BE1022918B1 - METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS - Google Patents

Abstract

The present invention relates to MicroRNAs (miRNA), which are single stranded non-coding RNAs. In particular, the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain of a protein.

Description

METHOD FOR IDENTIFYING MODULATORS OF THE INTERACTION BETWEEN KH DOMAIN-BINDING MICRORNAS AND KH DOMAIN CONTAINING PROTEINS

BACKGROUND OF THE INVENTION

MicroRNAs (miRNAs) are single-stranded non-coding RNAs. They are a totally new class of gene regulators that can function by binding the 3 'untranslated region of target messenger RNAs (mRNAs) leading to either suppression of their translation or acceleration of their degradation.

The majority of the miRNAs (canonical biogenesis pathway) are first transcribed by RNA polymerase II as primary transcripts (prim-miRNAs) that must be further processed to yield a working-finished miRNA. Pri-miRNAs are processed in the nucleus by the RNAse III enzyme Drosha, cooperating with DGCR8 (in vertebrates) or Pasha (in invertebrates), and transform pri-miRNAs into shorter double-stranded RNAs (dsRNAs) hairpin structures, called precursor miRNAs (pre- miRNAs). Pre-miRNAs are then transported from the nucleus to the cytoplasm and are processed by Dicer into fully finished miRNAs.

Finished miRNAs enter the effector complex, called the RNA-Induced Silencing Complex (RISC), targeting single-stranded complementary mRNAs for translation repression or mRNA degradation. miRNAs are also produced via non-canonical pathways, such as the spliceosomal dependent mechanism.

MicroRNAs play important roles in processes as diverse as normal development and cellular homeostasis. They can be used as biomarkers in various diseases.

However, prior art data regarding the use of miRs as biomarkers in samples from patients with neurological disorders are confusing and contradictory. WO2012145363 published October 26, 2012, describes miR-125b and miR-7 as a synapse or neurite miR that can be used in conjunction with miR-16 in serum to distinguish between patients with mild cognitive disorders and patients with Alzheimer's. These miRs are reported to be more prevalent. WO2015038593 published March 19, 2015, describes the increased presence of miR-125b and miR-7 in primary cortical neurons. WO2013122918 published on August 22, 2013, describes the presence of miR-199 in neuroblastoma xenografts. WO2014152932 published September 25, 2014, describes a reduced expression of miR-7 in patients with glioblastoma. WO2013003350 published January 3, 2013, describes a reduced expression of miR-15b in plasma from patients with Alzheimer's. WO2014152243 published September 25, 2014, describes an increased expression of miR-15a and miR-16-2 in plasma of centenarians. WO2015004413 published January 15, 2015, describes an upward adjustment of miR-15a, miR-16-1 and miR-15b in serum of glioblastoma patients and a downward adjustment of miR-16-1 in a glioblastoma cell line versus normal astrocytes. WO2014012047 published January 16, 2014, describes an increased expression of miR-33 in a lovostatin-treated medulloblastoma cell line. KH domains are named after HNRNPK, the protein in which they were first discovered. KH domains are structurally conserved sets of approximately 70 amino acids. They can occur as multiple copies in various proteins and function in collaboration or independently. Their binding surface is a gap in which only four unpaired bases fit as standard. Vanderwaal forces, hydrophobic interactions and electrostatic interactions may contribute to nucleic acid binding affinity and may therefore be different for different proteins and even between KH domains of the same protein. Interactions and binding affinity depend on the secondary structure and sequence of the mRNA. The so-called 'Enlarged' KH domains have extra binding sites. HNRNPK can bind to the hairpin RNA structures and to extended RNA, while PCBP1, PCBP2, PCBP3 and PCBP4 bind RNA in extended form.

Extracellular vesicles (EVs) are vesicles with a diameter of 50-300 nm that are secreted and / or secreted by most cells into the extracellular medium by either the fusion of endosomal compartments, called multivesicular bodies, with the plasma membrane, resulting in exosome-type EVs or via direct separation from the plasma membrane resulting in ectosome type EVs. EVs play an important role in communication between cells, having demonstrated that the nucleic acids they contain, preferably of the RNA type, including mRNAs, microRNA (miRNA) and other RNAs, are functionally transferred by the secreting and secreting cells and into the specific cells receptor cells or target cells are built in where they will fulfill their function. The fact that exosomes contain RNA type regulatory nucleic acids points to their important role in the transfer of genetic information between different cells in the body. WO2014049125 published April 3, 2014, discloses the use of isolated short series motifs capable of driving or packaging regulatory nucleic acids, preferably RNAs, in extracellular vesicles, preferably exosomes.

The use of modified DNA and / or RNA oligonucleotides is contemplated as the primary weapons for controlling the action of carcinogenic miRNAs or simulating tumor-suppressing miRNAs. However, in addition to the general difficulties in developing drugs, there are three intrinsic disadvantages of this approach. Firstly, these oligonucleotides are too large in size.

Experimentally modified oligonucleotides tested on rodents and primates are generally longer than 15 bases. On the other hand, the molecular weight of most orally active drugs for human use does not exceed 500 Dalton. Secondly, DNA and RNA oligonucleotides are presumably considered foreign by the human body and thereby elicit an immune response. Third, modified oligonucleotides are likely to behave as miRNAs that can target hundreds if not thousands of transcriptions in humans, while only seven or eight nucleotides are required for miRNAs to effectively control their targets. WO2013019469 published February 7, 2013, describes a method for identifying agents that modulate miRNA activity. WO2014195026 published December 11, 2014 describes a FRET for identifying compounds that modulate biological molecules.

In addition to in vitro screening, drugs can also be screened in cell lines and organisms such as yeast and bacteria and these techniques have historically played an important role in identifying biologically active molecules. The use of these microorganism models for drug discovery is hampered by the fact that single-celled organisms lack important families of targets that are found in multicellular organisms (such as tyrosine kinases, hormone receptors in the nucleus). In addition, many drugs only show physiological activity in multicellular whole organisms because of the complex network of interactions within a biological system. Testing complete animals such as mice, dogs, and monkeys may not be feasible when testing many thousands or millions of compounds due to the cost and time of rearing, housing, maintaining, and testing animals. That is why animal testing is limited to much smaller, more selective screenings.

It has recently been proposed to use a small fast-growing organism as a model for small animals for screening compounds. Microfluidic devices consisting of flow and control layers made of flexible polymers where the flow layers contain microchannels for manipulating small animals, immobilizing them for taking images and supplying media and reagents have been described. An important practical problem, however, is a thick cuticle and intestinal covering that forms a physical barrier to many chemicals as well as a large number of xenobiotic pumps and detoxification enzymes for drugs that prevents or delays the absorption of many compounds. For this reason, a system is desirable that overcomes these problems. WO2015038987 published on March 19, 2015 describes systems and methods for screening very many compounds in complete animals in a short time.

Thus, there remains a need to develop not only improved and better-typed biomarkers, screening methods and systems, but also to identify new and existing pharmaceutical agents that can be used to treat, in particular, tumors and neurodegeneration.

SUMMARY OF THE INVENTION

The present invention offers KH domain binding miRNAs that interact with KH domain containing proteins and may be useful for solving the problem described above.

A first aspect of the present invention is the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to modify interaction of said KH domain binding miRNA with a protein KH domain. Said KH domain binding miRNA can be a finished miRNA, a finished isomeric miRNA, a pre-miRNA, a prim-miRNA or any combination thereof.

Preferably, said KH domain binding miRNA is selected from miRNA-125b-5p, pre-miRNA-125b-1, prim-miRNA-125b-1, miRNA-199b-5p, pre-miRIMA-199b, pri-miRI-IA -199b / miRIMA-7-2-3p, miRIMA-7-3-3p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri-miRNA-7-3 , miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b or pri-miR-33b. Said KH domain binding miRNA can be part of, group with or complementary to another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogen RNA transcription, a gene RNA transcription, an RNA transcription, overlapping gene RNA transcripts or combinations thereof and as such can interact with the KH domain-containing protein.

In a more preferred embodiment of the first aspect of the invention, (a) the KH domain is binding miRNA, miRNA-125b-5p, pre-miRNA-125b-1 or prim-miRNA-125b-1 and (b ) the other is miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2; and / or (c) is the gene RNA transcription, BLID and / or (d) is the IncRNA, miR-100HG.

In a further more preferred embodiment of the first aspect of the invention (a), the KH domain is binding miRNA, miRNA-199b-5β, pre-miRNA-199b, or prim-miRNA-199b, and (b) is other miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, prim-miRNA-219a-2; and / or (c) the RNA RNA transcription is DNM1 or PTGES2.

In another further more preferred embodiment of the first aspect of the invention (a) is the KH domain binding miRNA, miRNA-7-2-3p, miRNA-7-3-3p, pre-miRI \ IA-7 -2, pre-miRNA-7-3, prim-miRI-IA-7-2 or prim-miRNA-7-3, and / or (b) is the lincRNA, miR-7-3HG.

In another further more preferred embodiment of the first aspect of the invention (a) is the KH domain binding miRIMA, miRNA-3613-3p, pre-miRNA-3613 or prim-miRNA-3613, and (b) is the other miRIMA, miRIMA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-1-3p, miR-16-2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, prim-miRNA-15a, prim-miRIMA-15b, prim-miRNA-16-1, or pri- miRNA-16-2, and / or (c) is the gene RNA transcription of TRIM 13 or TRIM59, and / or (d) is the IncRNA DLEU2 or RP11-432B6.3.

In yet another further more preferred embodiment of the first aspect of the invention (a) is the KH domain binding miRNA, miRNA-33b-3p, pre-miRNA-33b or prim-miRNA-33b, and (b ) is the gene RNA transcription of SREBF1, and / or (c) is the IncRNA SMCR5.

In a second aspect of the invention, the KH domain is of a protein such as AKAP1, ANKHD1, ANKRD17, ASCC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP2, IGF2BP2, IGF2BP2, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 or TDRKH. Preferably, said KH domain is of a protein such as BICC1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, PCBP1, PCBP2, PCBP3 or PCBP4. The most preferred is said KH domain of a protein such as BICC1, HDLBP, HNRNPK, PCBP1, PCBP2, PCBP3 or PCBP4.

In a third aspect of the invention, the KH domain binding miRNA is part of a complex consisting of the KH domain-containing protein and one or more other proteins, RNAs, DNAs, or any combination thereof. Said KH domain-containing protein may be AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BPB, IGF2BPB, IGF2BPB, IGF2BPB, IGF2BPB, IGH2 KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 or TDRKH. The aforementioned other protein may be part of the EGFR path, the cholesterol path, the LXR path or the LRP path.

In a fourth aspect of the invention, the KH domain binding miRNA contains at least one fluorophore donor and the KH domain containing protein at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired with the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the 'dark quencher' at least partially overlapping, the following steps are included (a) supplying said KH domain binding miRNA and said KH domain containing protein, (b) supplying a potential therapeutic agent, (c) contacting said KH domain binding miRNA and said KH domain containing protein with the potential therapeutic agent under conditions that FRET (Förster Resonance Energy Transfer) between the fluorophore donor and fluorophore acceptor or the enable fluorodonor and the dark quencher, (d) identify the potential therapeutic agent as a modulating compound, preferably an interaction between said KH domain binding miRNA and said KH domain containing protein inhibiting or enhancing, if the FRET (Förster Résonance Energy Transfer) differs in the presence of the interesting connection compared to the FRET in the absence of the interesting connection.

A fifth aspect of the invention relates to the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the potential of a potential therapeutic agent to modify the interaction of said KH domain binding miRNA with a KH domain containing protein in an intact cell in which the potential therapeutic agent is contacted with said cell. Said KH domain binding miRNA and / or said KH domain containing protein may be as defined above. Said KH domain binding microRNA and / or the KH domain containing protein may be endogenous to the cell. Said KH domain binding microRNA and / or the KH domain containing protein may be exogenous to the cell. Said cell can be genetically modified to allow the KH domain binding microRNA to be expressed or suppressed. Said cell can be genetically modified to express or suppress the KH domain-containing protein.

In a sixth aspect of the invention, directly or indirectly altering the interaction between the KH domain binding microRNA and the KH domain containing protein can lead to altered surface delivery, transport, stability, reuse or translation of another protein in the cell .

Direct or indirect alteration of the interaction between the KH domain binding microRNA and the KH domain containing protein can lead to altered surface delivery, transport, cleavage, transcription, stability or reuse of an RNA in the cell. Preferably, altering the interaction between the KH domain binding microRNA and the KH domain containing protein results directly or indirectly in a change in proliferation, differentiation, apoptosis, necrosis, autophagy, motility, migration, or invasion of a cell.

The cell in the above aspects can be a brain tumor cell, a nervous system cell, a brain tumor cell or a cell line of a nervous system.

A seventh aspect of the invention relates to the use as described above wherein said whole cell contains a reporter protein coding sequence operably linked to a KH domain binding microRNA binding sequence. Said reporter protein can be selected from the group of green fluorescent protein, red fluorescent protein, yellow fluorescent protein, luciferase, beta-galactosidase and beta-glucuronidase. Said KH domain binding microRNA binding sequence may be located downstream of the reporter protein coding sequence or upstream of the reporter protein coding sequence.

An eighth aspect of the invention relates to the use of the KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the potential of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain containing protein in an animal in which the potential therapeutic agent is contacted with said animal. Said KH domain binding miRNA, said KH domain containing protein and said other protein may be as described above. Said KH domain binding microRNA and / or said KH domain containing protein may be endogenous or exogenous to the animal. Said animal may be genetically modified to express or suppress the KH domain binding microRNA and / or silencing the KH domain containing protein. Altering the interaction between the KH domain binding microRNA and the KH domain containing protein can directly or indirectly cause proliferation, differentiation, apoptosis, necrosis, autophagia, motility, migration or cell invasion into the animal. The animal can be introduced into one or more chambers in a micro-flow device module and the contents of one or more chambers can be recorded on screen to get results in one or more chambers. The animal can be a complete animal, an embryo or a larva. The animal can be a Danio rerio or Drosophila melanogaster. The animal can be a wild type or transgenic. The animal may include tissue-specific, site-specific and / or development-stage-specific expression of the KH domain binding miRNA, the KH domain containing protein, and / or combinations thereof.

In the above aspects of the invention, the potential therapeutic agent can be selected from a protein, polypeptide, peptide, nucleic acid, oligonucleotide, hydrocarbon, lipid, synthetic molecule, semi-synthetic molecule, small molecule, or purified natural product.

A ninth aspect of the invention relates to the KH domain binding miRIMA oligonucleotide that contains a sequence that binds to a KH domain of a protein wherein said KH domain binding miRNA is selected from the group consisting of a finished miRNA, a finished isomer miRNA, a pre-miR, a prim-miR, a miRNA mimic or a mixture of miRNA mimics, an RNA or DNA molecule coding for said finished miRNA, for said finished isomer miRNA, for said pre-miR, for said pri-miRNA, for the aforementioned miRNA mimic or mixtures of miRNA mimic or a combination thereof. Preferably, the KH domain binding miRNA oligonucleotide has one or more of the following sequences that bind to a KH domain: 5 '- (U / A) C3-4 (U / A) -3', 5 '- (U / A A / C) C3-4 (U / A / C) -3 ', 5'-CCAUC N2-7 (A / U) CCC (A / U) N7 - is UCA (C / U) C-3', 5'-CA N2-10 CCC N7-24 CA-3 ', 5' - (U / A) 2 C3-5 (U / A) 2-6 C3-5 (U / A) 2-6 C3-5 (U / A) 2-3 ', 5'-C3-5 (N) 2-6 C3-5 (N) 2-6 C3-5 (N) 2-3', or 5'-C2-5 ( N) 2-8 C2-5 (N) 2-8 C2-5 (N) 2 -3 'wherein N can be one of the C, U, A or G.

The ninth aspect of the invention also relates to an antisense oligonucleotide that is complementary to the KH domain binding miRNA oligonucleotide as described above.

Said KH domain binding miRIMA oligonucleotide or said antisense oligonucleotide can be used in the treatment and / or prevention of a disease or disorder. And so this aspect of the invention also relates to a pharmaceutical composition containing said KH domain binding miRNA oligonucleotide or said antisense oligonucleotide with a pharmaceutically acceptable carrier as additive.

A tenth aspect of the invention relates to an extracellular vesicle, intracellular vesicle, particle or exosome that contains a KH domain binding miRNA. Said KH domain binding miRNA is bound to a KH domain of a protein. The aforementioned extracellular vesicle, intracellular vesicle, particle or exosome can be used in the treatment and / or prevention of a disease or disorder. Preferably it relates to an exosome.

An eleventh aspect of the invention relates to the use of a KH domain binding miRNA comprising selecting a treatment or changing a treatment for a disease or disorder based on determining the amount of KH domain binding miRNA in a biological sample wherein the KH domain is binding miRNA as described above. The aforementioned use to determine whether to start, continue or continue treatment of a disease or disorder in an individual or may consist of: a) analyzing a series of biological samples to determine an amount of a KH domain in each of the biological samples to determine binding miRNA and b) comparing a measurable change in the amounts of a KH domain binding miRNA in each of the biological samples.

Said biological sample can be selected from a biological tissue sample, a whole blood sample, a blood-derived sample, a smear, a plasma sample, a serum sample, a saliva sample, a vaginal fluid sample, a sperm sample, a pharynx fluid sample, a bronchi fluid sample, a faecal fluid sample, a cerebrospinal fluid sample, a tear fluid sample, a urine sample, a lymph fluid sample, a supernatant of a tissue culture sample, a cellular fraction, an exosome fraction, a platelet fraction or a microparticle fraction . Preferably, said sample is an exosome fraction of a serum sample.

The content of the aforementioned miRNA can be determined by means of quantitative reverse transcription polymerase chain reaction (qRT-PCR) or array hybridization.

The disease or disorder described above may be a brain cancer or a neurodegenerative disease.

The aforementioned brain cancer may be; acoustic neuroma, astrocytoma, chordoma, pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, glioblastoma, craniopharyngioma, brainstem glioma, ependymone, mixed glioma, glioma to the optic nerve, subependymoma, medulioma neuro, hereditary, medulloentomic, hereditary, medulloentomous, hereditary, medulloentomous, hereditary , schwannome. The aforementioned neurodegenerative diseases may be Parkinson's, Multiple System Atrophy (MSA), multiple sclerosis, amyotrophysic lateral sclerosis (ALS), Alzheimer's disease or Huntington's disease.

A twelfth aspect of the invention relates to a system that is useful for performing the use as described above. This system may be a computer program consisting of means for receiving data representing a modified interaction level of at least one KH domain binding miRNA, means for receiving data representing at least one reference pattern or control pattern of said at least one KH domain binding miRNA, means for comparing said data and means for selecting a potential therapeutic agent. Said system can be a device for carrying out said use. Said system may be a set, wherein said set consists of instructions for performing said use, a detection reagent for determining the amount of at least one KH domain binding miRNA in a sample of a subject, and reference standards.

DEFINITIONS

As used herein, the term "isolated" means separate from the natural state through human intervention. For example, a naturally occurring RNA in a living animal is not "isolated", but synthetic miRNA or mRNA separated from coexisting materials from its natural state is considered "isolated" for the purposes of the present invention. Isolated nucleic acid may exist in substantially purified form or it may exist in a non-natural state such as, for example, in a cell into which said nucleic acid has been introduced.

As used herein, the term "biomarker" refers to a substance used as an indicator of a biological condition or a normal biological process, a condition of disease, or a response to treatment with drugs. For the purposes of the present invention, the term biomarker refers to regulatory nucleic acids, preferably to RNAs and more preferably to miRNAs, spent miRNAs, spent isomeric miRNAs, pre-miRNAs, prim-miRNAs or any combination thereof.

As used herein, the term "genetically modified" refers to any process capable of introducing functional genetic material into a cell to correct a genetic and / or metabolic, physiological and / or functional defect, through either overexpression or underexpression or provide the cells with a new function.

As used herein, the "effective dose" refers to a minimum dose capable of producing the desired effect, whether it is reversing a disease state or inducing a specific immune response, etc.

The term "expression" as used herein refers to both the transcription of a gene sequence and the translation of mRNA to a resulting protein. As used herein, the term "gene" refers to a nucleic acid (e.g., DNA or RNA) comprising a portion or the full length of the sequence code necessary to produce the sequences of a polypeptide or a polypeptide precursor. As used herein, the term "suppress" refers to the suppression or inhibition of the expression of a specific target gene.

According to long-standing conventions in patent law, the terms "one" and "the" refer to "one or more" when used in this application, including in the claims. And so referring to "a cell" involves a plurality of such cells, and so on.

As used herein, the term "KH domain binding miRNA" is a microRNA that has a sequence that fits into the slot of a KH domain. "Long non-coding RNAs" (long ncRNAs, IncRNA) as used herein are non-protein coding transcripts longer than 200 nucleotides. A special class of IncRNA are long intergenic ncRNAs (lincRNA), which includes long non-coding RNAs that are transcribed from non-coding DNA sequences between protein-coding genes.

A "piwi RNA" as used herein is a small non-coding RNA molecule that forms RNA protein complexes through interactions with piwi proteins.

A "cluster" as used herein is a set of miRNA, Incrna, lincRNA, piwiRNA, pseudogen RNA transcription, gene RNA transcription, RNA transcription, overlapping gene RNA transcriptions that are close to each other or overlapped in the genome . By being close together is meant within 5 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 60 kb, 70 kb, 80 kb, 90 kb, 100 kb, 200 kb, 300 kb, 400 kb, 500 kb, 600 kb, 700 kb, 900 kb, 100 kb, preferably 100 kb between 5 to 200kb.

The term "interactions" as used herein refers to contacts established between two or more molecules as a result of biochemical events and / or electrostatic forces. When the interaction is direct, the molecules come into physical contact with each other at a certain moment. When the interaction is indirect, the molecules influence each other's activity without being in physical contact with each other. Preferably, covalent, ion and weak bonds play a role in the interaction between two molecules, such as dipole-dipole interactions, ion-dipole interactions, London forces, van der Waals interactions, charge transfer interactions and hydrogen bonding.

The term "expression" as used herein refers to the transcription of a gene sequence as well as the translation of an mRNA to the resulting protein. As used herein, the term "gene" refers to nucleic acid (e.g., DIMA or RIMA) consisting of a portion or full length of the sequence code, the sequences necessary for the production of a polypeptide or a polypeptide precursor.

As used herein, the term "suppress" refers to the suppression or inhibition of the expression of a specific target gene. The term suppression does not necessarily mean limited transcription since suppressing the gene can also, at least in some cases, be performed at the post-transcription level. The degree of gene suppression can occur to reduce or interfere with the production of the encoded gene.

By the term "the ability of a (potential) therapeutic agent to alter the interaction" as used herein is meant all types of compounds, such as inorganic and organic compounds of low and high molecular mass, amino acids, peptides, polypeptides, lipids , (poly) nucleotides, etc. that are capable of at least partially (inhibiting) or completely (inhibiting) disrupting the interaction between the biomolecules or domains, or capable of initiating or increasing the interaction between the biomolecules or domains. In other words, the connection will reduce, interrupt, initiate or increase the binding between the biomolecules or domains.

The term "biomolecule" as used herein refers to any molecule that occurs in a living cell and that has a biological function in this cell as well as functional derivatives and fragments thereof. Functional derivatives and fragments of a biomolecule normally have at least 10, 20, 30 or 40%, preferably at least 50, 60, 70 or 80%, more preferably at least 90%, most preferably at least 95% (percent) identity with the structure of the biomolecule in nature and show the same or a substantially similar biological effect as the biomolecule in nature. For example, structural identity of polynucleotides and polypeptides can be determined with standard algorithms that calculate the percent identity of the sequences and for polynucleotides, structural identity can also be determined by hybridization tests.

For polynucleotides, the term "% (percent) identity" as known to those skilled in the art and used herein, indicates the degree of relationship between two or more nucleic acid molecules that is determined by correspondence between the sequences. The percentage of "identity" is the result of the percentage of identical regions in two or more sequences, taking into account the gaps and other specificities of the sequence. The identity of related molecules of nucleic acids can be established using known methods. In general, special computer programs are used that use algorithms adapted to the specific needs of this task. Preferred methods for determining identity begin by generating the greatest degree of identity between the sequences to be compared. Preferred computer programs for determining the degree of identity between two nucleic acid is sequences include, but are not limited to, BLASTN. The BLAST programs can be obtained from the National Center for Biotechnology Information (NCBI).

The structural identity of related nucleic acids can also be typified to the extent that they are able to hybridize to specific reference nucleic acid sequences, preferably under stringent conditions. In addition to the general and / or standard protocols of the prior art for determining the hybridization capacity with a specific reference nucleic acid sequence under stringent conditions, preference is given to analyzing and determining the hybridization capacity with a specific reference nucleic acid sequence under stringent conditions by the compare nucleic acid sequences that can be found in the gene databases (eg http: //www.ncbi.nlm.- nih.gov/entrez/query. fcgi? db = nucleotide) with alignment aids, such as the BLASTN and ALIGN mentioned above alignment tools.

Preferably, the ability to hybridize a nucleic acid with a related nucleic acid derivative or fragment has been confirmed in a Southern Blot test under the following conditions: 6x sodium chloride / sodium citrate (NNC) at 45 ° C followed by washing out in 0.2x NNC, 0.1 % SDS at 65 ° C.

The percent identity of amino acid molecules in nature with functional fragments or derivatives thereof can be determined by known methods. In general, special computer programs are used that use algorithms adapted to the specific needs of this task. Preferred methods for determining identity begin by generating the greatest degree of identity between the sequences to be compared. Preferred computer programs for determining the degree of identity between two amino acid sequences include, but are not limited to, TBLASTIM, BLASTP, BLASTX or TBLASTX. The BLAST programs are available from the National Center for Biotechnology Information (NCBI) and from others.

By the term "functional derivative" of a compound, in particular a polypeptide or polynucleotide, as mentioned herein is meant all polypeptides, polynucleotides or fragments thereof including chemically or genetically modified amino acid or nucleotide sequence, e.g. by addition, substitution and / or removal of amino acid or nucleotide residue (s) and / or chemically modified in at least one or more of its atoms and / or functional chemical groups, e.g. by additions, deletions, regrouping, oxidation, reduction, etc. as long as the derivative still has one of the biological activities of the original polypeptide or polynucleotide in nature to a measurable extent, e.g. at least about 1 to 10% of the biological activity of the original unchanged polypeptide or polynucleotide.

As used herein, the terms "label" and "detectable label" refer to a molecule that can be detected, including, but not limited to, radioactive isotopes, fluorescent labels, chemiluminescent labels, chromophors, enzymes, enzyme substrates, enzyme co-factors, enzyme inhibitors,

Chromophors, dyes, metal ions, metal soles, ligands (e.g., biotin, avidin, strepavidin or haptens) and the like.

As used herein, "solid support" refers to a solid surface such as a plastic plate, magnetic bead, latex bead, multi-titre cavity, glass plate, nylon, agarose, acrylamide, and the like.

DETAILED DESCRIPTION OF THE INVENTION

It was unexpectedly discovered that miRNAs can bind to the KH domain of a protein via specific nucleic acid sequences. The KH domain binding miRNA can be a finished miRNA, a finished isomeric miRNA, a pre-miRNA or a combination thereof. The specific nucleic acid sequence that can bind to the KH domain of a protein can be found in an area encoding various overlapping or complementary transcripts. These overlapping or complementary transcripts and all clusters that they can form through trans or cis activation or trans or cis suppression influence each other's action. And thus, the KH domain binding miRNA of the invention can cluster with or be complementary to another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogen RNA transcript, a gene RNA transcript, an RNA transcript, overlapping gene RNA transcripts or any combination thereof.

An aspect of the invention is the use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to modify the interaction of said KH domain binding miRNA with a KH domain of a protein.

Another aspect of the invention is that certain miRIMAs contain specific KH domain binding sequences. Therefore, this other aspect of the present invention relates to KH domain binding miRNA comprising KH domain binding sequences selected independently from one or more of 5 '- (U / A) C3-4 (U / A) -3', 5 ' - (U / A / C) C3-4 (U / A / C) -3 ', 5'-CCAUC N2-7 (A / U) CCC (A / U) N7-18 UCA (C / U) C -3 ', 5'-CA N2-10 CCC N7-24CA-3', 5 '- (U / A) 2 C3-5 (U / A) 2-6 C3-5 (ü / A) 2-6 C3-5 (U / A) 2-3 ', 5'-C3-5 (N) 2-6 C3-5 (N) 2-6 C3-5 (N) 2-3', or 5'-C2 -5 (N) 2-8 C2-5 (N) 2-8 C2-5 (N) 2 -3 ', wherein N can be one of C, U, A or G.

The present invention also discloses the association of KH domain containing proteins and KH domain binding miRNAs, both of which may be located within the EVs. Said KH domain containing proteins together with the KH domain binding miRNAs described in the invention may be responsible for the packaging and / or forwarding of molecules in the EVs. These KH domain-containing proteins can be SUMOylated, or phosphorylated, and these post-translational modifications can control the binding of KH domain-containing miRNA to KH domain-binding miRNA.

The field of the invention is related to the use of Förster Resonance Energy Transfer (FRET), which is a mechanism that describes energy transfer between two chromophores. When both chromophores are fluorescent, i.e., so-called fluorophores, the term "fluorescence resonance energy transfer" is often used instead. To avoid a misinterpretation of the phenomenon that is always a non-radiative transfer of energy (even when it occurs between two fluorophores), the name "Förster Résonance Energy Transfer" is preferred. A fluorophore donor, initially in its electronically excited state, can transfer energy to a fluorophore acceptor via non-radiative dipole-dipole coupling. The efficiency of this energy transfer is inversely proportional to the sixth power of the distance between donor and acceptor, which makes FRET extremely sensitive to small distances.

The field of the invention relates to a method for identifying a compound that modulates an interaction between two biomolecules or two domains of the same biomolecule, the first biomolecule or first domain comprises at least one fluorophore donor and the second biomolecule or second domain at at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are spectrally paired such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher 'at least partially overlap each other, and may include following steps (i) supplying the first and second biomolecules or a biomolecule providing said first and second domains, (ii) a compound of interest, (iii) in contact bringing the first and second biomolecules or the biomol molecule comprising the first and second domain with the compound of interest under conditions that allow FRET (Förster Resonance Energy Transfer) between the fluorophor donor and fluorophore acceptor or the fluorophore donor and the dark quencher, (iv) identifying the compound of interest as a compound that modulates an interaction, preferably inhibits or enhances between the two biomolecules or the two domains of one biomolecule if the FRET (Förster Résonance Energy Transfer) differs between the first and second biomolecules or the first and second domains in the presence of the compound of interest compared to the FRET between the first and second biomolecules or the first and second domains in the absence of the compound of interest.

In the invention, the first biomolecule is selected from the group consisting of the KH domain containing proteins mentioned herein and the second biomolecule is selected from the group consisting of KH domain binding miRNAs as mentioned herein or vice versa.

The invention relates to a test for detecting modulators of KH domain binding miRNAs in which a miRNA binding sequence is linked to a nucleic acid molecule encoding a reporter protein for use in monitoring changes in reporter protein expression upon exposure to a potential therapeutic agent .

For example, the assays can be used in screening small organic molecules for agonistic or antagonistic activity with respect to miRI \ IA-125b-5p, pre-miRNA-125b-1, prim-miRI \ IA-125b-1, miRNA -199b-5p, pre-miRI-IA-199b, pri-miRNA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, pri-miRNA-7-2, pri -miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, or pri-miR-33b. These miRNAs have a specific sequence that can bind to the KH domain of a protein.

The invention also relates to a method for determining whether prophylaxis or treatment of a brain tumor or a neurodegenerative disease should be initiated or continued in a subject. This method comprises (a) analyzing a series of biological samples to determine an amount of a KH domain binding microRNA in each of the biological samples; and (b) comparing any measurable change in the amounts of the KH domain binding microRNA in each of the biological samples.

The method, in a specific further form, comprises (c) determining whether prophylaxis or therapy of the brain tumor or neurodegenerative disease is to be initiated or continued based on including any measurable change in the amounts of microRNA containing KH domain.

The invention also relates to the methods and micro-flow systems in which whole animals or whole cells are used to identify compounds that modulate a target or phenotype of interest. These methods make it possible to perform improved experiments with the micro-flow modules and to obtain more accurate and reliable results at lower costs and at a higher speed.

The present invention provides a robotized micro-flow device for maintaining zebrafish larvae or embryos (Danio rerio) in which media and a library of compounds is supplied to the animals, and wherein high throughput sorting and screening of entire animals is used to identify compounds.

In one aspect of the invention, a screening method is provided for identifying compounds where a mature animal or whole cell is placed in a room in a micro-flow device module, where the animal or whole cell is contacted with a compound to be tested and images are taken recorded from the room to get results. The method can be a high throughput screening method where the animal is a complete animal, an embryo or a larva. The animal can be wild-type or transgenic zebrafish larvae or embryos (Danio rerio) in which the transgenic Danio rerio comprises an increased bioavailability of compounds.

In a preferred embodiment, the polynucleotide for carrying out a method of the invention is a pri- or pre-miRNA or finished miRNA, preferably selected from the group consisting of miRNA-125b-5p, pre-miRNA-125b-1, pri -miRI \ IA-125b-1, miRNA-199b-5p, pre-miRNA-199b, prim-miRI \ IA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3 , pri-miRNA-7-2, pri-miRNA-7-3, miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, or prim miR-33b and overlapping transcripts, precursors, functional derivatives or fragments thereof.

In a further preferred embodiment, the polypeptide for carrying out a method of the present invention is a KH domain-containing protein such as but not limited to AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3 , FXR1, FXR2, GLD1, HDLBP, HNRNPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, Pb, Pbb, Pbb, PCB , QKI, SF1 or TDRKH or a functional fragment or functional derivative thereof.

In yet another preferred embodiment for carrying out a method of the present invention, the KH domain binding miRNA can be part of, group with, or complementary to another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogen RNA transcription, an RNA transcription gene, an RNA transcription, overlapping gene RNA transcripts, or combinations thereof.

In a more preferred embodiment for carrying out a method of the present invention (a), the KFI domain is binding miRNA, miRNA-125b-5p, pre-miRNA-125b-1 or prim-miRNA-125b-1; and (b) the other is miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2; and / or (c) the gene is RNA transcription, BLID and / or (d) is the IncRNA miR-100FIG.

In another more preferred embodiment for carrying out a method of the present invention (a), the KFI domain is binding miRNA, miRNA-199b-5β, pre-miRNA-199b, or prim-miRNA-199b; and (b) the other is miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, prim-miRIMA-219a-2; and / or (c) the gene RNA transcription is DNM1 or PTGES2.

In another more preferred embodiment of a method of the present invention (a), the KH domain is binding miRNA, miRNA-7-2-3p, miRNA- (b) 7-3-3p, pre-miRNA-7-2 , pre-miRNA-7-3, prim-miRNA-7-2 or prim-miRNA-7-3; and / or (c) the lincRNA is miR-7-3HG.

In another more preferred embodiment of a method of the present invention (a) the KH domain is binding miRNA, miRNA-3613-3p, pre-miRNA-3613 or prim-miRNA-3613; and (b) the other is miRNA, miRNA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-1-3p, miR-16 -2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, prim-miRNA-15a, prim-miRNA-15b, prim-miRNA-16 -1 or primmiRNA-16-2; and / or (c) is the gene RNA transcription of TRIM13 or TRIM59, and / or (d) the IncRNA is DLEU2 or RP11-432B6.3.

In another more preferred embodiment of a method of the present invention (a), the KH domain is binding miRNA, miRNA-33b-3β, pre-miRNA-33b, or prim-miRNA-33b; and (b) is the gene RNA transcription of SREBF1, and / or (c) is the IncRNA, SMCR5.

In another more preferred embodiment of the present invention, the KH domain binding miRNA is part of a complex consisting of the KH domain containing protein, one or more other proteins, RNAs, DNAs, or any combination thereof.

In another more preferred embodiment for carrying out a method of the present invention, the other protein is part of the EGFR path, the cholesterol path, the LXR path or the LRP path.

Sequence data for the above and more preferred miRNA embodiments can be found on the miRBase site (http://www.mirbase.org/) and are well known to those skilled in the art:

Sequence data: Potential KH domain binding sites may be but are not limited to the sequences indicated in bold

Seq. 1> hsa-mir-10a MI0000266

GAUCUGUCUGUCUUCUGUAUAUACCCUGUAGAUCCGAAUUUGUGU

AAGGAAUUUUGUGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAGU

UGACAUAAACACUCCGCUCU

Seq. 2> hsa-mir-10b MI0000267

CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUU

UGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGAAAAAA

UGGUCGAUGCAAAAACUUCA

Seq. 3

> hsa-mir-99a MIOOOOIOI

CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGAC

CGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG

Seq. 4> hsa-mir-99b MI0000746

GGCACCCACCCGUAGAACCGACCUUGCGGGGCCUUCGCCGCACAC

AAGCUCGUGUCUGUGGGUCCGUGUC

Seq. 5> hsa-mir-100 MI0000102

CC U G U U CCACAAACCCGUAGAUCCGAACU U G UGG UAU UAG U CCG CACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG

Seq. 6> hsa-mir-125a MI0000469

UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUC

CAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCC

Seq. 7> hsa-mir-125b-1 MI0000446

UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACC

GUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCU

Seq. 8> hsa-mir-125b-2 MI0000470

ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUU

UAGUAACAUCACAAGÜCAGGCUCUUGGGACCUAGGCGGAGGGGA

Seq. 9> hsa-let-7c MI0000064

GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACC

CUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

Seq. 10> hsa-let-7th MI0000066

CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAA

GGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG

Seq. 11> hsa-mir-199a-1 MI0000242

GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUG

UACAGUAGUCUGCACAUUGGUUAGGC

Seq. 12> hsa-mir-199a-2 MI0000281

AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACU

ACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUU

AGACUGGGCAAGGGAGAGCA

Seq. 13> hsa-mir-199b MI0000282

CCAG AGG ACACCUCCACU CCG U CU ACCCAG UG U U U AG ACU AU CUG

UUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGCU

GGGCUGGGUUAGACCCUCGG

Seq. 14> hsa-mir-33b MI0003646

ATCACCCCATGCGGGCGGCCCCCCGGUGCAUUGCUGUUGCAUUGC

ACGUGUGUGAGGCGGGUGCAGUGCCUCGGCAGUGCAGCCCGGAG

CCGGCCCCUGGCACCAC

Seq. 15> hsa-mir-7-2 MI0000264

CUGGAUACAGAGUGUGACACGGCUGGCCCCAUCUGGAAGACUAGUGA

UUUUGUUGUUGUCUUACUGCGCUCAACAACAAAUCCCAGUCUACC

UAAUGGUGCCAGCCAUCGCA

Seq. 16> hsa-mir-7-3 MI0000265

AGAUUAGAGUGGCUGUGGUCUAGUGCUGUGUGGAAGACUAGUGAU

UUUGUUGUUCUGAUGUACUACGACAACAAGUCACAGCCGGCCUCA

UAGCGCAGACUCCCUUCGAC

Seq. 17> hsa-mir-3613 MI0016003

UGGUUGGGUUUGGAUUGUUGUACUUUUUUUUUUGUUCGUUGCAU

UUUUAGGAACAAAAAAAAAAGCCCAACCCUUCACACCACUUCA

A fluorophore is a fluorescent chemical compound that can re-emit light after light excitation. Fluorophores usually contain various combined aromatic groups or flat or cyclic substructures with various ττ bonds. A fluorodonor as in accordance with the present invention absorbs light energy of a specific wavelength (donor excitation spectrum) and emits light with a longer wavelength (donor emission spectrum). The fluorodonor "donates" the excitation energy to the fluoroacceptor (acceptor excitation spectrum), a fluorescent chemical that retransmits the accepted excitation energy at a longer wavelength (emission spectrum of the receiver).

A dark quencher for carrying out the method of the present invention is a substance that at least partially absorbs excitation energy from the fluorophore donor and dissipates the energy as heat. Black hole quencher (BHQ ™) dyes are preferred dark quenchers for carrying out the method of the present invention.

For carrying out the method of the invention, the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are preferably spectrally paired, meaning that they are selected such that the energy spectrum emitted by the fluorophore donor (fluorophore donor emission spectrum) and the energy spectrum are absorbed by the fluorophore acceptor (fluorophore acceptor spectrum) or the energy absorbed by the dark quencher (quencher absorption spectrum) at least partially overlap.

Preferably, the fluorodonor is capable of absorbing radiation with a wavelength between 300 nm and 900 nm, more preferably between 350 nm and 800 nm, and can transfer this energy to the fluorophore acceptor or the dark quencher acceptor.

Preferably, the acceptor or dark quencher is capable of absorbing radiation with a wavelength between approximately 300 nm and 900 nm, more preferably between 350 nm and 800 nm, and has an excitation spectrum that overlaps with the emission of the fluorophor donor, such that the energy sent by the donor, the acceptor can excite.

Preferably, the fluorophore acceptor absorbs light at a wavelength that is at least 10 nm larger and more preferably at least 20 nm larger, and most preferably at least 30 nm larger than the maximum absorption wavelength of the donor fluorophore. Preferably, the dark quencher absorbs at least 30% of the wavelength transmitted by the fluorophor donor, more preferably at least 50%, and most preferably all of the transmitted wavelength.

In another preferred embodiment, the spectral overlap of the fluorophore donor emission spectrum and the dark quencher absorption spectrum, more preferably the black hole quencher (BHQ ™) absorption spectrum is at least 30, preferably at least 50, 60 or 70, more preferably at least 80, and most preferably at least 95 or 100%.

In a preferred embodiment, at least one fluorophore for carrying out the method of the invention is selected from fluorescent proteins and small fluorescent dye molecules, (a) preferably fluorescent proteins selected from the group consisting of (1.1) blue fluorescent proteins, preferably selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP, (1.2) cyan fluorescent proteins, preferably selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-lshi Cyan, TagCFP and mTFP1 (Teal ), (1.3) yellow fluorescent proteins, preferably selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana, (1.4) orange fluorescent proteins, preferably selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T,

DsRed, DsRed2, DsRed-Express (T1), DsRed-Monomer and mTangerine, (1.5) red fluorescent proteins, preferably selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRedl, mRasberry dKeima-Tandem, HcRed-Tandem, mPlum and AQ143, and (1.6) green fluorescent proteins (GFP), preferably selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire, more preferably green fluorescent proteins (1.6) and yellow fluorescent proteins (1.3), best EGFP; (b) preferably small fluorescent dye molecules selected from the group consisting of (11.1) acridines, preferably acridine orange or acridine yellow, (11.2) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, (11.3) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosine, Eosine B, Eosine Y or Erythrosine, (11.4) oxazines, preferably Cresyl violet, Nile blue or Nile red, (11.5) phenanthridines, preferably Ethidium bromide,

Gelred or Propidium iodide, and (11.6) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101, Sulforhodamine B or Texas Red, (c) more preferably cyanine and rhodamine dyes.

The above fluorophore donors are well known in the art. For example, they are listed on, for example, fluirophores.org.

The most preferred fluorophore donor is Green fluorescent protein (GFP), which contains 238 amino acids and which emits bright green fluorescent light on excitation (eGFP, Exmax = 488nm, Emmax = 509 nm). The term Green fluorescent protein (s) as used herein also generally includes its derivatives, preferably selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire.

In a preferred embodiment, at least one fluorophore acceptor is selected from the group consisting of (a) acridines, preferably acridine orange or acridine yellow, (b) cyanines, preferably Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 or Cy7, (c) fluorones, preferably Fluorescein, Carboxyfluorescein, Dichlorofluorescein, Eosine, Eosine B, Eosine Y or Erythrosine, (d) oxazines, preferably Cresyl violet, Nile blue or Nile red, (e) phenanthridines, preferably Ethidium bromide, Gelred or Propidium iodide, and (f) rhodamines, preferably Rhodamine, Rhodamine 123, Rhodamine 6G, Rhodamine B, Auramine, Sulforhodamine 101, Sulforhodamine B or Texas red, more preferably cyanines (b), most preferably Cy3.

Cyanine 3 (Cy3) is a small molecule of fluorophore that exhibits a bright pink fluorescence (Exmax = 550 nm, Emmax = 570 nm) on excitation.

The most preferred Cy3 compound for demonstrating the method of the invention is attached to a ribonucleotide in the miRINA by reaction with an azide.

In another preferred embodiment, at least one dark quencher is selected from the group consisting of Dabcyl, Dabsyl, Black Hole Quenchers (BHQ ™) dyes; more preferably BHQ-0, BHQ-1, BHQ-2 or BHQ-3, QXL quenchers; more preferably QXL 490, QXL 570, QXL 610, QXL 670, or QXL 680, Iowa Black quenchers; more preferably Iowa black FQ or Iowa Black RQ, and IRDyes; more preferred IRDye 800, IRDye 800CW, IRDye 800RS, IRDye 680, IRDye 680LT, IRDye 700, or IRDye 700DX, even more preferred Black Hole Quenchers (BHQTM) dyes, and the most preferred BHQ-1.

The term Black Hole Quenchers (BHQ ™) dyes as used herein generally includes all functional derivatives. Black hole quencher 1 (BHQ1) is a small molecule that absorbs fluorescence upon excitation (wide range, Ex = 480 to 580 nm). The most preferred BHQ1 functional derivative for demonstrating the method of the invention as illustrated in the examples is attached to a ribonucleotide in the miRNA by reaction with the azide.

The skilled person can quickly select spectrally paired fluorophore donors and fluorophore acceptors or spectrally paired fluorophore donors and dark quenchers based on the known or easily measurable emission spectra for the donors, the known or easily measurable excitation spectra of the acceptors and the known or easily measurable absorption spectra of the dark quenchers . binding miRNA take place under conditions that enable FRET (Förster Résonance Energy Transfer) between the fluorophore donor and the fluorophore acceptor or between the fluorophore donor and the dark quencher. Conditions for molecular interactions between biomolecules such as, for example, polypeptides and nucleotides are well known in the art. The conditions must be chosen in such a way that covalent and / or preferentially non-covalent binding of the biomolecules of interest is promoted so that the fluorophore donor (s) and fluorophore acceptor (s) or dark quencher (s) each other at a small distance of 10 or less approaching nanometers ,. And the conditions should preferably not denature the biomolecules or at least not affect their natural structure and function. The conditions must also not reduce the FRET signal.

For carrying out the method of the invention, the compound of interest is identified as a compound that modulates, preferably inhibits or increases, an interaction between the two biomolecules or the two domains of the biomolecules if the FRET (Förster Résonance Energy Transfer) between the first and second biomolecules or between the first and second domain differs in the presence of the compound of interest compared to the FRET between the first and second biomolecules or between the first and second domains in the absence of the compound of interest is.

If the compound inhibits the interaction, the distance from the fluorophore donor and the fluorophore acceptor or from the fluorophore donor and the dark quencher will increase, and thus decrease or degrade the FRET. If the compound increases the biomolecule interaction, the FRET will increase. To positively identify the compound of interest as a modulator, of the first and second biomolecules or the first and second domain, the FRET must be compared in the presence and absence of the compound of interest. Preferably, compounds known to modulate the interaction of the first and second biomolecules or the first and second domains will be used as a further reference and compared to the FRET results with one without the compound of interest.

The method of the invention and its preferred embodiments have a number of advantages over the screening methods that are generally used to identify modulating compounds of interest that, in particular, reduce, inhibit, initiate or increase biomolecule interaction. The inventive method is simple, and only requires contacting the compound of interest with spectrally paired biomolecules or domains under conditions suitable for biomolecule interaction and FRET and that the measured value is spectral and therefore easy to automate. The method is particularly suitable for screening polypeptide-miRNA interactions that represent important goals for medical treatments.

Given the roles of microRNA in a number of cellular processes including normal development, cellular homeostatis, cancer and normal or pathological aging or degeneration, compounds that specifically modulate the action of microRNA find application in the treatment of diseases and conditions related to microRNA, e.g. as chemotherapeutic agents for the treatment of cancers such as brain cancer or for the treatment of neurodegenerative diseases. In addition, microRNA modulators can be used in the research framework for analyzing the biogenesis, degradation and functioning of microRNAs.

The field of the invention also covers a method for identifying microRNA modulators. The microRNA modulator can be an antagonist or the microRNA modulator can be an agonist. In accordance with this method, a cell containing a microRNA and a microRNA binding sequence operably linked to a nucleic acid molecule encoding a reporter protein is contacted with a potential therapeutic agent and it is determined whether the agent expresses the expression of the reporter protein increases or decreases.

In certain embodiments of the invention, the KH domain binding microRNA and the KH domain containing protein or domain are deployed in the present test, related to a disease or disorder, wherein an antagonist or agonist for the KH domain binding microRNA or the KH domain-containing protein, or the interaction between them, would be useful in preventing or treating the disease or condition.

To monitor binding between the KH domain binding microRNA and the microRNA binding sequence, a microRNA binding sequence is operably linked to a nucleic acid molecule encoding a reporter protein. As used herein, the term "operably linked" refers to a coupling of nucleic acid elements in a functional relationship. A nucleic acid molecule encoding a reporter protein that is "operably linked" to a microRNA binding sequence means that said microRNA binding sequence is in the correct location and has the correct orientation with respect to the coding sequence for binding by control a microRNA, expression of the coding sequence. Certain embodiments of the invention involve operably linking the microRNA binding sequence downstream (i.e., 3 ') of the reporter protein coding sequence. In particular, the microRNA binding sequence is in the 3 'UTR of the mRNA encoding the reporter. Other embodiments of the invention involve the microRNA binding sequence upstream of the reporter protein coding sequence, i.e., in the 5 'UTR. The microRNA binding sequence can be any binding sequence that can provide information about the interaction between the KH domain binding microRNA and the KH domain binding protein.

As is conventional in the art, a reporter protein is a protein that produces a detectable signal when expressed. Reporter proteins used in the invention can be autofluorescent or catalyze a reaction that yields a detectable product. Examples of such reporter proteins include, but are not limited to, Green Fluorescent Protein (GFP), Red Fluorescent Protein (RFP), Yellow Fluorescent Protein (YFP), luciferase, beta-galactosidase, and beta-glucuronidase.

In general, the nucleic acid molecule encoding the reporter protein will be in a vector to facilitate manipulation and transformation. Any suitable vector, in particular any suitable expression vector, may be used including chromosomal, episomal and virus-derived vectors, such as vectors derived from bacterial plasmids, from bacteriophages, from transposons, from yeast episomes, from insert elements, from yeast chromosomal elements, from viruses such as baculoviruses, papovaviruses, such as SV40, vaccinia viruses, adenoviruses, bird pox viruses, pseudorabies viruses, and retroviruses and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophagegenic elements, such as cosmids and phagemids. In general, any system or vector can be capable of maintaining, propagating, or expressing an mRNA around one. produce protein in a host. In this regard, the expression vector must contain a promoter upstream of the coding sequence to direct the transcription (e.g., conditional or constitutive) of the mRNA encoding the reporter protein. In addition, the vector may contain other regulatory sequences such as polyadenylation signals and the like to direct mRNA transcription and translation of the reporter protein. Such nucleic acid molecules can be inserted into an expression vector by any variant of well-known and routine techniques.

Useful cells according to the present method can be selected for the expression of an endogenous KH domain binding microRNA or an endogenous KH domain containing protein or can be genetically modified using conventional methods for expressing an exogenous KH domain binding microRNA or an exogenous KH domain-containing protein. The use of cells in accordance with the current method can be selected to suppress an endogenous KH domain binding microRNA or an endogenous KH domain-containing protein or can be genetically modified using conventional methods for suppressing an endogenous KH domain binding microRNA or an endogenous KH domain containing protein.

Cells of the invention are standard eukaryotic and preferably derived from mammals, more preferably from humans. Examples of suitable human host cells include, but are not limited to, SH-SY5Y neuroblastoma cell line; HT22 neuronal cell line; 9L gliosarcoma cell line; A172, U87 XXX, U373, LN229, LN428, LN308 glioblastoma cell lines; GL261 mouse glioma cell line; BOSC 23 astrocyte cell line; D283, Daoy medulloblastoma cell lines or H06 / M0313K6-1C oligodendroglial cell line, which are well known and commercially available in the art from sources such as but not limited to the American Type Culture Collection (Manassas, VA, USA).

To implement the claimed methods, cells harboring a KH domain binding microRNA must also be transformed or transfected with the microRNA binding sequence operably linked to the nucleic acid molecule encoding the reporter protein. In general, the introduction of nuclelic acids into mammalian cells can be achieved by methods described in many standard laboratory manuals.

Such methods include, for example, calcium phosphate transfection, DEAE-dextran-mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic insertion, or infection.

Once a cell contains both the KH domain binding microRNA, the microRNA binding sequence operably linked to a nucleic acid molecule encoding the reporter protein and / or the KH domain containing protein, the screening test is performed by contacting the cell with a potential therapeutic agent. bring.

Potentially therapeutic agents that can be screened in accordance with the method of the present invention are generally available in libraries of agents or compounds. Such libraries can either contain collections of pure agents or collections of mixtures of agents. Examples of pure agents include, but are not limited to, proteins, polypeptides, peptides, nucleic acids, oligonucleotides, hydrocarbons, lipids, synthetic or semi-synthetic molecules, and purified or partially purified natural products. Examples of agent mixtures include, but are not limited to, extracts from prokaryotic or eukariotic cells and tissues as well as fermentation fluids and supernatants from cell or tissue cultures. In certain embodiments of this invention, the test agent is not a nucleic acid or nucleic acid molecule, e.g., no antisense RNA, siRNA, or the like. In other embodiments, the test agent is a small organic molecule.

Library screening can be performed as described here or in any format that allows rapid preparation and processing of multiple responses. For in vitro screening tests, stock solutions from the test agents as well as test components can be prepared manually and all subsequent activities such as pipetting, diluting, mixing, washing, incubating, reading sample values and collecting data can be performed using commercially available robotic pipetting equipment, automatic workstations and analysis tools for detecting the signal generated by the test. Examples of such detectors include, but are not limited to, luminometers, spectrophotometers, and fluorimeters or any other device that can detect changes in the activity of reporter proteins.

The moment signals generated by the reporter protein are detected, it is determined whether the agent tested increases or decreases the expression of the reporter protein relative to a control. Such a determination can be made by comparing the signal produced by a cell in contact with the test agent with the signal produced by a control cell, e.g., a cell that has not been brought into contact with a test agent or a cell in brought into contact with the agent to be tested but lacking a microRNA binding sequence. Agents that result in higher reporter protein signals are indicative of agents with antagonistic action on the miRNA thereby increasing the expression of the reporter protein. In contrast, agents that result in a decrease in the reporter protein signal as compared to a control are indicative of agents with an agonistic action on the miRNA thereby reducing the expression of the reporter protein.

An effective amount of an antagonistic compound is an amount that reduces or decreases or increases the activity of the KH domain binding microRNA by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or 100%. Such activity can be monitored by detecting the level of the target mRNA or the level of the protein product translated from the target mRNA.

When a role of the KH domain binding miRNA in various diseases and conditions has been identified, inhibiting the activity of a KH domain binding microRNA with a microRNA antagonist may be useful in selectively analyzing the biogenesis, degradation, and action of the KH domain binding microRNAs as well as in the prevention or treatment of diseases and conditions involving these microRNAs.

As indicated, agonists are also included in this study in which the aforementioned agonists are useful in selectively analyzing the biogenesis, degradation, and function of the KH domain containing microRNA as well as in the prevention or treatment of diseases and conditions involving these microRNAs.

And so the present invention also relates to methods in which the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly causes altered surface delivery, transport, stability, recycling or translation of a protein in the cell. Another embodiment of the present invention is a method in which the interaction between the KH domain binding microRNA and the KH domain containing protein leads directly or indirectly to altered surface delivery, transport, cleavage, transcription, stability or recycling of an RNA in the RNA. cell. And yet another embodiment of the present invention is a method in which changing the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly the proliferation, differentiation, apoptosis, necrosis, autophagia, motility, migration or cell invasion changes.

Suitable KH domain-containing proteins may include but are not limited to: AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRNPP, IGF2, IGF2, IGF2 IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, NOVA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOl, PNPT1, QKI, SF1 or TDRKH.

The A-kinase anchor proteins (AKAPs) are a group of proteins with a diverse structure that have the general function of binding the regulatory subunit of protein kinase A (PKA) and anchoring the holoenzyme in separate locations within the cell. AKAP1 (A-kinase anchor protein 1) encodes a KH domain-containing member of the AKAP family. The encoded protein binds to type I and type II regulatory subunits of PKA and anchors these to the mitochondrium. This protein is thought to be involved in the cAMP-dependent signal transduction pathway and in directing RNA to a specific cellular compartment.

The ankyrin repeat and KH domain-containing proteins encode proteins with ankyrin repeats and a single KH domain. They are associated with protein-protein interactions and can function as scaffold building proteins. Alternative cleavage results in multiple transcription variants. ANKHD1 and ANKRD17 and their cleavage variants encode KH domain-containing members of the ankyrin repeat and KH domain-containing proteins. ANKHD1 (ankyrin repeat and KH domain containing 1) can generate a fusion transcription (MASK-BP3) with the downstream eIF4E binding protein 3 (EIF4EBP3) gene, resulting in a protein consisting of the ANKHD1 sequence for the majority of the protein and another C-terminus due to an alternative read-out framework of the EIF4EBP3 segments. For ANKRD17 (ankyrin repeat domain 17), three transcription variants encoding different isoforms were found. ASCC1 (activating signal integrator 1 complex subunit 1) encodes a subunit of the activating signal integrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene activation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The coding protein contains an N-terminal KH-type RNA-binding motif that is required for AP-1 transactivation by the ASC-1 complex. Alternative spliced transcripts encoding multiple isoforms have been observed for this gene. BICC1 (Bicaudal C family RNA-binding protein 1) encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Acts as a negative regulator of Wnt signaling. It is a paralog of HDLBP (High Density Lipoprotein Binding Protein) that binds High Density Lipoprotein (HDL) and can serve to regulate high levels of cholesterol in cells. The HDLBP protein also binds RNA and can induce heterochromatin formation. Three transcription variants encoding two different isoforms have been found for this gene. It appears to play a role in cell sterol metabolism. It can function to protect cells against over-accumulation of cholesterol. BICC1 and HDLBP are more preferred KH domain-containing proteins of the invention.

Proteins of the DEAD box protein family are characterized by the preserved motif Asp-Glu-Ala-Asp (DEAD) and its putative RNA helicases. They are included in a number of cellular processes such as alteration of RNA secondary structure, translation initiation, nuclear and mitochondrial cleavage, and ribosome and spliceosome assembly. The protein encoded by DDX43 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 43) is an ATP-dependent RNA helicase in the DEAD-box family and exhibits tumor-specific expression. DDX53 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 53) is a gene with no intron. DDX43 and DDX53 and their cleavage variants encode KH domain containing members of the DEAD box protein family. KRR1 (KRR1, small subunit (SSU) processome component, homologue (yeast)) This protein-encoding gene is required for 40S ribosome biogenesis. It is involved in nucleolar processing of pre-18S ribosomal RNA and ribosome assembly. DPPA5 (Developmental PluriPotency Associated 5) encodes a protein that can function in the control of cell pluripotency and early embryogenesis. Expression of this gene is a specific marker for pluripotent stem cells. Pseudogens of this gene are known. FMR1 (Fragile X Mental Retardation 1), FXR1 (Fragile X Mental Retardation, autosomal homologue 1) and FXR2 (Fragile X Mental Retardation, autosomal homologue 2) encodes RNA-binding proteins that play a role in intracellular RNA transport and in regulation. of local translation of target mRNAs. They can interact with each other and associated polyribosomes, primarily with the 60S ribosomal subunit. FMR1 encodes a component of the CYFIP1-EIF4E-FMR1 complex that binds to the mRNA cap and mediates translational repression. For FXR1, three transcription variants have been found that encode different isoforms. The protein encoded by FXR2 is an RNA binding protein that contains two KH domains. GLD1 (Putative glucose-6-phosphate-1-dehydrogenase), is a cytosolic putative glucose-6-phosphate-1-dehydrogenase.

The hnRNPs (heterogeneous nuclear ribonucleoproteins) are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins can associate with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. Some of the hnRNPs commute between the nucleus and the cytoplasm. They can be responsible for transcriptional regulation by acting as transfactors in regulatory gene expression. They can interact with each other and thereby form heterodimers. They are important for RNA localization, surface delivery and local translation regulation.

The hnRNP proteins have clearly distinct nucleic acid binding properties. HNRNPK (Heterogeneous Nuclear RiboNucleoProtein K), PCBP1 (poly (rC) binding protein 2), PCBP3 (poly (rC) binding protein 3) and PCBP4 (poly (rC) binding protein 4) clearly distinguish themselves from other hnRNP proteins in their binding preference in that they persistently bind to poly (C). These proteins each have three repeated KH domains that bind to RNAs. The KH domain-containing proteins of the hnRNPs (heterogeneous nuclear RiboNucleoProteins) are a preferred embodiment of the invention. HNRNPK, PCBP1, PCBP2, PCBP3 and / or PCBP4 are more preferred KH domain-containing proteins of the invention.

The HNRNPK encoded protein is in the nucleoplasm. It is assumed that it plays a role during cell cycle progression. Various alternative spliced transcription variants have been described for this gene, but not all of them have been fully characterized. It plays an important role in p53 / TP53 response to DNA damage at the level of both transcription activation and repression. When SUMOylated, this protein acts as a transcriptional co-activator of p53 / TP53, thereby playing a role in p21 / CDKN1A and 14-3-3 sigma / SFIM induction. As far as transcription repression is concerned, it works by interacting with long intergenic RNA p21 (MncRNA-p21), a non-coding RNA induced by p53 / TP53. This interaction is necessary for the induction of apoptosis, but not for stopping the cell cycle. The protein promotes tumor metastasis by induction of genes involved in extracellular matrix, cell displacement and angiogenesis. HNRNPK post-transcriptively co-regulates multiple genes for the cytoskeleton needed for axonogenesis and loss of hnRNP K weakens synaptic plasticity in hippocampal neurons. PCBP1 is a gene without an intron. PCBP2 has multiple transcription variants that encode different isoforms. It is a single-stranded nucleic acid binding protein that binds preferentially to oligodC but also binds to poly (rU). The protein of the PCBP3 gene is found in the cytoplasm. There is a lack of nuclear localization signals that can be found in other subfamily members. Alternative splitting results in multiple transcription variants encoding different isoforms. PCBP4 is induced by the p53 tumor suppressor and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle stop in G (2) -M. Like PCBP3, the protein of this gene is found in the cytoplasm and the nuclear localization signals are found in other subfamily members. Multiple alternative spliced transcription variants have been described.

The insulin-like growth factor 2 mRNA-binding protein family encodes proteins that contain various KH domains that are important in RNA binding and are known to be involved in RNA synthesis and metabolism. These are RNA-binding factors that attract target transcripts for cytoplasmic protein-RNA complexes (mRNPs). This transcription 'cages' in mRNPs makes mRNA transport and short-term storage possible. It also modulates the speed and location at which target transcripts encounter the translation device and shields them from endonuclease attacks or microRNA mediated degradation. IGF2BP1 (insulin-like growth factor 2 mRNA binding protein 1) encodes a protein that functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducine repeat-containing protein and regulating their translation. Two transcription variants have been found for this gene that encode different isoforms. It plays a direct role in the transport and translation of transcriptions required for axon regeneration in mature sensory neurons. It controls localized beta-actin (ACTB) mRNA translation, a crucial process for cell polarity, cell migration and neurite outgrowth. Co-transcriptively, it associates with ACTB mRNA in the nucleus. This involves a conserved element of 54 nucleotides in the ACTB mRNA 3 'UTR, known as the' zip code '. The thus formed RNP is exported to the cytoplasm, binds to a motor protein and is transported along the cytoskeleton to the cell periphery. ACTB prevents the translation of mRNA to a protein during transport. When the RNP complex reaches its destination close to the plasma membrane, IGF2BP1 is phosphorylated. This releases the mRNA allowing ribosomal 40S and 60S subunits to assemble and initiate ACTB protein synthesis. Monomer ACTB then assembles in the subcortical actin cytoskeleton (by uniformity). During neuronal development, it is an important regulator of neurite outgrowth, growth cone conduction, and neuronal cell migration, believed to be via the spatial-fine tuning of protein synthesis, such as that of ACTB. Can regulate mRNA transport to activated synapses. Bind and stabilize ABCB1 / MDR-1 mRNA. It interacts with and stabilizes PTGS2 transcription. Binds with the 3 'UTR of IGF2 mRNA through a mechanism of cooperative and sequential dimerization and IGF2 mRNA regulates subcellular localization and translation. Binds to MYC mRNA, in the Coding Region instability Determinant (CRD) of the Open Reading Frame (ORF), and thus prevents MYC cleavage by endonucleases and possibly microRNA that focuses on MYC-CRD. Binds to the 3 'UTR of CD44 mRNA and stabilizes it, thus promoting cell adhesion and invadopodia formation in cancer cells. Binds to the oncofetal H19 transcription and to the neuron-specific TAU mRNA and regulates their localizations. Binds to and stabilizes BTRC / FBW1A mRNA. Binds to the adenine-rich AutoRegulating Sequence (ARS) located in PABPC1 mRNA and suppresses its translation. PABPC1 mRNA binding is stimulated by PABPC1 protein. Prevents BTRC / FBW1A mRNA degradation by disruption of microRNA-dependent interaction with AG02. Promotes the controlled displacement of tumor-derived cells by fine-tuning intracellular signaling networks. Binds to MAPK4 3 'UTR and inhibits its translation. Interacts with Open Reading Frame (ORF) PTEN transcription and prevents mRNA decay. This combined action on MAPK4 (down-regulation) and PTEN (up-regulation) antagonizes HSPB1 phosphorylation, and therefore prevents G-actin sequestration by phosphorylated HSPB1, allowing F-actin polymerization. Therefore, it increases the speed of cell migration and stimulates controlled cell migration by PTEN modulated polarization.

During cell stress, such as oxidative stress or heat shock, the target mRNAs that are attracted to stress granules, including CD44, IGF2, MAPK4, MYC, PTEN, RAPGEF2 and RPS6KA5 transcripts. IGF2BP2: (insulin-like growth factor 2 mRNA binding protein 2) This gene encodes a part of the IGF-II mRNA binding protein (IMP) family. Flet protein encoded by this gene functions by binding to the 5 'UTR of the insulin-like growth factor 2 (IGF2) mRNA and regulating IGF2 translation. Alternative transcriptional cleavage variants, encoding other isoforms, have been characterized. Binding is isoform-specific. Binding to beta-actin / ACTB and MYC transcripts IGF2BP3; IGF2BP3 (insulin-like growth factor 2 mRNA binding protein 3) The protein encoded by this gene is mainly found in the nucleolus, where it can bind to the 5 'UTR of the insulin-like growth factor II leader 3 mRNA and suppress translation of insulin-like growth factor II during late development. A pseudogen exists on chromosome 7 and there are putative pseudogens on other chromosomes. Binds to the 3'-UTR of CD44 mRNA and stabilizes it, and therefore promotes cell adhesion and invadopodia formation in cancer cells. Binds to beta-actin / ACTB and MYC transcripts. Binds to the 5 'UTR of the insulin-like growth factor 2 (IGF2) mRNAs. IGF2BP1, IGF2BP2 and / or IGF2BP3 are members of the insulin-like growth factor 2 mRNA binding protein family. They are preferred KH domain-containing proteins.

The K-homology domain-containing, RNA-binding, signal transduction-associated proteins have many functions and can be involved in various cellular processes, including alternative cleavage, cell cycle regulation, RNA 3 'end formation and tumorigenesis. KHDRBS1 (containing KH domain, RNA binding, signal transduction associated 1). The alternative cleavage of this gene results in multiple transcription variants. The proteins are attracted and tyrosine phosphorylated by various receptor systems, for example the T cell, leptin and insulin receptors. Once phosphorylated, the protein functions as an adapter protein in signal transduction cascades by binding to SH2 and SH3 domain-containing proteins. It plays a role in G2-M progression in the cell cycle. Suppresses CBP-dependent transcriptional activation by competing with other nuclear factors for binding to CBP. It reacts as a putative regulator of mRNA stability and / or translation scope and mediates mRNA nuclear export. It positively regulates the association of Constitutive Transport Element (CTE)-containing mRNA with large polyribosomes and translation initiation. According to some authors, it is not involved in nucleocytoplasmic export of the non-spliced (CTE) -containing RNA Isoform 3 species, which is only expressed in growth-arrested cells, inhibits S phase. KHDRBS2 (containing KH domain, RNA binding, signal transduction associated 3). The protein encoded by this gene is an RNA-binding protein that plays a role in regulating alternative cleavage and influencing site selection for mRNA cleavage and exon inclusion affected. Its phosphorylation by FYN inhibits its ability to regulate the selection of the cleavage site. Induces an increased concentration-dependent absorption of exons in CD44 pre-mRNA by direct binding to purine-rich exon enhancer. Can act as an adapter protein for Src kinases during mitosis. Bind both poly (A) and poly (U) homopolymers. Phosphorylation by PTK6 inhibits its RNA binding capacity KHDRBS3 (containing KH domain, RNA binding, signal transduction associated 3) encodes an RIMA binding protein that plays a role in the regulation of alternative cleavage and influences the selection of mRNA cleavage location and exoninclusion. It can play a role as a negative supply mechanism for cell growth. It inhibits cell proliferation. It is involved in selecting the vascular endothelial growth factor cleavage site. It induces an increased concentration-dependent absorption of exons in CD44 pre-mRNA by direct binding to purine-rich exon enhancer. Its RNA binding capabilities are down-regulated by tyrosine kinase PTK6. KHDRBS1, KHDRBS2 and / or KHDRBS3 are part of the KH domain-containing, RNA-binding, signal transduction-associated protein family. They are the preferred KH-containing proteins.

The Far UpStream Element (FUSE) binding protein can interact with single-stranded DNA from the Far-UpStream Element (FUSE) and can activate gene expression. FUBP1 (far upstream element (FUSE) binding protein 1) encodes an ssDNA binding protein that activates the Far UpStream Element (FUSE) of c-myc and stimulates expression of c-myc in undifferentiated cells. Regulation of FUSE by FUBP takes place via single-strand binding of FUBP to the non-coding strand. This protein has been shown to function as an ATP-dependent DNA helicase. It regulates MYC expression by binding to a single-stranded Far-UpStream Element (FUSE) upstream of the MYC promoter. It can work as both an activator and repressor of transcription. KHSRP / FUBP2 (KH-type cleavage regulating protein) encodes a protein that binds to the dendritic target element and can play a role in mRNA transport. It is part of a ternary complex that binds to the DownStream Control sequence (DCS) of the pre-mRNA. It mediates exon inclusion in transcripts that are subject to tissue-specific alternative cleavage. It is also involved in the degradation of inherently unstable mRNAs that contain AU-rich elements (AREs) in their 3 'UTR, possibly by attracting degradation machines to ARE-containing mRNAs. FUBP3 (Far UpStream Element (FUSE) binding protein 3) also encodes a protein coding gene. FUBP1, FUBP2 and / or FUBP3 are KH domain-containing proteins that belong to the Far UpStream Element-containing protein family.

The members of the mex-3 (muscle excess 3) RNA-binding family are RNA-binding proteins that may be involved in post-transcriptional control mechanisms. MEX3A (mex-3 RNA binding family member A) gene product can colocalize with the gene product of MEX3B. MEX3B (mex-3 RNA-binding family member B) encodes an RNA-binding phosphoprotein. The encoded protein contains N-terminal nuclear export and nuclear localization signals and is exported from the cytoplasm to the nucleus. The protein binds with RNA via two KH domains and also colocalisates with DcplA decapping factor and Argonaut proteins within P (processing) bodies. MEX3C (mex-3 RNA-binding family member C) encodes a member of a family of proteins with two K-homologous (KH) RNA-binding domains and a C-terminal RING finger domain. The protein interacts with mRNA via the KH domains and the protein commutes between the nucleus and the cytoplasm. It is an E3 ubiquitin ligase responsible for the post-transcriptional regulation of general HLA-A allotypes. It binds to the 3 'UTR of HLA-A2 mRNA, and regulates its level by promoting mRNA decay. RNA binding is sufficient to prevent translation, but ubiquitin ligase activity is required for mRNA degradation. MEX3D (mex-3 RNA binding family member D) is also a protein-encoding gene. MEX3A, MEX3B and / or MEX3C are KH domain-containing proteins belonging to the mex-3 RNA binding family.

The neuro-oncological ventral antigen proteins may possibly regulate RNA cleavage or metabolism in a specific subset of developing neurons. NOVA1 (neuro-oncologically ventral antigen 1) encodes a neuron-specific RNA-binding protein, a member of the Nova family of paraneoplastic disease antigens, which is recognized and inhibited by paraneoplastic antibodies. Alternative spliced transcripts encoding distinct isoforms have been described. NOVA2 (Neuro-Oncological Ventral Antigen 2) is also a protein coding gene. NOVA1 and / or NOVA2 are KH domain-containing proteins that belong to the neuro-oncological ventral antigen family. NOVA1 and / or NOVA2 are preferred KH domain-containing proteins of the invention. PNO1 (partner of NOB1 homologue (S. cerevisiae)) is a protein-coding gene. PNPT1 (polyribonucleotide nucleotidyl transferase 1). The protein encoded by this gene belongs to the evolutionally conserved polynucleotide phosphorylase family consisting of phosphate dependent 3 'to 5' exoribonucleases involved in RNA processing and degradation. This enzyme is mainly located in the space between mitochondrial membranes and is involved in the import of RNA into mitochondria. Related pseudogens have been found. It

RNA-binding protein is involved in numerous RNA-metabolic processes. It catalyzes the phosphorus lysis of single-stranded polyribonucleotides in the 3'-to-5 'direction. It is a component of the mitochondrial degradosome (mtEXO) complex that degrades 3 'overhang double-stranded RNA in a 3' to 5 'direction in an ATP dependent manner. It is required for correct processing and polyadenylation of mitochondrial mRNAs. It plays a role as a cytoplasmic RNA import factor that mediates the translocation of small RNA components, such as the 5S RNA, the RNA subunit of ribonucléase P and the Mitochondrial RNA Processing (MRP) RNA, to the mitochondrial matrix. It plays a role in mitochondrial morphogenesis and respiration and regulates the expression of the Electron Transport chain (ETC) components at the level of mRNA and protein. In the cytoplasm, exhibits a 3 'to 5' exoribonuclease mRNA degradation activity. It degrades c-myc mRNA when treated with IFNB1 / IFN-beta, resulting in a growth stop in melanoma cells. It plays a role in RNA cell monitoring by cleaning up oxidized RNAs. Binds to the RNA subunit of ribonucléase P, MRP RNA and miR-221 microRNA QKI (Quaking Homolog, KH domain RNA binding). The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA cleavage, export of mRNAs from the nucleus, protein translation and mRNA stability. The encoded protein is involved in myelination and differentiation of oligodendrocytes and may possibly play a role in schizophrenia. Four transcription variants encoding different isoforms have been found for this gene. RNA-binding protein that plays a central role in myelination. Binds to the 5'-€Α € υΑΑΥ-Ν (1.20) -υΑΑΥ-3 'RNA core sequence. Works by regulating pre-mRNA cleavage, mRNA export, mRNA stability and protein translation. Required for protecting and promoting stability of mRNAs such as MBP and CDKN1B. Regulator of oligodendrocyte differentiation and maturation in the brain and may play a role in myelin and oligodendrocyte dysfunction in schizophrenia. Participates in mRNA transport by regulating the nuclear export of MBP mRNA. Is also involved in regulating mRNA cleavage of MAG pre-mRNA. Acts as a translation repressor. SF1 (splicing factor 1) encodes a nuclear pre-mRNA cleavage factor. The encoded protein specifically recognizes the intron branching point sequence and is required for the early stages of spliceosome assembly. Alternative splitting results in multiple transcription variants. Necessary for the ATP-dependent first step of spliceosome assembly. Binds to the intron branching point sequence (BPS) 5'-UACUAAC-3 'of the pre-mRNA. Can act as a transcription repressor. SF1 is a preferred KH domain-containing protein of the invention. TDRKH (containing tudor and KH domain) is a protein coding gene. Participates in the primary piRNA biogenesis pathway and is required during spermatogenesis to suppress transposable elements and prevent their further mobilization, which is essential for germline integrity. The piRNA metabolic process mediates the repression of transposable elements during the meiosis by forming complexes composed of piRNAs and Piwi proteins and controls the methylation and subsequent suppression of transposons. Required for the final steps of primary piRNA biogenesis by participating in the processing of 31-37 nt intermediates into finished piRNAs.

The invention is relevant to systems and methods for performing tests for determining the biological activity and pharmacological properties of one or more compounds, individually or in combination, by using whole animals and whole cells. The systems and methods are particularly suitable for high throughput screening techniques for identifying compounds that are effective in a whole-animal or whole-cell system.

The invention provides an automated, robot micro-fluid system for maintaining a single cell or multiple cells or organisms with minimal or no manual intervention. In this system, organisms and cells can be moved, sorted, immobilized, exposed to connections and recordings can be made with microscopy for anatomical research, behavioral research and by using various genetically coded fluorescent or luminescent reporters, the concentration of various molecular elements such as calcium , the electrical potential, or other characteristics are monitored in the living animal or the entire cell. Physiological parameters including, but not limited to, reproduction, genetic and epigenetic modifications, ingestion, consumption of various substances and metabolites can be monitored by linking the system to various microtitration and analysis techniques. The invention provides screening methods for detecting and identifying substances that affect cell viability and / or prevent the bioavailability of a compound and / or disease or phenotype progression, and / or confer protective effects.

Micro flow devices have recently been accepted and have significantly influenced the design and implementation of modern bioanalysis systems. These devices can handle and manipulate small amounts of fluid sample in a much more efficient manner with the possibility of faster test response times, simplified analysis procedures and smaller samples needed for analysis. Micro-flow devices are used in a wide range ranging from syntheses to separation procedures to analyzes in applications such as immunoassays, 'lab-on-a-chip', fast nucleotide sequence analysis and high throughput screening.

Accordingly, a typical micro-flow device has standard structural or functional properties dimensioned on a millimeter scale or less, capable of manipulating small amounts of liquids. Typically, these features include, but are not limited to, channels, fluid reservoirs, reaction chambers, mixing chambers, and separation areas. In some examples, the channels have at least one cross-sectional dimension in the size of about 0.1 μιη to about 500 μιη. By using dimensions of this order of magnitude, a larger number of channels can be accommodated in a smaller area, so that smaller liquid volumes are required.

A micro-flow device may exist on its own or may be part of a micro-fluid system that may include, for example and without limitation, pumps for introducing fluids, e.g., samples, reagents, buffers, drugs, and the like, into a system and / or via the system; detection equipment or systems; data storage systems; and control systems for controlling fluid transport and / or direction within the device, monitoring and controlling environmental conditions to which the liquids in the device are subjected, such as temperature, flow, and the like.

An embodiment of the invention described herein is a micro-flow system with a micro-flow device module that has one or more sealed chambers and in which the fluid in the chamber communicates with an inlet channel and an outlet channel for micro-flow. In this way, a liquid can be pumped through the chambers to bring in nutrients or remove biological waste that can accumulate over time. In addition, drugs or nutrients can be pumped through the micro-flow channels into the chambers for use in the culture and research of adult specimens, embryos and larvae of multicellular organisms, organs, tissues, cells or cell lines that can be placed in the chambers and grown up. In one aspect of the invention, a plurality of micro-flow device modules, each with one or more chambers, can be coupled together within a larger frame to realize a universal micro-flow environment.

In another embodiment of the invention, the micro-flow system described herein can be used to perform experiments on whole organisms, such as e.g., C. elegans, fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and other small metazoë organisms that are placed in the chambers. The changes in the entire animal or the development of the embryos / larvae over a period of days can be monitored, for example with or without exposure to drugs or other compounds. For example, transparent or partially transparent organisms such as Danio rerio can be used to take pictures of cell activity or internal processes with or without exposure to drugs or other compounds. In other embodiments, experiments can be performed on a monolayer of cells, on a membrane, matrix, or other material. The invention is suitable for systems and methods for performing tests for determining the biological activity and pharmacological properties of one or more compounds, individually or in combination, by using whole animals or whole cells. The systems and methods are particularly suitable for high throughput screening techniques for identifying compounds that are effective in a whole-animal or whole-cell system.

The invention provides an automated, robot micro-fluid system for maintaining a single cell or multiple cells or organisms with minimal or no manual intervention. In this system organisms and cells can be moved, sorted, immobilized, exposed to connections and microscopic recordings can be made for anatomical research, behavioral research and by using various genetically coded fluorescent or luminescent reporters, the concentration of various molecular elements such as calcium, the electrical potential, or other characteristics, are monitored in the living animal or the entire cell. Physiological parameters including, but not limited to, reproduction, genetic and epigenetic modifications, ingestion, consumption of various substances and metabolites can be monitored by linking the system to various micro-titration and analysis techniques. The invention provides screening methods for detecting and identifying substances that affect cell viability and / or prevent the bioavailability of a compound and / or disease or phenotype progression, and / or confer protective effects.

Micro-flow devices have recently been accepted and have significantly influenced the design and implementation of modern bioanalysis systems. These devices can handle and manipulate small amounts of fluid sample in a much more efficient manner with the possibility of faster test response times, simplified analysis procedures, and smaller samples needed for analysis. Micro-flow devices find application in a wide range ranging from syntheses to separation procedures to analyzes in applications such as immunoassays, 'lab-on-a-chip', fast nucleotide sequence analysis and screening with a high throughput.

Accordingly, a typical micro-flow device has standard structural or functional properties dimensioned on a millimeter scale or less, capable of manipulating small amounts of liquids. Typically these functions include, but are not limited to, channels, fluid reservoirs, reaction chambers, mixing chambers, and separation areas. In some examples, the channels have at least a cross-sectional dimension that is in a range of about 0.1 μιη to about 500 μιη. By using dimensions of this order of magnitude, a larger number of channels can be accommodated in a smaller area and smaller amounts of liquids are used.

A micro-flow device may exist on its own or may be part of a micro-fluid system that may include, for example and without limitation, pumps for introducing fluids, e.g., samples, reagents, buffers, drugs, and the like, into a system and / or through the system; detection equipment or systems; data storage systems; and control systems for controlling fluid transport and / or direction within the device, monitoring and controlling environmental conditions to which the liquids in the device are subjected, such as temperature, flow, and the like.

An embodiment of the invention described herein is a micro-flow system with a micro-flow device module that has one or more sealed chambers and in which the fluid in the chamber communicates with an inlet channel and an outlet channel for micro-flow. In this way, a liquid can be pumped through the chambers to bring in nutrients or remove biological waste that can accumulate over time. In addition, drugs or nutrients can be pumped through the micro-flow channels into the chambers for use in the culture and research of adult specimens, embryos and larvae of multicellular organisms, organs, tissues, cells or cell lines that can be placed and grown in the chambers . In one aspect of the invention, a plurality of micro-flow device modules, each with one or more chambers, can be coupled together within a larger frame to realize a universal micro-flow environment.

In another embodiment of the invention, the micro-flow system described herein can be used to perform experiments on whole organisms, such as e.g., C. elegans, fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and other small metazoë organisms that are placed in the chambers. The changes in the entire animal or the development of the embryos / larvae over a period of days can be monitored, for example with or without exposure to drugs or other compounds. For example, transparent or partially transparent organisms such as Danio rerio can be used to take pictures of cell activity or internal processes with or without exposure to drugs or other compounds. In other embodiments, experiments can be performed on a monolayer of cells, on a membrane, matrix, or other material within the chamber.

The micro-flow device can contain a substrate. The substrate can be rectangular, circular, oval or any other shape. The substrate can be made of a suitable material selected for its properties, such as good thermal conductivity, surface properties that allow uniform coating and a stable reagent, and neutrality to the liquid medium to prevent interference with the test. Suitable materials for a solid substrate for this purpose include flexible polymer such as polydimethylsiloxane, harder polymers, glass, metal, hydrogel, silicone, PETG, polyester, polycarbonate, PVC, polystyrene, SAN, acrylonitrile butadiene styrene (ABS), and combinations and hybrids thereof and includes beads, membranes, microtitre tubs, strings, plastic, strips, or any surface on which entire organisms can be deposited or immobilized. Alternatively and equivalent, a commercially available molded solid substrate can be used in practicing the invention.

Each micro-flow module can contain one or more ports with negative pressure (vacuum) and positive pressure to provide the movement force to liquids, or other ways of moving the liquids, as well as pressure-transmitting ports for controlling on-chip valves.

Large animals including the zebrafish embryos and larvae can have dimensions in the order of a few millimeters. To make chambers with these dimensions, channels in a rigid substrate can be milled out with a milling machine or a laser cutter. For areas requiring round channels, including sections that contain micro-flow valves, a ball end mill with a round top can be used.

It will be appreciated that in practice a micro-flow device module may contain 32 chambers, 96 chambers, 869 chambers, or any other number of chambers required. In another aspect of the invention, the micro-flow device consists of a set of micro-flow device modules, which usually consist of a structure of single or multi-layer polymer chips, with a common interface of physical interconnections, with which any two modules can be connected to each other. Multiple chips can be connected within a larger frame to create a universal micro-flow environment. The frame can be flat, so that devices with a square or rectangular shape can have a place or it can be three-dimensional, so that rectangular prism or cube shapes are possible. The physical interface between the modules can simply consist of adjacent faces or it can consist of male / female plug connections analogous to a chip socket on an electronic printed circuit board, tongue and groove connections, or other coupling configurations or mounting methods.

By coordinated switching of on-chip valves, animals can be moved to other parts of a device and also between connected devices. In addition, by coordinated switching of on-chip or off-chip valves, liquids can be moved to or away from the animals for the purpose of supplying test compounds or reagents, as well as for collecting liquids, tissue and metabolic products for analysis.

In one aspect of the invention, specified micro-flow device modules can be designed to allow geometric alignment or physical connection to third-party devices, such as microscope object carriers or lenses to enable image recording.

Micro-flow modules can be designed to interface with other third-party devices such as complex object sorters such as COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers such as FACS (Fluorescence Activated Cell Sorter), lasers, irradiators and other detection systems can similar micro-flow modules to have an interface with the system.

An example of an automated detection system for use with the present invention and associated methods consists of an excitation source, a monochromator (or any other device that can spectrally decompose light components, or a set of narrow-band filters) and a detector package. The excitation source can consist of infrared, blue or UV wavelengths and the excitation wavelength can be shorter than the emission wavelength (s) to be detected. The detection system can be: a broadband UV light source, such as a deuterium lamp with a filter in front; the light from a white light source such as a xenon lamp or a deuterium lamp after it has passed through a monochromator to extract the desired wavelengths; or any other of a number of 'continue wave' (cw) gas lasers, including, but not limited to, all Argon ion laser lines (457, 488, 514, etc. nm) or a HeCd laser; solid state diode lasers such as GaN and GaAs (doubled) based lasers or the doubled or tripled output of YAG or YLF based lasers; or any pulse laser that emits blue light.

The light emitted by the organism, sample, or reagents into the chamber can be detected with an apparatus that provides spectral data on the substrate, e.g., a grating spectrometer, prism spectrometer, image recording spectrometer, or the like, or uses interference band filters. By using a two-dimensional area recording device such as a ccd camera, many objects can be displayed simultaneously. Spectral data can be generated by collecting more than one image via different band filters, or filters that transmit long or short waves (interference filter or electronically adjustable filters are suitable). More than one image recording device can be used to collect data simultaneously by means of special filters, or the filter arranged for a single recording device can be exchanged. Image-based systems, such as the Biometrics Imaging system, scan a surface to find fluorescence signals.

The micro-flow system described here can be used to perform experiments on whole cells as described above and below, and / or on organisms such as e.g.

Caenorhabditis elegans (C. elegans), fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and other small metazoa organisms or single-cell organisms such as, for example, Saccharomyces cerevisiae (yeast), and other fungi or protozoa organisms, placed in the rooms. The current disclosure will focus on Danio rerio and / or Drosophila melanogaster, but it should be noted that where Danio rerio or Drosophila melanogaster is mentioned other small animals can be used.

For example, genes important for metabolism in mammals such as genes for an insulin signaling pathway, the EGFR pathway, the cholesterol pathway, the LXR pathway, the LRP pathway and / or the bile acid pathway are present in Danio rerio. For example, the plurality of Danio rerio can include a large number of wild-type or genetically modified or transgenic Danio rerio. In another example, the plurality of zebrafish may include a large number of genetically modified or transgenic zebrafish with a transgene that is a promoter-reporter composition, wherein the reporter encodes a fluorescent or luminescent protein and wherein the Promoter is a promoter of a zebrafish induced in response for exposure to a toxin or stress.

The present invention can focus on methods for mutating a single gene or multiple genes (e.g., two or more) in zebrafish to obtain mutant strains that exhibit increased permeability or bioavailability for compounds. The present invention includes various methods for creating mutations in zebrafish. In one embodiment, the mutation is an insertion or insertion mutation. In another embodiment, the mutation is a deletion or deletion mutation. In another embodiment, the method of mutation is to introduce a cassette or gene trap by recombination. In another embodiment, a small nucleic acid sequence modification is created by mutagenesis, such as by creating frame shifts, stop mutations, substitution mutations, small insertion mutations, small deletion mutations, and the like.

Mutant strains that exhibit increased permeability to compounds can be identified by conducting in parallel pure forward EMS mutagenesis screening and candidate-based screening for mutants in genes that can confer permeability, including but not limited to, multiple drug resistance proteins, P- glycoproteins, ABC transport proteins, glycosyl transferases, nuclear hormone receptors, organic anion transporters and fatty acid transporters. The mutant strains can be screened for permeability mutants using a combination of fluorescence / luminescence tests and accessibility tests for compounds known to be excluded by wild-type zebrafish (including but not limited to chloroquine, colchicine, nicotine, verapamil and other calcium channel antagonists, heavy metals, ivermectin). Single mutations can be combined combinatorically and the resulting strains re-screened in an iterative manner for health and uptake of compounds until the desired set of mutations is revealed. Heat determinations include but are not limited to motility, reproduction, propidium iodide uptake, lifespan, and behavioral analyzes. The accessibility of small molecules to cells and tissue in the mutant strains can be determined by expressing luciferases in a tissue-specific manner, then feeding zebrafish with luciferin co-factor and screening for luminescence. The invention thus provides a panel of mutant strains that are more or less susceptible to drugs with regard to the levels of cell and tissue accessibility. These strains may permit exogenous compounds that would normally be excluded from entry into the body due to increased intestinal or cuticular permeability, increased intestinal transport of incorporated molecules, increased pharyngeal pumping action, decreased function of detoxification enzymes or pumps or a combination of these mechanisms, or by an unknown mechanism. This library may contain strains with permeability that varies per tissue or that varies depending on the chemotype of the exogenous compound. These strains exhibit increased permeability for compounds without an increased background phenotype. Increased permeability is determined in various tissues and cell types by fluorescence and luminescence studies and by phenotype screening for accessibility for compounds known to be excluded by wild-type strains. Strains in this library can also be modified to contain compositions for tissue-specific, location-specific and / or development-stage-specific expression of endogenous or exogenous human proteins, which can be included in plasmids or introduced directly by genomic processing. These transgenic strains may contain single or multiple copies of transgenes expressing human proteins from extrachromasomal ranges or integrated into the genome.

The selected animals can be sorted and supplied using one of the known methods or the micro-flow system can be used to sort the animals and move them to the correct room. Preferably, with the selected sorting / administration method, efficient distribution can take place in the chambers of C. elegans, Danio rerio embryos or Drosophila melanogaster and individual organisms can be quickly deposited. Furthermore, each organism can be optically analyzed so that only desired organisms with certain predetermined biological characteristics are deposited. This makes it possible to select identically phased organisms, which considerably increases the uniformity of the test procedure. Any of the known sorting processing methods and commercially available equipment can be used.

The transgenic animals can carry a label to facilitate detection thereof. In some embodiments, this can be a fluorescent label. Every animal can bear a different fluorescent label. However, the detectable label does not have to be fluorescent but can be any label. A method for detecting the fluorescent label consists of the use of radiation with a wavelength specific to the label or the use of other suitable lighting sources. The fluorescence of the label can be detected by a CCD camera or other suitable detection methods.

The micro-flow systems and methods provided here can be advantageous with robotic systems and equipment for storing and moving these micro-flow modules as chambers for robotic systems for rapidly delivering liquids into and out of the plates. By combining an automated micro-flow platform for maintaining, handling and testing organisms with a library of synthetic mutants with a diversity of permeability properties and selectivity, this system can make it possible to screen compounds with high throughput for intact organisms.

The robotic system includes programmable robotic arm manipulators for installing, removing, and configuring modules of the micro-flow module arrangement. When they are clicked into place, the modules connect closely to other modules to form sealed micro-flow interfaces. These interfaces can be fixed or attached with mechanical lips or pins. Modules can also be controlled and triggered by fluid, electrical, magnetic, thermal and mechanical interaction with an active control matrix below the plane of the module arrangement. This control matrix can contain electrical connections, analog-digital interfaces and magnetic and mechanical actuators, as well as thermocouples and fluid couplings, as well as outlet ports for removing liquid and particulate waste from the micro-flow arrangement. The control matrix and robotics can be connected to computers for software-programmable real-time operation. In addition, the manipulators can mechanically manipulate external equipment such as video cameras and external devices from third parties and operate them without human intervention. The robotic system can be controlled with a programmable software package with an application programming interface allowing it to be used in combination with existing software programming languages such as C, C ++, Visual Basic, Python, and MATLAB, as well as proprietary and open source robotic control software.

The robot system can be monitored by means of video monitoring, laser / optical sensors, as well as mechanical, temperature and chemical sensors.

With multi-colored fluorescence, multiple targets and cell processes can be tested on a single screen. Cross-correlation of cellular responses will provide a wealth of information needed to validate goals and optimize a lead.

The present invention provides a method for analyzing whole animals comprising a range of locations containing multiple animals in which the animals contain one or more fluorescent reporter molecules; scanning multiple animals at each location to obtain fluorescence signals from the fluorescent reporter molecules in the animals; converting the fluorescent signals into digital data; and utilizing the digital data to determine the distribution, environment, or activity of the fluorescent reporter molecules within the animals. In another aspect, the present invention provides a method for analyzing whole animals comprising providing a location in which there is an animal in which the animal can optionally contain one or more reporter molecules; bringing the animal into contact with a library of compounds; scanning the animal at multiple locations in which each location contains a different detection system; obtaining detection signals and converting the signals to digital data; and utilizing the digital data to determine the distribution, environment, or activity of the reporter molecules within the animals.

As an example, the Drosophila melanogaster or a zebrafish embryo can be placed in the room by a robotizer. The animal may lie freely in the fluid in the chamber, or may be embedded in a low melting point agarose, or any other substance that can immobilize the animal but does not damage it or prevent gas / nutrient exchange. Each chamber will have a constant supply of a certain buffer that flows through its micro-flow inlet channels. In addition, medications can be administered to the animals in the room by using the micro-flow channels or by using robot pipet handlers through a sliding cover, which can be plastic or glass and can be withdrawn to make the opening accessible for injection. The invention is relevant to systems and methods for performing tests for determining the biological activity and pharmacological properties of one or more compounds, individually or in combination, by using whole animals or whole cells. The systems and methods are particularly suitable for high throughput screening techniques for identifying compounds that are effective in a complete animal or a complete cell based system.

The invention provides an automated, robot micro-fluid system for maintaining a single cell or multiple cells or organisms with minimal or no manual intervention. In this system organisms and cells can be moved, sorted, immobilized, exposed to connections and recordings can be made via microscopy for anatomical research, behavioral research and by using various genetically coded fluorescent or luminescent reporters, the concentration of various molecular elements such as calcium , the electrical potential, or other characteristics are monitored in the living animal or whole cell. Physiological parameters including, but not limited to, reproduction, genetic and epigenetic modifications, ingestion, consumption of various substances and metabolites can be monitored by linking the system to various micro-titration and analysis techniques. The invention provides screening methods for detecting and identifying substances that affect cell viability and / or prevent the bioavailability of a compound and / or disease or phenotype progression, and / or confer protective effects.

Micro-flow devices have recently been accepted and have significantly influenced the design and implementation of modern bioanalysis systems. These devices can handle and manipulate small amounts of liquid sample in a much more efficient way, with the possibility of faster test response times, simplified analysis procedures and smaller samples needed for analysis. Micro-flow devices are used in a wide range ranging from syntheses to separation procedures to analyzes in applications such as immunoassays, lab-on-a-chip, fast nucleotide sequence analysis and screening with a high throughput.

Accordingly, a typical micro-flow device has standard structural or functional properties dimensioned on a millimeter scale or less, capable of manipulating small amounts of liquids. Usually this includes features such as, but not limited to, channels, fluid reservoirs, reaction chambers, mixing chambers, and separation areas. In some examples, the channels have at least one cross-sectional dimension in the order of magnitude of about 0.1 μιη to about 500 μιη. By using dimensions of this order of magnitude, a larger number of channels can be accommodated in a smaller area, so that smaller liquid volumes are required.

A micro-flow device may exist on its own or may be part of a micro-fluid system that may include, for example but without limitation: pumps for introducing fluids, e.g., samples, reagents, buffers, drugs, and the like, into a system and / or via the system; detection equipment or systems; data storage systems and control systems for controlling fluid transport and / or direction within the device, monitoring and controlling environmental conditions to which the fluids in the device are subjected, such as temperature, flow, and the like.

In one embodiment of the invention described herein is a micro-flow system with a micro-flow device module that has one or more sealed chambers and in which the fluid in the chamber communicates with an inlet channel and an outlet channel for micro-flow. In this way, a liquid can be pumped through the chambers to bring in nutrients or remove biological waste that can accumulate over time. In addition, drugs or nutrients can be pumped through the micro-flow channels into the chambers for use in spawning and examination of adult specimens, embryos and larvae of multicellular organisms, organs, tissues, cells or cell lines that can be placed in the chambers and grown up. In one aspect of the invention, a plurality of micro-flow device modules, each with one or more chambers, can be coupled together within a larger frame to realize a universal micro-flow environment.

In another embodiment of the invention, the micro-flow system described herein can be used to perform experiments on entire organisms, such as, e.g., C. elegans, fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio rerio), and others small metazoe organisms that are placed in the rooms. The changes in the entire animal or the development of the embryos / larvae over a period of days can be monitored, for example with or without exposure to drugs or other compounds. For example, the transparent or partially transparent organisms such as Danio rerio can be used to take pictures of cell activity or internal processes with or without exposure to drugs or other compounds. In other embodiments, experiments can be performed on a monolayer of cells, on a membrane, matrix, or other material within a chamber.

The micro-flow device can contain a substrate. The substrate can be rectangular, circular, oval or any other shape. The substrate can be made of a suitable material selected for its properties, such as good thermal conductivity, surface properties that allow uniform coating and stable reaction, and neutrality to the liquid medium to prevent interference with the test. For this purpose, suitable material for a solid substrate is a flexible polymer such as polydimethylsiloxane, hard polymers, glass, metal, hydrogel, silicone, PETG, polyester, polycarbonate, PVC, polystyrene, SAN, acrylonitrile butadiene styrene (ABS) and combinations and hybrids of these, and include beads, membranes, microtitre tubs, strings, plastic, strips, or any other surface on which entire organisms can be deposited or immobilized. Alternatively and equivalent, a commercially available molded solid substrate can be used in practicing the invention. Each micro-flow module can include one or more ports under negative pressure (vacuum) or positive pressure that provides movement power to liquids, or other ways of moving the liquids, as well as pressure-transmitting ports for controlling on-chip valves.

Large animals including the zebrafish embryos and larvae can have dimensions in the order of a few millimeters. To make chambers with these dimensions, channels in a solid substrate can be milled out with a milling machine or a laser cutter. For areas requiring round channels, including sections that contain micro-flow valves, a ball end mill with a round top can be used.

It will be appreciated that in practice a micro-flow device module may contain 32 rooms, 96 rooms, 869 rooms, or any other number of rooms that is required. In another aspect of the invention, the micro-flow device consists of a set of micro-flow device modules, which usually consist of a structure of single or multi-layer polymer chips, with a common interface of physical interconnections, with which any two modules can be connected to each other. Multiple chips can be connected within a larger frame to create a universal micro-flow environment. The frame can be flat so that devices with a square or rectangular shape can have a place or it can be three-dimensional so that rectangular, prism or cube shapes are possible. The physical interface between the modules can simply consist of adjacent faces or it can consist of male / female plug connections analogous to a chip socket on an electronic circuit board, tongue and groove connections and or other coupling configurations or mounting methods.

By coordinated switching of on-chip valves, animals can be moved to other parts of a device and also between connected devices. In addition, by coordinated switching of on-chip or off-chip valves, liquids can be moved to or away from the animals for the purpose of supplying test compounds or reagents, as well as for collecting liquids, tissue and metabolites for analysis.

In one aspect of the invention, specified micro-flow device modules can be designed to allow geometric alignment or physical connection to third-party devices, such as microscope object carriers or lenses to enable image recording.

Micro-flow modules can be designed to interface with other third-party devices such as complex object sorters such as COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers such as FACS (Fluorescence Activated Cell Sorter), lasers, irradiators and other detection systems can similar micro-flow modules to have an interface with the system.

An example of an automated detection system for use with the present invention and associated methods consists of an excitation source, a monochromator (or any other device that can spectrally decompose light components, or a set of narrow-band filters) and a detector package. The excitation source can consist of infrared, blue or UV wavelengths and the excitation wavelength can be shorter than the emission wavelength (s) to be detected. The detection system can be: a broadband UV light source, such as a deuterium lamp with a filter in front; the light from a white light source such as a xenon lamp or a deuterium lamp after it has passed through a monochromator to extract the desired wavelengths; or any other of a number of 'continue wave' (cw) gas lasers, including but not limited to all Argon ion laser lines (457, 488, 514, etc. nm) or a HeCd laser; solid state diode lasers such as GaN and GaAs (doubled) based lasers or the doubled or tripled output of YAG or YLF based lasers; or any pulse laser that emits blue light.

The light emitted by the organism, sample or reagents into the chamber can be detected with an apparatus that provides spectral data on the substrate, e.g. a grating spectrometer, prism spectrometer, image recording spectrometer, or the like, or uses interference band filters. By using a two-dimensional area recording such as a CCD camera, many objects can be displayed simultaneously. Spectral data can be generated by collecting more than one image capture through different band filters, or filters that transmit long or short waves (interference filter or electronically adjustable filters are suitable). More than one image recording device can be used to collect data simultaneously by means of special filters, or the filter arranged for a single recording device can be exchanged. Image-based systems, such as the Biometrics Imaging system, scan a surface to find fluorescence signals.

The micro-flow system described here can be used to perform experiments on whole cells as described above and below, and / or on organisms such as, for example, Caenorhabditis elegans (C. elegans), fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos (Danio) rerio), and other small metazoa organisms or single-cell organisms such as, for example, Saccharomyces cerevisiae (yeast), and other fungi or protozoa organisms placed in the chambers. The current disclosure will focus on Danio rerio and / or Drosophila melanogaster, but it should be noted that where Danio rerio or Drosophila melanogaster is mentioned other small animals can be used.

For example, genes important for metabolism in mammals such as genes for an insulin signaling pathway, the EGFR pathway, the cholesterol pathway, the LXR pathway, the LRP pathway and / or the bile acid pathway are present in Danio rerio. For example, the plurality of Danio rerio can include a large number of wild-type or genetically modified or transgenic Danio rerio. In another example, the plurality of zebrafish may include a large number of genetically modified or transgenic zebrafish with a transgene that is a promoter-reporter composition wherein the reporter encodes a fluorescent or luminescent protein and wherein the Promoter is a promoter of a zebrafish induced in response to exposure to a toxin or stress.

The present invention can focus on methods for mutating a single gene or multiple genes (e.g., two or more) in zebrafish to obtain mutant strains that exhibit increased permeability or bioavailability for compounds. The present invention contemplates various methods for creating mutations in zebrafish. In one embodiment, the mutation is an insertion or insertion mutation. In another embodiment, the mutation is a deletion or deletion mutation. In another embodiment, the method of mutation is to introduce a cassette or gene trap by recombination. In another embodiment, a small nucleic acid sequence modification is created by mutagenesis, such as by creating frame shifts, stop mutations, substitution mutations, small insertion mutations, small deletion mutations, and the like.

Mutant strains that exhibit increased permeability to compounds can be identified by performing in parallel pure forward EMS mutagenesis screening and candidate-based screening for mutants in genes that can confer permeability, including but not limited to, multiple drug resistance proteins, P-glycoproteins, ABC transport proteins, glycosyl transferases, nuclear hormone receptors, organic anion transporters and fatty acid transporters. The mutant strains can be screened for permeability mutants using a combination of fluorescence / luminescence tests and accessibility tests for fluorescence / luminescence tests and accessibility tests for compounds known to be excluded by wild-type zebrafish (including but not limited to chloroquine, colchicine, nicotine , verapamil and other calcium channel antagonists, heavy metals, ivermectin). Single mutations can be combined combinatorically and the resulting strains re-screened in an iterative manner for health and uptake of compounds until the desired set of mutations is revealed. Heat determinations include but are not limited to motility, reproduction, propidium iodide uptake, lifespan, and behavioral analyzes. The accessibility of small molecules to cells and tissue in the mutant strains can be determined by expressing luciferases in a tissue-specific manner, then feeding zebrafish with luciferin co-factor and screening for luminescence. The invention thus provides a panel of mutant strains that are more or less susceptible to drugs with regard to the levels of cell and tissue accessibility. These strains may permit exogenous compounds that would normally be excluded from entry into the body due to increased intestinal or cuticular permeability, increased intestinal transport of incorporated molecules, increased pharyngeal pumping action, decreased function of detoxification enzymes or pumps or a combination of these mechanisms or by an unknown mechanism. This library can contain strains with a permeability that varies per tissue or that varies depending on the chemotype of the exogenous compound. These strains exhibit increased permeability for compounds without an increased background phenotype. Increased permeability is determined in various tissues and cell types by fluorescence and luminescence studies and by phenotype screening for accessibility for compounds known to be excluded by wild-type strains. Strains in this library can also be modified to contain compositions for tissue-specific, location-specific and / or developmental-stage-specific expression of endogenous or exogenous human proteins that can be included in plasmids or introduced directly by genome processing. These transgenic strains may contain single or multiple copies of transgenes expressing human proteins from extrachromasomal ranges or integrated into the genome.

The selected animals can be sorted and supplied using one of the known methods or the micro-flow system can be used to sort the animals and move them to the correct room. Preferably, with the selected sorting / administration method, efficient distribution can take place in the chambers of C. elegans, Danio rerio embryos or Drosophila melanogaster and individual organisms can be quickly deposited. Furthermore, each organism can be optically analyzed so that only desired organisms with certain predetermined biological characteristics are deposited. This makes it possible to select identically phased organisms, which considerably increases the uniformity of the test procedure. Any of the known sorting processing methods and commercially available equipment can be used.

The transgenic animals can carry a label to facilitate detection thereof. In some embodiments, this can be a fluorescent label. Every animal can bear a different fluorescent label. However, the detectable label does not have to be fluorescent but can be any label. A method for detecting the fluorescent label consists of the use of radiation with a wavelength specific to the label or the use of other suitable lighting sources. The fluorescence of the label can be detected by a CCD camera or other suitable detection method.

The micro-flow systems and methods provided here can be advantageous with robotic systems and equipment for storing and moving these micro-flow modules as chambers for robotic systems for rapidly delivering liquids into and out of the plates. By combining an automated micro-flow platform for maintaining, handling and testing organisms with a library of synthetic mutants with a diversity of permeability properties and selectivity, this system can make it possible to screen compounds with high throughput for intact organisms.

The robotic system includes programmable robotic arm manipulators for installing, removing, and configuring modules of the micro-flow module arrangement. When they are clicked into place, the modules connect closely to other modules to form sealed micro-flow interfaces. These interfaces can be fixed or attached with mechanical lips or pins. Modules can also be controlled and triggered by fluid, electrical, magnetic, thermal and mechanical interaction with an active control matrix below the plane of the module arrangement. This control matrix can contain electrical connections, analog-digital interfaces and magnetic and mechanical actuators, as well as thermocouples and fluid couplings, as well as outlet ports for removing liquid and particulate waste from the micro-flow arrangement. The control matrix and robotics can be connected to computers for software-programmable real-time operation. In addition, the manipulators can mechanically manipulate and operate external equipment such as video cameras and external devices from third parties without human intervention. The robotic system can be controlled with a programmable software package with an application programming interface allowing it to be used in combination with existing software programming languages such as C, C ++, Visual Basic, Python, and MATLAB, as well as proprietary and open source robotic control software.

The robot system can be monitored by means of video monitoring, laser / optical sensors, as well as mechanical, temperature and chemical sensors.

With multi-colored fluorescence, multiple targets and cell processes can be tested on a single screen. Cross-correlation of cellular responses will provide a wealth of information needed to validate goals and optimize a lead.

The present invention provides a method for analyzing whole animals comprising a range of locations containing multiple animals in which the animals contain one or more fluorescent reporter molecules; scanning multiple animals at each location to obtain fluorescence signals from the fluorescent reporter molecules in the animals; converting the fluorescent signals into digital data; and utilizing the digital data to determine the distribution, environment, or activity of the fluorescent reporter molecules within the animals. In another aspect, the present invention provides a method for analyzing whole animals comprising providing a location in which there is an animal in which the animal may optionally contain one or more reporter molecules; bringing the animal into contact with a library of compounds; scanning the animal at multiple locations in which each location contains a different detection system; obtaining detection signals and converting the signals to digital data; and utilizing the digital data to determine the distribution, environment, or activity of the reporter molecules within the animals.

As an example, the Drosophila melanogaster or a zebrafish embryo can be placed in the room by a robotizer. The animal may lie freely in the fluid in the chamber, may be embedded in low melting point agarose, or any other substance that can immobilize the animal but does not damage it or prevent gas / nutrient exchange. Each chamber will have a constant supply of a certain buffer that flows through its micro-flow inlet channels. In addition, medications can be administered to the animals in the room by either using the micro-flow channels or by using robot pipet handlers through a sliding lid, which can be plastic or glass and can be withdrawn to make the opening in the room accessible for injection .

In some aspects of the invention, the micro-flow system described herein may have a lid having a shape that covers the openings of the chambers in the upper surface of the substrate. The lid can be a sliding lid such that when the sliding lid is in the open position, it provides an opening to the chambers through which animals can be placed prior to the start of the experiment and / or medication can be brought in during the experiment. The lid can then be pushed back to a closed position during the experiment. In another aspect of the invention, the cover can seal the chamber and allow efficient micro-flow in the chamber. The flow of micro-flow can be controlled by a robot and can be used to maintain the animal by supplying the correct nutrients, removing waste and supplying the test compound or library of compounds to the animals in the rooms.

In preferred embodiments, the test provides a method for quantifying an interaction between specific biomolecules in a biological sample, for example, an entire animal or a cell. Even better are the mentioned interactions between a KH domain binding microRNA and a KH-containing protein. In one aspect, the invention provides a method for screening candidate compounds for the treatment or prevention of a brain tumor or neurodegeneration by bringing an entire animal or cell into contact with a candidate therapeutic agent and measuring the effects that the compound on the animal or cell. The compound can then be further studied for possible therapeutic effects. In certain preferred embodiments, the screening is performed by means of high throughput screening with which simultaneous diagnoses can be made at the same time.

The tests provide a method for diagnosing a disease or disorder that consists of screening a biological sample from a patient to identify and / or quantify a marker or molecule characteristic of the specific disease or disorder. For example, a KH domain binding microRNA, a KH-containing protein, and the like. In another aspect, the invention provides a method for identifying subjects at risk of developing a disease or disorder, consisting of screening a patient's biological sample and identifying and / or quantifying a marker or molecule , characteristic of the specific disease or disorder.

The method can also evaluate the effect of a compound on animal behavior. The method consists in administering a test compound to a mutant as described above which is placed inside a chamber of a micro-flow apparatus of the invention, observing and mutating the behavior exhibited by the mutant with that of a wild-type animal in which the observed differences differ be in behavior related to the test compound. As one skilled in the art will recognize, quantitative analyzes can be performed on the measured behavioral parameters to detect behavioral changes induced by the compound. Breeding the animals, administering the test compounds, observing the behavior of the animals and comparing the differences in behavior can be performed with the robot systems described above.

The invention also provides a method for evaluating the effect of a compound on the neural activity of animals. The method provides administering a test compound to a mutant as described above, observing the neural activity that the mutant exhibits and comparing the observed neural activity with that of a wild-type animal, in which the differences in neural activity are associated with the test compound. Neural activity can be measured by a genetically coded indicator in one or more neurons to see how the entire neural activity is affected by the connections. In another aspect, neural activity can be measured in response to a behavioral stimulus, such as, for example, starvation, hunger or presentation of food and the like. Neural development can be measured in another aspect.

In another aspect, the invention provides a method for evaluating the degenerative effect of a compound. The method consists of administering a test compound to a mutant as described above, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal, in which the observed differences in behavior are associated with the test compound. The behavior to be observed includes but is not limited to changes in the movements of the wild type and the mutant, changes in the rate of breathing, changes in the lifespan of the wild type and the mutant, changes in the movement development of the wild type and the mutant, changes in the senescence of the wild type and the mutant.

In some aspects of the invention, the micro-flow system described herein may have a lid having a shape that covers the openings of the chambers in the upper surface of the substrate. The lid can be a sliding lid such that when the sliding lid is in the open position, it provides an opening to the chambers through which animals and / or drugs can be introduced during the experiment prior to the start of the experiment. The lid can then be pushed back to a closed position during the experiment. In another aspect of the invention, the cover can seal the chamber and allow efficient micro-flow in the chamber. The micro-flow can be controlled by a robot and used to keep the animals alive by supplying the right nutrients, removing waste, and delivering the test compound or library of compounds to animals in the chambers.

In preferred embodiments, the test provides a method for quantifying an interaction between specific biomolecules in a biological sample, for example, an entire animal or a cell.

Even better are the aforementioned interactions between a KH domain binding microRNA and a KH domain containing protein. In one aspect, the invention provides a method for screening candidate compounds for the treatment or prevention of a brain tumor or neurodegeneration by bringing an entire animal or cell into contact with a candidate therapeutic agent and measuring the effects that the compound has on the animal or cell. The compound can then be further studied for possible therapeutic effects. In certain preferred embodiments, the screening is performed by means of high throughput screening whereby simultaneous diagnoses can be made at the same time.

The test provides a method for diagnosing a disease or disorder that consists of screening a biological sample from a patient to identify and / or quantify a marker and / or characteristic molecule of the particular disease or disorder. For example, a KH domain binding microRNA, a KH-containing protein, and the like. In another aspect, the invention provides a method for identifying subjects at risk of developing a disease or disorder consisting of screening a patient's biological sample and identifying and / or quantifying a marker or molecule, characteristic of the specific disease or disorder.

The method can also evaluate the effect of a compound on animal behavior. The method provides administering a test compound to a mutant, as described above, that is placed inside a chamber of the micro-flow apparatus of the invention, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal in which the observed differences in behavior are associated with the test compound. As one skilled in the art will recognize, quantitative analyzes can be performed on the measured behavioral parameters to detect behavioral changes induced by the compound. Breeding the animals, administering the test compounds, observing the behavior of animals and comparing the differences in behavior can be performed with the robot systems described above.

The invention also provides a method for evaluating the effect of a compound on the neural activity of the animals. The method provides administering a test compound to a mutant as described above, observing the neural activity that the mutant shows and comparing the observed neural activity with that of a wild-type animal, in which the observed differences in neural activity are associated with the test compound. Neural activity can be measured by using a genetically coded indicator in one or more neurons to see how the entire neural activity is affected by connections. In another aspect, neural activity can be measured in response to a behavioral stimulus, such as, for example, starvation, hunger, or presenting food and the like. Neural development can be measured in another aspect.

In another aspect, the invention provides a method for evaluating the degenerative effect of a compound. The method provides administering a test compound to a mutant as described above, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal in which the observed differences in behavior are associated with the mutant test compound. The behavior to be observed includes but is not limited to changes in the movements of the wild type and the mutant, changes in the rate of breathing, changes in the lifespan of the wild type and the mutant, changes in the movement development of the wild type and the mutant, changes in the senescence of the wild type and the mutant.

The micro-flow device can contain a substrate. The substrate can be rectangular, circular, oval or any other shape. The substrate can be made of a suitable material selected for its properties, such as good thermal conductivity, surface properties that allow uniform coating and stability of the reagent, and neutrality to the liquid medium to prevent interference with the test. Suitable materials for a solid substrate for this purpose include flexible polymer such as polydimethylsiloxane, harder polymers, glass, metal, hydrogel, silicone, PETG, polyester, polycarbonate, PVC, polystyrene, SAN, acrylonitrile butadiene styrene (ABS), and combinations and hybrids thereof and includes beads, membranes, microtitre tubs, strings, plastic, strips, or any surface on which entire organisms can be placed or immobilized. Alternatively and equivalent, a commercially available molded solid substrate can be used in practicing the invention.

Each micro-flow module can contain one or more ports under negative pressure (vacuum) or positive pressure to provide the movement force to liquids, or other ways of moving the liquids, as well as pressure-transmitting ports for controlling the on-chip valves.

Large animals including the zebrafish embryos and larvae can have dimensions in the order of a few millimeters. To create chambers with these dimensions, channels in a rigid substrate can be milled out with a milling machine or a laser cutter. For areas that require circular ducts, including sections that contain micro-flow valves, a ball end mill with a round tip can be used.

It will be appreciated that in practice a micro-flow device module may contain 32 chambers, 96 chambers, 869 chambers, or any other number of chambers required. In another aspect of the invention, the micro-flow device consists of a set of micro-flow device modules, which usually consist of a structure of single or multi-layer polymer chips, with a common interface of physical interconnections, with which any two modules can be connected to each other. Multiple chips can be connected within a larger frame to create a universal micro-flow environment. The frame can be flat so that devices with a square or rectangular shape can have a place or it can be three-dimensional so that rectangular, prism or cube shapes are possible. The physical interface between the modules can simply consist of adjacent faces or it can consist of male / female plug connections analogous to a chip socket on an electronic printed circuit board, tongue and groove connections and or other coupling configurations or mounting methods.

By coordinated switching of on-chip valves, animals can be moved to other parts of a device as well as between connected devices. By coordinated switching of on-chip or off-chip valves, liquids or animals can be moved to provide test compounds or reagents, as well as to collect liquids, tissue, and metabolites for analysis.

In one aspect of the invention, specified micro-flow modules can be designed to allow for geometric alignment or physical coupling with third-party devices, such as microscope object carriers or lenses to enable image recording.

Micro flow modules can be designed to interface with other third party devices such as complex object sorters such as COPASTM (Complex Object Parametric Analyzer and Sorter, Union Biometrica), cytometers such as FACS (Fluorescence Activated Cell Sorter), lasers, irradiators and other detection systems can be similar have micro-flow modules to interface with the system.

An example of an automated detection system for use with the present invention and associated methods consists of an excitation source, a monochromator (or any other device that can spectrally decompose light components, or a set of narrow-band filters) and a detector package. The excitation source can consist of infrared, blue or UV wavelengths and the excitation wavelength can be shorter than the emission wavelength (s) to be detected. The detection system can be: a broadband UV light source, such as a deuterium lamp with a filter in front; the light from a white light source such as a xenon lamp or a deuterium lamp after it has passed through a monochromator to extract the desired wavelengths; or any other of a number of 'continuous wave' (cw) gas lasers, including but not limited to all Argon ion laser lines (457, 488, 514, etc. nm) or a HeCd laser; solid state diode lasers such as GaN and GaAs (doubled) based lasers or the doubled or tripled output of YAG or YLF based lasers; or any pulse laser that emits blue light.

The light emitted by the organism, sample, or reagents into the chamber can be detected with an apparatus that provides spectral data on the substrate, e.g., a grating spectrometer, prism spectrometer, image pickup spectrometer, or the like, or uses interference band filters. By using two-dimensional area recording such as a CCD camera, many objects can be displayed simultaneously. Spectral data can be generated by collecting more than one image via different band filters, filters that transmit long or short waves (interference filter or electronically adjustable filters are suitable). More than one image recording device can be used to collect data simultaneously by means of special filters, or the filter arranged for a single recording device can be exchanged. Image-based systems, such as the Biometrics Imaging system, scan a surface to find fluorescence signals.

The micro-flow system described here can be used to perform experiments on whole cells as described above and below, and / or on organisms such as, for example, Caenorhabditis elegans (C. elegans), fruit fly larvae or embryos (Drosophila melanogaster), zebrafish larvae or embryos ( Danio rerio), and other small metazoa organisms or single-cell organisms such as, for example, Saccharomyces cerevisiae (yeast), and other fungi or protozoa organisms placed in the chambers. The current disclosure focuses on Danio rerio and / or Drosophila melanogaster, but it should be noted that where Danio rerio or Drosophila melanogaster is mentioned other small animals can be used.

For example, genes important for metabolism in mammals such as genes for an insulin signaling pathway, the EGFR pathway, the cholesterol pathway, the LXR pathway, the LRP pathway and / or the bile acid pathway are present in Danio rerio. For example, the plurality of Danio rerio can include a large number of wild-type or genetically modified or transgenic Danio rerio. In another example, the large number of zebrafish may include a large number of genetically modified or transgenic zebrafish with a transgene that is a promoter-reporter composition wherein the reporter encodes a fluorescent or luminescent protein and wherein the Promoter is a Promoter of a zebrafish induced in response for exposure to a toxin or stress.

The present invention can be applied to methods for mutating a single gene or multiple genes (e.g., two or more) in zebrafish to obtain mutant strains that exhibit increased permeability or bioavailability for compounds. The present invention contemplates various methods for creating mutations in zebrafish. In one embodiment, the mutation is an insertion or insertion mutation. In another embodiment, the mutation is a deletion or deletion mutation. In another embodiment, the method of mutation is to introduce a cassette or gene trap by recombination. In another embodiment, a small nucleic acid sequence modification is created by mutagenesis, such as by creating frame shifts, stop mutations, substitution mutations, small insertion mutations, small deletion mutations, and the like.

Mutant strains that exhibit increased permeability to compounds can be identified by performing in parallel pure forward EMS mutagenesis screening and candidate-based screening with mutants in genes that can confer permeability, including but not limited to, multiple drug resistance proteins, P-glycoproteins , ABC transport proteins, glycosyl transferases, nuclear hormone receptors, organic anion transporters and fatty acid transporters. The mutant strains can be screened for permeability mutants using a combination of fluorescence / liiminescence tests and accessibility tests for compounds known to be excluded by wild-type zebrafish (including but not limited to chloroquine, colchicine, nicotine, verapamil and other calcium channel antagonists, heavy metals, ivermectin). Single mutations can be combined combinatorically and the resulting strains re-screened in an iterative manner for health and uptake of compounds until the desired set of mutations is revealed. Heat determinations include but are not limited to motility, reproduction, propidium iodide uptake, lifespan, and behavioral analyzes. The accessibility of small molecules to cells and tissue in the mutant strains can be determined by expressing luciferases in a tissue-specific manner, then feeding zebrafish with luciferin co-factor and screening for luminescence. The invention thus provides a panel of mutant strains that are more or less susceptible to drugs with regard to the levels of cell and tissue accessibility. These strains may permit exogenous compounds that would normally be excluded from entering the body through increased intestinal or cuticular permeability, increased intestinal transport of incorporated molecules, increased pharyngeal pumping action, decreased function of detoxification enzymes or pumps or a combination of these mechanisms, or by an unknown mechanism. This library can contain strains with a permeability that varies per tissue or that varies depending on the chemotype of the exogenous compounds. These strains exhibit increased permeability for compounds without an increased background phenotype. Increased permeability is determined in various tissues and cell types by fluorescence and luminescence studies and by the accessibility of compounds known to be excluded by wild-type strains as determined by phenotype screening. Strains in this library can also be modified to contain compositions for tissue-specific, location-specific and / or development-stage-specific expression of endogenous or exogenous human proteins that may be included in plasmids or introduced directly by genome processing. These transgenic strains may contain single or multiple copies of transgenes expressing human proteins or extrachoromasomal elements integrated into the genome.

The selected animals can be sorted and supplied using one of the known methods or the micro-flow system can be used to sort the animals and move them to the correct room. Preferably, with the selected sorting / distribution method, efficient distribution can take place in the chambers of C. elegans, Danio rerio embryos or Drosophila melanogaster embryos and individual organisms can be placed quickly. Furthermore, each organism can be optically analyzed so that only desired organisms with certain predetermined biological characteristics are placed. This makes it possible to select identically phased organisms, which considerably increases the uniformity of the test procedure. Any of the known sorting procedures and commercially available equipment can be used.

The transgenic animals can carry a label to facilitate detection thereof. In some embodiments, this can be a fluorescent label. Every animal can bear a different fluorescent label. However, the detectable label does not have to be fluorescent, but can be any label. A method of detecting the fluorescent label consists of using radiation with a wavelength specific to the label or using other suitable lighting sources. The fluorescence of the label can be detected by a CCD camera or other suitable detection method.

The micro-flow systems and methods provided here can take advantage of robotic systems and equipment for storing and moving these micro-flow modules as chambers for robotic systems for quickly delivering liquids into and from the plates. By combining an automated micro-flow platform for the maintenance, handling and testing of organisms with a library of synthetic mutants with a diversity of permeability properties and selectivity, this system can make it possible to screen compounds with high throughput for intact organisms.

The robotic system includes programmable robotic arm manipulators for installing, removing, and configuring modules of the micro-flow module. When they are clicked into place, the modules connect closely to other modules to form sealed micro-flow interfaces. These interfaces can be fixed or attached with mechanical lips or pins. Modules can also be controlled and triggered by fluid, electrical, magnetic, thermal, and mechanical interaction with an active operating matrix that is below the plane of the module arrangement. This control matrix can contain electrical connections, analog-digital interfaces and magnetic and mechanical actuators, as well as thermocouples and liquid-i couplings, as well as outlet ports for removing liquid and particulate waste from the micro-flow arrangement. The control matrix and robotics can be connected to computers for software-programmable real-time operation. In addition, the manipulators can mechanically manipulate external equipment such as video cameras and external devices from third parties and operate them without human intervention. The robotic system can be controlled with a programmable software package with an application programming interface (api) that allows it to be used in combination with existing software programming languages such as C, C ++, Visual Basic, Python, and MATLAB, as well as proprietary and open source robotic control software. The robot system can be monitored by means of video monitoring, laser / optical sensors, as well as mechanical, temperature and chemical sensors.

With multi-colored fluorescence, multiple targets and cell processes can be tested on a single screen. Cross-correlation of cellular responses will provide a wealth of information that is needed to validate goals and optimize a lead.

The present invention provides a method for analyzing whole animals comprising providing a set of locations containing multiple animals in which the animals contain one or more fluorescent reporter molecules, scanning multiple animals in each of the locations to obtain fluorescent signals from the fluorescent reporter molecules in the animals; converting the fluorescent signals to data; and utilizing the digital data to determine the distribution, environment, or activity of the fluorescent reporter molecules within the animals. In another aspect, the present invention provides a method for analyzing whole animals comprising providing a location that includes an animal in which the animal may optionally contain one or more reporter molecules; bringing the animal into contact with a library of compounds; scanning the animal at multiple locations in which each location contains a different detection system; collecting digital data to determine the distribution, environment or activity of the reporter molecules within the animals.

The Drosophila melanogaster or a zebrafish embryo can, for example, be placed in the room by a robot manipulator. The animal may lie freely in the fluid in the chamber, may be embedded in low melting point agarose, or any other substance that can immobilize the animal but does not damage it or prevent gas / nutrient exchange. Each chamber will have a constant supply of a certain buffer that flows through its micro-flow inlet channels. In addition, medications can be administered to the animals in the room by either using the micro-flow channels or by using robot pipet handlers through a sliding lid, which can be plastic or glass and can be withdrawn to clear the opening in the room for injection. .

In some aspects of the invention, the micro-flow system described herein may have a lid having a shape that covers the openings of the chambers in the upper surface of the substrate. The lid can be a sliding lid such that when the sliding lid is in the open position, it provides an opening to the chambers through which animals can be placed and / or medication can be brought in during the experiment prior to the start of the experiment. The lid can then be pushed back to a closed position during the experiment. In another aspect of the invention, the cover can seal the chamber and allow efficient micro-flow in the chamber. The micro-flow can be controlled by a robot and used to keep the animals alive by supplying the right nutrients, removing waste and delivering test compound or library of compounds to animals in the rooms.

In a preferred embodiment, the test provides a method for quantifying an interaction between specific biomolecules in a biological sample, for example, an entire animal or a cell. Even better are the aforementioned interactions between a KH domain binding microRNA and a KH domain containing protein. In one aspect, the invention provides a method for screening candidate compounds for the treatment or prevention of a brain tumor or neurodegeneration by bringing an entire animal or cell into contact with a candidate therapeutic agent and measuring the effects that the compound has on the animal or cell. The compound can then be further studied for possible therapeutic effects. In certain preferred embodiments, the screening is performed by means of high throughput screening with which simultaneous diagnoses can be made at the same time.

The test provides a method for diagnosing a disease or disorder that consists of screening a biological sample from a patient to identify and / or quantify a marker or molecule characteristic of the disease or disorder. For example, a KH domain binding microRNA, a KH-containing protein, and the like. In another aspect, the invention provides a method for identifying subjects at risk of developing a disease or disorder consisting of screening a patient's biological sample and identifying and / or quantifying a marker or molecule that characteristic of the disease or disorder.

The method can also evaluate the effect of a compound on animal behavior. The method provides administering a test compound to a mutant as described above, which is placed within a chamber of the micro-flow apparatus of the invention, observing the behavior exhibited by the mutant and comparing the observed behavior with that of a wild-type animal wherein the observed differences in behavior are associated with the test compound. As one skilled in the art will recognize, quantitative analyzes can be performed on the measured behavioral parameters to detect behavioral changes induced by the compound. The growth of the animals, the administration of the test compounds, the observation of the behavior of the animals and the comparison of the differences in behavior can be performed with the robot systems described above.

The invention also provides a method for evaluating the effect of a compound on the neural activity of the animals. The method consists of administering a test compound to a mutant as described above, observing the neural activity that the mutant exhibits and comparing the observed neural activity with that of a wild-type animal, in which the differences in neural activity are related brought to the test compound. The neural activity can be measured by a genetically coded indicator in one or more neurons to see how the entire neural activity is affected by the connections. In another aspect, neural activity can be measured in response to a behavioral stimulus, such as, for example, starvation, hunger or the presentation of food and the like. Neural development can be measured in another aspect.

In another aspect, the invention provides a method for evaluating the degenerative effect of a compound. The method offers administering a test compound to a mutant as described above, observing the neural activity that the mutant exhibits and comparing the observed neural activity with that of a wild-type animal, in which the observed differences in behavior are associated with the test compound. The behavior to be observed includes but is not limited to changes in the movements of the wild type and the mutant, changes in the rate of breathing, changes in the lifespan of the wild type and the mutant, changes in the movement development of the wild type and the mutant, changes in the senescence of the wild type and the mutant.

The invention relates to a method described herein which consists of placing the animal in one or more chambers in a micro-flow device module and making image recordings of one or more chambers to obtain results in one or more chambers.

The animal can be a complete animal, an embryo or a larva. The animal may include tissue-specific, location-specific and / or development-phase-specific expression of the KH domain binding miRNA and / or the KH domain-containing protein.

The present invention in one form relates to a method for diagnosing a brain tumor and / or a neurodegenerative disease in a subject. The method consists of (a) determining an amount in the sample of a KH domain containing microRNA; and (b) comparing the amount of said microRNA in the sample with a control level of said microRNA.

In a further specific form of the present method, a subject is diagnosed with a brain tumor and / or a neurodegenerative disease or at risk of developing a brain tumor and / or neurodegenerative disease if there is a measurable difference in the amount of KH domain binding microRNA in the sample compared to the control level. In an alternative, more specific form, the method consists of selecting a treatment or changing a treatment for the brain tumor and / or the neurodegenerative disease based on the determined amount of said KH domain binding microRNA.

In addition, it is important to note that EVs are secreted by many cells and that they play a role in modulating immune responses. Packaging miRNAs and therefore KH-binding miRNAs in these vesicles can be useful for controlling and modulating the immune response.

Another aspect of the present invention relates to a formulation comprising at least one KH domain binding miRNA or a functional derivative thereof and / or EV as previously defined, and further at least one pharmaceutically acceptable carrier or excipient. Said composition is preferably a pharmaceutical formulation.

The pharmaceutical formulation of the invention may, if desired, also contain additives to enhance, control, or otherwise direct the desired therapeutic effect of KH domain binding miRNA or functional derivatives thereof and / or EVs. Such additives and / or auxiliaries or pharmaceutically acceptable substances, either as a type of binder or carrier, can be selected from one of the following buffering agents, surfactants, cosolvents, preservatives, disintegrants, diluents, etc. The aforementioned pharmaceutically acceptable substances that can be used in the pharmaceutical formulation of the invention are well known to those skilled in the art.

Another part of the present invention consists of the use of the isolated KH domain binding miRNA or functional derivatives thereof and / or EVs or the use of the compositions described herein in producing a drug, vaccine or a biomarker.

Another part of the present invention relates to isolated KH domain binding miRNA or functional derivatives thereof and / or EVs themselves or the compositions described herein, for use as medicines, preferably for gene therapy, as vaccines or as biomarkers.

Another part of the present invention relates to a method for treating diseases by administering to a subject an effective dose of the isolated KH domain binding miRNA or functional derivatives thereof and / or EVs of the compositions described in this invention . Another part of the present invention relates to a vaccination method for administering to a subject at least one effective dose of a vaccine consisting of the isolated KH domain binding miRNA or functional derivatives thereof or EVs or compositions, as described herein.

Thus, the present subject matter provides methods and systems for diagnosis and prognosis of a disease or disorder, as well as methods for treating or limiting the occurrence of said disease or disorder.

In preferred embodiments, the disease or disorder is a brain tumor or a neurodegenerative disease.

In other preferred embodiments, the brain tumor is acoustic neuroma, astrocytoma, Chordoma, Pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, glioblastoma, craniopharyngioma, brainstem glioma, ependymoma, mixed glioma, optic nerve glioma, medulentum, subependoma stoma, subulendoma stoma, subependoma stoma tumors, primitive neuroectodermal tumors, schwannoma.

In other preferred embodiments, the brain tumor is acoustic neuroma, astrocytoma, Chordoma, Pilocytic astrocytoma, low-grade neuroma, astrocytoma, Chordoma, Pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, craniopharyngioma, stem tribe, glioma, optic glioma, gendoma, glioma, gendoma, glioma, gendoma, gendoma, glioma, gendoma, gendoma, gendoma, gendoma, gendoma, metastatic brain tumors, oligodendroglioma, pituitary tumors, primitive neuroectodermal tumors, schwannoma.

In other preferred embodiments, the brain tumor is acoustic neuroma, astrocytoma, chordoma, pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, craniopharyngioma, ependymoma, mixed glioma, optic nerve glioma, subependymoma, meningioma, metastatic primitive neuro tumor neuro tumourous tumor tumors, tumor nerve tumor tumors .

In other preferred embodiments, the neurodegenerative disease is Parkinson's, Multiple System Atrophy (MSA), multiple sclerosis, amyotrophic lateral sclerosis (ALS), Alzheimer's or Huntingtons.

In some embodiments, the brain tumor is a drug-resistant brain tumor.

In some embodiments of the subject matter disclosed, methods, systems, devices and sets are provided for diagnosing a cancer or a degenerative disease in a subject and for determining whether prophylaxis or treatment of cancer or neurodegenerative disease is to be initiated in a subject or and include identifying at least one biomarker in a biological sample from a subject.

In some embodiments of the subject matter disclosed herein, a method for diagnosing a disease or disorder in a subject is provided. The terms diagnosis and diagnosis as used herein refer to methods with which the skilled person can estimate and even determine whether or not a subject suffers from a given disease or condition. The skilled person often makes a diagnosis on the basis of one or more diagnostic indicators such as, for example, a marker, the amount (including presence or absence) of what is indicative of the presence, severity or absence of the disorder.

Along with the diagnosis, clinical disease prognosis is also an area of great concern and importance. It is important to know the phase and speed of progression of the disease or disorder to plan the most effective therapy. If a more accurate prognosis can be made, a more suitable therapy and in some cases less burdensome therapy can be chosen for the patient. Measurements of the KH domain binding miRNA biomarker levels disclosed herein may be useful for categorizing subjects in accordance with the progression of disease or disorder. Measurement of the KH domain binding miRNA biomarker levels disclosed herein may be useful for categorizing subjects who may benefit from certain therapies. Measurement of the KH domain binding miRNA biomarker levels disclosed herein may be useful for distinguishing subjects where alternative or additional therapies may be better suited to other subjects.

As such, the phrase "make a diagnosis" or "diagnose" as used herein includes making a prognosis that can serve to predict a clinical outcome (with or without medical treatment), selecting an appropriate treatment (then whether treatment will be effective), or monitoring current treatment and potential treatment change, based on the level of diagnostic biomarker levels disclosed herein.

The phrase "making a prognosis" as used herein refers to methods with which the skilled person can predict the course or outcome of a disorder in a subject. The term "prognosis" does not refer to being able to predict the course or outcome of a condition with 100% accuracy, or even to predict that a certain course or outcome will be more or less likely to occur based on the presence , absence or levels of test biomarkers. Instead, those skilled in the art will understand that the term "prognosis" refers to an increased likelihood that a certain course or outcome will occur; that is, a course or outcome is more likely to occur in a subject who exhibits a given fact, when compared to individuals who do not show this fact. For example, in individuals who do not display the data (e.g., no expression of the biomarker or its expression at a low level), the probability of a given outcome may be about 3%. In certain embodiments, a prognosis is about 5% chance of a given outcome, about 7% chance, about 10% chance, about 12% chance, about 15% chance, about 20% chance, about 25% chance, about 30% chance , about 40% chance, about 50% chance, about 60% chance, about 75% chance, about 90% chance, or about 95% chance.

The person skilled in the art will understand that linking a forecast indicator with a predisposition to a certain bad outcome is a statistical analysis. For example, a biomarker level higher than a control level in some embodiments may signal that a subject with greater probability will suffer from a cancer than subjects with a level that is lower or equal to the control level, as determined by a level of statistical significance. In addition, a change in marker concentration from baseline levels may reflect the subject's prognosis, and the degree of change in marker level may be related to the severity of adverse events. Statistical significance is often determined by comparing two or more populations and determining a confidence interval and / or a p value. Preferred confidence intervals for this are 90%.

In other embodiments, a threshold value of change in the level of a prognostic or diagnostic biomarker can be determined and the degree of change in the level of the indicator in a biological sample can be easily compared with the threshold value of change in the level. A preferred threshold of change in the level for markers of the subject matter disclosed is approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 50%, approximately 75%, approximately 100 %) and about 150%. In yet another embodiment, a "nomogram" can be determined with which a level of a prognostic or diagnostic indicator can be directly associated with a related indication for a given outcome. The person skilled in the art is familiar with the use of such nomograms to relate two numerical values to each other, knowing that the uncertainty in this measurement is the same as the uncertainty in the marker concentration, because reference is made to individual measurement values in samples, not to a population of means.

In some embodiments of the presently disclosed matter, multiple determination of one or more diagnostic or prognostic biomarkers can take place and a temporary change in the KH domain binding miRNA level can be used to monitor the progression of cancer and / or effectiveness of appropriate therapies aimed at the disease. For example, in such embodiments, one might expect to see a decrease or increase in the biomarker (s) over time during the duration of an effective therapy. And so, in some embodiments, the subject matter disclosed herein provides a method for determining the effectiveness of treatment and / or progression of a brain tumor and / or neurodegenerative disease in a subject. In some embodiments, the method comprises determining an amount of KH domain binding miRNA in biological samples collected from the subject at many different time points and comparing these amounts of said miRNA in the samples collected at different time points. For example, a first time point can be selected prior to starting a treatment and a second time point can be selected at a time point after the start of treatment. One or more levels of KH domain binding miRNAs can be measured in any of the samples taken at various time points and noted qualitative and / or quantitative differences. A change in the amounts of miRNA levels of the first and second samples can be correlated with the effectiveness of treatment and / or progression of the cancer in the subject.

The terms "correlated" and "correlating" referring to the use of diagnostic and prognostic biomarkers refers to comparing the presence or amount of the biomarker in a subject, with its presence or amount in subjects known to suffer from , or is known to be at risk for, a particular condition, or in subjects who are known to be free from a specific condition, ie "normal individuals".

In certain embodiments, a diagnostic or prognostic biomarker is correlated to a condition or disease simply by being present or absent. In other embodiments, a threshold value of a diagnostic or prognostic biomarker can be determined and the level of the indicator in a subject sample can be easily compared to the threshold level.

As noted, in some embodiments, multiple determinations of one or more diagnostic or prognostic biomarkers can be made and a temporary change in marker can be used to make a diagnosis or prognosis. For example, a diagnostic marker can be determined at a starting time and then again at a second time. In such embodiments, an increase in the marker from the start time to the second time may be diagnostic for a particular type of disease or a given prognosis. Similarly, a decrease in the marker from the starting time to the second time may be indicative of a certain type of disease or a given prognosis. In addition, the rate of change of one or more markers may be related to the severity of the disease and future adverse events.

Those skilled in the art will appreciate that while in certain embodiments comparative measurements can be made of the same diagnostic marker at multiple times, one can also measure a given marker at one time and a second marker at a second time and a comparison of these markers can provide diagnostic information .

Regarding the step of delivering a biological sample from a subject, the term "biological sample" as used herein refers to body fluid or tissue that potentially contains a KH domain binding miRNA. For example, in some embodiments, the biological sample may be a blood sample, a serum sample, a plasma sample, or subfractions thereof.

Turning now to the step of identifying one or more markers in the biological sample, various methods known to those skilled in the art can be used to identify one or more markers in the supplied biological sample. In some embodiments, determining the amount of KH domain binding miRNA is performed by an explorator (e.g., a nucleic acid explorator) for selectively binding or hybridizing with the miRNA. In other words, in certain embodiments, known KH domain binding miRNA sequence data can be used to assemble explorators that find KH domain binding miRNA strands in a sample and thereby hybridize to thereby capture the miRNA strands by selective binding.

The term "selective binding" as used herein refers to the extent to which an explorator can specifically hybridize to a target polynucleotide. Thus, in the case of a miRNA, the explorator will consist of a polynucleotide sequence that is complementary, or essentially complementary, to at least a portion of the miRNA sequence. Nucleic acid sequences that are "complementary" are base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementarity sequences" means nucleic acid sequences that are substantially complementary, as can be investigated with the same nucleotide equation as set forth above or as defined as being capable of hybridizing the particular nucleic acid segment under relatively stringent conditions as described herein. A particular example of a contemplated complementary nucleic acid segment is an antsense oligonucleotide. With respect to explorators disclosed herein that have binding affinity with RNAs, the explorator can be 100% complementary to the target i polynucleotide sequence. However, the explorator need not be completely complementary over the entire length of the target polynucleotide as long as the explorator can specifically bind to the target polynucleotide and capture it from the sample.

Nucleic acid hybridization will be influenced by conditions such as salt concentration, temperature or organic solvents, in addition to the base composition, length of the complementary strands, and the number of mismatched nucleotide bases between the hybridizing nucleic acids, as will be immediately recognized by those skilled in the art. Stringent temperature conditions will generally be temperatures above 30 ° C, usually higher than 37 ° C, and preferably higher than 45 ° C. Stringent salt conditions will normally be less than 1000 mM, usually less than 500 mM, and preferably less than 200 mM. However, the combination of parameters is much more important than the size of a single parameter. Determining suitable hybridization conditions to identify and / or isolate sequences with high levels of homology is well known in the art. For the purpose of specifying very strict conditions, preferred conditions are a salt concentration of about 200 mM and a temperature factor of about 45 ° C. Biomarkers in samples include an RNA measuring arrangement for measuring RNA-encoding biomarker polypeptides in the sample and / or the use of a protein measuring arrangement for measuring biomarker polypeptides in the sample.

In certain embodiments of the methods, it may be desirable to include a control sample that is analyzed simultaneously with the biological sample or the test sample such that the results obtained from the sample can be compared to the results obtained from the control sample. In addition, standard graphs can be offered to compare analysis results for the biological sample. Such standard graphs show levels as a function of key units, i.e., fluorescent signal intensity, if a fluorescent signal is used.

The analysis of samples can be carried out separately or simultaneously. For example, multiple markers can be combined in one test. In addition, a skilled person will recognize the value of testing various markers in different cells. Such tests provide more information regarding the potential therapeutic agent.

Moreover, the analysis of markers can be performed with a variety of physical formats. For example, the use of microtiter plates or automation can be used to facilitate the processing of large numbers of test samples or potential therapeutic agents. Alternatively, individual sample formats can be developed to facilitate immediate treatment and timely diagnosis such as, for example, during transport by ambulance or in the emergency department.

In some embodiments of the subject matter disclosed, a system for diagnosing cancer in a subject is provided, or a system (e.g., a computer system) to determine whether prophylaxis or treatment should be started or continued or selection of a potential therapeutic agent are carried out. Such systems can be offered, such as, for example, commercial kits and devices that can be used to test a biological sample, or series of biological samples from a subject. In some embodiments, the system has explorators for selectively binding miRNA and means for detecting binding of said explorators to said miRNA. The system may also contain certain samples for use as controls. The system may further contain one or more standard graphs that offer marker levels as a function of test units.

As used herein, the term "treating" or "treatment" refers to any treatment of a disease or disorder including, but not limited to, therapeutic treatment and prophylactic treatment of a disease or disorder. As such, the terms "treat" or "treatment" include, but are not limited to, inhibiting the progression of a disease or disorder, stopping the development of a disease or disorder, reducing the severity of a disease or disorder , improving or alleviating one or more symptoms associated with a disease or disorder and causing a regression of a disease or disorder or one or more symptoms associated with a disease or disorder.

Suitable methods of administering a pharmaceutical agent in accordance with the methods of the subject matter disclosed include, but are not limited to, systemic administration, parenteral administration (including intravascular, intramuscular and / or intraarterial administration), oral administration, buccal administration, rectal administration, subcutaneous administration, intraperitoneal administration, inhalation, intratracheal installation, surgical implantation, transdermal release, local injection, intranasal administration, and hypervelocity injection / bombardment. Where applicable, continuous infusion may increase medication accumulation at the target site.

Apart from the route of administration, the pharmaceutical agents used in accordance with the subject matter disclosed are usually administered in amounts effective to achieve the desired response. As such, the term "effective amount" is used herein to refer to an amount of pharmaceutical agent sufficient to produce a measurable biological response.

Preferably a minimum dose is administered and the dose is increased to a minimum effective amount in the absence of a dose-limiting toxicity. Determining and adjusting a therapeutically effective dose as well as evaluating when and how to make adjustments are known to those skilled in the art.

With regard to the subject matter disclosed, a preferred subject is a vertebrate subject. A preferred vertebrate is warm-blooded; a preferred warm-blooded vertebrate is a mammal. A preferred mammal is preferably a human. As used herein, the term "subject" includes both human and animal subjects.

Unless otherwise stated, conventional cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology techniques that are used in the art can be used in the practice of this subject matter. Such methods are fully explained in the literature. KH domain binding miRNAs and / or KH domain containing protein can be involved in various functions, such as but not limited to cleavage, transcription, signal transfer, localization, translation, cholesterol metabolism, stress response, cell displacement, axogenesis, axonal regeneration, synaptic plasticity, stabilization or biosynthesis of finished piRNA. KH domain binding miRNAs and / or KH domain containing proteins may be involved in cleavage. They can regulate nuclear and mitochondrial cleavage and alternatively induce cleavage variants of important genes. They can induce fusion transcripts with downstream genes. They may influence the selection of the mRNA cleavage site and exon inclusion that may be phosphorylation dependent. They may mediate exon inclusion in transcripts that are subject to tissue-specific alternative cleavage, and they may be necessary for the early stages of spliceosome assembly. KH domain binding miRNAs and / or KH domain containing proteins may be involved in transcription. They can be subunits of coactivator complexes that play an important role in gene transactivation. They can be important in transcriptional regulation by acting as transfactors in regulating gene expression. They can induce heterochromatin formation and alter RNA-secondary structure. They can act as transcription modulators through interaction with and being part of long intergenic RNA. They can act as or interact with ATP-dependent DNA helicases. KH domain binding miRNAs and / or KH domain containing proteins may be involved in signal transduction. They may be involved in the cAMP-dependent signal transduction path, Wnt signaling path or the EGFR signaling path. They can bind to HDL and can regulate high levels of cholesterol in cells. They may be involved in the sterol signaling path. They may be involved in the LXR and LRP path. KH domain binding miRNAs and / or KH domain containing proteins may be involved in RNA localization. They can direct RNA to specific cellular compartments and thus play a role in intracellular RNA transport and in regulating local translation of target mRNAs. They are important for RNA localization and surface delivery. They can commute between the nucleus and the cytoplasm. KH domain binding miRNAs and / or KH domain containing proteins may be involved in translation. They may be required for 40S ribosome biogenesis, processing of pre-18S ribosomal RNA and ribosome assembly. They may be associated with polyribosomes, primarily with the 60S ribosomal subunit. They can be part of complexes that bind to the mRNA end piece and mediate translational repression. They can modulate the speed and location with which and at which target transcripts encounter the translation device. They can bind to the 5 'UTR and 3'UTR of mRNA and thus regulate their translation.

They can regulate the association of constitutive transport element (CTE) containing mRNA with large polyribosomes and thus initiate translation. They can regulate localized mRNA translation, a crucial process for cell polarity and cell migration. In neurite outgrowth, they can be important regulators of growth cone conduction and neuronal cell migration, presumably through the spatial-fine tuning of protein synthesis. KH domain binding miRNAs and / or KH domain containing proteins may be involved in stress responses. They can play an important role in p53 / TP53 response to DNA damage, apoptosis induction, cell cycle stop in G (2) -M and G2-M progression. During cell stress, such as oxidative stress or heat shock, they can stabilize target mRNAs that are attracted to stress granules. KH domain binding miRNAs and / or KH domain containing proteins may be involved in RNA stabilization. They may attract target transcripts for cytoplasmic protein-RNA complexes (mRIMPs). They can colocalize with decapping factor and Argonaut proteins within P (processing) bodies. They can interact with the polynucleotide phosphorylase family, which consists of phosphate-dependent 3 'to 5' exoribonucleases involved in RNA processing and degradation. They can be a component of a mitochondrial degradosome (mtEXO) complex and play a role in RNA cell monitoring by clearing up oxidizing RNAs. They can play a role in myelination by influencing the stability of mRNAs such as MBP. KH domain binding miRNAs and / or KH domain containing proteins may be involved in primary piRIMA biogenesis by participating in the processing of 31-37 nt intermediates into mature piRNAs.

Thus, changing the interaction between a KH-binding miRNA and a KH-domain-containing protein can directly contribute to the phenotype observed in KH-domain-binding miRNAs and KH-domain-containing protein-regulated cells, preferably tumor cells or central nervous system cells , and more preferably, tumor cells or neuronal cells.

MicroRNAs and therefore also KH domain binding microRNAs have various potential mechanisms for transcriptional regulation. They inhibit translation initiation by influencing translation initiation factors, cap recognition, 40S small ribosomal subunit recruitment, incorporation of the 60S subunit and formation of the 60S ribosomal complex. miRNAs are involved in inhibiting elongation by ribosomes, encouraging them to shed mRNA and / or facilitating the degradation of newly synthesized peptides. Binding of miRNA can attract RNA decapping and / or de-adenylating enzymes which can lead to mRNA destabilization. Β-bodies are the most important cellular organeilen for the degradation and storage of miRNA-mRNA complexes.

Unexpectedly, various miRNAs are characterized by KH domain binding sequences. Furthermore, both KH domain-containing proteins and KH-binding microRNAs are involved in the same pathways and processes. Thus, KH domain-containing proteins have functional interaction and bind to KH domain-containing microRNAs. Interaction of KH domain-containing proteins with KH domain binding miRNAs can affect all of the above-mentioned functions of KH-containing proteins, and vice versa.

From this point on, cell lysates, cell fractions and whole cells can be used to understand the underlying mechanism of KH domain-containing proteins regulated gene expression, primarily due to the experimental manipulation of the cell type. It is important to emphasize that caution must be exercised when deriving molecular mechanisms by extrapolation from one cell type to another.

Techniques that can be used to investigate further interaction between KH domain binding proteins and KH domain binding microRNAs or to characterize potential therapeutic agents may be but are not limited to microarray hybridization, RNA sequencing, RNA mmunoprecipitation, UV -cross-linked immunoprecipitation, Ago2-cross-linked immunoprecipitation, Ab protein-RNA immunoprecipitation, mutational analysis, in-line probing, Western blotting, Electrophoretic Mobility Shift Assay, Neurosphere formation, transwell migration, wound healing, sprouting, soft agar colony formation test, FACS- analysis, immunochemistry.

The invention is described in more detail by the following non-exhaustive examples.

EXAMPLES

Cell culture, transfection and transduction.

All cell lines are grown at 37 ° C in an atmosphere with 5% CO2.

Specific cell lines that are used are: SH-SY5Y neuroblastoma cell line; HT22 neuronal cell line; 9L gliosarcoma cell line; A172, U87 XXX, U373, LN229, LN428, LN308 gioblastoma cell lines; GL261 mouse glioma cell line; BOSC 23 astrocyte cell line; D283, Daoy cells, medulloblastoma cell lines or H06 / M0313K6-1C oligodendroglial cell line. These cell lines endogenously express one or more of the finished KH domain binding miRNAs, their overlapping transcripts, and / or the KH domain containing proteins. In these cell lines that express the KH domain-containing proteins, the endogenous protein can be depleted or eliminated and / or genetically modified to exogenously produce the KH domain-containing protein.

Example 1: reporter compositions

The following KH domain binding miRNAs or overlapping transcripts were selected as KH domain binding miRNAs or RNAs due to the presence of a KH domain binding sequence miRNA-125b-5p, pre-miRNA-125b-1, pri-miRNA-125b- 1, miRNA-199b-5p, pre-miRNA-199b, prim-miRNA-199b, miRNA-7-2-3p, miRNA-7-3-3p pre-miRNA-7-2, pre-miRNA-7-3 , prim-miRNA-7-2, prim-miRNA-7-3, miR-3613-5p, pre-miR-3613, prim-miR-3613, miR-33b-5p, pre-miR-33b, or pri -miR-33b, miR-100HG, miR-7-3HG, DLEU2.

Lentiviral reporter compositions for miRNA activity are assembled by introducing the complementary sequences of finished miRNA-125b-5p, finished miRNA-199b-5p, finished miRNA-7-2-3p, finished miRNA-7-3-3p, finished miR- 3613-5p and finished miR-33b-5p and a linker sequence (multiple cloning location without detectable recognition by natural miRNAs) as a negative control downstream of a luciferase reporter gene.

For each finished miRNA, 2 plasmids are compiled -pCMV-fireflyLuc_miRTS_PUR plasmid and a pCMV-Renilia_miRTS_PUR plasmid. In the pCMV FireflyLuc plasmid, one to five tandem miRTS (target locations) are cloned downstream of a firefly luciferase ORF (with a stop codon), which is driven by a CMV promoter. These target locations serve in their entirety as an artificial 3 'UTR for firefly-luciferase transcription. The sequence 1-8 in the target locations is complementary to the germ sequence of each target. The sequences following the target locations are complementary to the nucleotide positions in the finished miR. The supernatant sequence will not anneal to the finished miRs, and will form a "bump" construction when the miRs anneal to the RNA transcription of target sites. This firefly Luc_miRTS_PUR cassette is further cloned into a lentivirus backbone. In the pCMV-RenillaLuc_miRTS_PUR plasmid, the firefly luciferase ORF is replaced by a renillaluciferase ORF. pCMV-FireflyLuc_miRTS_PUR and pCMV-RenillaLuc_miRTS_PUR plasmids are used to generate lentivirus particles in 293T cells, which are then used to infect the different cell lines. Infected brain cell lines are selected with Puromycin (2 mg / L) and expanded by cloning. These clones are used in successive experiments.

In one experiment, the clones (25,000 cells per well on 24-well plates) of the different cell lines are transfected with 0.5 nM and 5 nM miR mimetics that can be processed into finished miR in cells. The activities of firefly luciferase in mimetics transfected cells are significantly reduced. In another experiment, the clones (25,000 cells per well on 24-well plates) of the different cell lines are transfected with 10 nM synthetic inhibitors that can hybridize with endogenous miR and therefore block its action. The activities of firefly luciferase in miR inhibitors transfected cells are significantly increased. Both experiments are performed in 6 repeated copies.

Example 2: Identification of KH domain binding miR modulators.

In one experiment, the clones (25,000 cells per well in 24-well plates) are treated with drugs and biological preparations in growth media. A first screening of> 1000 compounds is performed. Compounds with a final concentration of 10 μΜ are added to each well. All compounds are stored at a 10 mM concentration in DMSO to keep the DMSO concentration in the actual screening at 0.1%, thereby minimizing toxicity. Cells with a stable expression of miR reporter were treated with DMSO in a range of 0.1-1%. Luciferase signals were determined 48 hours after treatment. Additional chemical modifications of selected compounds are prepared and screened. In addition, other libraries of compounds are screened for inhibitory or enhancing activity.

Example 3: Specificity and effectiveness of the identified compounds are further evaluated by quantitative RT-PCR tests.

The primers for the control genes (similar oxysterol-binding protein 9, SMEK homologue 1, mekl suppressor, rho GTPase activating proteins 12 and 22, EPH receptor A5, EGF-like repeats and discoidin I-like domain 3, ATP-binding cassette , subfamily A, paragraph 1) used in this study are designed as described herein (see Example 6 below)

Example 4: Identification of modulators of KH domain binding miR and KH domain containing proteins

The modulators identified in the above steps are further used in another experiment. The clones (25,000 cells per well on 24-well plates) of the different cell lines are transfected with 10 nM synthetic inhibitors that can hybridize to endogenous genes or transcripts of the endogenously expressed KH domain-containing proteins and therefore block their action. The activities of firefly luciferase in transfected cells will change when there is an interaction between the KH domain binding miRs and the KH-containing proteins. Genetically modifying the cells to eliminate or enhance KH domain-containing proteins will also alter the firefly luciferase activities when there is an interaction between the KH domain binding miRs and the KH containing proteins. Those modulators identified in the previous experiments that have an effect on the interaction of a KH domain-containing protein with a KH domain binding miRNA will enhance the effect or undo the effect after lowering, eliminating, increasing (by exogenous protein) ) or overexpressing the KH domain-containing proteins.

Example 5: Screening with high throughput for interesting connections

This example describes a screening test with a high throughput for identifying small organic molecules that disrupt the interaction between KH domain-containing proteins and KH domain-containing miRNA. These active small molecules can be used as innovative chemical tools to better understand miRNA functions and the molecular mechanisms of miRNA biogenesis. Moreover, they can potentially be developed into new therapeutics, including brain tumor and neurodegenerative agents. The test with high throughput consists of a two-phase screening protocol, consisting of a first screening to identify potentially interesting compounds from collections of small molecules and a second screening to evaluate and characterize the primary active substances and to obtain a detailed structural analysis. Activity Relationship (SAR). SAR will also direct the development of highly effective and highly specific modifiers. SAR: The concentration response data for the entire high throughput screening is plotted and modeled by a logistic fit based on four parameters and SAR analysis is performed according to conventional approaches. Maximum corresponding substructures are then extracted from each cluster that typically contains at least three compounds, which are then used to search the entire screening set to find all analogs, including inactive compounds. Connections with a common scaffolding form a series. Candidate series and singletons are chosen for follow-up studies. A suitable library design method (e.g., point substitution library or matrix library) is selected for each lead or series. Typically, precursors are synthesized and a library of 15-25 compounds is produced for analysis in the tests described above. After generating bioactivity results, subsequent cycles of library design, synthesis, and analysis are performed to obtain one or more high-activity compounds.

The identified modulators are expected to have an effect on phenotypic screenings and in vivo screenings.

Example 6: Use of miR-125b-1 as a biomarker for brain tumors and neurodegeneratia.

Isolation of the exosome fractions of serum samples from patients with brain tumors and / or neurodegeneration are performed by various centrifugation steps and / or filtration steps.

Detection of mi RN A's normed pilot experiment and data analysis

A normed pilot experiment is performed to select suitable, stably expressed reference miRNAs for data normalization by using a set of 8 candidate reference miRNAs exosome samples on 10 representative samples belonging to different groups (at least 3 samples per subgroup) ). Data analysis is performed with Biogazelle's qbase + software. This software has been developed based on the latest and proven quantification. The geNorm module in qbase + is used to determine the best reference genes. geNorm is the most popular algorithm for finding stable reference genes. From this analysis, the three most stably expressed reference miRNAs are selected for further miRNA expression normalization. RNA extraction, RNA quality control

Sample-specific validated approaches to RNA extraction (including DNase treatment) are used. RNA quality monitoring is analyzed with the Agilent 2100 Bioanalyzer microfluidic chip-based system to assess the integrity of the RNA.

Expression analysis of miRNA targets that are of interest and reference miRNA targets

The miScript miRNA PCR tests (Qiagen) are used that enable accurate and sensitive expression analysis of miRNAs by quantitative PCR. Briefly, all of the RNA is reversibly transcribed with a universal RT approach, which allows miRNA-specific cDNA synthesis of miRNAs and small RNA controls. Subsequently, the diluted RT product is amplified by a 12-cycle PCR reaction. Finally, a dilution of previously amplified miRNA cDNA is used as a raw material for a SYBR-green based qPCR reaction with miRNA specific forward primer and a universal reverse primer.

All qPCR reactions are performed in 5 μΙ reactions in 384-well plates in duplicate.

Basic data analysis

Basic data analysis is done in qbase +. This software has been developed based on the latest and proven quantification model including PCR efficiency correction, multiple standardization of reference gene or general average standardization, interrun calibration and uncertainty propagation, and offers numerous quality control tools.

Detection of longer transcripts PrimePCR tests SYBR Green I based PrimePCR tests are designed using the validated pipeline primerXL for design and in-silico verification of high quality tests.

All tests have been validated for the wetlab and evaluated with the gold standard method of standard graphs based on a 6-point 10-fold dilution series using synthetic templates to create a wide detection range. The serial dilution is used to determine test efficiency, sensitivity and linearity.

The performance and functionality of the tests is further evaluated on gDNA, cDNA and non-template checks (IMTC). Subsequently, Next Generation Sequencing of the amplicon is performed for verification of specificity.

Test design and validation

Custom primer design is performed with the validated primerXL pipeline for design and in-silico verification [computer verification] of high quality testing. Great care is taken to design tests that are free from general SNPs and secondary structures. For gene expression studies, we prefer to work with Intron Voltage tests. If good tests cannot be designed in this way, exogenous tests are done.

The primerXL pipeline is also used to develop the PrimePCR tests (Bio-Rad) that meet the highest available level of quality and specificity and that have been fully validated in accordance with established MIQE procedures.

All tests have been validated for the wetlab and evaluated with the gold standard method of standard graphs based on a 6-point 10-fold dilution series using synthetic templates to create a wide detection range. The serial dilution is used to determine test efficiency, sensitivity and linearity.

The performance and functionality of the tests is further evaluated on gDNA, cDNA and non-template checks (NTC). Subsequently, microchip electrophoresis will be used to verify the specificity of the PCR reactions. RNA extraction, RNA quality control, gDNA contamination assessment

Sample-specific validated approaches to RNA extraction (including DNase treatment) are used. RNA quality control is analyzed with the Agilent 2100 Bioanalyzer microfluidic chip-based system to assess the integrity of the RNA. Prior to cDNA synthesis, a quality control step is included to exclude gDNA contamination. standard pilot experiment and data analysis

A normed pilot experiment is performed to select suitable, stably expressed reference genes for data normalization by using a set of 8 candidate reference genes on 10 representative samples belonging to different groups (at least 3 samples per subgroup). Data analysis is performed with Biogazelle's qbase + software (www.qbaseplus.com). This software has been developed based on the most modern and proven quantification model. The geNorm module in qbase + is used to determine the best reference genes.

From this analysis, the three most stably expressed genes are retained for further normalization of gene expression. RT-qPCR and data analysis

To create gene expression profiles of genes of interest and the reference genes used, validated approaches to cDNA synthesis and verification of the quality of the prepared cDNA, qPCR enhancement, and data analysis are used. All measurements are made in 384-well plates in a reaction volume of 5 µl. Each PCR reaction will be carried out in duplicate.

Data analysis is performed in Biogazelle's qbase + (www.qbaseplus.com).

Detection of KH domain-containing proteins

Detection of KH domain-containing proteins is performed in the exosome fractions using conventional ELISA techniques.

Claims (59)

CONCLUSIONS Use of a KH domain binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, comprising testing the ability of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain of a protein. The use claimed in claim 1 wherein the KH domain binding miRNA is a mature miRNA, a mature isomeric miRNA, a pre-miRNA, a prim-miRNA or any combination thereof. The use claimed in claims 1 or 2 wherein the KH domain binding miRNA is selected from miRNA-125b-5p, pre-miRNA-125b-1, prim-miRNA-125b-1, miRNA-199b-5p , pre-miRNA-199b, pri-miRNA-199b, miRNA-7-5p, pre-miRNA-7-2, pre-miRNA-7-3, prim-miRNA-7-2, prim-miRNA-7-3 , miR-3613-5p, pre-miR-3613, pri-miR-3613, miR-33b-5p, pre-miR-33b, or pri-miR-33b. The use claimed in claims 1 to 3 wherein the KH domain binding miRNA is part of, groups with, or is complementary to, another miRNA, an IncRNA, a lincRNA, a piwiRNA, a pseudogenic RNA transcription, a gene RNA transcription, an RNA transcription, overlapping gene RNA transcripts or combinations thereof. The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-125b-5p, pre-miRNA 125b-1, or prim-miRNA-125b-1; and (b) the other is miRNA, miRNA-100-5p, pre-miR-100, pri-miR-100, let-7a-5p, pre-let-7a-2, pri-let-7a-2; and / or (c) is the gene RNA transcription of BLID; and / or (d) the IncRNA is miR-100HG. The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-199b-5β, pre-miRNA-199b, or prim-miRNA-199b; and (b) the other is miRNA, miRNA-219a-5p, miRNA-219a-2-3p, pre-miRNA-219a-2, prim-miRNA-219a-2; and / or (c) the gene RNA transcription is DNM1 or PTGES2. The use claimed in claim 4 wherein (a) the KH domain binding miRNA, miRNA-7-2-3p, miRNA-7-3-3p, pre-miRNA-7-2, pre-miRNA- 7-3, pri-miRNA-7-2 or prim-miRNA-7-3; and / or (b) the lincRNA, miR-7-3HG. The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-3613-3p, pre-miRNA-3613 or prim-miRNA-3613; and (b) the other miRNA, miRNA-15a-5p, miRNA-15a-3p, miR-15b-5p, miRNA-15b-3p, miRNA-16-5p, miRNA-16-1-3p, miR-16- 2-3p, pre-miRNA-15a, pre-miRNA-15b, pre-miRNA-16-1, pre-miRNA-16-2, prim-miRNA-15a, prim-miRNA-15b, pri-miRNA-16- 1 or primmiRNA-16-2; and / or (c) is the gene RNA transcription of TRIM 13 or TRIM59; and / or (d) the IncRNA, DLEU2 or RP11-432B6.3. The use claimed in claim 4 wherein (a) the KH domain is binding miRNA, miRNA-33b-3β, pre-miRNA-33b, or prim-miRNA-33b; and (b) is the gene RNA transcription of SREBF1; and / or (c) the IncRNA, SMCR5. The use claimed in any of claims 1 to 10 wherein the KH domain is a protein of AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3B, MEX3B, PPC, NOVAP, PCB, NOVAP, PCB, NOVAP, PCB, NOVAP QKI, SF1 or TDRKH. The claimed claim in any of claims 1 to 9 wherein the KH domain binding miRNA is part of a complex comprising the KH domain containing protein and one or more other proteins, RNA (s) ), DNA (s) or any combination thereof. The use claimed in claim 11 wherein the KH domain-containing protein AKAP1, ANKHD1, ANKRD17, ASCC1, BICC1, DDX43, DDX53, DPPA5, FMR1, FUBP1, FUBP3, FXR1, FXR2, GLD1, HDLBP, HNRPK, IGF2BP1, IGF2BP2, IGF2BP3, KHDRBS1, KHDRBS2, KHDRBS3, KHSRP, KRR1, MEX3A, MEX3B, MEX3C, MEX3D, N0VA1, NOVA2, PCBP1, PCBP2, PCBP3, PCBP4, PNOKDR, PNNO, PNNO, PNNO, PNOK, The use claimed in claims 11 or 12 wherein the other protein is part of the EGFR path, the cholesterol path, the LXR path or the LRP path. The use claimed in any of claims 1 to 13 wherein the KH domain binding miRNA comprises at least one fluorophore donor and the KH domain containing protein comprises at least one fluorophore acceptor or a dark quencher, wherein the fluorophore donor and fluorophore acceptor or the fluorophore donor and dark quencher are paired spectrally such that the energy spectrum emitted by the fluorophore donor and the excitation energy spectrum of the fluorophore acceptor or the energy spectrum absorbed by the dark quencher at least partially overlap, including the steps of (a ) supplying said KH domain binding miRNA and said KH containing protein, (b) supplying a potential therapeutic agent, (c) contacting said KH domain binding miRNA and said KH domain containing protein with the potential therapeutic agent under conditions that make FRET (Förster Résonance Energy Transfer) possible and between the fluorophore donor and the fluorophore acceptor or the fluorophore donor and the dark quencher, (d) identifying the potential therapeutic agent as a compound that modulates, preferably inhibits, or enhances an interaction between said KH domain binding miRNA and said KH domain containing protein, if the FRET (Förster Résonance Energy Transfer) differs in the presence of the compound of interest compared to the FRET in the absence of the compound of interest. Use of a KH binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to alter the interaction of said KH domain binding miRNA with a KH domain containing protein in a whole cell in which the potential therapeutic agent is contacted with said cell. The use claimed in claim 15, wherein the KH domain is binding miRNA, the KH domain-containing protein, and the other protein as defined in any of claims 2 to 13. The use claimed in claims 15 or 16 wherein the KH domain binding miRNA and / or the KH domain containing protein are endogenous to the cell. The use claimed in claims 15 or 16 wherein the KH domain binding microRNA and / or the KH domain containing protein are exogenous to the cell. The use claimed in any of claims 15 to 18 wherein the cell is genetically modified to express or suppress the KH domain binding microRNA. The use claimed in any of claims 15 to 18 wherein the cell is genetically modified to express or suppress the KH domain-containing protein. The use claimed in any of claims 15 to 18 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly changes the surface delivery, transport, stability, recycling or causes translation of another protein in the cell. The use claimed in any one of claims 15 to 18 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly altered surface delivery, transport, cleavage, transcription, stability or reuse of an RNA in the cell. The use claimed in any of claims 15 to 18 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly proliferation, differentiation, apoptosis, necrosis, autophagia cell motility, migration or invasion. The use claimed in any of claims 15 to 23, wherein the cell is a brain tumor cell, a nervous system cell, a brain tumor cell line, or a nervous system cell line. The use claimed in any of claims 15 to 20 wherein the cell expresses a reporter protein coding sequence that is operably linked to a KH domain binding microRNA binding sequence. The use claimed in claim 25 wherein the reporter protein is selected from the group of green fluorescent protein, red fluorescent protein, yellow fluorescent protein, luciferase, beta-galaktosidase and beta-glucuronidase. The use claimed in claim 25 or 26 wherein the KH domain binding microRNA binding sequence is downstream of the reporter protein coding sequence or upstream of the reporter protein coding sequence. Use of a KH-binding miRNA to identify a therapeutic agent capable of preventing or treating a disease or disorder, including testing the ability of a potential therapeutic agent to alter the interaction of said KH- domain binding miRNA with a KH domain-containing protein in an animal in which the potential therapeutic agent is contacted with said animal. The use claimed in claim 28 wherein the KH domain binding miRNA, the KH domain containing protein and the other protein as defined in any of claims 2 to 13. The use claimed in claims 28 or 29 wherein the KH domain binding miRNA and / or the KH domain containing protein are endogenous to the animal. The use claimed in claims 28 or 29 wherein the KH domain binding microRNA and / or the protein containing KH domain are exogenous to the animal. The use claimed in any of claims 28 to 31 wherein the animal is genetically modified to express or suppress the KH domain binding microRNA. The use claimed in any of claims 28 to 31 wherein the animal is genetically modified to express or suppress the protein containing KH domain. The use claimed in any of claims 28 to 33 wherein altering the interaction between the KH domain binding microRNA and the KH domain containing protein directly or indirectly proliferation, differentiation, apoptosis, necrosis, autophagia, motility, migration or invasion of cells in the animal. The use claimed in any of claims 28 to 34 wherein the animal is placed in one or more chambers in a micro-flow device module; and an image recording is made of the content of one or more rooms to obtain results in one or more rooms. The use claimed in any of claims 28 to 35 wherein the animal is a complete animal, an embryo or a larva. The use claimed in any of claims 28 to 36 wherein the entire animal is Danio rerio or Drosophila melanogaster. The use claimed in any of claims 28 to 37 wherein the animal is wild type or transgenic. The use claimed in any of claims 28 to 38 in which the animal can have tissue-specific, site-specific and / or development-phase-specific expression of the KH domain binding miRNA, the KH domain-containing protein and / or combinations thereof. include. The use claimed in any of claims 1 to 39 wherein the potential therapeutic agent is selected from a protein, polypeptide, peptide, nucleic acid, oligonucleotide, hydrocarbon, lipid, synthetic molecule, semi-synthetic molecule, small molecule or purified natural product. 41. A KH domain binding miRNA oligonucleotide comprising a sequence that binds to a KH domain of a protein wherein said KH domain binding miRNA is selected from the group consisting of a mature miRNA, a mature isomeric miRNA, a pre-miR , a pri-miR, a miRNA mimic or a mixture of miRNA mimics, an RNA or DNA molecule encoding said mature, for said mature isomer miRNA, for said pre-miR, for said pri-miRNA, for said miRNA mimic or a mixture of miRNA mimics or any combination thereof. The KH domain binding miRNA oligonucleotide claimed in claim 41 wherein the sequence that binds to a KH domain is one or more of 5 '- (U / A) C3-4 (U / A) -3' 5 '- (U / A / C) C3-4 (U / A / C) -3', 5'-CCAUC N2-7 (A / U) CCC (A / U) N7 - is UCA (C / U) C-3 ', 5'-CA N2 -10CCC N7-24CA-3', 5 '- (U / A) 2 C3-5 (U / A) 2-6 C3-5 (U / A) 2 -6 C3-5 (U / A) 2 -3 ', 5'-C3-5 (N) 2-6 C3-5 (N) 2-6 C3-5 (N) 2 -3', or 5 ' - C 2-5 (N) 2-8 C 2-5 (N) 2-8 C 2-5 (N) 2-3 wherein N may be one of C, U, A or G. An antisense oligonucleotide that is complementary to the KH domain binding miRNA oligonucleotide claimed in claim 41 or 42. The KH domain binding miRNA oligonucleotide claimed in claim 41 or 42 or the antisense oligonucleotide claimed in claim 43 for use in the treatment and / or prevention of a disease or disorder. A pharmaceutical composition consisting of the KH domain binding miRNA oligonucleotide claimed in claim 41 or 42 or the antisense oligonucleotide claimed in claim 43 in admixture with a pharmaceutically acceptable carrier. An extracellular vesicle, intracellular vesicle, particle or exosome containing a KH domain binding miRNA as detained in any of claims 2 to 9. The extracellular vesicle, intracellular vesicle, particle or exosome claimed in claim 46 wherein said KH domain binding miRNA is bound to a KH domain of a protein. The extracellular vesicle, intracellular vesicle, particle or exosome claimed in claim 46 or 47 for use in the treatment and / or prevention of a disease or disorder. Use of a KH domain binding miRNA comprising selecting a treatment or changing a treatment for a disease or disorder based on determining the amount of KH domain binding miRNA in a biological sample in which the KH domain binding miRNA is as defined in any of claims 2 to 13. The use claimed in claim 49 for determining the choice to initiate, continue or change a treatment for a disease or disorder in a subject, comprising: (a) analyzing a series of biological samples to determine an amount of a KH domain binding miRNA in each of the biological samples; and (b) comparing any measurable change in the amounts of a KH domain binding miRNA in each of the biological samples. The use claimed in claims 49 or 50, wherein said biological sample is selected from a biological tissue sample, a whole blood sample, a blood-derived sample, a smear, a plasma sample, a serum sample, a saliva sample, a vaginal fluid sample, sperm sample, pharyngeal fluid sample, bronchial fluid sample, faecal fluid sample, cerebrospinal fluid sample, tear fluid sample, urine sample, lymph sample, tissue culture supernatant, cellular fraction, exosome fraction , a platelet fraction or a microparticle fraction. The use claimed in any of claims 49 to 51 wherein the biological sample is an exosome fraction of serum. The use claimed in any of claims 49 to 52 wherein the level of said miRNA is determined by quantitative reversive transcription polymerase chain reaction (qRT-PCR) or series of hybridization. The use claimed in any of claims 1 to 40, 44 or 48 to 53 wherein the disease or disorder is a brain tumor or a neurodegenerative disease. The use claimed in claim 54 wherein the brain tumor is acoustic neuroma, astrocytoma, chordoma, pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, craniopharyngioma, brainstem glioma, ependymoma, mixed glioma, optic nerve glioma, meningioma tumors, subependum soma, meningioma. oligodendroglioma, pituitary tumors, primitive neuroectodermal tumors or schwannoma. The use claimed in claim 54 wherein the neurodegenerative disease is Parkinson's disease, Multiple System Atrophy (MSA), multiple sclerosis, amyotrophysic lateral sclerosis (ALS), Alzheimer's disease or Hunttington's disease. A computer program product useful for performing the applications claimed in any one of claims 1 to 40, 44 or 48 to 53, comprising means for receiving data representing a changed level of interaction from at least one KH domain binding miRNA, means for receiving data representing at least one reference pattern or control pattern of said at least one KH domain binding miRNA, means for comparing said data and means for selecting a potential therapeutic agent. An apparatus for performing the applications claimed in any of claims 49 to 53. A set for performing the application claimed in any of claims 49 to 53, wherein said set comprises instructions for performing said use, a detection reagent for determining the amount of at least one KH domain binding miRNA in a subject sample and reference standards.