WO2014188201A2 - Treatment - Google Patents
Treatment Download PDFInfo
- Publication number
- WO2014188201A2 WO2014188201A2 PCT/GB2014/051577 GB2014051577W WO2014188201A2 WO 2014188201 A2 WO2014188201 A2 WO 2014188201A2 GB 2014051577 W GB2014051577 W GB 2014051577W WO 2014188201 A2 WO2014188201 A2 WO 2014188201A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- setd2
- inhibitor
- seq
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/10—Protein-tyrosine kinases (2.7.10)
- C12Y207/10002—Non-specific protein-tyrosine kinase (2.7.10.2), i.e. spleen tyrosine kinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
Definitions
- the invention relates to methods of treating cancers which comprise a decreased amount of H3K36me3. Kits for use in such methods are also provided.
- Personalised cancer medicine involves the customisation of treatment to the
- H3K36 histone H3 at lysine 36
- H3K36 methylation is catalysed through the activities of eight distinct enzymes, in which seven (NSD1, NSD2, NSD3, SETMAR, ASH1L, and SETD3) are responsible for H3K36 mono- and or di-methylation, while SETD2 (also known as Huntingtin-interacting protein B, HYPE) uniquely catalyses the tri-methylation of H3K36 (Edmunds et al, 2008).
- NSD1, NSD2, NSD3, SETMAR, ASH1L, and SETD3 seven
- SETD2 also known as Huntingtin-interacting protein B, HYPE
- cancer cells which comprise a decreased amount of H3K36me3 are unexpectedly and acutely sensitive to inhibition of ataxia telangiectasia and Rad3-related protein (ATR), checkpoint kinase 1 (CHK1) or WEE1, resulting in growth inhibition and cell death.
- ATR ataxia telangiectasia and Rad3-related protein
- CHK1 checkpoint kinase 1
- WEE1 checkpoint kinase 1
- cancer cells are much less sensitive to ATM or CHK2 inhibition or to general replication stress induced by hydroxyurea or aphidicolin.
- the targeted inhibition of ATR, CHK1 WEE1, or other components of the replication checkpoint pathway may therefore be exploited to create novel approaches for the treatment of cancers which comprise a decreased amount of
- the present invention provides a method of treating a cancer which comprises a decreased amount of H3K36me3 in a patient, the method comprising administering to the patient a WEE1 inhibitor or a checkpoint kinase 1 (CHK1) inhibitor or an ataxia telangiectasia and Rad3 -related protein (ATR) inhibitor and thereby treating the cancer.
- the invention also provides a method of treating cancer in a patient, the method comprising (a) determining whether or not the cancer comprises a decreased amount of
- H3K36me3 and (b), if the cancer comprises a decreased amount of H3K36me3, administering to the patient a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor and thereby treating the cancer.
- the invention also provides a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor for use in a method of treating in a patient a cancer which comprises a decreased amount of H3K36me3.
- the invention also provides use of a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor in the manufacture of a medicament for treating in a patient a cancer which comprises a decreased amount of H3K36me3.
- the invention also provides a kit for treating cancer comprising (a) means for testing for whether or not the cancer comprises a decreased amount of H3K36me3 and (b) a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor.
- Fig 1 shows that in fission yeast set2A and weel-50 exhibit a synthetic lethal genetic interaction.
- Five-fold serial dilutions of wild-type (2094) set2A (3271) weel-50 (7024) and set2A weel-50 (7121) were grown on minimal media (EMM6S) at 35°C. While both set2A and weel-50 were able to grow on EMM6S at the restrictive temperature of 35°C, the set2A weel-50 double mutant was not.
- Fig 2 shows that SETD2-deficient cells are hypersensitive to the WEEl inhibitor MK- 1775.
- C Percentage of total number of cells undergoing apoptosis as determined by Hoechst nuclear staining 48 hours after treatment with DMSO or MK-1775 (as described in Materials and Methods). Images were captured and quantitated using the Incell Analyzer system (GE healthcare). Error bars represent standard errors of the mean. MK-1775 treatment results in significantly more apoptosis in A498 cells compared to U20S. Fig 3 shows that siRNA knockdown of SETD2 in wild-type cells leads to MK-1775 hypersensitivity. Re-expression of SETD2 protein in deficient cells reduces MK-1775 hypersensitivity.
- U20S cells were transfected with control non-targeting siRNAs (NT) or siRNAs targeting SETD2 (si#3 and si#5) for 72 hours. Protein knockdown was confirmed by Western blotting using anti-SETD2 antibody (Abeam) (upper panel). SETD2 knockdown led to a significant decrease in H3K36me3 (Abeam) (middle panel) without affecting the loading control Histone 3 protein levels (Abeam) (lower panel).
- C Clonogenic survival of U20S after transfection with non-targeting siRNA (siNT) or siRNAs targeting SETD2 (siSETD2#3 or #5) for 48 hours prior to one-off treatment with DMSO or MK-1775 at the concentrations indicated. Colonies were allowed to form for 10-14 days before counting. Error bars represent standard errors of the mean. The figure shows that SETD2 knockdown reduces the survival of U20S cells upon MK-1775 treatment.
- A498 cells or A498 cells with stably integrated SETD2 cDNA were treated with DMSO or MK-1775 at the indicated concentrations. Cell survival was measured by Resazurin assay 48 hours after MK-1775 treatment. Error bars represent standard errors of the mean. The figure shows that re-expression of SETD2 increases cell survival in A498 after MK-1775 treatment.
- Apoptosis (as determined by Hoechst and analysed by Incell (GE healthcare) of A498 cells or A498 cells with stably integrated SETD2 cDNA (A498 SETD2), were treated with DMSO or MK-1775 at the indicated concentrations.
- Error bars represent standard errors of the mean.
- the figure shows that re-expression of SETD2 reduces apoptosis in A498 after MK-1775 treatment, confirming that loss of SETD2 was the primary cause of cell death in A498 cells treated with MK- 1775.
- Fig 4 shows that inhibition of WEEl by siRNA selectively kills SETD2-deficient cells.
- Fig 5 shows that SETD2-deficient cells are hypersensitive to the ATR inhibitor VE-821.
- Fig 6 shows that SETD2-deficient cells are hypersensitive to CHK1 inhibitors such as Go 6976, LY2603618 or AZD7762.
- A-C SETD2-deficient A498 cells are hypersensitive to Go 6976, as demonstrated by light microscope images (taken 5 days after treatment), reduction in survival (measured 5 days after treatment) and increase in apoptosis (measured 48 hours after treatment). Error bars represent standard errors of the mean.
- D-F SETD2-deficient A498 cells are hypersensitive to LY2603618, as demonstrated by light microscope images (taken 5 days after treatment), reduction in survival (measured 5 days after treatment) and increase in apoptosis (measured 48 hours after treatment). Error bars represent standard errors of the mean.
- G-I SETD2-deficient A498 cells are hypersensitive to AZD7762, as demonstrated by light microscope images (taken 5 days after treatment), reduction in survival (measured 5 days after treatment) and increase in apoptosis (measured 48 hours after treatment). Error bars represent standard errors of the mean.
- Fig 7 shows that siRNA knockdown of SETD2 in wild-type cells leads to CHK1 inhibitor hypersensitivity. Re-expression of SETD2 protein in deficient cells reduces CFD l inhibitor hypersensitivity.
- A,B U20S cells where transfected with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) 48 hours prior to Go 6976 treatment.
- SETD2 knockdown leads to reduced survival (measured 5 days after Go 6976 treatment) and increased apoptosis (measured 48 hours after Go 6976 treatment).
- C,D U20S cells where transfected with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) 48 hours prior to LY2603618 treatment.
- SETD2 knockdown leads to reduced survival (measured 5 days after LY2603618 treatment) and increased apoptosis (measured 48 hours after LY2603618 treatment).
- E,F U20S cells where transfected with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) 48 hours prior to AZD7762 treatment.
- SETD2 knockdown leads to reduced survival (measured 5 days after AZD7762 treatment) and increased apoptosis (measured 48 hours after AZD7762 treatment).
- G Apoptosis (determined by Hoechst) of A498 transfected with SETD2-expression plasmid for 48 hours prior to treatment with Go 6976. Error bars represent standard errors of the mean. Re-expression of SETD2 reduces apoptotic population in A498 after Go 6976 treatment, confirming that loss of SETD2 was the primary cause of cell death in A498 cells treated with Go 6976.
- Fig 8 shows that inhibition of CFD 1 by siRNA selectively kills SETD2-deficient cells.
- A Survival of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNA against CHK1 (siCHKl) were measured 6 days after transfection. Error bars represent standard errors of the mean. CHK1 siRNA reduces the survival of SETD2-deficient A498 much more compared to SETD2 wild-type U20S.
- B Apoptosis (determined by Hoechst) of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNA against CHKl (siCHKl) were measured 48 hours after transfection. Error bars represent standard errors of the mean. CHKl siRNA increases apoptosis in SETD2-deficient A498 much more compared to U20S.
- Fig 9 shows that targeting ATM or CHK2 does not seletively kill SETD2-deficient cells.
- Fig 10 shows that SETD2-deficient cells are not hypersensitive to DNA replication inhibitors.
- Fig 11 shows the chemical structure of the inhibitors used in this study.
- Fig 12 shows (A) Graphic demonstration of the Invitrogen T-REx system (picture adapted from Invitrogen User Manual 2010).
- B Addition of Doxycycline to the cell culture medium turns on expression of KDM4A, leading to reduced H3K36me3.
- C-H The KDM4A- U20S cell line was split into two groups, one cultured in the presence of Doxycline (5ug/ml) in the medium, one without, for 72 hours. Cells from the two groups were then seeded 18 hours prior to the treatment with indicated concentrations of MK-1775, LY2603618 or VE821. Cell survival was measured using Resazurin five days after treatment. Apoptosis was detected by Hoechst staining and analysed using an Incell Analysis System (GE Healthcare) 48 hours after treatment. The graphs represent data from three independent experiments.
- Fig 13 shows (A) U20S cells were infected with lentivirus containing H3.3 gene or the mutant H3.3 K36M gene. Cells containing the virus integrated into the genome were selected for by Puromycin. Western blots were performed with U20S cells containing integrated H3.3 or integrated H3.3-K36M, and show that K36M expression reduced H3K36me3 levels. (B-G) U20S cell lines with integrated H3.3 or H3.3-K36M were seeded 18 hours prior to the treatment with indicated concentrations of MK-1775, LY2603618 or VE821. Cell survival was measured by Resazurin five days after treatment.
- Fig 14 shows the in vivo efficacy of MK-1775 against SETD2-deficient cancer.
- A Data represent the mean tumour volume (mm ⁇ SEM) for each group. Arrows represent days when MK-1775 or vehicle were dosed. On day 13, the mean tumour volume in the MK-1775 treatment group (50.2 ⁇ 4.7 mm 3 ) was significantly less than in the vehicle control group (291 ⁇ 40 mm 3 ) (P ⁇ 0.0001, t-Test).
- B Image of the tumours recovered on day 13 from mice treated with either MK-1775 or vehicle.
- C Mean body weight of tumour-bearing mice treated with either MK-1775 or vehicle. MK-1775 had no significant impact on body weight.
- SEQ ID NO: 1 shows the cDNA sequence of human SETD2.
- SEQ ID NO: 2 shows the amino acid sequence of human SETD2.
- SEQ ID NO: 3 shows the cDNA sequence of human WEE1.
- SEQ ID NO: 4 shows the mRNA sequence of human WEE1 (variant 1).
- SEQ ID NO: 5 shows the amino acid sequence of human WEE1 (isoform 1 enocoded by SEQ ID NO: 4).
- SEQ ID NO: 6 shows the mRNA sequence of human WEE J transcript variant 2. This variant has a different first exon and 5' UTR, compared to variant 1 (SEQ ID NO: 4). This difference causes translation initiation from an in-frame downstream AUG and an isoform (2) with a shorter N-terminus compared with isoform 1.
- SEQ ID NO: 7 shows the amino acid sequence of human WEE1 isoform 2 (encoded by SEQ ID NO: 6).
- SEQ ID NO: 8 shows the cDNA sequence of human CHK1.
- SEQ ID NO: 9 shows the mRNA sequence of human CHK1.
- SEQ ID NO: 10 shows the amino acid sequence of human CHK1 (isoform 1 encoded by SEQ ID NO: 9).
- SEQ ID NO: 11 shows the cDNA sequence of human CHK1 transcript variant 4.
- CHK1 has 4 confirmed mRNA transcript variants, 3 of which code for the same protein (isoform 1 ; SEQ ID NO: 10) as the predominant form (SEQ ID NO: 9).
- Variant 4 lacks an in-frame coding exon at the 3' end compared to the predominant form. This results in a shorter isoform (SEQ ID NO: 12) missing an internal protein segment compared to isoform 1 (SEQ ID NO: 10).
- SEQ ID NO: 12 shows the mRNA sequence of human CHK1 transcript variant 4.
- SEQ ID NO: 13 shows the amino acid sequence of the shorter isoform of human CHK1 (encoded by SEQ ID NO: 12).
- SEQ ID NO: 14 shows the cDNA sequence of human ATR.
- SEQ ID NO: 15 shows the mRNA sequence of human ATR.
- SEQ ID NO: 16 shows the amino acid sequence of human ATR. Human ATR has 4 different protein isoforms
- SEQ ID NOs: 17 to 22 show some oligonucleotides of the invention (see Table 7).
- SEQ ID NOs: 23 to 29 show some oligonucleotides used in the Examples (see Table 7).
- SEQ ID NO: 30 shows the cDNA sequence of human KDM4A.
- SEQ ID NO: 31 shows the amino acid sequence of human KDM4A.
- SEQ ID NO: 32 shows the cDNA sequence of human KDM4B.
- SEQ ID NO: 33 shows the amino acid sequence of human KDM4B.
- SEQ ID NO: 34 shows the cDNA sequence of human KDM4C.
- SEQ ID NO: 35 shows the amino acid sequence of human KDM4C.
- SEQ ID NO: 36 shows the cDNA sequence of HIST1H3A (a histone H3).
- SEQ ID NO: 37 shows the amino acid sequence of HIST1H3A (a histone H3).
- SEQ ID NO: 38 shows the cDNA sequence of HIST1H3B (a histone H3).
- SEQ ID NO: 39 shows the amino acid sequence of HIST1H3B (a histone H3).
- SEQ ID NO: 40 shows the cDNA sequence of HIST1H3C (a histone H3).
- SEQ ID NO: 41 shows the amino acid sequence of HIST1H3C (a histone H3).
- SEQ ID NO: 42 shows the cDNA sequence of HIST1H3D (a histone H3).
- SEQ ID NO: 43 shows the amino acid sequence of HIST1H3D (a histone H3).
- SEQ ID NO: 44 shows the cDNA sequence of HIST1H3E (a histone H3).
- SEQ ID NO: 45 shows the amino acid sequence of HIST1H3E (a histone H3).
- SEQ ID NO: 46 shows the cDNA sequence of HIST1H3F (a histone H3).
- SEQ ID NO: 47 shows the amino acid sequence of HIST1H3F (a histone H3).
- SEQ ID NO: 48 shows the cDNA sequence of HIST1H3G (a histone H3).
- SEQ ID NO: 49 shows the amino acid sequence of HIST1H3G (a histone H3).
- SEQ ID NO: 51 shows the amino acid sequence of HIST1H3H (a histone H3).
- SEQ ID NO: 52 shows the cDNA sequence of HIST1H3I (a histone H3).
- SEQ ID NO: 53 shows the amino acid sequence of HIST1H3I (a histone H3).
- SEQ ID NO: 54 shows the cDNA sequence of HIST1H3J (a histone H3).
- SEQ ID NO: 55 shows the amino acid sequence of HIST1H3J (a histone H3).
- SEQ ID NO: 56 shows the cDNA sequence of HIST2H3A (a histone H3).
- SEQ ID NO: 57 shows the amino acid sequence of HIST2H3A (a histone H3).
- SEQ ID NO: 58 shows the cDNA sequence of HIST2H3C (a histone H3).
- SEQ ID NO: 59 shows the amino acid sequence of HIST2H3C (a histone H3).
- SEQ ID NO: 60 shows the cDNA sequence of HIST2H3C (a histone H3).
- SEQ ID NO: 61 shows the amino acid sequence of HIST2H3C (a histone H3).
- SEQ ID NO: 62 shows the cDNA sequence of H3F3A (a histone H3).
- SEQ ID NO: 63 shows the amino acid sequence of H3F3A (a histone H3).
- SEQ ID NO: 64 shows the cDNA sequence of H3F3B (a histone H3).
- SEQ ID NO: 65 shows the amino acid sequence of H3F3B (a histone H3).
- SEQ ID NO: 66 shows the cDNA sequence of human IDH1.
- H3K36 methylation is catalysed through the activities of eight distinct enzymes, in which seven (NSD1, NSD2, NSD3, SETMA , ASH1L, and SETD3) are responsible for H3K36 mono- and or di-methylation, while SETD2 uniquely catalyses the tri- methylation of H3K36 (Edmunds et al., 2008).
- H3K36 histone H3 at lysine 36
- Set2- dependent H3K36 di- and tri-methylation also prevents aberrant transcription by both preventing histone exchange over coding regions through suppressing H3K36 interaction with the histone chaperones Asfl, Spt6 and Sptl6 (Venkatesh et al, 2012), and by recruitment of the Iswlb chromatin remodelling complex (Smolle et al., 2012).
- SETD2 prevents intragenic transcription by promoting loading of the FACT (Facilitates Chromatin Transcription) complex and maintaining nucleosome occupancy in active genes, and SETD2 down-regulation leads to intragenic transcription in 1 1% of active genes (Carvalho et al., 2013).
- SETD2 may act as a tumour suppressor through preventing intragenic transcription initiation (Carvalho et al., 2013).
- IWS 1 an RNA processing regulator, is phosphorylated by Akt3 and Aktl at Ser720/Thr721. This allows IWS 1 to recruit SETD2 and create the H3K36me3 mark.
- H3K36me3 acts as a docking site for MRG15 and PTB, which in turn regulate FGFR-2 splicing, which controls tumor growth and invasiveness (Sanidas et al., 2014).
- LEDGF has recently been found to promote DNA-end resection and DSB repair by homologous recombination through recruiting C-terminal binding protein interacting protein (CtIP) to DSBs.
- CtIP C-terminal binding protein interacting protein
- MMR mismatch repair
- MSH6 was found to preferentially bind to H3K36me3 through its PWWP domain, and a role for SETD2 and this histone mark has been identified in regulating human mismatch repair through this interaction (Li et al., 2013; Vermeulen et al., 2010).
- the cancer treated in accordance with the invention comprises a decreased amount of H3K36me3 (i.e. a decreased amount of histone H3 tri-methylated at lysine 36).
- the cancer preferably comprises a decreased amount of H3K36me3 and an increased amount of H3K36me2 (i.e. an increased amount of histone H3 di-methylated at lysine 36).
- the cancer may comprise a decreased amount of H3K36me3 compared with normal cells of the same tissue type.
- the amount of H3K36me3 may be decreased compared with normal lung cells.
- the amount of H3K36me3 may be decreased by any amount.
- the amount of H3K36me3 may be decreased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared with the level of H3K36me3 in normal cells of the same type.
- the amount of H3K36me3 can be measured using known techniques.
- the amount of H3K36me3 can be measured using immunohistochemistry, western blotting, mass spectrometry or fluorescence- activated cell sorting (FACS). Suitable antibodies against H3K36me3 are available.
- the anti-histone H3 (tri methyl K36) antibody (ab9050) is available from Abeam®.
- surrogate markers of H3K36me3 loss could be used in certain disease indications, such as measuring increased levels of FGFR-2 transcript Illb vs IIIc (Luco et al.,2010). Any of the above methods may also be used to measure H3K36me2.
- the anti-histone H3 (di methyl K36) antibody (ab9049) is available from Abeam®.
- H3K36me3 disruption is observed in 54% pediatric high-grade glioma, and the main causing mutations are: SETD2, IDH1 or G34R/V-H3.3 (Fontebasso et al., 2013).
- the cancer treated in accordance with the invention is preferably glioma, more preferably high-grade glioma. More specific genotypes and phenotypes of the cancers treated in accordance with the invention are discussed below.
- the cancer which comprises a decreased amount of H3K36me3 is preferably a SETD2- deficient cancer.
- SETD2 is also known as Huntingtin-interacting protein B (HYPB).
- HYPB Huntingtin-interacting protein B
- SETD2 and HYPB are interchangeable.
- SETD2 human SET domain-containing 2
- HYPB Huntingtin- interacting protein B
- SETD2 was also found to be inactivated in clear cell renal cell carcinomas (ccRCC) (Duns et al., 2010), with systematic sequencing revealing SETD2 to be mutated in 8% of ccRCCs (Dalgliesh et al, 2010; Hakimi et al., 2013).
- ccRCC clear cell renal cell carcinomas
- HOGs pediatric high-grade gliomas
- SETD2 mutations have also been identified in a number of other cancer types including acute lymphoblastic leukaemia (Zhang et al., 2012), endometrium (2%), skin (2%), large intestine (2.5%), stomach (3%), lung (4%), and bladder (11%)
- the SETD2 gene is located on the short arm of chromosome 3 (3p21.31), spanning 147.57 Kb across 21 exons and encodes a protein of 2564 amino acids. Its cDNA sequence is shown in SEQ ID NO: 1.
- the SETD2 protein (SEQ ID NO: 2) contains a single WW domain, a triplicate AWS- SET-PostSET domain and a low charged region rich in glutamine and proline, characterized as a novel transcriptional activation domain (Rega et al., 2001). SETD2 is also predicted to tightly bind single-stranded DNA and RNA (Krajewski et al., 2005).
- SETD2 is observed within the nucleus and is collocated in nuclear speckles with huntingtin (HD) mutant protein, and is ubiquitously expressed throughout the body (Rega et al., 2001). Sequence analysis of SETD2 indicates that loss of function could be caused by various types of mutations, including missense, nonsense and frameshift mutations.
- SETD2 Despite its increasingly important role as a tumour suppressor, how loss of SETD2 may promote tumorigenesis is currently unclear. While the role of SETD2 in Huntingtons disease is uncertain, numerous other functions have been ascribed to SETD2, including regulating telomere function (Newbold and Mokbel, 2010); downregulating Mdm2 transcription (Xie et al., 2008), embryonic vascular remodeling and angiogenesis in mice (Hu et al., 2010); stem cell development and transcription regulation (Carvalho et al., 2013). However, the role of SETD2 is currently best understood through its evolutionarily conserved role as a histone H3 lysine 36 (H3K36) methyltransferase (Sun et al., 2005).
- H3K36 histone H3 lysine 36
- the invention preferably concerns the treatment of a SETD2-deficient cancer.
- a cancer is SETD2-deficient if the function of SETD2 in the cancer cells is decreased compared with SETD2 function in normal cells of the same tissue type.
- the function of SETD2 may be decreased by any amount. For instance, the function may be decreased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared with the level of SETD2 function in normal cells.
- a SETD2-deficient cancer preferably has a complete loss of SETD2 function (i.e. the function is decreased 100% compared with normal cells of the same tissue type).
- SETD2 function may be measured in any of the ways discussed below.
- SETD2 deficiency is typically caused by a mutation in the SETD2 gene.
- the Sanger Institute summarised the different types of mutations found in the SETD2 gene. As shown in Table 1, a decreased function of SETD2 may be caused by various mutations.
- the SETD2-deficient cancer may comprise a missense mutation. Missense mutations change the amino acid sequence of the SETD2 protein and thus can reduce the function of the SETD2 protein or abolish it altogether.
- the SETD2-deficient cancer may comprise a nonsense mutation. This leads to decay of mRNA and thus a reduction in SETD2 protein expression.
- the SETD2-deficient cancer may comprise a frameshift mutation.
- the frameshift mutation may be a deletion frameshift mutation or an insertion frameshift mutation. Both types of mutation can decrease the function of the SETD2 protein or abolish it altogether Some frameshift mutations can also introduce a pre-mature stop codon and lead to loss of SETD2 protein expression.
- the SETD2-deficient cancer may comprise a deletion inframe mutation. This mutation may also decrease the function of the SETD2 protein or abolish it altogether.
- the mutations discussed above are preferably homozygous.
- the SETD2-deficient cancer may lack the SETD2 gene.
- the SETD2 gene may be absent from the cancer.
- the mutation or absence of the SETD2 gene may be due to a chromosome 3 abnormality, such as chromosome 3p deletion or rearrangement.
- the SETD2- deficient cancer may therefore comprise a chromosome abnormality, such as chromosome 3p deletion or rearrangement.
- SETD2 deficiency may be due to mutations in other genes which affect the expression of the SETD2 protein, its stability or its ability to function. It will be clear from the above that mutations resulting in SETD2 deficiency may affect the expression of the SETD2 protein, its stability or its ability to function.
- the SETD2-deficient cancer may comprise a decreased amount of SETD2 protein, such as a decreased amount of SEQ ID NO: 2 or a polymorphism thereof.
- the SETD2-deficient cancer may comprise a decreased amount of SETD2 protein compared with normal cells of the same tissue type. The amount of the SETD2 protein may be decreased by any amount and in particular the % amounts discussed above in relation of SETD2 function.
- the SETD2-deficient cancer may comprise a SETD2 protein with decreased function.
- the SETD2-deficient cancer may comprise a SETD2 protein with decreased function compared with normal (i.e. wild-type or native) SETD2 protein, such as SEQ ID NO: 2 or a polymorphism thereof.
- the function of the SETD2 protein may be decreased by any amount and in particular the % amounts discussed above in relation of SETD2 function.
- the SETD2-deficient cancer may comprise SETD2 protein with no function (i.e. a lack of function or an abolished function).
- the function of SETD2 protein for instance its ability to catalyse the H3K36 di- to tri- methylation in human cells, can be assayed as discussed in more detail below.
- the SETD2- deficient cancer may comprise no SETD2 protein (i.e. may lack SETD2 protein).
- the SETD2-deficient cancer may comprise a decreased amount of SETD2 mRNA.
- the SETD2-deficient cancer may comprise a decreased amount of SETD2 mRNA compared with normal cells of the same tissue type.
- the amount of the SETD2 mRNA may be decreased by any amount and in particular the % amounts discussed above in relation of SETD2 function.
- the amount of SETD2 mRNA may be assayed as discussed in more detail below.
- the SETD2-deficient cancer preferably comprises (a) a decreased amount of SETD2 protein (such as a decreased amount of SEQ ID NO: 2 or a polymorphism thereof), (b) a decreased amount of SETD2 mRNA, (c) a mutation in SETD2 DNA (such as a mutation in SEQ ID NO: 1 or a polymorphism thereof) or (d) a chromosome 3 abnormality.
- the SETD2-deficient cancer may comprise any combination of (a) to (d).
- the SETD2-deficient cancer may comprise (a); (b); (c); (d); (a) and (b); (a) and (c); (a) and (d); (b) and (c); (b) and (d); (c) and (d); (a),(b) and (c); (a),(b) and (d); (a),(c) and (d); (b), (c) and (d); or (a), (b), (c) and (d).
- the mutation in (c) may be any of those discussed above.
- SETD2-deficient Before treatment in accordance with the invention, it is necessary to determine whether or not the cancer is SETD2-deficient. This can be done is several ways as discussed below. The presence of SETD2-deficiency indicates that the cancer is suitable for treatment using a WEE1 inhibitor or a CHK1 inhibitor or an ATR inhibitor in accordance with the invention.
- a decreased amount of SETD2 protein such as a decreased amount of SEQ ID NO: 2 or a polymorphism thereof
- a decreased amount of SETD2 mRNA such as a decreased amount of SETD2 mRNA
- a mutation in SETD2 DNA such as a mutation in SEQ ID NO: 2 or a polymorphism thereof
- a chromosome 3 abnormality in a cancer is typically indicative that the cancer is SETD2-deficient. All possible combinations are set out above. Conversely, the absence of any of (a) to (d) in a cancer is typically indicative that the cancer is not SETD2-deficient.
- the measurement of or the identification of a decreased amount of H3K36me3 is typically indicative that the cancer is SETD2-deficient. Conversely, the absence of a decreased amount of H3K36me3 in a cancer is typically indicative that the cancer is not SETD2-deficient.
- SETD2 deficiency can be measured using known techniques.
- the amount of SETD2 protein can be measured using immunohistochemistry, western blotting, mass spectrometry or fluorescence-activated cell sorting (FACS). These techniques may be used to measure the amount of human SETD2 (SEQ ID NO: 2 and polymorphisms thereof). Suitable antibodies for use in these techniques are discussed below with reference to the kits of the invention.
- the amount of SETD2 mRNA can be measured using quantitative reverse transcription polymerase chain reaction (qRT-PCR), such as real time qRT-PCR, northern blotting or microarrays. Mutations in SETD2 mRNA may be identified using RNA sequencing including next-generation sequencing.
- qRT-PCR quantitative reverse transcription polymerase chain reaction
- Mutations in the SETD2 gene may be identified using DNA sequencing including next-generation sequencing. This may also be done using Southern blotting, measuring copy-number variation and investigating SETD2 promoter methylation. These techniques may be used to identify mutations in the human SETD2 gene (SEQ ID NO: 1 and polymorphisms thereof).
- Chromosome 3 abnormalities such as chromosome 3p deletion or rearrangement, may be identified using cytogenetic analysis such as giemsa banding, fluorescence in situ hybridisation (FISH) or comparative genomic hybridization, such as array-comparative genomic hybridization (array CGH).
- cytogenetic analysis such as giemsa banding, fluorescence in situ hybridisation (FISH) or comparative genomic hybridization, such as array-comparative genomic hybridization (array CGH).
- FISH fluorescence in situ hybridisation
- array CGH array-comparative genomic hybridization
- the function of SETD2 can be determined by measuring the extent of H3K36 methylation. For instance, decreased amounts of H3K36me3 (which is the product of SETD2) can be measured using immunohistochemistry, western blotting, mass spectrometry and FACS. The same techniques may be used to measure an increased amount of H3K36me2.
- SETD2 deficiency is typically measured in a cancer biopsy obtained from the patient. Any of the methods discussed above may be carried on a cancer biopsy. Such methods may also be carried out on cancer cells circulating in the blood of the patient. The RNA methods may be carried out on urinary or blood exosomes. The DNA methods may be carried out on circulating free DNA in blood.
- a number of different cancers have been identified as being SETD2-deficient. These are summarised in Table 2. Any of these types of cancers may be treated in accordance with the invention. The invention is also suitable for treating any types of cancer that are identified as SETD2-deficient.
- SETD2-deficient cancer treated in accordance with the invention may be leukaemia, preferably early T-cell precursor acute lymphoblastic leukaemia.
- KDM4/JMJD2 family of histone demethylases contain a JmjN-JmjC domain, together with a tandem-6.1 domain that specifically removes the tri and di-methyl forms both H3K9 and H3K36, with preference for the trimethyl form being observed in the case of
- KDM4A JMJD2A (Couture et al., 2007; Hillringhaus et al., 2011; Klose et al., 2006; Whetstine et al., 2006).
- the cDNA sequences of KDM4A, KDM4B and KDM4C are shown in SEQ ID NOs: 30, 32 and 34 respectively.
- the amino acid sequences of of KDM4A, KDM4B and KDM4C are shown in SEQ ID NOs: 31, 33 and 35 respectively
- the cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises an increased amount of and/or an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof.
- the cancer more preferably comprises an increased amount of and an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof.
- the cancer may comprise an increased amount of and/or an increased activity of KDM4A; KDM4B; KDM4C; KDM4A and KDM4B; KDM4A and KDM4C; KDM4B and KDM4C; or KDM4A, KDM4B and KDM4C.
- the cancer may comprise an increased amount of and/or an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof compared with normal cells of the same tissue type.
- the amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be increased compared with normal lung cells.
- the amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be increased by any amount
- the amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be increased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared with the amount and/or activity in normal cells of the same type.
- the amount and/or activity of the different KDM4s may be increased to different degrees.
- KDM4A KDM4B and KDM4C All three Constituent proteins (KDM4A KDM4B and KDM4C) (all of which demethylate H3K36me3/2) are frequently overexpressed in various cancers, including breast, colorectal, lung and prostate (Berry and Janknecht, 2013). They are believed to be oncogenes. Further the Sanger COSMIC database identifies copy number gain of KDM4A, KDM4B and KDM4C (Table 3).
- Such copy number gain is associated with protein overexpression (cBioPortal) and poor prognosis.
- KDM4A is over-expressed in 46% of ovarian cancers and is significantly associated with reduced survival (median 691 days v.s. 1052 days) (Black et al., 2013).
- the cancer may comprise a mutation of the KDM4A gene and/or mRNA, a mutation of the KDM4B gene and/or mRNA, a mutation of the KDM4C gene and/or mRNA (such as a mutation in SEQ ID NO: 30, 32, 34 or a polymorphism thereof) or a combination thereof.
- the cancer may comprise a copy number gain of the KDM4A gene and/or mRNA, a copy number gain of the KDM4B gene and/or mRNA, a copy number gain of the KDM4C gene and/or mRNA (such as a copy number gain of SEQ ID NO: 30, 32 or 34 or a polymorphism thereof) or a combination thereof.
- the mutation in or copy number gain of KDM4A, KDM4B, KDM4C or a combination thereof may be due to a chromosome 3 abnormality, such as chromosome 3p deletion or rearrangement.
- the cancer may therefore comprise a chromosome abnormality, such as chromosome 3p deletion or rearrangement. This can be measured as discussed above.
- the increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be due to mutations in other genes which affect the expression of the KDM4A protein, KDM4B protein, KDM4C protein (such as SEQ ID NO: 31, 33 or 35 or a polymorphism thereof) or a combination thereof, its/their stability or its/their ability to function.
- the cancer may comprise an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof.
- the cancer may comprise an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof compared with normal cells of the same tissue type.
- the amount of the protein may be increased by any amount and in particular the % amounts discussed above.
- the cancer may comprise a KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof with increased function.
- the cancer may comprise a KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof with increased function compared with normal (i.e. wild-type or native) KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof (such as SEQ ID NO: 31, 33, 35, polymorphisms thereof or a combination thereof).
- the function of the KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof may be increased by any amount and in particular the % amounts discussed above.
- KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof for instance its/their ability to catalyse the H3K36 tri- to di-methylation in human cells, can be assayed as discussed in more detail above.
- the cancer may comprise an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof.
- the cancer may comprise an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof compared with normal cells of the same tissue type.
- the amount of the KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof may be increased by any amount and in particular the % amounts discussed above.
- the amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof may be assayed as discussed above for SETD2 mRNA.
- the cancer preferably comprises (a) an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof (such as an increased amount of SEQ ID NO: 31, 33, 35, polymorphisms thereof or a combination thereof), (b) an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof, (c) a mutation in KDM4A DNA, KDM4B DNA, KDM4C DNA or a combination thereof (such as a mutation in SEQ ID NO: 30, 32, 34, polymorphisms thereof or a combination thereof) or (d) a chromosome 3 abnormality.
- the cancer may comprise any combination of (a) to (d).
- the cancer may comprise (a); (b); (c); (d); (a) and (b); (a) and (c); (a) and (d); (b) and (c); (b) and (d); (c) and (d); (a),(b) and (c); (a),(b) and (c); (a),(c) and (d); (b), (c) and (d); or (a), (b), (c) and (d).
- the cancer Before treatment in accordance with the invention, it is necessary to determine whether or not the cancer comprises an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof. This can be done is several ways as discussed above with reference to SETD2.
- the presence of an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof indicates that the cancer is suitable for treatment using a WEE1 inhibitor or a CHK1 inhibitor or an ATR inhibitor in accordance with the invention.
- the measurement of or the identification of any combination of (a) an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof (such as an increased amount of SEQ ID NO: 31, 33, 35, polymorphisms thereof or a combination thereof), (b) an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof, (c) a mutation in KDM4A DNA, KDM4B DNA, KDM4C DNA or a combination thereof (such as a mutation in SEQ ID NO: 30, 32, 34, polymorphisms thereof or a combination thereof) or (d) a chromosome 3 abnormality is typically indicative that the cancer is suitable for treatment in accordance with the invention. All possible combinations are set out above. Conversely, the absence of any of (a) to (d) in a cancer is typically indicative that the cancer is not suitable for treatment in accordance with the invention.
- the measurement of or the identification of a decreased amount of H3K36me3 is typically indicative that the cancer comprises an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof
- the absence of or a decreased amount of H3K36me3 in a cancer is typically indicative that the cancer does not comprise an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof.
- KDM4A, KDM4B, KDM4C or a combination thereof is typically measured in a cancer biopsy obtained from the patient. This is also described above with reference to SETD2.
- the cancer treated in accordance with the invention is preferably colorectal cancer, prostate cancer, ovarian cancer, lung cancer, central nervous system (CNS) cancer, breast cancer, pancreatic cancer, large intestine cancer or kidney cancer.
- CNS central nervous system
- the cDNA sequences of the different versions of human histone H3 are shown in SEQ D NOs: 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62 and 64.
- the amino acid sequences of the different versions of human histone H3 are shown in SEQ ID NOs: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 and 65.
- the cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises a mutated histone H3 protein (such as a mutated SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65 or a polymorphism thereof) and/or a mutation in a histone H3 gene (such as a mutation in SEQ ID NO: 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64 or a polymorphism thereof).
- the cancer more preferably comprises a mutated histone H3 protein and a mutation in a histone H3 gene.
- the cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises a mutated histone H3.3 protein (such as a mutated SEQ ID NO: 63, 65 or a polymorphism thereof) and/or a mutation in a histone H3.3 gene (such as a mutation in SEQ ID NO: 62, 64 or a polymorphism thereof).
- the cancer more preferably comprises a mutated histone H3.3 protein and a mutation in a histone H3.3 gene.
- the mutation is preferably H3.3-K36M.
- the mutation is more preferably H3.3-G34R/V.
- the mutation H3.3-G34R/V is observed in glioma, such as high-grade glioma.
- Mutations in a histone H3 protein or a histone H3 gene can be determined using any of the techniques discussed above.
- the cDNA sequence of IDHl is shown in SEQ ID NO: 66. Mutations in the IDHl are observed in gliomas.
- the cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises a mutation in the IDHl gene (such as a mutation in SEQ ID NO: 66 or a polymorphism thereof).
- the mutation in the IDHl gene may manifest itself as a mutation in the IDHl protein (such as a mutation in SEQ ID NO: 67 or a polymorphism thereof).
- Mutations is the IDHl gene or in the IDHl protein can be determined using any of the techniques discussed above.
- the patient is typically human.
- the patient can be another animal or mammal, such as a commercially farmed animal, such as a horse, a cow, a sheep or a pig, or may alternatively be a pet, such as a cat, a dog or a hamster.
- WEE1 WEEl kinase delays entry into mitosis by negatively regulating the cyclin-dependent kinase through phosphorylation of CDK1 and CDK2 thus inhibiting CDK activity (Gould and Nurse, 1989; Parker and Pi wnica- Worms, 1992; Russell and Nurse, 1987; Watanabe et al., 1995).
- activated XCHK1 can phosphorylate XWEE1 kinase resulting in increased tyrosine 15 phosphorylation and CDK inhibition following CHKl activation (Harvey et al., 2005; Lee et al., 2001).
- WEEl also functions during DNA replication to directly regulate the Mus81-Emel endonuclease activity in human cells (Dominguez-Kelly et al., 2011). WEEl also phosphorylates histone H2B Tyr37, which suppresses expression of replication-dependent core histone genes (Mahajan et al., 2012). Deregulated CDK activity following inhibition of WEEl kinase induces replication stress and loss of genomic integrity through increased firing of replication origins and subsequent nucleotide shortage (Beck et al., 2012).
- CHKl activation promotes cell cycle arrest by promoting Cdc25 phosphatase inactivation and degradation, thereby restraining CDK activation (Peng et al., 1997; Sanchez et al., 1997; Sclafani and Holzen, 2007; Sorensen et al., 2003). CHKl activation also functions to prevent firing of late replication origins, premature chromosome condensation following disruption of replication, and also regulates transcriptional responses to DNA damage (Feijoo et al , 2001 ; Maya-Mendoza et al., 2007; Shimada et al., 2008; Syljuasen et al., 2005; Zachos et al., 2003).
- DDR DNA damage response
- ATM is activated by DSBs and is primarily responsible for activation of the CHK2 kinase (Ahn et al., 2004), while ATR senses single-stranded DNA (ssDNA) arising at stalled replication forks or at resected DNA double- strand breaks (Zou and Elledge, 2003) and primarily phosphorylates and activates CHKl kinase (Mordes and Cortez, 2008).
- ssDNA single-stranded DNA
- a WEEl inhibitor or a CHKl inhibitor or an ATR inhibitor is any molecule that reduces the function of WEEl or CHKl or ATR.
- the inhibitor may decrease the function of WEEl or CHKl or ATR by any amount. For instance, the function may be decreased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%.
- An inhibitor may abolish the function of WEEl or CHKl or ATR (i.e. the function is decreased by 100%).
- WEEl or CHKl or ATR function may be measured using known techniques.
- the extent to which an inhibitor affects its target kinase may be determined by measuring the function of the kinase in cells in the presence and absence of the inhibitor.
- the cells may be normal cells or may be cancer cells.
- the kinase activity of WEEl, CHKl or ATR can be measured by the amount of phosphorylation of their target by, for example, western blotting.
- WEEl inhibition leads to reduced CDK1 phosphorylation at Threonine 14 and Tyrosine 15.
- the CHKl inhibitor Go 6976 leads to increased phosphorylation of Ser345 or Ser317 on CHKl itself (Leung-Pineda et al., 2006).
- CHKl inhibitor AZD7762 leads to increased phosphorylation of Ser345 and decreased Ser296 on CHKl (Parsels et al., 201 1).
- ATR activity is tested by monitoring Chkl Ser345
- the inhibitor may affect the function of WEEl or CHKl or ATR in any manner.
- the inhibitor may decrease the amount of WEEl or CHKl or ATR, for instance by decreasing the expression of or increasing the degradation of WEEl or CHKl or ATR.
- the inhibitor may decrease the activity of WEEl or CHKl or ATR, for instance by binding to WEEl or CHKl or ATR or the molecule(s) which WEEl or CHKl or ATR phosphorylate(s).
- the inhibitor may be a competitive inhibitor (which binds the active site of the molecule to which it binds) or an allosteric inhibitor (which does not bind the active site of the molecule to which it binds).
- the inhibitor may be reversible.
- the inhibitor may be irreversible.
- the inhibitor may decrease the production of or expression of WEEl or CHKl or ATR.
- the inhibitor may decrease the transcription of WEEl or CHKl or ATR.
- the inhibitor may disrupt the DNA of WEEl or CHKl or ATR, for instance by site-specific mutagenesis using methods such as Zinc-finger nucleases.
- the inhibitor may decrease the mR A level of WEEl or CHKl or ATR or interfere with the processing of WEEl or CHKl or ATR mRNA, for instance by antisense RNA or RNA interference. This is discussed in more detail below.
- the inhibitor may increase protein degradation of WEEl or CHKl or ATR.
- the inhibitor may increase the level of natural inhibitors of WEEl or CHKl or ATR.
- the inhibitor may decrease the function of WEEl or CHKl or ATR by inhibitory phosphorylation, ubiquitylation, sumoylation or the like.
- the inhibitor is preferably a small molecule inhibitor, a protein, an antibody, a polynucleotide, an oligonucleotide, an antisense RNA, small interfering RNA (siRNA) or small hairpin RNA (shRNA).
- small molecule inhibitors preferably a small molecule inhibitor, a protein, an antibody, a polynucleotide, an oligonucleotide, an antisense RNA, small interfering RNA (siRNA) or small hairpin RNA (shRNA).
- MK-1775 shows activity against sarcoma cells in vitro as a single agent or combined with Gemcitabine (Kreahling et al., 2013) and also shows antitumour activity when combined with cytotoxic agents in non-small cell lung carcinomas (Murrow et al., 2010; Yoshida et al., 2004), breast (Murrow et al., 2010), prostate (Kiviharju-af Hallstrom et al., 2007), pancreatic (Rajeshkumar et al., 2011), ovarian (Mizuarai et al., 2009) and colon cancers (Hirai et al., 2010).
- the WEEl inhibitor is preferably MK-1775 (whose structure is shown in Fig 1 1).
- CHK1 has been targeted using a number of small molecule inhibitors.
- Go 6976 initially used as a protein kinase C inhibitor, also acts as a potent inhibitor of CHK1 and CHK2 resulting in abrogation of DNA damage -induced S- and G2 cell cycle checkpoints (Jia et al., 2009; Kohn et al., 2003).
- Go 6976 has a synergistic cytotoxic effect when combined with a number of DNA damaging agents including doxorubicin and paclitaxel, radiotherapy, and Cisplatin (Aaltonen et al., 2007; Feng et al., 2010; Thompson et al., 2012).
- LYS2603618 is a potent and selective inhibitor of CHK1 and has recently been found to show acceptable safety and pharmacokinetic profiles when administered after the DNA damaging anti-metabolite pemetrexed (Weiss et al., 2013).
- AZD7762 has also been shown to be a potent ATP-competitive CFD 1 kinase inhibitor which results in the abrogation of DNA damage-induced cell cycle arrest (Zabludoff et al., 2008). This is currently being evaluated in clinical trials either alone or in combination with chemotherapeutic agents and ionizing radiation (Ma et al., 201 1).
- the CFIK1 inhibitor is preferably AZD7762, LY2603618 (IC-83) or Go 6976 (whose structures are shown in Fig 11).
- VE- 821 a selective small molecule inhibitor of ATR has recently been shown to selectively sensitize pancreatic cancer cells and hypoxic cancer cells to radiation (Pires et al., 2012; Prevo et al., 2012) (reviewed in (Fokas et al., 2013)).
- AZ20 another ATR inhibitor has shown antitumour effect in xenograft models (Foote et al., 2013).
- the ATR inhibitor is preferably VE-821 or AZ20.
- the structure of VE-821 is shown in Fig 11.
- the inhibitor of WEEl or CHK1 or ATR may be a protein.
- the inhibitor is preferably a non-functional form of WEEl or CFD 1 or ATR, such as dominant-negative or an enzyme-dead protein which prevents the function of the wild type protein.
- a non-functional form of WEEl or CHKl or ATR will compete with native (i.e. wild-type) WEE1 or CHKl or ATR in the cancer cells and reduce WEE1 or CHKl or ATR function.
- the amino acid sequence of human WEE1 (isoform 1) is shown in SEQ ID NO: 5.
- the amino acid sequence of isoform 2 of human WEE1 is shown in SEQ ID NO: 7.
- the amino acid sequence of human CHKl (isoform 1) is shown in SEQ ID NO: 10.
- the amino acid sequence of the shorter isoform of human CHKl is shown in SEQ ID NO: 13.
- the amino acid sequence of human ATR is shown in SEQ ID NO: 16.
- the inhibitor is preferably a non-functional variant of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof.
- a non-functional variant is a protein that has an amino acid sequence which varies from that of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof and does not have the ability to function as WEE1 or CHKl or ATR.
- the variant may have one or more mutations in the active site of the kinase.
- the ability of a variant to function as WEE1 or CHKl or ATR can be assayed using any method known in the art. Suitable methods are described above.
- a non-functional variant of SEQ ID NO: 5 preferably comprises a substitution at position K328 and more preferably comprises the substitution K328R (McGowan and Russell, 1993).
- a non- functional variant of SEQ ID NO: 7 may comprise corresponding substitutions.
- a non-functional variant of SEQ ID NO: 10 preferably comprises a substitution at one or more of the following positions K38 (Heffernan et al, 2002), D130 (Sanchez et al, 1997) R372 (Zhang et al., 2009), R376 (Zhang et al., 2009) and R379 (Zhang et al., 2009).
- a non-functional variant of SEQ ID NO: 10 more preferably comprises one or more of the following substitutions K38R, D130A, R372E, R376E and R379E.
- a non-functional variant of SEQ ID NO: 13 may comprise corresponding substitutions.
- a non-functional variant of SEQ ID NO: 16 preferably comprises a substitution at one or more of the following positions K2327 (Tibbetts et al, 1999), D2475 (Cliby et al, 1998) and D2494 (Wright et al., 1998).
- a non-functional variant of SEQ ID NO: 16 preferably comprises one or more of the following substitutions K2327R, D2475A and D2494E.
- a dominant-negative variant of SEQ ID NO: 16 preferably comprises a truncating mutation in exon 10 of ATR (Lewis et a! ., 2005) .
- the variant may be a naturally occurring variant which is expressed naturally, for instance in humans.
- the variant may be expressed in vitro or recombinantly by a bacterium such as Escherichia coli.
- Variants also include non-naturally occurring variants produced by recombinant technology.
- a variant will preferably be at least 80% homologous to that sequence based on amino acid identity. More preferably, the variant may be at least 85%, at least 90% and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NOs: 5, 7, 10, 13 or 16 or any isoform thereof over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95%, amino acid identity over a stretch of 200 or more, for example 300, 400, 500, 600, 700, 800, 1000, 1500 or 2000 or more, contiguous amino acids ("hard homology").
- Standard methods in the art may be used to determine homology.
- the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al (1984) Nucleic Acids Research 12, p387- 395).
- the PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S.F et al (1990) J Mol Biol 215 :403-10.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information
- Amino acid substitutions may be made to the amino acid sequences of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof, for example up to 1, 2, 3, 4, 5, 10, 20, 30, 50, 100 or 200 substitutions.
- Conservative substitutions replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side-chain volume.
- the amino acids introduced may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge to the amino acids they replace.
- the conservative substitution may introduce another amino acid that is aromatic or aliphatic in the place of a pre-existing aromatic or aliphatic amino acid.
- Conservative amino acid changes are well-known in the art and may be selected in accordance with the properties of the 20 main amino acids as defined in Table 4 below. Where amino acids have similar polarity, this can also be determined by reference to the hydropathy scale for amino acid side chains in Table 5.
- One or more amino acid residues of the amino acid sequence of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof may additionally be deleted from the polypeptides described above. Up to 1, 2, 3, 4, 5, 10, 20, 30 or 50 residues may be deleted, or more.
- Variants may include fragments of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof. Such fragments typically retain the kinase domain of 5, 7, 10, 13 or 16 or any isoform thereof but are non-fUnctional. Fragments may be at least 600, 700, 800 or 900 amino acids in length. One or more amino acids may be alternatively or additionally added to the polypeptides described above.
- the inhibitor may be a polynucleotide encoding a non-functional variant of WEE1 or CHKl or ATR.
- the non- functional variant may be any of those discussed above.
- a polynucleotide such as a nucleic acid, is a polymer comprising two or more nucleotides.
- the nucleotides can be naturally occurring or artificial.
- a nucleotide typically contains a nucleobase, a sugar and at least one linking group, such as a phosphate, 2'O-methyl, 2' methoxy-ethyl, phosphoramidate, methylphosphonate or phosphorothioate group.
- the nucleobase is typically heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines and more specifically adenine (A), guanine (G), thymine (T), uracil (U) and cytosine (C).
- the sugar is typically a pentose sugar.
- Nucleotide sugars include, but are not limited to, ribose and deoxyribose.
- the nucleotide is typically a ribonucleotide or deoxyribonucleotide.
- the nucleotide typically contains a monophosphate, diphosphate or triphosphate. Phosphates may be attached on the 5' or 3' side of a nucleotide.
- Nucleotides include, but are not limited to, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), 5-methylcytidine monophosphate, 5- methylcytidine diphosphate, 5-methylcytidine triphosphate, 5-hydroxymethylcytidine monophosphate, 5-hydroxymethylcytidine diphosphate, 5-hydroxymethylcytidine triphosphate, cyclic
- dATP deoxyadenosine triphosphate
- dGMP deoxyguanosine monophosphate
- deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), deoxyuridine triphosphate (dUTP), deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP), 5-methyl-2'-deoxycytidine monophosphate, 5- methyl-2' -deoxycytidine diphosphate, 5 -methyl-2' -deoxycytidine triphosphate, 5- hydroxymethyl-2' -deoxycytidine monophosphate, 5-hydroxymethyl-2'-deoxycytidine diphosphate and 5-hydroxymethyl-2'-deoxycytidine triphosphate.
- the nucleotides are preferably selected from AMP, TMP, GMP, UMP, dAMP, dTMP, dGMP or dCMP.
- the nucleotides may contain additional modifications.
- suitable modified nucleotides include, but are not limited to, 2'amino pyrimidines (such as 2'-amino cytidine and 2'-amino uridine), 2'-hyrdroxyl purines (such as , 2'-fluoro pyrimidines (such as 2'- fluorocytidine and 2'fluoro uridine), hydroxyl pyrimidines (such as 5'-a-P-borano uridine), 2'- O-methyl nucleotides (such as 2'-0-methyl adenosine, 2'-0-methyl guanosine, 2'-0-methyl cytidine and 2'-0-methyl uridine), 4'-thio pyrimidines (such as 4'
- One or more nucleotides in the polynucleotide can be oxidized or methylated.
- One or more nucleotides in the polynucleotide may be damaged.
- the polynucleotide may comprise a pyrimidine dimer. Such dimers are typically associated with damage by ultraviolet light.
- the nucleotides in the polynucleotide may be attached to each other in any manner.
- the nucleotides may be linked by phosphate, 2'0-methyl, 2' methoxy-ethyl, phosphoramidate, methylphosphonate or phosphorothioate linkages.
- the nucleotides are typically attached by their sugar and phosphate groups as in nucleic acids.
- the nucleotides may be connected via their nucleobases as in pyrimidine dimers.
- the polynucleotide can be a nucleic acid, such as deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA).
- the polynucleotide may be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), morpholino nucleic acid or other synthetic polymers with nucleotide side chains.
- PNA peptide nucleic acid
- GMA glycerol nucleic acid
- TAA threose nucleic acid
- LNA locked nucleic acid
- morpholino nucleic acid or other synthetic polymers with nucleotide side chains.
- the polynucleotide may be single stranded or double stranded.
- the polynucleotide sequence preferably comprises a variant of SEQ ID NO: 3, 4, 6, 8, 9, 11, 12, 14 or 15 or any isoform thereof with at least 80%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% homology based on nucleotide identity over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95% nucleotide identity over a stretch of 600 or more, for example 900, 1200, 1500, 1800, 2100, 2400, 3000, 4500 or 6000 or more, contiguous nucleotides ("hard homology"). Homology may be calculated as described above.
- the polynucleotide sequence may comprise a sequence that differs from SEQ ID NO: 3, 4, 6, 8, 9, 11, 12, 14 or 15 or any isoform thereof on the basis of the degeneracy of the genetic code.
- Polynucleotide sequences may be derived and replicated using standard methods in the art, for example using PCR involving specific primers. It is straightforward to generate polynucleotide sequences using such standard techniques.
- the amplified sequences may be incorporated into a recombinant replicable vector such as a cloning vector.
- the vector may be used to replicate the polynucleotide in a compatible host cell.
- polynucleotide sequences may be made by introducing the polynucleotide into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
- the vector may be recovered from the host cell. Suitable host cells for cloning of polynucleotides are known in the art and described in more detail below.
- the polynucleotide sequence may be cloned into any suitable expression vector.
- the polynucleotide sequence encoding a construct is typically operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell.
- Such expression vectors can be used to express a construct.
- operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
- a control sequence "operably linked' to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. Multiple copies of the same or different polynucleotide may be introduced into the vector.
- the expression vector may then be introduced into a suitable host cell.
- a construct can be produced by inserting a polynucleotide sequence encoding a construct into an expression vector, introducing the vector into a compatible bacterial host cell, and growing the host cell under conditions which bring about expression of the polynucleotide sequence.
- the vectors may be for example, plasmid, virus or phage vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide sequence and optionally a regulator of the promoter.
- the vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene. Promoters and other expression regulation signals may be selected to be compatible with the host cell for which the expression vector is designed. A T7, trc, lac, ara or ⁇ , promoter is typically used.
- the host cell typically expresses the construct at a high level. Host cells transformed with a polynucleotide sequence encoding a construct will be chosen to be compatible with the expression vector used to transform the cell.
- the host cell is typically bacterial and preferably E. coll Any cell with a ⁇ DE3 lysogen, for example C41 (DE3), BL21 (DE3), JM109 (DE3), B834 (DE3), TUNER, Origami and Origami B, can express a vector comprising the T7 promoter.
- Inhibitors of WEE1 or CHK1 or ATR may also reduce amounts of WEE1 or CHK1 or ATR present in the patient, for example by knocking down expression of WEE1 or CHK1 or ATR.
- Antisense and RNA interference (RNAi) technology for knocking down protein expression are well known in the art and standard methods can be employed to knock down expression of WEE1 or CHK1 or ATR.
- Antisense oligonucleotides interfere with mRNA by binding to (hybridising with) a section of the mRNA.
- the antisense oligonucleotide is therefore designed to be complementary to the mRNA (although the oligonucleotide does not have to be 100% complementary as discussed below).
- the antisense oligonucleotide may be a section of the cDNA.
- the oligonucleotide sequence may not be 100% identical to the cDNA sequence. This is also discussed below.
- RNAi involves the use of double-stranded RNA, such small interfering RNA (siRNA) or small hairpin RNA (shRNA), which can bind to the mRNA and inhibit protein expression.
- siRNA small interfering RNA
- shRNA small hairpin RNA
- the inhibitor preferably comprises an oligonucleotide which specifically hybridises to a part of SEQ ID NO: 4, 6, 9, 12 or 15 (WEEJ or CHK1 or ATR mRNA) or any isoform thereof.
- Oligonucleotides are short nucleotide polymers which typically have 50 or fewer nucleotides, such 40 or fewer, 30 or fewer, 22 or fewer, 21 or fewer, 20 or fewer, 10 or fewer or 5 or fewer nucleotides.
- the oligonucleotide used in the invention is preferably 20 to 25 nucleotides in length, more preferably 21 or 22 nucleotides in length.
- the nucleotides can be naturally occurring or artificial.
- the nucleotides can be any of those described above.
- An oligonucleotide preferably specifically hybridises to a part of a SEQ ID NO: 4, 6, 9, 12 or 15 or any isoform thereof, hereafter called the target sequence.
- the length of the target sequence typically corresponds to the length of the oligonucleotide
- a 21 or 22 nucleotide oligonucleotide typically specifically hybridises to a 21 or 22 nucleotide target sequence.
- the target sequence may therefore be any of the lengths discussed above with reference to the length of the oligonucleotide.
- the target sequence is typically consecutive nucleotides within the target polynucleotide.
- An oligonucleotide “specifically hybridises” to a target sequence when it hybridises with preferential or high affinity to the target sequence but does not substantially hybridise, does not hybridise or hybridises with only low affinity to other sequences.
- An oligonucleotide “specifically hybridises” if it hybridises to the target sequence with a melting temperature (T m ) that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C or at least 10 °C, greater than its T m for other sequences.
- T m melting temperature
- the oligonucleotide hybridises to the target sequence with a T m that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its T m for other nucleic acids.
- the portion hybridises to the target sequence with a T m that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its T m for a sequence which differs from the target sequence by one or more nucleotides, such as by 1, 2, 3, 4 or 5 or more nucleotides.
- the portion typically hybridises to the target sequence with a T m of at least 90 °C, such as at least 92 °C or at least 95 °C.
- T m can be measured experimentally using known techniques, including the use of DNA microarrays, or can be calculated using publicly available T m calculators, such as those available over the internet.
- Hybridisation can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaCl and 1 % SDS (sodium dodecyl sulfate) at 37 °C followed by a 20 wash in from IX (0.1650 M Na + ) to 2X (0.33 M Na + ) SSC (standard sodium citrate) at 50 °C.
- a buffered solution of 30 to 35% formamide, 1 M NaCl and 1 % SDS (sodium dodecyl sulfate) at 37 °C followed by a 20 wash in from IX (0.1650 M Na + ) to 2X (0.33 M Na + ) SSC (standard sodium citrate) at 50 °C.
- Hybridisation can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaCl, and 1 % SDS at 37 °C, followed by a wash in from 0.5X (0.0825 M Na + ) to IX (0.1650 M Na + ) SSC at 55 °C.
- Hybridisation can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 M NaCl, 1% SDS at 37 °C, followed by a wash in 0. IX (0.0165 M Na + ) SSC at 60 °C.
- the oligonucleotide may comprise a sequence which is substantially complementary to the target sequence. Typically, the oligonucleotides are 100% complementary. However, lower levels of complementarity may also be acceptable, such as 95%, 90%, 85% and even 80%. Complementarity below 100% is acceptable as long as the oligonucleotides specifically hybridise to the target sequence. An oligonucleotide may therefore have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mismatches across a region of 5, 10, 15, 20, 21, 22, 30, 40 or 50 nucleotides.
- the inhibitor preferably comprises an oligonucleotide which comprises 50 or fewer consecutive nucleotides from (a) SEQ ID NO: 3, 8, 11 or 14 ⁇ WEE1 or CHK1 or A TR cDNA) or any isoform thereof or (b) a variant sequence which has at least 95%, such as at least 97%, at least 98% or at least 99%, homology to SEQ ID NO: 3, 8, 11 or 14 or any isoform thereof based on nucleotide identity over the entire sequence.
- the oligonucleotide may be any of the lengths discussed above. It is preferably 21 or 22 nucleotides in length.
- oligonucleotide may comprise any of the nucleotides discussed above, including the modified nucleotides.
- the oligonucleotide can be a nucleic acid, such as any of those discussed above.
- the oligonucleotide is preferably RNA.
- the oligonucleotide may be single stranded.
- the oligonucleotide may be double stranded.
- the oligonucleotide may compirse a hairpin.
- Oligonucleotides may be synthesised using standard techniques known in the art.
- oligonucleotides may be purchased. Suitable sources are shown in Table 6.
- the WEE1 inhibitor or CHK1 inhibitor or ATR inhibitor is administered to the patient.
- An inhibitor of WEE1 or CHK1 or ATR may be administered to the patient in any appropriate way.
- the inhibitor may be administered in a variety of dosage forms. Thus, it can be administered orally, for example as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules. It may also be administered byenteral or parenteral routes such as via buccal, anal, pulmonary, intravenous, intra-arterial, intramuscular, intraperitoneal, intraarticular, topical or other appropriate administration routes.
- the inhibitor may be administered directly into the cancer to be treated. A physician will be able to determine the required route of administration for each particular patient.
- an inhibitor will depend upon factors such as the nature of the exact inhibitor, etc.
- An inhibitor may be formulated for simultaneous, separate or sequential use with other inhibitors defined herein or with other cancer treatments as discussed in more detail below.
- An inhibitor is typically formulated for administration with a pharmaceutically acceptable carrier or diluent.
- the pharmaceutical carrier or diluent may be, for example, an isotonic solution.
- solid oral forms may contain, together with the active substance, diluents, e.g. lactose, dextrose, saccharose, cellulose, corn starch or potato starch; lubricants, e.g. silica, talc, stearic acid, magnesium or calcium stearate, and/or polyethylene glycols; binding agents; e.g. starches, gum arabic, gelatin, methylcellulose, carboxymethylcellulose or polyvinyl pyrrolidone; disaggregating agents, e.g.
- Liquid dispersions for oral administration may be syrups, emulsions or suspensions.
- the syrups may contain as carriers, for example, saccharose or saccharose with glycerine and/or mannitol and/or sorbitol.
- Suspensions and emulsions may contain as carrier, for example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol.
- the suspensions or solutions for intramuscular injections may contain, together with the active substance, a pharmaceutically acceptable carrier, e.g. sterile water, olive oil, ethyl oleate, glycols, e.g. propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride.
- Solutions for intravenous administration or infusion may contain as carrier, for example, sterile water or preferably they may be in the form of sterile, aqueous, isotonic saline solutions.
- binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1% to 2%.
- Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the pharmaceutical composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. a suspension. Reconstitution is preferably effected in buffer.
- Capsules, tablets and pills for oral administration to an individual may be provided with an enteric coating comprising, for example, Eudragit "S”, Eudragit "L”, cellulose acetate, cellulose acetate phthalate or hydroxypropylmethyl cellulose.
- Polynucleotide or oligonucleotide inhibitors maybe naked nucleotide sequences or be in combination with cationic lipids, polymers or targeting systems. They may be delivered by any available technique.
- the polynucleotide or oligonucleotide may be introduced by needle injection, preferably intradermally, subcutaneously or intramuscularly.
- the polynucleotide or oligonucleotide may be delivered directly across the skin using a delivery device such as particle-mediated gene delivery.
- the polynucleotide or oligonucleotide may be administered topically to the skin, or to mucosal surfaces for example by intranasal, oral, or intrarectal administration.
- Uptake of polynucleotide or oligonucleotide constructs may be enhanced by several known transfection techniques, for example those including the use of transfection agents.
- transfection agents include cationic agents, for example, calcium phosphate and DEAE- Dextran and lipofectants, for example, lipofectam and transfectam.
- the dosage of the polynucleotide or oligonucleotide to be administered can be altered.
- a therapeutically effective amount of the inhibitor is typically administered to the patient.
- a therapeutically effective amount of is an amount effective to ameliorate one or more symptoms of the cancer.
- a therapeutically effective amount of the immunotherapy is preferably an amount effective to abolish one or more of, or preferably all of, the symptoms of the cancer.
- a therapeutically effective amount preferably leads to a reduction in the size of the cancer or more preferably kills all of the cancer cells.
- the dose may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular patient.
- a typical daily dose is from about 0.1 to 50 mg per kg of body weight, according to the activity of the specific inhibitor, the age, weight and conditions of the subject to be treated and the frequency and route of administration.
- the dose may be provided as a single dose or may be provided as multiple doses, for example taken at regular intervals, for example 2, 3 or 4 doses administered hourly.
- dosage levels of inhibitors are from 5 mg to 2 g.
- polynucleotide or oligonucleotide inhibitors are administered in the range of 1 pg to 1 mg, preferably to 1 pg to 10 ⁇ g nucleic acid for particle mediated delivery and 10 ⁇ g to 1 mg for other routes.
- the inhibitor may be used in combination with one or more other therapies intended to treat the same patient.
- a combination is meant that the therapies may be administered simultaneously, in a combined or separate form, to the patient.
- the therapies may be
- an inhibitor may be used in combination with another therapy intended to treat the cancer.
- the other therapy may be a general therapy aimed at treating or improving the condition of the patient.
- treatment with methotrexate, glucocorticoids, salicylates, nonsteroidal anti-inflammatory drugs (NSAIDs), analgesics, other DMARDs, aminosalicylates, corticosteroids, and/or immunomodulatory agents e.g., 6-mercaptopurine and azathioprine
- the other therapy may be a specific treatment directed at the cancer suffered by the patient, or directed at a particular symptom of the cancer.
- the inhibitor may be used in combination with chemotherapy, radiation therapy and surgery.
- the inhibitor may also be used in combination with other cancer drugs.
- Preferred combinations for use in the invention include, but are not limited to, (a) Go 6976 in combination with doxorubicin , paclitaxel, radiotherapy, or Cisplatin, (b) LYS2603618 in combination with pemetrexed, (c) AZD7762 in combination with a chemotherapeutic agent or ionizing radiation or (d) MK-1775 in combination with Gemcitabine and other cytotoxic agents.
- the present invention also relates to a kit for treating cancer.
- the kit comprises a means (or reagent) for testing whether or not the cancer comprises a decreased amount of H3K36me3 and an inhibitor of WEE 1 or CHKl or ATR.
- the kit thereby allows the determination of whether or not cancers comprise a decreased amount of H3K36me3 and the subsequent treatment of such cancers using a WEE1 or CHKl or ATR inhibitor.
- the means (or reagent) for testing for whether or not the cancer comprises a decreased amount of H3K36me3 may be any suitable means or reagent for the use in the screening methods described above.
- the reagent is typically capable of detecting and/or measuring amounts of H3K36me3, SETD2 DNA, SETD2 mRNA, SETD2 protein, SETD2 modification (such as phosphorylation, ubiquitination, sumoylation), KDM4A, B or C DNA, KDM4 A, B or C mRNA, KDM4 A, B or C protein, KDM4 A, B or C modification (such as phosphorylation, ubiquitination, sumoylation), histone H3 DNA, histone H3 mRNA, histone H3 protein, IDHl DNA, IDHl mRNA, IDHl protein and/or detecting possible mutations therein.
- the kit may include antibodies that specifically bind to H3K36me3, SETD2, KDM4 A, B or C, a histone H3 or IDHl
- the kit may include any combination of such antibodies, such as antibodies that specifically bind H3K36me3 and SETD2.
- the kit preferably includes an antibody that specifically binds human H3K36me3, human SETD2, human KDM4 A, B or C, a human histone H3, human IDHl or a polymorphism thereof, i.e.
- the kit may include an antibody that specifically binds modified or mutated SETD2, modified or mutated KDM4 A, modified or mutated KDM4 B, modified or mutated KDM4 C, a modified or mutated histone H3 or a modified or mutated IDHl .
- the kit may further comprise means (or reagent) for testing whether or not the cancer comprises an increased amount of H3K36me2, such as an antibody that specifically binds H3K36me2.
- the kit may comprise an antibody which specifically binds human histone H3, i.e. SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when di-methylated at lysine 36 or a polymorphism thereof.
- An antibody "specifically binds" to a protein when it binds with preferential or high affinity to that protein but does not substantially bind, does not bind or binds with only low affinity to other proteins.
- an antibody “specifically binds" to SEQ ID NO: 2 or a polymorphism thereof when it binds with preferential or high affinity to SEQ ID NO: 2 or a polymorphism thereof but does not substantially bind, does not bind or binds with only low affinity to other human proteins.
- SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when tri-methylated at lysine 36 SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when di-methylated at lysine 36, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 67 or a polymorphism thereof.
- An antibody binds with preferential or high affinity if it binds with a Kd of 1 x 10-7 M or less, more preferably 5 x 10-8 M or less, more preferably 1 x 10-8 M or less or more preferably 5 x 10-9 M or less.
- An antibody binds with low affinity if it binds with a Kd of 1 x 10-6 M or more, more preferably l x l 0-5 M or more, more preferably l x l 0-4 M or more, more preferably 1 x 10-3 M or more, even more preferably 1 x 10-2 M or more.
- the antibody may be, for example, a monoclonal antibody, a polyclonal antibody, a single chain antibody, a chimeric antibody, a CDR-grafted antibody or a humanized antibody.
- the antibody may be an intact immunoglobulin molecule or a fragment thereof such as a Fab, F(ab') 2 or Fv fragment.
- the kit may comprise an oligonucleotide which specifically hybridises to part of SETD2 DNA, KDM4 A, B or C DNA, H3.3 DNA or IDH1 DNA.
- the kit preferably comprises an oligonucleotide which specifically hybridises to part of human SETD2 cDNA, human KDM4 A, B or C DNA, human H3.3 DNA or human IDH1 DNA, such as SEQ ID NO: 1, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66 or a polymorphism thereof.
- oligonucleotides may be used to detect and/or measure amounts of SETD2 DNA, KDM4 A, B or C DNA, histone H3 DNA or IDH1 DNA and possible mutations therein. Oligonucleotides, parts and specific hybridisation are discussed above.
- the kit also comprises a WEE1 inhibitor or CHK1 inhibitor or ATR inhibitor.
- the inhibitor may be any of those discussed above.
- the kit may additionally comprise one or more other reagents or instruments which enables the method mentioned above to be carried out.
- reagents include means for taking a sample from the patient, suitable buffers, means to extract/isolate H3K36me3, H3K36me2, SETD2, KDM4 A, B or C, H3.3, histone H3 or IDH1 from the sample or a support comprising wells on which quantitative reactions can be done.
- the kit may, optionally, comprise instructions to enable the kit to be used in the method of invention or details regarding patients on which the method may be carried out.
- the kit may comprise primers and reagents for PCR, qPCR (quantitative PCR), RT-PCR (reverse-transcription PCR), qRT-PCR (quantitative reverse- transcription PCR) reaction or R A sequencing.
- U20S a cell line derived from osteosarcoma was obtained from American Type Culture Collection ATCC (ATCC number HTB-96).
- A-498 ATCC number HTB-44
- U20S and A498 were grown in DMEM (Dulbecco) cell culture medium supplemented with 10% FCS and antibiotics. Both cell lines were routinely mycoplasma tested and found to be negative.
- DMSO Dimethyl sulfoxide
- Equal numbers of cells were seeded in each well 24 hours prior to inhibitors treatment; DMSO (solvent for inhibitors) was used as a negative control. 3 days after addition of inhibitors, the medium was replaced by fresh medium without drugs. 5 days after addition of inhibitors, the medium was removed and fresh media containing Resazurin was added to each well.
- Resazurin is a nonfluorescent dye, which can be converted (by redox reaction) to a red fluorescent resorufin by living cells.
- the fluorescent signal is proportional to the number of living cells, and was measured by a fluorescence plate reader (BMG Labtech).
- U20S or A498 cells were transfected with specific siRNAs targeting genes as indicated in the Table below in suspension by RNAiMax (Invitrogen) according to the manufactures instructions. Medium was replaced 24 hours after transfection.
- SETD2 #3 GAAACCGUCUCCAGUCUGU (SEQ ID NO: 28) Thermo Scientific
- lysis buffer 50 mM Tris HC1 pH7.5, 150 mM NaCL, 1 % Triton X- 100, supplemented with protease/phosphatase inhibitors
- Antibodies used were HYPB (Abeam) and Tubulin. Proteins levels were detected using BM Chemiluminescence substrate (Roche).
- SETD2 protein in SETD2-deficient cells For re-expression of SETD2 protein in SETD2-deficient cells (A498), wild-type full length SETD2 cDNA was purchased from Source Bioscience and inserted into pcDNA6.1 mammalian expression plasmid (Invitrogen). After verification by sequencing, the plasmid was transfected into A498 cells using X-tremeGENE HP DNA transfection reagent (Roche) according to the manufactures instruction. An empty plasmid containing green fluorescent protein was used as control. 48 hours after transfection, cells were challenged with inhibitors for 48 hours and analysed for apoptosis. Results
- SETD2-deficient cells are hypersensitive to WEE1 inhibition
- siRNA targeting was used to knock down SETD2 in U20S cells for 48 hours (Fig 3A) and subsequently exposed to continuous MK-1775 treatment.
- SETD2 knockdown with siRNAs #3 and #5 showed a striking loss of viability following exposure to 300nM MK-1775 compared to non-targeted siRNA control (Fig 3B).
- Clonogenic survival experiment indicated a striking increase in U20S cell sensitivity to MK-1775 when SETD2 was knocked down with siRNA#3, or siRNA#5, compared to the non-targeted siRNA control (Fig 3C).
- a corresponding increase in the levels of apoptotic cells was observed following treatment with MK-1775 (Fig 3D).
- A498 cells treated with MK-1775 a SETD2 cDNA was transiently expressed in A498 cells and cells were again challenged with MK-1775.
- A498 cells complemented with SETD2 exhibited increased survival and reduced levels of apoptosis compared to those transfected with empty vector alone when treated with MK-1775, consistent with loss of SETD2 being the cause of MK-1775 sensitivity in A498 cells (Fig 3F,G).
- WEE1 was knocked down with siRNA.
- siRNA knockdown of WEE 1 reduced the viability of SETD2-deficient A498 cells substantially more than SETD2-proficient U20S cells, while non-targeting siRNA had little effect on survival of either cell lines (Fig 4A).
- the reduced survival in WEE1 -siRNA targeted A498 cells compared to U20S cells was accompanied by a corresponding increase in the number of apoptotic cells observed (Fig 4B).
- Fig 4B shows that inhibiting WEE1 by either siRNA or the WEE1 inhibitor MK-1775 resulted in reduced survival and increased apoptotic cell death in SETD2-deficient cells.
- Example 3 below confirms the in vivo efficacy of MK1775 against SETD2-deficient cancer
- SETD2-deficient cells are hypersensitive to ATR inhibition
- VE-821 was recently described as a potent and specific ATR inhibitor (Reaper et al., 201 1). We therefore tested the sensitivity of A498 and U20S cells to VE-821. Subjecting SETD2-deficient A498 cells to VE-821 resulted in a striking loss of viability, while little effect was observed in SETD2-proficient U20S cells (Fig 5A and B). The increased loss of viability of A498 cells treated with VE-821 corresponded with highly elevated levels of apoptosis compared to controls (Fig 5C). U20S cells become more sensitive to ATR inhibitors after SETD2 knockdown by siRNA (Fig 5D).
- SETD2 cDNA was transiently expressed in A498 cells, which were again challenged with VE- 821.
- A498 cells complemented with SETD2 exhibited reduced levels of apoptosis compared to those transfected with vector alone when treated with VE-821 (Fig 5E), consistent with loss of SETD2 being the cause of VE-821 sensitivity in A498 cells.
- inhibiting ATR selectively kills SETD2-deficient cells.
- SETD2-deficient cells are hypersensitive to Chkl inhibition
- A498 cells were transiently complemented with the SETD2 cDNA or vector alone and challenged with Go 6976.
- Cells complemented with SETD2 cDNA exhibited reduced levels of apoptosis compared to those transfected with vector alone when treated with Go 6976, consistent with loss of SETD2 being the cause of Go 6976 sensitivity in A498 cells (Fig 7G).
- CHKl siRNA knockdown showed a striking loss of in SETD2-deficient A498 cells compared to U20S proficient cells and to non-targeted siRNA controls (Fig 8A and B).
- SETD2-deficient cells are not hypersensitive to DNA replication inhibitors
- SETD2 essential function performed by SETD2 in the absence of these kinases may be to limit DNA damage arising from inappropriate CDK activity during S-phase.
- CHKl or WEEl cells may be unable to repair such damage, thus resulting in apoptosis.
- the essential function of SETD2 may be related to its H3K36 tri-methyltransferase activity, which could coordinate histone deposition or prevent inappropriate transcription during S-phase.
- SETD2 could function independently of its methyltransferase activity, perhaps through binding tightly to single stranded DNA or RNA (Krajewski et al., 2005) to limit DNA damage in the absence of the replication checkpoint kinases.
- SETD2 inhibitors may be used therapeutically to target cancer cells deficient in these replication checkpoint kinases.
- SETD2 a histone H3K36 trimethyltransferase
- KDM4A overexpression sensitizes cells to WEEl, CHKl and A TR inhibitors.
- KDM4A overexpression resulted in poorer survival and increased apoptosis after inhibitor treatment compared to cells in which KDM4A was not overexpressed (Fig 12C-H).
- H3.3-K36M expressing cells low H3K36me3
- H3.3-K36M expressing cells low H3K36me3
- This H3.3-K36M mutation is not observed in cancers but its expression was predicted from this study to promote loss of H3K36me3 levels based on mutations frequently observed in cancers (Lewis et al, 2013).
- H3K36me3 mutations in the histone H3.3 genes that lead to reduced level of H3K36me3, such as the H3.3- G34R V observed in gliomas.
- the Invitrogen T-REx system (U20S-FLIPrN cells and FRT plasmid backbone) was provided by Dr. Csanad Bachrati.
- KDM4A cDNA was purchased from Genecopoeia.
- KDM4A overexpression cell line was generated by Sophia Pfister in the lab of Dr Timothy Humphrey. Briefly, the KDM4A cDNA was inserted into integration FRT plasmid backbone by recombination reaction. U20S-FLIPIN cells were transfected with the plasmid using Fugene transfection reagent (Promega). 48 hours after transfection, cells were split and stable integrants are selected for by Hygromycin and Blasticidin. About 20 days after selection, colonies were isolated and expanded individually. Individual colonies were tested for KDM4A expression in response to Doxycyline by Western blotting. Cells expressing KDM4A under the control of the repressible T-REx system were subsequently subjected to inhibitor treatment.
- H3.3 and H3.3-K36M lentiviral plasmids were generous gifts from David Allis lab (Lewis et al., 2013).
- Biosciences were co-transfected into 293T cells using lipofectamine transfection reagent (Invitrogen). Viral particles produced from 293T cells were collected and used to infect U20S cells. Five days after viral infection, U20S cells were selected for stable integration of the gene using Puromycin. Stable cell lines were tested for H3.3 or H3.3-K36M expression by Western blotting and subsequently subjected to inhibitor treatment.
- PKC inhibitor Go6976 induces mitosis and enhances doxorubicin-paclitaxel cytotoxicity in urinary bladder carcinoma cells. Cancer Lett 253, 9 '-107 ' .
- KDM4A lysine demethylase induces site-specific copy gain and rereplication of regions amplified in tumors. Cell 154, 541-555.
- Histone methyltransferase SETD2 coordinates FACT recruitment with nucleosome dynamics during transcription. Nucleic Acids Res 41, 2881-2893.
- Fiistone methyltransferase gene SETD2 is a novel tumor suppressor gene in clear cell renal cell carcinoma. Cancer Res 70, 4287-4291.
- Chkl inhibitor Go6976 enhances the sensitivity of nasopharyngeal carcinoma cells to radiotherapy and chemotherapy in vitro and in vivo. Cancer Lett 297, 190-197.
- Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis. Nature 342, 39-45.
- the transcriptional repressor JHDM3A demethylates trimethyl histone H3 lysine 9 and lysine 36. Nature 442, 312-316.
- the protein kinase C inhibitor Go6976 is a potent inhibitor of DNA damage-induced S and G2 cell cycle checkpoints.
- methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J Biol Chem 277, 49383-49388.
- H2B Tyr37 phosphorylation suppresses expression of replication-dependent core histone genes. Nat Struct Mol Biol 19, 930-937.
- Chkl regulates the density of active replication origins during the vertebrate S phase. Embo J 26, 2719-2731.
- Mitotic and G2 checkpoint control regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216. Science 277, 1501-1505.
- the novel ATR inhibitor VE-821 increases sensitivity of pancreatic cancer cells to radiation and chemotherapy. Cancer Biol Ther 73, 1072-1081.
- Chkl is a histone H3 threonine 1 1 kinase that regulates DNA damage- induced transcriptional repression. Cell 132, 221-232.
- Chkl regulates the S phase checkpoint by coupling the physiological turnover and ionizing radiation-induced accelerated proteolysis of Cdc25A. Cancer Cell 3, 247-258.
- a cell-based screen identifies ATR inhibitors with synthetic lethal properties for cancer-associated mutations. Nat Struct Mol Biol 18, 721-727.
- Histone methyltransferase protein SETD2 interacts with p53 and selectively regulates its downstream genes. Cell Signal 20, 1671-1678.
- Chkl -deficient tumour cells are viable but exhibit multiple checkpoint and survival defects. Embo J 22, 713-723.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to methods of treating cancers which comprise a decreased amount of H3K36me3. Kits for use in such methods are also provided.
Description
TREATMENT
Field of the Invention
The invention relates to methods of treating cancers which comprise a decreased amount of H3K36me3. Kits for use in such methods are also provided.
Background of the Invention
Personalised cancer medicine involves the customisation of treatment to the
characteristics of the cancer in individual patient. One of the earliest and most common examples of this is the use of Herceptin® (trastuzumab) to treat HER2 positive tumours. The identification and exploitation of particular driver mutations in individual cancers are central to personalised cancer medicine.
Summary of the Invention
Modification of histone H3 at lysine 36 (H3K36) through methylation is associated with numerous functions including active chromatin, transcription regulation, alternative splicing, dosage compensation, DNA replication and repair (reviewed in Wagner and Carpenter, 2012). In humans, H3K36 methylation is catalysed through the activities of eight distinct enzymes, in which seven (NSD1, NSD2, NSD3, SETMAR, ASH1L, and SETD3) are responsible for H3K36 mono- and or di-methylation, while SETD2 (also known as Huntingtin-interacting protein B, HYPE) uniquely catalyses the tri-methylation of H3K36 (Edmunds et al, 2008).
The inventors have shown that cancer cells which comprise a decreased amount of H3K36me3 (i.e. a decreased amount of histone H3 tri-methylated at lysine 36) are unexpectedly and acutely sensitive to inhibition of ataxia telangiectasia and Rad3-related protein (ATR), checkpoint kinase 1 (CHK1) or WEE1, resulting in growth inhibition and cell death. In contrast, such cancer cells are much less sensitive to ATM or CHK2 inhibition or to general replication stress induced by hydroxyurea or aphidicolin. The targeted inhibition of ATR, CHK1 WEE1, or other components of the replication checkpoint pathway, may therefore be exploited to create novel approaches for the treatment of cancers which comprise a decreased amount of
H3K36me3.
Accordingly, the present invention provides a method of treating a cancer which comprises a decreased amount of H3K36me3 in a patient, the method comprising administering to the patient a WEE1 inhibitor or a checkpoint kinase 1 (CHK1) inhibitor or an ataxia telangiectasia and Rad3 -related protein (ATR) inhibitor and thereby treating the cancer.
The invention also provides a method of treating cancer in a patient, the method comprising (a) determining whether or not the cancer comprises a decreased amount of
H3K36me3 and (b), if the cancer comprises a decreased amount of H3K36me3, administering to the patient a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor and thereby treating the cancer.
The invention also provides a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor for use in a method of treating in a patient a cancer which comprises a decreased amount of H3K36me3.
The invention also provides use of a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor in the manufacture of a medicament for treating in a patient a cancer which comprises a decreased amount of H3K36me3.
The invention also provides a kit for treating cancer comprising (a) means for testing for whether or not the cancer comprises a decreased amount of H3K36me3 and (b) a WEEl inhibitor or a CHK1 inhibitor or an ATR inhibitor.
Description of the Figures
Fig 1 shows that in fission yeast set2A and weel-50 exhibit a synthetic lethal genetic interaction. Five-fold serial dilutions of wild-type (2094) set2A (3271) weel-50 (7024) and set2A weel-50 (7121) were grown on minimal media (EMM6S) at 35°C. While both set2A and weel-50 were able to grow on EMM6S at the restrictive temperature of 35°C, the set2A weel-50 double mutant was not.
Fig 2 shows that SETD2-deficient cells are hypersensitive to the WEEl inhibitor MK- 1775.
(A) Light microscopy images of SETD2-deficient A498 cells (top) or SETD2 wild-type U20S cells (bottom) treated with DMSO control or WEEl inhibitor (MK-1775) at 200nM for 5 days.
(B) Survival of U20S and A498 cells 6 days after a one-off treatment with DMSO or MK-1775 at the concentrations indicated. Error bars represent standard errors of the mean. MK- 1775 dramatically reduces survival and growth of A498 cells compared to U20S.
(C) Percentage of total number of cells undergoing apoptosis as determined by Hoechst nuclear staining 48 hours after treatment with DMSO or MK-1775 (as described in Materials and Methods). Images were captured and quantitated using the Incell Analyzer system (GE healthcare). Error bars represent standard errors of the mean. MK-1775 treatment results in significantly more apoptosis in A498 cells compared to U20S.
Fig 3 shows that siRNA knockdown of SETD2 in wild-type cells leads to MK-1775 hypersensitivity. Re-expression of SETD2 protein in deficient cells reduces MK-1775 hypersensitivity.
(A) U20S cells were transfected with control non-targeting siRNAs (NT) or siRNAs targeting SETD2 (si#3 and si#5) for 72 hours. Protein knockdown was confirmed by Western blotting using anti-SETD2 antibody (Abeam) (upper panel). SETD2 knockdown led to a significant decrease in H3K36me3 (Abeam) (middle panel) without affecting the loading control Histone 3 protein levels (Abeam) (lower panel).
(B) Light microscopy images of U20S cells after transfection with non-targeting siRNA (siNT) or siRNAs targeting SETD2 (siSETD2#3 or #5) for 48 hours prior to treatment of MK- 1775 at 300nM for 5 days.
(C) Clonogenic survival of U20S after transfection with non-targeting siRNA (siNT) or siRNAs targeting SETD2 (siSETD2#3 or #5) for 48 hours prior to one-off treatment with DMSO or MK-1775 at the concentrations indicated. Colonies were allowed to form for 10-14 days before counting. Error bars represent standard errors of the mean. The figure shows that SETD2 knockdown reduces the survival of U20S cells upon MK-1775 treatment.
(D) Apoptosis (as determined by Hoechst) of U20S after transfection with non-targeting siRNA (siNT) or siRNAs targeting SETD2 (siSETD2#3 or #5) for 48 hours prior to 48-hour treatment with DMSO or MK-1775 at the concentrations indicated. The figure shows that SETD2 knockdown increases the apoptotic population in U20S cells upon MK-1775 treatment.
(E) Survival of U20S or A498 cells after transfection with non-targeting siRNA (siNT) or siRNAs targeting SETD2 (siSETD2#3 or #5) for 48 hours prior to one-off treatment with DMSO or MK-1775 at 200nM for 5 days. Error bars represent standard errors of the mean. The figure shows that while SETD2 knockdown sensitises U20S cells to MK-1775, it does not sensitise A498 cells (which are SETD2-deficient), confirming the specificity of the siRNAs.
(F) Rescue of A498 cells with SETD2 reexpression from MK-1775 treatment. A498 cells or A498 cells with stably integrated SETD2 cDNA (A498 SETD2), were treated with DMSO or MK-1775 at the indicated concentrations. Cell survival was measured by Resazurin assay 48 hours after MK-1775 treatment. Error bars represent standard errors of the mean. The figure shows that re-expression of SETD2 increases cell survival in A498 after MK-1775 treatment.
(G) Apoptosis (as determined by Hoechst and analysed by Incell (GE healthcare) of A498 cells or A498 cells with stably integrated SETD2 cDNA (A498 SETD2), were treated with DMSO or MK-1775 at the indicated concentrations.. Error bars represent standard errors of the mean. The figure shows that re-expression of SETD2 reduces apoptosis in A498 after MK-1775
treatment, confirming that loss of SETD2 was the primary cause of cell death in A498 cells treated with MK- 1775.
Fig 4 shows that inhibition of WEEl by siRNA selectively kills SETD2-deficient cells.
(A) Survival of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNAs against WEEl (siWEEl) were measured 6 days after transfection. Error bars represent standard errors of the mean. WEEl siRNAs reduce the survival of SETD2-deficient A498 much more compared to SETD2 wild-type U20S.
(B) Apoptosis (as determined by Hoechst) of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNAs against WEEl (siWEEl) were measured 48 hours after transfection. Error bars represent standard errors of the mean. WEEl siRNAs increase apoptosis in SETD2-deficient A498 much more compared to U20S.
Fig 5 shows that SETD2-deficient cells are hypersensitive to the ATR inhibitor VE-821.
(A) Light microscopy images of SETD2-deficient A498 cells (top) or SETD2 wild- type U20S cells (bottom) treated with DMSO control or ATR inhibitor (VE-821) at 5uM for 5 days.
(B) Survival of A498 and U20S cells 5 days after a one-off treatment with DMSO or VE-821 at the concentrations indicated. VE-821 dramatically reduces survival and growth of A498 cells compared to U20S. Error bars represent standard errors of the mean.
(C) Percentage of total number of cells undergoing apoptosis as determined by Hoechst nuclear staining 48 hours after treatment with DMSO or VE-821 at the concentrations indicated. VE-821 treatment results in significant increase of apoptosis in A498 cells compared to U20S. Error bars represent standard errors of the mean.
(D) Apoptosis (determined by Hoechst) in U20S cells treated with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) for 48 hours prior to DMSO or VE-821 treatment. Knockdown of SETD2 in U20S increases apoptosis after VE-821 treatment.
(E) Apoptosis (determined by Hoechst) in A498 cells transfected with SETD2- expression plasmid for 48 hours prior to treatment with DMSO or VE-821. Error bars represent standard errors of the mean. Re-expression of SETD2 reduces apoptotic population in A498 after VE-821 treatment, confirming that loss of SETD2 was the primary cause of cell death in A498 cells treated with VE-821.
Fig 6 shows that SETD2-deficient cells are hypersensitive to CHK1 inhibitors such as Go 6976, LY2603618 or AZD7762.
(A-C) SETD2-deficient A498 cells are hypersensitive to Go 6976, as demonstrated by light microscope images (taken 5 days after treatment), reduction in survival (measured 5 days
after treatment) and increase in apoptosis (measured 48 hours after treatment). Error bars represent standard errors of the mean.
(D-F) SETD2-deficient A498 cells are hypersensitive to LY2603618, as demonstrated by light microscope images (taken 5 days after treatment), reduction in survival (measured 5 days after treatment) and increase in apoptosis (measured 48 hours after treatment). Error bars represent standard errors of the mean.
(G-I) SETD2-deficient A498 cells are hypersensitive to AZD7762, as demonstrated by light microscope images (taken 5 days after treatment), reduction in survival (measured 5 days after treatment) and increase in apoptosis (measured 48 hours after treatment). Error bars represent standard errors of the mean.
Fig 7 shows that siRNA knockdown of SETD2 in wild-type cells leads to CHK1 inhibitor hypersensitivity. Re-expression of SETD2 protein in deficient cells reduces CFD l inhibitor hypersensitivity.
(A,B) U20S cells where transfected with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) 48 hours prior to Go 6976 treatment. SETD2 knockdown leads to reduced survival (measured 5 days after Go 6976 treatment) and increased apoptosis (measured 48 hours after Go 6976 treatment).
(C,D) U20S cells where transfected with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) 48 hours prior to LY2603618 treatment. SETD2 knockdown leads to reduced survival (measured 5 days after LY2603618 treatment) and increased apoptosis (measured 48 hours after LY2603618 treatment).
(E,F) U20S cells where transfected with non-targeting siRNA (siNT) or SETD2 siRNA (siSETD2#3) 48 hours prior to AZD7762 treatment. SETD2 knockdown leads to reduced survival (measured 5 days after AZD7762 treatment) and increased apoptosis (measured 48 hours after AZD7762 treatment).
(G) Apoptosis (determined by Hoechst) of A498 transfected with SETD2-expression plasmid for 48 hours prior to treatment with Go 6976. Error bars represent standard errors of the mean. Re-expression of SETD2 reduces apoptotic population in A498 after Go 6976 treatment, confirming that loss of SETD2 was the primary cause of cell death in A498 cells treated with Go 6976.
Fig 8 shows that inhibition of CFD 1 by siRNA selectively kills SETD2-deficient cells.
(A) Survival of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNA against CHK1 (siCHKl) were measured 6 days after transfection. Error bars represent standard errors of the mean. CHK1 siRNA reduces the survival of SETD2-deficient A498 much more compared to SETD2 wild-type U20S.
(B) Apoptosis (determined by Hoechst) of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNA against CHKl (siCHKl) were measured 48 hours after transfection. Error bars represent standard errors of the mean. CHKl siRNA increases apoptosis in SETD2-deficient A498 much more compared to U20S.
Fig 9 shows that targeting ATM or CHK2 does not seletively kill SETD2-deficient cells.
(A) Survival of A498 and U20S cells 6 days after a one-off treatment with DMSO or ATM inhibitor (KU55933) at the concentrations indicated. Error bars represent standard errors of the mean. KU55933 does not show selective killing of SETD2-deficient A498 cells over U20S cells.
(B) Apoptosis (determined by Hoechst) of A498 and U20S cells 48 hours after ATM inhibitor (KU55933) treatment. Error bars represent standard errors of the mean. KU55933 does not induce more apoptosis in A498 cells compared to U20S cells.
(C) Survival of A498 and U20S cells transfected with non-targeting siRNA (siNT) or siRNA against ATM (siATM) or CHK2 (siCHK2) were measured 6 days after transfection. Error bars represent standard errors of the mean. Neither knockdown of ATM or CHK2 resulted in significantly reduced survival in A498 cells.
Fig 10 shows that SETD2-deficient cells are not hypersensitive to DNA replication inhibitors.
(A) Survival of U20S cells transfected with non-targeting siRNA (siNT) or siRNAs against SETD2 (siSETD2#3 or siSETD2#5) 48 hours prior to one-off aphidicolin treatment for 5 days. Error bars represent standard errors of the mean. SETD2 knockdown does not sensitise U20S to aphidicolin.
(B) Survival of U20S cells transfected with non-targeting siRNA (siNT) or siRNAs against SETD2 (siSETD2#3 or siSETD2#5) 48 hours prior to one-off hydroxyurea treatment for 5 days. Error bars represent standard errors of the mean. SETD2 knockdown does not sensitise U20S to hydroxyurea.
(C) Survival of A498 and U20S after one-off hydroxyurea treatment for 4 days. Error bars represent standard errors of the mean. SETD2-deficient A498 cells are not hypersensitive to hydroxyurea.
Fig 11 shows the chemical structure of the inhibitors used in this study.
Fig 12 shows (A) Graphic demonstration of the Invitrogen T-REx system (picture adapted from Invitrogen User Manual 2010). (B) Addition of Doxycycline to the cell culture medium turns on expression of KDM4A, leading to reduced H3K36me3. (C-H) The KDM4A- U20S cell line was split into two groups, one cultured in the presence of Doxycline (5ug/ml) in the medium, one without, for 72 hours. Cells from the two groups were then seeded 18 hours
prior to the treatment with indicated concentrations of MK-1775, LY2603618 or VE821. Cell survival was measured using Resazurin five days after treatment. Apoptosis was detected by Hoechst staining and analysed using an Incell Analysis System (GE Healthcare) 48 hours after treatment. The graphs represent data from three independent experiments.
Fig 13 shows (A) U20S cells were infected with lentivirus containing H3.3 gene or the mutant H3.3 K36M gene. Cells containing the virus integrated into the genome were selected for by Puromycin. Western blots were performed with U20S cells containing integrated H3.3 or integrated H3.3-K36M, and show that K36M expression reduced H3K36me3 levels. (B-G) U20S cell lines with integrated H3.3 or H3.3-K36M were seeded 18 hours prior to the treatment with indicated concentrations of MK-1775, LY2603618 or VE821. Cell survival was measured by Resazurin five days after treatment. Apoptosis was detected by Hoechst staining and analysed using an Incell Analysis System (GE Healthcare) 48 hours after treatment. The graphs represent data from three independent experiments. (H) Light microscope pictures showing cell survival and morphology of U20S-H3.3 or U20S-K36M cells after inhibitor treatments as indicated.
Fig 14 shows the in vivo efficacy of MK-1775 against SETD2-deficient cancer. (A) Data represent the mean tumour volume (mm ±SEM) for each group. Arrows represent days when MK-1775 or vehicle were dosed. On day 13, the mean tumour volume in the MK-1775 treatment group (50.2 ± 4.7 mm3) was significantly less than in the vehicle control group (291 ± 40 mm3) (P<0.0001, t-Test). (B) Image of the tumours recovered on day 13 from mice treated with either MK-1775 or vehicle. (C) Mean body weight of tumour-bearing mice treated with either MK-1775 or vehicle. MK-1775 had no significant impact on body weight.
Description of the Sequence Listing
SEQ ID NO: 1 shows the cDNA sequence of human SETD2.
http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi ?REQUEST=CCDS&DATA=CCDS2749
SEQ ID NO: 2 shows the amino acid sequence of human SETD2.
SEQ ID NO: 3 shows the cDNA sequence of human WEE1.
http://wvvw.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=CCDS&DATA=
SEQ ID NO: 4 shows the mRNA sequence of human WEE1 (variant 1).
http ://www.ncbi .nlm.nih. gov/nuccore/NM_003390.3
SEQ ID NO: 5 shows the amino acid sequence of human WEE1 (isoform 1 enocoded by SEQ ID NO: 4).
SEQ ID NO: 6 shows the mRNA sequence of human WEE J transcript variant 2. This variant has a different first exon and 5' UTR, compared to variant 1 (SEQ ID NO: 4). This difference causes translation initiation from an in-frame downstream AUG and an isoform (2)
with a shorter N-terminus compared with isoform 1.
http://www.ncbi.nlm.nih.gov/nuccore/NM_001143976.1
SEQ ID NO: 7 shows the amino acid sequence of human WEE1 isoform 2 (encoded by SEQ ID NO: 6).
SEQ ID NO: 8 shows the cDNA sequence of human CHK1.
http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REOUEST-CCDS&DATA-CCDS84S9
SEQ ID NO: 9 shows the mRNA sequence of human CHK1.
http : //www . ncbi . nlm ,ni h . gov/ nuccore/NM_0011 14122.2
SEQ ID NO: 10 shows the amino acid sequence of human CHK1 (isoform 1 encoded by SEQ ID NO: 9).
SEQ ID NO: 11 shows the cDNA sequence of human CHK1 transcript variant 4. CHK1 has 4 confirmed mRNA transcript variants, 3 of which code for the same protein (isoform 1 ; SEQ ID NO: 10) as the predominant form (SEQ ID NO: 9). Variant 4 lacks an in-frame coding exon at the 3' end compared to the predominant form. This results in a shorter isoform (SEQ ID NO: 12) missing an internal protein segment compared to isoform 1 (SEQ ID NO: 10).
http://www.ncbi.nlm.nih.gov/nuccore/NM_001244846
SEQ ID NO: 12 shows the mRNA sequence of human CHK1 transcript variant 4.
http://www.ncbi.nlm.nih.gov/nuccore/NM_001244846
SEQ ID NO: 13 shows the amino acid sequence of the shorter isoform of human CHK1 (encoded by SEQ ID NO: 12).
SEQ ID NO: 14 shows the cDNA sequence of human ATR.
http://www.ncbi.nlm.nSh.gov/CCDS/CcdsBrowse gi?REOUEST=:CCDS&DATA^CCDS3124
SEQ ID NO: 15 shows the mRNA sequence of human ATR.
http://www.ncbi.nlm.nih.gov/nuccore/NM 001 184.3
SEQ ID NO: 16 shows the amino acid sequence of human ATR. Human ATR has 4 different protein isoforms
(http://www.ensembl.org/Homo_sapiens/Transcript/Sequence_cDNA?db=core;g=ENSG000001 75054;r=3 : 142168077- 142297668;t=ENST00000383101).
SEQ ID NOs: 17 to 22 show some oligonucleotides of the invention (see Table 7).
SEQ ID NOs: 23 to 29 show some oligonucleotides used in the Examples (see Table 7).
SEQ ID NO: 30 shows the cDNA sequence of human KDM4A.
SEQ ID NO: 31 shows the amino acid sequence of human KDM4A.
http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=GV&DATA=305662 &BUILD S=CURRENTBUILD S
SEQ ID NO: 32 shows the cDNA sequence of human KDM4B.
SEQ ID NO: 33 shows the amino acid sequence of human KDM4B.
http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=GV&DATA=320036 &BUILD S=CURRENTBUILD S
SEQ ID NO: 34 shows the cDNA sequence of human KDM4C.
SEQ ID NO: 35 shows the amino acid sequence of human KDM4C.
http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=GV&DATA=335190 &BUILD S=CURRENTBUILD S
SEQ ID NO: 36 shows the cDNA sequence of HIST1H3A (a histone H3).
SEQ ID NO: 37 shows the amino acid sequence of HIST1H3A (a histone H3).
http ://www.ncbi .nlm.nih. gov/CCDS/CcdsBrowse. cgi?REQUEST=GV&DATA=331033 &BUILDS=CURRENTB UILD S
SEQ ID NO: 38 shows the cDNA sequence of HIST1H3B (a histone H3).
SEQ ID NO: 39 shows the amino acid sequence of HIST1H3B (a histone H3).
http ://www.ncbi .nlm.nih. gov/CCDS/CcdsBrowse. cgi?REQUEST=GV&D ATA=331036 &BUILD S=CURRENTB UILD S
SEQ ID NO: 40 shows the cDNA sequence of HIST1H3C (a histone H3).
SEQ ID NO: 41 shows the amino acid sequence of HIST1H3C (a histone H3).
http ://www.ncbi .nlm.nih .gov/CCDS/CcdsBrowse. cgi?REQUEST GV&D ATA^ 31039 &BUILD S=CURRENTBUILD S
SEQ ID NO: 42 shows the cDNA sequence of HIST1H3D (a histone H3).
SEQ ID NO: 43 shows the amino acid sequence of HIST1H3D (a histone H3).
&BUILD S=CURRENTBUILD S
SEQ ID NO: 44 shows the cDNA sequence of HIST1H3E (a histone H3).
SEQ ID NO: 45 shows the amino acid sequence of HIST1H3E (a histone H3).
http ://www.ncbi .nlm.nih. gov/CCDS/CcdsBrowse. cgi?REQUEST=GV&DATA=331065 &BUILDS=CURRENTBUILDS
SEQ ID NO: 46 shows the cDNA sequence of HIST1H3F (a histone H3).
SEQ ID NO: 47 shows the amino acid sequence of HIST1H3F (a histone H3).
http ://www.ncbi .nlm .nih.gov/CCDS/CcdsBrowse. cgi?REQUEST=GV &DATA=331069 & B UILD S := CURREN TBUILD S
SEQ ID NO: 48 shows the cDNA sequence of HIST1H3G (a histone H3).
SEQ ID NO: 49 shows the amino acid sequence of HIST1H3G (a histone H3).
http://w .ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=GV&DATA==331071 &BUILD S=CURRENTBUILD S
SEQ ID NO: 50 shows the cDNA sequence of HIST1H3H (a histone H3).
SEQ ID NO: 51 shows the amino acid sequence of HIST1H3H (a histone H3).
http ://www.ncbi .nlm.nih.gov/CCDS/CcdsBrowse. cgi?REQUEST=GV&DATA=331109 &BUILDS=CURRENTBUILDS
SEQ ID NO: 52 shows the cDNA sequence of HIST1H3I (a histone H3).
SEQ ID NO: 53 shows the amino acid sequence of HIST1H3I (a histone H3).
http ://www.nebi .nlm .nih. gov/CCDS/CcdsBrowse. cgi?REQUEST=GV&D ATA=331 119 &BU:iLDS-CURRF.NTBUILDS
SEQ ID NO: 54 shows the cDNA sequence of HIST1H3J (a histone H3).
SEQ ID NO: 55 shows the amino acid sequence of HIST1H3J (a histone H3).
http://www.ncbi.nlm.mL
&BUILD S=CURRENTBUILD S
SEQ ID NO: 56 shows the cDNA sequence of HIST2H3A (a histone H3).
SEQ ID NO: 57 shows the amino acid sequence of HIST2H3A (a histone H3).
http ://www.ncbi .nlm .nih. gov/CCDS/CcdsBrowse. cgi?REQUEST=GV&DATA=306564 &BUILD S=CURRENTB UILD S
SEQ ID NO: 58 shows the cDNA sequence of HIST2H3C (a histone H3).
SEQ ID NO: 59 shows the amino acid sequence of HIST2H3C (a histone H3).
http://www.ncbi.nlm.nih. gov/CCDS/CcdsBrowse.cgi?REQUEST=ALLFIELDS&D ATA -liIS1 .H3c&ORGANISM= i&BIJILDS-CURRENTBUiI,DS
SEQ ID NO: 60 shows the cDNA sequence of HIST2H3C (a histone H3).
SEQ ID NO: 61 shows the amino acid sequence of HIST2H3C (a histone H3).
http://ww.ncbi .nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=GV&DATA=306559 &BUII.D S=CURRENTB UILD S
SEQ ID NO: 62 shows the cDNA sequence of H3F3A (a histone H3).
SEQ ID NO: 63 shows the amino acid sequence of H3F3A (a histone H3).
http://www.ncbi .nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST:=GV&DATA:==:307877 &BUILD S=CURRENTBUILD S
SEQ ID NO: 64 shows the cDNA sequence of H3F3B (a histone H3).
SEQ ID NO: 65 shows the amino acid sequence of H3F3B (a histone H3).
http://ww.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgt?REQUEST:=GV&DATA:=319048 &BUILD S=CURRENTBUILD S
SEQ ID NO: 66 shows the cDNA sequence of human IDH1.
SEQ ID NO: 67 shows the amino acid sequence of human IDH1.
http://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi?REQUEST=GV&DATA=323746 &BUILD S=CURRENTBUILD S
Detailed Description of the Invention
It is to be understood that different applications of the disclosed products and methods may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
In addition as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "an inhibitor" includes two or more such inhibitors, or reference to "an oligonucleotide" includes two or more such oligonucleotide and the like.
All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
Method of treating a cancer which comprises a decreased amount of H3K36me3
In humans, H3K36 methylation is catalysed through the activities of eight distinct enzymes, in which seven (NSD1, NSD2, NSD3, SETMA , ASH1L, and SETD3) are responsible for H3K36 mono- and or di-methylation, while SETD2 uniquely catalyses the tri- methylation of H3K36 (Edmunds et al., 2008).
Modification of histone H3 at lysine 36 (H3K36) through methylation is associated with numerous functions including active chromatin, transcription regulation, alternative splicing, dosage compensation, DNA replication and repair (reviewed in (Wagner and Carpenter, 2012). The mechanisms in which H3K36 is involved in some of these processes are detailed below:
(1) Transcription regulation: In yeast, Set2 binds to the elongating RNA polymerase II (polll) (Krogan et al., 2003; Li et al., 2003; Li et al., 2002; Xiao et al, 2003). Co- transcriptional H3K36 tri-methylation prevents aberrant transcriptional initiation by recruiting histone deacetylase and restoring normal chromatin structure (Keogh et al., 2005). Set2- dependent H3K36 di- and tri-methylation also prevents aberrant transcription by both preventing histone exchange over coding regions through suppressing H3K36 interaction with the histone chaperones Asfl, Spt6 and Sptl6 (Venkatesh et al, 2012), and by recruitment of the Iswlb chromatin remodelling complex (Smolle et al., 2012). In humans, SETD2 prevents intragenic transcription by promoting loading of the FACT (Facilitates Chromatin Transcription) complex and maintaining nucleosome occupancy in active genes, and SETD2 down-regulation leads to intragenic transcription in 1 1% of active genes (Carvalho et al., 2013). Thus SETD2 may act as
a tumour suppressor through preventing intragenic transcription initiation (Carvalho et al., 2013). In addition, IWS 1, an RNA processing regulator, is phosphorylated by Akt3 and Aktl at Ser720/Thr721. This allows IWS 1 to recruit SETD2 and create the H3K36me3 mark.
H3K36me3 acts as a docking site for MRG15 and PTB, which in turn regulate FGFR-2 splicing, which controls tumor growth and invasiveness (Sanidas et al., 2014).
(2) DNA repair: Roles for H3K36 modification have also been identified in DNA repair. In yeast, set2 loss is associated with increased DNA double-strand breaks (DSBs) (Merker et al, 2008). In human cells, H3K36 di-methylation increases at DNA double-stand breaks (DSBs) and enhance DNA repair by non-homologous end joining (NHEJ) through recruiting NB SI and Ku70 repair factors (Fnu et al., 201 1). LEDGF is constitutively associated with chromatin and through its Pro-Trp-Trp-Pro (PWWP) domain that binds preferentially to di and tri-methylated H3K36 (Daugaard et al., 2012). LEDGF has recently been found to promote DNA-end resection and DSB repair by homologous recombination through recruiting C-terminal binding protein interacting protein (CtIP) to DSBs. The mismatch repair (MMR) protein MSH6 was found to preferentially bind to H3K36me3 through its PWWP domain, and a role for SETD2 and this histone mark has been identified in regulating human mismatch repair through this interaction (Li et al., 2013; Vermeulen et al., 2010).
The cancer treated in accordance with the invention comprises a decreased amount of H3K36me3 (i.e. a decreased amount of histone H3 tri-methylated at lysine 36). The cancer preferably comprises a decreased amount of H3K36me3 and an increased amount of H3K36me2 (i.e. an increased amount of histone H3 di-methylated at lysine 36).
The cancer may comprise a decreased amount of H3K36me3 compared with normal cells of the same tissue type. For instance, in lung cancer, the amount of H3K36me3 may be decreased compared with normal lung cells. The amount of H3K36me3 may be decreased by any amount. For instance, the amount of H3K36me3 may be decreased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared with the level of H3K36me3 in normal cells of the same type. The amount of H3K36me3 can be measured using known techniques. The amount of H3K36me3 can be measured using immunohistochemistry, western blotting, mass spectrometry or fluorescence- activated cell sorting (FACS). Suitable antibodies against H3K36me3 are available. For example, the anti-histone H3 (tri methyl K36) antibody (ab9050) is available from Abeam®. In addition surrogate markers of H3K36me3 loss could be used in certain disease indications, such as measuring increased levels of FGFR-2 transcript Illb vs IIIc (Luco et al.,2010).
Any of the above methods may also be used to measure H3K36me2. For instance, the anti-histone H3 (di methyl K36) antibody (ab9049) is available from Abeam®.
H3K36me3 disruption is observed in 54% pediatric high-grade glioma, and the main causing mutations are: SETD2, IDH1 or G34R/V-H3.3 (Fontebasso et al., 2013). The cancer treated in accordance with the invention is preferably glioma, more preferably high-grade glioma. More specific genotypes and phenotypes of the cancers treated in accordance with the invention are discussed below.
Method of treating a SETD2-deficient cancer
The cancer which comprises a decreased amount of H3K36me3 is preferably a SETD2- deficient cancer. SETD2 is also known as Huntingtin-interacting protein B (HYPB). In the context of this invention, SETD2 and HYPB are interchangeable.
Mutations in the human SET domain-containing 2 (SETD2, also known as Huntingtin- interacting protein B, HYPB) gene have been recently identified in an increasing number of cancers, leading to its classification as a novel tumour suppressor. A tumour suppressor role for SETD2 was first proposed following the observation that its expression levels were significantly reduced in malignant breast cancer tissue compared to normal tissues in patients (Al Sarakbi et al., 2009; Newbold and Mokbel, 2010). SETD2 was also found to be inactivated in clear cell renal cell carcinomas (ccRCC) (Duns et al., 2010), with systematic sequencing revealing SETD2 to be mutated in 8% of ccRCCs (Dalgliesh et al, 2010; Hakimi et al., 2013). Recently, whole exome sequencing of a cohort of 60 pediatric high-grade gliomas (HGGs) identified mutations in SETD2 in 15 % of pediatric HGGs, and 8 % of adult HGGs (Fontebasso et al, 2013). SETD2 mutations have also been identified in a number of other cancer types including acute lymphoblastic leukaemia (Zhang et al., 2012), endometrium (2%), skin (2%), large intestine (2.5%), stomach (3%), lung (4%), and bladder (11%)
(http://cancer.sanger.ac.uk/cosmic/gene/analysis?ln=SETD2&start=l&end=2062&id=7148#ts).
In summary, the high frequencies of SETD2 mutation in multiple cancers identify this gene as an important target, and exploiting cancer deficiencies is becoming an increasing important therapeutic approach (Brough et al., 201 1). The types of cancer that may be treated in accordance with the invention are discussed in more detail below.
The SETD2 gene
The SETD2 gene is located on the short arm of chromosome 3 (3p21.31), spanning 147.57 Kb across 21 exons and encodes a protein of 2564 amino acids. Its cDNA sequence is shown in SEQ ID NO: 1.
The SETD2 protein (SEQ ID NO: 2) contains a single WW domain, a triplicate AWS- SET-PostSET domain and a low charged region rich in glutamine and proline, characterized as a novel transcriptional activation domain (Rega et al., 2001). SETD2 is also predicted to tightly bind single-stranded DNA and RNA (Krajewski et al., 2005). SETD2 is observed within the nucleus and is collocated in nuclear speckles with huntingtin (HD) mutant protein, and is ubiquitously expressed throughout the body (Rega et al., 2001). Sequence analysis of SETD2 indicates that loss of function could be caused by various types of mutations, including missense, nonsense and frameshift mutations.
(http://cancer.sanger.ac.uk/cosmic/gene/analysis?ln=SETD2#dist). SETD2 function
Despite its increasingly important role as a tumour suppressor, how loss of SETD2 may promote tumorigenesis is currently unclear. While the role of SETD2 in Huntingtons disease is uncertain, numerous other functions have been ascribed to SETD2, including regulating telomere function (Newbold and Mokbel, 2010); downregulating Mdm2 transcription (Xie et al., 2008), embryonic vascular remodeling and angiogenesis in mice (Hu et al., 2010); stem cell development and transcription regulation (Carvalho et al., 2013). However, the role of SETD2 is currently best understood through its evolutionarily conserved role as a histone H3 lysine 36 (H3K36) methyltransferase (Sun et al., 2005).
SETD2 deficiency
The invention preferably concerns the treatment of a SETD2-deficient cancer. A cancer is SETD2-deficient if the function of SETD2 in the cancer cells is decreased compared with SETD2 function in normal cells of the same tissue type. The function of SETD2 may be decreased by any amount. For instance, the function may be decreased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared with the level of SETD2 function in normal cells. A SETD2-deficient cancer preferably has a complete loss of SETD2 function (i.e. the function is decreased 100% compared with normal cells of the same tissue type). SETD2 function may be measured in any of the ways discussed below.
SETD2 deficiency is typically caused by a mutation in the SETD2 gene. The Sanger Institute summarised the different types of mutations found in the SETD2 gene. As shown in Table 1, a decreased function of SETD2 may be caused by various mutations.
Table 1 - Types of mutations in SETD2 cancers
Major Types of mutations SETD2 Percentage of all mutations
Substitution missense (change an amino-acid 50.3
to a different one)
Substitution nonsense (change an amino acid 26.9
to a stop codon)
Deletion frameshift 11.0
Insertion frameshift 2.1
Deletion inframe 1.4
Substitution synonymous 7.6
Complex 0.7
Total 100
Source: http : //cancer. Sanger. ac.uk/cosmic/gene/ analy si s?ln=SETD2#di st
The SETD2-deficient cancer may comprise a missense mutation. Missense mutations change the amino acid sequence of the SETD2 protein and thus can reduce the function of the SETD2 protein or abolish it altogether.
The SETD2-deficient cancer may comprise a nonsense mutation. This leads to decay of mRNA and thus a reduction in SETD2 protein expression.
The SETD2-deficient cancer may comprise a frameshift mutation. The frameshift mutation may be a deletion frameshift mutation or an insertion frameshift mutation. Both types of mutation can decrease the function of the SETD2 protein or abolish it altogether Some frameshift mutations can also introduce a pre-mature stop codon and lead to loss of SETD2 protein expression.
The SETD2-deficient cancer may comprise a deletion inframe mutation. This mutation may also decrease the function of the SETD2 protein or abolish it altogether.
The mutations discussed above are preferably homozygous.
The SETD2-deficient cancer may lack the SETD2 gene. In other words, the SETD2 gene may be absent from the cancer.
In some instances, the mutation or absence of the SETD2 gene may be due to a chromosome 3 abnormality, such as chromosome 3p deletion or rearrangement. The SETD2- deficient cancer may therefore comprise a chromosome abnormality, such as chromosome 3p deletion or rearrangement.
In some instances SETD2 deficiency may be due to mutations in other genes which affect the expression of the SETD2 protein, its stability or its ability to function.
It will be clear from the above that mutations resulting in SETD2 deficiency may affect the expression of the SETD2 protein, its stability or its ability to function. The SETD2-deficient cancer may comprise a decreased amount of SETD2 protein, such as a decreased amount of SEQ ID NO: 2 or a polymorphism thereof. The SETD2-deficient cancer may comprise a decreased amount of SETD2 protein compared with normal cells of the same tissue type. The amount of the SETD2 protein may be decreased by any amount and in particular the % amounts discussed above in relation of SETD2 function.
The SETD2-deficient cancer may comprise a SETD2 protein with decreased function. The SETD2-deficient cancer may comprise a SETD2 protein with decreased function compared with normal (i.e. wild-type or native) SETD2 protein, such as SEQ ID NO: 2 or a polymorphism thereof. The function of the SETD2 protein may be decreased by any amount and in particular the % amounts discussed above in relation of SETD2 function. The SETD2-deficient cancer may comprise SETD2 protein with no function (i.e. a lack of function or an abolished function). The function of SETD2 protein, for instance its ability to catalyse the H3K36 di- to tri- methylation in human cells, can be assayed as discussed in more detail below. The SETD2- deficient cancer may comprise no SETD2 protein (i.e. may lack SETD2 protein).
It will be clear from the above that mutations resulting in SETD2 deficiency may affect the amount of the SETD2 mRNA. The SETD2-deficient cancer may comprise a decreased amount of SETD2 mRNA. The SETD2-deficient cancer may comprise a decreased amount of SETD2 mRNA compared with normal cells of the same tissue type. The amount of the SETD2 mRNA may be decreased by any amount and in particular the % amounts discussed above in relation of SETD2 function. The amount of SETD2 mRNA may be assayed as discussed in more detail below.
The SETD2-deficient cancer preferably comprises (a) a decreased amount of SETD2 protein (such as a decreased amount of SEQ ID NO: 2 or a polymorphism thereof), (b) a decreased amount of SETD2 mRNA, (c) a mutation in SETD2 DNA (such as a mutation in SEQ ID NO: 1 or a polymorphism thereof) or (d) a chromosome 3 abnormality. The SETD2-deficient cancer may comprise any combination of (a) to (d). In particular, the SETD2-deficient cancer may comprise (a); (b); (c); (d); (a) and (b); (a) and (c); (a) and (d); (b) and (c); (b) and (d); (c) and (d); (a),(b) and (c); (a), (b) and (d); (a),(c) and (d); (b), (c) and (d); or (a), (b), (c) and (d). The mutation in (c) may be any of those discussed above.
Screening for SETD2 deficiency
Before treatment in accordance with the invention, it is necessary to determine whether or not the cancer is SETD2-deficient. This can be done is several ways as discussed below. The
presence of SETD2-deficiency indicates that the cancer is suitable for treatment using a WEE1 inhibitor or a CHK1 inhibitor or an ATR inhibitor in accordance with the invention.
The measurement of or the identification of any combination of (a) a decreased amount of SETD2 protein (such as a decreased amount of SEQ ID NO: 2 or a polymorphism thereof), (b) a decreased amount of SETD2 mRNA, (c) a mutation in SETD2 DNA (such as a mutation in SEQ ID NO: 2 or a polymorphism thereof) or (d) a chromosome 3 abnormality in a cancer is typically indicative that the cancer is SETD2-deficient. All possible combinations are set out above. Conversely, the absence of any of (a) to (d) in a cancer is typically indicative that the cancer is not SETD2-deficient.
The measurement of or the identification of a decreased amount of H3K36me3 is typically indicative that the cancer is SETD2-deficient. Conversely, the absence of a decreased amount of H3K36me3 in a cancer is typically indicative that the cancer is not SETD2-deficient.
SETD2 deficiency can be measured using known techniques. The amount of SETD2 protein can be measured using immunohistochemistry, western blotting, mass spectrometry or fluorescence-activated cell sorting (FACS). These techniques may be used to measure the amount of human SETD2 (SEQ ID NO: 2 and polymorphisms thereof). Suitable antibodies for use in these techniques are discussed below with reference to the kits of the invention.
The amount of SETD2 mRNA can be measured using quantitative reverse transcription polymerase chain reaction (qRT-PCR), such as real time qRT-PCR, northern blotting or microarrays. Mutations in SETD2 mRNA may be identified using RNA sequencing including next-generation sequencing.
Mutations in the SETD2 gene may be identified using DNA sequencing including next- generation sequencing. This may also be done using Southern blotting, measuring copy-number variation and investigating SETD2 promoter methylation. These techniques may be used to identify mutations in the human SETD2 gene (SEQ ID NO: 1 and polymorphisms thereof).
Chromosome 3 abnormalities, such as chromosome 3p deletion or rearrangement, may be identified using cytogenetic analysis such as giemsa banding, fluorescence in situ hybridisation (FISH) or comparative genomic hybridization, such as array-comparative genomic hybridization (array CGH).
The function of SETD2 can be determined by measuring the extent of H3K36 methylation. For instance, decreased amounts of H3K36me3 (which is the product of SETD2) can be measured using immunohistochemistry, western blotting, mass spectrometry and FACS. The same techniques may be used to measure an increased amount of H3K36me2.
SETD2 deficiency is typically measured in a cancer biopsy obtained from the patient. Any of the methods discussed above may be carried on a cancer biopsy. Such methods may also
be carried out on cancer cells circulating in the blood of the patient. The RNA methods may be carried out on urinary or blood exosomes. The DNA methods may be carried out on circulating free DNA in blood.
Cancer types
A number of different cancers have been identified as being SETD2-deficient. These are summarised in Table 2. Any of these types of cancers may be treated in accordance with the invention. The invention is also suitable for treating any types of cancer that are identified as SETD2-deficient.
Table 2 - Mutation rate of SETD2 in various cancers
*Sanger COSMIC:
http://cancer.sanger.ac.uk/cosmic/gene/analysis?ln=SETD2&start=l&end=2062&id=7148#ts
Early T-cell precursor acute lymphoblastic leukaemia has also been identified as SETD2- deficient (Zhang et al., 2012). Hence, the SETD2-deficient cancer treated in accordance with the invention may be leukaemia, preferably early T-cell precursor acute lymphoblastic leukaemia.
Method of treating a cancer comprising an increased amount of and/or an increased activity of KDM4A, KDM4B. KDM4C or a combination thereof
The KDM4/JMJD2 family of histone demethylases contain a JmjN-JmjC domain, together with a tandem- Tudor domain that specifically removes the tri and di-methyl forms both H3K9 and H3K36, with preference for the trimethyl form being observed in the case of
KDM4A JMJD2A (Couture et al., 2007; Hillringhaus et al., 2011; Klose et al., 2006; Whetstine et al., 2006). The cDNA sequences of KDM4A, KDM4B and KDM4C are shown in SEQ ID NOs: 30, 32 and 34 respectively. The amino acid sequences of of KDM4A, KDM4B and KDM4C are shown in SEQ ID NOs: 31, 33 and 35 respectively
The cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises an increased amount of and/or an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof. The cancer more preferably comprises an increased amount of and an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof. The cancer may comprise an increased amount of and/or an increased activity of KDM4A; KDM4B; KDM4C; KDM4A and KDM4B; KDM4A and KDM4C; KDM4B and KDM4C; or KDM4A, KDM4B and KDM4C. These combinations apply to any of the KDM4 embodiments discussed below.
The cancer may comprise an increased amount of and/or an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof compared with normal cells of the same tissue type. For instance, in lung cancer, the amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be increased compared with normal lung cells. The amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be increased by any amount For instance, the amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be increased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared with the amount and/or activity in normal cells of the same type. In combinations, the amount and/or activity of the different KDM4s may be increased to different degrees.
All three Tudor domain containing KDM4/JMJD2 proteins (KDM4A KDM4B and KDM4C) (all of which demethylate H3K36me3/2) are frequently overexpressed in various cancers, including breast, colorectal, lung and prostate (Berry and Janknecht, 2013). They are believed to be oncogenes. Further the Sanger COSMIC database identifies copy number gain of KDM4A, KDM4B and KDM4C (Table 3). For example, KDM4A shows copy number gain in ovarian cancer (32%), cancers of the lung (14.5%), central nervous system (10.7%), breast (10.6%), and pancreas (9.4%) http://cancer.sanger.ac.uk/cosmi c/gene/analysis?ln=KDM4A#dist. Such copy number gain is associated with protein overexpression (cBioPortal) and poor prognosis. For example, KDM4A is over-expressed in 46% of ovarian cancers and is
significantly associated with reduced survival (median 691 days v.s. 1052 days) (Black et al., 2013).
- Frequency of copy number gain of KDM4 family g
Source: Sanger COMSIC http://cancer.sanger.ac. uk/cosmic/gene/analysis?ln=KDM4A#dist.
The cancer may comprise a mutation of the KDM4A gene and/or mRNA, a mutation of the KDM4B gene and/or mRNA, a mutation of the KDM4C gene and/or mRNA (such as a mutation in SEQ ID NO: 30, 32, 34 or a polymorphism thereof) or a combination thereof.
The cancer may comprise a copy number gain of the KDM4A gene and/or mRNA, a copy number gain of the KDM4B gene and/or mRNA, a copy number gain of the KDM4C gene and/or mRNA (such as a copy number gain of SEQ ID NO: 30, 32 or 34 or a polymorphism thereof) or a combination thereof.
In some instances, the mutation in or copy number gain of KDM4A, KDM4B, KDM4C or a combination thereof may be due to a chromosome 3 abnormality, such as chromosome 3p deletion or rearrangement. The cancer may therefore comprise a chromosome abnormality, such as chromosome 3p deletion or rearrangement. This can be measured as discussed above.
In some instances, the increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof may be due to mutations in other genes which affect the expression of the KDM4A protein, KDM4B protein, KDM4C protein (such as SEQ ID NO: 31, 33 or 35 or a polymorphism thereof) or a combination thereof, its/their stability or its/their ability to function.
It will be clear from the above that a variety of mutations may affect the expression of the KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof, its/their stability or its/their ability to function. The cancer may comprise an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof. The cancer may comprise an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination
thereof compared with normal cells of the same tissue type. The amount of the protein may be increased by any amount and in particular the % amounts discussed above.
The cancer may comprise a KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof with increased function. The cancer may comprise a KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof with increased function compared with normal (i.e. wild-type or native) KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof (such as SEQ ID NO: 31, 33, 35, polymorphisms thereof or a combination thereof). The function of the KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof may be increased by any amount and in particular the % amounts discussed above. The function of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof, for instance its/their ability to catalyse the H3K36 tri- to di-methylation in human cells, can be assayed as discussed in more detail above.
It will be clear from the above that mutations may affect the amount of the KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof. The cancer may comprise an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof. The cancer may comprise an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof compared with normal cells of the same tissue type. The amount of the KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof may be increased by any amount and in particular the % amounts discussed above. The amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof may be assayed as discussed above for SETD2 mRNA.
The cancer preferably comprises (a) an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof (such as an increased amount of SEQ ID NO: 31, 33, 35, polymorphisms thereof or a combination thereof), (b) an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof, (c) a mutation in KDM4A DNA, KDM4B DNA, KDM4C DNA or a combination thereof (such as a mutation in SEQ ID NO: 30, 32, 34, polymorphisms thereof or a combination thereof) or (d) a chromosome 3 abnormality. The cancer may comprise any combination of (a) to (d). In particular, the cancer may comprise (a); (b); (c); (d); (a) and (b); (a) and (c); (a) and (d); (b) and (c); (b) and (d); (c) and (d); (a),(b) and (c); (a), (b) and (d); (a),(c) and (d); (b), (c) and (d); or (a), (b), (c) and (d).
Before treatment in accordance with the invention, it is necessary to determine whether or not the cancer comprises an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof. This can be done is several ways as discussed above with reference to SETD2. The presence of an increased amount and/or activity of KDM4A, KDM4B, KDM4C or
a combination thereof indicates that the cancer is suitable for treatment using a WEE1 inhibitor or a CHK1 inhibitor or an ATR inhibitor in accordance with the invention.
The measurement of or the identification of any combination of (a) an increased amount of KDM4A protein, KDM4B protein, KDM4C protein or a combination thereof (such as an increased amount of SEQ ID NO: 31, 33, 35, polymorphisms thereof or a combination thereof), (b) an increased amount of KDM4A mRNA, KDM4B mRNA, KDM4C mRNA or a combination thereof, (c) a mutation in KDM4A DNA, KDM4B DNA, KDM4C DNA or a combination thereof (such as a mutation in SEQ ID NO: 30, 32, 34, polymorphisms thereof or a combination thereof) or (d) a chromosome 3 abnormality is typically indicative that the cancer is suitable for treatment in accordance with the invention. All possible combinations are set out above. Conversely, the absence of any of (a) to (d) in a cancer is typically indicative that the cancer is not suitable for treatment in accordance with the invention.
The measurement of or the identification of a decreased amount of H3K36me3 is typically indicative that the cancer comprises an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof Conversely, the absence of or a decreased amount of H3K36me3 in a cancer is typically indicative that the cancer does not comprise an increased amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof.
All of the methods described above with reference to SETD2 are equally applicable to KDM4A, KDM4B, KDM4C or a combination thereof.
The amount and/or activity of KDM4A, KDM4B, KDM4C or a combination thereof is typically measured in a cancer biopsy obtained from the patient. This is also described above with reference to SETD2.
A number of different cancers have been identified as having a copy gain number of KDM4A, KDM4B, KDM4C or a combination thereof. These are summarised in Table 2. The cancer treated in accordance with the invention is preferably colorectal cancer, prostate cancer, ovarian cancer, lung cancer, central nervous system (CNS) cancer, breast cancer, pancreatic cancer, large intestine cancer or kidney cancer.
Method of treating a cancer comprising a mutated histone H3 and/or a mutation in a histone H3 gene
Mutations in histone H3 itself can affect its ability to be methylated and hence the amount of H3K36me3 (or the amount of H3K36me3 and H3K36me2). The cDNA sequences of the different versions of human histone H3 are shown in SEQ D NOs: 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62 and 64. The amino acid sequences of the different versions of human
histone H3 are shown in SEQ ID NOs: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 and 65.
The cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises a mutated histone H3 protein (such as a mutated SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65 or a polymorphism thereof) and/or a mutation in a histone H3 gene (such as a mutation in SEQ ID NO: 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64 or a polymorphism thereof). The cancer more preferably comprises a mutated histone H3 protein and a mutation in a histone H3 gene.
The cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises a mutated histone H3.3 protein (such as a mutated SEQ ID NO: 63, 65 or a polymorphism thereof) and/or a mutation in a histone H3.3 gene (such as a mutation in SEQ ID NO: 62, 64 or a polymorphism thereof). The cancer more preferably comprises a mutated histone H3.3 protein and a mutation in a histone H3.3 gene.
The mutation is preferably H3.3-K36M. The mutation is more preferably H3.3-G34R/V. The mutation H3.3-G34R/V is observed in glioma, such as high-grade glioma.
Mutations in a histone H3 protein or a histone H3 gene can be determined using any of the techniques discussed above.
Method of treating a cancer comprising a mutation in the IDHl gene
The cDNA sequence of IDHl is shown in SEQ ID NO: 66. Mutations in the IDHl are observed in gliomas. The cancer which comprises a decreased amount of H3K36me3 is preferably a cancer which comprises a mutation in the IDHl gene (such as a mutation in SEQ ID NO: 66 or a polymorphism thereof). The mutation in the IDHl gene may manifest itself as a mutation in the IDHl protein (such as a mutation in SEQ ID NO: 67 or a polymorphism thereof).
Mutations is the IDHl gene or in the IDHl protein can be determined using any of the techniques discussed above.
Patient
Any patient may be treated in accordance with the invention. The patient is typically human. However, the patient can be another animal or mammal, such as a commercially farmed animal, such as a horse, a cow, a sheep or a pig, or may alternatively be a pet, such as a cat, a dog or a hamster.
WEE1
WEEl kinase delays entry into mitosis by negatively regulating the cyclin-dependent kinase through phosphorylation of CDK1 and CDK2 thus inhibiting CDK activity (Gould and Nurse, 1989; Parker and Pi wnica- Worms, 1992; Russell and Nurse, 1987; Watanabe et al., 1995). In Xenopus, activated XCHK1 can phosphorylate XWEE1 kinase resulting in increased tyrosine 15 phosphorylation and CDK inhibition following CHKl activation (Harvey et al., 2005; Lee et al., 2001). WEEl also functions during DNA replication to directly regulate the Mus81-Emel endonuclease activity in human cells (Dominguez-Kelly et al., 2011). WEEl also phosphorylates histone H2B Tyr37, which suppresses expression of replication-dependent core histone genes (Mahajan et al., 2012). Deregulated CDK activity following inhibition of WEEl kinase induces replication stress and loss of genomic integrity through increased firing of replication origins and subsequent nucleotide shortage (Beck et al., 2012).
CHKl
CHKl activation promotes cell cycle arrest by promoting Cdc25 phosphatase inactivation and degradation, thereby restraining CDK activation (Peng et al., 1997; Sanchez et al., 1997; Sclafani and Holzen, 2007; Sorensen et al., 2003). CHKl activation also functions to prevent firing of late replication origins, premature chromosome condensation following disruption of replication, and also regulates transcriptional responses to DNA damage (Feijoo et al , 2001 ; Maya-Mendoza et al., 2007; Shimada et al., 2008; Syljuasen et al., 2005; Zachos et al., 2003).
ATR
Cells have evolved a complex DNA damage response (DDR) which functions to maintain genome stability under conditions of genotoxic stress. The DDR responses- DNA repair, DNA replication, cell cycle arrest, transcription and apoptosis, are coordinated by the DNA damage checkpoint protein kinases ATM (Ataxia telangiectasia mutated) and ATR (ATM and Rad3- related), which have a wide range of overlapping substrate specificities (Jackson and Bartek, 2009; Smith et al., 2010; Sorensen and Syljuasen, 2012). ATM is activated by DSBs and is primarily responsible for activation of the CHK2 kinase (Ahn et al., 2004), while ATR senses single-stranded DNA (ssDNA) arising at stalled replication forks or at resected DNA double- strand breaks (Zou and Elledge, 2003) and primarily phosphorylates and activates CHKl kinase (Mordes and Cortez, 2008).
Inhibitors
A WEEl inhibitor or a CHKl inhibitor or an ATR inhibitor (or an inhibitor of WEEl or CHKl or ATR) is any molecule that reduces the function of WEEl or CHKl or ATR. The
inhibitor may decrease the function of WEEl or CHKl or ATR by any amount. For instance, the function may be decreased by at least 10%, at least 30% at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. An inhibitor may abolish the function of WEEl or CHKl or ATR (i.e. the function is decreased by 100%). WEEl or CHKl or ATR function may be measured using known techniques. The extent to which an inhibitor affects its target kinase may be determined by measuring the function of the kinase in cells in the presence and absence of the inhibitor. The cells may be normal cells or may be cancer cells. The kinase activity of WEEl, CHKl or ATR can be measured by the amount of phosphorylation of their target by, for example, western blotting. WEEl inhibition leads to reduced CDK1 phosphorylation at Threonine 14 and Tyrosine 15. The CHKl inhibitor Go 6976 leads to increased phosphorylation of Ser345 or Ser317 on CHKl itself (Leung-Pineda et al., 2006). CHKl inhibitor AZD7762 leads to increased phosphorylation of Ser345 and decreased Ser296 on CHKl (Parsels et al., 201 1). ATR activity is tested by monitoring Chkl Ser345
phosphorylation (Reaper et al., 2011)
The inhibitor may affect the function of WEEl or CHKl or ATR in any manner. For instance, the inhibitor may decrease the amount of WEEl or CHKl or ATR, for instance by decreasing the expression of or increasing the degradation of WEEl or CHKl or ATR. The inhibitor may decrease the activity of WEEl or CHKl or ATR, for instance by binding to WEEl or CHKl or ATR or the molecule(s) which WEEl or CHKl or ATR phosphorylate(s).
The inhibitor may be a competitive inhibitor (which binds the active site of the molecule to which it binds) or an allosteric inhibitor (which does not bind the active site of the molecule to which it binds). The inhibitor may be reversible. The inhibitor may be irreversible.
The inhibitor may decrease the production of or expression of WEEl or CHKl or ATR. The inhibitor may decrease the transcription of WEEl or CHKl or ATR. The inhibitor may disrupt the DNA of WEEl or CHKl or ATR, for instance by site-specific mutagenesis using methods such as Zinc-finger nucleases. The inhibitor may decrease the mR A level of WEEl or CHKl or ATR or interfere with the processing of WEEl or CHKl or ATR mRNA, for instance by antisense RNA or RNA interference. This is discussed in more detail below.
The inhibitor may increase protein degradation of WEEl or CHKl or ATR. The inhibitor may increase the level of natural inhibitors of WEEl or CHKl or ATR. The inhibitor may decrease the function of WEEl or CHKl or ATR by inhibitory phosphorylation, ubiquitylation, sumoylation or the like.
The inhibitor is preferably a small molecule inhibitor, a protein, an antibody, a polynucleotide, an oligonucleotide, an antisense RNA, small interfering RNA (siRNA) or small hairpin RNA (shRNA).
Small molecule inhibitors
WEEl inhibition has been shown to abrogate the G2-M checkpoint, resulting in cancer cells with DNA damage to enter mitosis inappropriately, resulting in mitotic catastrophe (De Witt Hamer et al., 2011). MK-1775 shows activity against sarcoma cells in vitro as a single agent or combined with Gemcitabine (Kreahling et al., 2013) and also shows antitumour activity when combined with cytotoxic agents in non-small cell lung carcinomas (Murrow et al., 2010; Yoshida et al., 2004), breast (Murrow et al., 2010), prostate (Kiviharju-af Hallstrom et al., 2007), pancreatic (Rajeshkumar et al., 2011), ovarian (Mizuarai et al., 2009) and colon cancers (Hirai et al., 2010). The WEEl inhibitor is preferably MK-1775 (whose structure is shown in Fig 1 1).
CHK1 has been targeted using a number of small molecule inhibitors. Go 6976, initially used as a protein kinase C inhibitor, also acts as a potent inhibitor of CHK1 and CHK2 resulting in abrogation of DNA damage -induced S- and G2 cell cycle checkpoints (Jia et al., 2009; Kohn et al., 2003). Go 6976 has a synergistic cytotoxic effect when combined with a number of DNA damaging agents including doxorubicin and paclitaxel, radiotherapy, and Cisplatin (Aaltonen et al., 2007; Feng et al., 2010; Thompson et al., 2012). LYS2603618 is a potent and selective inhibitor of CHK1 and has recently been found to show acceptable safety and pharmacokinetic profiles when administered after the DNA damaging anti-metabolite pemetrexed (Weiss et al., 2013). AZD7762, has also been shown to be a potent ATP-competitive CFD 1 kinase inhibitor which results in the abrogation of DNA damage-induced cell cycle arrest (Zabludoff et al., 2008). This is currently being evaluated in clinical trials either alone or in combination with chemotherapeutic agents and ionizing radiation (Ma et al., 201 1). The CFIK1 inhibitor is preferably AZD7762, LY2603618 (IC-83) or Go 6976 (whose structures are shown in Fig 11).
Small molecules targeting ATR impair G2 M arrest and increase sensitivity to DNA damaging agents (Peasland et al., 201 1 ; Reaper et al., 201 1; Toledo et al., 2011). The use of VE- 821, a selective small molecule inhibitor of ATR has recently been shown to selectively sensitize pancreatic cancer cells and hypoxic cancer cells to radiation (Pires et al., 2012; Prevo et al., 2012) (reviewed in (Fokas et al., 2013)). AZ20, another ATR inhibitor has shown antitumour effect in xenograft models (Foote et al., 2013). The ATR inhibitor is preferably VE-821 or AZ20. The structure of VE-821 is shown in Fig 11.
Protein and polynucleotide inhibitors
The inhibitor of WEEl or CHK1 or ATR may be a protein. The inhibitor is preferably a non- functional form of WEEl or CFD 1 or ATR, such as dominant-negative or an enzyme-dead protein which prevents the function of the wild type protein. A non-functional form of WEEl or
CHKl or ATR will compete with native (i.e. wild-type) WEE1 or CHKl or ATR in the cancer cells and reduce WEE1 or CHKl or ATR function.
The amino acid sequence of human WEE1 (isoform 1) is shown in SEQ ID NO: 5. The amino acid sequence of isoform 2 of human WEE1 is shown in SEQ ID NO: 7. The amino acid sequence of human CHKl (isoform 1) is shown in SEQ ID NO: 10. The amino acid sequence of the shorter isoform of human CHKl is shown in SEQ ID NO: 13. The amino acid sequence of human ATR is shown in SEQ ID NO: 16.
The inhibitor is preferably a non-functional variant of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof. A non-functional variant is a protein that has an amino acid sequence which varies from that of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof and does not have the ability to function as WEE1 or CHKl or ATR. For instance, the variant may have one or more mutations in the active site of the kinase. The ability of a variant to function as WEE1 or CHKl or ATR can be assayed using any method known in the art. Suitable methods are described above.
A non-functional variant of SEQ ID NO: 5 preferably comprises a substitution at position K328 and more preferably comprises the substitution K328R (McGowan and Russell, 1993). A non- functional variant of SEQ ID NO: 7 may comprise corresponding substitutions.
A non- functional variant of SEQ ID NO: 10 preferably comprises a substitution at one or more of the following positions K38 (Heffernan et al, 2002), D130 (Sanchez et al, 1997) R372 (Zhang et al., 2009), R376 (Zhang et al., 2009) and R379 (Zhang et al., 2009). A non-functional variant of SEQ ID NO: 10 more preferably comprises one or more of the following substitutions K38R, D130A, R372E, R376E and R379E. A non-functional variant of SEQ ID NO: 13 may comprise corresponding substitutions.
A non- functional variant of SEQ ID NO: 16 preferably comprises a substitution at one or more of the following positions K2327 (Tibbetts et al, 1999), D2475 (Cliby et al, 1998) and D2494 (Wright et al., 1998). A non-functional variant of SEQ ID NO: 16 preferably comprises one or more of the following substitutions K2327R, D2475A and D2494E.
A dominant-negative variant of SEQ ID NO: 16 (ATR) preferably comprises a truncating mutation in exon 10 of ATR (Lewis et a! ., 2005) .
The variant may be a naturally occurring variant which is expressed naturally, for instance in humans. Alternatively, the variant may be expressed in vitro or recombinantly by a bacterium such as Escherichia coli. Variants also include non-naturally occurring variants produced by recombinant technology.
Over the entire length of the amino acid sequence of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof, a variant will preferably be at least 80% homologous to that sequence based
on amino acid identity. More preferably, the variant may be at least 85%, at least 90% and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NOs: 5, 7, 10, 13 or 16 or any isoform thereof over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95%, amino acid identity over a stretch of 200 or more, for example 300, 400, 500, 600, 700, 800, 1000, 1500 or 2000 or more, contiguous amino acids ("hard homology").
Standard methods in the art may be used to determine homology. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al (1984) Nucleic Acids Research 12, p387- 395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S.F et al (1990) J Mol Biol 215 :403-10. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/).
Amino acid substitutions may be made to the amino acid sequences of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof, for example up to 1, 2, 3, 4, 5, 10, 20, 30, 50, 100 or 200 substitutions. Conservative substitutions replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side-chain volume. The amino acids introduced may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge to the amino acids they replace. Alternatively, the conservative substitution may introduce another amino acid that is aromatic or aliphatic in the place of a pre-existing aromatic or aliphatic amino acid. Conservative amino acid changes are well-known in the art and may be selected in accordance with the properties of the 20 main amino acids as defined in Table 4 below. Where amino acids have similar polarity, this can also be determined by reference to the hydropathy scale for amino acid side chains in Table 5.
Chemical properties of amino acids
Ala aliphatic, hydrophobic, neutral Met hydrophobic, neutral
Cys polar, hydrophobic, neutral Asn polar, hydrophilic, neutral
Asp polar, hydrophilic, charged (-) Pro hydrophobic, neutral
Glu polar, hydrophilic, charged (-) Gin polar, hydrophilic, neutral
Phe aromatic, hydrophobic, neutral Arg polar, hydrophilic, charged (+)
Gly aliphatic, neutral Ser polar, hydrophilic, neutral
His aromatic, polar, hydrophilic, Thr polar, hydrophilic, neutral charged (+)
He aliphatic, hydrophobic, neutral Val aliphatic, hydrophobic, neutral
Lys polar, hydrophilic, charged(+) Trp aromatic, hydrophobic, neutral
Leu aliphatic, hydrophobic, neutral Tyr aromatic, polar, hydrophobic
Table 5- Hydropathy scale
Side Chain Hydropathy
He 4.5
Val 4.2
Leu 3.8
Phe 2.8
Cys 2.5
Met 1.9
Ala 1.8
Gly -0.4
Thr -0.7
Ser -0.8
Trp -0.9
Tyr -1.3
Pro -1.6
His -3.2
Glu -3.5
Gin -3.5
Asp -3.5
Asn -3.5
Lys -3.9
Arg -4.5
One or more amino acid residues of the amino acid sequence of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof may additionally be deleted from the polypeptides described above. Up to 1, 2, 3, 4, 5, 10, 20, 30 or 50 residues may be deleted, or more.
Variants may include fragments of SEQ ID NO: 5, 7, 10, 13 or 16 or any isoform thereof. Such fragments typically retain the kinase domain of 5, 7, 10, 13 or 16 or any isoform thereof but
are non-fUnctional. Fragments may be at least 600, 700, 800 or 900 amino acids in length. One or more amino acids may be alternatively or additionally added to the polypeptides described above.
Alternatively, the inhibitor may be a polynucleotide encoding a non-functional variant of WEE1 or CHKl or ATR. The non- functional variant may be any of those discussed above.
A polynucleotide, such as a nucleic acid, is a polymer comprising two or more nucleotides. The nucleotides can be naturally occurring or artificial. A nucleotide typically contains a nucleobase, a sugar and at least one linking group, such as a phosphate, 2'O-methyl, 2' methoxy-ethyl, phosphoramidate, methylphosphonate or phosphorothioate group. The nucleobase is typically heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines and more specifically adenine (A), guanine (G), thymine (T), uracil (U) and cytosine (C). The sugar is typically a pentose sugar. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. The nucleotide is typically a ribonucleotide or deoxyribonucleotide. The nucleotide typically contains a monophosphate, diphosphate or triphosphate. Phosphates may be attached on the 5' or 3' side of a nucleotide.
Nucleotides include, but are not limited to, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), 5-methylcytidine monophosphate, 5- methylcytidine diphosphate, 5-methylcytidine triphosphate, 5-hydroxymethylcytidine monophosphate, 5-hydroxymethylcytidine diphosphate, 5-hydroxymethylcytidine triphosphate, cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP),
deoxyadenosine triphosphate (dATP), deoxyguanosine monophosphate (dGMP),
deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), deoxyuridine triphosphate (dUTP), deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP), 5-methyl-2'-deoxycytidine monophosphate, 5- methyl-2' -deoxycytidine diphosphate, 5 -methyl-2' -deoxycytidine triphosphate, 5- hydroxymethyl-2' -deoxycytidine monophosphate, 5-hydroxymethyl-2'-deoxycytidine diphosphate and 5-hydroxymethyl-2'-deoxycytidine triphosphate. The nucleotides are preferably selected from AMP, TMP, GMP, UMP, dAMP, dTMP, dGMP or dCMP.
The nucleotides may contain additional modifications. In particular, suitable modified nucleotides include, but are not limited to, 2'amino pyrimidines (such as 2'-amino cytidine and 2'-amino uridine), 2'-hyrdroxyl purines (such as , 2'-fluoro pyrimidines (such as 2'- fluorocytidine and 2'fluoro uridine), hydroxyl pyrimidines (such as 5'-a-P-borano uridine), 2'- O-methyl nucleotides (such as 2'-0-methyl adenosine, 2'-0-methyl guanosine, 2'-0-methyl cytidine and 2'-0-methyl uridine), 4'-thio pyrimidines (such as 4'-thio uridine and 4'-thio cytidine) and nucleotides have modifications of the nucleobase (such as 5-pentynyl-2'-deoxy uridine, 5-(3-aminopropyl)-uridine and l,6-diaminohexyl-N-5-carbamoylmethyl uridine).
One or more nucleotides in the polynucleotide can be oxidized or methylated. One or more nucleotides in the polynucleotide may be damaged. For instance, the polynucleotide may comprise a pyrimidine dimer. Such dimers are typically associated with damage by ultraviolet light.
The nucleotides in the polynucleotide may be attached to each other in any manner. The nucleotides may be linked by phosphate, 2'0-methyl, 2' methoxy-ethyl, phosphoramidate, methylphosphonate or phosphorothioate linkages. The nucleotides are typically attached by their sugar and phosphate groups as in nucleic acids. The nucleotides may be connected via their nucleobases as in pyrimidine dimers.
The polynucleotide can be a nucleic acid, such as deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). The polynucleotide may be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), morpholino nucleic acid or other synthetic polymers with nucleotide side chains. The polynucleotide may be single stranded or double stranded.
The polynucleotide sequence preferably comprises a variant of SEQ ID NO: 3, 4, 6, 8, 9, 11, 12, 14 or 15 or any isoform thereof with at least 80%, at least 90%, at least 95%, at least 97%, at least 98% or at least 99% homology based on nucleotide identity over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95% nucleotide identity over a stretch of 600 or more, for example 900, 1200, 1500, 1800, 2100, 2400, 3000, 4500 or 6000 or more, contiguous nucleotides ("hard homology"). Homology may be calculated as described above. The polynucleotide sequence may comprise a sequence that differs from SEQ ID NO: 3, 4, 6, 8, 9, 11, 12, 14 or 15 or any isoform thereof on the basis of the degeneracy of the genetic code.
Polynucleotide sequences may be derived and replicated using standard methods in the art, for example using PCR involving specific primers. It is straightforward to generate polynucleotide sequences using such standard techniques.
The amplified sequences may be incorporated into a recombinant replicable vector such as a cloning vector. The vector may be used to replicate the polynucleotide in a compatible host cell. Thus polynucleotide sequences may be made by introducing the polynucleotide into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell. Suitable host cells for cloning of polynucleotides are known in the art and described in more detail below.
The polynucleotide sequence may be cloned into any suitable expression vector. In an expression vector, the polynucleotide sequence encoding a construct is typically operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell. Such expression vectors can be used to express a construct.
The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked' to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. Multiple copies of the same or different polynucleotide may be introduced into the vector.
The expression vector may then be introduced into a suitable host cell. Thus, a construct can be produced by inserting a polynucleotide sequence encoding a construct into an expression vector, introducing the vector into a compatible bacterial host cell, and growing the host cell under conditions which bring about expression of the polynucleotide sequence. The vectors may be for example, plasmid, virus or phage vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide sequence and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene. Promoters and other expression regulation signals may be selected to be compatible with the host cell for which the expression vector is designed. A T7, trc, lac, ara or λι, promoter is typically used.
The host cell typically expresses the construct at a high level. Host cells transformed with a polynucleotide sequence encoding a construct will be chosen to be compatible with the expression vector used to transform the cell. The host cell is typically bacterial and preferably E. coll Any cell with a λ DE3 lysogen, for example C41 (DE3), BL21 (DE3), JM109 (DE3), B834 (DE3), TUNER, Origami and Origami B, can express a vector comprising the T7 promoter.
Antisense and RNAi
Inhibitors of WEE1 or CHK1 or ATR may also reduce amounts of WEE1 or CHK1 or ATR present in the patient, for example by knocking down expression of WEE1 or CHK1 or
ATR. Antisense and RNA interference (RNAi) technology for knocking down protein expression are well known in the art and standard methods can be employed to knock down expression of WEE1 or CHK1 or ATR.
Both antisense and siRNA technology interfere with mRNA. Antisense oligonucleotides interfere with mRNA by binding to (hybridising with) a section of the mRNA. The antisense oligonucleotide is therefore designed to be complementary to the mRNA (although the oligonucleotide does not have to be 100% complementary as discussed below). In other words, the antisense oligonucleotide may be a section of the cDNA. Again, the oligonucleotide sequence may not be 100% identical to the cDNA sequence. This is also discussed below.
RNAi involves the use of double-stranded RNA, such small interfering RNA (siRNA) or small hairpin RNA (shRNA), which can bind to the mRNA and inhibit protein expression.
Accordingly, the inhibitor preferably comprises an oligonucleotide which specifically hybridises to a part of SEQ ID NO: 4, 6, 9, 12 or 15 (WEEJ or CHK1 or ATR mRNA) or any isoform thereof. Oligonucleotides are short nucleotide polymers which typically have 50 or fewer nucleotides, such 40 or fewer, 30 or fewer, 22 or fewer, 21 or fewer, 20 or fewer, 10 or fewer or 5 or fewer nucleotides. The oligonucleotide used in the invention is preferably 20 to 25 nucleotides in length, more preferably 21 or 22 nucleotides in length. The nucleotides can be naturally occurring or artificial. The nucleotides can be any of those described above.
An oligonucleotide preferably specifically hybridises to a part of a SEQ ID NO: 4, 6, 9, 12 or 15 or any isoform thereof, hereafter called the target sequence. The length of the target sequence typically corresponds to the length of the oligonucleotide For instance, a 21 or 22 nucleotide oligonucleotide typically specifically hybridises to a 21 or 22 nucleotide target sequence. The target sequence may therefore be any of the lengths discussed above with reference to the length of the oligonucleotide. The target sequence is typically consecutive nucleotides within the target polynucleotide.
An oligonucleotide "specifically hybridises" to a target sequence when it hybridises with preferential or high affinity to the target sequence but does not substantially hybridise, does not hybridise or hybridises with only low affinity to other sequences.
An oligonucleotide "specifically hybridises" if it hybridises to the target sequence with a melting temperature (Tm) that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C or at least 10 °C, greater than its Tm for other sequences. More preferably, the oligonucleotide hybridises to the target sequence with a Tm that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its Tm for other nucleic acids. Preferably, the portion hybridises to the target sequence with a Tm
that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its Tm for a sequence which differs from the target sequence by one or more nucleotides, such as by 1, 2, 3, 4 or 5 or more nucleotides. The portion typically hybridises to the target sequence with a Tm of at least 90 °C, such as at least 92 °C or at least 95 °C. Tm can be measured experimentally using known techniques, including the use of DNA microarrays, or can be calculated using publicly available Tm calculators, such as those available over the internet.
Conditions that permit the hybridisation are well-known in the art (for example,
Sambrook et al., 2001, Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbour Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wiley-lnterscience, New York (1995)). Hybridisation can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaCl and 1 % SDS (sodium dodecyl sulfate) at 37 °C followed by a 20 wash in from IX (0.1650 M Na+) to 2X (0.33 M Na+) SSC (standard sodium citrate) at 50 °C. Hybridisation can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaCl, and 1 % SDS at 37 °C, followed by a wash in from 0.5X (0.0825 M Na+) to IX (0.1650 M Na+) SSC at 55 °C.
Hybridisation can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 M NaCl, 1% SDS at 37 °C, followed by a wash in 0. IX (0.0165 M Na+) SSC at 60 °C.
The oligonucleotide may comprise a sequence which is substantially complementary to the target sequence. Typically, the oligonucleotides are 100% complementary. However, lower levels of complementarity may also be acceptable, such as 95%, 90%, 85% and even 80%. Complementarity below 100% is acceptable as long as the oligonucleotides specifically hybridise to the target sequence. An oligonucleotide may therefore have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mismatches across a region of 5, 10, 15, 20, 21, 22, 30, 40 or 50 nucleotides.
Alternatively, the inhibitor preferably comprises an oligonucleotide which comprises 50 or fewer consecutive nucleotides from (a) SEQ ID NO: 3, 8, 11 or 14 {WEE1 or CHK1 or A TR cDNA) or any isoform thereof or (b) a variant sequence which has at least 95%, such as at least 97%, at least 98% or at least 99%, homology to SEQ ID NO: 3, 8, 11 or 14 or any isoform thereof based on nucleotide identity over the entire sequence. The oligonucleotide may be any of the lengths discussed above. It is preferably 21 or 22 nucleotides in length. The
oligonucleotide may comprise any of the nucleotides discussed above, including the modified nucleotides.
The oligonucleotide can be a nucleic acid, such as any of those discussed above. The oligonucleotide is preferably RNA.
The oligonucleotide may be single stranded. The oligonucleotide may be double stranded. The oligonucleotide may compirse a hairpin.
Oligonucleotides may be synthesised using standard techniques known in the art.
Alternatively, oligonucleotides may be purchased. Suitable sources are shown in Table 6.
Administration
In the method of the invention, the WEE1 inhibitor or CHK1 inhibitor or ATR inhibitor is administered to the patient. An inhibitor of WEE1 or CHK1 or ATR may be administered to the patient in any appropriate way. In the invention, the inhibitor may be administered in a variety of dosage forms. Thus, it can be administered orally, for example as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules. It may also be administered byenteral or parenteral routes such as via buccal, anal, pulmonary, intravenous, intra-arterial, intramuscular, intraperitoneal, intraarticular, topical or other appropriate administration routes. The inhibitor may be administered directly into the cancer to be treated. A physician will be able to determine the required route of administration for each particular patient.
The formulation of an inhibitor will depend upon factors such as the nature of the exact inhibitor, etc. An inhibitor may be formulated for simultaneous, separate or sequential use with other inhibitors defined herein or with other cancer treatments as discussed in more detail below.
An inhibitor is typically formulated for administration with a pharmaceutically acceptable carrier or diluent. The pharmaceutical carrier or diluent may be, for example, an isotonic solution. For example, solid oral forms may contain, together with the active substance, diluents, e.g. lactose, dextrose, saccharose, cellulose, corn starch or potato starch; lubricants, e.g. silica, talc, stearic acid, magnesium or calcium stearate, and/or polyethylene glycols; binding agents; e.g. starches, gum arabic, gelatin, methylcellulose, carboxymethylcellulose or polyvinyl pyrrolidone; disaggregating agents, e.g. starch, alginic acid, alginates or sodium starch glycolate; effervescing mixtures; dyestuffs; sweeteners; wetting agents, such as lecithin, polysorbates, laurylsulphates; and, in general, non-toxic and pharmacologically inactive substances used in pharmaceutical formulations. Such pharmaceutical preparations may be manufactured in known manner, for example, by means of mixing, granulating, tabletting, sugar-coating, or film-coating processes.
Liquid dispersions for oral administration may be syrups, emulsions or suspensions. The syrups may contain as carriers, for example, saccharose or saccharose with glycerine and/or mannitol and/or sorbitol.
Suspensions and emulsions may contain as carrier, for example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol. The suspensions or solutions for intramuscular injections may contain, together with the active substance, a pharmaceutically acceptable carrier, e.g. sterile water, olive oil, ethyl oleate, glycols, e.g. propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride.
Solutions for intravenous administration or infusion may contain as carrier, for example, sterile water or preferably they may be in the form of sterile, aqueous, isotonic saline solutions.
For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1% to 2%.
Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the pharmaceutical composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. a suspension. Reconstitution is preferably effected in buffer.
Capsules, tablets and pills for oral administration to an individual may be provided with an enteric coating comprising, for example, Eudragit "S", Eudragit "L", cellulose acetate, cellulose acetate phthalate or hydroxypropylmethyl cellulose.
Polynucleotide or oligonucleotide inhibitors maybe naked nucleotide sequences or be in combination with cationic lipids, polymers or targeting systems. They may be delivered by any available technique. For example, the polynucleotide or oligonucleotide may be introduced by needle injection, preferably intradermally, subcutaneously or intramuscularly. Alternatively, the polynucleotide or oligonucleotide may be delivered directly across the skin using a delivery device such as particle-mediated gene delivery. The polynucleotide or oligonucleotide may be administered topically to the skin, or to mucosal surfaces for example by intranasal, oral, or intrarectal administration.
Uptake of polynucleotide or oligonucleotide constructs may be enhanced by several known transfection techniques, for example those including the use of transfection agents. Examples of these agents include cationic agents, for example, calcium phosphate and DEAE-
Dextran and lipofectants, for example, lipofectam and transfectam. The dosage of the polynucleotide or oligonucleotide to be administered can be altered.
A therapeutically effective amount of the inhibitor is typically administered to the patient. A therapeutically effective amount of is an amount effective to ameliorate one or more symptoms of the cancer. A therapeutically effective amount of the immunotherapy is preferably an amount effective to abolish one or more of, or preferably all of, the symptoms of the cancer. A therapeutically effective amount preferably leads to a reduction in the size of the cancer or more preferably kills all of the cancer cells.
The dose may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular patient. A typical daily dose is from about 0.1 to 50 mg per kg of body weight, according to the activity of the specific inhibitor, the age, weight and conditions of the subject to be treated and the frequency and route of administration. The dose may be provided as a single dose or may be provided as multiple doses, for example taken at regular intervals, for example 2, 3 or 4 doses administered hourly. Preferably, dosage levels of inhibitors are from 5 mg to 2 g.
Typically polynucleotide or oligonucleotide inhibitors are administered in the range of 1 pg to 1 mg, preferably to 1 pg to 10 μg nucleic acid for particle mediated delivery and 10 μg to 1 mg for other routes.
Combination therapy
The inhibitor may be used in combination with one or more other therapies intended to treat the same patient. By a combination is meant that the therapies may be administered simultaneously, in a combined or separate form, to the patient. The therapies may be
administered separately or sequentially to a patient as part of the same therapeutic regimen. For example, an inhibitor may be used in combination with another therapy intended to treat the cancer. The other therapy may be a general therapy aimed at treating or improving the condition of the patient. For example, treatment with methotrexate, glucocorticoids, salicylates, nonsteroidal anti-inflammatory drugs (NSAIDs), analgesics, other DMARDs, aminosalicylates, corticosteroids, and/or immunomodulatory agents (e.g., 6-mercaptopurine and azathioprine) may be combined with the inhibitor. The other therapy may be a specific treatment directed at the cancer suffered by the patient, or directed at a particular symptom of the cancer.
The inhibitor may be used in combination with chemotherapy, radiation therapy and surgery. The inhibitor may also be used in combination with other cancer drugs. Preferred
combinations for use in the invention include, but are not limited to, (a) Go 6976 in combination with doxorubicin , paclitaxel, radiotherapy, or Cisplatin, (b) LYS2603618 in combination with pemetrexed, (c) AZD7762 in combination with a chemotherapeutic agent or ionizing radiation or (d) MK-1775 in combination with Gemcitabine and other cytotoxic agents.
Kit for treating cancer
The present invention also relates to a kit for treating cancer. The kit comprises a means (or reagent) for testing whether or not the cancer comprises a decreased amount of H3K36me3 and an inhibitor of WEE 1 or CHKl or ATR. The kit thereby allows the determination of whether or not cancers comprise a decreased amount of H3K36me3 and the subsequent treatment of such cancers using a WEE1 or CHKl or ATR inhibitor.
The means (or reagent) for testing for whether or not the cancer comprises a decreased amount of H3K36me3 may be any suitable means or reagent for the use in the screening methods described above. The reagent is typically capable of detecting and/or measuring amounts of H3K36me3, SETD2 DNA, SETD2 mRNA, SETD2 protein, SETD2 modification (such as phosphorylation, ubiquitination, sumoylation), KDM4A, B or C DNA, KDM4 A, B or C mRNA, KDM4 A, B or C protein, KDM4 A, B or C modification (such as phosphorylation, ubiquitination, sumoylation), histone H3 DNA, histone H3 mRNA, histone H3 protein, IDHl DNA, IDHl mRNA, IDHl protein and/or detecting possible mutations therein. For example, the kit may include antibodies that specifically bind to H3K36me3, SETD2, KDM4 A, B or C, a histone H3 or IDHl The kit may include any combination of such antibodies, such as antibodies that specifically bind H3K36me3 and SETD2. The kit preferably includes an antibody that specifically binds human H3K36me3, human SETD2, human KDM4 A, B or C, a human histone H3, human IDHl or a polymorphism thereof, i.e. SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when tri-methylated at lysine 36, SEQ ID NO: 2, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65, SEQ ID NO: 67 or a polymorphism thereof. The kit may include an antibody that specifically binds modified or mutated SETD2, modified or mutated KDM4 A, modified or mutated KDM4 B, modified or mutated KDM4 C, a modified or mutated histone H3 or a modified or mutated IDHl .
The kit may further comprise means (or reagent) for testing whether or not the cancer comprises an increased amount of H3K36me2, such as an antibody that specifically binds H3K36me2. The kit may comprise an antibody which specifically binds human histone H3, i.e. SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when di-methylated at lysine 36 or a polymorphism thereof.
An antibody "specifically binds" to a protein when it binds with preferential or high affinity to that protein but does not substantially bind, does not bind or binds with only low affinity to other proteins. For instance, an antibody "specifically binds" to SEQ ID NO: 2 or a polymorphism thereof when it binds with preferential or high affinity to SEQ ID NO: 2 or a polymorphism thereof but does not substantially bind, does not bind or binds with only low affinity to other human proteins. The same applies to SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when tri-methylated at lysine 36, SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63 or 65 when di-methylated at lysine 36, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 67 or a polymorphism thereof.
An antibody binds with preferential or high affinity if it binds with a Kd of 1 x 10-7 M or less, more preferably 5 x 10-8 M or less, more preferably 1 x 10-8 M or less or more preferably 5 x 10-9 M or less. An antibody binds with low affinity if it binds with a Kd of 1 x 10-6 M or more, more preferably l x l 0-5 M or more, more preferably l x l 0-4 M or more, more preferably 1 x 10-3 M or more, even more preferably 1 x 10-2 M or more. A variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of compounds, such as antibodies or antibody constructs and oligonucleotides are well known in the art (see for example Maddox et al, J. Exp. Med. 158, 121 1-1226, 1993).
The antibody may be, for example, a monoclonal antibody, a polyclonal antibody, a single chain antibody, a chimeric antibody, a CDR-grafted antibody or a humanized antibody. The antibody may be an intact immunoglobulin molecule or a fragment thereof such as a Fab, F(ab')2 or Fv fragment.
The kit may comprise an oligonucleotide which specifically hybridises to part of SETD2 DNA, KDM4 A, B or C DNA, H3.3 DNA or IDH1 DNA. The kit preferably comprises an oligonucleotide which specifically hybridises to part of human SETD2 cDNA, human KDM4 A, B or C DNA, human H3.3 DNA or human IDH1 DNA, such as SEQ ID NO: 1, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66 or a polymorphism thereof. Such oligonucleotides may be used to detect and/or measure amounts of SETD2 DNA, KDM4 A, B or C DNA, histone H3 DNA or IDH1 DNA and possible mutations therein. Oligonucleotides, parts and specific hybridisation are discussed above.
The kit also comprises a WEE1 inhibitor or CHK1 inhibitor or ATR inhibitor. The inhibitor may be any of those discussed above.
The kit may additionally comprise one or more other reagents or instruments which enables the method mentioned above to be carried out. Such reagents include means for taking a sample from the patient, suitable buffers, means to extract/isolate H3K36me3, H3K36me2, SETD2, KDM4 A, B or C, H3.3, histone H3 or IDH1 from the sample or a support comprising
wells on which quantitative reactions can be done. The kit may, optionally, comprise instructions to enable the kit to be used in the method of invention or details regarding patients on which the method may be carried out. The kit may comprise primers and reagents for PCR, qPCR (quantitative PCR), RT-PCR (reverse-transcription PCR), qRT-PCR (quantitative reverse- transcription PCR) reaction or R A sequencing.
Example 1
Materials & Methods
Cell lines and cell culture
U20S, a cell line derived from osteosarcoma was obtained from American Type Culture Collection ATCC (ATCC number HTB-96). A-498 (ATCC number HTB-44), a cell line derived from kidney carcinoma were obtained and cultured as previously described. U20S and A498 were grown in DMEM (Dulbecco) cell culture medium supplemented with 10% FCS and antibiotics. Both cell lines were routinely mycoplasma tested and found to be negative.
Inhibitors
All inhibitors (except hydroxyurea) were dissolved in Dimethyl sulfoxide (DMSO) at lOmM and stored at -80°C, and used in accordance with the manufacturers' instructions.
Hydroxyurea was dissolved in water immediately prior to use. The inhibitors used are summarised in Table 6 below and their structures are shown in Fig 1 1.
Table 6 - Inhibitors used in the experiments
Inhibitor Target Purchased from
MK-1775 WEE1 Axon Medchem
AZD7762 CHK1/CHK2 Selleck Chemicals
LY2603618 (IC-83) CHK1 Selleck Chemicals
Go 6976 CHK1 Sigma-Aldrich
VE-821 ATR Axon Medchem
KU55933 ATM Tocris Bioscience
Aphidicolin DNA polymerase Sigma
alpha
Hydroxyurea Ribonucleotide Sigma
reductase
Assay for cell survival
Equal numbers of cells were seeded in each well 24 hours prior to inhibitors treatment; DMSO (solvent for inhibitors) was used as a negative control. 3 days after addition of inhibitors, the medium was replaced by fresh medium without drugs. 5 days after addition of inhibitors, the medium was removed and fresh media containing Resazurin was added to each well.
Resazurin is a nonfluorescent dye, which can be converted (by redox reaction) to a red fluorescent resorufin by living cells. The fluorescent signal is proportional to the number of living cells, and was measured by a fluorescence plate reader (BMG Labtech).
Clonogenic survival assay
400 cells were seeded in each well of the 6-well plate. The next day, inhibitors were added and colonies were allowed to form for 10-14 days. Colonies were then stained with Brilliant blue (Sigma) and counted.
Assay for apoptosis
Equal numbers of cells were seeded in each well. 24 hours later, inhibitors were added to the media, with DMSO used as a negative control. 48 hours after addition of inhibitors, Hoechst stain was added to the media. Hoechst stains the nucleus, and the nuclei of apoptotic cells appear condensed and pycnotic. Images were taken using Incell Analyzer (GE Healthcare) and the number apoptotic cells is counted by Incell Analysis software (GE Healthcare), and presented as a percentage of total number of cells. siRNA transfections
U20S or A498 cells were transfected with specific siRNAs targeting genes as indicated in the Table below in suspension by RNAiMax (Invitrogen) according to the manufactures instructions. Medium was replaced 24 hours after transfection.
Table 7 - siRNA sequences used
siRNA siRNA target sequence 5' to 3' Purchased from target
SETD2 #3 : GAAACCGUCUCCAGUCUGU (SEQ ID NO: 28) Thermo Scientific
#5: UAAAGGAGGUAUAUCGAAU (SEQ ID NO: 29)
WEE1 A pool of 4 siRNAs: Thermo Scientific
AAUAGAACAUCUCGACUUA (SEQ ID NO: 17)
AAUAUGAAGUCCCGGUAUA (SEQ ID NO: 18)
GAUCAUAUGCUUAUACAGA (SEQ ID NO: 19)
CGACAGACUCCUCAAGUGA (SEQ ID NO: 20)
CHK1 GGCUUGGCAACAGUAUUUCGGUAUA (SEQ ID Invitrogen
NO: 21)
ATR GGGAAAUACUAGAACCUCAUCUAAA (SEQ ID Invitrogen
NO: 22)
ATM GCGCAGUGUAGCUACUUCUUCUAUU (SEQ ID Invitrogen
NO: 23)
CHK2 A pool of 4 siRNAs: Thermo Scientific
GUAAGAAAGUAGCCAUAAA (SEQ ID NO: 24)
GCAUAGGACUCAAGUGUCA (SEQ ID NO: 25)
GUUGUGAACUCCGUGGUUU (SEQ ID NO: 26)
CUCAGGAACUCUAUUCUAU(SEQ ID NO: 27)
Non- none Qiagen
targeting
(negativ
e
control)
Immunob lotting
Cells were lysed in lysis buffer (50 mM Tris HC1 pH7.5, 150 mM NaCL, 1 % Triton X- 100, supplemented with protease/phosphatase inhibitors) on ice for 30 minutes. Antibodies used were HYPB (Abeam) and Tubulin. Proteins levels were detected using BM Chemiluminescence substrate (Roche).
Gene complementation
For re-expression of SETD2 protein in SETD2-deficient cells (A498), wild-type full length SETD2 cDNA was purchased from Source Bioscience and inserted into pcDNA6.1 mammalian expression plasmid (Invitrogen). After verification by sequencing, the plasmid was transfected into A498 cells using X-tremeGENE HP DNA transfection reagent (Roche) according to the manufactures instruction. An empty plasmid containing green fluorescent protein was used as control. 48 hours after transfection, cells were challenged with inhibitors for 48 hours and analysed for apoptosis.
Results
Mutants in set2 and weel exhibit a synthetic lethal genetic interaction
During our effort to understand the role of Set2 in fission yeast, a genetic analysis unexpectedly revealed a set2 deletion mutant (set2A) to exhibit synthetic lethality with a temperature sensitive mutant of Weel (wee 1-50). The wee 1-50 strain was first described by (Nurse and Thuriaux, 1980). While both parental strains were able to grow on minimal media (EMM6S) at the restrictive temperature of 35°C, the set2A wee 1-50 double mutant was not (Fig 1). Synthetic lethality describes a genetic interaction of two genes, where mutation in either gene alone has no effect on cell viability but the simultaneous mutation in both genes results in cell death (reviewed in (Dixon et al., 2009)). Thus Set2 and Weel must function in parallel to perform an essential function. The mechanism by which cell death is occurring in set2A weel- 50 cells is currently under investigation.
SETD2-deficient cells are hypersensitive to WEE1 inhibition
To test whether this genetic relationship was conserved in human cells, SETD2-deficient renal (A498) or SET2 proficient (U20S) osteosarcoma cell lines were exposed to increasing concentrations of the WEE1 inhibitor MK-1775 or to DMSO as a control for six days and cell survival calculated. No loss of viability was observed upon treatment of either A498 or U20S cells with DMSO, while treatment of U20S cells with MK-1775 showed a slight reduction in viability. In contrast, a striking loss of viability was observed following treatment of the SETD2-deficient A498 cells in response to MK-1775, with an LD50 of approximately ΙΟΟηΜ (Fig 2A and B). In accordance with the reduced viability, treatment the Weel inhibitor (MK- 1775) resulted in a significantly increased population of apoptotic cells in SETD2-deficient cells (A498) compared to SETD2 wild type cells (U20S) (Fig 2C).
To confirm that the MK-1775 sensitivity was due to loss of SETD2, siRNA targeting was used to knock down SETD2 in U20S cells for 48 hours (Fig 3A) and subsequently exposed to continuous MK-1775 treatment. SETD2 knockdown with siRNAs #3 and #5 showed a striking loss of viability following exposure to 300nM MK-1775 compared to non-targeted siRNA control (Fig 3B). Clonogenic survival experiment indicated a striking increase in U20S cell sensitivity to MK-1775 when SETD2 was knocked down with siRNA#3, or siRNA#5, compared to the non-targeted siRNA control (Fig 3C). A corresponding increase in the levels of apoptotic cells was observed following treatment with MK-1775 (Fig 3D). To confirm that the increased MK-1775 sensitivity observed in U20S cells was not due to siRNA off-target effects, A498 cells were also treated with siRNAs #3 and #5 before being challenged with 200nM of MK-1775. In contrast to U20S cells, A498 cells treated with siRNAs #3 and #5 did not exhibit any further
reduction in survival following exposure to MK-1775 (Fig3E). These results strongly suggest that the U20S sensitivity to MK-1775 following knockdown was not due to off-target siRNA effects.
To further confirm that loss of SETD2 was the primary cause of cell death in A498 cells treated with MK-1775, a SETD2 cDNA was transiently expressed in A498 cells and cells were again challenged with MK-1775. A498 cells complemented with SETD2 exhibited increased survival and reduced levels of apoptosis compared to those transfected with empty vector alone when treated with MK-1775, consistent with loss of SETD2 being the cause of MK-1775 sensitivity in A498 cells (Fig 3F,G).
To confirm that inhibition of WEE1 kinase activity by MK-1775 was the cause of A498 sensitivity, WEE1 was knocked down with siRNA. siRNA knockdown of WEE 1 reduced the viability of SETD2-deficient A498 cells substantially more than SETD2-proficient U20S cells, while non-targeting siRNA had little effect on survival of either cell lines (Fig 4A). The reduced survival in WEE1 -siRNA targeted A498 cells compared to U20S cells was accompanied by a corresponding increase in the number of apoptotic cells observed (Fig 4B). Thus inhibiting WEE1 by either siRNA or the WEE1 inhibitor MK-1775 resulted in reduced survival and increased apoptotic cell death in SETD2-deficient cells. Example 3 below confirms the in vivo efficacy of MK1775 against SETD2-deficient cancer
SETD2-deficient cells are hypersensitive to ATR inhibition
These findings prompted us to test whether SETD2-deficient cells could also be sensitized by other DDR kinase inhibitors. VE-821 was recently described as a potent and specific ATR inhibitor (Reaper et al., 201 1). We therefore tested the sensitivity of A498 and U20S cells to VE-821. Subjecting SETD2-deficient A498 cells to VE-821 resulted in a striking loss of viability, while little effect was observed in SETD2-proficient U20S cells (Fig 5A and B). The increased loss of viability of A498 cells treated with VE-821 corresponded with highly elevated levels of apoptosis compared to controls (Fig 5C). U20S cells become more sensitive to ATR inhibitors after SETD2 knockdown by siRNA (Fig 5D).
To confirm that the sensitization of A498 cells by VE-821 was due to SETD2-loss, SETD2 cDNA was transiently expressed in A498 cells, which were again challenged with VE- 821. A498 cells complemented with SETD2 exhibited reduced levels of apoptosis compared to those transfected with vector alone when treated with VE-821 (Fig 5E), consistent with loss of SETD2 being the cause of VE-821 sensitivity in A498 cells. Thus inhibiting ATR selectively kills SETD2-deficient cells.
SETD2-deficient cells are hypersensitive to Chkl inhibition
As Chkl kinase is the major target of ATR we wished to test whether SETD2-deficient cells could also be killed by CHKl kinase inhibitors. Treatment of SETD2-deficient A498 cells with the CHKl inhibitor Go 6976 resulted in a striking degree of cell death, while no obvious effect was observed in SETD2-proficient U20S cells (Fig 6A and B). Reduced cell viability was accompanied by an increase in apoptotic cells after 48 hours in A498 cells but not in U20S or DMSO-treated cells (Fig 6C). Very similar results were obtained following treatment of A498 or U20S cells with the CHKl kinase inhibitors LY2603618 (Fig 6D-F), or AZD7762 (Fig 6G-I). Thus SETD2-deficient cells are hypersensitive to CHKl kinase inhibition.
To confirm that the CHKl inhibitors were specifically targeting SETD2 deficiency, the effects of these CHKl inhibitors was also tested on U20S cells in which SETD2 was knocked down using siRNA targeting. Treatment with CHKl inhibitor Go 6976 resulted in reduced survival of SETD2-depleted U20S cells compared to non-targeted controls (Fig 7A). Reduced viability in SETD2-depleted U20S cells again corresponded with increased levels of apoptosis (Fig 7B). Very similar results were also obtained using the CHKl inhibitors LY2603618 (Fig 7C and D), or AZD7762 (Fig 7E and F), thus strongly suggesting that inhibiting CHKl kinase also resulted in SETD2-deficient cell death.
To confirm the sensitization of A498 cells to the CHKl inhibitor Go 6976 was due to SETD2-loss, A498 cells were transiently complemented with the SETD2 cDNA or vector alone and challenged with Go 6976. Cells complemented with SETD2 cDNA exhibited reduced levels of apoptosis compared to those transfected with vector alone when treated with Go 6976, consistent with loss of SETD2 being the cause of Go 6976 sensitivity in A498 cells (Fig 7G). Further, CHKl siRNA knockdown showed a striking loss of in SETD2-deficient A498 cells compared to U20S proficient cells and to non-targeted siRNA controls (Fig 8A and B).
Together these results confirm that SETD2-deficient cells are hypersensitive to CHKl inhibition.
Targeting ATM and CHK2 does not sensitize SETD 2 -deficient cells
To test whether SETD2-deficient cells were sensitive to inhibition of all DDR kinases, the ATM inhibitor KU55933 was added to both A498 and U20S cells. In contrast to inhibiting ATR, CHKl or WEEl, the viability of SETD2-deficient A498 cells was not affected by addition of KU55933 (Fig 9A and B). Survival of A498 or U20S cells was further examined following knockdown of ATM or CHK2 using siRNAs. Neither knockdown of ATM or CHK2 resulted in significantly reduced survival in A498 cells (Fig 9C). These data indicate that SETD2-deficient
A498 cells are insensitive to loss of ATM or CHK2 kinases, indicating that the sensitivity of SETD2-deficient cells is specific to WEEl, ATR or CHKl kinase inhibition.
SETD2-deficient cells are not hypersensitive to DNA replication inhibitors
ATR, CHKl and WEEl have been proposed to maintain genome integrity during DNA replication (Sorensen and Syljuasen, 2012). We therefore tested whether SETD2-deficient cells were sensitive to replication stress. U20S cells in which SETD2 had been knocked down with siRNAs as previously described, did not show sensitivity to increasing concentrations of aphidicolin, an inhibitor of DNA polymerase alpha that results in replication stress (Krokan et al., 1981), compared to non-targeted siRNA control (Fig 10A). Sensitivity of SETD2-depleted cells was also tested using increasing concentrations of the DNA replication inhibitor hydroxyurea (HU), which also causes replication stress (Slater, 1973). Only a very modest increase in HU sensitivity was observed in SETD2 siRNA treated cells, compared to non- targeted controls (Fig 10B). HU sensitivity was examined further in A498 cells. A very modest increase in HU sensitivity was observed in SETD2-deficient A498 cells compared to U20S cells (Fig IOC). However, these sensitivities were much reduced compared to the acute sensitization of SETD2-deficient cells to ATR, CHKl and WEEl, suggesting this hypersensitization is not an effect of general replication stress.
Discussion
The results presented here describe a profound sensitization of SETD2-deficient cancer cells to inhibitors of ATR, CHKl and WEEl . These interactions are specific as inhibiting or knocking down the related DDR kinases ATM or CHK2, or exposing SETD2-deficient cells to drugs causing replication stress did not promote such sensitivity. The mechanistic basis of such synthetic lethality is currently unclear. ATR, CHKl and WEEl kinases contribute to the DDR pathway, are active during normal S-phase progression, and their loss results in deregulated CDK activity, which can force unscheduled DNA replication, aberrant fork structures and DNA breaks (reviewed in (Sorensen and Syljuasen, 2012)). Thus the essential function performed by SETD2 in the absence of these kinases may be to limit DNA damage arising from inappropriate CDK activity during S-phase. In the absence of SETD2 and ATR, CHKl or WEEl cells may be unable to repair such damage, thus resulting in apoptosis. The essential function of SETD2 may be related to its H3K36 tri-methyltransferase activity, which could coordinate histone deposition or prevent inappropriate transcription during S-phase. Alternatively SETD2 could function independently of its methyltransferase activity, perhaps through binding tightly to single stranded DNA or RNA (Krajewski et al., 2005) to limit DNA damage in the absence of the
replication checkpoint kinases. While ATR, CHKl and WEEl function in parallel pathways to SETD2, it is also clear that CHKl and WEEl function independently to inhibit CDK activity and to maintain genome stability, as inhibiting both CHKl and WEEl simultaneously can result in cell death (Davies et al., 201 1 ; Russell et al, 2013). Similarly, although sei2A was found to be synthetic lethal with weel-50, this relationship was not observed in sei2A rad3A (the ATR homologue) or set2A chklA double mutants (our unpublished results) indicating that Weel functions independently of ATR and CHKl homologues to maintain viability in the absence of Set2 in fission yeast.
Importantly, our results suggest a novel approach to treating patients with SETD2- deficient cancers using inhibitors to ATR, CHKl or WEEl . Given the extreme sensitivity of SETD2deficient cells to these agents, it seems likely that their use as a monotherapy is likely to be less toxic and more specific than the genotoxic agents currently used in cancer therapy.
Importantly, these findings may provide a rational basis for treating SETD2-deficient gliomas, for which there is currently no cure. Further the synthetic lethality resulting from loss of SETD2 together with either ATR, CHKl or WEEl function raises the possibility that future
development of SETD2 inhibitors may be used therapeutically to target cancer cells deficient in these replication checkpoint kinases.
Example 2
Results and Discussion
General Introduction
We demonstrate in Example 1 above that depletion of SETD2 (a histone H3K36 trimethyltransferase) results in sensitization to the WEEl inhibitor, MK-1775, the CHKl inhibitor, LY2603618, AZD7762 and Go6976 or the ATR inhibitor and VE821. This raises the question as to whether this sensitivity resulted from reduced levels of SETD2 or reduced levels ofH3K36me3.
In this Example, we present evidence indicating that reduced H3K36me3 levels arising through either KDM4A over-expression or expression of H3.3K36M, results in sensitization of cells to WEEl, CHKl or ATR inhibitors. These findings have important implications as this suggests that these inhibitors may be used to treat a broader range of cancers associated with reduced H3K36me3 levels, including those in which KDM4A B or C are over-expressed, or those containing mutations in histone H3.3 gene.
/. KDM4A overexpression sensitizes cells to WEEl, CHKl and A TR inhibitors.
Here, we have examined the effect of reducing histone H3K36me3 levels resulting from KDM4A over-expression on the sensitivity to the WEE1 inhibitor, MK-1775, the CHKl inhibitor, LY2603618, or the ATR inhibitor, VE821. We used a Tetracycline-inducible system in which the KDM4A cDNA was inserted behind a Tet-operator in the genome of U20S cells. Upon addition of Tetracycline or its related form Doxycycline to the cell culture medium, the Tet-operator was de-repressed and KDM4A was over expressed. KDM4A over-expression led to a global reduction in H3K36me3 levels (Fig 12A and B). We then compared the sensitivity of this U20S cell line with or without KDM4A over expression following treatment to the WEE1 inhibitor, MK-1775, the CHKl inhibitor, LY2603618, or the ATR inhibitor, VE821. We found that KDM4A overexpression resulted in poorer survival and increased apoptosis after inhibitor treatment compared to cells in which KDM4A was not overexpressed (Fig 12C-H). These findings are consistent with the hypothesis that reduced H3K36me3 level sensitizes cells to WEE1, CHKl or ATR inhibitors.
2. Expression of a mutant H3.3 (K36M) reduces level of H3K36me3, and sensitises cells to WEE1, CHKl and ATR inhibitors.
Expression of a plasmid encoding histone H3.3 mutated on amino acid 36 Lysine to Methionine (K36M) can reduce levels of H3K36me3 (Lewis et al., 2013). Here show that expression of the H3.3-K36M plasmid reduces H3K36me3 globally while expression of the non- mutant H3.3 plasmid has no effect on H3K36me3 (Fig 13A).
We compared the sensitivity of U20S cells expressing H3.3-K36M or H3.3 to MK-1775, LY2603618 or VE821. We found that H3.3-K36M expressing cells (low H3K36me3) showed reduced survival and increased apoptosis after inhibitor treatment compared to control cells expressing H3.3 (Fig 13B-H). This H3.3-K36M mutation is not observed in cancers but its expression was predicted from this study to promote loss of H3K36me3 levels based on mutations frequently observed in cancers (Lewis et al, 2013). However, there are other mutations in the histone H3.3 genes that lead to reduced level of H3K36me3, such as the H3.3- G34R V observed in gliomas.
General Discussion
Here we present evidence that depleting levels of H3K36me3 by either KDM4A over- expression or by expression of H3.3K36M resulted in sensitization to the WEE1 inhibitor, MK- 1775, the CHKl inhibitor, LY2603618, or the ATR inhibitor, VE821. We demonstrate above that these inhibitors could selectively kill cells SETD2-deficient cells. SETD2 functions as a non-redundant histone H3K36 methyltransferase which is required for H3K36 trimethylation.
These findings together indicate that depletion of H3K36me3 sensitizes cells to MK-1775, LY2603618, or VE821. As such, these findings extend the number of potential cancer types which may be treated with these agents.
Materials and Methods
Methods for measuring cell survival by Resazurin and measuring apoptosis by Hoechst staining is described in Example 1 above.
Generation ofKDM4A overexpression cell lines
The Invitrogen T-REx system (U20S-FLIPrN cells and FRT plasmid backbone) was provided by Dr. Csanad Bachrati. KDM4A cDNA was purchased from Genecopoeia.
Generation of the KDM4A overexpression cell line was performed by Sophia Pfister in the lab of Dr Timothy Humphrey. Briefly, the KDM4A cDNA was inserted into integration FRT plasmid backbone by recombination reaction. U20S-FLIPIN cells were transfected with the plasmid using Fugene transfection reagent (Promega). 48 hours after transfection, cells were split and stable integrants are selected for by Hygromycin and Blasticidin. About 20 days after selection, colonies were isolated and expanded individually. Individual colonies were tested for KDM4A expression in response to Doxycyline by Western blotting. Cells expressing KDM4A under the control of the repressible T-REx system were subsequently subjected to inhibitor treatment.
Generation o/H3.3 and H3.3-K36M expression cell lines
The H3.3 and H3.3-K36M lentiviral plasmids were generous gifts from David Allis lab (Lewis et al., 2013).
Generation of the stably integrated cell line was performed by Sophia Pfister in the lab of Dr Timothy Humphrey. Briefly, the lentiviral plasmids and viral packaging mix (System
Biosciences) were co-transfected into 293T cells using lipofectamine transfection reagent (Invitrogen). Viral particles produced from 293T cells were collected and used to infect U20S cells. Five days after viral infection, U20S cells were selected for stable integration of the gene using Puromycin. Stable cell lines were tested for H3.3 or H3.3-K36M expression by Western blotting and subsequently subjected to inhibitor treatment.
Example 3 - In vivo efficacy of MK1775 against SETD2-deficient cancer
BALB/C nude mice (female, 6-8 weeks old, n=14) were injected subcutaneously with A498 tumour cells (5xl06 cells per mouse in 50% v/v matrigel). When the mean tumour size
reached 1 10 mm3, mice were divided into two groups. Group 1 (control, n=7) received drug vehicle alone (0.5% w/v methylcellulose, 0.1 niL/lOg body weight, twice daily by oral gavage) for 12 days. Group 2 (n=7) received MK-1775 (60mg/kg in 0.5% w/v methylcellulose, 0.1 mL/lOg body weight, twice daily by oral gavage) for 12 days. Tumour size was determined by calliper measurements 3 times per week. Tumour volume was calculated according to the formula (width x length x height)/2. All mice in the control group were sacrificed on day 13, 24 hours after the last dose of vehicle. Three mice in the treatment group were sacrificed on day 13, 24 hours after the last dose of MK-1775, and tumour re-growth in the remaining mice (n=4) was followed until day 33, when all remaining mice were sacrificed. The results are shown in Figure 14. On day 13, the mean tumour volume in the MK-1775 treatment group (50.2 ± 4.7 mm3) was significantly less than in the vehicle control group (291 ± 40 mm3) (PO.0001, t-Test). MK-1775 had no significant impact on body weight.
References
Aaltonen, V., Koivunen, J., Laato, M., and Peltonen, J. (2007). PKC inhibitor Go6976 induces mitosis and enhances doxorubicin-paclitaxel cytotoxicity in urinary bladder carcinoma cells. Cancer Lett 253, 9 '-107 '.
Ahn, J., Urist, M., and Prives, C. (2004). The Chk2 protein kinase. DNA Repair (Amst) 3, 1039-1047.
Al Sarakbi, W., Sasi, W., Jiang, W.G., Roberts, T., Newbold, R.F., and Mokbel, K. (2009). The mRNA expression of SETD2 in human breast cancer: correlation with clinico- pathological parameters. BMC Cancer 9, 290.
Beck, H., Nahse-Kumpf, V., Larsen, M.S., O'Hanlon, K.A., Patzke, S., Holmberg, C, Mejlvang, J., Groth, A., Nielsen, O., Syljuasen, R.G., et al. (2012). Cyclin-dependent kinase suppression by WEE1 kinase protects the genome through control of replication initiation and nucleotide consumption. Mol Cell Biol 32, 4226-4236.
Berry, W.L., and Janknecht, R. (2013). KDM4/JMJD2 histone demethylases:
epigenetic regulators in cancer cells. Cancer Res 73, 2936-2942.
Black, J.C., Manning, A.L., Van Rechem, C, Kim, J., Ladd, B., Cho, J., Pineda, CM., Murphy, N., Daniels, D.L., Montagna, C, et al. (2013). KDM4A lysine demethylase induces site-specific copy gain and rereplication of regions amplified in tumors. Cell 154, 541-555.
Brough, R., Frankum, J.R., Costa-Cabral, S., Lord, C.J., and Ashworth, A. (2011). Searching for synthetic lethality in cancer. Curr Opin Genet Dev 21, 34-41.
Carvalho, S., Raposo, AC, Martins, F.B., Grosso, A.R., Sridhara, S.C, Rino, J., Carmo-Fonseca, M., and de Almeida, S.F. (2013). Histone methyltransferase SETD2 coordinates FACT recruitment with nucleosome dynamics during transcription. Nucleic Acids Res 41, 2881-2893.
Cliby W.A., Roberts C.J., Cimprich K.A., Stringer CM., Lamb J.R., Schreiber S.L., Friend S.H. (1988). Overexpression of a kinase-inactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints. EMBO J. 77: 159-169
Couture, J.F., Collazo, E., Ortiz-Tello, P.A., Brunzelle, J.S., and Trievel, R.C (2007). Specificity and mechanism of JMJD2A, a trimethyllysine-specific histone demethylase. Nat Struct Mol Biol 14, 689-695.
Dalgliesh, G.L., Furge, K., Greenman, C, Chen, L., Bignell, G., Butler, A., Davies, H., Edkins, S., Hardy, C, Latimer, C, et al. (2010). Systematic sequencing of renal carcinoma reveals inactivation of histone modifying genes. Nature 463, 360-363.
Daugaard, M., Baude, A., Fugger, K., Povlsen, L.K., Beck, H., Sorensen, C.S., Petersen, N.H., Sorensen, P.H., Lukas, C, Bartek, J., et al. (2012). LEDGF (p75) promotes DNA-end resection and homologous recombination. Nat Struct Mol Biol 19, 803-810.
Davies, K.D., Cable, P.L., Garrus, J.E., Sullivan, F X , von Carlowitz, I, Huerou, Y.L., Wallace, E., Woessner, R.D., and Gross, S. (2011). Chkl inhibition and Weel inhibition combine synergistically to impede cellular proliferation. Cancer Biol Ther 12, 788- 796.
De Witt Hamer, P.C., Mir, S.E., Noske, D., Van Noorden, C.J., and Wurdinger, T. (2011). WEE1 kinase targeting combined with DNA-damaging cancer therapy catalyzes mitotic catastrophe. Clin Cancer Res 17, 4200-4207.
Dixon, S.J., Costanzo, M., Baryshnikova, A., Andrews, B., and Boone, C. (2009). Systematic mapping of genetic interaction networks. Annu Rev Genet 43, 601-625.
Dominguez-Kelly, R., Martin, Y., Koundrioukoff, S., Tanenbaum, M E., Smits, V.A., Medema, R.H., Debatisse, M., and Freire, R. (2011). Weel controls genomic stability during replication by regulating the Mus81-Emel endonuclease. J Cell Biol 194, 567-579.
Duns, G , van den Berg, E., van Duivenbode, I., Osinga, J., Hollema, H., Hofstra, R.M., and Kok, K. (2010). Fiistone methyltransferase gene SETD2 is a novel tumor suppressor gene in clear cell renal cell carcinoma. Cancer Res 70, 4287-4291.
Edmunds, J.W., Mahadevan, L.C., and Clayton, A.L. (2008). Dynamic histone H3 methylation during gene induction: HYPB/Setd2 mediates all H3K36 trimethylation. Embo J 27, 406-420.
Feijoo, C , Hall-Jackson, C, Wu, R., Jenkins, D., Leitch, J., Gilbert, D M , and Smythe, C. (2001). Activation of mammalian Chkl during DNA replication arrest: a role for Chkl in the intra-S phase checkpoint monitoring replication origin firing. J Cell Biol 154, 913-923.
Feng, Z., Xu, S., Liu, M., Zeng, Y.X., and Kang, T. (2010). Chkl inhibitor Go6976 enhances the sensitivity of nasopharyngeal carcinoma cells to radiotherapy and chemotherapy in vitro and in vivo. Cancer Lett 297, 190-197.
Fnu, S., Williamson, E.A., De Haro, L.P., Brenneman, M., Wray, J., Shaheen, M., Radhakrishnan, K., Lee, S.H., Nickoloff, J.A., and Hromas, R. (2011). Methylation of histone H3 lysine 36 enhances DNA repair by nonhomologous end-joining. Proc Natl Acad Sci U S A 108, 540-545.
Fokas, E., Prevo, R , Hammond, E.M., Brunner, T.B., McKenna, W.G., and Muschel, R.J. (2013). Targeting ATR in DNA damage response and cancer therapeutics. Cancer Treat Rev.
Fontebasso, A.M., Schwartzentruber, J., Khuong-Quang, D.A., Liu, X.Y., Sturm, D., Korshunov, A., Jones, D.T., Witt, H., Kool, M., Albrecht, S., et al. (2013). Mutations in SETD2 and genes affecting histone H3K36 methylation target hemispheric high-grade gliomas. Acta europathol.
Foote, K.M., Blades, K , Cronin, A., Fillery, S., Guichard, S.S., Hassall, L., Hickson, I., Jacq, X., Jewsbury, P. J., McGuire, T.M., et al. (2013). Discovery of 4-{4-[(3R)-3- Methylmorpholin-4-yl] -6- [ 1 -(methylsulfonyl)cy clopropyl]pyrimidin-2-y 1 } - 1 H-indole (AZ20): a potent and selective inhibitor of ATR protein kinase with monotherapy in vivo antitumor activity. J Med Chem 56, 2125-2138.
Fuchs, S.M., Kizer, K.O., Braberg, H., Krogan, N.J., and Strahl, B.D. (2012). RNA polymerase II carboxyl-terminal domain phosphorylation regulates protein stability of the Set2 methyltransferase and histone H3 di- and trimethylation at lysine 36. J Biol Chem 287, 3249-3256.
Gould, K.L., and Nurse, P. (1989). Tyrosine phosphorylation of the fission yeast cdc2+ protein kinase regulates entry into mitosis. Nature 342, 39-45.
Hakimi, A.A., Chen, Y.B., Wren, J., Gonen, M., Abdel-Wahab, O., Heguy, A., Liu, H., Takeda, S., Tickoo, S.K., Reuter, V.E., et al. (2013). Clinical and Pathologic Impact of Select Chromatin-modulating Tumor Suppressors in Clear Cell Renal Cell Carcinoma. Eur Urol 63, 848-854.
Harvey, S.L., Charlet, A., Haas, W., Gygi, S.P., and Kellogg, D R. (2005). Cdkl- dependent regulation of the mitotic inhibitor Weel . Cell 122, 407-420.
Heffernan T P., Simpson D A., Frank A.R., Heinloth A.N., Paules R.S., Cordeiro- Stone M., Kaufmann W.K. (2002). An ATR- and Chkl -dependent S checkpoint inhibits replicon initiation following UVC-induced DNA damage. Mol. Cell. Biol. 22:8552-8561
Hillringhaus, L , Yue, W.W., Rose, N R., Ng, S.S., Gileadi, C, Loenarz, C, Bello, S.H., Bray, J.E., Schofield, C.J., and Oppermann, U. (201 1). Structural and evolutionary basis for the dual substrate selectivity of human KDM4 histone demethylase family. J Biol Chem 286, 41616-41625.
Hirai, H., Arai, T., Okada, M., Nishibata, T., Kobayashi, M., Sakai, N., Imagaki, K., Ohtani, J., Sakai, T., Yoshizumi, T., et al. (2010). MK-1775, a small molecule Weel
inhibitor, enhances anti-tumor efficacy of various DNA-damaging agents, including 5- fluorouracil. Cancer Biol Ther 9, 514-522.
Hu, M., Sun, X.J., Zhang, Y.L., Kuang, Y., Hu, C.Q , Wu, W.L., Shen, S.H., Du, T.T., Li, H., He, F., et al. (2010). Histone H3 lysine 36 methyltransferase Hypb/Setd2 is required for embryonic vascular remodeling. Proc Natl Acad Sci U S A 107, 2956-2961.
Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461, 1071-1078.
Jia, X.Z., Yang, S.Y., Zhou, J., Li, S.Y., Ni, J.H., An, G.S., and Jia, H.T. (2009). Inhibition of CHKl kinase by Go6976 converts 8-chloro-adenosine-induced G2/M arrest into S arrest in human myelocytic leukemia K562 cells. Biochem Pharmacol 77, 770-780.
Keogh, M.C., Kurdistani, S.K., Morris, S.A., Ahn, S.H., Podolny, V., Collins, S.R , Schuldiner, M., Chin, K., Punna, T., Thompson, N.J., et al. (2005). Cotranscriptional set2 methylation of histone H3 lysine 36 recruits a repressive Rpd3 complex. Cell 123, 593-605.
Kiviharju-af Hall strom, T.M., Jaamaa, S., Monkkonen, M., Peltonen, K., Andersson, L.C., Medema, R.H., Peehl, D.M., and Laiho, M. (2007). Human prostate epithelium lacks Weel A-mediated DNA damage-induced checkpoint enforcement. Proc Natl Acad Sci U S A 104, 7211-7216.
Klose, R.J., Yamane, K., Bae, Y., Zhang, D., Erdjument-Bromage, H., Tempst, P., Wong, J., and Zhang, Y. (2006). The transcriptional repressor JHDM3A demethylates trimethyl histone H3 lysine 9 and lysine 36. Nature 442, 312-316.
Kohn, E.A., Yoo, C.J., and Eastman, A. (2003). The protein kinase C inhibitor Go6976 is a potent inhibitor of DNA damage-induced S and G2 cell cycle checkpoints.
Cancer Res 63, 31-35.
Krajewski, W.A., Nakamura, T., Mazo, A., and Canaani, E. (2005). A motif within SET-domain proteins binds single-stranded nucleic acids and transcribed and supercoiled DNAs and can interfere with assembly of nucleosomes. Mol Cell Biol 25, 1891-1899.
Kreahling, J.M., Foroutan, P., Reed, D., Martinez, G., Razabdouski, T., Bui, M.M., Raghavan, M., Letson, D., Gillies, R.J., and Altiok, S. (2013). Weel Inhibition by MK-1775 Leads to Tumor Inhibition and Enhances Efficacy of Gemcitabine in Human Sarcomas. PLoS One 8, e57523.
Krogan, N.J., Kim, M., Tong, A., Golshani, A., Cagney, G., Canadien, V., Richards, D.P., Beattie, B.K., Emili, A., Boone, C, et al. (2003). Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol Cell Biol 23, 4207-4218.
Krokan, H., Wist, E., and Krokan, R.H. (1981). Aphidicolin inhibits DNA synthesis by DNA polymerase alpha and isolated nuclei by a similar mechanism. Nucleic Acids Res 9, 41 '09-4719.
Lee, J., Kumagai, A., and Dunphy, W.G. (2001). Positive regulation of Weel by Chkl and 14-3-3 proteins. Mol Biol Cell 12, 551-563.
Lewis, K.A., Mullany, S., Thomas, B., Chien, J., Loewen, R , Shridhar, V., and Cliby, W.A. (2005). Heterozygous ATR mutations in mismatch repair-deficient cancer cells have functional significance. Cancer Res 65, 7091-7095.
Lewis, P.W., Muller, M.M., Koletsky, M.S., Cordero, F., Lin, S., Banaszynski, L.A., Garcia, B.A., Muir, T.W., Becher, O.J., and Allis, CD. (2013). Inhibition of PRC2 activity by a gain-of-function H3 mutation found in pediatric glioblastoma. Science 340, 857-861.
Li, B., Howe, L., Anderson, S., Yates, J.R., 3rd, and Workman, J.L. (2003). The Set2 histone methyltransferase functions through the phosphorylated carboxyl-terminal domain of RNA polymerase II. J Biol Chem 278, 8897-8903.
Li, F., Mao, G , Tong, D., Huang, J., Gu, L., Yang, W., and Li, G.-M. (2013). The Histone Mark H3K36me3 Regulates Human DNA Mismatch Repair through Its Interaction with MutSalpha. Cell 153, 590-600.
Li, J., Moazed, D., and Gygi, S.P. (2002). Association of the histone
methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J Biol Chem 277, 49383-49388.
Luco et al (2010) Regulation of alternative splicing by histone modifications. Science. 19;327(5968):996-1000.
Ma, C.X., Janetka, J.W., and Pi wnica- Worms, H. (2011). Death by releasing the breaks: CHK1 inhibitors as cancer therapeutics. Trends Mol Med 17, 88-96.
Mahajan, K., Fang, B., Koomen, J.M., and Mahajan, N.P. (2012). H2B Tyr37 phosphorylation suppresses expression of replication-dependent core histone genes. Nat Struct Mol Biol 19, 930-937.
Maya-Mendoza, A., Petermann, E., Gillespie, D.A., Caldecott, K.W., and Jackson, D.A. (2007). Chkl regulates the density of active replication origins during the vertebrate S phase. Embo J 26, 2719-2731.
Merker, J.D., Dominska, M., Greenwell, P.W., Rinella, E., Bouck, D.C., Shibata, Y., Strahl, B.D., Mieczkowski, P., and Petes, T.D. (2008). The histone methylase Set2p and the histone deacetylase Rpd3p repress meiotic recombination at the HIS4 meiotic recombination hotspot in Saccharomyces cerevisiae. DNA Repair (Amst) 7, 1298-1308.
Mizuarai, S., Yamanaka, K., Itadani, H., Arai, T., Nishibata, T., Hirai, H., and Kotani, H. (2009). Discovery of gene expression-based pharmacodynamic biomarker for a p53 context-specific anti-tumor drug Weel inhibitor. Mol Cancer 8, 34.
Mordes, D.A., and Cortez, D. (2008). Activation of ATR and related PD Ks. Cell Cycle 7, 2809-2812.
McGowan C.H., Russell P. (1993). Human Weel kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyrl5." EMBO J. 72:75-85
Murrow, L.M., Garimella, S.V., Jones, T.L., Caplen, N.J., and Lipkowitz, S. (2010). Identification of WEE1 as a potential molecular target in cancer cells by RNAi screening of the human tyrosine kinome. Breast Cancer Res Treat 722, 347-357.
Newbold, R.F., and Mokbel, K. (2010). Evidence for a tumour suppressor function of SETD2 in human breast cancer: a new hypothesis. Anticancer Res 30, 3309-3311.
Nurse, P., and Thuriaux, P. (1980). Regulatory genes controlling mitosis in the fission yeast Schizosaccharomyces pombe. Genetics 96, 627-637.
Parker, L.L., and Pi wnica- Worms, H. (1992). Inactivation of the p34cdc2-cyclin B complex by the human WEE1 tyrosine kinase. Science 257, 1955-1957.
Peasland, A., Wang, L.Z., Rowling, E., Kyle, S., Chen, T., Hopkins, A., Cliby, W.A., Sarkaria, J., Beale, G, Edmondson, R.J., et al. (201 1). Identification and evaluation of a potent novel ATR inhibitor, NU6027, in breast and ovarian cancer cell lines. Br J Cancer 105, 372-381.
Peng, C.Y., Graves, P R , Thoma, R.S., Wu, Z., Shaw, A.S., and Pi wnica- Worms, H. (1997). Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216. Science 277, 1501-1505.
Pires, I.M., Olcina, M.M., Anbalagan, S., Pollard, J.R., Reaper, P.M., Charlton, P.A., McKenna, W.G., and Hammond, E.M. (2012). Targeting radiation-resistant hypoxic tumour cells through ATR inhibition. Br J Cancer 707, 291-299.
Prevo, R., Fokas, E., Reaper, P.M., Charlton, P.A., Pollard, J.R., McKenna, W.G., Muschel, R.J., and Brunner, T.B. (2012). The novel ATR inhibitor VE-821 increases sensitivity of pancreatic cancer cells to radiation and chemotherapy. Cancer Biol Ther 73, 1072-1081.
Rajeshkumar, N.V., De Oliveira, E., Ottenhof, N., Watters, J., Brooks, D., Demuth, T., Shumway, S.D., Mizuarai, S., Hirai, H., Maitra, A., et al. (2011). MK-1775, a potent Weel inhibitor, synergizes with gemcitabine to achieve tumor regressions, selectively in p53- deficient pancreatic cancer xenografts. Clin Cancer Res 77, 2799-2806.
Reaper, P.M., Griffiths, M R., Long, J.M., Charrier, J.D., Maccormick, S., Charlton, P.A., Golec, J.M , and Pollard, J.R. (201 1). Selective killing of ATM- or p53-deficient cancer cells through inhibition of ATR. Nat Chem Biol 7, 428-430.
Rega, S., Stiewe, T., Chang, D.I., Pollmeier, B., Esche, H., Bardenheuer, W., Marquitan, G., and Putzer, B.M. (2001). Identification of the full-length huntingtin- interacting protein p231HBP HYPB as a DNA-binding factor. Mol Cell Neurosci 18, 68-79.
Russell, M.R., Levin, K., Rader, J., Belcastro, L., Li, Y., Martinez, D., Pawel, B., Shumway, S.D., Maris, J.M., and Cole, K.A. (2013). Combination therapy targeting the Chkl and Weel kinases shows therapeutic efficacy in neuroblastoma. Cancer Res 73, 776-784.
Russell, P., and Nurse, P. (1987). Negative regulation of mitosis by weel+, a gene encoding a protein kinase homolog. Cell 49, 559-567.
Sanchez, Y., Wong, C , Thoma, R.S., Richman, R., Wu, Z , Piwnica- Worms, H., and Elledge, S.J. (1997). Conservation of the Chkl checkpoint pathway in mammals: linkage of DNA damage to Cdk regulation through Cdc25. Science 277, 1497-1501.
Sanidas, I et al. (2014) Phosphoproteomics Screen Reveals Akt Isoform-Specific Signals Linking RNA Processing to Lung Cancer. Mol Cell. 20;53(4):577-90.
Sclafani, R.A., and Holzen, T.M. (2007). Cell cycle regulation of DNA replication. Annu Rev Genet 41, 237-280.
Shimada, M., Niida, H., Zineldeen, D.H., Tagami, H., Tanaka, M., Saito, H., and Nakanishi, M. (2008). Chkl is a histone H3 threonine 1 1 kinase that regulates DNA damage- induced transcriptional repression. Cell 132, 221-232.
Slater, M L. (1973). Effect of reversible inhibition of deoxyribonucleic acid synthesis on the yeast cell cycle. J Bacteriol 113, 263-270.
Smith, J., Tho, L.M., Xu, N., and Gillespie, D A (2010). The ATM-Chk2 and ATR- Chkl pathways in DNA damage signaling and cancer. Adv Cancer Res 108, 73-1 12.
Smolle, M., Venkatesh, S., Gogol, M M., Li, H , Zhang, Y., Florens, L., Washburn, M.P., and Workman, J.L. (2012). Chromatin remodelers Iswl and Chdl maintain chromatin structure during transcription by preventing histone exchange. Nat Struct Mol Biol 19, 884- 892.
Sorensen, C.S., and Syljuasen, R.G. (2012). Safeguarding genome integrity: the checkpoint kinases ATR, CHK1 and WEE1 restrain CDK activity during normal DNA replication. Nucleic Acids Res 40, 477-486.
Sorensen, C.S., Syljuasen, R.G., Falck, J., Schroeder, T., Ronnstrand, L., Khanna, K.K., Zhou, B.B., Bartek, J., and Lukas, J. (2003). Chkl regulates the S phase checkpoint by
coupling the physiological turnover and ionizing radiation-induced accelerated proteolysis of Cdc25A. Cancer Cell 3, 247-258.
Sun, X.J., Wei, J., Wu, X.Y., Hu, M., Wang, L., Wang, H.H., Zhang, Q.H., Chen, S.J., Huang, Q.H., and Chen, Z. (2005). Identification and characterization of a novel human histone H3 lysine 36-specific methyltransferase. J Biol Chem 280, 35261-35271.
Syljuasen, R.G., Sorensen, C.S., Hansen, L.T., Fugger, K , Lundin, C, Johansson, F., Helleday, T., Sehested, M, Lukas, J., and Bartek, J. (2005). Inhibition of human Chkl causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage. Mol Cell Biol 25, 3553-3562.
Thompson, R., Meuth, M., Woll, P., Zhu, Y., and Danson, S. (2012). Treatment with the Chkl inhibitor Go6976 enhances cisplatin cytotoxicity in SCLC cells. Int J Oncol 40, 194-202.
Tibbetts R.S., Brumbaugh K.M., Williams J.M., Sarkaria J.N., Cliby W.A., Shieh S.- Y., Taya Y., Prives C, Abraham R.T.(1999). A role for ATR in the DNA damage-induced phosphorylation of p53. Genes Dev. 13 : 152-157
Toledo, L.I., Murga, M., Zur, R., Soria, R., Rodriguez, A., Martinez, S., Oyarzabal, J., Pastor, J., Bischoff, J.R., and Fernandez-Capetillo, O. (2011). A cell-based screen identifies ATR inhibitors with synthetic lethal properties for cancer-associated mutations. Nat Struct Mol Biol 18, 721-727.
Venkatesh, S., Smolle, M., Li, H, Gogol, M M , Saint, M., Kumar, S., Natarajan, K., and Workman, J.L. (2012). Set2 methylation of histone H3 lysine 36 suppresses histone exchange on transcribed genes. Nature 489, 452-455.
Vermeulen, M., Eberl, H.C., Matarese, F., Marks, H, Denissov, S., Butter, F., Lee, K.K., Olsen, J.V., Hyman, A.A., Stunnenberg, H.G., et al. (2010). Quantitative interaction proteomics and genome-wide profiling of epigenetic histone marks and their readers. Cell 142, 967-980.
Wagner, E.J., and Carpenter, P.B. (2012). Understanding the language of Lys36 methylation at histone H3. Nat Rev Mol Cell Biol 13, 1 15-126.
Watanabe, N., Broome, M., and Hunter, T. (1995). Regulation of the human WEElHu CDK tyrosine 15-kinase during the cell cycle. Embo J 14, 1878-1891.
Weiss, G.J., Donehower, R.C., Iyengar, T., Ramanathan, R.K., Lewandowski, K., Westin, E., Hurt, K., Hynes, S.M., Anthony, S.P., and McKane, S. (2013). Phase I dose- escalation study to examine the safety and tolerability of LY2603618, a checkpoint 1 kinase
inhibitor, administered 1 day after pemetrexed 500 mg/m(2) every 21 days in patients with cancer. Invest New Drugs 31, 136-144.
Whetstine, J R., Nottke, A., Lan, F., Huarte, M., Smolikov, S., Chen, Z., Spooner, E., Li, E., Zhang, G., Colaiacovo, M., et al. (2006). Reversal of histone lysine trimethylation by the JMJD2 family of histone demethylases. Cell 125, 467-481.
Wright J.A., Keegan K.S., Herendeen D R., Bentley N.J., Carr A.M., Hoekstra M.F., Concannon P. (1998). Protein kinase mutants of human ATR increase sensitivity to UV and ionizing radiation and abrogate cell cycle checkpoint control. Proc. Natl. Acad. Sci. U.S.A. 95:7445-7450
Xiao, T., Hall, H., Kizer, K.O., Shibata, Y., Hall, M.C., Borchers, C.H., and Strahl, B .D. (2003). Phosphorylation of RNA polymerase II CTD regulates H3 methylation in yeast. Genes Dev 17, 654-663.
Xie, P., Tian, C, An, L , Nie, J., Lu, K., Xing, G, Zhang, L., and He, F. (2008). Histone methyltransferase protein SETD2 interacts with p53 and selectively regulates its downstream genes. Cell Signal 20, 1671-1678.
Yoshida, T., Tanaka, S., Mogi, A., Shitara, Y , and Kuwano, H. (2004). The clinical significance of Cyclin B l and Weel expression in non-small-cell lung cancer. Ann Oncol 15, 252-256.
Zabludoff, S.D., Deng, C , Grondine, M.R., Sheehy, A.M., Ashwell, S., Caleb, B.L., Green, S., Haye, H.R., Horn, C.L., Janetka, J.W., et al. (2008). AZD7762, a novel checkpoint kinase inhibitor, drives checkpoint abrogation and potentiates DNA-targeted therapies. Mol Cancer Ther 7, 2955-2966.
Zachos, G , Rainey, M.D., and Gillespie, D A. (2003). Chkl -deficient tumour cells are viable but exhibit multiple checkpoint and survival defects. Embo J 22, 713-723.
Zhang Y.-W., Brognard J., Coughlin C, You Z., Dolled-Filhart M., Aslanian A., Manning G., Abraham R.T., Hunter T.(2009). The F box protein Fbx6 regulates Chkl stability and cellular sensitivity to replication stress. Mol. Cell 35 :442-453.
Zhang, J., Ding, L , Holmfeldt, L., Wu, G., Heatley, S.L., Payne-Turner, D., Easton, J., Chen, X., Wang, J., Rusch, M., et al. (2012). The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481, 157-163.
Zou, L., and Elledge, S.J. (2003). Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 300, 1542-1548.
Claims
1. A method of treating a cancer which comprises a decreased amount of H3K36me3 in a patient, the method comprising administering to the patient a WEE1 inhibitor or a checkpoint kinase 1 (CHKl) inhibitor or an ataxia telangiectasia and Rad3 -related protein (ATR) inhibitor and thereby treating the cancer.
2. A method according to claim 1, wherein the cancer is SETD2-deficient.
3. A method according to claim 2, wherein the cancer comprises (a) a decreased amount of SETD2 protein, (b) a decreased amount of SETD2 mRNA, (c) a mutation in SETD2 DNA and/or (d) a chromosome 3 abnormality.
4. A method according to claim 2 or 3 , wherein the SETD2-deficient cancer is a high- grade glioma, bladder cancer, kidney cancer, lung cancer, stomach cancer, large intestine cancer, skin cancer, endometrial cancer, breast cancer or leukaemia.
5. A method according to claim 1, wherein the cancer comprises an increased amount of and/or an increased activity of KDM4A, KDM4B, KDM4C or a combination thereof.
6. A method according to claim 5, wherein the cancer is colorectal cancer, prostate cancer, ovarian cancer, lung cancer, central nervous system (CNS) cancer, breast cancer, pancreatic cancer, large intestine cancer or kidney cancer.
7. A method according to claim 1, wherein the cancer comprises a mutated histone H3 protein and/or a mutation in a histone H3 gene.
8. A method according to claim 7, wherein the mutation is H3.3-G34R/V.
9. A method according to claim 1, wherein the cancer comprises a mutation in the IDH1 gene.
10. A method according to claim 9, wherein the cancer is glioma.
11. A method according to any one of the preceding claims, wherein the inhibitor is a small molecule inhibitor, a protein, an antibody, a polynucleotide, an oligonucleotide, an antisense RNA, small interfering RNA (siRNA) or small hairpin RNA (shRNA).
12. A method according to any one of the preceding claims, wherein the WEE1 inhibitor is MK- 1775.
13. A method according to any one of claims 1 to 11, wherein the WEE1 inhibitor is (a) an oligonucleotide which specifically hybridises to a part of SEQ ID NO: 4, 6 or any isoform thereof or (b) an oligonucleotide which comprises 50 or fewer consecutive nucleotides from SEQ ID NO: 3 or any isoform thereof or a variant thereof which has at least 90% homology to SEQ ID NO: 3 or any isoform thereof based on nucleotide identity over its entire sequence
14. A method according to claim 13, wherein the oligonucleotide comprises (a)
AAUAGAACAUCUCGACUUA (SEQ ID NO: 17), (b) AAUAUGAAGUCCCGGUAUA (SEQ ID NO: 18), (c) GAUCAUAUGCUUAUACAGA (SEQ ID NO: 19) or (d)
CGACAGACUCCUCAAGUGA (SEQ ID NO: 20).
15. A method according to any one of claims 1 to 11, wherein the CHK1 inhibitor is AZD7762, LY2603618 (IC-83) or Go 6976.
16. A method according to any one of claims 1 to 11, wherein the CHK1 inhibitor is (a) an oligonucleotide which specifically hybridises to a part of SEQ ID NO: 9, 12 or any isoform thereof or (b) an oligonucleotide which comprises 50 or fewer consecutive nucleotides from SEQ ID NO: 8, 11 or any isoform thereof or a variant thereof which has at least 90% homology to SEQ ID NO: 8, 11 or any isoform thereof based on nucleotide identity over its entire sequence.
17. A method according to claim 16, wherein the oligonucleotide comprises
GGCUUGGC AAC AGUAUUUC GGUAUA (SEQ ID NO: 21).
18. A method according to any one of claims 1 to 11, wherein the ATR inhibitor is VE- 821.
19. A method according to any one of claims 1 to 11, wherein the ATR inhibitor is (a) an oligonucleotide which specifically hybridises to a part of SEQ ID NO: 15 or any isoform
thereof or (b) an oligonucleotide which comprises 50 or fewer consecutive nucleotides from SEQ ID NO: 14 or any isoform thereof or a variant thereof which has at least 90% homology to SEQ ID NO: 14 or any isoform thereof based on nucleotide identity over its entire sequence.
20. A method according to claim 19, wherein the oligonucleotide comprises
GGGAAAUACUAGAACCUCAUCUAAA (SEQ ID NO: 23).
21. A method according to any one of the preceding claims, wherein the patient is human.
22. A method of treating cancer in a patient, the method comprising (a) determining whether or not the cancer comprises a decreased amount of H3K36me3 and (b), if the cancer comprises a decreased amount of H3K36me3, administering to the patient a WEEl inhibitor or a CHKl inhibitor or an ATR inhibitor and thereby treating the cancer.
23. A WEEl inhibitor or a CHKl inhibitor or an ATR inhibitor for use in a method of treating in a patient a cancer which comprises a decreased amount of H3K36me3.
24. Use of a WEEl inhibitor or a CHKl inhibitor or an ATR inhibitor in the manufacture of a medicament for treating in a patient a cancer which comprises a decreased amount of H3K36me3.
25. A kit for treating cancer comprising (a) means for testing whether or not the cancer comprises a decreased amount of H3K36me3 and (b) a WEEl inhibitor or a CHKl inhibitor or an ATR inhibitor.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB201309238A GB201309238D0 (en) | 2013-05-22 | 2013-05-22 | Treatment |
| GB1309238.2 | 2013-05-22 | ||
| GB1321115.6 | 2013-11-29 | ||
| GB201321115A GB201321115D0 (en) | 2013-11-29 | 2013-11-29 | Treatment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014188201A2 true WO2014188201A2 (en) | 2014-11-27 |
| WO2014188201A3 WO2014188201A3 (en) | 2015-03-05 |
Family
ID=50829207
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2014/051577 Ceased WO2014188201A2 (en) | 2013-05-22 | 2014-05-22 | Treatment |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014188201A2 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016112374A3 (en) * | 2015-01-09 | 2016-09-01 | The General Hospital Corporation | Treating cancer using inhibitors of ataxia-telangiectasia mutated and rad3-related (atr) |
| WO2016149618A1 (en) * | 2015-03-19 | 2016-09-22 | The Johns Hopkins University | Method for regulation of telomere-length |
| RU2813966C2 (en) * | 2017-12-29 | 2024-02-20 | Вертекс Фармасьютикалз Инкорпорейтед | Methods for treatment of malignant tumors, using atr inhibitor |
| WO2025133381A3 (en) * | 2023-12-22 | 2025-10-23 | Debiopharm International S.A. | Methods of treating solid tumors |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006005462A2 (en) * | 2004-07-15 | 2006-01-19 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with tyrosine kinase wee 1 (wee1) |
| US9222086B2 (en) * | 2009-09-23 | 2015-12-29 | Protiva Biotherapeutics, Inc. | Compositions and methods for silencing genes expressed in cancer |
| US20120029062A1 (en) * | 2010-08-02 | 2012-02-02 | Gunaratne Preethi H | Interior functionalized hyperbranched dendron-conjugated nanoparticles and uses thereof |
| RU2017127088A (en) * | 2010-11-16 | 2019-02-04 | Эррэй Биофарма Инк. | COMBINATION OF CHECKPOINT KINASE 1 INHIBITORS AND WEE 1 KINASE INHIBITORS |
-
2014
- 2014-05-22 WO PCT/GB2014/051577 patent/WO2014188201A2/en not_active Ceased
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016112374A3 (en) * | 2015-01-09 | 2016-09-01 | The General Hospital Corporation | Treating cancer using inhibitors of ataxia-telangiectasia mutated and rad3-related (atr) |
| WO2016149618A1 (en) * | 2015-03-19 | 2016-09-22 | The Johns Hopkins University | Method for regulation of telomere-length |
| RU2813966C2 (en) * | 2017-12-29 | 2024-02-20 | Вертекс Фармасьютикалз Инкорпорейтед | Methods for treatment of malignant tumors, using atr inhibitor |
| WO2025133381A3 (en) * | 2023-12-22 | 2025-10-23 | Debiopharm International S.A. | Methods of treating solid tumors |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014188201A3 (en) | 2015-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11957703B2 (en) | Modulating Nudix homology domain (NHD) with nicotinamide mononucleotide analogs and derivatives of same | |
| Yen et al. | ARAF mutations confer resistance to the RAF inhibitor belvarafenib in melanoma | |
| Li et al. | A ROR1–HER3–lncRNA signalling axis modulates the Hippo–YAP pathway to regulate bone metastasis | |
| KR102373074B1 (en) | Inhibitors of human ezh2, and methods of use thereof | |
| Göder et al. | HDAC1 and HDAC2 integrate checkpoint kinase phosphorylation and cell fate through the phosphatase-2A subunit PR130 | |
| Reynoird et al. | Coordination of stress signals by the lysine methyltransferase SMYD2 promotes pancreatic cancer | |
| Bryant et al. | PARP is activated at stalled forks to mediate Mre11-dependent replication restart and recombination | |
| Buss et al. | Cyclin-dependent kinase 6 phosphorylates NF-κB P65 at serine 536 and contributes to the regulation of inflammatory gene expression | |
| Lee et al. | Parkin regulates mitosis and genomic stability through Cdc20/Cdh1 | |
| Burdova et al. | E2F1 proteolysis via SCF‐cyclin F underlies synthetic lethality between cyclin F loss and Chk1 inhibition | |
| Chand et al. | Posttranscriptional regulation of PARG mRNA by HuR facilitates DNA repair and resistance to PARP inhibitors | |
| Wood et al. | MCPH1 functions in an H2AX-dependent but MDC1-independent pathway in response to DNA damage | |
| Buss et al. | The WIP1 oncogene promotes progression and invasion of aggressive medulloblastoma variants | |
| Hooten et al. | Coordination of DNA repair by NEIL1 and PARP-1: a possible link to aging | |
| US20160130663A1 (en) | Method for predicting response to cancer treatment | |
| Liu et al. | The mismatch repair‐mediated cell cycle checkpoint response to fluorodeoxyuridine | |
| US20230149507A1 (en) | Treatment of alt cancers | |
| Abramowicz et al. | Oral-facial-digital syndrome type I cells exhibit impaired DNA repair; unanticipated consequences of defective OFD1 outside of the cilia network | |
| JP2025164768A (en) | Determine cancer response to treatment | |
| WO2014188201A2 (en) | Treatment | |
| Ferreira et al. | The novel RNA polymerase I transcription inhibitor PMR-116 exploits a critical therapeutic vulnerability in a broad-spectrum of high MYC malignancies | |
| US12404332B2 (en) | Methods for diagnosing and treating cancers | |
| Siles | Translational readthrough of nonsense mutant TP53, RB1 and PTEN tumor suppressor genes as a strategy for novel cancer therapy | |
| US20210003580A1 (en) | Methods of detection and treatment of hyper transcription diseases | |
| WO2015109218A1 (en) | Targeted cancer treatment by hsp90 inhibitors ganetespib and nvp-auy922 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14726743 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14726743 Country of ref document: EP Kind code of ref document: A2 |

