases, nucleaire hormoonreceptoren, organische anion transporteurs en vetzuurtrans porteurs. De mutante stammen kunnen worden gescreend op permeabiliteitmutanten met behulp van een combinatie van fluorescentie-/luminescentietesten en toegankelijkheidstesten voor fluorescentie-/luminescentietesten en toegankelijkheidstesten voor verbindingen waarvan bekend is dat ze door wildtype zebravis worden buitengesloten (waaronder maar niet beperkt tot chloroquine, colchicine, nicotine, verapamil en andere calciumkanaal antagonisten, zware metalen, ivermectine). Enkelvoudige mutaties kunnen combinatoir worden gecombineerd en de resulterende stammen op een iteratieve wijze opnieuw gescreend op gezondheid en opname van verbindingen totdat de gewenste set mutaties aan het licht is gebracht. Warmtebepalingen omvatten maar zijn niet beperkt tot motiliteit, reproductie, propidiumjodideopname, levensduur en gedragsanalyses. De toegankelijkheid van kleine moleculen tot cellen en weefsel in de mutante stammen kan worden bepaald door luciferases op een weefselspecifieke manier tot expressie te brengen, vervolgens zebravis te voeden met luciferinecofactor en te screenen op luminescentie. De uitvinding biedt zo een panel van mutante stammen die in meer of mindere mate gevoelig zijn voor medicijnen voor wat betreft de niveaus van cel- en weefseltoegankelijkheid. Deze stammen kunnen exogene verbindingen toelaten die normalerwijze zouden worden buitengesloten van binnentreden van het lichaam door toegenomen intestinale of cuticulale permeabiliteit, verhoogd intestinaal transport van opgenomen moleculen, toegenomen faryngale pompwerking, verminderde functie van detoxificatie-enzymen of pompen of een combinatie van deze mechanismen of door een onbekend mechanisme. Deze bibliotheek kan stammen bevatten met een permeabiliteit die varieert per weefsel of die varieert afhankelijk van het chemotype van de exogene verbinding. Deze stammen vertonen verhoogde permeabiliteit voor verbindingen zonder een verhoogd achtergrondfenotype. Verhoogde permeabiliteit wordt bepaald in verschillende weefsels en celtypen door fluorescentie en luminescentieonderzoeken en door fenotypescreening op toegankelijkheid voor verbindingen waarvan bekend is dat ze door wildtype-stammen worden buitengesloten. Stammen in deze bibliotheek kunnen ook worden gemodificeerd om samenstellingen te bevatten voor weefselspecifieke, locatiespecifieke en/of ontwikkelings-istadiumspecifieke expressie van endogene of exogene humane proteïnen die kunnen omvat worden in plasmiden of direct geïntroduceerd worden door genoombewerking. Deze transgene stammen kunnen enkelvoudige of meervoudige kopieën van transgenen bevatten die humane proteïnen uitdrukken vertrekkende van extrachromasomale waaiers of in het genoom zijn geïntegreerd.Mutant strains that exhibit increased permeability to compounds can be identified by performing in parallel pure forward EMS mutagenesis screening and candidate-based screening for mutants in genes that can confer permeability, including but not limited to, multiple drug resistance proteins, P-glycoproteins, ABC transport proteins, glycosyl transferases, nuclear hormone receptors, organic anion transporters and fatty acid transporters. The mutant strains can be screened for permeability mutants using a combination of fluorescence / luminescence tests and accessibility tests for fluorescence / luminescence tests and accessibility tests for compounds known to be excluded by wild-type zebrafish (including but not limited to chloroquine, colchicine, nicotine , verapamil and other calcium channel antagonists, heavy metals, ivermectin). Single mutations can be combined combinatorically and the resulting strains re-screened in an iterative manner for health and uptake of compounds until the desired set of mutations is revealed. Heat determinations include but are not limited to motility, reproduction, propidium iodide uptake, lifespan, and behavioral analyzes. The accessibility of small molecules to cells and tissue in the mutant strains can be determined by expressing luciferases in a tissue-specific manner, then feeding zebrafish with luciferin co-factor and screening for luminescence. The invention thus provides a panel of mutant strains that are more or less susceptible to drugs with regard to the levels of cell and tissue accessibility. These strains may permit exogenous compounds that would normally be excluded from entry into the body due to increased intestinal or cuticular permeability, increased intestinal transport of incorporated molecules, increased pharyngeal pumping action, decreased function of detoxification enzymes or pumps or a combination of these mechanisms or by an unknown mechanism. This library can contain strains with a permeability that varies per tissue or that varies depending on the chemotype of the exogenous compound. These strains exhibit increased permeability for compounds without an increased background phenotype. Increased permeability is determined in various tissues and cell types by fluorescence and luminescence studies and by phenotype screening for accessibility for compounds known to be excluded by wild-type strains. Strains in this library can also be modified to contain compositions for tissue-specific, location-specific and / or developmental-stage-specific expression of endogenous or exogenous human proteins that can be included in plasmids or introduced directly by genome processing. These transgenic strains may contain single or multiple copies of transgenes expressing human proteins from extrachromasomal ranges or integrated into the genome.

De geselecteerde dieren kunnen worden gesorteerd en verstrekt met behulp van één van de bekende methoden of het microstromingssysteem kan worden gebruikt om de dieren te sorteren en ze naar de juiste kamer te verplaatsen. Bij voorkeur kan met de geselecteerde methode voor het sorteren/toedienen, efficiënte distributie in de kamers plaatsvinden van C. elegans, Danio rerio embryo's of Drosophila melanogaster en kunnen afzonderlijke organismen snel worden gedeponeerd. Verder kan ieder organisme optisch worden geanalyseerd zodat alleen gewenste organismen met bepaalde vooraf bepaalde biologische kenmerken worden gedeponeerd. Hierdoor wordt het mogelijk identiek gefaseerde organismen te selecteren, hetgeen de uniformiteit van de testprocedure aanzienlijk vergroot. Iedere van de bekende sorteer verwerkingsmethoden en in de handel verkrijgbare apparatuur kan worden gebruikt.The selected animals can be sorted and supplied using one of the known methods or the micro-flow system can be used to sort the animals and move them to the correct room. Preferably, with the selected sorting / administration method, efficient distribution can take place in the chambers of C. elegans, Danio rerio embryos or Drosophila melanogaster and individual organisms can be quickly deposited. Furthermore, each organism can be optically analyzed so that only desired organisms with certain predetermined biological characteristics are deposited. This makes it possible to select identically phased organisms, which considerably increases the uniformity of the test procedure. Any of the known sorting processing methods and commercially available equipment can be used.

De transgene dieren kunnen een label dragen om detectie ervan te vergemakkelijken. In sommige uitvoeringsvormen kan dit een fluorescent label zijn. Ieder dier kan een ander fluorescent label dragen. Het detecteerbare label hoeft echter geen fluorescent maar kan ieder label zijn. Een methode voor het detecteren van het fluorescente label bestaat uit het gebruik van straling met een golflengte specifiek voor het label of het gebruik van andere geschikte verlichtingsbronnen. De fluorescentie van het label kan worden gedetecteerd door een ccd-camera of andere geschikte detectiemethode.The transgenic animals can carry a label to facilitate detection thereof. In some embodiments, this can be a fluorescent label. Every animal can bear a different fluorescent label. However, the detectable label does not have to be fluorescent but can be any label. A method for detecting the fluorescent label consists of the use of radiation with a wavelength specific to the label or the use of other suitable lighting sources. The fluorescence of the label can be detected by a CCD camera or other suitable detection method.

De microstromingssystemen en -methoden die hier worden voorzien kunnen voordeel hebben bij robotsystemen en apparatuur voor het opslaan en verplaatsen van deze microstromingsmodules als kamers voor robotsystemen voor het snel toedienen van vloeistoffen in en uit de platen. Door combineren van een geautomatiseerd microstromingsplatform voor het onderhouden, hanteren en testen van organismen met een bibliotheek van synthetische mutanten met een diversiviteit aan permeabiliteitseigenschappen en selectiviteit kan dit systeem het met hoge doorvoercapaciteit screenen van verbindingen op intacte organismen mogelijk maken.The micro-flow systems and methods provided here can be advantageous with robotic systems and equipment for storing and moving these micro-flow modules as chambers for robotic systems for rapidly delivering liquids into and out of the plates. By combining an automated micro-flow platform for maintaining, handling and testing organisms with a library of synthetic mutants with a diversity of permeability properties and selectivity, this system can make it possible to screen compounds with high throughput for intact organisms.

Het robotsysteem omvat programmeerbare robotarmmanipulators voor het installeren, verwijderen en configureren van modules van de microstromingsmodule opstelling. Als ze op hun plaats worden geklikt sluiten de modules nauw aan op andere modules om zo afgedichte microstromingsinterfaces te vormen. Deze interfaces kunnen vast worden gedrukt of zijn bevestigd met mechanische lippen of pennen. Modules kunnen ook worden aangestuurd en in werking gezet door vloeistof, elektrische, magnetische, thermische en mechanische interactie met een actieve bedienings matrix onder het vlak van de moduleopstelling. Deze bedieningsmatrix kan elektrische verbindingen, analoog-digitale interfaces en magnetische en mechanische actuators bevatten, alsmede thermokoppels en vloeistofkoppelingen, en ook uitlaatpoorten voor het verwijderen van vloeibaar en corpusculair afval uit de microstromingsopstelling. De bedieningsmatrix en robotica kunnen worden verbonden met computers voor een softwarematig programmeerbare realtime bediening. Daarbij kunnen de manipulators externe apparatuur zoals videocamera's en externe apparaten van derden mechanisch manipuleren en bedienen zonder menselijke interventie. Het robotsysteem kan worden aangestuurd met een programmeerbaar software pakket met een interface voor het programmeren van applicaties waardoor deze kan worden gebruikt in combinatie met bestaande softwareprogrammeertalen zoals C, C++, Visual Basic, Python, en MATLAB, alsmede eigen en open source roboticabedieningssoftware.The robotic system includes programmable robotic arm manipulators for installing, removing, and configuring modules of the micro-flow module arrangement. When they are clicked into place, the modules connect closely to other modules to form sealed micro-flow interfaces. These interfaces can be fixed or attached with mechanical lips or pins. Modules can also be controlled and triggered by fluid, electrical, magnetic, thermal and mechanical interaction with an active control matrix below the plane of the module arrangement. This control matrix can contain electrical connections, analog-digital interfaces and magnetic and mechanical actuators, as well as thermocouples and fluid couplings, as well as outlet ports for removing liquid and particulate waste from the micro-flow arrangement. The control matrix and robotics can be connected to computers for software-programmable real-time operation. In addition, the manipulators can mechanically manipulate and operate external equipment such as video cameras and external devices from third parties without human intervention. The robotic system can be controlled with a programmable software package with an application programming interface allowing it to be used in combination with existing software programming languages such as C, C ++, Visual Basic, Python, and MATLAB, as well as proprietary and open source robotic control software.

Het robotsysteem kan worden gemonitord door middel van video monitoring, laser-/optische sensors, alsmede mechanische, temperatuur en chemische sensors.The robot system can be monitored by means of video monitoring, laser / optical sensors, as well as mechanical, temperature and chemical sensors.

Met meerkleurige fluorescentie kunnen meerdere doelen en celprocessen op één enkel scherm worden getoetst. Kruiscorrelatie van cellulaire responses zullen een schat aan informatie geven die nodig is voor het valideren van doelen en optimalisatie van een lead.With multi-colored fluorescence, multiple targets and cell processes can be tested on a single screen. Cross-correlation of cellular responses will provide a wealth of information needed to validate goals and optimize a lead.

De huidige uitvinding biedt een methode voor het analyseren van volledige dieren omvattende een waaier van locaties die meerdere dieren bevatten waarin de dieren één of meerdere fluorescente reporter moleculen bevatten; scannen van meerdere dieren op iedere locatie om fluorescentiesignalen te verkrijgen van de fluorescente reportermoleculen in de dieren; omzetten van de fluorescente signalen in digitale data; en het benutten van de digitale data om de verdeling, de omgeving of de activiteit van de fluorescente reportermoleculen binnenin de dieren te bepalen. In een ander aspect, biedt de onderhavige uitvindng een methode voor het analyseren van volledige dieren omvattende het bieden van een locatie waarin zich een dier bevindt waarin het dier optioneel een of meerdere reportermoleculen kan bevatten; het dier in contact brengen met een bibliotheek van verbindingen; scannen van het dier op meerdere locaties waarin ieder locatie een ander detectiesysteem bevat; het verkrijgen van detectie signalen en het omzetten van de signalen naar digitale data; en het benutten van de digitale data om de verdeling, de omgeving of de activiteit van de reportermoleculen binnenin de dieren te bepalen.The present invention provides a method for analyzing whole animals comprising a range of locations containing multiple animals in which the animals contain one or more fluorescent reporter molecules; scanning multiple animals at each location to obtain fluorescence signals from the fluorescent reporter molecules in the animals; converting the fluorescent signals into digital data; and utilizing the digital data to determine the distribution, environment, or activity of the fluorescent reporter molecules within the animals. In another aspect, the present invention provides a method for analyzing whole animals comprising providing a location in which there is an animal in which the animal may optionally contain one or more reporter molecules; bringing the animal into contact with a library of compounds; scanning the animal at multiple locations in which each location contains a different detection system; obtaining detection signals and converting the signals to digital data; and utilizing the digital data to determine the distribution, environment, or activity of the reporter molecules within the animals.

Als voorbeeld kan de Drosophila melanogaster of een zebravisembryo in de kamer worden geplaatst door een robothanteerder. Het dier kan vrij in de vloeistof in de kamer liggen, kan zijn ingebed in agarose met een laag smeltpunt, of iedere andere substantie die het dier kan immobiliseren maar het niet beschadigt of gas-/nutriëntuitwisseling verhindert. Iedere kamer zal een constante toevoer hebben van een bepaalde buffer die door zijn microstromingsinlaatkanalen stroomt. Bovendien kunnen medicijnen aan de dieren in de kamer worden toegediend door of de microstromingskanalen te gebruiken of met behulp van robotpipet-handlers via een schuifdeksel, dat van plastic of glas kan zijn en kan worden teruggetrokken om de opening in de kamer toegankelijk te maken voor injectie.As an example, the Drosophila melanogaster or a zebrafish embryo can be placed in the room by a robotizer. The animal may lie freely in the fluid in the chamber, may be embedded in low melting point agarose, or any other substance that can immobilize the animal but does not damage it or prevent gas / nutrient exchange. Each chamber will have a constant supply of a certain buffer that flows through its micro-flow inlet channels. In addition, medications can be administered to the animals in the room by either using the micro-flow channels or by using robot pipet handlers through a sliding lid, which can be plastic or glass and can be withdrawn to make the opening in the room accessible for injection .

In sommige aspecten van de uitvinding kan het hier beschreven microstromingssysteem een deksel hebben met een vorm die de openingen van de kamers in het bovenste oppervlak van het substraat afdekt. Het deksel kan een schuifdeksel zijn zodanig dat wanneer het schuifdeksel zich in geopende stand bevindt, het een opening tot de kamers biedt waardoor dieren kunnen worden geplaatst voorafgaand aan de start van het experiment en/of medicijnen tijdens het experiment naar binnen kunnen worden gebracht. Het deksel kan vervolgens terug worden geschoven naar een dichte stand tijdens het experiment. In een andere aspect van de uitvinding kan het deksel de kamer afdichten en efficiënte stroming van microstroming in de kamer mogelijk maken. De stroming van microstroming kan door een robot worden geregeld en kan worden gebruikt om het dier te onderhouden door levering van de juiste nutriënten, verwijderen van afvalstoffen en het leveren van de te testen verbinding of bibliotheek van verbindingen aan de dieren in de kamers.In some aspects of the invention, the micro-flow system described herein may have a lid having a shape that covers the openings of the chambers in the upper surface of the substrate. The lid can be a sliding lid such that when the sliding lid is in the open position, it provides an opening to the chambers through which animals can be placed prior to the start of the experiment and / or medication can be brought in during the experiment. The lid can then be pushed back to a closed position during the experiment. In another aspect of the invention, the cover can seal the chamber and allow efficient micro-flow in the chamber. The flow of micro-flow can be controlled by a robot and can be used to maintain the animal by supplying the correct nutrients, removing waste and supplying the test compound or library of compounds to the animals in the rooms.

In preferente uitvoeringsvormen biedt de test een methode voor het kwantificeren van een interactie tussen specifieke biomoleculen in een biologisch monster, bijvoorbeeld, een volledig dier of een cel. Beter nog zijn de genoemde interacties tussen een KH-domein bindend microRNA en een KH-bevattend proteïne. In een aspect, biedt de uitvinding een methode voor het screenen van candidaat verbindingen voor de behandeling of preventie van een hersentumor of een neurodegeneratie door een volledig dier of een cel in contact te brengen met een kandidaat therapeutisch agens en de effecten te meten die de verbinding heeft op het dier of de cel. De verbinding kan vervolgens verder worden bestudeerd op mogelijke therapeutische effecten. In bepaalde preferente uitvoeringsvormen wordt de screening uitgevoerd door middel van hoge-doorvoercapaciteit-screening waarmee op hetzelfde moment simultane diagnoses kunnen worden gesteld.In preferred embodiments, the test provides a method for quantifying an interaction between specific biomolecules in a biological sample, for example, an entire animal or a cell. Even better are the mentioned interactions between a KH domain binding microRNA and a KH-containing protein. In one aspect, the invention provides a method for screening candidate compounds for the treatment or prevention of a brain tumor or neurodegeneration by bringing an entire animal or cell into contact with a candidate therapeutic agent and measuring the effects that the compound on the animal or cell. The compound can then be further studied for possible therapeutic effects. In certain preferred embodiments, the screening is performed by means of high throughput screening with which simultaneous diagnoses can be made at the same time.

De testen bieden een methode voor het diagnosticeren van een ziekte of stoornis die bestaat uit het screenen van een biologisch monster van een patiënt voorhet identificeren en/of kwantificeren van een marker of molecuul dat kenmerkend is voor de specifieke ziekte of stoornis. Bijvoorbeeld een KH-domein bindend microRNA, een KH-bevattend proteïne en dergelijke. In een ander aspect, biedt de uitvinding een methode voor het identificeren van subjecten die risico lopen op het ontwikkelen van een ziekte of stoornis, bestaande uit het screenen van een biologisch monster van een patiënt en het identificeren en/of kwantificeren van een marker of molecuul, kenmerkend voor de specifieke ziekte of stoornis.The tests provide a method for diagnosing a disease or disorder that consists of screening a biological sample from a patient to identify and / or quantify a marker or molecule characteristic of the specific disease or disorder. For example, a KH domain binding microRNA, a KH-containing protein, and the like. In another aspect, the invention provides a method for identifying subjects at risk of developing a disease or disorder, consisting of screening a patient's biological sample and identifying and / or quantifying a marker or molecule , characteristic of the specific disease or disorder.

De methode kan ook het effect van een verbinding op het gedrag van dieren evalueren. De methode bestaat uit het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven die wórdt geplaatst binnenin een kamer van een microstromingsapparaat van de uitvinding, waarbij het door de mutant vertoonde gedrag wordt geobserveerd en vergeleken met dat van een wildtype dier, waarin de waargenomen verschillen in gedrag in verband staan met de testverbinding. Zoals een vakkundige zal herkennen, kunnen kwantitatieve analyses op de gemeten gedragsparameters worden uitgevoerd om gedragsveranderingen te detecteren die zijn geïnduceerd door de verbinding. Het opkweken van de dieren, toedienen van de testverbindingen, observeren van het gedrag van de dieren en vergelijken van de verschillen in gedrag kunnen worden uitgevoerd met bovenstaand beschreven robotsystemen.The method can also evaluate the effect of a compound on animal behavior. The method consists in administering a test compound to a mutant as described above which is placed inside a chamber of a micro-flow apparatus of the invention, observing and mutating the behavior exhibited by the mutant with that of a wild-type animal in which the observed differences differ be in behavior related to the test compound. As one skilled in the art will recognize, quantitative analyzes can be performed on the measured behavioral parameters to detect behavioral changes induced by the compound. Breeding the animals, administering the test compounds, observing the behavior of the animals and comparing the differences in behavior can be performed with the robot systems described above.

De uitvinding biedt ook een methode voor het evalueren van het effect van een verbinding op de neurale activiteit van dieren. De methode biedt het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven, het observeren van de neurale activiteit die de mutant vertoont en het vergelijken van de waargenomen neurale activiteit met die van een wildtype dier, waarin de verschillen in neurale activiteit worden in verband gebracht met de testverbinding. De neurale activiteit kan worden gemeten door middel van een genetisch gecodeerde indicator in één of meerdere neuronen om te zien hoe de gehele neurale activiteit door de verbindingen wordt beïnvloed. In een ander aspect, kan de neurale activiteit worden gemeten in respons tot een gedrags stimulus, zoals bijvoorbeeld, uithongering, honger of presentatie van voedsel en dergelijke. In een ander aspect kan neurale ontwikkeling worden gemeten.The invention also provides a method for evaluating the effect of a compound on the neural activity of animals. The method provides administering a test compound to a mutant as described above, observing the neural activity that the mutant exhibits and comparing the observed neural activity with that of a wild-type animal, in which the differences in neural activity are associated with the test compound. Neural activity can be measured by a genetically coded indicator in one or more neurons to see how the entire neural activity is affected by the connections. In another aspect, neural activity can be measured in response to a behavioral stimulus, such as, for example, starvation, hunger or presentation of food and the like. Neural development can be measured in another aspect.

In een ander aspect biedt de uitvinding een methode voor het evalueren van het degeneratieve effect van een verbinding. De method bestaat uit het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven, het waarnemen van het door de mutant vertoonde gedrag en vergelijken van het waargenomen gedrag met dat van een wildtype dier, waarin de waargenomen verschillen in gedrag in verband worden gebracht met de testverbinding. Het te observeren gedrag omvat maar is niet beperkt tot wijzigingen in de bewegingen van het wildtype en de mutant, veranderingen in snelheid van ademhalen, veranderingen in de levensduur van het wildtype en de mutant, veranderingen in de bewegingsontwikkeling van het wildtype en de mutant, wijzigingen in de senescentie van het wildtype en de mutant.In another aspect, the invention provides a method for evaluating the degenerative effect of a compound. The method consists of administering a test compound to a mutant as described above, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal, in which the observed differences in behavior are associated with the test compound. The behavior to be observed includes but is not limited to changes in the movements of the wild type and the mutant, changes in the rate of breathing, changes in the lifespan of the wild type and the mutant, changes in the movement development of the wild type and the mutant, changes in the senescence of the wild type and the mutant.

In sommige aspecten van de uitvinding kan het hier beschreven microstromingssysteem een deksel hebben met een vorm die de openingen van de kamers in het bovenste oppervlak van het substraat afdekt. Het deksel kan een schuifdeksel zijn zodanig dat wanneer het schuifdeksel zich in geopende stand bevindt, het een opening tot de kamers biedt waardoor voorafgaand aan de start van het experiment dieren kunnen worden geplaatst en/of medicijnen kunnen worden geïntroduceerd tijdens het experiment. Het deksel kan vervolgens terug worden geschoven naar een dichte stand tijdens het experiment. In een andere aspect van de uitvinding kan het deksel de kamer afdichten en efficiënte stroming van microstroming in de kamer mogelijk maken. De microstroming kan door een robot worden geregeld en worden gebruikt om de dieren in leven te houden door aanleveren van de juiste nutriënten, afvalstoffen te verwijderen, en voor het leveren van de testverbinding of bibliotheek van verbindingen aan dieren in de kamers.In some aspects of the invention, the micro-flow system described herein may have a lid having a shape that covers the openings of the chambers in the upper surface of the substrate. The lid can be a sliding lid such that when the sliding lid is in the open position, it provides an opening to the chambers through which animals and / or drugs can be introduced during the experiment prior to the start of the experiment. The lid can then be pushed back to a closed position during the experiment. In another aspect of the invention, the cover can seal the chamber and allow efficient micro-flow in the chamber. The micro-flow can be controlled by a robot and used to keep the animals alive by supplying the right nutrients, removing waste, and delivering the test compound or library of compounds to animals in the chambers.

In preferente uitvoeringsvormen biedt de test een methode voor het kwantificeren van een interactie tussen specifieke biomoleculen in een biologisch monster, bijvoorbeeld, een volledig dier of een cel.In preferred embodiments, the test provides a method for quantifying an interaction between specific biomolecules in a biological sample, for example, an entire animal or a cell.

Nog beter zijn voornoemde interacties tussen een KH-domein bindend microRNA en een KH-domein bevattend proteïne. In één aspect biedt de uitvinding een methode voor het screenen van kandidaatverbindingen voor de behandeling of preventie van een hersentumor of een neurodegeneratie door een volledig dier of een cel in contact te brengen met een kandidaat therapeutisch agens en de effecten te meten die de verbinding heeft op het dier of de cel. De verbinding kan vervolgens verder worden bestudeerd op mogelijke therapeutisch effecten. In bepaalde preferente uitvoeringsvormen wordt de screening uitgevoerd door middel van hoge-doorvoercapaciteit-screening waardoor op hetzelfde moment simultane diagnoses kunnen worden gesteld.Even better are the aforementioned interactions between a KH domain binding microRNA and a KH domain containing protein. In one aspect, the invention provides a method for screening candidate compounds for the treatment or prevention of a brain tumor or neurodegeneration by bringing an entire animal or cell into contact with a candidate therapeutic agent and measuring the effects that the compound has on the animal or cell. The compound can then be further studied for possible therapeutic effects. In certain preferred embodiments, the screening is performed by means of high throughput screening whereby simultaneous diagnoses can be made at the same time.

De test biedt een methode voor het diagnosticeren van een ziekte of stoornis die bestaat uit het screenen van een biologisch monster van een patiënt om een marker en/of kenmerkend molecuul van de bepaalde ziekte of stoornis te identificeren en/of te kwantificeren. Bijvoorbeeld een KH-domein bindend microRNA, een KH-bevattend proteïne en dergelijke. In een andere aspect, biedt de uitvinding een methode voor het identificeren van subjecten die risico lopen op het ontwikkelen van een ziekte of stoornis bestaande uit het screenen van een biologisch monster van een patiënt en het identificeren en/of kwantificeren van een marker of molecuul, kenmerkend voor de specifieke ziekte of stoornis.The test provides a method for diagnosing a disease or disorder that consists of screening a biological sample from a patient to identify and / or quantify a marker and / or characteristic molecule of the particular disease or disorder. For example, a KH domain binding microRNA, a KH-containing protein, and the like. In another aspect, the invention provides a method for identifying subjects at risk of developing a disease or disorder consisting of screening a patient's biological sample and identifying and / or quantifying a marker or molecule, characteristic of the specific disease or disorder.

De methode kan ook het effect van een verbinding op het gedrag van dieren evalueren. De methode biedt het toedienen van een testverbinding aan een mutant, zoals bovenstaand beschreven, die is geplaatst binnenin een kamer van het microstromingsapparaat van de uitvinding, het observeren van het gedrag vertoond door de mutant en het vergelijken van het waargenomen gedrag met dat van een wildtype dier, waarin de waargenomen verschillen in gedrag in verband worden gebracht met de testverbinding. Zoals een vakkundige zal herkennen, kunnen kwantitatieve analyses op de gemeten gedragsparameters worden uitgevoerd om gedragsveranderingen te detecteren die zijn geïnduceerd door de verbinding. Het opkweken van de dieren, het toedienen van de testverbindingen, het observeren van het gedrag van dieren en het vergelijken van de verschillen in gedrag kunnen worden uitgevoerd met bovenstaand beschreven robotsystemen.The method can also evaluate the effect of a compound on animal behavior. The method provides administering a test compound to a mutant, as described above, that is placed inside a chamber of the micro-flow apparatus of the invention, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal in which the observed differences in behavior are associated with the test compound. As one skilled in the art will recognize, quantitative analyzes can be performed on the measured behavioral parameters to detect behavioral changes induced by the compound. Breeding the animals, administering the test compounds, observing the behavior of animals and comparing the differences in behavior can be performed with the robot systems described above.

De uitvinding biedt ook een methode voor het evalueren van het effect van een verbinding op de neurale activiteit van de dieren. De method biedt het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven, het waarnemen van de neurale activiteit die de mutant vertoond en vergelijken van de waargenomen neurale activitet met dat van een wildtype dier, waarin de waargenomen verschillen in neurale activiteit in verband worden gebracht met de testverbinding. De neurale activiteit kan worden gemeten door het gebruiken van een genetisch gecodeerde indicator in een of meerdere neuronen om te zien hoe de gehele neurale activiteit door verbindingen wordt beïnvloed. In een andere aspect kan de neurale activiteit worden gemeten in respons tot een gedragstimulus, zoals bijvoorbeeld, uithongering, honger of het presenteren van voedsel en dergelijke. In een ander aspect kan neurale ontwikkeling worden gemeten.The invention also provides a method for evaluating the effect of a compound on the neural activity of the animals. The method provides administering a test compound to a mutant as described above, observing the neural activity that the mutant shows and comparing the observed neural activity with that of a wild-type animal, in which the observed differences in neural activity are associated with the test compound. Neural activity can be measured by using a genetically coded indicator in one or more neurons to see how the entire neural activity is affected by connections. In another aspect, neural activity can be measured in response to a behavioral stimulus, such as, for example, starvation, hunger, or presenting food and the like. Neural development can be measured in another aspect.

In een ander aspect biedt de uitvinding een methode voor het evalueren van het degeneratieve effect van een verbinding. De methode biedt het toedienen van een testverbinding aan een mutant, zoals bovenstaand beschreven, het observeren van het gedrag vertoond door de mutant en het vergelijken van het waargenomen gedrag met dat van een wildtype dier waarin de waargenomen verschillen in gedrag in verband worden gebracht met de testverbinding. Het te observeren gedrag omvat maar is niet beperkt tot wijzigingen in de bewegingen van het wildtype en de mutant, veranderingen in snelheid van ademhalen, wijzigingen in de levensduur van het wildtype en de mutant, veranderingen in de bewegingsontwikkeling van het wildtype en de mutant, wijzigingen in de senescentie van het wildtype en de mutant.In another aspect, the invention provides a method for evaluating the degenerative effect of a compound. The method provides administering a test compound to a mutant as described above, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal in which the observed differences in behavior are associated with the mutant test compound. The behavior to be observed includes but is not limited to changes in the movements of the wild type and the mutant, changes in the rate of breathing, changes in the lifespan of the wild type and the mutant, changes in the movement development of the wild type and the mutant, changes in the senescence of the wild type and the mutant.

Het microstromingsapparaat kan een substraat bevatten. Het substraat kan rechthoekig zijn, circelvormig, ovaal of iedere andere vorm hebben. Het substraat kan zijn gemaakt van een geschikt materiaal dat wordt geselecteerd vanwege zijn eigenschappen, zoals goed thermisch geleidingsvermogen, oppervlakte-eigenschappen die uniforme coating en stabiliteit van het reagens mogelijk maken en neutraliteit ten opzichte van het vloeibare medium om interferentie met de test te voorkomen. Voor dit doel geschikt materiaal voor een stevige ondergrond is onder andere flexibel polymeer zoals polydimethylsiloxaan, hardere polymeren, glas, metaal, hydrogel, siliconen, PETG, polyester, polycarbonaat, pvc, polystyreen, SAN, acrylonitrilbutadieenstyreen (ABS), en combinaties en hybriden hiervan, en omvat kralen, membranen, microtiterkuipjes, strings, plastic, strips, of ieder oppervlak waarop volledige organismen kunnen worden geplaatst of geïmmobiliseerd. Alternatief en gelijkwaardig, kan een in de handel verkrijgbare gegoten vaste ondergrond worden gebruikt bij het in de praktijk brengen van de uitvinding.The micro-flow device can contain a substrate. The substrate can be rectangular, circular, oval or any other shape. The substrate can be made of a suitable material selected for its properties, such as good thermal conductivity, surface properties that allow uniform coating and stability of the reagent, and neutrality to the liquid medium to prevent interference with the test. Suitable materials for a solid substrate for this purpose include flexible polymer such as polydimethylsiloxane, harder polymers, glass, metal, hydrogel, silicone, PETG, polyester, polycarbonate, PVC, polystyrene, SAN, acrylonitrile butadiene styrene (ABS), and combinations and hybrids thereof and includes beads, membranes, microtitre tubs, strings, plastic, strips, or any surface on which entire organisms can be placed or immobilized. Alternatively and equivalent, a commercially available molded solid substrate can be used in practicing the invention.

Iedere microstromingmodule kan een of meerdere poorten onder negatieve druk (vacuüm) of positieve druk bevatten om de bewegingskracht te leveren aan vloeistoffen, of andere manieren voor het verplaatsen van de vloeistoffen alsmede drukoverbrengende poorten voor het aansturen van de on-chipventielen.Each micro-flow module can contain one or more ports under negative pressure (vacuum) or positive pressure to provide the movement force to liquids, or other ways of moving the liquids, as well as pressure-transmitting ports for controlling the on-chip valves.

Grote dieren waaronder de embryo's en larven van de zebravis kunnen afmetingen hebben in de orde van een aantal millimeter. Om kamers te creëren met deze afmetingen, kunnen kanalen in een stijf substraat worden uitgefreesd met een freesmachine of een lasersnijder. Voor gebieden die vragen om ronde kanalen, waaronder secties die microstromingsventielen bevatten, kan een bolfrees [ball end mill] met een ronde top worden gebruikt.Large animals including the zebrafish embryos and larvae can have dimensions in the order of a few millimeters. To create chambers with these dimensions, channels in a rigid substrate can be milled out with a milling machine or a laser cutter. For areas that require circular ducts, including sections that contain micro-flow valves, a ball end mill with a round tip can be used.

Het zal worden gewaardeerd dat in de praktijk een microstromingsapparaatmodule 32 kamers, 96 kamers, 869 kamers, of ieder ander aantal kamers kan bevatten dat nodig is. In een ander aspect van de uitvinding, bestaat het microstromingsapparaat uit een set microstromingsapparaatmodules, die meestal bestaan uit een constructie van enkelvoudige of multilaags polymeerchips, met een gemeenschappelijke interface van fysieke onderlinge verbindingen, waarmee iedere twee modules met elkaar kunnen worden verbonden. Meerdere chips kunnen binnen een groter frame met elkaar worden verbonden om een universeel microstromingsmilieu te creëren. Het frame kan vlak zijn zodat apparaten met een vierkante of rechthoekige vorm een plaats kunnen krijgen of het kan driedimensionaal zijn zodat rechthoekige, prisma- of kubusvormen mogelijk zijn. De fysische interface tussen de modules kan eenvoudig bestaan uit aangrenzende vlakken of deze kan bestaan uit mannetje/vrouwtje-steekverbindingen analoog aan een chipsocket op een elektronische printplaat, messing-en-groefverbindingen en of andere koppelings configuraties of bevestigingsmethoden.It will be appreciated that in practice a micro-flow device module may contain 32 chambers, 96 chambers, 869 chambers, or any other number of chambers required. In another aspect of the invention, the micro-flow device consists of a set of micro-flow device modules, which usually consist of a structure of single or multi-layer polymer chips, with a common interface of physical interconnections, with which any two modules can be connected to each other. Multiple chips can be connected within a larger frame to create a universal micro-flow environment. The frame can be flat so that devices with a square or rectangular shape can have a place or it can be three-dimensional so that rectangular, prism or cube shapes are possible. The physical interface between the modules can simply consist of adjacent faces or it can consist of male / female plug connections analogous to a chip socket on an electronic printed circuit board, tongue and groove connections and or other coupling configurations or mounting methods.

Door gecoördineerd schakelen van on-chip-ventielen, kunnen dieren worden verplaatst naar andere gedeelten van een apparaat alsmede tussen verbonden apparaten. Door gecoördineerd schakelen van on-chip of off-chip ventielen, kunnen vloeistoffen of dieren worden verplaatst voor het aanleveren van testverbindingen of reagentia, alsook voor het verzamelen van vloeistoffen, weefsel en metabolieten voor analyse.By coordinated switching of on-chip valves, animals can be moved to other parts of a device as well as between connected devices. By coordinated switching of on-chip or off-chip valves, liquids or animals can be moved to provide test compounds or reagents, as well as to collect liquids, tissue, and metabolites for analysis.

In één aspect van de uitvinding kunnen nader genoemde microstromingsmodules worden ontworpen om geometrische uitlijning of fysieke koppeling met apparaten van derden mogelijk te maken, zoals microscoopobjectdragers of objectieven om beeldopnamen te kunnen maken.In one aspect of the invention, specified micro-flow modules can be designed to allow for geometric alignment or physical coupling with third-party devices, such as microscope object carriers or lenses to enable image recording.

Microstromingsmodules kunnen worden ontworpen om een interface met andere apparaten van derden zoals complexe objectsorteerders zoals COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers zoals FACS (Fluorescence Activated Cell Sorter), lasers, irradiators aan te gaan en andere detectiesystemen kunnen gelijksoortige microstromingsmodules hebben om een interface met het systeem aan te gaan.Micro flow modules can be designed to interface with other third party devices such as complex object sorters such as COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers such as FACS (Fluorescence Activated Cell Sorter), lasers, irradiators and other detection systems can be similar have micro-flow modules to interface with the system.

Een voorbeeld van een detectsysteem voor geautomatiseerde detectie voor gebruik met de huidige uitvinding en geassocieerde methoden bestaan uit een excitatiebron, een monochromator (of ieder ander apparaat dat lichtcomponenten spectraal kan ontbinden, of een set smallebandfilters) en een detectorpakket. De excitatiebron kan bestaan uit infrarode, blauwe of UV-golflengtes en de excitatiegolflengte kan korter zijn dan te detecteren emissiegolflengte(s). Het detectie systeem kan zijn: een breedband UV-lichtbron, zoals een deuteriumlamp met een filter ervoor; het licht van een witte lichtbron zoals een xenonlamp of een deuteriumlamp nadat dit door een monochromator is gegaan om de gewenste golflengtes te extraheren; of ieder andere van een aantal 'continuous wave' (cw) gaslasers, waaronder, maar niet beperkt tot alle Argon-ionlaserlijnen (457, 488, 514, etc. nm) of een HeCd-laser; vastestof-diodelasers in het blauw zoals GaN en GaAs (verdubbeld) gebaseerde lasers of de verdubbelde of verdrievoudigde output van op YAG of YLF gebaseerde lasers; of iedere pulslaser die blauw licht uitzendt.An example of an automated detection system for use with the present invention and associated methods consists of an excitation source, a monochromator (or any other device that can spectrally decompose light components, or a set of narrow-band filters) and a detector package. The excitation source can consist of infrared, blue or UV wavelengths and the excitation wavelength can be shorter than the emission wavelength (s) to be detected. The detection system can be: a broadband UV light source, such as a deuterium lamp with a filter in front; the light from a white light source such as a xenon lamp or a deuterium lamp after it has passed through a monochromator to extract the desired wavelengths; or any other of a number of 'continuous wave' (cw) gas lasers, including but not limited to all Argon ion laser lines (457, 488, 514, etc. nm) or a HeCd laser; solid state diode lasers such as GaN and GaAs (doubled) based lasers or the doubled or tripled output of YAG or YLF based lasers; or any pulse laser that emits blue light.

Het door het organisme, het monster of de reagentia in de kamer uitgezonden licht kan worden gedetecteerd met een apparaat dat spectraalgegevens levert over het substraat, bijv. een traliespectrometer, prisma spectrometer, beeldopnamespectrometer, of iets dergelijks, of gebruik maakt van interferentiebandfilters. Door gebruik te maken van tweedimensionale gebiedsopname zoals een ccd-camera, kunnen veel objecten tegelijkertijd op beeld worden gezet. Spectrale gegevens kunnen worden gegenereerd door het verzamelen van meer dan een beeld via verschillende bandfilters, filters die lange of korte golven doorlaten (interferentiefilter of elektronisch instelbare filters zijn geschikt). Meer dan één beeldopnameapparaat kan worden gebruikt om simultaan data te verzamelen door middel van speciale filters, of de filter aangebracht voor een enkelvoudig opnameapparaat kan worden verwisseld. Op beeldopname gebaseerde systemen, zoals het Biometrie Imaging systeem, scannen een oppervlakte om fluorescentiesignalen te vinden.The light emitted by the organism, sample, or reagents into the chamber can be detected with an apparatus that provides spectral data on the substrate, e.g., a grating spectrometer, prism spectrometer, image pickup spectrometer, or the like, or uses interference band filters. By using two-dimensional area recording such as a CCD camera, many objects can be displayed simultaneously. Spectral data can be generated by collecting more than one image via different band filters, filters that transmit long or short waves (interference filter or electronically adjustable filters are suitable). More than one image recording device can be used to collect data simultaneously by means of special filters, or the filter arranged for a single recording device can be exchanged. Image-based systems, such as the Biometrics Imaging system, scan a surface to find fluorescence signals.

Het hier beschreven microstromingssysteem kan gebruikt worden voor het uitvoeren van experimenten op volledige cellen zoals bovenstaand en onderstaand beschreven, en/of op organismen zoals bijv. Caenorhabditis elegans (C. elegans), fruitvlieg larven of embryo's (Drosophila melanogaster), zebravislarven of embryo's (Danio rerio), en andere kleine metazoa organismen of enkelcellige organismen zoals bijv. Saccharomyces cerevisiae (gist), en andere schimmels of protozoa organismen, geplaatst in de kamers. De huidige openbaarmaking richt sich op Danio rerio en/of Drosophila melanogaster, maar er zij op gewezen dat waar Danio rerio of Drosophila melanogaster wordt genoemd andere kleine dieren kunnen worden gebruikt.The micro-flow system described here can be used to perform experiments on whole cells as described above and below, and / or on organisms such as, for example, Caenorhabditis elegans (C. elegans), fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos ( Danio rerio), and other small metazoa organisms or single-cell organisms such as, for example, Saccharomyces cerevisiae (yeast), and other fungi or protozoa organisms placed in the chambers. The current disclosure focuses on Danio rerio and / or Drosophila melanogaster, but it should be noted that where Danio rerio or Drosophila melanogaster is mentioned other small animals can be used.

Zo zijn bijvoorbeeld, genen die belangrijk zijn voor het metabolisme in zoogdieren zoals genen voor een insulinesignaleringspad, het EGFR-pad, het cholesterolpad, het LXR-pad, het LRP-pad en/of het galzuurpad aanwezig in Danio rerio. Zo kan bijvoorbeeld de veelheid aan Danio rerio een groot aantal wildtype of genetisch gemodificeerd of transgene Danio rerio omvatten. In een ander voorbeeld, kan het grote aantal zebravissen een groot aantal genetisch gemodificeerde of transgene zebravissen omvatten met een transgen dat een promoter-reportersamenstelling is waarin de reporter een fluorescent of luminescent proteïne codeert en waarin de Promoter een Promoter is van een zebravisgen geïnduceerd in respons op blootstelling aan een toxine of stress.For example, genes important for metabolism in mammals such as genes for an insulin signaling pathway, the EGFR pathway, the cholesterol pathway, the LXR pathway, the LRP pathway and / or the bile acid pathway are present in Danio rerio. For example, the plurality of Danio rerio can include a large number of wild-type or genetically modified or transgenic Danio rerio. In another example, the large number of zebrafish may include a large number of genetically modified or transgenic zebrafish with a transgene that is a promoter-reporter composition wherein the reporter encodes a fluorescent or luminescent protein and wherein the Promoter is a Promoter of a zebrafish induced in response for exposure to a toxin or stress.

De onderhavige uitvinding kan worden toegepast op methoden voor het muteren van een enkelvoudig gen of meerdere genen (bijv. twee of meer) in zebravis om mutante stammen te verkrijgen die een verhoogde permeabiliteit of biologische beschikbaarheid voor verbindingen vertonen. De onderhavige uitvinding beschouwt diverse methoden voor het creëren van mutaties in zebravis. In één uitvoeringsvorm is de mutatie een insertie- of invoegmutatie. In een andere uitvoeringsvorm is de mutatie een deletie- of verwijdermutatie. In een andere uitvoeringsvorm is de methode van mutatie het introduceren van een cassette of gen-trap door recombinatie. In een andere uitvoeringsvorm wordt een klein nucleïnezuursequentiemodificatie gecreëerd door mutagenese, zoals door middel van het creëren van frameshifts, stopmutaties, substitutiemutaties, kleine insertiemutaties, kleine deletiemutaties, en dergelijke.The present invention can be applied to methods for mutating a single gene or multiple genes (e.g., two or more) in zebrafish to obtain mutant strains that exhibit increased permeability or bioavailability for compounds. The present invention contemplates various methods for creating mutations in zebrafish. In one embodiment, the mutation is an insertion or insertion mutation. In another embodiment, the mutation is a deletion or deletion mutation. In another embodiment, the method of mutation is to introduce a cassette or gene trap by recombination. In another embodiment, a small nucleic acid sequence modification is created by mutagenesis, such as by creating frame shifts, stop mutations, substitution mutations, small insertion mutations, small deletion mutations, and the like.

Mutante stammen die verhoogde permeabiliteit vertonen voor verbindingen kunnen worden geïdentificeerd door parallel een zuivere voorwaartse EMS-mutagenese-screening uit te voeren en een kandidaatgebaseerde screening met mutanten in genen die permeabiliteit kunnen verlenen, waaronder maar niet beperkt tot, meervoudig medicijnresistentie proteïnen, P-glycoproteïnen, ABC transport proteïnen, glycosyltransferases, nucleaire hormoonreceptoren, organische aniontransporteurs en vetzuurtransporteurs. De mutantstammen kunnen worden gescreend op permeabiliteitmutanten met behulp van een combinatie van fluorescentie-/liiminescentietesten en toegankelijkheidstesten voor verbindingen waarvan bekend is dat ze door wildtype-zebravis worden buitengesloten (waaronder maar niet beperkt tot chloroquine, colchicine, nicotine, verapamil en andere calciumkanaal antagonisten, zware metalen, ivermectine). Enkelvoudige mutaties kunnen combinatoir worden gecombineerd en de resulterende stammen op een iteratieve wijze opnieuw gescreend op gezondheid en opname van verbindingen totdat de gewenste set mutaties aan het licht is gebracht. Warmtebepalingen omvatten maar zijn niet beperkt tot motiliteit, reproductie, propidiumjodideopname, levensduur en gedragsanalyses. De toegankelijkheid van kleine moleculen tot cellen en weefsel in de mutante stammen kan worden bepaald door luciferases op een weefselspecifieke manier tot expressie te brengen vervolgens zebravis te voeden met luciferinecofactor en te screenen op luminescentie. De uitvinding biedt zo een panel van mutante stammen die in meer of mindere mate gevoelig zijn voor medicijnen voor wat betreft de niveaus van cel- en weefseltoegankelijkheid. Deze stammen kunnen exogene verbindingen toelaten die normaal zouden worden buitengesloten van het binnentreden van het lichaam door middel van een toegenomen intestinale of cuticulale permeabiliteit, verhoogd intestinaal transport van opgenomen moleculen, toegenomen faryngale pompwerking, verminderde functie van detoxificatie-enzymen of pompen of een combinatie van deze mechanismen, of door een onbekend mechanisme. Deze bibliotheek kan stammen bevatten met een permeabiliteit die varieert per weefsel of die varieert afhankelijk van het chemotype van de exogene verbindingen. Deze stammen vertonen verhoogde permeabiliteit voor verbindingen zonder een verhoogde achtergrondfenotype. Verhoogde permeabiliteit wordt bepaald in verschillende weefsels en celtypen door fluorescentie en luminescentieonderzoeken en door de toegankelijkheid van verbindingen waarvan bekend is dat ze door wildtype-stammen worden buitengesloten zoals bepaald door fenotypescreening. Stammen in deze bibliotheek kunnen ook worden gemodificeerd om samenstellingen te bevatten voor weefsel specifieke, locatiespecifieke en/of ontwikkelingsstadiumspecifieke expressie van endogene of exogene humane proteïnen die kunnen omvat zijn in plasmiden of direct geïntroduceerd door genoombewerking. Deze transgene stammen kunnen enkelvoudige of meervoudige kopieën van transgenen die humane proteïnen uitdrukken bevatten of extrachoromasomale elementen die in het genoom zijn geïntegreerd.Mutant strains that exhibit increased permeability to compounds can be identified by performing in parallel pure forward EMS mutagenesis screening and candidate-based screening with mutants in genes that can confer permeability, including but not limited to, multiple drug resistance proteins, P-glycoproteins , ABC transport proteins, glycosyl transferases, nuclear hormone receptors, organic anion transporters and fatty acid transporters. The mutant strains can be screened for permeability mutants using a combination of fluorescence / liiminescence tests and accessibility tests for compounds known to be excluded by wild-type zebrafish (including but not limited to chloroquine, colchicine, nicotine, verapamil and other calcium channel antagonists, heavy metals, ivermectin). Single mutations can be combined combinatorically and the resulting strains re-screened in an iterative manner for health and uptake of compounds until the desired set of mutations is revealed. Heat determinations include but are not limited to motility, reproduction, propidium iodide uptake, lifespan, and behavioral analyzes. The accessibility of small molecules to cells and tissue in the mutant strains can be determined by expressing luciferases in a tissue-specific manner, then feeding zebrafish with luciferin co-factor and screening for luminescence. The invention thus provides a panel of mutant strains that are more or less susceptible to drugs with regard to the levels of cell and tissue accessibility. These strains may permit exogenous compounds that would normally be excluded from entering the body through increased intestinal or cuticular permeability, increased intestinal transport of incorporated molecules, increased pharyngeal pumping action, decreased function of detoxification enzymes or pumps or a combination of these mechanisms, or by an unknown mechanism. This library can contain strains with a permeability that varies per tissue or that varies depending on the chemotype of the exogenous compounds. These strains exhibit increased permeability for compounds without an increased background phenotype. Increased permeability is determined in various tissues and cell types by fluorescence and luminescence studies and by the accessibility of compounds known to be excluded by wild-type strains as determined by phenotype screening. Strains in this library can also be modified to contain compositions for tissue-specific, location-specific and / or development-stage-specific expression of endogenous or exogenous human proteins that may be included in plasmids or introduced directly by genome processing. These transgenic strains may contain single or multiple copies of transgenes expressing human proteins or extrachoromasomal elements integrated into the genome.

De geselecteerde dieren kunnen worden gesorteerd en verstrekt met behulp van een van de bekende methoden of het microstromingssysteem kan worden gebruikt om de dieren te sorteren en ze naar de juiste kamer te verplaatsen. Bij voorkeur kan met de geselecteerde methode voor het sorteren/verdelen efficiënte distributie in de kamers plaatsvinden van C. elegans, Danio rerio embryo's of Drosophila melanogaster embryo's en kunnen afzonderlijke organismen snel worden geplaatst. Verder kan ieder organisme optisch worden geanalyseerd zodat alleen gewenste organismen met bepaalde vooraf bepaalde biologische kenmerken worden geplaatst. Hierdoor wordt het mogelijk identiek gefaseerde organismen te selecteren, hetgeen de uniformiteit van de testprocedure aanzienlijk vergroot. Iedere van de bekende sorteerprocedures en in de handel verkrijgbare apparatuur kan worden gebruikt.The selected animals can be sorted and supplied using one of the known methods or the micro-flow system can be used to sort the animals and move them to the correct room. Preferably, with the selected sorting / distribution method, efficient distribution can take place in the chambers of C. elegans, Danio rerio embryos or Drosophila melanogaster embryos and individual organisms can be placed quickly. Furthermore, each organism can be optically analyzed so that only desired organisms with certain predetermined biological characteristics are placed. This makes it possible to select identically phased organisms, which considerably increases the uniformity of the test procedure. Any of the known sorting procedures and commercially available equipment can be used.

De transgenische dieren kunnen een label dragen om detectie ervan te vergemakkelijken. In sommige uitvoeringsvormen kan dit een fluorescent label zijn. Ieder dier kan een ander fluorescent label dragen. Het detecteerbare label hoeft echter geen fluorescent maar kan ieder label zijn.Een methode voor het detecteren van het fluorescente label bestaat uit het gebruik van straling met een golflengte specifiek voor het label of het gebruik van andere geschikte verlichtingsbronnen. De fluorescentie van het label kan worden gedetecteerd door een ccd-camera of andere geschikte detectiemethode.The transgenic animals can carry a label to facilitate detection thereof. In some embodiments, this can be a fluorescent label. Every animal can bear a different fluorescent label. However, the detectable label does not have to be fluorescent, but can be any label. A method of detecting the fluorescent label consists of using radiation with a wavelength specific to the label or using other suitable lighting sources. The fluorescence of the label can be detected by a CCD camera or other suitable detection method.

De microstromingssystemen en -methoden die hier worden voorzien kunnen voordeel halen uit robotsystemen en apparatuur voor het opslaan en verplaatsen van deze microstromingsmodules als kamers voor robotsystemen voor het snel toedienen van vloeistoffen in en uit de platen. Door het combineren van een geautomatiseerd microstromingsplatform voor het onderhouden, hanteren en testen van organismen met een bibliotheek van synthetische mutanten met een diversiteit aan permeabiliteitseigenschappen en selectiviteit, kan dit systeem het met hoge doorvoercapaciteit screenen van verbindingen op intacte organismen mogelijk maken.The micro-flow systems and methods provided here can take advantage of robotic systems and equipment for storing and moving these micro-flow modules as chambers for robotic systems for quickly delivering liquids into and from the plates. By combining an automated micro-flow platform for the maintenance, handling and testing of organisms with a library of synthetic mutants with a diversity of permeability properties and selectivity, this system can make it possible to screen compounds with high throughput for intact organisms.

Het robotsysteem omvat programmeerbare robotarmmanipulators voor het installeren, verwijderen en configureren van modules van de microstromingsmodule. Als ze op hun plaats worden geklikt sluiten de modules nauw aan op andere modules om zo afgedichte microstromingsinterfaces te vormen. Deze interfaces kunnen vast worden gedrukt of zijn bevestigd met mechanische lippen of pennen. Modules kunnen ook worden aangestuurd en in werking gezet door vloeistof, elektrische, magnetische, thermische en mechanische interactie met een actieve bedieningsmatrix die onder het vlak van de moduleopstelling ligt. Deze bedieningsmatrix kan elektrische verbindingen, analoog-digitale interfaces en magnetische en mechanische actuators bevatten, alsmede thermokoppels en vloeistof-ikoppelingen, en ook uitlaatpoorten voor het verwijderen van vloeibaar en corpusculair afval uit de microstromingsopstelling. De bedieningsmatrix en robotica kunnen worden verbonden met computers voor een softwarematig programmeerbare realtime bediening. Daarbij kunnen de manipulators externe apparatuur zoals video camera' s en externe apparaten van derden mechanisch manipuleren en bedienen zonder menselijke interventie. Het robotsysteem kan worden aangestuurd met een programmeerbaar softwarepakket met een interface voor het programmeren van applicaties (api) waardoor deze gebruikt kan worden in combinatie met bestaande softwareprogrammeertalen zoals C, C++, Visual Basic, Python, en MATLAB, alsmede bedrijfseigen en open source roboticabedieningssoftware. Het robotsysteem kan worden gemonitord door middel van videomonitoring, laser-/optische sensors, alsmede mechanische, temperatuur en chemische sensors.The robotic system includes programmable robotic arm manipulators for installing, removing, and configuring modules of the micro-flow module. When they are clicked into place, the modules connect closely to other modules to form sealed micro-flow interfaces. These interfaces can be fixed or attached with mechanical lips or pins. Modules can also be controlled and triggered by fluid, electrical, magnetic, thermal, and mechanical interaction with an active operating matrix that is below the plane of the module arrangement. This control matrix can contain electrical connections, analog-digital interfaces and magnetic and mechanical actuators, as well as thermocouples and liquid-i couplings, as well as outlet ports for removing liquid and particulate waste from the micro-flow arrangement. The control matrix and robotics can be connected to computers for software-programmable real-time operation. In addition, the manipulators can mechanically manipulate external equipment such as video cameras and external devices from third parties and operate them without human intervention. The robotic system can be controlled with a programmable software package with an application programming interface (api) that allows it to be used in combination with existing software programming languages such as C, C ++, Visual Basic, Python, and MATLAB, as well as proprietary and open source robotic control software. The robot system can be monitored by means of video monitoring, laser / optical sensors, as well as mechanical, temperature and chemical sensors.

Met meerkleurige fluorescentie kunnen meerdere doelen en celprocessen op één enkel scherm worden getoetst. Kruiscorrelatie van cellulaire responses zal een schat aan informatie geven die nodig is voor het valideren van doelen en optimalisatie van een lead.With multi-colored fluorescence, multiple targets and cell processes can be tested on a single screen. Cross-correlation of cellular responses will provide a wealth of information that is needed to validate goals and optimize a lead.

De onderhavige uitvinding biedt een methode voor het analyseren van volledige dieren omvattende het leveren van een reeks locaties die meerdere dieren bevatten waarin de dieren een of meerdere fluorescente reportermoleculen bevatten, het scannen van meerdere dieren in ieder van de locaties om fluorescente signalen te verkrijgen van de fluorescente reportermoleculen in de dieren; converteren van de fluorescente signalen naar data; en het benutten van de digitale data om de verdeling, het milieu of de activiteit van de fluorescente reportermoleculen binnenin de dieren te bepalen. In een ander aspect biedt de onderhavige uitvinding een methode voor het analyseren van volledige dieren omvattende het bieden van een locatie die een dier bevat waarin het dier optioneel een of meerdere reportermoleculen kan bevatten; het dier in contact brengen met een bibliotheek aan verbindingen; scannen van het dier op meerdere locaties waarin iedere locatie een ander detectiesysteem bevat; het verzamelen van digitale data om de verdeling, de omgeving of de activiteit van de reportermoleculen binnenin de dieren te bepalen.The present invention provides a method for analyzing whole animals comprising providing a set of locations containing multiple animals in which the animals contain one or more fluorescent reporter molecules, scanning multiple animals in each of the locations to obtain fluorescent signals from the fluorescent reporter molecules in the animals; converting the fluorescent signals to data; and utilizing the digital data to determine the distribution, environment, or activity of the fluorescent reporter molecules within the animals. In another aspect, the present invention provides a method for analyzing whole animals comprising providing a location that includes an animal in which the animal may optionally contain one or more reporter molecules; bringing the animal into contact with a library of compounds; scanning the animal at multiple locations in which each location contains a different detection system; collecting digital data to determine the distribution, environment or activity of the reporter molecules within the animals.

Het Drosophila melanogaster of een zebravisembryo kan bijvoorbeeld door een robotmanipulator in de kamer worden geplaatst. Het dier kan vrij in de vloeistof in de kamer liggen, kan zijn ingebed in agarose met een laag smeltpunt, of iedere andere substantie die het dier kan immobiliseren maar het niet beschadigt of gas-/nutriëntuitwisseling verhindert. Iedere kamerzal een constante toevoer hebben van een bepaalde buffer die door zijn microstromingsinlaatkanalen stroomt. Bovendien kunnen medicijnen aan de dieren in de kamer worden toegediend door of de microstromingskanalen te gebruiken of met behulp van robotpipet-handlers via een schuifdeksel, dat van plastic of glas kan zijn en kan worden teruggetrokken om de opening in de kamer vrij te maken voor injectie.The Drosophila melanogaster or a zebrafish embryo can, for example, be placed in the room by a robot manipulator. The animal may lie freely in the fluid in the chamber, may be embedded in low melting point agarose, or any other substance that can immobilize the animal but does not damage it or prevent gas / nutrient exchange. Each chamber will have a constant supply of a certain buffer that flows through its micro-flow inlet channels. In addition, medications can be administered to the animals in the room by either using the micro-flow channels or by using robot pipet handlers through a sliding lid, which can be plastic or glass and can be withdrawn to clear the opening in the room for injection. .

In sommige aspecten van de uitvinding kan het hier beschreven microstromingssysteem een deksel hebben met een vorm die de openingen van de kamers in het bovenste oppervlak van het substraat afdekt. Het deksel kan een een schuifdeksel zijn zodanig dat wanneer het schuifdeksel zich in geopende stand bevindt, het een opening tot de kamers biedt waardoor voorafgaand aan de start van het experiment dieren kunnen worden geplaatst en/of medicijnen naar binnen kunnen worden gebracht tijdens het experiment. Het deksel kan vervolgens terug worden geschoven naar een dichte stand tijdens het experiment. In een ander aspect van de uitvinding kan het deksel de kamer afdichten en efficiënte stroming van microstroming in de kamer mogelijk maken. De microstroming kan door een robot worden geregeld en worden gebruikt om de dieren in leven te houden door aanleveren van de juiste nutriënten, het verwijderen van afvalstoffen en voor het aanleveren van test verbinding of bibliotheek van verbindingen aan dieren in de kamers.In some aspects of the invention, the micro-flow system described herein may have a lid having a shape that covers the openings of the chambers in the upper surface of the substrate. The lid can be a sliding lid such that when the sliding lid is in the open position, it provides an opening to the chambers through which animals can be placed and / or medication can be brought in during the experiment prior to the start of the experiment. The lid can then be pushed back to a closed position during the experiment. In another aspect of the invention, the cover can seal the chamber and allow efficient micro-flow in the chamber. The micro-flow can be controlled by a robot and used to keep the animals alive by supplying the right nutrients, removing waste and delivering test compound or library of compounds to animals in the rooms.

In een preferente uitvoeringsvorm biedt de test een methode voor het kwantificeren van een interactie tussen specifieke biomoleculen in een biologisch monster, bijvoorbeeld, een volledig dier of een cel. Nog beter zijn voornoemde interacties tussen een KH-domein bindend microRNA en een KH-domein bevattend proteïne. In één aspect biedt de uitvinding een methode voor het screenen van kandidaatverbindingen voor de behandeling of preventie van een hersentumor of een neurodegeneratie door een volledig dier of een cel in contact te brengen met een kandidaat therapeutisch agens en de effecten te meten die de verbinding heeft op het dier of de cel. De verbinding kan vervolgens verder worden bestudeerd op mogelijke therapeutische effecten. In bepaalde preferente uitvoeringsvormen wordt de screening uitgevoerd door middel van hoge-doorvoercapaciteit-screening waarmee op hetzelfde moment simultane diagnoses kunnen worden gesteld.In a preferred embodiment, the test provides a method for quantifying an interaction between specific biomolecules in a biological sample, for example, an entire animal or a cell. Even better are the aforementioned interactions between a KH domain binding microRNA and a KH domain containing protein. In one aspect, the invention provides a method for screening candidate compounds for the treatment or prevention of a brain tumor or neurodegeneration by bringing an entire animal or cell into contact with a candidate therapeutic agent and measuring the effects that the compound has on the animal or cell. The compound can then be further studied for possible therapeutic effects. In certain preferred embodiments, the screening is performed by means of high throughput screening with which simultaneous diagnoses can be made at the same time.

De test biedt een methode voor het diagnosticeren van een ziekte of stoornis die bestaat uit het screenen van een biologisch monster van een patiënt voor het identificeren en/of kwantificeren van een marker of molecuul dat kenmerkend is voor de ziekte of stoornis. Bijvoorbeeld een KH-domein bindend microRNA, een KH-bevattend proteïne en dergelijke. In een ander aspect biedt de uitvinding een methode voor het identificeren van subjecten die risico lopen op het ontwikkelen van een ziekte of stoornis die bestaat uit het screenen van een biologisch monster van een patiënt en het identificeren en/of kwantificeren van een marker of molecuul dat kenmerkend is voor de ziekte of stoornis.The test provides a method for diagnosing a disease or disorder that consists of screening a biological sample from a patient to identify and / or quantify a marker or molecule characteristic of the disease or disorder. For example, a KH domain binding microRNA, a KH-containing protein, and the like. In another aspect, the invention provides a method for identifying subjects at risk of developing a disease or disorder consisting of screening a patient's biological sample and identifying and / or quantifying a marker or molecule that characteristic of the disease or disorder.

De methode kan ook het effect van een verbinding op het gedrag van dieren evalueren. De method biedt het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven, die is geplaatst binnenin een kamer van het microstromingsapparaat van de uitvinding, het observeren van het gedrag vertoond door de mutant en het vergelijken van het waargenomen gedrag met dat van een wildtype dier, waarin de waargenomen verschillen in gedrag in verband worden gebracht met de testverbinding. Zoals een vakkundige zal herkennen, kunnen kwantitatieve analyses op de gemeten gedragsparameters worden uitgevoerd om gedragsveranderingen te detecteren die zijn geïnduceerd door de verbinding. De groei van de dieren, het toedienen van de testverbindingen, het observeren van het gedrag van de dieren en het vergelijken van de verschillen in gedrag kunnen worden uitgevoerd met bovenstaand beschreven robotsystemen.The method can also evaluate the effect of a compound on animal behavior. The method provides administering a test compound to a mutant as described above, which is placed within a chamber of the micro-flow apparatus of the invention, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal wherein the observed differences in behavior are associated with the test compound. As one skilled in the art will recognize, quantitative analyzes can be performed on the measured behavioral parameters to detect behavioral changes induced by the compound. The growth of the animals, the administration of the test compounds, the observation of the behavior of the animals and the comparison of the differences in behavior can be performed with the robot systems described above.

De uitvinding biedt ook een methode voor het evalueren van het effect van een verbinding op de neurale activiteit van de dieren. De methode bestaat uit het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven, het observeren van de neurale activiteit die de mutant vertoont en het vergelijken van de waargenomen neurale activiteit met die van een wildtype dier, waarin de verschillen in neurale activiteit in verband worden gebracht met de testverbinding. De neurale activiteit kan worden gemeten door middel van een genetisch gecodeerde indicator in een of meerdere neuronen om te zien hoe de gehele neurale activiteit door de verbindingen wordt beïnvloed. In een andere aspect, kan de neurale activiteit worden gemeten in respons tot een gedragsstimulus, zoals bijvoorbeeld, uithongering, honger of het presenteren van voedsel en dergelijke. In een ander aspect kan neurale ontwikkeling worden gemeten.The invention also provides a method for evaluating the effect of a compound on the neural activity of the animals. The method consists of administering a test compound to a mutant as described above, observing the neural activity that the mutant exhibits and comparing the observed neural activity with that of a wild-type animal, in which the differences in neural activity are related brought to the test compound. The neural activity can be measured by a genetically coded indicator in one or more neurons to see how the entire neural activity is affected by the connections. In another aspect, neural activity can be measured in response to a behavioral stimulus, such as, for example, starvation, hunger or the presentation of food and the like. Neural development can be measured in another aspect.

In een ander aspect biedt de uitvinding een methode voor het evalueren van het degeneratieve effect van een verbinding. De methode biedt het toedienen van een testverbinding aan een mutant zoals bovenstaand beschreven, het observeren van de neurale activiteit die de mutant vertoont en het vergelijken van de waargenomen neurale activiteit met die van een wildtype dier, waarin de waargenomen verschillen in gedrag in verband worden gebracht met de testverbinding. Het te observeren gedrag omvat maar is niet beperkt tot wijzigingen in de bewegingen van het wildtype en de mutant, veranderingen in snelheid van ademhalen, wijzigingen in de levensduur van het wildtype en de mutant, veranderingen in de bewegingsontwikkeling van het wildtype en de mutant, wijzigingen in de senescentie van het wildtype en de mutant.In another aspect, the invention provides a method for evaluating the degenerative effect of a compound. The method offers administering a test compound to a mutant as described above, observing the neural activity that the mutant exhibits and comparing the observed neural activity with that of a wild-type animal, in which the observed differences in behavior are associated with the test compound. The behavior to be observed includes but is not limited to changes in the movements of the wild type and the mutant, changes in the rate of breathing, changes in the lifespan of the wild type and the mutant, changes in the movement development of the wild type and the mutant, changes in the senescence of the wild type and the mutant.

De uitvinding heeft betrekking op een methode hier beschreven die bestaat uit het plaatsen van het dier in één of meerdere kamers in een microstromingsapparaatmodule en het maken van beeldopnamen van één of meerder kamers om in één of meerdere kamers resultaten te verkrijgen.The invention relates to a method described herein which consists of placing the animal in one or more chambers in a micro-flow device module and making image recordings of one or more chambers to obtain results in one or more chambers.

Het dier kan een volledig dier, een embryo of een larve zijn. Het dier kan een weefselspecifieke, locatiespecifieke en/of ontwikkelingsfase specifieke expressie van het KH-domein bindende miRNA en/of het KH-domein bevattende proteïne omvatten.The animal can be a complete animal, an embryo or a larva. The animal may include tissue-specific, location-specific and / or development-phase-specific expression of the KH domain binding miRNA and / or the KH domain-containing protein.

De onderhavige uitvinding heeft in één vorm betrekking op een methode voor het diagnosticeren van een hersentumor en/of een neurodegeneratieve ziekte in een subject. De methode bestaat uit (a) het bepalen van een hoeveelheid in het monster van een KH-domein bevattend microRNA; en (b) het vergelijken van de hoeveelheid van voornoemd microRNA in het monster met een controleniveau van voornoemd microRNA.The present invention in one form relates to a method for diagnosing a brain tumor and / or a neurodegenerative disease in a subject. The method consists of (a) determining an amount in the sample of a KH domain containing microRNA; and (b) comparing the amount of said microRNA in the sample with a control level of said microRNA.

In een verdere specifieke vorm van onderhavige methode wordt een subject gediagnosticeerd met een hersentumor en/of een neurodegeneratieve ziekte of risico lopend op het ontwikkelen van een hersentumor en/of neurodegeneratieve ziekte als er een meetbaar verschil is van de hoeveelheid KH-domein bindend microRNA in het monster in vergelijking tot het controleniveau. In een alternatieve meer specifieke vorm bestaat de methode uit het selecteren van een behandeling of het wijzigen van een behandeling voor de hersentumor en/of de neurodegeneratieve ziekte op basis van de vastgestelde hoeveelheid van voornoemd KH-domein bindend microRNA.In a further specific form of the present method, a subject is diagnosed with a brain tumor and / or a neurodegenerative disease or at risk of developing a brain tumor and / or neurodegenerative disease if there is a measurable difference in the amount of KH domain binding microRNA in the sample compared to the control level. In an alternative, more specific form, the method consists of selecting a treatment or changing a treatment for the brain tumor and / or the neurodegenerative disease based on the determined amount of said KH domain binding microRNA.

Bovendien is het belangrijk op te merken dat EV's door vele cellen worden uitgescheiden en dat ze een rol spelen in het moduleren van immuunresponses. Het verpakken van miRNA's en derhalve KH-bindende miRNA's in deze vesicula kan nuttig zijn voor het regelen en moduleren van de immuunresponse.In addition, it is important to note that EVs are secreted by many cells and that they play a role in modulating immune responses. Packaging miRNAs and therefore KH-binding miRNAs in these vesicles can be useful for controlling and modulating the immune response.

Een ander aspect van onderhavige uitvinding heeft betrekking op een formulering omvattende ten minste één KH-domein bindend miRNA of een functioneel derivaat daarvan en/of EV zoals eerder gedefinieerd, en verder tenminste één farmaceutisch acceptabele drager of excipiens. Voornoemde samenstelling is bij voorkeur een farmaceutische formulering.Another aspect of the present invention relates to a formulation comprising at least one KH domain binding miRNA or a functional derivative thereof and / or EV as previously defined, and further at least one pharmaceutically acceptable carrier or excipient. Said composition is preferably a pharmaceutical formulation.

De farmaceutische formulering van de uitvinding kan, desgewenst indien nodig ook additieven bevatten voor het verhogen, regelen of anders aansturen van het gewenste therapeutische effect van KH-domein bindend miRNA of functionele derivaten daarvan en/of EV's. Zulke additieven en/of hulpstoffen of farmaceutisch acceptabele substanties, hetzij als type bindmiddel of drager, kan worden geselecteerd uit één van de volgende bufferende agentia, oppervlakteactieve stoffen, cosolventen, conserveringsmiddelen, desintegratiemiddelen, verdunningsmiddelen, etc. Voornoemde farmaceutisch toelaatbare stoffen die kunnen worden gebruikt in de farmaceutische formulering van de uitvinding zijn algemeen bekend bij vakkundigen.The pharmaceutical formulation of the invention may, if desired, also contain additives to enhance, control, or otherwise direct the desired therapeutic effect of KH domain binding miRNA or functional derivatives thereof and / or EVs. Such additives and / or auxiliaries or pharmaceutically acceptable substances, either as a type of binder or carrier, can be selected from one of the following buffering agents, surfactants, cosolvents, preservatives, disintegrants, diluents, etc. The aforementioned pharmaceutically acceptable substances that can be used in the pharmaceutical formulation of the invention are well known to those skilled in the art.

Een ander deel van de huidige uitvinding bestaat uit het gebruik van het geïsoleerde KH-domein bindend miRNA of functionele derivaten daarvan en/of EV's of het gebruik van de samenstellingen hierin beschreven, bij het produceren van een medicijn, vaccin of een biomarker.Another part of the present invention consists of the use of the isolated KH domain binding miRNA or functional derivatives thereof and / or EVs or the use of the compositions described herein in producing a drug, vaccine or a biomarker.

Een ander deel van de huidige uitvinding heeft betrekking op geïsoleerd KH-domein bindend miRNA of functionele derivaten daarvan en/of EV's zelf of de samenstellingen hierin beschreven, voor gebruik als medicijnen, bij voorkeur voor gentherapie, als vaccins of als biomarkers.Another part of the present invention relates to isolated KH domain binding miRNA or functional derivatives thereof and / or EVs themselves or the compositions described herein, for use as medicines, preferably for gene therapy, as vaccines or as biomarkers.

Een ander deel van de huidige uitvinding heeft betrekking op een methode voor het behandelen van ziekten door het aan een subject toedienen van een effectieve dosis van het geïsoleerde KH-domein bindend miRNA of functionele derivaten daarvan en/of EV's van de samenstellingen beschreven in deze uitvinding. Een andere deel van de huidige uitvinding heeft betrekking op een vaccinatiemethode voor het toedienen aan een subject van ten minste een effectieve dosis van een vaccin bestaande uit het geïsoleerde KH-domein bindend miRNA of functionele derivaten daarvan of EV's of samenstellingen, zoals hierin beschreven.Another part of the present invention relates to a method for treating diseases by administering to a subject an effective dose of the isolated KH domain binding miRNA or functional derivatives thereof and / or EVs of the compositions described in this invention . Another part of the present invention relates to a vaccination method for administering to a subject at least one effective dose of a vaccine consisting of the isolated KH domain binding miRNA or functional derivatives thereof or EVs or compositions, as described herein.

En dus biedt de huidige geopenbaarde materie methoden en systemen voor diagnose en prognose van een ziekte of stoornis, alsmede methoden voor het behandelen of beperken van het voorkomen van voornoemde ziekte of stoornis.Thus, the present subject matter provides methods and systems for diagnosis and prognosis of a disease or disorder, as well as methods for treating or limiting the occurrence of said disease or disorder.

In preferente uitvoeringsvormen is de ziekte of stoornis een hersentumor of een neurodegeneratieve ziekte.In preferred embodiments, the disease or disorder is a brain tumor or a neurodegenerative disease.

In andere preferente uitvoeringsvormen is de hersentumor akoestisch neuroma astrocytoom, Chordoom, Pilocytisch astrocytoom, laaggradig astrocytoom, anaplastisch astrocytoom, glioblastoom, craniopharyngioom, hersenstam glioom, ependymoom, gemengd glioom, optische zenuw glioom, subependymoom, medulloblastoom, meningioom, metastatische hersentumors, oligodendroglioom, pituitaire tumoren, primitieve neuroectodermale tumoren, schwannoom.In other preferred embodiments, the brain tumor is acoustic neuroma, astrocytoma, Chordoma, Pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, glioblastoma, craniopharyngioma, brainstem glioma, ependymoma, mixed glioma, optic nerve glioma, medulentum, subependoma stoma, subulendoma stoma, subependoma stoma tumors, primitive neuroectodermal tumors, schwannoma.

In andere preferente uitvoeringsvormen is de hersentumor akoestisch neuroma astrocytoom, Chordoom, Pilocytisch astrocytoom, laaggradig neuroom, astrocytoom, Chordoom, Pilocytisch astrocytoom, laaggradig astrocytoom, anaplastsch astrocytoom, craniofaryngioom, hersenstam glioom, ependymoom, gemengd glioom, optische zenuw glioom, subependymoom, meningioom, metastatische hersentumoren, oligodendroglioom, pituitaire tumoren, primitieve neuroectodermal tumoren, schwannoom.In other preferred embodiments, the brain tumor is acoustic neuroma, astrocytoma, Chordoma, Pilocytic astrocytoma, low-grade neuroma, astrocytoma, Chordoma, Pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, craniopharyngioma, stem tribe, glioma, optic glioma, gendoma, glioma, gendoma, glioma, gendoma, gendoma, glioma, gendoma, gendoma, gendoma, gendoma, gendoma, metastatic brain tumors, oligodendroglioma, pituitary tumors, primitive neuroectodermal tumors, schwannoma.

In andere preferente uitvoeringsvormen is de hersentumor akoestisch neuroma astrocytoom, Chordoom, Pilocytisch astrocytoom, laaggradig astrocytoom, anaplastisch astrocytoom, craniofaryngioom, ependymoom, gemengd glioom, optische zenuw glioom, subependymoom, meningioom, metastatische hersentumoren, oligodendroglioom, pituitaire tumoren, primitieve neuroectodermale tumoren, schwannoom.In other preferred embodiments, the brain tumor is acoustic neuroma, astrocytoma, chordoma, pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, craniopharyngioma, ependymoma, mixed glioma, optic nerve glioma, subependymoma, meningioma, metastatic primitive neuro tumor neuro tumourous tumor tumors, tumor nerve tumor tumors .

In andere preferente uitvoeringsvormen is de neurodegeneratieve ziekte Parkinson, Multiple System Atrophy (MSA), multipele sclerose, amyotrofische laterale sclerose (ALS), Alzheimer of Huntingtons.In other preferred embodiments, the neurodegenerative disease is Parkinson's, Multiple System Atrophy (MSA), multiple sclerosis, amyotrophic lateral sclerosis (ALS), Alzheimer's or Huntingtons.

In sommige uitvoeringsvormen, is de hersentumor een medicijnresistente hersentumor.In some embodiments, the brain tumor is a drug-resistant brain tumor.

In sommige uitvoeringsvormen van de onderhavige geopenbaarde materie worden methoden, systemen, apparaten en sets voorzien voor het diagnosticeren van een kanker of een degeneratieve ziekte in een subject en voor het bepalen of profylaxe of behandeling van kanker of neurodegeneratieve ziekte in een subject moet worden geïnitieerd of voortgezet en omvatten het identificeren van ten minste één biomarker in een biologisch monster van een subject.In some embodiments of the subject matter disclosed, methods, systems, devices and sets are provided for diagnosing a cancer or a degenerative disease in a subject and for determining whether prophylaxis or treatment of cancer or neurodegenerative disease is to be initiated in a subject or and include identifying at least one biomarker in a biological sample from a subject.

In sommige uitvoeringsvormen van de onderhavig geopenbaarde materie wordt een methode voor het diagnosticeren van een ziekte of stoornis in een subject voorzien. De termen diagnosticeren en diagnose zoals hier gebruikt verwijzen naar methoden waarmee de vakkundige kan inschatten en zelfs kan bepalen of een subject al dan niet lijdt aan een gegeven ziekte of aandoening. De vakkundige stelt vaak een diagnose op basis van een of meerdere diagnostische indicatoren zoals bijvoorbeeld een marker, de hoeveelheid (inclusief aanwezigheid of afwezigheid) van wat indicatief is voor de aanwezigheid, ernst of afwezigheid van de aandoening.In some embodiments of the subject matter disclosed herein, a method for diagnosing a disease or disorder in a subject is provided. The terms diagnosis and diagnosis as used herein refer to methods with which the skilled person can estimate and even determine whether or not a subject suffers from a given disease or condition. The skilled person often makes a diagnosis on the basis of one or more diagnostic indicators such as, for example, a marker, the amount (including presence or absence) of what is indicative of the presence, severity or absence of the disorder.

Samen met de diagnose, is klinische ziekteprognose ook een gebied van grote zorg en belang. Het is belangrijk de fase en snelheid van voortschrijden van de ziekte of stoornis te weten voor het plannen van de meest effectieve therapie. Indien een meer accurate prognose kan worden gesteld, kan een beter passende therapie en in sommige gevallen minder belastende therapie voor de patiënt worden gekozen. Metingen van de KH-domein bindende miRNA biomarkerniveaus die hierin worden geopenbaard kunnen nuttig zijn voor het categoriseren van subjecten in overeenstemming met de voortschrijding van ziekte of stoornis. Meting van de KH-domein bindende miRNA biomarkerniveaus hierin geopenbaard kan nuttig zijn voor het categoriseren van subjecten die baat kunnen hebben van bepaalde therapieën. Meting van de KH-domein bindende miRNA biomarkerniveaus die hierin worden geopenbaard kunnen nuttig zijn voor het onderscheiden van subjecten waar alternatieve of additionele therapieën beter geschikt kunnen zijn van andere subjecten.Along with the diagnosis, clinical disease prognosis is also an area of great concern and importance. It is important to know the phase and speed of progression of the disease or disorder to plan the most effective therapy. If a more accurate prognosis can be made, a more suitable therapy and in some cases less burdensome therapy can be chosen for the patient. Measurements of the KH domain binding miRNA biomarker levels disclosed herein may be useful for categorizing subjects in accordance with the progression of disease or disorder. Measurement of the KH domain binding miRNA biomarker levels disclosed herein may be useful for categorizing subjects who may benefit from certain therapies. Measurement of the KH domain binding miRNA biomarker levels disclosed herein may be useful for distinguishing subjects where alternative or additional therapies may be better suited to other subjects.

Als zodanig sluit de hierin gebruikte zin "stellen van een diagnose" of "diagnosticeren" het stellen van een prognose in, die kan dienen voor het voorspellen van een klinisch resultaat (met of zonder medische behandeling), het selecteren van een geschikte behandeling (dan wel of behandeling effectief zal zijn), of het monitoren van een actuele behandeling en potentieel wijziging van de behandeling, op basis van de mate van diagnostische biomarkerniveaus hierin geopenbaard.As such, the phrase "make a diagnosis" or "diagnose" as used herein includes making a prognosis that can serve to predict a clinical outcome (with or without medical treatment), selecting an appropriate treatment (then whether treatment will be effective), or monitoring current treatment and potential treatment change, based on the level of diagnostic biomarker levels disclosed herein.

De zin "stellen van een prognose" zoals hier gebruikt verwijst naar methoden waarmee de vakkundige het verloop of de uitkomst van een aandoening in een subject kan voorspellen. De term "prognose" verwijst niet naar het in staan zijn om het verloop of de uitkomst van een aandoening met 100% nauwkeurigheid te voorspellen, of zelfs te voorspellen dat een bepaald verloop of uitkomst meer of minder waarschijnlijk op zal treden op basis van de aanwezigheid, afwezigheid of niveaus van testbiomarkers. In plaats daarvan zal de vakkundige begrijpen dat de term "prognose" refereert naar een verhoogde waarschijnlijkheid dat een bepaald verloop of uitkomst zal optreden; dat wil zeggen, dat een verloop of uitkomst meer waarschijnlijk zal optreden in een subject die een bepaald gegeven vertoond, indien vergeleken met individuën die dit gegeven niet vertonen. Zo kan bijvoorbeeld, in individuen die het gegeven niet vertonen (bijv., geen expressie van de biomarker of expressie ervan op een laag niveau), de kans op een bepaalde uitkomst ongeveer 3% zijn. In bepaalde uitvoeringsvormen, is een prognose ongeveer 5% kans op een gegeven uitkomst, ongeveer 7% kans, ongeveer 10% kans, ongeveer 12% kans, ongeveer 15% kans, ongeveer 20% kans, ongeveer 25% kans, ongeveer 30% kans, ongeveer 40% kans, ongeveer 50% kans, ongeveer 60% kans, ongeveer 75% kans, ongeveer 90% kans, of ongeveer 95% kans.The phrase "making a prognosis" as used herein refers to methods with which the skilled person can predict the course or outcome of a disorder in a subject. The term "prognosis" does not refer to being able to predict the course or outcome of a condition with 100% accuracy, or even to predict that a certain course or outcome will be more or less likely to occur based on the presence , absence or levels of test biomarkers. Instead, those skilled in the art will understand that the term "prognosis" refers to an increased likelihood that a certain course or outcome will occur; that is, a course or outcome is more likely to occur in a subject who exhibits a given fact, when compared to individuals who do not show this fact. For example, in individuals who do not display the data (e.g., no expression of the biomarker or its expression at a low level), the probability of a given outcome may be about 3%. In certain embodiments, a prognosis is about 5% chance of a given outcome, about 7% chance, about 10% chance, about 12% chance, about 15% chance, about 20% chance, about 25% chance, about 30% chance , about 40% chance, about 50% chance, about 60% chance, about 75% chance, about 90% chance, or about 95% chance.

De vakkundige zal begrijpen dat het in verband brengen van een prognose-indicator met een voorbeschiktheid voor een bepaalde slechte uitkomst een statistische analyse is. Zo kan bijvoorbeeld een biomarkerniveau hoger dan een controleniveau in sommige uitvoeringsvormen signaleren dat een subject met een grotere waarschijnlijkheid zal lijden aan een kanker dan subjecten met een niveau dat lager is of gelijk aan het controleniveau, zoals bepaald door een niveau van statistische significantie. Bovendien kan een verandering in markerconcentratie vanaf baselineniveaus de prognose van het subject weerspiegelen en de mate van verandering in markerniveau kan zijn gerelateerd aan de ernst van de ongunstige gebeurtenissen. Statistische significantie wordt vaak bepaald door het vergelijken van twee of meer populaties en het bepalen van een betrouwbaarheidsinterval en/of een p-waarde. Geprefereerde betrouwbaarheidsintervallen voor hetgeen dit betreft zijn 90%.The person skilled in the art will understand that linking a forecast indicator with a predisposition to a certain bad outcome is a statistical analysis. For example, a biomarker level higher than a control level in some embodiments may signal that a subject with greater probability will suffer from a cancer than subjects with a level that is lower or equal to the control level, as determined by a level of statistical significance. In addition, a change in marker concentration from baseline levels may reflect the subject's prognosis, and the degree of change in marker level may be related to the severity of adverse events. Statistical significance is often determined by comparing two or more populations and determining a confidence interval and / or a p value. Preferred confidence intervals for this are 90%.

In andere uitvoeringsvormen kan een drempelwaarde van verandering in het niveau van een prognostische of diagnostische biomarker worden vastgesteld en kan de mate van wijziging van het niveau van de indicator in een biologisch monster eenvoudig worden vergeleken met de drempelwaarde van verandering in het niveau. Een preferente drempelwaarde van verandering in het niveau voor markers van de onderhavig geopenbaarde materie is ongeveer 5%, ongeveer 10%, ongeveer 15%, ongeveer 20%, ongeveer 25%, ongeveer 30%, ongeveer 50%, ongeveer 75%, ongeveer 100%) en ongeveer 150%. In nog een andere uitvoeringsvorm kan een "nomogram "worden bepaald waarmee een niveau van een prognostische of diagnostische indicator direct in verband kan worden gebracht met een gerelateerde aanwijzing voor een gegeven uitkomst. De vakkundige is bekend met het gebruik van dergelijke nomogrammen om twee numerieke waarden aan elkaar te relateren wetende dat de onzekerheid in deze meting hetzelfde is als de onzekerheid in de markerconcentratie omdat naar afzonderlijke meetwaarden in monsters wordt verwezen, niet naar een populatie gemiddelden.In other embodiments, a threshold value of change in the level of a prognostic or diagnostic biomarker can be determined and the degree of change in the level of the indicator in a biological sample can be easily compared with the threshold value of change in the level. A preferred threshold of change in the level for markers of the subject matter disclosed is approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 50%, approximately 75%, approximately 100 %) and about 150%. In yet another embodiment, a "nomogram" can be determined with which a level of a prognostic or diagnostic indicator can be directly associated with a related indication for a given outcome. The person skilled in the art is familiar with the use of such nomograms to relate two numerical values to each other, knowing that the uncertainty in this measurement is the same as the uncertainty in the marker concentration, because reference is made to individual measurement values in samples, not to a population of means.

In sommige uitvoeringsvormen van de huidige geopenbaarde materie, kan meervoudige determinatie plaatsvinden van één of meerdere diagnostische of prognostische biomarkers en een tijdelijke verandering in het KH-domein bindend miRNA niveau kan worden gebruikt voor het monitoren van de progressie van kanker en/of effectiviteit van geschikte therapieën gericht tegen de ziekte. In zulke uitvoeringsvormen bijvoorbeeld zou men kunnen verwachten na verloop van tijd een afname of toename te zien van de biomarker(s) tijdens de duur van een effectieve therapie. En dus biedt de onderhavige geopenbaarde materie in sommige uitvoeringsvormen een methode voor het bepalen van de effectiviteit van behandeling en/of progressie van een hersentumor en/of neurodegeneratieve ziekte in een subject. In sommige uitvoeringsvormen omvat de methode het bepalen van een hoeveelheid KH-domein bindend miRNA in biologische monsters verzameld bij het subject op veel verschillende tijdstippen en deze hoeveelheden van voornoemd miRNA in de monsters die op verschillende tijdstippen zijn verzameld te vergelijken. Bijvoorbeeld, kan een eerste tijdstip worden geselecteerd voorafgaand aan het starten van een behandeling en kan een tweede tijdstip worden geselecteerd op een tijdstip na de start van de behandeling. Eén of meer niveaus van KH-domein bindend miRNAs kunnen worden gemeten in ieder van de op diverse tijdstippen genomen monsters en kwalitatieve en/of kwantitatieve verschillen genoteerd. Een verandering in de hoeveelheden miRNA-niveaus van de eerste en tweede monsters kan worden gecorreleerd met de effectiviteit van de behandeling en/of progressie van de kanker in het subject.In some embodiments of the presently disclosed matter, multiple determination of one or more diagnostic or prognostic biomarkers can take place and a temporary change in the KH domain binding miRNA level can be used to monitor the progression of cancer and / or effectiveness of appropriate therapies aimed at the disease. For example, in such embodiments, one might expect to see a decrease or increase in the biomarker (s) over time during the duration of an effective therapy. And so, in some embodiments, the subject matter disclosed herein provides a method for determining the effectiveness of treatment and / or progression of a brain tumor and / or neurodegenerative disease in a subject. In some embodiments, the method comprises determining an amount of KH domain binding miRNA in biological samples collected from the subject at many different time points and comparing these amounts of said miRNA in the samples collected at different time points. For example, a first time point can be selected prior to starting a treatment and a second time point can be selected at a time point after the start of treatment. One or more levels of KH domain binding miRNAs can be measured in any of the samples taken at various time points and noted qualitative and / or quantitative differences. A change in the amounts of miRNA levels of the first and second samples can be correlated with the effectiveness of treatment and / or progression of the cancer in the subject.

De termen "gecorreleerd" en "correlerend" refererend naar het gebruik van diagnostische en prognostische biomarkers verwijst naar het vergelijken van de aanwezigheid of de hoeveelheid van de biomarker in een subject, met de aanwezigheid of hoeveelheid ervan in subjecten waarvan bekend is dat ze lijden aan, of bekend is dat ze een risisco lopen op, een bepaalde aandoening, of in subjecten waarvan bekend is dat ze vrij zijn van een bepaalde aandoening, d.w.z. "normale individuen".The terms "correlated" and "correlating" referring to the use of diagnostic and prognostic biomarkers refers to comparing the presence or amount of the biomarker in a subject, with its presence or amount in subjects known to suffer from , or is known to be at risk for, a particular condition, or in subjects who are known to be free from a specific condition, ie "normal individuals".

In bepaalde uitvoeringsvormen, is een diagnostische of prognostische biomarker gecorreleerd aan een aandoening of ziekte door alleen maar aanwezig of afwezig te zijn. In andere uitvoeringsvormen kan een drempelwaarde van een diagnostische of prognostische biomarker worden vastgesteld en kan het niveau van de indicator in een subjectmonster eenvoudig worden vergeleken met het drempelniveau.In certain embodiments, a diagnostic or prognostic biomarker is correlated to a condition or disease simply by being present or absent. In other embodiments, a threshold value of a diagnostic or prognostic biomarker can be determined and the level of the indicator in a subject sample can be easily compared to the threshold level.

Zoals opgemerkt kunnen in sommige uitvoeringsvormen meervoudige bepalingen van één of meerdere diagnostische of prognostische biomarkers gebeuren en een tijdelijke verandering in marker kan worden gebruikt voor het stellen van een diagnose of prognose. Zo kan bijvoorbeeld een diagnostische marker worden bepaald op een begintijdstip en daarna weer op een tweede tijdstip. In dergelijke uitvoeringsvormen kan een toename van de marker vanaf het begintijdstip tot aan de tweede tijdstip diagnostisch zijn voor een bepaald type ziekte of een gegeven prognose. Evenzo kan een afname van de marker vanaf het begintijdstip tot aan het tweede tijdstip indicatief zijn voor een bepaald type ziekte of een gegeven prognose. Bovendien kan de mate van verandering van één of meerdere markers gerelateerd zijn aan de ernst van de ziekte en toekomstige ongunstige gebeurtenissen.As noted, in some embodiments, multiple determinations of one or more diagnostic or prognostic biomarkers can be made and a temporary change in marker can be used to make a diagnosis or prognosis. For example, a diagnostic marker can be determined at a starting time and then again at a second time. In such embodiments, an increase in the marker from the start time to the second time may be diagnostic for a particular type of disease or a given prognosis. Similarly, a decrease in the marker from the starting time to the second time may be indicative of a certain type of disease or a given prognosis. In addition, the rate of change of one or more markers may be related to the severity of the disease and future adverse events.

De vakkundige zal begrijpen dat terwijl in bepaalde uitvoeringsvormen vergelijkende metingen kunnen worden gedaan van dezelfde diagnostische marker op meerdere tijdstippen, men een gegeven marker ook kan meten op één tijdstip en een tweede marker op een tweede tijdstip en een vergelijking van deze markers diagnostische informatie kan opleveren.Those skilled in the art will appreciate that while in certain embodiments comparative measurements can be made of the same diagnostic marker at multiple times, one can also measure a given marker at one time and a second marker at a second time and a comparison of these markers can provide diagnostic information .

Met betrekking tot de stap van het aanleveren van een biologisch monster van een subject, heeft de term "biologisch monster" zoals hier gebruikt betrekking op lichaamsvocht of -weefsel dat potentieel een KH-domein bindend miRNA bevat. In sommige uitvoeringsvormen kan het biologische monster bijvoorbeeld een bloedmonster zijn, een serummonster, een plasmamonster, of subfracties daarvan.Regarding the step of delivering a biological sample from a subject, the term "biological sample" as used herein refers to body fluid or tissue that potentially contains a KH domain binding miRNA. For example, in some embodiments, the biological sample may be a blood sample, a serum sample, a plasma sample, or subfractions thereof.

Ons nu wendend tot de stap van het identificeren van één of meerdere markers in het biologische monster, kunnen diverse methoden die bekend zijn bij de vakkundigen worden gebruikt voor het identificeren van één of meerdere markers in het geleverde biologische monster. In sommige uitvoeringsvormen wordt het bepalen van de hoeveelheid KH-domein bindend miRNA uitgevoerd door middel van een explorator (bijv., een nucleïnezuur explorator) voor het selectief binden of hybridiseren met het miRNA. Met andere woorden, in bepaalde uitvoeringsvormen kunnen bekende KH-domein bindend miRNA-sequentiegegevens worden gebruikt voor het samenstellen van explorators die KH-domein bindende miRNA strengen in een monster vinden en ermee hybridiserenom daardoor de miRNA strengen door selectieve binding te vangen.Turning now to the step of identifying one or more markers in the biological sample, various methods known to those skilled in the art can be used to identify one or more markers in the supplied biological sample. In some embodiments, determining the amount of KH domain binding miRNA is performed by an explorator (e.g., a nucleic acid explorator) for selectively binding or hybridizing with the miRNA. In other words, in certain embodiments, known KH domain binding miRNA sequence data can be used to assemble explorators that find KH domain binding miRNA strands in a sample and thereby hybridize to thereby capture the miRNA strands by selective binding.

De term "selectieve binding" zoals hier gebruikt heeft betrekking op de mate waarin een explorator specifiek kan hybridiseren metr een doelpolynucleotide. Zo zal in het geval van een miRNA, de explorator bestaan uit een polynucleotidesequentie die complementair, of in essentie complementair, is aan ten minste een deel van de miRNA-sequentie. Nucleïne zuursequenties die "complementair" zijn, zijn base-parend conform de standaard Watson-Crick complementariteitsregels. Zoals hier gebruikt, betekent de term "complementariteitsequenties" nucleïnezuursequenties die substantieel complementair zijn, zoals kan worden onderzocht met dezelfde nucleotidevergelijking zoals hierboven uiteen gezet of zoals gedefinieerd als zijnde in staat tot het hybridiseren van het betreffende nucleïnezuursegment onder relatief stringente voorwaarden zoals hierin beschreven. Een bijzonder voorbeeld van een overwogen complementair nucleïnezuursegment is een antsense oligonucleotide. Met betrekking tot explorators hierin geopenbaard die een bindingsaffiniteit met RNA's hebben, kan de explorator 100% complementair zijn met de doel-i-polynucleotidesequentie. De explorator hoeft echter niet volledig complementair te zijn over de gehele lengte van het doelpolynucleotide zo lang als de explorator specifiek aan het doelpolynucleotide kan binden en dit uit het monster kan vangen.The term "selective binding" as used herein refers to the extent to which an explorator can specifically hybridize to a target polynucleotide. Thus, in the case of a miRNA, the explorator will consist of a polynucleotide sequence that is complementary, or essentially complementary, to at least a portion of the miRNA sequence. Nucleic acid sequences that are "complementary" are base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementarity sequences" means nucleic acid sequences that are substantially complementary, as can be investigated with the same nucleotide equation as set forth above or as defined as being capable of hybridizing the particular nucleic acid segment under relatively stringent conditions as described herein. A particular example of a contemplated complementary nucleic acid segment is an antsense oligonucleotide. With respect to explorators disclosed herein that have binding affinity with RNAs, the explorator can be 100% complementary to the target i polynucleotide sequence. However, the explorator need not be completely complementary over the entire length of the target polynucleotide as long as the explorator can specifically bind to the target polynucleotide and capture it from the sample.

Nucleïnezuurhybridisatie zal worden beïnvloed door condities zoals zoutconcentratie, temperatuur of organische oplosmiddelen, naast de basensamenstelling, lengte van de complementaire strengen, en het aantal niet passende nucleotidebasen tussen de hybridiserende nucleïnezuren, zoals door de vakkundige onmiddellijk zal worden erkend. Stringente temperatuurcondities zullen in het algemeen temperaturen zijn boven de 30 °C , meestal hoger dan 37 °C, en bij voorkeur hoger dan 45 °C. Stringente zoutcondities zullen normaal minder zijn 1000 mM, meestal minder dan 500 mM, en bij voorkeur minder dan 200 mM. De combinatie van parameters is echter veel belangrijker dan de maat van één enkele parameter. Het bepalen van geschikte hybridisatecondities om sequenties met hoge niveaus van homologie te identificeren en/of te isoleren is in het vakgebied goed bekend. Ten behoeve van het specificeren van zeer stricte condities, zijn voorkeurscondities een zoutconcentratie van ongeveer 200 mM en een temperatuurfactor van ongeveer 45 °C. Biomarkers in monsters omvatten een RNA-meetopstelling voor het meten van RNA-coderende biomarker polypeptiden in het monster en/of het gebruik van een proteïne meetopstelling voor het meten van biomarker polypeptiden in het monster.Nucleic acid hybridization will be influenced by conditions such as salt concentration, temperature or organic solvents, in addition to the base composition, length of the complementary strands, and the number of mismatched nucleotide bases between the hybridizing nucleic acids, as will be immediately recognized by those skilled in the art. Stringent temperature conditions will generally be temperatures above 30 ° C, usually higher than 37 ° C, and preferably higher than 45 ° C. Stringent salt conditions will normally be less than 1000 mM, usually less than 500 mM, and preferably less than 200 mM. However, the combination of parameters is much more important than the size of a single parameter. Determining suitable hybridization conditions to identify and / or isolate sequences with high levels of homology is well known in the art. For the purpose of specifying very strict conditions, preferred conditions are a salt concentration of about 200 mM and a temperature factor of about 45 ° C. Biomarkers in samples include an RNA measuring arrangement for measuring RNA-encoding biomarker polypeptides in the sample and / or the use of a protein measuring arrangement for measuring biomarker polypeptides in the sample.

In bepaalde uitvoeringsvormen van de methoden, kan het wenselijk zijn een controlemonster op te nemen dat gelijktijdig met het biologische monster of het testmonster wordt geanalyseerd, zo danig dat de resultaten verkregen uit het monster kunnen worden vergeleken met de resultaten verkregen uit het controlemonster. Daarnaast kunnen er standaard grafieken kunnen worden aangeboden waarmee analyseresultaten voor het biologische monster kunnen worden vergeleken. Dergelijke standaardgrafieken tonen niveaus in functie van toetseenheden, d.w.z. fluorescente signaalintensiteit, indien een fluorescent signaal wordt gebruikt.In certain embodiments of the methods, it may be desirable to include a control sample that is analyzed simultaneously with the biological sample or the test sample such that the results obtained from the sample can be compared to the results obtained from the control sample. In addition, standard graphs can be offered to compare analysis results for the biological sample. Such standard graphs show levels as a function of key units, i.e., fluorescent signal intensity, if a fluorescent signal is used.

De analyse van monsters kunnen afzoderlijk worden uitgevoerd of simultaan. Zo kunnen bijvoorbeeld meerdere markers worden gecombineerd in één test. Daarbij aansluitend zal een vakkundige de waarde van het testen van diverse markers in verschillende cellen herkennen. Zulke testen geven meer informatie ten aanzien van het potentiële therapeutische agens.The analysis of samples can be carried out separately or simultaneously. For example, multiple markers can be combined in one test. In addition, a skilled person will recognize the value of testing various markers in different cells. Such tests provide more information regarding the potential therapeutic agent.

De analyse van markers kan bovendien worden uitgevoerd met uiteenlopende fysische formaten. Zo kan bijvoorbeeld het gebruik van microtiterplaten of automatisering worden gebruikt voor het vergemakkelijken van de verwerking van grote aantallen testmonsters of potentiële therapeutische agentia. Als alternatief kunnen afzonderlijke monsterformaten worden ontwikkeld om onmiddellijke behandeling en tijdige diagnose te vergemakkelijken zoals bijvoorbeeld tijdens transport per ambulance of op de eerstehulpafdeling.Moreover, the analysis of markers can be performed with a variety of physical formats. For example, the use of microtiter plates or automation can be used to facilitate the processing of large numbers of test samples or potential therapeutic agents. Alternatively, individual sample formats can be developed to facilitate immediate treatment and timely diagnosis such as, for example, during transport by ambulance or in the emergency department.

In sommige uitvoeringsvormen van de onderhavig geopenbaarde materie wordt een systeem voor het diagnosticeren van kanker in een subject geboden, of een systeem (bijv. een computersysteem) om te bepalen of profylaxe of behandeling moet worden begonnen of voortgezet of selectie van een potentieel therapeutisch agens moet worden uitgevoerd. Zulke systemen kunnen worden aangeboden, zoals bijvoorbeeld commerciële kits en apparaten die kunnen worden gebruikt voor het testen van een biologisch monster, of series biologische monsters van een subject. In sommige uitvoeringsvormen, heeft het systeem explorators om miRNA selectief te binden en middelen voor het detecteren van het binden van voornoemde explorators aan voornoemd miRNA. Het systeem kan ook bepaalde monsters bevatten om te gebruiken als controles. Het systeem kan verder één of meerdere standaardgrafieken bevatten die markerniveaus bieden als een functie van toetseenheden.In some embodiments of the subject matter disclosed, a system for diagnosing cancer in a subject is provided, or a system (e.g., a computer system) to determine whether prophylaxis or treatment should be started or continued or selection of a potential therapeutic agent are carried out. Such systems can be offered, such as, for example, commercial kits and devices that can be used to test a biological sample, or series of biological samples from a subject. In some embodiments, the system has explorators for selectively binding miRNA and means for detecting binding of said explorators to said miRNA. The system may also contain certain samples for use as controls. The system may further contain one or more standard graphs that offer marker levels as a function of test units.

Zoals hier gebruikt verwijst de term "behandelend" of "behandeling" naar iedere behandeling van een ziekte of stoornis waaronder maar niet beperkt tot, therapeutische behandeling en profylactische behandeling van een ziekte of stoornis. Als zodanig omvatten de termen "behandelen" of "behandeling", maar zijn niet beperkt tot, het remmen van de voortschrijding van een ziekte of stoornis, het stoppen van de ontwikkeling van een ziekte of stoornis, verminderen van de ernst van een ziekte of stoornis, verbeteren of verlichten van één of meerdere symptomen geassocieerd met een ziekte of stoornis en het veroorzaken van een regressie van een ziekte of stoornis of één of meer symptomen geassocieerd met een ziekte of stoornis.As used herein, the term "treating" or "treatment" refers to any treatment of a disease or disorder including, but not limited to, therapeutic treatment and prophylactic treatment of a disease or disorder. As such, the terms "treat" or "treatment" include, but are not limited to, inhibiting the progression of a disease or disorder, stopping the development of a disease or disorder, reducing the severity of a disease or disorder , improving or alleviating one or more symptoms associated with a disease or disorder and causing a regression of a disease or disorder or one or more symptoms associated with a disease or disorder.

Geschikte methoden voor het toedienen van een farmaceutisch agens in overeenstemming met de methoden van de onderhavig geopenbaarde materie omvatten, maar zijn niet beperkt tot, systemische toediening, parenterale toediening (waaronder intravasculaire, intramusculaire en/of intraarteriële toediening), orale toedoening, buccale toediening, rectale toediening, subcutane toediening, intraperitonele toediening, inademing, intratracheale installatie, chirurgisch implanteren, transdermale vrijgave, plaatselijke injectie, intranasale toediening, en hypervelocity injectie/beschieting. Waar van toepassing, kan doorlopende infusie, medicijnaccumulatie op de doellocatie vergroten.Suitable methods of administering a pharmaceutical agent in accordance with the methods of the subject matter disclosed include, but are not limited to, systemic administration, parenteral administration (including intravascular, intramuscular and / or intraarterial administration), oral administration, buccal administration, rectal administration, subcutaneous administration, intraperitoneal administration, inhalation, intratracheal installation, surgical implantation, transdermal release, local injection, intranasal administration, and hypervelocity injection / bombardment. Where applicable, continuous infusion may increase medication accumulation at the target site.

Afgezien van de toedieningsroute, worden de farmaceutische agentia gebruikt in overeenstemming met de onderhavig geopenbaarde materie meestal toegediend in hoeveelheden die effectief zijn voor het realiseren van de gewenste respons . Als zodanig wordt de term "effectieve hoeveelheid" hier gebruikt om te verwijzen naar een hoeveelheid farmaceutisch agens dat voldoende is voor het produceren van een meetbare biologische respons.Apart from the route of administration, the pharmaceutical agents used in accordance with the subject matter disclosed are usually administered in amounts effective to achieve the desired response. As such, the term "effective amount" is used herein to refer to an amount of pharmaceutical agent sufficient to produce a measurable biological response.

Bij voorkeur wordt een minimale dosis toegediend en wordt de dosis, bij afwezigheid van een dosislimiterende toxiciteit, verhoogd tot een minimaal effectieve hoeveelheid. Het vaststellen en aanpassen van een therapeutisch effectieve dosis alsmede evaluatie van wanneer en hoe aanpassingen uit te voeren zijn bekend bij de vakkundigen.Preferably a minimum dose is administered and the dose is increased to a minimum effective amount in the absence of a dose-limiting toxicity. Determining and adjusting a therapeutically effective dose as well as evaluating when and how to make adjustments are known to those skilled in the art.

Met betrekking tot de onderhavig geopenbaarde materie, is een preferent subject een gewerveld subject. Een preferente gewervelde is warmbloedig; een preferente warmbloedige gewervelde is een zoogdier. Een preferent zoogdier is liefst een mens. Zoals hier gebruikt omvat de term "subject" zowel menselijke als dierlijke subjecten.With regard to the subject matter disclosed, a preferred subject is a vertebrate subject. A preferred vertebrate is warm-blooded; a preferred warm-blooded vertebrate is a mammal. A preferred mammal is preferably a human. As used herein, the term "subject" includes both human and animal subjects.

In de praktijk van onderhavig geopenbaarde materie kunnen worden ingezet, tenzij anders aangegeven, conventionele technieken voor celbiologie, celcultuur, moleculaire biologie, transgenetische biologie, microbiologie, recombinant-DNA en immunologie die binnen het vakgebied toepassing vinden. Dergelijke werkwijzen worden in de literatuur volledig uitgelegd. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïne kunnen betrokkken zijn bij diverse functies, zoals maar niet gelimiteerd tot splitsen, transcriptie, signaal overdracht, localisatie, translatie, cholesterolmetabolisme, stresrespons, celverplaatsing, axogenese, axonale regeneratie, synaptische plasticiteit, stabilisatie of biosynthese van afgewerkt piRNA. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïnen kunnen betrokkken zijn bij het splitsen. Zij kunnen nucleaire en mitochondriale splitsing reguleren en alternatief splitsende varianten van belangrijke genen induceren. Zij kunnen fusietranscripties induceren met benedenstroomse genen. Zij kunnen invloed uitoefenen op de selectie van de mRNA-splitsingslocatie en exoninclusie die fosforylatie-afhankelijk kan zijn. Zij kunnen exoninclusie in transcripties die onderhevig zijn aan weefselspecifieke alternatieve splitsing mediëren en zij kunnen nodig zijn voor de vroege fasen van spliceosoomassemblage. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïnen kunnen betrokkken zijn bij transcriptie. Zij kunnen subunits van coactivator complexen zijn die een belangrijke rol spelen in gentransactivatie. Zij kunnen belangrijk zijn in transcriptionele regulering door als transfactors op te treden bij het reguleren van de genexpressie. Zij kunnen heterochromatinevorming induceren en RNA-secundaire structuur wijzigen. Zij kunnen optreden als transcriptiemodulators via de interactie met en het deel uitmaken van lang intergenisch RNA. Zij kunnen werken als of een interactie aangaan met ATP-afhankelijke DNA-helicasen. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïnen kunnen betrokkken zijn bij signaaltransductie. Zij kunnen betrokken zijn bij het cAMP-afhankelijke signaaltransductiepad, Wnt-signaleringspad of het EGFR signalerend pad. Zij kunnen binden aan HDL en kunnen te hoge cholesterolniveaus in cellen reguleren. Zij kunnen betrokken zijn bij het sterolsignaleringspad. Zij kunnen betrokken zijn bij het LXR- en LRP-pad. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïnen kunnen betrokkken zijn bij RNA-lokalisatie. Zij kunnen RNA leiden naar specifieke cellulaire compartimenten en spelen zo een rol bij intracellulair RNA-transport en bij het reguleren van lokale translatie van doel-mRNA's. Ze zijn belangrijk voor RNA-lokalisatie en oppervlaktelevering. Zij kunnen pendelen tussen de nucleus en het cytoplasma. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïnen kunnen betrokken zijn bij translatie. Zij kunnen vereist zijn voor 40S ribosoombiogenese, het verwerken van pre-18S ribosomaal RNA en ribosoomassemblage. Zij kunnen geassocieerd zijn met polyribosomen, voornamelijk met de 60S ribosomale subunit. Zij kunnen onderdeel uitmaken van complexen die binden aan het mRNA-eindstuk en translationele repressie mediëren. Zij kunnen de snelheid en locatie moduleren waarmee en waarop doeltranscripties het translâtieapparaat tegen komen. Zij kunnen binden aan het 5' UTR en 3'UTR van mRNA en aldus hun translatie reguleren.Unless otherwise stated, conventional cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology techniques that are used in the art can be used in the practice of this subject matter. Such methods are fully explained in the literature. KH domain binding miRNAs and / or KH domain containing protein can be involved in various functions, such as but not limited to cleavage, transcription, signal transfer, localization, translation, cholesterol metabolism, stress response, cell displacement, axogenesis, axonal regeneration, synaptic plasticity, stabilization or biosynthesis of finished piRNA. KH domain binding miRNAs and / or KH domain containing proteins may be involved in cleavage. They can regulate nuclear and mitochondrial cleavage and alternatively induce cleavage variants of important genes. They can induce fusion transcripts with downstream genes. They may influence the selection of the mRNA cleavage site and exon inclusion that may be phosphorylation dependent. They may mediate exon inclusion in transcripts that are subject to tissue-specific alternative cleavage, and they may be necessary for the early stages of spliceosome assembly. KH domain binding miRNAs and / or KH domain containing proteins may be involved in transcription. They can be subunits of coactivator complexes that play an important role in gene transactivation. They can be important in transcriptional regulation by acting as transfactors in regulating gene expression. They can induce heterochromatin formation and alter RNA-secondary structure. They can act as transcription modulators through interaction with and being part of long intergenic RNA. They can act as or interact with ATP-dependent DNA helicases. KH domain binding miRNAs and / or KH domain containing proteins may be involved in signal transduction. They may be involved in the cAMP-dependent signal transduction path, Wnt signaling path or the EGFR signaling path. They can bind to HDL and can regulate high levels of cholesterol in cells. They may be involved in the sterol signaling path. They may be involved in the LXR and LRP path. KH domain binding miRNAs and / or KH domain containing proteins may be involved in RNA localization. They can direct RNA to specific cellular compartments and thus play a role in intracellular RNA transport and in regulating local translation of target mRNAs. They are important for RNA localization and surface delivery. They can commute between the nucleus and the cytoplasm. KH domain binding miRNAs and / or KH domain containing proteins may be involved in translation. They may be required for 40S ribosome biogenesis, processing of pre-18S ribosomal RNA and ribosome assembly. They may be associated with polyribosomes, primarily with the 60S ribosomal subunit. They can be part of complexes that bind to the mRNA end piece and mediate translational repression. They can modulate the speed and location with which and at which target transcripts encounter the translation device. They can bind to the 5 'UTR and 3'UTR of mRNA and thus regulate their translation.

Zij kunnen de associatie reguleren van constitutief transportelement (CTE)-bevattend mRNA met grote polyribosomen en aldus translatie initiëren. Zij kunnen gelocaliseerde mRNA-translatie reguleren, een cruciaal proces voor celpolariteit en celmigratie. Bij het uitgroeien van neurieten kunnen ze belangrijke regulators van groeiconusgeleiding en neuronale cel migratie zijn, vermoedelijk via de spatiotemporale fijnafstemming van proteïnesynthese. KH-domein bindende miRNA' s en/of KH-domein bevattend proteïnen kunnen betrokkken zijn bij stresresponses. Zij kunnen een belangrijke rol spelen in p53/TP53-respons op DNA-schade, de inductie van apoptose, cel cyclusstop in G(2)-M en G2-M progressie. Tijdens celstress, zoals oxidatieve stress of hitteschok kunnen zij doel-mRNA's stabiliseren die worden aangetrokken naar stressgranules. KH-domein bindende miRNA's en/of KH-domein bevattend proteïnen kunnen betrokkken zijn bij RNA-stabilisatie. Zij kunnen doel transscripties aantrekken voor cytoplasmische proteïne-RNA complexen (mRIMP's). Zij kunnen colocaliseren met decapperende factor en Argonaut-proteïnen binnen P-(processing)lichamen. Zij kunnen een interactie aangaan met de polynucleotidefosforylasefamilie, die bestaat uit fosfaatafhankelijk 3'-tot-5' exoribonucleasen betrokken bij RNA-verwerking en degradatie. Zij kunnen een component zijn van een mitochondriaal degradosoom (mtEXO) complex en spelen een rol in RNA-celbewaking door het opruimen van oxiderende RNA's. Zij kunnen een rol spelen in myelinisatie door beïnvloeding van de stabiliteit van mRNA's zoals MBP. KH-domein bindende miRNA's en/of KH-domein bevattende proteïnen kunnen betrokken zijn bij primaire piRIMA biogenese door deel te nemen aan het verwerken van 31-37 nt intermediairen naar mature piRNA's.They can regulate the association of constitutive transport element (CTE) containing mRNA with large polyribosomes and thus initiate translation. They can regulate localized mRNA translation, a crucial process for cell polarity and cell migration. In neurite outgrowth, they can be important regulators of growth cone conduction and neuronal cell migration, presumably through the spatial-fine tuning of protein synthesis. KH domain binding miRNAs and / or KH domain containing proteins may be involved in stress responses. They can play an important role in p53 / TP53 response to DNA damage, apoptosis induction, cell cycle stop in G (2) -M and G2-M progression. During cell stress, such as oxidative stress or heat shock, they can stabilize target mRNAs that are attracted to stress granules. KH domain binding miRNAs and / or KH domain containing proteins may be involved in RNA stabilization. They may attract target transcripts for cytoplasmic protein-RNA complexes (mRIMPs). They can colocalize with decapping factor and Argonaut proteins within P (processing) bodies. They can interact with the polynucleotide phosphorylase family, which consists of phosphate-dependent 3 'to 5' exoribonucleases involved in RNA processing and degradation. They can be a component of a mitochondrial degradosome (mtEXO) complex and play a role in RNA cell monitoring by clearing up oxidizing RNAs. They can play a role in myelination by influencing the stability of mRNAs such as MBP. KH domain binding miRNAs and / or KH domain containing proteins may be involved in primary piRIMA biogenesis by participating in the processing of 31-37 nt intermediates into mature piRNAs.

Derhalve kan het veranderen van de interactie tussen een KH-bindend miRNA en een KH-domein bevattend proteïne rechtstreeks bijdragen aan het fenotype waargenomen in KH-domein bindende miRNA's en KH-domein bevattende proteïne gereguleerde cellen, bij voorkeur tumorcellen of cellen van het centrale zenuwstelsel, en nog liever tumorcellen of neuronale cellen.Thus, changing the interaction between a KH-binding miRNA and a KH-domain-containing protein can directly contribute to the phenotype observed in KH-domain-binding miRNAs and KH-domain-containing protein-regulated cells, preferably tumor cells or central nervous system cells , and more preferably, tumor cells or neuronal cells.

MicroRNA's en derhalve ook KH-domein bindende microRNA's hebben diverse potentiële mechanismen voor transcriptionele regulatie. Zij remmen het starten van de translatie door het beïnvloeden van translatie-initiatie factoren, capherkenning, 40S kleine ribosomale subunit-recrutering, opnemen van de 60S subunit en het formeren van het 60S ribosomaal complex. miRNA's zijn betrokken bij het remmen van de verlenging door ribosomen, door ze ertoe aan te zetten mRNA af te werpen en/of de degradatie van nieuw gesynthetiseerde peptiden te vergemakkelijken. Binden van miRNA kan RNA decapping en/of deadenylerende enzymen aantrekken hetgeen kan leiden tot mRNA-destabilisatie. P-lichamen zijn de belangrijkste cellulaire organeilen voor de degradatie en opslag van miRNA-mRNA-complexen.MicroRNAs and therefore also KH domain binding microRNAs have various potential mechanisms for transcriptional regulation. They inhibit translation initiation by influencing translation initiation factors, cap recognition, 40S small ribosomal subunit recruitment, incorporation of the 60S subunit and formation of the 60S ribosomal complex. miRNAs are involved in inhibiting elongation by ribosomes, encouraging them to shed mRNA and / or facilitating the degradation of newly synthesized peptides. Binding of miRNA can attract RNA decapping and / or de-adenylating enzymes which can lead to mRNA destabilization. Β-bodies are the most important cellular organeilen for the degradation and storage of miRNA-mRNA complexes.

Onverwacht worden diverse miRNA's gekenmerkt door KH-domein bindende sequenties. Verder zijn zowel KH-domein bevattende proteïnen en KH-bindende microRNA's betrokken bij dezelfde paden en processen. Derhalve hebben KH-domein bevattende proteïnen functionele interactie en binden zij aan KH-domein bevattende microRNA's. Wisselwerking van KH-domein bevattende proteïnen met KH-domein bindende miRNA's kan alle bovenstaand genoemde functies van KH-bevattende proteïnen beïnvloeden, en vice versa.Unexpectedly, various miRNAs are characterized by KH domain binding sequences. Furthermore, both KH domain-containing proteins and KH-binding microRNAs are involved in the same pathways and processes. Thus, KH domain-containing proteins have functional interaction and bind to KH domain-containing microRNAs. Interaction of KH domain-containing proteins with KH domain binding miRNAs can affect all of the above-mentioned functions of KH-containing proteins, and vice versa.

Vanaf dit punt kunnen cellysaten, celfracties en complete cellen worden gebruikt om het onderliggende mechanisme van KH-domein bevattende proteïnen gereguleerde genexpressie te begrijpen, voornamelijk vanwege de experimentele manipuleerbaarheid van het celtype. Het is belangrijk om te benadrukken dat voorzichtigheid moet worden geboden bij het afleiden vanmoleculaire mechanismen door extrapolatie van het ene celtype naar een ander.From this point on, cell lysates, cell fractions and whole cells can be used to understand the underlying mechanism of KH domain-containing proteins regulated gene expression, primarily due to the experimental manipulation of the cell type. It is important to emphasize that caution must be exercised when deriving molecular mechanisms by extrapolation from one cell type to another.

Technieken die kunnen worden gebruikt voor het onderzoeken van verdere interactie tussen KH-domein bindende proteïnen en KH-domein bindende microRNA's of voor het karakteriseren van potentiële therapeutische agentia kunnen zijn maar zijn niet beperkt tot microarray hybridisatie, RNA-sequencing, RNA-mmunoprecipitatie, UV-crosslinked immunoprecipitatie, Ago2-cross-linked immunoprecipitatie, Ab proteïne-RNA immunoprecipitatie, mutational analyse, in-line probing, Western blotting, Electrophoretic Mobility Shift Assay's, Neurosphere formatie, transwell-migratie, wondheling, sprouting, zachte agar kolonievormingtoets, FACS-analyse, immunochemie.Techniques that can be used to investigate further interaction between KH domain binding proteins and KH domain binding microRNAs or to characterize potential therapeutic agents may be but are not limited to microarray hybridization, RNA sequencing, RNA mmunoprecipitation, UV -cross-linked immunoprecipitation, Ago2-cross-linked immunoprecipitation, Ab protein-RNA immunoprecipitation, mutational analysis, in-line probing, Western blotting, Electrophoretic Mobility Shift Assay, Neurosphere formation, transwell migration, wound healing, sprouting, soft agar colony formation test, FACS- analysis, immunochemistry.

De uitvinding wordt in meer detail beschreven door de volgende niet uitputtende voorbeelden.The invention is described in more detail by the following non-exhaustive examples.

VOORBEELDENEXAMPLES

Celcultuur, transfectie en transductie.Cell culture, transfection and transduction.

Alle cellijnen worden gekweekt bij 37°C in een atmosfeer met 5% C02.All cell lines are grown at 37 ° C in an atmosphere with 5% CO2.

Specifieke cellijnen die worden gebruikt zijn: SH-SY5Y neuroblastoom cellijn; HT22 neuronale cellijn; 9L gliosarcoom cellijn; A172, U87 XXX, U373, LN229, LN428, LN308 giioblastoom cellijnen; GL261 muisglioomcellijn; BOSC 23 astrocyt cellijn; D283, Daoy cellen medulloblastoom cellijnen of H06/M0313K6-1C oligodendrogliale cel lijn. Deze cellijnen exprimeren endogeen één of meerdere van de afgewerkte KH-domein bindende miRNA's, hun overlappende transcripties en/of de KH-domein bevattende proteïnen. In deze cellijnen die de KH domein bevattende proteïnen tot uitdrukking brengen, kan het endogene proteïne worden uitgeput of geëlimineerd en/of genetisch gemodificeerd om het KH-domein bevattende proteïne exogeen te produceren.Specific cell lines that are used are: SH-SY5Y neuroblastoma cell line; HT22 neuronal cell line; 9L gliosarcoma cell line; A172, U87 XXX, U373, LN229, LN428, LN308 gioblastoma cell lines; GL261 mouse glioma cell line; BOSC 23 astrocyte cell line; D283, Daoy cells, medulloblastoma cell lines or H06 / M0313K6-1C oligodendroglial cell line. These cell lines endogenously express one or more of the finished KH domain binding miRNAs, their overlapping transcripts, and / or the KH domain containing proteins. In these cell lines that express the KH domain-containing proteins, the endogenous protein can be depleted or eliminated and / or genetically modified to exogenously produce the KH domain-containing protein.

Voorbeeld 1: reportersamenstellingenExample 1: reporter compositions

De volgende KH-domein bindende miRNA's of overlappende transcripties werden geselecteerd als KH-domein bindende miRNA's of RNA's vanwege de aanwezigheid van een KH-domein bindende sequentie miRNA-125b-5p, pre-miRNA-125b-l, pri-miRNA-125b-l, miRNA-199b-5p, pre-miRNA-199b, pri-miRNA-199b, miRNA-7-2-3p, miRNA-7-3-3p pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri- -miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, of pri-miR-33b, miR-lOOHG, miR-7-3HG, DLEU2.The following KH domain binding miRNAs or overlapping transcripts were selected as KH domain binding miRNAs or RNAs due to the presence of a KH domain binding sequence miRNA-125b-5p, pre-miRNA-125b-1, pri-miRNA-125b- 1, miRNA-199b-5p, pre-miRNA-199b, prim-miRNA-199b, miRNA-7-2-3p, miRNA-7-3-3p pre-miRNA-7-2, pre-miRNA-7-3 , prim-miRNA-7-2, prim-miRNA-7-3, miR-3613-5p, pre-miR-3613, prim-miR-3613, miR-33b-5p, pre-miR-33b, or pri -miR-33b, miR-100HG, miR-7-3HG, DLEU2.

Lentiviraal reportersamenstellingen voor miRNA activiteit worden geassembleerd door het introduceren van de complementaire sequenties van afgewerkt miRNA-125b-5p, afgewerkt miRNA-199b-5p, afgewerkt miRNA-7-2-3p, afgewerkt miRNA-7-3-3p, afgewerkt miR-3613-5p en afgewerkt miR-33b-5p en een linker sequentie (meervoudige cloneringslocatie zonder detecteerbare herkenning door natuurlijke miRNA's) als een negatieve controle stroomafwaarts van een luciferase-reportergen.Lentiviral reporter compositions for miRNA activity are assembled by introducing the complementary sequences of finished miRNA-125b-5p, finished miRNA-199b-5p, finished miRNA-7-2-3p, finished miRNA-7-3-3p, finished miR- 3613-5p and finished miR-33b-5p and a linker sequence (multiple cloning location without detectable recognition by natural miRNAs) as a negative control downstream of a luciferase reporter gene.

Voor iedere afgewerkt miRNA worden 2 plasmiden samengesteld -pCMV-VuurvliegLuc_miRTS_PUR plasmide en een pCMV-Renilia_miRTS_PUR plasmide. In het pCMV-FireflyLuc plasmide worden één tot vijf tandem miRTS (doellocaties) gekloond, stroomafwaarts van een vuurvliegluciferase ORF (met een stop-codon), die wordt aangestuurd door een CMV-promotor. Deze doellokaties dienen in hun geheel als een kunstmatige 3' UTR voor vuurvlieg-luciferasetranscriptie. De sequentie 1-8 in de doellocaties is complementair aan de kiem sequentie van ieder doel. De sequenties volgend op de doellokaties zijn complementair met de nucleotideposities in de afgewerkt miR. De overbijvende sequentie in het midden zal niet annealen met de afgewerkte miR's, en zal een "bult"constructie vormen wanneer de miR's annealen aan de RNA-transcriptie van doellokaties. Deze vuurvlieg Luc_miRTS_PUR cassette wordt verder gekloond in een lentivirusruggengraat. In de pCMV-RenillaLuc_miRTS_PUR plasmide, wordt het vuurvlieg luciferase ORF vervangen door een renillaluciferase ORF. pCMV-FireflyLuc_miRTS_PUR en pCMV-RenillaLuc_miRTS_PUR plasmiden worden gebruikt om lentivirusdeeltjes te genereren in 293T cellen, die dan worden gebruikt voor het infecteren van de verschillende cell —ilijnen. Geïnfecteerde hersencellijnen worden geselecteerd met Puromycin (2 mg/L) en door klonen geëxpandeerd. Deze klonen worden in opeenvolgende experimenten gebruikt.For each finished miRNA, 2 plasmids are compiled -pCMV-fireflyLuc_miRTS_PUR plasmid and a pCMV-Renilia_miRTS_PUR plasmid. In the pCMV FireflyLuc plasmid, one to five tandem miRTS (target locations) are cloned downstream of a firefly luciferase ORF (with a stop codon), which is driven by a CMV promoter. These target locations serve in their entirety as an artificial 3 'UTR for firefly-luciferase transcription. The sequence 1-8 in the target locations is complementary to the germ sequence of each target. The sequences following the target locations are complementary to the nucleotide positions in the finished miR. The supernatant sequence will not anneal to the finished miRs, and will form a "bump" construction when the miRs anneal to the RNA transcription of target sites. This firefly Luc_miRTS_PUR cassette is further cloned into a lentivirus backbone. In the pCMV-RenillaLuc_miRTS_PUR plasmid, the firefly luciferase ORF is replaced by a renillaluciferase ORF. pCMV-FireflyLuc_miRTS_PUR and pCMV-RenillaLuc_miRTS_PUR plasmids are used to generate lentivirus particles in 293T cells, which are then used to infect the different cell lines. Infected brain cell lines are selected with Puromycin (2 mg / L) and expanded by cloning. These clones are used in successive experiments.

In een experiment worden de klonen (25.000 cellen per well op 24-wells platen) van de verschillende cellijnen getransfecteerd met 0,5 nM en 5 nM miR mimetics die kunnen worden verwerkt tot afgewerkt miR in cellen. De activiteiten van vuurvliegluciferase in mimetics getransfecteerde cellen worden significant verminderd. In een ander experiment, worden de klonen (25.000 cellen per well op 24-well platen) van de verschillende cellijnen getransfecteerd met 10 nM synthetische inhibitors die kunnen hybridiseren met endogeen miR en derhalve de werking ervan blokkeren. De activiteiten van vuurvliegluciferase in miR inhibitors getransfecteerde cellen worden significant verhoogd. Beide experimenten worden uitgevoerd in 6 herhaalde kopieën.In one experiment, the clones (25,000 cells per well on 24-well plates) of the different cell lines are transfected with 0.5 nM and 5 nM miR mimetics that can be processed into finished miR in cells. The activities of firefly luciferase in mimetics transfected cells are significantly reduced. In another experiment, the clones (25,000 cells per well on 24-well plates) of the different cell lines are transfected with 10 nM synthetic inhibitors that can hybridize with endogenous miR and therefore block its action. The activities of firefly luciferase in miR inhibitors transfected cells are significantly increased. Both experiments are performed in 6 repeated copies.

Voorbeeld 2: Identificatie van KH-domein bindende miR modulators.Example 2: Identification of KH domain binding miR modulators.

In één experiment, worden de klonen (25.000 cellen per well in 24-well platen) behandeld met medicijnen en biologische preparaten in groeimedia. Een eerste screening van >1000 verbindingen wordt uitgevoerd. Verbindingen met een eindconcentratie van 10 μΜ worden aan iedere well toegevoegd. Alle verbindingen worden opgeslagen aan een 10 mM concentratie in DMSO om de DMSO-concentratie in de feitelijke screening te houden op 0,1%, daarmee toxiciteit minimaliserend. Cellen met een stabiele expressie van miR-reporter werden behandeld met DMSO in een bereik van 0,1-1%. Luciferasesignalen werden 48 uur na de behandeling bepaald. Additionele chemische modificaties van geselecteerde verbindingen worden geprepareerd en gescreend. Daarnaast worden andere bibliotheken van verbindingen gescreend op remmende of versterkende activiteit.In one experiment, the clones (25,000 cells per well in 24-well plates) are treated with drugs and biological preparations in growth media. A first screening of> 1000 compounds is performed. Compounds with a final concentration of 10 μΜ are added to each well. All compounds are stored at a 10 mM concentration in DMSO to keep the DMSO concentration in the actual screening at 0.1%, thereby minimizing toxicity. Cells with a stable expression of miR reporter were treated with DMSO in a range of 0.1-1%. Luciferase signals were determined 48 hours after treatment. Additional chemical modifications of selected compounds are prepared and screened. In addition, other libraries of compounds are screened for inhibitory or enhancing activity.

Voorbeeld 3: Specificiteit en effectiviteit van de geïdentificeerde verbindingen worden verder geëvalueerd door middel van kwantitatieve RT-PCR testen.Example 3: Specificity and effectiveness of the identified compounds are further evaluated by quantitative RT-PCR tests.

De primers voor de controlegenen (gelijkaardig oxysterol-bindend proteïne 9, SMEK homoloog 1, suppressor van mekl, rho GTPase activerend proteïne 12 en 22, EPH-receptor A5, EGF-gelijke repeats en discoidin I-gelijkaardig domein 3, ATP-bindende cassette, subfamilie A, lid 1) gebruikt in dit onderzoek worden ontworpen zoals hierin beschreven (zie onderstaand voorbeeld 6)The primers for the control genes (similar oxysterol-binding protein 9, SMEK homologue 1, mekl suppressor, rho GTPase activating proteins 12 and 22, EPH receptor A5, EGF-like repeats and discoidin I-like domain 3, ATP-binding cassette , subfamily A, paragraph 1) used in this study are designed as described herein (see Example 6 below)

Voorbeeld 4: Identificatie van modulators van KH-domein bindend miR en KH-domein bevattende proteïnenExample 4: Identification of modulators of KH domain binding miR and KH domain containing proteins

De modulators geïdentificeerd in bovenstaande stappen worden verder gebruikt in een ander experiment. De klonen (25.000 cellen per well op 24-well platen) van de verschillende cellijnen worden getransfecteerd met 10 nM synthetische Inhibitors die kunnen hybridiseren met endogene genen of transcripties van de endogeen tot uitdrukking gebrachte KH-domein bevattende proteïnen en blokkeren derhalve de werking ervan. De activiteiten van vuurvliegluciferase in getransfecteerde cellen zal veranderen wanneer er een interactie is tussen de KH-domein bindende miR's en de KH-bevattende proteïnen. Genetisch modificeren van de cellen om KH-domein bevattende proteïnen te elimineren of te versterken zal ook de activiteiten van het vuurvliegluciferase veranderen wanneer er een interactie is tussen de KH-domein bindende miR's en de KH-bevattende proteïnen. Die modulators die werden geïdentificeerd in de voorafgaande experimenten die een effect hebben op de interactie van een KH-domein bevattend proteïne met een KH-domein bindend miRNA zullen het effect versterken of het effect ongedaan maken na het verlagen, elimineren, verhogen (door exogeen proteïne) of tot overexpressie brengen van de KH-domein bevattende proteïnen.The modulators identified in the above steps are further used in another experiment. The clones (25,000 cells per well on 24-well plates) of the different cell lines are transfected with 10 nM synthetic inhibitors that can hybridize to endogenous genes or transcripts of the endogenously expressed KH domain-containing proteins and therefore block their action. The activities of firefly luciferase in transfected cells will change when there is an interaction between the KH domain binding miRs and the KH-containing proteins. Genetically modifying the cells to eliminate or enhance KH domain-containing proteins will also alter the firefly luciferase activities when there is an interaction between the KH domain binding miRs and the KH containing proteins. Those modulators identified in the previous experiments that have an effect on the interaction of a KH domain-containing protein with a KH domain binding miRNA will enhance the effect or undo the effect after lowering, eliminating, increasing (by exogenous protein) ) or overexpressing the KH domain-containing proteins.

Voorbeeld 5: Screening met hoge doorvoercapaciteit voor interessante verbindingenExample 5: Screening with high throughput for interesting connections

Dit voorbeeld beschrijft een screeningstest met een hoge doorvoercapaciteit voor het identificeren van kleine organische moleculen die de interactie tussen KH-domein bevattende proteïnen en KH-domein bevattend miRNA verstoren. Deze actieve kleine moleculen kunnen worden gebruikt als innoverende chemische hulpmiddelen om miRNA-functies en de moleculaire mechanismen van miRNA biogenese beter te begrijpen. Bovendien kunnen ze potentieel worden ontwikkeld tot nieuwe therapeutica, waaronder hersentumor en neurodegeneratieve agentia. De test met hoge doorvoercapaciteit bestaat uit een tweefasen screenings protocol, bestaande uit een eerste screening voor het identificeren van potentieel interessante verbindingen van collecties kleine moleculen en een tweede screening voor het evalueren en karakteriseren van de primaire actieve stoffen en het verkrijgen van een gedetailleerde structuur-activiteitsrelatie (SAR). SAR zal ook de ontwikkeling van hoogeffectieve en hoogspecifieke modificators sturen. SAR: De concentratie-responsdata voor de gehele hoge doorvoercapaciteit-screening wordt geplot en gemodelleerd door een logistische passing op basis van vier parameters en SAR-analyse wordt uitgevoerd volgens conventionele benaderingen. Maximale overeenkomende substructuren worden vervolgens uit iedere cluster die typisch tenminste drie verbindingen bevatten geëxtraheerd, die vervolgens worden gebruikt om de volledige screeningsverzameling te doorzoeken om alle analogen te vinden, inclusief niet-actieve verbindingen. Verbindingen met een gemeenschappelijke steigervorm vormen een reeks. Kandidaatreeksen en singletons worden gekozen voor vervolgonderzoekingen. Voor iedere lead of reeks wordt een geschikte bibliotheekontwerpmethode (bijv. puntsubstitutiebibliotheek of matrixbibliotheek) geselecteerd. Meestal worden precursors gesynthetiseerd en wordt een bibliotheek van 15-25 verbindingen geproduceerd voor analyse in bovenstaand beschreven testen. Na genereren van bioactiviteitresultaten, worden daaropvolgende cycli van bibliotheekontwerp, synthese en analyse uitgevoerd om één of meerdere hoogactieve verbindingen te verkrijgen.This example describes a screening test with a high throughput for identifying small organic molecules that disrupt the interaction between KH domain-containing proteins and KH domain-containing miRNA. These active small molecules can be used as innovative chemical tools to better understand miRNA functions and the molecular mechanisms of miRNA biogenesis. Moreover, they can potentially be developed into new therapeutics, including brain tumor and neurodegenerative agents. The test with high throughput consists of a two-phase screening protocol, consisting of a first screening to identify potentially interesting compounds from collections of small molecules and a second screening to evaluate and characterize the primary active substances and to obtain a detailed structural analysis. Activity Relationship (SAR). SAR will also direct the development of highly effective and highly specific modifiers. SAR: The concentration response data for the entire high throughput screening is plotted and modeled by a logistic fit based on four parameters and SAR analysis is performed according to conventional approaches. Maximum corresponding substructures are then extracted from each cluster that typically contains at least three compounds, which are then used to search the entire screening set to find all analogs, including inactive compounds. Connections with a common scaffolding form a series. Candidate series and singletons are chosen for follow-up studies. A suitable library design method (e.g., point substitution library or matrix library) is selected for each lead or series. Typically, precursors are synthesized and a library of 15-25 compounds is produced for analysis in the tests described above. After generating bioactivity results, subsequent cycles of library design, synthesis, and analysis are performed to obtain one or more high-activity compounds.

Er wordt verwacht dat de geïdentificeerde modulators een effect zullen hebben op fenotypische screeningen en in-vivoscreeningen.The identified modulators are expected to have an effect on phenotypic screenings and in vivo screenings.

Voorbeeld 6: Gebruik van miR-125b-l als een Biomarker voor hersenumoren en neurodegeneratïe.Example 6: Use of miR-125b-1 as a biomarker for brain tumors and neurodegeneratia.

Isolatie van de exosome fracties van serummonsters van patiënten met hersentumoren en/of neurodegeneratie worden uitgevoerd door middel van verschillende centrifugatiestappen en/of filtratiestappen.Isolation of the exosome fractions of serum samples from patients with brain tumors and / or neurodegeneration are performed by various centrifugation steps and / or filtration steps.

Detectie van mi RN A's geNorm pilotexperiment en data-analyseDetection of mi RN A's normed pilot experiment and data analysis

Een geNorm pilotexperiment wordt uitgevoerd voor het selecteren van geschikte, stabiel tot uitdrukking gebrachte referentie-miRNA's voor datanormalisatie door gebruik te maken van een set van 8 kandidaat referentie-miRNA's exosoommonsters op 10 representatieve monsters die behoren tot verschillende groepen (ten minste 3 monsters per subgroep). Data-analyse wordt uitgevoerd met Biogazelle's qbase+software. Deze software is ontwikkeld op basis van de nieuwste en beproefde kwantificering. Om de beste referentiegenen te bepalen, wordt gebruik gemaakt van de geNorm module in qbase+. geNorm is het meest populaire algoritme voor het vinden van stabiele referentiegenen. Uit deze analyse worden de drie meest stabiel uitgedrukte referentie-miRNA's verkozen voor verdere miRNA expressienormalisatie. RNA-extractie, RNA-kwaliteitscontroleA normed pilot experiment is performed to select suitable, stably expressed reference miRNAs for data normalization by using a set of 8 candidate reference miRNAs exosome samples on 10 representative samples belonging to different groups (at least 3 samples per subgroup) ). Data analysis is performed with Biogazelle's qbase + software. This software has been developed based on the latest and proven quantification. The geNorm module in qbase + is used to determine the best reference genes. geNorm is the most popular algorithm for finding stable reference genes. From this analysis, the three most stably expressed reference miRNAs are selected for further miRNA expression normalization. RNA extraction, RNA quality control

Monsterspecifieke gevalideerde benaderingen voor RNA-extractie (incusief DNase-behandeling) worden toegepast. RNA-kwaliteitsbewaking wordt geanalyseerd met het Agilent 2100 Bioanalyzer microfluidic chipbased system om de integriteit van het RNA te beoordelen.Sample-specific validated approaches to RNA extraction (including DNase treatment) are used. RNA quality monitoring is analyzed with the Agilent 2100 Bioanalyzer microfluidic chip-based system to assess the integrity of the RNA.

Expressieanalyse van miRNA-doelen waarin interesse is en referentie miRNA-doelenExpression analysis of miRNA targets that are of interest and reference miRNA targets

Er wordt gebruik gemaakt van de miScript miRNA PCR testen (Qiagen) die accurate en gevoelige expressieanalyse van miRNAs mogelijk maakt door middel van kwantitatieve PCR. Kort samengevat, wordt al het RNA reversief getranscribeerd met een universele RT-benadering, die miRNA-specifieke cDNA synthese van miRNAs en kleine RNA-controles mogelijk maakt. Daarop volgend wordt het verdunde RT-product versterkt door middel van een 12-cycli PCR-reactie. Ten slotte wordt een verdunning van hiervoor vermeerderde miRNA cDNA gebruikt als grondstof voor een SYBR-green gebaseerde qPCR reactie met miRNA specifieke forward primer en een universele reverse primer.The miScript miRNA PCR tests (Qiagen) are used that enable accurate and sensitive expression analysis of miRNAs by quantitative PCR. Briefly, all of the RNA is reversibly transcribed with a universal RT approach, which allows miRNA-specific cDNA synthesis of miRNAs and small RNA controls. Subsequently, the diluted RT product is amplified by a 12-cycle PCR reaction. Finally, a dilution of previously amplified miRNA cDNA is used as a raw material for a SYBR-green based qPCR reaction with miRNA specific forward primer and a universal reverse primer.

Alle qPCR-reacties worden uitgevoerd in 5 μΙ reacties in 384-well platen in duplo.All qPCR reactions are performed in 5 μΙ reactions in 384-well plates in duplicate.

Basis data-analyseBasic data analysis

Basis data-analyse wordt gedaan in qbase+. Deze software is ontwikkeld op basis van de nieuwste en beproefd kwantificeringsmodel met inbegrip van PCR-efficiëntiecorrectie, meervoudige normalisatie van referentiegen of algemene gemiddelde normalisatie, interrun-calibratie en onzekerheids-propagatie, en biedt talrijke hulpmiddelen voor kwaliteitscontrole.Basic data analysis is done in qbase +. This software has been developed based on the latest and proven quantification model including PCR efficiency correction, multiple standardization of reference gene or general average standardization, interrun calibration and uncertainty propagation, and offers numerous quality control tools.

Detectie van langere transcripties PrimePCR testen SYBR Green I based PrimePCR testen zijn ontworpen met gebruikmaking van de gevalideerde pipeline primerXL voor ontwerp en in-silico verificatie van hogekwaliteits testen.Detection of longer transcripts PrimePCR tests SYBR Green I based PrimePCR tests are designed using the validated pipeline primerXL for design and in-silico verification of high quality tests.

Alle testen zijn gevalideerd voor het natlab en geëvalueerd met de gouden standaardmethode van standaardgrafieken gebaseerd op een 6-punts 10-voudige verdunnings reeks met gebruik van synthetische sjablonen voor het creëren van een breed detectiebereik. De seriematige verdunning wordt toegepast voor het bepalen van testefficiëntie, gevoeligheid en lineariteit.All tests have been validated for the wetlab and evaluated with the gold standard method of standard graphs based on a 6-point 10-fold dilution series using synthetic templates to create a wide detection range. The serial dilution is used to determine test efficiency, sensitivity and linearity.

De prestaties en functionaliteit van de testen wordt verder geëvalueerd op gDNA, cDNA en non-template controles (IMTC). Daaropvolgend wordt Next Generation Sequencing van het amplicon uitgevoerd voor verificatie van de specificiteit.The performance and functionality of the tests is further evaluated on gDNA, cDNA and non-template checks (IMTC). Subsequently, Next Generation Sequencing of the amplicon is performed for verification of specificity.

Testontwerp en validatieTest design and validation

Aangepast primer-ontwerp wordt uitgevoerd met de gevalideerde pijplijn primerXL voor ontwerp en in-silico verificatie [verificatie met de computer] van de hoge kwaliteit testen. Met veel zorg wordt erop gelet testen te ontwerpen die vrij zijn van algemene SNP's en secundaire structuren. Voor genexpressieonderzoeken wordt bij voorkeur gewerkt met Intron Spanning testen. Als op die manier geen goede testen kunnen worden ontworpen, worden exogene testen gedaan.Custom primer design is performed with the validated primerXL pipeline for design and in-silico verification [computer verification] of high quality testing. Great care is taken to design tests that are free from general SNPs and secondary structures. For gene expression studies, we prefer to work with Intron Voltage tests. If good tests cannot be designed in this way, exogenous tests are done.

De primerXL pijplijn wordt ook gebruikt voor het ontwikkelen van de PrimePCR testen (Bio-Rad) die voldoet aan het hoogst beschikbare niveau van kwaliteit en specificiteit en die volledig is gevalideerd in overeenstemming met vastgelegde MIQE-procedures.The primerXL pipeline is also used to develop the PrimePCR tests (Bio-Rad) that meet the highest available level of quality and specificity and that have been fully validated in accordance with established MIQE procedures.

Alle testen zijn gevalideerd voor het natlab en geëvalueerd met de gouden standaardmethode van standaardgrafieken gebaseerd op een 6-punts 10-voudige verdunnings reeks met gebruik van synthetische sjablonen voor het creëren van een breed detectiebereik. De seriematige verdunning wordt toegepast voor het bepalen van testefficiëntie, gevoeligheid en lineariteit.All tests have been validated for the wetlab and evaluated with the gold standard method of standard graphs based on a 6-point 10-fold dilution series using synthetic templates to create a wide detection range. The serial dilution is used to determine test efficiency, sensitivity and linearity.

De prestaties en functionaliteit van de testen wordt verder geëvalueerd op gDNA, cDNA en non-template controles (NTC). Daaropvolgend zal microchip-elektroforese worden gebruikt ter verificatie van de specifiteit van de PCR-reacties. RNA-extractie, RNA-kwaliteitscontrole, gDNA- contaminatiebeoordelingThe performance and functionality of the tests is further evaluated on gDNA, cDNA and non-template checks (NTC). Subsequently, microchip electrophoresis will be used to verify the specificity of the PCR reactions. RNA extraction, RNA quality control, gDNA contamination assessment

Monsterspecifieke gevalideerde benaderingen voor RNA-extractie (incusief DNase-behandeling) worden toegepast. RNA-kwaliteitscontrole wordt geanalyseerd met het Agilent 2100 Bioanalyzer microfluidic chipbased systeem om de integriteit van het RNA te beoordelen. Voorafgaand aan cDNA-synthese, wordt een kwaliteitscontrolestap opgenomen om gDNA-contaminatie uit te sluiten. geNorm pilotexperiment en data-analyseSample-specific validated approaches to RNA extraction (including DNase treatment) are used. RNA quality control is analyzed with the Agilent 2100 Bioanalyzer microfluidic chip-based system to assess the integrity of the RNA. Prior to cDNA synthesis, a quality control step is included to exclude gDNA contamination. standard pilot experiment and data analysis

Een geNorm pilotexperiment wordt uitgevoerd voor het selecteren van geschikte, stabiel tot uitdrukking gebrachte referentiegenen voor datanormalisatie door gebruik te maken van een set van 8 kandidaat referentiegenen op 10 representatieve monsters die behoren tot verschillende groepen (ten minste 3 monsters per subgroep). Data-analyse wordt uitgevoerd met Biogazelle's qbase+ software (www.qbaseplus.com). Deze software is ontwikkeld op basis van het meest moderne en beproefde kwantificeringsmodel. Om de beste referentiegenen te bepalen, wordt gebruik gemaakt van de geNorm module in qbase+.A normed pilot experiment is performed to select suitable, stably expressed reference genes for data normalization by using a set of 8 candidate reference genes on 10 representative samples belonging to different groups (at least 3 samples per subgroup). Data analysis is performed with Biogazelle's qbase + software (www.qbaseplus.com). This software has been developed based on the most modern and proven quantification model. The geNorm module in qbase + is used to determine the best reference genes.

Uit deze analyse worden de drie meest stabiel tot uitdrukking gebrachte genen weerhouden voor verdere normalisatie van genexpressie. RT-qPCR en data-analyseFrom this analysis, the three most stably expressed genes are retained for further normalization of gene expression. RT-qPCR and data analysis

Voor het maken van profielen van genexpressie van genen waarin men geïnteresseerd is en van de gebruikte referentiegenen wordt gebruik gemaakt van gevalideerde benaderingen voor cDNA-synthese en verificatie van de kwaliteit van het geprepareerde cDNA, qPCR-versterking, en data-analyse. Alle metingen worden uitgevoerd in 384-well platen in een reactievolume van 5 pl. Iedere PCR reactie zal in duplo worden uitgevoerd.To create gene expression profiles of genes of interest and the reference genes used, validated approaches to cDNA synthesis and verification of the quality of the prepared cDNA, qPCR enhancement, and data analysis are used. All measurements are made in 384-well plates in a reaction volume of 5 µl. Each PCR reaction will be carried out in duplicate.

Data-analyse wordt uitgevoerd in Biogazelle's qbase+ (www.qbaseplus.com).Data analysis is performed in Biogazelle's qbase + (www.qbaseplus.com).

Detectie van KH-domein bevattende proteïnenDetection of KH domain-containing proteins

Detectie van KH-domein bevattende proteïnen wordt uitgevoerd in de exosoomfracties met behulp van conventionele ELISA-technieken.Detection of KH domain-containing proteins is performed in the exosome fractions using conventional ELISA techniques.

Claims (59)

CONCLUSIESCONCLUSIONS 1. Gebruik van een KH-domein bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattende het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH-domein van een proteïne.Use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, comprising testing the ability of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain of a protein. 2. Het gebruik waarop aanspraak wordt gemaakt in conclusie 1 waarin het KH-domein bindend miRNA een matuur miRNA, een matuur isomeer miRNA, een pre-miRNA, een pri-miRNA of iedere combinatie daarvan is.The use claimed in claim 1 wherein the KH domain binding miRNA is a mature miRNA, a mature isomeric miRNA, a pre-miRNA, a prim-miRNA or any combination thereof. 3. Het gebruik waarop aanspraak wordt gemaakt in conclusies 1 of 2 waarin het KH-domein bindend miRNA wordt geselecteerd uit miRNA-125b-5p, pre-miRNA-125b-l, pri-miRNA-125b-l, miRNA-199b-5p, pre-miRNA-199b, pri-miRNA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri-miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, of pri-miR-33b.The use claimed in claims 1 or 2 wherein the KH domain binding miRNA is selected from miRNA-125b-5p, pre-miRNA-125b-1, prim-miRNA-125b-1, miRNA-199b-5p , pre-miRNA-199b, pri-miRNA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, prim-miRNA-7-2, prim-miRNA-7-3 , miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, or pri-miR-33b. 4. Het gebruik waarop aanspraak wordt gemaakt in conclusiesl t/m 3 waarin het KH-domein bindend miRNA onderdeel uitmaakt van, groepeert met of complementair is aan een ander miRNA, een IncRNA, een lincRNA, een piwiRNA, een pseudogen RNA-transcriptie, een gen-RNA-transcriptie, een RNA-transcriptie, overlappende gen RNA-transcripties of combinaties daarvan.The use claimed in claims 1 to 3 wherein the KH domain binding miRNA is part of, groups with, or is complementary to, another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogenic RNA transcription, a gene RNA transcription, an RNA transcription, overlapping gene RNA transcripts or combinations thereof. 5. Het gebruik waarop aanspraak wordt gemaakt in conclusie 4 waarin (a) het KH-domein bindend miRNA, miRNA-125b-5p, pre-miRNA 125b-l of pri-miRNA-125b-l is; en (b) het andere miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2 is; en/of (c) de gen-RNA-transcriptie van BLID is; en/of (d) de IncRNA miR-lOOHG is.The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-125b-5p, pre-miRNA 125b-1, or prim-miRNA-125b-1; and (b) the other is miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2; and / or (c) is the gene RNA transcription of BLID; and / or (d) the IncRNA is miR-100HG. 6. Het gebruik waarop aanspraak wordt gemaakt in conclusie 4 waarin (a) het KH-domein bindende miRNA, miRNA-199b-5p, pre-miRNA-199b of pri-miRNA-199b is; en (b) het andere miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, pri-miRNA-219a-2 is; en/of (c) de gen-RNA-transcriptie DNM1 of PTGES2 is.The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-199b-5β, pre-miRNA-199b, or prim-miRNA-199b; and (b) the other is miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, prim-miRNA-219a-2; and / or (c) the gene RNA transcription is DNM1 or PTGES2. 7. Het gebruik waarop aanspraak wordt gemaakt in conclusie 4 waarin (a) het KH-domain bindend miRNA, miRNA-7-2-3p, miRNA-7-3-3p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2 of pri-miRNA-7-3 is; en/of (b) het lincRNA, miR-7-3HG is.The use claimed in claim 4 wherein (a) the KH domain binding miRNA, miRNA-7-2-3p, miRNA-7-3-3p, pre-miRNA-7-2, pre-miRNA- 7-3, pri-miRNA-7-2 or prim-miRNA-7-3; and / or (b) the lincRNA, miR-7-3HG. 8. Het gebruik waarop aanspraak wordt gemaakt in conclusie 4 waarin (a) het KH-domein bindende miRNA, miRNA-3613-3p, pre-miRNA-3613 of pri-miRNA-3613 is; en (b) het andere miRNA, miRNA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-l-3p, miR-16-2-3p, pre-miRNA-15a, pre-miRNA-15b, pre- miRNA-16-1, pre-miRNA-16-2, pri-miRNA-15a, pri-miRNA-15b, pri-miRNA-16-1 of pri-miRNA-16-2 is; en/of (c) de gen-RNA-transcriptie van TRIM 13 of TRIM59 is; en/of (d) het IncRNA, DLEU2 of RP11-432B6.3 is.The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-3613-3p, pre-miRNA-3613 or prim-miRNA-3613; and (b) the other miRNA, miRNA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-1-3p, miR-16- 2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, prim-miRNA-15a, prim-miRNA-15b, pri-miRNA-16- 1 or primmiRNA-16-2; and / or (c) is the gene RNA transcription of TRIM 13 or TRIM59; and / or (d) the IncRNA, DLEU2 or RP11-432B6.3. 9. Het gebruik waarop aanspraak wordt gemaakt in conclusie 4 waarin (a) het KH-domein bindend miRNA, miRNA-33b-3p, pre-miRNA-33b of pri-miRNA-33b is; en (b) de gen-RNA-transcriptie van SREBF1 is; en/of (c) het IncRNA, SMCR5 is.The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-33b-3β, pre-miRNA-33b, or prim-miRNA-33b; and (b) is the gene RNA transcription of SREBF1; and / or (c) the IncRNA, SMCR5. 10. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 1 t/m 10 waarin het KH-domein van een proteïne is van AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3,KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 of TDRKH.The use claimed in any of claims 1 to 10 wherein the KH domain is a protein of AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3B, MEX3B, PPC, NOVAP, PCB, NOVAP, PCB, NOVAP, PCB, NOVAP QKI, SF1 or TDRKH. 11. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies van 1 t/m 9 waarin het KH-domein bindend miRNA onderdeel is van een complex dat omvat het KH-domein bevattende proteïne en één of meerdere andere proteïnen, RNA('s), DNA('s) of iedere combinatie daarvan.The claimed claim in any of claims 1 to 9 wherein the KH domain binding miRNA is part of a complex comprising the KH domain containing protein and one or more other proteins, RNA (s) ), DNA (s) or any combination thereof. 12. Het gebruik waarop aanspraak wordt gemaakt in conclusie 11 waarin het KH-domein bevattende proteïne AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, N0VA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 of TDRKH is.The use claimed in claim 11 wherein the KH domain-containing protein AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, N0VA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOKDR, PNNO, PNNO, PNNO, PNOK, 13. Het gebruik waarop aanspraak wordt gemaakt in conclusies 11 of 12 waarin het andere proteïne onderdeel uitmaakt van het EGFR-pad, het cholesterolpad, het LXR-pad of het LRP-pad.The use claimed in claims 11 or 12 wherein the other protein is part of the EGFR path, the cholesterol path, the LXR path or the LRP path. 14. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 1 t/m 13 waarin het KH-domein bindende miRNA ten minste één fluorofoordonor omvat en het KH-domein bevattende proteïne ten minste één fluorofooracceptor of een dark quencher omvat, waarin de fluorofoordonor en fluorofooracceptor of de fluorofoor donor en dark quencher zodanig spectraal worden gepaard dat het energiespectrum uitgezonden door de fluorofoordonor en het excitatie-energiespectrum van de fluorofooracceptor of het energiespectrum geabsorbeerd door de 'dark quencher' elkaar ten minste gedeeltelijk overlappen, omvattende de stappen van (a) het leveren van voornoemd KH-domein bindend miRNA en voornoemd KH- bevattende proteïne, (b) het leveren van een potentieel therapeutisch agens, (c) het contact maken van voornoemd KH-domein bindend miRNA en voornoemd KH-domein bevattende proteïne met het potentiële therapeutisch agens onder omstandigheden die FRET (Förster Résonance Energy Transfer) mogelijk maken tussen de fluorofoordonor en de fluorofooracceptor of de fluorofoordonor en de dark quencher, (d) identificeren van het potentieel therapeutische agens als een verbinding die een interactie moduleert, bij voorkeur remt of versterkt tussen voornoemd KH-domein bindend miRNA en voornoemd KH-domein bevattende proteïne, indien de FRET (Förster Résonance Energy Transfer) verschilt in aanwezigheid van de verbinding die van belang is vergeleken met de FRET in afwezigheid van de verbinding die van belang is.The use claimed in any of claims 1 to 13 wherein the KH domain binding miRNA comprises at least one fluorophore donor and the KH domain containing protein comprises at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are paired spectrally such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher at least partially overlap, including the steps of (a ) supplying said KH domain binding miRNA and said KH containing protein, (b) supplying a potential therapeutic agent, (c) contacting said KH domain binding miRNA and said KH domain containing protein with the potential therapeutic agent under conditions that make FRET (Förster Résonance Energy Transfer) possible and between the fluorophore donor and the fluorophore acceptor or the fluorophore donor and the dark quencher, (d) identifying the potential therapeutic agent as a compound that modulates, preferably inhibits, or enhances an interaction between said KH domain binding miRNA and said KH domain containing protein, if the FRET (Förster Résonance Energy Transfer) differs in the presence of the compound of interest compared to the FRET in the absence of the compound of interest. 15. Gebruik van een KH-bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattende het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH- domein bevattend proteïne in een volledige cel waarin het potentieel therapeutisch agens in contact wordt gebracht met voornoemde cel.Use of a KH binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain containing protein in a whole cell in which the potential therapeutic agent is contacted with said cell. 16. Het gebruik waarop aanspraak wordt gemaakt in conclusie 15 waarin het KH-domein bindend miRNA, het KH-domein bevattende proteïne en het andere proteïne zijn zoals gedefinieerd in elk van de conclusies 2 t/m 13.The use claimed in claim 15, wherein the KH domain is binding miRNA, the KH domain-containing protein, and the other protein as defined in any of claims 2 to 13. 17. Het gebruik waarop aanspraak wordt gemaakt in conclusies 15 of 16 waarin het KH-domein bindend miRNA en/of het KH-domein bevattende proteïne endogeen zijn voor de cel.The use claimed in claims 15 or 16 wherein the KH domain binding miRNA and / or the KH domain containing protein are endogenous to the cell. 18. Het gebruik waarop aanspraak wordt gemaakt in conclusies 15 of 16 waarin het KH-domein bindend microRNA en/of het KH-domein bevattend proteïne exogeen zijn voor de cel.The use claimed in claims 15 or 16 wherein the KH domain binding microRNA and / or the KH domain containing protein are exogenous to the cell. 19. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 15 t/m 18 waarin de cel genetisch gemodificeerd is om het KH-domein bindend microRNA tot uitdrukking te laten komen of te onderdrukken.The use claimed in any of claims 15 to 18 wherein the cell is genetically modified to express or suppress the KH domain binding microRNA. 20. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 15 t/m 18 waarin de cel genetisch wordt gemodificeerd om het KH-domein bevattende proteïne tot uitdrukking te laten komen of te onderdrukken.The use claimed in any of claims 15 to 18 wherein the cell is genetically modified to express or suppress the KH domain-containing protein. 21. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 15 t/m 18 waarin wijzigen van de interactie tussen het KH-domein bindende microRNA en het KH-domein bevattende proteïne direct of indirect een gewijzigde oppervlaktelevering, transport, stabiliteit, recycling of translatie van een ander proteïne in de cel veroorzaakt.The use claimed in any of claims 15 to 18 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly changes the surface delivery, transport, stability, recycling or causes translation of another protein in the cell. 22. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 15 t/m 18 waarin wijzigen van de interactie tussen het KH-domein bindende microRNA en het KH-domein bevattende proteïne direct of indirect een gewijzigde oppervlaktelevering, transport, splitsen, transcriptie, stabiliteit of hergebruik van een RNA in de cel veroorzaakt.The use claimed in any one of claims 15 to 18 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly altered surface delivery, transport, cleavage, transcription, stability or reuse of an RNA in the cell. 23. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 15 t/m 18 waarin het wijzigen van de interactie tussen het KH-domein bindend microRNA en het KH-domein bevattende proteïne direct of indirect proliferatie, differentiatie, apoptose, nécrosé, autofagie, motiliteit, migratie of invasie van een cel wijzigt.The use claimed in any of claims 15 to 18 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly proliferation, differentiation, apoptosis, necrosis, autophagia cell motility, migration or invasion. 24. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 15 t/m 23 waarin de cel een hersentumorcel, een zenuwstelselcel, een hersentumorcellijn of een cellijn van het zenuwstelsel is.The use claimed in any of claims 15 to 23, wherein the cell is a brain tumor cell, a nervous system cell, a brain tumor cell line, or a nervous system cell line. 25. Het gebruik waarop aanspraak wordt gemaakt in elk van conclusies 15 t/m 20 waarin de cel een reporterproteïne coderende sequentie tot uitdrukking brengt die functioneel gekoppeld is aan een KH-domein bindend microRNA bindende sequentie.The use claimed in any of claims 15 to 20 wherein the cell expresses a reporter protein coding sequence that is operably linked to a KH domain binding microRNA binding sequence. 26. Het gebruik waarop aanspraak wordt gemaakt in conclusie 25 waarin het reporterproteïne wordt geselecteerd uit de groep van groen fluorescerende proteïne, rood fluorescerend proteïne, geel fluorescerend proteïne, luciferase, bèta-galaktosidase en bèta-glucuronidase.The use claimed in claim 25 wherein the reporter protein is selected from the group of green fluorescent protein, red fluorescent protein, yellow fluorescent protein, luciferase, beta-galaktosidase and beta-glucuronidase. 27. Het gebruik waarop aanspraak wordt gemaakt in conclusie 25 of 26 waarin de KH-domein bindend microRNA bindende sequentie zich stroomafwaarts van de reporterproteïne coderende sequentie of stroomopwaarts van de reporter proteïne coderende sequentie bevindt.The use claimed in claim 25 or 26 wherein the KH domain binding microRNA binding sequence is downstream of the reporter protein coding sequence or upstream of the reporter protein coding sequence. 28. Gebruik van een KH-bindend miRNA voor het identificeren van een therapeutisch agens dat in staat is een ziekte of stoornis te voorkomen of te behandelen, omvattende het testen van het vermogen van een potentieel therapeutisch agens om de interactie te wijzigen van voornoemd KH-domein bindend miRNA met een KH-domein bevattend proteïne in een dier waarin het potentieel therapeutisch agens in contact wordt gebracht met voornoemd dier.Use of a KH-binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to alter the interaction of said KH- domain binding miRNA with a KH domain-containing protein in an animal in which the potential therapeutic agent is contacted with said animal. 29. Het gebruik waarop aanspraak wordt gemaakt in conclusie 28 waarin het KH-domein bindend miRNA, het KH-domein bevattende proteïne en het andere proteïne zoals gedefinieerd is in elk van de conclusies 2 t/m 13.The use claimed in claim 28 wherein the KH domain binding miRNA, the KH domain containing protein and the other protein as defined in any of claims 2 to 13. 30. Het gebruik waarop aanspraak wordt gemaakt in conclusies 28 of 29 waarin het KH-domein bindend miRNA en/of het KH-domein bevattende proteïne endogeen zijn voor het dier.The use claimed in claims 28 or 29 wherein the KH domain binding miRNA and / or the KH domain containing protein are endogenous to the animal. 31. Het gebruik waarop aanspraak wordt gemaakt in conclusies 28 of 29 waarin het KH-domein bindend microRNA en/of het KH-domein bevattend proteïne exogeen zijn voor het dier.The use claimed in claims 28 or 29 wherein the KH domain binding microRNA and / or the protein containing KH domain are exogenous to the animal. 32. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 31 waarin het dier genetisch gemodificeerd is om het KH-domein bindende microRNA tot uitdrukking te laten komen ofte onderdrukken.The use claimed in any of claims 28 to 31 wherein the animal is genetically modified to express or suppress the KH domain binding microRNA. 33. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 31 waarin het dier genetisch wordt gemodificeerd om het KH-domein bevattende proteïne tot uitdrukking te laten komen ofte onderdrukken.The use claimed in any of claims 28 to 31 wherein the animal is genetically modified to express or suppress the protein containing KH domain. 34. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 33 waarin wijziging van de interactie tussen het KH-domein bindende microRNA en het KH-domein bevattende proteïne direct of indirect proliferatie, differentiatie, apoptose, nécrosé, autofagie, motiliteit, migratie of invasie van cellen in het dier wijzigt.The use claimed in any of claims 28 to 33 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly proliferation, differentiation, apoptosis, necrosis, autophagia, motility, migration or invasion of cells in the animal. 35. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 34 waarin het dier wordt geplaatst in één of meerdere kamers in een microstromingapparaatmodule; en een beeldopname wordt gemaakt van de inhoud van één of meerdere kamers om in één of meerdere kamers resultaten te verkrijgen.The use claimed in any of claims 28 to 34 wherein the animal is placed in one or more chambers in a micro-flow device module; and an image recording is made of the content of one or more rooms to obtain results in one or more rooms. 36. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 35 waarin het dier een volledig dier, een embryo of een larve is.The use claimed in any of claims 28 to 35 wherein the animal is a complete animal, an embryo or a larva. 37. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 36 waarin het volledige dier Danio rerio of Drosophila melanogaster is.The use claimed in any of claims 28 to 36 wherein the entire animal is Danio rerio or Drosophila melanogaster. 38. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 37 waarin het dier wildtype of transgeen is.The use claimed in any of claims 28 to 37 wherein the animal is wild type or transgenic. 39. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 28 t/m 38 waarin het dier weefselspecifieke, locatiespecifieke en/of ontwikkelingsfase specifieke expressie van het KH-domein bindende miRNA, het KH-domein bevattende proteïne en/of combinaties daarvan kan omvatten.The use claimed in any of claims 28 to 38 in which the animal can have tissue-specific, site-specific and / or development-phase-specific expression of the KH domain binding miRNA, the KH domain-containing protein and / or combinations thereof. include. 40. Het gebruik waarop aanspraak wordt gemaakt in elk van de conclusies 1 t/m 39 waarin het potentieel therapeutisch agens wordt geselecteerd uit een proteïne, polypeptide, peptide, nucleïnezuur, oligonucleotide, koolwaterstof, lipide, synthetisch molecuul, semi-synthetisch molecuul, klein molecuul of gezuiverd natuurproduct.The use claimed in any of claims 1 to 39 wherein the potential therapeutic agent is selected from a protein, polypeptide, peptide, nucleic acid, oligonucleotide, hydrocarbon, lipid, synthetic molecule, semi-synthetic molecule, small molecule or purified natural product. 41. Een KH-domein bindend miRNA oligonucleotide die een sequentie omvat die aan een KH-domein van een proteïne bindt waarin voornoemd KH- domein bindend miRNA wordt geselecteerd uit de groep bestaande uit een matuur miRNA, een matuur isomeer miRNA, een pre-miR, een pri-miR, een miRNA nabootser of een mengsel van miRNA nabootsers, een RNA- of DNA-molecuul coderend voor voornoemd matuur, voor voornoemd matuur isomeer miRNA, voor voornoemd pre-miR, voor voornoemd pri-miRNA, voor voornoemde miRNA nabootser of een mengsel van miRNA nabootsers of iedere combinatie daarvan.41. A KH domain binding miRNA oligonucleotide comprising a sequence that binds to a KH domain of a protein wherein said KH domain binding miRNA is selected from the group consisting of a mature miRNA, a mature isomeric miRNA, a pre-miR , a pri-miR, a miRNA mimic or a mixture of miRNA mimics, an RNA or DNA molecule encoding said mature, for said mature isomer miRNA, for said pre-miR, for said pri-miRNA, for said miRNA mimic or a mixture of miRNA mimics or any combination thereof. 42. Het KH-domein bindend miRNA oligonucleotide waarop aanspraak wordt gemaakt in conclusie 41 waarin de sequentie die bindt aan een KH-domein één of meerdere is van 5'-(U/A)C3-4(U/A)-3', 5'-(U/A/C)C3-4(U/A/C)-3', 5'-CCAUC N2-7 (A/U)CCC(A/U) N7-is UCA(C/U)C-3', 5'-CA N2-ioCCC N7-24CA-3', 5'-(U/A)2 C3-5 (U/A)2-6 C3-5 (U/A)2-6 C3-5 (U/A)2 -3', 5'- C3-5 (N)2-6 C3-5 (N)2-6 C3-5 (N)2 -3', or 5'- C2-5 (N)2-8 C2-5 (N)2-8 C2-5 (N)2 -3' waarin N een van de C, U, A of G kan zijn.The KH domain binding miRNA oligonucleotide claimed in claim 41 wherein the sequence that binds to a KH domain is one or more of 5 '- (U / A) C3-4 (U / A) -3' 5 '- (U / A / C) C3-4 (U / A / C) -3', 5'-CCAUC N2-7 (A / U) CCC (A / U) N7 - is UCA (C / U) C-3 ', 5'-CA N2 -10CCC N7-24CA-3', 5 '- (U / A) 2 C3-5 (U / A) 2-6 C3-5 (U / A) 2 -6 C3-5 (U / A) 2 -3 ', 5'-C3-5 (N) 2-6 C3-5 (N) 2-6 C3-5 (N) 2 -3', or 5 ' - C 2-5 (N) 2-8 C 2-5 (N) 2-8 C 2-5 (N) 2-3 wherein N may be one of C, U, A or G. 43. Een antisense oligonucleotide dat complementair is aan het KH-domein bindende miRNA oligonucleotide waarop aanspraak wordt gemaakt in conclusie 41 of 42.An antisense oligonucleotide that is complementary to the KH domain binding miRNA oligonucleotide claimed in claim 41 or 42. 44. Het KH-domein bindende miRNA oligonucleotide waarop aanspraak wordt gemaakt in conclusie 41 of 42 of het antisense oligonucleotide waarop aanspraak wordt gemaakt in conclusie 43 voor gebruik bij de behandeling en/of preventie van een ziekte of stoornis.The KH domain binding miRNA oligonucleotide claimed in claim 41 or 42 or the antisense oligonucleotide claimed in claim 43 for use in the treatment and / or prevention of a disease or disorder. 45. Een farmaceutische samenstelling bestaande uit het KH-domein bindende miRNA oligonucleotide waarop aanspraak wordt gemaakt in conclusie 41 of 42 of het antisense oligonucleotide waarop aanspraak wordt gemaakt in conclusie 43 in vermenging met een farmaceutisch acceptabele drager.A pharmaceutical composition consisting of the KH domain binding miRNA oligonucleotide claimed in claim 41 or 42 or the antisense oligonucleotide claimed in claim 43 in admixture with a pharmaceutically acceptable carrier. 46. Een extracellulair vesicula, intracellulair vesicula, deeltje of exosoom dat een KH-domein bindend miRNA bevat zoals gedetineerd in elk van conclusies 2 t/m 9.An extracellular vesicle, intracellular vesicle, particle or exosome containing a KH domain binding miRNA as detained in any of claims 2 to 9. 47. Het extracellulair vesicula, intracellulair vesicula, deeltje of exosoom waarop aanspraak wordt gemaakt in conclusie 46 waarin voornoemd KH-domein bindend miRNA is gebonden aan een KH-domein van een proteïne.The extracellular vesicle, intracellular vesicle, particle or exosome claimed in claim 46 wherein said KH domain binding miRNA is bound to a KH domain of a protein. 48. Het extracellulair vesicula, intracellulair vesicula, deeltje of exosoom waarop aanspraak wordt gemaakt in conclusie 46 of 47 voor gebruik in de behandeling en/of preventie van een ziekte of stoornis.The extracellular vesicle, intracellular vesicle, particle or exosome claimed in claim 46 or 47 for use in the treatment and / or prevention of a disease or disorder. 49. Gebruik van een KH-domein bindend miRNA omvattende het selecteren van een behandeling of wijzigen van een behandeling van een ziekte of stoornis op basis van het bepalen van de hoeveelheid KH-domein bindend miRNA in een biologisch monster waarin het KH-domein bindend miRNA is zoals gedefinieerd in elk van de conclusies 2 t/m 13.Use of a KH domain binding miRNA comprising selecting a treatment or changing a treatment for a disease or disorder based on determining the amount of KH domain binding miRNA in a biological sample in which the KH domain binding miRNA is as defined in any of claims 2 to 13. 50. Het gebruik waarop aanspraak wordt gemaakt in conclusie 49 voor het bepalen van de keuze om een behandeling te initiëren, te continueren of te wijzigen voor een ziekte of stoornis in een subject, omvattende: (a) het analyseren van een reeks biologische monsters om in elk van de biologische monsters een hoeveelheid van een KH-domein bindend miRNA te bepalen; en (b) vergelijken van elk meetbare verandering in de hoeveelheden van een KH-domein bindend miRNA in ieder van de biologische monsters.The use claimed in claim 49 for determining the choice to initiate, continue or change a treatment for a disease or disorder in a subject, comprising: (a) analyzing a series of biological samples to determine an amount of a KH domain binding miRNA in each of the biological samples; and (b) comparing any measurable change in the amounts of a KH domain binding miRNA in each of the biological samples. 51. Het gebruik waarop aanspraak wordt gemaakt in conclusies 49 of 50, waarin voornoemd biologisch monster wordt geselecteerd uit een biologisch weefsel monster, een volledig bloed monster, een van bloed afgeleid monster, een uitstrijkje, een plasmamonster, een serummonster, een speekselmonster, een vaginale vloeistof monster, een spermamonster, een faryngeale vloeistof monster, een bronchiale vloeistof monster een fecaal vocht monster, een cerebrospinale vloeistof monster, een traanvocht monster, een urinemonster, een lymfe monster, een supernatant van een weefselcultuur , een cellulaire fractie, een exosome fractie, een bloedplaatjesfractie of een microdeeltjesfractie.The use claimed in claims 49 or 50, wherein said biological sample is selected from a biological tissue sample, a whole blood sample, a blood-derived sample, a smear, a plasma sample, a serum sample, a saliva sample, a vaginal fluid sample, sperm sample, pharyngeal fluid sample, bronchial fluid sample, faecal fluid sample, cerebrospinal fluid sample, tear fluid sample, urine sample, lymph sample, tissue culture supernatant, cellular fraction, exosome fraction , a platelet fraction or a microparticle fraction. 52. Het gebruik waarop aanspraak wordt gemaakt in elk van conclusies 49 t/m 51 waarin het biologische monster een exosoomfractie van serum is.The use claimed in any of claims 49 to 51 wherein the biological sample is an exosome fraction of serum. 53. Het gebruik waarop aanspraak wordt gemaakt in elk van conclusies 49 t/m 52 waarin het niveau van voornoemd miRNA wordt bepaald door middel van kwantitatieve reversieve transcriptie polymerase kettingreactie (qRT-PCR) of reeks hybridisatie.The use claimed in any of claims 49 to 52 wherein the level of said miRNA is determined by quantitative reversive transcription polymerase chain reaction (qRT-PCR) or series of hybridization. 54. Het gebruik waarop aanspraak wordt gemaakt in elk van conclusies 1 t/m 40, 44 of 48 t/m 53 waarin de ziekte of stoornis een hersentumor of een neurodegeneratieve ziekte is.The use claimed in any of claims 1 to 40, 44 or 48 to 53 wherein the disease or disorder is a brain tumor or a neurodegenerative disease. 55. Het gebruik waarop aanspraak wordt gemaakt in conclusie 54 waarin de hersentumor akoestisch neuroom, astrocytoom, Chordoom, Pilocytisch astrocytoom, laaggradig astrocytoom, anaplastisch astrocytoom, craniofaryngioom, hersenstamglioom, ependymoom, gemengd glioom, optische zenuw glioom, subependymoom, meningioom, metastatische hersentumoren, oligodendroglioom, pituitaire tumoren, primitieve neuroectodermale tumoren of schwannoom is.The use claimed in claim 54 wherein the brain tumor is acoustic neuroma, astrocytoma, chordoma, pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, craniopharyngioma, brainstem glioma, ependymoma, mixed glioma, optic nerve glioma, meningioma tumors, subependum soma, meningioma. oligodendroglioma, pituitary tumors, primitive neuroectodermal tumors or schwannoma. 56. Het gebruik waarop aanspraak wordt gemaakt in conclusie 54 waarin de neurodegeneratieve ziekte de ziekte van Parkinson, Multipele Systeem Atrophy (MSA), multipele sclerose, amyotrofysische laterale sclerose (ALS), Alzheimer of ziekte van Hunttington is.The use claimed in claim 54 wherein the neurodegenerative disease is Parkinson's disease, Multiple System Atrophy (MSA), multiple sclerosis, amyotrophysic lateral sclerosis (ALS), Alzheimer's disease or Hunttington's disease. 57. Een computerprogrammaproduct dat nuttig is voor het uitvoeren van de toepassingen waarop aanspraak wordt gemaakt in elk van de conclusies 1 t/m 40, 44 of 48 t/m 53, bestaande uit middelen voor het ontvangen van data die een gewijzigd interactienivau weergeven van ten minste één KH-domein bindend miRNA, middelen voor het ontvangen van data die ten minste één referentiepatroon of controlepatroon weergeven van voornoemd ten minste één KH-domein bindend miRNA, middelen voor het vergelijken van voornoemde data en middelen voor het selecteren van een potentieel therapeutisch agens.A computer program product useful for performing the applications claimed in any one of claims 1 to 40, 44 or 48 to 53, comprising means for receiving data representing a changed level of interaction from at least one KH domain binding miRNA, means for receiving data representing at least one reference pattern or control pattern of said at least one KH domain binding miRNA, means for comparing said data and means for selecting a potential therapeutic agent. 58. Een apparaat voor het uitvoeren van de toepassingen waarop aanspraak wordt gemaakt in elk van de conclusies 49 t/m 53.An apparatus for performing the applications claimed in any of claims 49 to 53. 59. Een set om de toepassing uit te voeren waarop aanspraak wordt gemaakt in elk van de conclusies 49 t/m 53, waarin voornoemde set omvat instructies voor het uitvoeren van voornoemd gebruik, een detectiereagens voor het bepalen van de hoeveelheid van ten minste één KH-domein bindend miRNA in een monster van een subject en referentiestandaarden.A set for performing the application claimed in any of claims 49 to 53, wherein said set comprises instructions for performing said use, a detection reagent for determining the amount of at least one KH domain binding miRNA in a subject sample and reference standards.
BE2015/5297A 2015-05-12 2015-05-12 METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS BE1022918B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
BE2015/5297A BE1022918B1 (en) 2015-05-12 2015-05-12 METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
BE2015/5297A BE1022918B1 (en) 2015-05-12 2015-05-12 METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS

Publications (1)

Publication Number Publication Date
BE1022918B1 true BE1022918B1 (en) 2016-10-17

Family

ID=54010792

Family Applications (1)

Application Number Title Priority Date Filing Date
BE2015/5297A BE1022918B1 (en) 2015-05-12 2015-05-12 METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS

Country Status (1)

Country Link
BE (1) BE1022918B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014093537A1 (en) * 2012-12-11 2014-06-19 Isis Pharmaceuticals, Inc. Competitive modulation of micrornas
EP2811298A1 (en) * 2013-06-07 2014-12-10 ETH Zurich FRET-Method for identifying a biomolecule-modulating compound
WO2015004413A2 (en) * 2013-07-09 2015-01-15 University Of Central Lancashire Detection of brain cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014093537A1 (en) * 2012-12-11 2014-06-19 Isis Pharmaceuticals, Inc. Competitive modulation of micrornas
EP2811298A1 (en) * 2013-06-07 2014-12-10 ETH Zurich FRET-Method for identifying a biomolecule-modulating compound
WO2015004413A2 (en) * 2013-07-09 2015-01-15 University Of Central Lancashire Detection of brain cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BURCU GURER GIRAY ET AL: "Profiles of serum microRNAs; miR-125b-5p and miR223-3p serve as novel biomarkers for HBV-positive hepatocellular carcinoma", MOLECULAR BIOLOGY REPORTS, vol. 41, no. 7, 5 March 2014 (2014-03-05), NL, pages 4513 - 4519, XP055219322, ISSN: 0301-4851, DOI: 10.1007/s11033-014-3322-3 *
ISABELLE PLANTE ET AL: "Dicer-Derived MicroRNAs Are Utilized by the Fragile X Mental Retardation Protein for Assembly on Target RNAs", JOURNAL OF BIOMEDICINE AND BIOTECHNOLOGY, vol. 4, no. 5, 1 January 2006 (2006-01-01), US, pages 783 - 12, XP055219303, ISSN: 1110-7243, DOI: 10.1101/gad.990802 *
MARIEKE VAN KOUWENHOVE ET AL: "MicroRNA regulation by RNA-binding proteins and its implications for cancer", NATURE REVIEWS. CANCER, vol. 11, no. 9, 5 August 2011 (2011-08-05), GB, pages 644 - 656, XP055219292, ISSN: 1474-175X, DOI: 10.1038/nrc3107 *
N. PIAZZON ET AL: "Bicc1 links the regulation of cAMP signaling in polycystic kidneys to microRNA-induced gene silencing", JOURNAL OF MOLECULAR CELL BIOLOGY, vol. 4, no. 6, 28 May 2012 (2012-05-28), pages 398 - 408, XP055219308, ISSN: 1674-2788, DOI: 10.1093/jmcb/mjs027 *

Similar Documents

Publication Publication Date Title
Wilson et al. ER-mitochondria contact sites in neurodegeneration: genetic screening approaches to investigate novel disease mechanisms
ElMaghraby et al. A heterochromatin-specific RNA export pathway facilitates piRNA production
Brigidi et al. Genomic decoding of neuronal depolarization by stimulus-specific NPAS4 heterodimers
Spiegel et al. Npas4 regulates excitatory-inhibitory balance within neural circuits through cell-type-specific gene programs
Teleman et al. Nutritional control of protein biosynthetic capacity by insulin via Myc in Drosophila
WO2020077236A1 (en) Method for extracting nuclei or whole cells from formalin-fixed paraffin-embedded tissues
Menon et al. Drosophila rolling pebbles: a multidomain protein required for myoblast fusion that recruits D-Titin in response to the myoblast attractant Dumbfounded
Korolchuk et al. Drosophila Vps35 function is necessary for normal endocytic trafficking and actin cytoskeleton organisation
JP5670755B2 (en) Methods and compositions for translation profiling and molecular phenotyping
Pyati et al. p63 mediates an apoptotic response to pharmacological and disease-related ER stress in the developing epidermis
Chen et al. Lin-28 promotes symmetric stem cell division and drives adaptive growth in the adult Drosophila intestine
EP2733491B1 (en) Diagnostic method
Cavalieri et al. Early asymmetric cues triggering the dorsal/ventral gene regulatory network of the sea urchin embryo
Helmer et al. Role of helicase-like transcription factor (hltf) in the G2/m transition and apoptosis in brain
Yatsenko et al. Mirna-based buffering of the cobblestone–lissencephaly-associated extracellular matrix receptor dystroglycan via its alternative 3′-UTR
Naef et al. The stemness gene Mex3A is a key regulator of neuroblast proliferation during neurogenesis
Hessel et al. Identification of Srp9 as a febrile seizure susceptibility gene
Emtenani et al. Macrophage mitochondrial bioenergetics and tissue invasion are boosted by an Atossa‐Porthos axis in Drosophila
Frizzell et al. Drosophila mutants show NMD pathway activity is reduced, but not eliminated, in the absence of Smg6
Samuels et al. Two distinct waves of transcriptome and translatome changes drive Drosophila germline stem cell differentiation
Sun et al. Zic5 stabilizes Gli3 via a non-transcriptional mechanism during retinal development
BE1022918B1 (en) METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS
Nakata et al. Up-regulated spinal microRNAs induce aggregation of superoxide dismutase 1 protein in canine degenerative myelopathy
Han et al. Specification of neural circuit architecture shaped by context-dependent patterned LAR-RPTP microexons
US7344833B2 (en) Methods and compositions for modulating activator protein 1

Legal Events

Date Code Title Description
MM Lapsed because of non-payment of the annual fee

Effective date: 20200531