WO2014182673A1 - Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto - Google Patents
Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto Download PDFInfo
- Publication number
- WO2014182673A1 WO2014182673A1 PCT/US2014/036928 US2014036928W WO2014182673A1 WO 2014182673 A1 WO2014182673 A1 WO 2014182673A1 US 2014036928 W US2014036928 W US 2014036928W WO 2014182673 A1 WO2014182673 A1 WO 2014182673A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- methyl
- piperazin
- chloro
- trifluoropropyl
- phenyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 *C(C1)N(CCC(F)(F)F)CCN1c1cc(Cl)ccc1NC(c(ccc(CNC(N(*)*)=O)c1F)c1F)=O Chemical compound *C(C1)N(CCC(F)(F)F)CCN1c1cc(Cl)ccc1NC(c(ccc(CNC(N(*)*)=O)c1F)c1F)=O 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D211/56—Nitrogen atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
- C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D207/04—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D207/08—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon radicals, substituted by hetero atoms, attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
- C07D211/18—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
- C07D211/18—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
- C07D211/20—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by singly bound oxygen or sulphur atoms
- C07D211/22—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by singly bound oxygen or sulphur atoms by oxygen atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/36—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D211/56—Nitrogen atoms
- C07D211/58—Nitrogen atoms attached in position 4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D257/00—Heterocyclic compounds containing rings having four nitrogen atoms as the only ring hetero atoms
- C07D257/02—Heterocyclic compounds containing rings having four nitrogen atoms as the only ring hetero atoms not condensed with other rings
- C07D257/04—Five-membered rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
- C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
- C07D295/06—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by halogen atoms or nitro radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
- C07D307/02—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
- C07D307/04—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
- C07D307/18—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D307/22—Nitrogen atoms not forming part of a nitro radical
Definitions
- the present invention relates to compounds of Formula (la) and pharmaceutically acceptable salts, solvates, and hydrates thereof that modulate the activity of the Mas receptor, and are useful in methods of treatment and alleviation of diseases and disorders of the heart, brain, kidney, immune system, and reproductive system resulting from ischemia, or reperfusion subsequent to ischemia, and any downstream complication(s) related thereto.
- the present invention further relates to methods of treatment and alleviation of diseases and disorders of the vasculature resulting from vasoconstriction or hypertension and any downstream complication(s) resulting from elevated blood pressure and/or reduced tissue perfusion.
- vascular disorders such as: coronary heart disease, atherosclerosis, ischemia, reperfusion injury, angina pectoris, myocardial infarction, the no-reflow phenomenon, hypertension, anxiety, transient ischemic attack, erectile dysfunction, ischemic colitis, mesenteric ischemia, acute limb ischemia, skin discoloration caused by reduced blood flow to the skin, renal artery stenosis, renovascular hypertension, renal failure, chronic kidney disease, and diabetic nephropathy; and calcium-signaling disorders such as: arrhythmia, tachycardia, bradycardia, supraventricular arrhythmia, atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, Wolff-Parkinson-White syndrome, ventricular arrhythmia, ventricular tachycardia, ventricular fibrillation, reperfusion arrhythmia, and reperfusion-induced cardiomyocyte cell death.
- vascular disorders such as: coronary heart disease
- G protein-coupled receptors share the common structural motif of having seven sequences of twenty-two to twenty-four hydrophobic amino acids that form seven alpha helices, each of which spans the cell membrane.
- the transmembrane helices are joined by strands of amino acids including a longer strand between the fourth and fifth transmembrane helices on the extracellular side of the membrane.
- Another longer strand composed primarily of hydrophilic amino acids, joins transmembrane helices five and six on the intracellular side of the membrane.
- the carboxy terminus of the receptor lies intracellularly with the amino terminus residing in the extracellular space.
- G proteins that have been identified include G q , G s , Gj, and G 0 .
- GPCRs exist in the cell membrane in equilibrium between two different states or conformations: an "inactive" state and an “active” state.
- a receptor in an inactive state is unable to link to the intracellular transduction pathway to produce a biological response.
- a change of the receptor conformation to the active state allows linkage to the transduction pathway and produces a biological response.
- these conformational changes are induced in response to binding of a molecule to the receptor.
- Several types of biological molecules can bind to specific receptors, such as peptides, hormones or lipids, and can cause a cellular response. Modulation of particular cellular responses can be extremely useful for the treatment of disease states, as can a number of chemical agents that act on GPCRs.
- the Mas receptor (Mas, or alternatively Masl) is a class I rhodopsin-like GPCR. In mammals,
- the Mas proto-oncogene encodes a GPCR protein (Mas) and was first detected in vivo by its tumorigenic properties which originate from rearrangement of its 5' flanking region (Young, D., et al., Cell 45 :711-719 (1996)). Subsequent studies have indicated that the tumorigenic properties of Mas appear to be negligible.
- the present invention describes, inter alia, the proximal signaling pathways activated by Mas and the role of the Mas receptor in cardiac ischemia/reperfusion (I/R) injury in vivo.
- I/R cardiac ischemia/reperfusion
- described herein include small molecule, non-peptide modulators of the Mas-G q -phospholipase C (PLC) signaling pathway.
- the present invention is directed to, inter alia, certain urea derivatives and pharmaceutically acceptable salts, solvates, and hydrates thereof, which are useful, for example, in methods of treatment or alleviation of ischemia-related disorders of the heart, brain, kidney, and reproductive system. While the literature cited herein may indicate that an agonist of the Mas receptor would be cardioprotective and decrease blood pressure, applicants have unexpectedly identified compounds that can act as inverse agonists of the Mas receptor which are cardioprotective and do not raise blood pressure.
- One aspect of the present invention is directed to compounds, as described herein, and pharmaceutically acceptable salts, solvates, and hydrates thereof, which bind to and modulate the activity of a GPCR, referred to herein as Mas, and uses related thereto.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (la) and pharm ereof:
- R 1 is selected from: Ci-C 6 alkyl, C 3 -C 7 cycloalkyl, C 4 -Ci 3 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl; each optionally substituted with one or more substituents selected from: C 1 -C6 alkoxycarbonyl, C 1 -C6 alkyl, C 1 -C6 alkylsulfonyl, amino, carboxamide, cyano, C 2 - C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
- R 2 is selected from: H and C 1 -C6 alkyl, wherein said C 1 -C6 alkyl is optionally substituted with one or more hydroxyl substituents;
- R 1 is a group other than: 2-(ieri-butoxy)-2-oxoethyl, 3-(ieri-butoxy)-3-oxopropyl, A-(tert- butoxy)-4-oxobutyl, or 1 -(ieri-butoxy)-4-methyl- 1 -oxopentan-2-yl;
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl, C C6 haloalkyl, and hydroxy-Ci-C6-alkyl;
- R 3 is selected from: H and halogen
- R 4 is halogen
- R 5 is selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxyl, and halogen; and R 6 is selected from: H and C 1 -C6 alkyl.
- R 5 is selected from: C 1 -C6 alkoxycarbonyl, C 1 -C6 alkyl, and halogen.
- One aspect of the present invention pertains to a crystalline form of (S)-N-(4-chloro-2-(4- (3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide .
- One aspect of the present invention pertains to anhydrous ( l S')-iV-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide .
- One aspect of the present invention pertains to a crystalline form of anhydrous (S)-N-(4-chloio-
- One aspect of the present invention pertains to a crystalline form of anhydrous (S)-N-(4-chloio- 2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide, having an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 9.36 °.
- compositions comprising a compound of the present invention.
- One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention and a pharmaceutically acceptable carrier.
- One aspect of the present invention pertains to compounds of Formula (la), and
- compositions comprising a compound of the present invention or a crystalline form of the present invention.
- One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit, each comprising a compound of the present invention or a crystalline form of the present invention.
- One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention or a crystalline form of the present invention, and a
- One aspect of the present invention pertains to methods for preparing a pharmaceutical composition
- methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention or a crystalline form of the present invention, and a pharmaceutically acceptable carrier.
- compositions comprising a compound of the present invention or a crystalline form of the present invention, and a second pharmaceutical agent.
- One aspect of the present invention pertains to methods for preparing a composition comprising the step of admixing a compound of the present invention or a crystalline form of the present invention, and a second pharmaceutical agent.
- One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a dosage form, a combined preparation, a twin pack, and a kit; comprising a compound of the present invention or a crystalline form of the present invention and a second pharmaceutical agent.
- compositions comprising a compound of the present invention or a crystalline form of the present invention, a second
- One aspect of the present invention pertains to methods for preparing a pharmaceutical composition
- methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention or a crystalline form of the present invention, a second pharmaceutical agent, and a pharmaceutically acceptable carrier.
- One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising administering to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention.
- One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising prescribing to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention.
- One aspect of the present invention pertains to the use of a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
- One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of a Mas receptor-mediated disorder.
- One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising administering to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a therapeutically effective amount of a second pharmaceutical agent.
- One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising prescribing to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a therapeutically effective amount of a second pharmaceutical agent.
- One aspect of the present invention pertains to the use of a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; each in combination with a second pharmaceutical agent in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
- One aspect of the present invention pertains to the use of a pharmaceutical agent in combination with a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
- One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a second pharmaceutical agent for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a second pharmaceutical agent for use in a method of treatment of a Mas receptor- mediated disorder.
- One aspect of the present invention pertains to a pharmaceutical agent in combination with a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to a pharmaceutical agent in combination with a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of a Mas receptor-mediated disorder.
- One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method of treatment of a Mas receptor-mediated disorder.
- One aspect of the present invention pertains to a composition of the present invention; methods of the present invention; a pharmaceutical product of the present invention; a pharmaceutical composition of the present invention; a use of the present invention; a compound of the present invention; a crystalline form of the present invention; or a pharmaceutical agent of the present invention; wherein the pharmaceutical agent or the second pharmaceutical agent is selected from: an ACE inhibitor, a beta blocker, a calcium channel blocker, a diuretic, a nitrate, a statin, aspirin, an antiplatelet, adenosine, an endothelin receptor antagonist, and a PDE5 inhibitor.
- Figures 1 to 3 show a general synthetic scheme for preparing intermediates useful for preparing compounds of the present invention.
- Figure 4 shows a general synthetic scheme for preparing of compounds of Formula (la).
- Figure 5 shows a general synthetic scheme for preparing of compounds of Formula (la).
- Figure 6 shows the dose dependent effect of Compound 17 on myocardial infarction size in rats subjected to coronary artery ligation and reperfusion.
- Figure 7 shows the effect of Compound 17 on mean arterial pressure (MAP) measured at drug steady state (25 min after starting dosing).
- Figure 8 shows a powder X-ray diffraction pattern (PXRD) for a sample containing
- Figure 9 shows a differential scanning calorimetry (DSC) thermogram for or a sample containing Compound 17, Form 1 , and a thermogravimetric analysis (TGA) thermogram of a sample containing Compound 17, Form 1.
- DSC differential scanning calorimetry
- TGA thermogravimetric analysis
- FIG 10 shows a dynamic moisture sorption (DMS) profile for a sample containing
- Figure 11 shows a powder X-ray diffraction pattern (PXRD) for a sample containing
- Figure 12 shows a differential scanning calorimetry (DSC) thermogram for a sample containing Compound 17 hydrochloride salt solvate, Form 1, and a thermogravimetric analysis (TGA) thermogram of a sample containing Compound 17 hydrochloride salt solvate, Form 1.
- Figure 13 shows Mas mRNA expression analysis by RT-PCR in rat heart. cDNA from adult male Sprague-Dawley rat atria, right ventricle and left ventricle was tested for Mas receptor mRNA expression. GAPDH expression in the same samples was used as an internal control for cDNA quality. Results are representative of three independent experiments.
- Figure 14 shows cellular expression of Mas in coronary arteries.
- Adult rat ventricular cryosections were co-stained with antibodies for Mas and SM-actin (a marker for smooth muscle cells) or Mas and vWF (a marker for endothelial cells).
- Mas protein expression overlapped with markers for smooth muscle cells and endothelial cells indicating expression in both smooth muscle and endothelial cells in coronary arteries.
- Figure 15 shows Mas mRNA expression analysis by RT-PCR in human cardiovascular cDNA panel.
- cDNA prepared from human cardiovascular and non-cardiovascular (placenta) tissues was analyzed for Mas mRNA expression. Actin mRNA expression was measured and used as a control for cDNA quality. Results are representative of three independent experiments.
- Figure 16 shows immunohistochemical staining of Mas in human left ventricular sections.
- Human myocardial cryosections were stained with either Mas antibody or Mas antibody preabsorbed with blocking peptide.
- Panel A shows positive staining for Mas in cardiomyocytes.
- Panel B shows positive staining for Mas in coronary arteries (black arrow). Preincubation of Mas antibody with the blocking peptide demonstrates the level of non-specific staining in human myocardial sections. The dark staining indicates hematoxylin counterstaining of cell nuclei.
- FIG 17 shows constitutive Mas G q activity for human and rat receptor constructs.
- Human and rat Mas receptors were transiently transfected into HEK293 cells and G q signaling was measured using an HTRF IP1 assay performed 48 h post transfection.
- Figure 18 shows a Mas agonist and an inverse agonist that modulate G q in HEK293 cells expressing human Mas. Increasing concentrations of Mas agonist (AR234960) and inverse agonist
- FIG 19 shows a Mas agonist and an inverse agonist that modulate G q in HEK293 cells expressing rat Mas.
- Mas agonist AR234960
- inverse agonist AR244555
- Figure 20 shows the effect of the Mas agonist (AR234960) on intracellular Ca 2+ Levels. Fluorometric assays were used to monitor Ca 2+ levels in HEK293 cells stably expressing human Mas receptor. Changes in intracellular Ca 2+ were monitored before and after addition of the Mas agonist AR234960 at indicated concentrations. Measurements were made in triplicate.
- FIG 22 shows the effects of Mas compounds on rat coronary flow.
- Coronary flow was measured in isolated perfused rat hearts. Coronary flow was significantly increased upon stimulation with Mas inverse agonist AR244555 (5 ⁇ ) and significantly decreased with Mas agonist AR234960 (1 ⁇ ).
- Pretreatment with the Mas inverse agonist AR244555 (5 ⁇ ) or the PLC inhibitor U-73122 (0.5 ⁇ ) prevented the decrease in coronary flow induced by AR234960.
- Changes in coronary flow induced by AR234960 with the pretreatment of AR244555 or U-73122 were calculated as percentage of the coronary flow at 10 min after AR234960 treatment relative to the coronary flow measured immediately prior to addition of AR234960.
- FIG. 23 shows the effects of Mas compounds on rat coronary flow after ischemia and reperfusion. Coronary flow was measured continuously in isolated perfused rat hearts that were subjected to 30 min of global ischemia followed by 30 min of reperfusion. Mas agonist (1 ⁇
- FIG. 24 shows ablation of Mas receptor in mice is cardioprotective during
- I/R injury ischemia/reperfusion injury
- Figure 25 shows the inverse agonist of the Mas receptor (AR244555) was cardioprotective in rats when administered prior to ischemia or immediately before reperfusion.
- ischemia/reperfusion injury was produced in rats by ligation of the left anterior descending coronary artery for 30 min followed by reperfusion for 2 h.
- Vehicle (20% HPBCD, i.v.) or the Mas inverse agonist (AR244555, 10 mg/kg i.v.) was administered 10 min before ligation (pre-ischemia) or 3 min before reperfusion (pre -reperfusion).
- FIG. 26 shows expression of Mas receptor following lipopolysaccharide (LPS) stimulation.
- LPS lipopolysaccharide
- Figure 27 shows expression of mTNFa following LPS stimulation in mice.
- Figure 28 shows suppression of TNFa induction with an inverse agonist of the Mas receptor (Compound A, see Compound 170 in PCT/US2012/063793) in mice.
- Figure 29 shows that a Mas receptor inverse agonist (AR305352) suppresses paw swelling in the Carrageenan-Induced Inflammatory Paw Swelling Model.
- Figure 30 shows the protocol for the left kidney artery ischemia reperfusion injury model used in Example 9.
- Figure 31 shows Compound A, a Mas receptor inverse agonist, improves kidney function compared to vehicle treatment as measured by blood creatinine.
- Figure 32 shows Compound A, a Mas receptor inverse agonist, improves kidney function compared to vehicle treatment as measured by blood urea nitrogen (BUN).
- BUN blood urea nitrogen
- Figure 33 shows the protocol for the transient cerebral ischemia/stroke rat model used in
- Figure 34 shows Compound A, a Mas receptor inverse agonist, reduced brain damage associated with transient ischemic injury in the rat.
- agonist refers to a moiety that interacts with and activates a G- protein-coupled receptor, and can thereby initiate a physiological or pharmacological response characteristic of that receptor.
- an agonist may activate an intracellular response upon binding to a receptor, or enhance GTP binding to a membrane.
- antagonist refers to a moiety that competitively binds to the receptor at the same site as an agonist (for example, the endogenous ligand), but which does not activate the intracellular response initiated by the active form of the receptor and can thereby inhibit the intracellular responses by an agonist or partial agonist.
- An antagonist does not diminish the baseline intracellular response in the absence of an agonist or partial agonist.
- composition refers to a compound of the present invention, including but not limited to, salts, solvates, and hydrates of a compound of the present invention, in combination with at least one additional component.
- the term "Mas” as used herein includes the human amino acid sequences found in GeneBank accession number CR542261, and naturally-occurring allelic variants thereof, and mammalian orthologs thereof.
- a preferred human Mas for use in screening and testing of the compounds of the invention is provided by the nucleotide sequence and the corresponding amino acid sequence found in GeneBank accession number CR542261.
- the term "in need of treatment” and the term “in need thereof when referring to treatment are used interchangeably and refer to a judgment made by a caregiver (e.g. physician, nurse, nurse practitioner, etc. in the case of humans; veterinarian in the case of animals, including non-human mammals) that an individual or animal requires or will benefit from treatment.
- the compounds of the invention can be used in a protective or preventive manner; or compounds of the invention can be used to alleviate, inhibit or ameliorate the disease, condition or disorder.
- mice refers to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans.
- inverse agonist refers to a moiety that binds to the endogenous form of the receptor or to the constitutively activated form of the receptor and which inhibits the baseline intracellular response initiated by the active form of the receptor below the normal base level of activity which is observed in the absence of an agonist or partial agonist, or decreases GTP binding to a membrane.
- the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, more preferably by at least 50% and most preferably by at least 75%, as compared with the baseline response in the absence of the inverse agonist.
- modulate or modulating refers to an increase or decrease in the amount, quality, response or effect of a particular activity, function or molecule.
- partial agonist refers to a moiety that by virtue of binding to a GPCR activates the GPCR so as to elicit an intracellular response mediated by the GPCR, albeit to a lesser extent or degree than does a full agonist.
- composition refers to a composition comprising at least one active ingredient, such as a compound of Formula (la) or a salt, solvate, or hydrate thereof, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, without limitation, a human).
- active ingredient such as a compound of Formula (la) or a salt, solvate, or hydrate thereof
- a mammal for example, without limitation, a human.
- terapéuticaally effective amount refers to the amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal, individual or human that is being sought by a researcher, veterinarian, medical doctor or other clinician or caregiver or by an individual, which includes one or more of the following:
- preventing the disease for example, preventing a disease, condition or disorder in an individual that may be predisposed to the disease, condition or disorder but does not yet experience or display the pathology or symptomatology of the disease;
- inhibiting the disease for example, inhibiting a disease, condition or disorder in an individual that is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., arresting further development of the pathology and/or symptomatology);
- ameliorating the disease for example, ameliorating a disease, condition or disorder in an individual that is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology and/or symptomatology).
- Ci-C6 alkoxy refers to a radical comprising a Ci-C6 alkyl group attached to an oxygen atom, wherein Ci-C6 alkyl has the same definition as found herein. Some embodiments contain 1 to 5 carbons. Some embodiments contain 1 to 4 carbons. Some embodiments contain 1 to 3 carbons. Some embodiments contain 1 or 2 carbons. Examples include, but are not limited to methoxy, ethoxy, M-propoxy, isopropoxy, w-butoxy, ieri-butoxy, isobutoxy, and sec-butoxy.
- amino refers to the radical -NH 2 .
- Ci-C6 alkoxycarbonyl refers to a radical comprising a Ci-C6 alkoxy group attached to a carbonyl, wherein Ci-C6 alkoxy has the same definition as found herein. Examples include, but are not limited to, methoxycarbonyl [i.e., -C0 2 CH 3 ], ethoxycarbonyl, propoxycarbonyl,
- Ci-C6 alkyl refers to a straight or branched carbon radical containing 1 to 6 carbons. Some embodiments contain 1 to 5 carbons. Some embodiments contain 1 to 4 carbons. Some embodiments contain 1 to 3 carbons. Some embodiments contain 1 or 2 carbons.
- Examples of an alkyl group include, but are not limited to, methyl, ethyl, w-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, i-pentyl, neopentyl, 1-methylbutyl [i.e. , -CH(CH 3 )CH 2 CH 2 CH 3 ], 2- methylbutyl [i.e., -CH 2 CH(CH 3 )CH 2 CH 3 ], and n-hexyl.
- Ci-C6 alkylsulfonyl refers to a radical comprising a Ci-C6 alkyl group attached to the sulfur of a sulfonyl group, wherein Ci-C 6 alkyl has the same definition as described herein.
- Examples include, but are not limited to, methylsulfonyl, ethylsulfonyl, w-propylsulfonyl,
- Ci-C6 haloalkyl refers to a radical comprising a Ci-C6 alkyl group substituted with one or more halogens, wherein Ci-C6 alkyl has the same definition as found herein.
- the Ci-C6 haloalkyl may be fully substituted in which case it can be represented by the formula C q L 2q+1 , wherein L is a halogen and "q" is 1, 2, 3, 4, 5, or 6. When more than one halogen is present then they may be the same or different and selected from: fluorine, chlorine, bromine, and iodine.
- haloalkyl contains 1 to 5 carbons.
- haloalkyl contains 1 to 4 carbons.
- haloalkyl contains 1 to 3 carbons. In some embodiments, haloalkyl contains 1 or 2 carbons.
- haloalkyl groups include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, and 2-fluoropropan-2-yl.
- C 2 -C 8 dialkylamino refers to a radical comprising two C 1 -C4 alkyl groups, that are the same or different, attached to an amino group, wherein C 1 -C4 alkyl and amino have the same definitions as described herein.
- C 3 -C 7 cycloalkyl refers to a saturated ring radical containing 3 to 7 carbons. Some embodiments contain 3 to 4 carbons. Some embodiments contain 3 to 5 carbons. Some embodiments contain 4 to 6 carbons. Some embodiments contain 5 to 6 carbons. Examples include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.
- C4-C 13 cycloalkylalkyl refers to a radical comprising a C 3 -C 7 cycloalkyl group attached to a C 1 -C6 alkyl group, wherein the C3-C7 cycloalkyl and C 1 -C6 alkyl groups have the same definitions as described herein. Examples include, but are not limited to cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, and cyclopropylethyl.
- carboxylate refers to the group -CONH 2 .
- carboxyl refers to the group -C0 2 H.
- carboxy-Ci-C6-alkyl refers to a radical comprising a carboxyl group attached to a C 1 -C6 alkyl group, wherein the carboxyl and C 1 -C6 alkyl groups have the same definitions as described herein. Examples include, but are not limited to carboxymethyl [i.e., -CH 2 C0 2 H], 2-carboxyethyl [i.e., -CH 2 CH 2 C0 2 H], and 1-carboxyethyl [i.e., -CH(CH 3 )C0 2 H].
- cyano refers to the group -CN.
- halogen refers to a fluoro, chloro, bromo, or iodo group.
- heteroaryl refers to a ring system containing 5 to 10 ring atoms, that may contain a single ring or two fused rings, and wherein at least one ring is aromatic and at least one ring atom of the aromatic ring is a heteroatom selected from, for example: O, S and N, wherein N is optionally substituted with H, C 1 -C4 acyl, C 1 -C4 alkyl, or O (i.e., forming an iV-oxide) and S is optionally substituted with one or two oxygens.
- the aromatic ring contains one heteroatom.
- the aromatic ring contains two heteroatoms.
- the aromatic ring contains three heteroatoms.
- heteroaryl rings that include, but are not limited to, furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, oxadiazolyl, triazolyl, tetrazolyl, thiadiazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl.
- Some embodiments are directed to 5-membered heteroaryl rings.
- Examples of a 5-membered heteroaryl ring include, but are not limited to, furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, oxadiazolyl, triazolyl, tetrazolyl, and thiadiazolyl.
- Some embodiments are directed to 6-membered heteroaryl rings.
- Examples of a 6- membered heteroaryl ring include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl.
- heterocyclyl refers to a non-aromatic ring radical containing 3 to 10 ring atoms, wherein one, two or three ring atoms are heteroatoms selected independently from, for example: O, S, and N, wherein S is optionally substituted with one or two oxo groups. It is understood that a ring carbon of the heterocyclyl group can not be substituted with an oxo group.
- heterocyclyl group examples include, but are not limited to, aziridinyl, azetidinyl, piperidinyl, morpholinyl, piperazinyl, pyrrolidinyl, [l,3]-dioxolanyl, thiomorpholinyl, [l,4]oxazepanyl, 1, 1-dioxothiomorpholinyl, azepanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydrothiopyranyl, l-oxo-hexahydro- ⁇ 4 -thiopyranyl, 1, 1- dioxo-hexahydro- ⁇ 6 -thiopyranyl, and azabicyclo[3.2.1]octanyl.
- heterocyclyl-Ci-C6-alkyl refers to a radical comprising a heterocyclyl group attached to a C 1 -C6 alkyl radical, wherein heterocyclyl and C 1 -C6 alkyl have the same definitions as described herein.
- heterocyclyl-Ci-C6-alkyl group examples include, but are not limited to, aziridinylmethyl, azetidinylmethyl, piperidinylmethyl, morpholinylmethyl, piperazinylmethyl, pyrrolidinylmethyl, [l,3]-dioxolanylmethyl, thiomorpholinylmethyl, [l ,4]oxazepanylmethyl, 1, 1- dioxothiomorpholinylmethyl, azepanylmethyl, tetrahydrofuranylmethyl, tetrahydropyranylmethyl, tetrahydrothiopyranylmethyl, 1 -oxo-hexahydro- 1 ⁇ 4 -thiopyranylmethyl, 1 , 1 -dioxo-hexahydro- 1 ⁇ 6 - thiopyranylmethyl, and azabicyclo[3.2.1]octanylmethyl.
- hydroxy-Ci-C 6 -alkyl refers to a radical comprising a hydroxyl group attached to a C 1 -C6 alkyl radical, wherein hydroxyl and Ci-C6 alkyl have the same definitions as described herein. Examples include, but are not limited to hydroxymethyl, 2-hydroxyethyl, and 1-hydroxyethyl.
- hydroxyl refers to the radical -OH.
- phosphonooxy refers to the radical -OP0 3 H 2 .
- sulfo refers to the radical -S0 3 H.
- One aspect of the present invention encompasses, inter alia, certain urea derivatives selected from compounds of Formul vates, and hydrates thereof:
- R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 have the same definitions as described herein. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
- substituted indicates that at least one hydrogen atom of the chemical group is replaced by a non-hydrogen substituent or group; the non-hydrogen substituent or group can be monovalent or divalent. When the substituent or group is divalent, then it is understood that this group is further substituted with another substituent or group.
- a chemical group herein when a chemical group herein is "substituted" it may have up to the full valance of substitution; for example, a methyl group can be substituted by 1 , 2, or 3 substituents, a methylene group can be substituted by 1 or 2 substituents, a phenyl group can be substituted by 1, 2, 3, 4, or 5 substituents, a naphthyl group can be substituted by 1, 2, 3, 4, 5, 6, or 7 substituents, and the like.
- substituted with one or more substituents refers to the substitution of a group with one substituent up to the total number of substituents physically allowed by the group. Further, when a group is substituted with more than one group they can be identical or they can be different.
- Tautomeric forms can be in equilibrium or sterically locked into one form by appropriate substitution. It is understood that the various tautomeric forms are within the scope of the compounds of the present invention.
- meso isomers Such meso isomers may be referred to as cis and trans isomers.
- the cis meso isomers of compounds of Formula (la) are named herein using the designation (Is, 3s) and the trans meso isomers of compounds of Formula (la) are named herein using the designation (lr,3r) as shown below:
- One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (ls,3s).
- One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (l r,3r).
- the cis meso isomers of compounds of Formula (la) are named herein using the designation (ls,4.y) and the trans meso isomers of compounds of Formula (la) are named herein using the designation (l r,4r) as shown below:
- One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (li,4i).
- One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (l r,4r).
- R 1 is a group other than a group selected from the following groups:
- R 1 is selected from: C 1 -C6 alkyl, C 3 -C 7 cycloalkyl, C4-C13
- cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl each optionally substituted with one or more substituents selected from: Ci-C 6 alkoxycarbonyl, Ci-C 6 alkyl, Ci-C 6 alkylsulfonyl, amino, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo.
- R 1 is selected from: C 1 -C6 alkyl, C3-C7 cycloalkyl, C4-C13
- cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C 6 -alkyl each optionally substituted with one or more substituents selected from: C 1 -C6 alkoxycarbonyl, C 1 -C6 alkyl, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo.
- R 1 is selected from: C 1 -C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: C 1 -C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl.
- R 1 is selected from: ethyl, methyl, n-propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, w-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: C 1 -C6 alkoxycarbonyl, C 1 -C6 alkyl, C 1 -C6 alkylsulfonyl, amino, carboxamide, cyano, C 2 -
- R 1 is selected from: ethyl, methyl, n-propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: C 1 -C6 alkoxycarbonyl, C 1 -C6 alkyl, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C 6 -alkyl,
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: C 1 -C 6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl.
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, w-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, pyrrolidinyl, methyl, carboxamide, dimethylamino, hydroxymethyl,
- R 1 is selected from: ethyl, methyl, w -propyl, piperidinyl, cyclohexyl,
- tetrahydrofuranyl cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy.
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, and pyrrolidinyl.
- R 1 is selected from: 2-aminoethyl, 2-hydroxyethyl,
- R 1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, l-methylpiperidin-4- yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (1- hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3-dihydroxybutan-2- yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4- yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1- (hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1-
- R 1 is selected from: 2-aminoethyl, 2-hydroxyethyl,
- R 1 is l-(ethoxycarbonyl)cyclopropyl.
- R 1 is l-(hydroxymethyl)cyclopropyl.
- R 1 is 2-hydroxypyrimidin-4-yl.
- R 1 is l-hydroxy-3-methylbutan-2-yl.
- R 1 is l-hydroxypropan-2-yl.
- R 1 is 1 ,3-dihydroxy-2-methylpropan-2-yl.
- R 1 is 3-hydroxypropyl.
- R 1 is l-(hydroxymethyl)cyclopentyl.
- R 1 is 1 -hydroxy-3-methylpentan-2-yl.
- R 1 is 4-hydroxybutyl.
- R 1 is 2-sulfoethyl.
- R 1 is 3-hydroxy-2,2-dimethylpropyl.
- R 1 is (2-hydroxycyclohexyl)methyl.
- R 1 is (4-(hydroxymethyl)cyclohexyl)methyl
- R 1 is 3-(hydroxymethyl)cyclobutyl.
- R 1 is 4-(hydroxymethyl)cyclohexyl.
- R 1 is 5-hydroxypentyl
- R 1 is (l/f-tetrazol-5-yl)methyl.
- R 1 is l,3-dihydroxypropan-2-yl.
- R 1 is 1 -amino -3 -hydroxy- 1 -oxopropan-2-yl.
- R 1 is 2-(phosphonooxy)ethyl.
- R 1 is 2-(phosphonooxy)propyl.
- R 1 is l-(phosphonooxy)propan-2-yl.
- the Group R 2 is l-(phosphonooxy)propan-2-yl.
- R 2 is selected from: H and Ci-C 6 alkyl, wherein said Ci-C 6 alkyl is optionally substituted with one or more hydroxyl substituents.
- R 2 is selected from: H and Ci-C6 alkyl.
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 2 is selected from: H and methyl.
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and t- butyl.
- R 2 is H.
- R 2 is ethyl
- R 2 is methyl
- R 2 is 2-hydroxyethyl
- R 2 is isopropyl
- R 2 is i-butyl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy- Ci-C 6 -alkyl, Ci-C 6 haloalkyl, and hydroxy-Ci-C 6 -alkyl; provided that when said heterocyclyl is substituted with said hydroxy-Ci-C6-alkyl then R 5 is C 1 -C6 alkyl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: carboxy-Ci-C 6 -alkyl, Ci-C 6 haloalkyl, and hydroxy-Ci-C 6 - alkyl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: trifluoromethyl, carboxymethyl, hydroxymethyl, and chloromethyl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: 4-(trifluoromethyl)piperidin-l-yl, 3- (carboxymethyl)pyrrolidin-l-yl, 4-(hydroxymethyl)piperidin-l-yl, and 4-(chloromethyl)piperidin-l-yl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form 4-(trifluoromethyl)piperidin-l-yl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form 3-(carboxymethyl)pyrrolidin-l-yl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form 4-(hydroxymethyl)piperidin-l-yl.
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form 4-(chloromethyl)piperidin-l-yl.
- R 3 is H and halogen.
- R 3 is H.
- R 3 is halogen. In some embodiments, R 3 is fluorine.
- R 4 is halogen
- R 4 is fluorine
- R 5 is selected from: Ci-C 6 alkoxycarbonyl, Ci-C 6 alkyl, carboxyl, and halogen.
- R 5 is selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, and halogen.
- R 5 is Ci-C6 alkoxycarbonyl.
- R 5 is ethoxycarbonyl
- R 5 is Ci-C 6 alkyl
- R 5 is feri-butyl
- R 5 is carboxyl
- R 5 is a group other than carboxyl.
- R 5 is halogen
- R 5 is chlorine
- R 6 is H and Ci-C6 alkyl.
- R 6 is H.
- R 6 is Ci-C6 alkyl.
- R 6 is methyl
- R 1 is selected from: Ci-C6 alkyl, C 3 -C 7 cycloalkyl, C 4 -Ci 3
- cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
- R 2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents.
- R 1 is selected from: Ci-C6 alkyl, C 3 -C 7 cycloalkyl, C 4 -Ci 3
- cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C 6 -alkyl each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and R 2 is selected from: H and C 1 -C6 alkyl, wherein said C 1 -C6 alkyl is optionally substituted with one or more hydroxyl substituents.
- R 1 is selected from: C 1 -C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: Ci-C 6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
- R 2 is selected from: H and C 1 -C6 alkyl.
- R 1 is selected from: ethyl, methyl, n -propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, n-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C 2 -C 8 dialkyla
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 1 is selected from: ethyl, methyl, n -propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 1 is selected from: ethyl, methyl, n -propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
- R 2 is selected from: H and methyl.
- R 1 is selected from: ethyl, methyl, n -propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, n-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, pyrrolidinyl, methyl, carboxamide, dimethylamino, hydroxymethyl
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy; and
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, and pyrrolidinyl; and
- R 2 is selected from: H and methyl.
- R 1 is selected from: 2-aminoethyl, 2-hydroxyethyl,
- R 2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl.
- R 1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, l-methylpiperidin-4- yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (1- hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3-dihydroxybutan-2- yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4- yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1-
- R 2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl.
- R 1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3-(l/f-imidazol- l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl; and
- R 2 is selected from: H and methyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceu of:
- R 1 is selected from: C 1 -C6 alkyl, C 3 -C 7 cycloalkyl, C4-C13 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: C 1 -C6 alkoxycarbonyl, C 1 -C6 alkyl, C 1 -C6 alkylsulfonyl, amino, carboxamide, cyano, C 2 - C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C 6 -alkyl, phosphonooxy, and sulfo;
- R 2 is selected from: H and C 1 -C6 alkyl, wherein said C 1 -C6 alkyl is optionally substituted with one or more hydroxyl substituents;
- R 3 is selected from: H and halogen
- R 4 is halogen
- R 5 is selected from: C 1 -C6 alkoxycarbonyl, carboxyl, and halogen;
- R 6 is selected from: H and C 1 -C6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: ethyl, methyl, n -propyl, piperidinyl, pyrrolidinyl, cyclohexyl,
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents;
- R 3 is selected from: H and halogen
- R 4 is halogen
- R 5 is selected from: C 1 -C6 alkoxycarbonyl, carboxyl, and halogen; and R 6 is selected from: H and C 1 -C6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, pyrrolidinyl, cyclohexyl,
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents;
- R 3 is selected from: H and halogen
- R 4 is halogen
- R 5 is selected from: Ci-C6 alkoxycarbonyl, carboxyl, and halogen;
- R 6 is selected from: H and Ci-C 6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3-(l/f-imidazol-l- yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, pyrrolidin-2-ylmethyl, 1 - methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2- hydroxycyclohexyl, (1 -hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, l,3-dihydroxybutan-2-yl, 2-(2-(hydroxymethyl)pyrrolidin-l -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy- 5-methylpyrimidin-4-yl,
- R 2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl;
- R 3 is selected from: H and fluorine
- R 4 is fluorine
- R 5 is selected from: ethoxycarbonyl, carboxyl, and chlorine;
- R 6 is selected from: H and methyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceu of:
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl and C 1 -C6 haloalkyl;
- R 3 is halogen
- R 4 is halogen
- R 5 is selected from: C 1 -C6 alkyl and halogen.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: carboxy-Ci-C 6 -alkyl and Ci-C 6 haloalkyl;
- R 3 is halogen
- R 4 is halogen
- R 5 is selected from: C 1 -C6 alkyl and halogen.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: trifluoromethyl, carboxymethyl, and chloromethyl;
- R 3 is halogen
- R 4 is halogen
- R 5 is selected from: C 1 -C6 alkyl and halogen.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 and R 2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: 4-(trifluoromethyl)piperidin-l-yl, 3-(carboxymethyl)pyrrolidin-l-yl, and 4- (chloromethyl)piperidin- 1 -yl;
- R 3 is fluorine
- R 4 is fluorine
- R 5 is selected from: ieri-butyl and chlorine.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ig) and pharm ereof:
- R 1 is selected from: Ci-C6 alkyl, C 3 -C 7 cycloalkyl, C4-C13 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo;
- R 2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents; and
- R 6 is selected from: H and Ci-C6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ig) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: ethyl, methyl, n -propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2- methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n-butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C 6 alkyl, carboxamide, cyano, C 2 -C 8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents; and
- R 6 is selected from: H and Ci-C6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2- methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, w-butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy;
- R 2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents; and
- R 6 is selected from: H and C 1 -C6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ig) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, l-methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2 -hydroxy cyclohexyl, (l-hydroxycyclohexyl)methyl, 1- hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, l,3-dihydroxybutan-2-yl, 2-(2- (hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5 -methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1- (hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1- hydroxypropan
- R 2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl;
- R 6 is selected from: H and methyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: Ci-C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and R 2 is selected from: H and C1-C6 alkyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: C1-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
- R 2 is selected from: H and methyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, IH- imidazolyl, cyano, and pyrrolidinyl; and
- R 2 is selected from: H and methyl.
- One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
- R 1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3-(l/f-imidazol-l- yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl; and R 2 is selected from: H and methyl.
- Some embodiments of the present invention include every combination of one or more of the compounds and pharmaceutically acceptable salts, solvates, and hydrates thereof selected from the following group shown in Table A.
- individual compounds and chemical genera of the present invention encompass all pharmaceutically acceptable salts, solvates, and hydrates, thereof.
- the compounds of Formula (la) of the present invention may be prepared according to relevant published literature procedures that are used by one skilled in the art. Exemplary reagents and procedures for these reactions appear hereinafter in the working Examples. Protection and deprotection may be carried out by procedures generally known in the art (see, for example, Greene, T. W. and Wuts, P. G. M., Protecting Groups in Organic Synthesis, 3 rd Edition, 1999 [Wiley]).
- the present invention embraces each diastereoisomer, each enantiomer and mixtures thereof of each compound and generic formula disclosed herein just as if they were each individually disclosed with the specific stereochemical designation for each chiral carbon. Separation of the individual isomers (such as, by chiral HPLC, recrystallization of diastereoisomeric mixtures and the like) or selective synthesis (such as, by enantiomeric selective syntheses and the like) of the individual isomers is accomplished by application of various methods which are well known to practitioners in the art.
- compositions comprising a compound of the present invention.
- One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising a compound of the present invention.
- One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention, and a pharmaceutically acceptable carrier.
- One aspect of the present invention pertains to methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention, and a
- compositions obtained by any of the methods described herein.
- One aspect of the present invention pertains to compositions comprising a compound of the present invention, and a second pharmaceutical agent.
- a pharmaceutical agent and “a second pharmaceutical agent”
- these terms in some aspects are further limited to a pharmaceutical agent/second pharmaceutical agent that is not a compound of Formula (la) or a compounds related thereto.
- a pharmaceutical agent and “a second pharmaceutical agent” may refer to a pharmaceutical agent that has an IC 50 that is greater than a value selected from: 50 ⁇ , 10 ⁇ , 1 ⁇ , and 0.1 ⁇ , or that has no detectable activity, in a Mas receptor activity assay as described in Example 3, such as the HTRF assay in Example 3.1.
- One aspect of the present invention pertains to methods for preparing a composition comprising the step of admixing a compound of the present invention, and a second pharmaceutical agent; some embodiments pertain to compositions obtained by any of the methods described herein.
- One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a unit dosage form, a combined preparation, a twin pack, and a kit; each comprising a compound of the present invention, and a second pharmaceutical agent.
- One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention, a second pharmaceutical agent, and a pharmaceutically acceptable carrier.
- One aspect of the present invention pertains to methods for preparing a pharmaceutical composition
- methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention, a second pharmaceutical agent, and a pharmaceutically acceptable carrier; some embodiments pertain to pharmaceutical compositions obtained by any of the methods described herein. Certain Embodiments: Methods, Pharmaceutical Products, Combinations, and Uses of the Present Invention
- Mas Receptor In mammals, Mas is expressed predominantly in brain and testis with moderate levels of expression in heart and kidney, and lower expression in several other tissues (Alenina N., et al, Exp Physiol 93:528-537 (2008); Metzger R., et al, FEBS Lett 357:27-32 (1995); Villar A. J. and Pedersen R. A., Nat Genet 8:373-379 (1994); Young D., et al, Cell 45:711-719 (1986)). As further described herein, Mas is expressed in cardiovascular tissue (Example 5.5).
- the Mas receptor has been implicated in the regulation of cardiac function during ischemia and reperfusion in isolated hearts (Castro C.H., et al., Life Sci 80:264-268 (2006)). To determine whether the Mas receptor also plays a role in regional ischemia/reperfusion injury in vivo, we performed coronary artery ligation studies in Mas + + (wild type) and Mas ' " (Mas knockout) mice. The data demonstrate that infarct size is significantly reduced in Mas ' " mice after ischemia/reperfusion
- a second mechanism whereby Mas inverse agonists can provide cardioprotection is by reducing apoptosis.
- Mas is expressed in cardiomyocytes where ischemia/reperfusion is known to cause a marked increase in intracellular Ca 2+ content (Tani M. and Neely J. R., Circ Res 65: 1045-1056 (1989); and Murphy E. and Steenbergen C, Physiol Rev 88:581-609 (2008)).
- Cytosolic and subsequent mitochondrial Ca 2+ overload results in cell death during myocardial ischemia/reperfusion injury (Talukder M. A., et al, Cardiovasc Res 84:345-352 (2009)).
- the standard treatment for myocardial infarction is reperfusion of the ischemic area by thrombolysis or percutaneous coronary angioplasty. Release of the blockage and return of blood flow to the affected area is crucial for heart tissue survival; however, damage beyond that generated by ischemia is typically observed in the reperfused heart tissue.
- the manifestations of reperfusion injury include arrhythmia, reversible contractile dysfunction-myocardial stunning, endothelial dysfunction and cell death.
- Inverse agonists/antagonists of the Mas receptor are cardio-protective.
- the cardio-protection observed with inhibitors of the Mas receptor is consistent with the inhibition of other myocardial G q coupled receptors, such as the angiotensin ATi receptor (De Gasparo, M. et al., Pharmacol Rev 52:415-472 (2000)) and the endothelin receptor ET A (Douglas, S. A. and Ohlstein, E. H. Vascular Research 34: 152- 164 (1997) and Takigawa, M. et al, Eur. L. Biochem. 228: 102-108 (1995)).
- angiotensin ATi receptor De Gasparo, M. et al., Pharmacol Rev 52:415-472 (2000)
- ET A Douglas, S. A. and Ohlstein, E. H. Vascular Research 34: 152- 164 (1997) and Takigawa, M. et al, Eur. L. Biochem. 228: 102-108 (1995)
- Mas inverse agonists of Formula (la) are useful in the treatment of a number of the conditions, such as, hypertension, recurrence of atrial fibrillation, reduction in the incidence of Alzheimer's disease, progression of Alzheimer' s disease, dementia, and other conditions provided herein.
- Angiotensin ATi receptor inhibitors are well known in medicine. Examples of ⁇ receptor inhibitors include candesartan (AtacandTM), eprosartan (TevetenTM), irbesartan (AvaproTM), telmisartan (MicardisTM), valsartan (DiovanTM), losartan (CozaarTM), and olmesartan (BenicarTM).
- ⁇ receptor inhibitors are useful in the treatment of hypertension (high blood pressure). Persistent hypertension is one of the risk factors for stroke, myocardial infarction, heart failure and arterial aneurysm, and is a leading cause of chronic kidney failure (Pierdomenico, S.D., et al., American J. Hypertension 22:842-847 (2009)). ATi receptor inhibitors also prevent/treat the recurrence of atrial fibrillation. In addition, ATi receptor inhibitors are associated with a significant reduction in the incidence and progression of Alzheimer' s disease and dementia compared with angiotensin converting enzyme inhibitors or other cardiovascular drugs (Li, N.-C. et al, BMJ 2010;340:b5465).
- Inverse agonists and antagonists of the G protein-coupled Mas receptor and pharmaceutical compositions comprising the same are useful in methods of treatment or alleviation of diseases or disorders of the heart, brain, kidney, and reproductive system resulting from ischemia, or reperfusion subsequent to ischemia, and any downstream complication(s) related thereto.
- the present invention further relates to methods of treatment or alleviation of diseases or disorders of the vasculature resulting from vasoconstriction or hypertension and any downstream complication(s) resulting from elevated blood pressure and/or reduced tissue perfusion.
- the Mas receptor inverse agonists and antagonists are useful in treating diseases or disorders characterized by an active, hyperactive, or an improperly active Mas receptor, and/or in ameliorating the symptoms thereof in a subject in need of such treatment.
- the methods involve contacting a cell, a tissue, or an organ expressing a Mas receptor of a subject in need of such treatment with an effective amount of an inverse agonist or antagonist of the Mas receptor.
- the contacted cell, tissue, or organ may be in a patient, or may be isolated from the patient, contacted with the Mas receptor inverse agonist or antagonist, and returned to the patient's body.
- the Mas receptor inverse agonist or antagonist decreases the activity of, or signaling through, the Mas receptor thereby treating the disease/disorder, reducing the risk of developing the disease/disorder, or alleviating the symptoms of the disease/disorder.
- Mas receptor inverse agonists and antagonists are useful in prophylactic and therapeutic treatments, in part, because of their ability to reduce or inhibit vasoconstriction and/or promote vasodilation. Regulating the vascular system (e.g., by vasodilation and/or vasorelaxation) is helpful in treating conditions where there is a restriction or impediment to normal blood flow, or reducing the symptoms of such conditions.
- Non-limiting examples of conditions that benefit from vascular regulation using Mas receptor inverse agonists and antagonists are provided below.
- Coronary heart disease also known as coronary artery disease
- Coronary heart disease is a narrowing of the small blood vessels that supply blood and oxygen to the heart and is the leading cause of death in the United States for men and women.
- This disease is usually caused by a condition called atherosclerosis, which occurs when fatty material and other substances form a plaque build-up on the walls of the arteries causing them to get narrow.
- atherosclerosis As the coronary arteries narrow, blood flow to the heart can slow down or stop.
- a restriction in blood supply can lead to ischemia.
- Ischemia results in tissue damage because of a lack of oxygen and nutrients.
- Mas receptor inverse agonists and antagonists are effective in reducing ischemia by reducing vasoconstriction and removing the restriction on blood flow.
- compounds of the present invention are useful for providing cardioprotection during and/or following an obstruction or reduced blood flow in the heart.
- Ischemia can result in a condition called angina pectoris, more commonly called angina, which is a temporary and often recurring chest pain caused by a lack of or inadequate oxygenated blood feeding the heart muscles.
- angina pectoris more commonly called angina
- the compounds of the present invention are useful in reducing the risk of angina attacks or the symptoms thereof.
- Myocardial infarction occurs when the blood supply to a part of the heart is interrupted by blockage of the coronary blood vessels causing heart cells in that part of the heart to die.
- the Mas receptor inverse agonists and antagonists are helpful in reducing vasoconstriction thereby reducing the risk of a myocardial infarction.
- the inverse agonists and antagonists of the present invention are helpful in promoting vasorelaxation following myocardial infarction.
- the no-reflow phenomenon which usually manifests as ECG changes and chest pain is a failure to restore normal myocardial blood flow despite removal of the coronary obstruction.
- the no- reflow phenomenon has been shown to complicate thrombolytic therapy and percutaneous revascularization.
- the compounds of the present invention are useful in the treatment of the no-reflow phenomenon and the symptoms thereof.
- Hypertension is a cardiac chronic condition in which the systemic arterial blood pressure is elevated. Persistent hypertension is one of the risk factors for myocardial infarction. Pulmonary hypertension is an increase in blood pressure in the pulmonary artery, pulmonary vein, or pulmonary capillaries, together known as the lung vasculature. Pulmonary hypertension can be a severe disease with a markedly increased risk for heart failure. Mas receptor inverse agonists and antagonists are useful in stabilizing blood pressure and thereby reducing hypertension and also ameliorating the symptoms thereof.
- Angioplasty is a catheter-based technique used to open arteries obstructed by a blood clot.
- Mas receptor inverse agonists and antagonists by promoting vasodilation, can have the effect of reducing the risk of the formation of blood clots following this procedure.
- Coronary bypass surgery is a surgical procedure in which an artery or vein is taken from elsewhere in the body and grafted to a blocked coronary artery, rerouting blood around the blockage and through the newly attached vessel.
- the compounds of the present invention are helpful in reducing the risk of vasoconstriction following this procedure.
- Ischemia/reperfusion Injury is the tissue damage that is caused when blood supply returns to the tissue after a period of ischemia.
- the absence of oxygen and nutrients from blood creates a condition in which the restoration of circulation results inflammation and oxidative damage through the induction of oxidative stress rather than restoration of normal function.
- Mas receptor inverse agonists and antagonists are useful in treating reperfusion injury.
- the reperfusion injury is injury following cardioplegia.
- the reperfusion injury is injury following angioplasty.
- a transient ischemic attack or mini-stroke is a brief interruption of blood flow to the brain caused by an obstruction to blood flow.
- Example 10 shows that inhibiting Mas receptor signaling reduced brain damage associated with transient ischemic stroke.
- Mas receptor inverse agonists and antagonists are helpful in treating transient ischemic attack and the symptoms thereof.
- a stroke is an event in which the brain does not receive adequate amounts of oxygenated blood and is usually caused by ischemia (resulting from blockage of a cerebral blood vessel) or a hemorrhage.
- the compounds of the present invention are useful in treating strokes and the symptoms thereof. In addition, these compounds are useful in reducing the risk of the reoccurrence of a stroke or a mini stroke.
- compounds of the present invention are useful for providing neuroprotection during and/or following an obstruction or reduced blood flow in the brain and in the treatment of one or more of the following Mas receptor-mediated disorders: stroke, brain attack, neuroprotection, brain ischemia (thrombotic, embolic and hypoperfusion), focal or multifocal brain ischemia, global brain ischemia, ischemic brain injury, acute ischemic brain damage, acute ischemic brain injury, brain infarction, brain reperfusion injury, brain hypoxia, cerebral reperfusion injury, neuronal reperfusion injury, ischemic neurological disorders, ischemic brain damage, cerebral hypoxia, cerebral ischemia, cerebral ischemic injury, hypoxic-ischemic brain injury, anoxic brain injury, anoxic brain damage, anoxic brain damage, anoxic brain damage, anoxicoxic
- encephalopathy subcortical ischemic depression
- moyamoya disease moyamoya disease
- cardiorespiratory arrest
- Erectile dysfunction is the inability of a male subject to develop or maintain penile erection for normal sexual performance.
- a penile erection is the hydraulic effect of blood entering and being retained in the corpus cavernosa, which are sponge-like bodies within the penis.
- Erectile dysfunction is indicated when an erection is difficult to produce.
- the Mas receptor is expressed in the corpus cavernosa and the vasodilatory properties of the inverse agonists and antagonists of the Mas receptor make them useful in treating erectile dysfunction.
- Ischemic colitis is a medical condition in which inflammation and injury of the large intestine result from inadequate blood supply usually caused by changes in the systemic circulation (e.g. low blood pressure) or local factors such as constriction of blood vessels or a blood clot.
- Ischemia of the small bowel is called mesenteric ischemia.
- the compounds of the present invention are useful in reducing ischemia of both the large and small intestine.
- Acute limb ischemia is caused by the lack of, or reduced, blood flow to a limb. It is usually due to either an embolism or thrombosis of an artery in subjects with underlying peripheral vascular disease. A blockage in the legs can lead to leg pain or cramps with activity (claudication), changes in skin color, sores or ulcers, and feeling tired in the legs. Total loss of circulation can lead to gangrene and loss of a limb. Mas receptor inverse agonists and antagonists can improve blood flow thereby treating the risk of developing acute limb ischemia in subjects in need thereof.
- Renal artery stenosis is a decrease in the diameter of the renal arteries.
- the resulting restriction of blood flow to the kidneys may lead to impaired kidney function and high blood pressure, referred to as renovascular hypertension (RVHT).
- RVHT renovascular hypertension
- Renal artery stenosis is a major cause of RVHT and accounts for 1 %-10% of the roughly 50 million cases of hypertension in the United States. Renovascular hypertension occurs when the artery to one of the kidneys is narrowed, while renal failure occurs when the arteries to both kidneys are narrowed. The decreased blood flow to both kidneys increasingly impairs renal function.
- Example 9 demonstrates that Mas inverse agonists can be protective for kidney function following ischemia reperfusion injury.
- the compounds of the present invention are useful in improving blood flow to and within the kidneys.
- Mas receptor inverse agonists and antagonists are helpful in treating or reducing the risk of developing renal artery stenosis, renovascular hypertension, and renal failure.
- the compounds described herein are also useful in treating chronic kidney disease and diabetic nephropathy and the symptoms thereof.
- compounds of the present invention are useful for providing renoprotection/renal protection during and/or following an obstruction or reduced blood flow in the kidney and in the treatment of one or more of the following Mas receptor-mediated disorders: nephropathy, nephrotic syndrome, obstruction nephropathy, obstructive nephropathy, diabetic nephropathy, renal hypertension, renovascular hypertension, renal ischemia, renal ischemic injury, renal ischemia-reperfusion injury, renal reperfusion injury, acute renal injury, acute kidney injury, acute renal failure, acute kidney failure, acute tubular necrosis, contrast nephropathy, chronic kidney disease, chronic renal failure, chronic renal insufficiency, end stage renal disease, end stage renal failure, focal segmental glomerulosclerosis, glomerulonephritis, diabetes and diabetic kidney disease, diabetes insipidus, Fabry's disease, focal segmental glomerulosclerosis, focal sclerosis, focal glomerulosclerosis, Gitelman syndrome, glomerul
- Mas receptor inverse agonists and antagonists are also useful in prophylactic and therapeutic treatments, in part, because of their ability to reduce or inhibit calcium signaling in cells or correct improper calcium handling by cells.
- the Mas receptor is a G q coupled receptor. Stimulation of the Mas receptor leads to the release of calcium stored within intracellular compartments. Contractility of cardiac myocytes is regulated by changes in intracellular calcium concentration. Improper calcium handling by cardiac myocytes can lead to inappropriate contractile activity. In addition, inappropriate calcium release from intracellular compartments can result in conditions such as cardiac arrhythmias, pathological structural changes in the myocardium, and apoptosis. Inverse agonists and antagonists of the Mas receptor are useful in treating any disease or disorder arising from improper regulation of calcium signaling and/or handling by cells, or the symptoms thereof,
- An arrhythmia is a problem with the rate or rhythm of the heartbeat.
- the heart can beat too fast, too slow, or with an irregular rhythm.
- a heartbeat that is too fast is called tachycardia.
- a heartbeat that is too slow is called bradycardia.
- the heart rate is too fast, too slow, or irregular, the heart may not be able to pump enough blood to the body. Lack of blood flow can damage the brain, heart, and other organs.
- arrhythmias such as supraventricular arrhythmias, ventricular arrhythmias, and brady arrhythmias.
- Supraventricular arrhythmias are tachycardias that start in the atria or the atrioventricular node and include atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, and Wolff - Parkinson-White syndrome. Atrial fibrillation, a condition which affects roughly two million
- Ventricular arrhythmias are abnormal rapid heart rhythms that originate in the ventricles (the lower chambers of the heart). Ventricular arrhythmias include ventricular tachycardia and ventricular fibrillation, both of which are life-threatening arrhythmias most commonly associated with heart attacks. Bradyarrhythmias are arrhythmias in which the heart rate is slower than normal. If the heart rate is too slow, not enough blood reaches the brain.
- Reperfusion of the ischemic myocardium may play an important role in the genesis of life- threatening reperfusion arrhythmias. Reflow may occur as a result of abrupt cessation of coronary artery spasm or upon dislodgment of platelet aggregates with the attendant washout of products of cellular ischemia and the released substances exert a transient but potent arrhythmo genie effect resulting in reperfusion arrhythmias.
- the Mas receptor inverse agonists and antagonists are effective in treating and/or reducing the likelihood of developing arrhythmias and are also effective in treating the symptoms of arrhythmias.
- Apoptosis is an important component of normal development as well as the pathogenesis of several diseases including cardiovascular diseases.
- Calcium levels play a key role in apoptosis of cardiomyocytes. Signaling through the Mas receptor mobilizes calcium stores and triggers apoptosis by elevation of intracellular fee calcium.
- Inverse agonists and antagonists of the Mas receptor are useful in protecting the myocardium from cell death.
- Inflammation is a complex biological response of vascular tissues to harmful stimuli, such as pathogens, damaged cells, or irritants. While after injury or in certain conditions inflammation is a normal, healthy response, inflammation that results in the immune system attacking the body' s own cells or tissues may also cause abnormal inflammation, which results in chronic pain, redness, swelling, stiffness, and damage to normal tissues. Prolonged inflammation, known as chronic inflammation, can lead to a host of diseases, such as hay fever, periodontitis, atherosclerosis, rheumatoid arthritis, and even cancer (e.g., gallbladder carcinoma). Mas receptor inverse agonists and antagonists such as those described herein are useful in the treatment and /or prevention of inflammatory disorders as well as conditions associated with inflammation.
- Cytokines include interleukins (IL), interferons (IFNs), chemokines (proteins that direct white blood cells to move to sites of inflammation), tumor necrosis factors (TNFs), and colony stimulating factors (CSFs).
- IL interleukins
- IFNs interferons
- chemokines proteins that direct white blood cells to move to sites of inflammation
- TNFs tumor necrosis factors
- CSFs colony stimulating factors
- the cytokines associated with increased inflammation are called "proinflammatory cytokines" and include IL-la, IL- ⁇ , IL-2, IL-6, IL-10, IL-12, IL- 15, IL-18, TNFa, secreted lymphotoxin a (TNF ), lymphotoxin ⁇ , IFNa, ⁇ , ⁇ , GM-CSF, M-CSF, lymphotoxin ⁇ , LIGHT, CD40 ligand, Fas ligand, CD30 ligand, CD27 ligand, 4- IBB ligand, the Ox40 ligand, TRAIL, TWEAK, TRAMP, CXC chemokines (e.g., L-8, GRO-a, GRO- ⁇ , PF-4, IP- 10, and Mig), and CC chemokines (e.g., eotaxin, eotaxin-2, and MCP-4).
- the compounds of the present invention are useful in treating or preventing inflammation, at least in part, by
- the compounds described herein can be used to treat inflammatory disorders such as, those mediated by tumor necrosis factor-a (TNFa).
- TNFa tumor necrosis factor-a
- Mas receptor gene expression correlates with TNFa expression by inflammatory immune cells, such macrophages (Example 6).
- TNFa is a cytokine that has been identified as a mediator of immunity, of inflammation, of cell proliferation, and of fibrosis. This mediator is present in large quantities in inflamed synovial tissues and plays an important role in the pathogenesis of autoimmunity (Black et, al., Annu. Rep. Med. Chem., 32:241 -250 (1997)).
- TNFa levels have been associated with many inflammatory diseases such as sepsis and rheumatoid arthritis.
- Rheumatoid arthritis is a chronic inflammatory disorder that affects multiple peripheral joints.
- Over expression of TNFa and other proinflammatory cytokines has been observed in patients with arthritis (Feldmann et. al., Prog Growth Factor Res 4:247-55 (1992)).
- transgenic animals that over express human TNFa develop an erosive polyarthritis with many characteristics associated with the disease (Keffer et. al, EMBO J. 10(13):4025-31 (1991)).
- TNFa-related disorders such as, but not limited to:
- A acute and chronic immune and autoimmune pathologies, such as systemic lupus erythematosus (SLE), rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis, osteoarthritis, refractory rheumatoid arthritis, chronic non-rheumatoid arthritis, osteoporosis/bone resorption, thyroidosis, graft versus host disease, scleroderma, diabetes mellitus, Graves' disease, and the like;
- SLE systemic lupus erythematosus
- infections including, but not limited to, sepsis syndrome, cachexia, septic shock, endotoxic shock, circulatory collapse and shock resulting from acute or chronic bacterial infection, acute and chronic parasitic and/or infectious diseases, bacterial, fungal, or viral such as AIDS (including symptoms of cachexia, autoimmune disorders, AIDS dementia complex and infections);
- C inflammatory diseases, such as chronic inflammatory pathologies and vascular inflammatory pathologies, including chronic inflammatory pathologies such as sarcoidosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic sclerosis, psoriasis, dermatomyositis, polyomyositis, and vascular inflammatory pathologies, such as, but not limited to, disseminated intravascular coagulation, atherosclerosis, and Kawasaki's pathology;
- chronic inflammatory pathologies such as sarcoidosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic sclerosis, psoriasis, dermatomyositis, polyomyositis, and vascular inflammatory pathologies, such as, but not limited to, disseminated intravascular coagulation, atherosclerosis, and Kawasaki's pathology;
- (D) neurodegenerative diseases including, but not limited to, demyelinating diseases, such as multiple sclerosis and acute transverse myelitis; extrapyramidal and cerebellar disorders such as lesions of the corticospinal system; disorders of the basal ganglia or cerebellar disorders; hyperkinetic movement disorders such as Huntington's chorea and senile chorea; drug-induced movement disorders, such as those induced by drugs which block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; progressive supranucleo palsy; cerebellar and spinocerebellar disorders, such as astructural lesions of the cerebellum; spinocerebellar degenerations (spinal ataxia, Friedreich's ataxia, cerebellar cortical degenerations, multiple systems degenerations (Mencel, Dejerine-Thomas, Shi-Drager, and Machado-Joseph); and systemic disorders (Refsum's disease, abetalipoprot
- panencephalitis panencephalitis, Hallerrorden-Spatz disease, and dementia pugilistica, or any subset thereof;
- TNF such as, but not limited to leukemias (acute, chronic myelocytic, chronic lymphocytic and/or myelodyspastic syndrome); lymphomas (Hodgkin's and non-Hodgkin's lymphomas, such as malignant lymphomas (Burkitt's lymphoma or mycosis fungoides)); and
- the compounds of the invention are equally useful in treating and/or preventing IL-1 related disorders.
- the IL-1 related disorder includes (a) inflammatory diseases such as osteoarthritis, pancreatitis and asthma; (b) autoimmune diseases such as glomerular nephritis, rheumatoid arthritis, scleroderma, and alphosis; and (c) infectious diseases such as septicemia and septic shock.
- the cytokine IL-6 acts as a proinflammatory cytokine in part through its effects on TNFa and
- the compounds of the present invention are also useful in treating IL-6 related disorders such as autoimmune diseases and chronic inflammatory proliferative diseases.
- the compounds of the present invention are useful in treating and/or preventing rheumatoid arthritis, systemic-onset juvenile chronic arthritis, osteoporosis, psoriasis, diabetes, atherosclerosis, depression, Alzheimer' s disease, systemic lupus erythematosus, and prostate cancer.
- the compounds of the present invention are also useful to treat and/or prevent disorders associated with deregulated expression and/or activity of other proinflammatory cytokines such as IL-2, IL-10, IL-12, IL- 15, IL- 18, TNF , lymphotoxin ⁇ , IFNa, ⁇ , IFNy, GM-CSF, M-CSF, lymphotoxin ⁇ , LIGHT, CD40 ligand, Fas ligand, CD30 ligand, CD27 ligand, 4- IBB ligand, the Ox40 ligand, TRAIL, TWEAK, TRAMP, CXC chemokines (e.g., L-8, GRO-a, GRO- ⁇ , PF-4, IP-10, and Mig), and CC chemokines (e.g., eotaxin, eotaxin-2, and MCP-4).
- proinflammatory cytokines such as IL-2, IL-10, IL-12, IL- 15, IL- 18, TNF , lymphot
- Mas receptor inverse agonists and antagonists such as those described herein are useful in the treatment and /or prevention of autoimmune and autoinflammatory disorders.
- An autoimmune disorder is a condition that occurs when the immune system mistakenly attacks and destroys healthy body tissue.
- An autoimmune disorder may result in the destruction of one or more types of body tissue; abnormal growth of an organ; and/or changes in organ function.
- Autoinflammatory diseases are a relatively new category of diseases that are different from autoimmune diseases. However, autoimmune and autoinflammatory diseases share common characteristics in that both groups of disorders result from the immune system attacking the body' s own tissues, and also result in increased inflammation.
- the compounds of the present invention are useful in the treatment of one or more of the following inflammatory disorders, autoimmune disorders, and/or disorders related to inflammatory or autoimmune diseases: acne vulgaris, adult respiratory distress syndrome, allergy, allergic asthma, Alzheimer's disease, amyloidosis, ankylosing spondylitis, asthma, bronchopulmonary aspergillosis, allergic rhinitis, autoimmune hemolytic anemia, acanthosis nigricans, allergic contact dermatitis, Addison's disease, atopic dermatitis, alopecia areata, alopecia universalis, amyloidosis, anaphylactoid purpura, anaphylactoid reaction, aplastic anemia, hereditary angioedema, idiopathic angioedema, cranial arteritis, giant cell arteritis, Takayasu's arteritis, temporal arteritis, asthma, autoimmune oophoritis, autoimmune orchitis
- keratoconjunctivitis sicca Landry-Guillain-Barre-Strohl syndrome, lepromatous leprosy, Loeffler's syndrome, lupus, Lyell's syndrome, lyme disease, lymphomatoid granulomatosis, lymphoproliferative disease, malaria, meningitis, systemic mastocytosis, mixed connective tissue disease, mononeuritis multiplex, Muckle- Wells syndrome, mucocutaneous lymph node syndrome, mucocutaneous lymph node syndrome, multicentric reticulohistiocytosis, multiple sclerosis, myasthenia gravis, mycosis fungoides, myeloproliferative disorder, nephrotic syndrome, ovarian cancer, recurrent ovarian cancer, overlap syndrome, panniculitis, paroxysmal cold hemoglobinuria, paroxysmal nocturnal
- hemoglobinuria pelvic inflammatory diseases, pemphigoid, pemphigus, pemphigus erythematosus, pemphigus foliaceus, pemphigus vulgaris, pigeon breeder's disease, plasmacytoma, pneumonitis, polyarteritis nodosa, refractory multiple myeloma, rheumatic polymyalgia, polymyositis, diopathic polyneuritis, pre-eclampsia/eclampsia, primary biliary cirrhosis, systemic sclerosis, progressive systemic sclerosis (scleroderma), multiple sclerosis, psoriasis, psoriatic arthritis, pulmonary alveolar proteinosis, pulmonary fibrosis, Raynaud's phenomenon/syndrome, Reidel's thyroiditis, Reiter's syndrome, relapsing polychrondritis, rheumatic fever
- One aspect of the present invention pertains to methods selected from one or more of the following for: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in
- One aspect of the present invention pertains to the use of: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; each optionally in combination with a second pharmaceutical agent, in the manufacture of a medicament, selected from one or more of the following for: 1) the treatment of a Mas receptor- mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary
- One aspect of the present invention pertains to: A) compounds of the present invention; B) crystalline forms of the present invention; C) compositions of the present invention; D) pharmaceutical products of the present invention; or E) pharmaceutical compositions of the present invention; each optionally in combination with a second pharmaceutical agent, for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to: A) compounds of the present invention; B) crystalline forms of the present invention; C) compositions of the present invention; D) pharmaceutical products of the present invention; or E) pharmaceutical compositions of the present invention; each optionally in combination with a second pharmaceutical agent, for use in a method selected from one or more for the following: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vas
- One aspect of the present invention pertains to the use of a pharmaceutical agent in combination with: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; in the manufacture of a medicament, selected from one or more of the following for: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual;
- One aspect of the present invention pertains to pharmaceutical agents in combination with: A) a compound of the present invention; B) a crystalline form of the present invention; C) a composition of the present invention; D) a pharmaceutical product of the present invention; or E) a pharmaceutical composition of the present invention; for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to pharmaceutical agents in combination with: A) a compound of the present invention; B) a crystalline form of the present invention; C) compositions of the present invention; D) a pharmaceutical product of the present invention; or E) a pharmaceutical composition of the present invention; for use in a method selected from one or more for the following: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vas
- One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method of treatment of the human or animal body by therapy.
- One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method selected from one or more for the following: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following ang
- One aspect of the present invention pertains to pharmaceutical products of the present invention; methods of the present invention; or pharmaceutical agents of the present invention; wherein the pharmaceutical product comprises a pharmaceutical composition.
- the pharmaceutical product comprises a formulation.
- the pharmaceutical product comprises a unit dosage form.
- the pharmaceutical product comprises a kit.
- the pharmaceutical product comprises a combined preparation.
- the pharmaceutical product comprises a twin pack.
- One aspect of the present invention pertains to methods of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; compositions of the present invention; pharmaceutical products of the present invention;
- compositions of the present invention or pharmaceutical agents of the present invention; wherein the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered simultaneously, separately, or sequentially.
- the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered simultaneously.
- the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered separately.
- the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered sequentially.
- the inverse agonists and antagonists described herein can be combined with one or more agents that are known to be useful in the treatment of the condition being treated. These agents may be formulated for administration to the subject as a single pharmaceutical composition with the Mas receptor inverse agonists and antagonists of the present invention, or may be formulated as separate compositions. These compositions may be administered to the subject separately, simultaneously, or sequentially.
- another aspect of the present invention includes methods of treatment or alleviation of diseases or disorders of the heart, brain, kidney, and reproductive system among others and/or in ameliorating the symptoms thereof, comprising administering to an individual in need thereof a therapeutically effective amount of a compound of Formula (la) or a pharmaceutically acceptable salt, solvate, or hydrate thereof, in combination with one or more additional pharmaceutical agents, as described herein.
- a compound of Formula (la) or a pharmaceutically acceptable salt, solvate, or hydrate thereof in combination with one or more additional pharmaceutical agents, as described herein.
- compositions of the present invention relate to compositions of the present invention; methods of the present invention; pharmaceutical products of the present invention; pharmaceutical compositions of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; or pharmaceutical agents of the present invention; wherein the pharmaceutical agent or the second pharmaceutical agent is selected from: an ACE inhibitor, a beta blocker, a calcium channel blocker, a diuretic, a nitrate, a statin, aspirin, an anti-platelet, adenosine, an endothelin receptor antagonist, a PDE5 inhibitor, an anti-TNF agent (i.e., an agent that inhibits the activity of TNF), and a cardioplegic solution.
- the pharmaceutical agent or the second pharmaceutical agent is an ACE inhibitor. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a beta blocker. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a calcium channel blocker. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a diuretic. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a nitrate. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a statin. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is aspirin. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an anti-platelet. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is adenosine.
- the pharmaceutical agent or the second pharmaceutical agent is an endothelin receptor antagonist. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a PDE5 inhibitor. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an anti-TNF agent. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a cardioplegic solution.
- Non-limiting examples of ACE inhibitors include captopril, zofenopril, enalapril, ramipril, quinapril, perindopril, lisinopril, benazepril, fosinopril, casokinins, lactokinins, and the lactotripeptides Val-Pro-Pro and Ile-Pro-Pro, for example lactotripeptides produced by the probiotic Lactobacillus helveticus or derived from casein.
- the pharmaceutical agent or the second pharmaceutical agent is an ACE inhibitor selected from: captopril, zofenopril, enalapril, ramipril, quinapril, perindopril, lisinopril, benazepril, fosinopril, casokinins, lactokinins, Val-Pro-Pro, and Ile- Pro-Pro.
- beta-blockers include non-selective agents such as: alprenolol, bucindolol, carteolol, carvedilol, labetalol, nadolol, penbutolol, pindolol, propranolol, sotalol, and timolol; ⁇ -selective agents such as: acebutolol, atenolol, betaxolol, bisoprolol, celiprolol, esmolol, metoprolol, and nebivolol; 2-selective agents such as: butaxamine and (2R,3R)-3-(isopropylamino)-l- (7-methyl-2,3-dihydro-l/f-inden-4-yloxy)butan-2-ol (ICI- 118,551); and 3-selective agents such as (S)- l-(2-
- the pharmaceutical agent or the second pharmaceutical agent is a beta blocker selected from: alprenolol, bucindolol, carteolol, carvedilol, labetalol, nadolol, penbutolol, pindolol, propranolol, sotalol, timolol, acebutolol, atenolol, betaxolol, bisoprolol, celiprolol, esmolol, metoprolol, nebivolol, butaxamine, (2R,3R)-3-(isopropylamino)-l-(7-methyl-2,3-dihydro-l/f-inden-4-yloxy)butan- 2-ol (ICI-118,551), and (S)-l-(2-ethylphenoxy)-3-((S)-l,2,3,4-tetrahydronaphthalen-l
- Non-limiting examples of calcium channel blockers include dihydropyridine calcium channel blockers such as: amlodipine, aranidipine, azelnidipine, barnidipine, benidipine, cilnidipine, clevidipine, isradipine, efonidipine, felodipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, and pranidipine; phenylalkylamine calcium channel blockers such as: verapamil and gallopamil; benzothiazepine calcium channel blockers such as diltiazem; and non-selective calcium blockers such as mibefradil, bepridil, fluspirilene, and fendiline.
- dihydropyridine calcium channel blockers such as: amlodipine,
- the pharmaceutical agent or the second pharmaceutical agent is a calcium channel blocker selected from: amlodipine, aranidipine, azelnidipine, barnidipine, benidipine, cilnidipine, clevidipine, isradipine, efonidipine, felodipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, pranidipine, verapamil, gallopamil, diltiazem, mibefradil, bepridil, fluspirilene, and fendiline.
- Non-limiting examples of diuretics include loop diuretics such as: furosemide, ethacrynic acid, torsemide and bumetanide; thiazide-type diuretics such as: hydrochlorothiazide; carbonic anhydrase inhibitors such as acetazolamide and methazolamide; potassium-sparing diuretics such as:
- the pharmaceutical agent or the second pharmaceutical agent is a diuretic selected from: furosemide, ethacrynic acid, torsemide, bumetanide,
- hydrochlorothiazide acetazolamide, methazolamide, spironolactone, potassium canreonate, amiloride, triamterene; a thiazide, mannitol, glucose, and digitalis.
- Non-limiting examples of nitrates include amyl nitrite, nitroglycerin, isosorbide dinitrate, isosorbide-5-mononitrate, and erythrityl tetranitrate.
- the pharmaceutical agent or the second pharmaceutical agent is a nitrate selected from: amyl nitrite, nitroglycerin, isosorbide dinitrate, isosorbide-5-mononitrate, and erythrityl tetranitrate.
- statins include atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin.
- the pharmaceutical agent or the second pharmaceutical agent is a statin selected from: atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin.
- anti-platelet agents include clopidogrel (Plavix®), prasugrel (Effient®), ticlopidine (Ticlid®), and temanogrel.
- the pharmaceutical agent or the second pharmaceutical agent is an anti-platelet selected from: clopidogrel, prasugrel, ticlopidine, and temanogrel.
- Non-limiting examples of endothelin receptor antagonists/inhibitors include bosentan, tezosentan, sitaxentan, ambrisentan, atrasentan, BQ-123 (i.e., cyclo(D-trp-D-asp-L-pro-D-val-L-leu)), and BQ-788 (i.e., N-cw-2,6-dime lpiperidinocarbonyl-L-Y-MeLeu-D-Trp(MeOCO)-D-Nle-OH sodium sal
- the pharmaceutical agent or the second pharmaceutical agent is an endothelin receptor antagonist selected from: bosentan, tezosentan, sitaxentan, ambrisentan, atrasentan, BQ-123, and BQ-788.
- Non-limiting examples of PDE5 inhibitors include sildenafil, avanafil, lodenafil, mirodenafil, sildenafil citrate, tadalafil, vardenafil, and udenafil.
- the pharmaceutical agent or the second pharmaceutical agent is a PDE5 inhibitor selected from: sildenafil, avanafil, lodenafil, mirodenafil, sildenafil citrate, tadalafil, vardenafil, and udenafil.
- Non-limiting examples of agents that inhibit the activity of TNF include small molecules, small interfering RNAs (siRNAs), anti-sense RNAs, antibodies that specifically bind to TNF, soluble TNF receptors, or dominant negative-TNF molecules (such as a dominant negative TNF protein or a nucleic acid encoding a dominant negative TNF protein). It is understood that an agent that inhibits TNF can be one that inhibits the ability of TNF to activate a receptor, but does not inhibit the binding of TNF to the receptor.
- Anti-TNF antibodies include, e.g., infliximab (Remicade®), D2E7 (adalumimab; HumiraTM), certolizumab (CDP-870), and CDP-571 (see, e.g., Sandborn et al., Gut 53(10): 1485-1493 (2004); Choy et al., Rheumatology 41(10): 1133-1137 (2002); and Kaushik et al., Expert Opinion on Biological Therapy 5(4):601-606(6) (2005)).
- Soluble TNF receptors include, e.g., etanercept (sTNF-RILFc;
- Enbrel® Exemplary anti-TNF therapies are described in, e.g., U.S. Patent No. 6,270,766.
- a cardioplegic or cardioplesia solution is a solution infused into the heart, such as into the aortic root or the coronary ostia, to induce cardiac arrest during heart surgery or as a solution for use in the storage of the heart in preparation for transportation and eventual transplantation into the recipient.
- Compounds of the present invention can be used in combination with a variety of cardioplegic solutions known in the art.
- the cardioplegic solution has a potassium chloride concentration in the range of about 15 mmol L to about 35 mmol/L.
- the cardioplegic solution has a potassium chloride concentration in the range of about 20 mmol/L to about 30 mmol/L.
- cardioplesia solutions include, but are not limited to, PlegisolTM, Celsior®, Custodiol® HTK (Bretschneider' s cardioplegic solution), CoStorSol® (University of Wisconsin) Solution, St. Thomas' Hospital solution (STH), and National Institutes of Health (NIH) solution.
- One aspect of the present invention pertains to compounds of Formula (la) and compositions, pharmaceutical compositions, medicaments, unit dosage forms, methods, uses of compounds, compounds for use, and pharmaceutical products, each comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein.
- One embodiment pertains to methods for the treatment of a disorder, as described herein, in an individual comprising administering to an individual in need thereof, a therapeutically effective amount of: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with a therapeutically effective amount of one or more agents selected from the agents as described herein.
- One embodiment pertains to uses of: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein, in the manufacture of a medicament for the treatment of a disorder, as described herein, in an individual.
- One embodiment pertains to: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein, for use in a method of treatment of the human or animal body by therapy.
- One embodiment pertains to: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein for use, in a method of treatment of one or more disorder as described herein.
- a compound of Formula (la) either alone or present in a composition, a pharmaceutical composition, a medicament, and/or a unit dosage form; and the one or more agents are administered simultaneously, separately, or sequentially.
- One aspect of the present invention relates to methods for preparing pharmaceutical products of the present invention comprising the steps: mixing said compound or said crystalline form with a first pharmaceutically acceptable carrier to prepare a compound unit dosage form; mixing said second pharmaceutical agent with a second pharmaceutically acceptable carrier to prepare a second pharmaceutical agent unit dosage form; and combining said compound unit dosage form and said second pharmaceutical agent unit dosage form in a combined unit dosage form (for example, a combined unit dosage form in a blister pack) for simultaneous, separate, or sequential use.
- a combined unit dosage form for example, a combined unit dosage form in a blister pack
- the first pharmaceutically acceptable carrier is different from the second pharmaceutically acceptable carrier. In some embodiments, the different pharmaceutically acceptable carriers are suitable for administration by the same route. In some embodiments, the different pharmaceutically acceptable carriers are suitable for administration by different routes. In some embodiments, the first pharmaceutically acceptable carrier is substantially the same as the second pharmaceutically acceptable carrier. In some embodiments, the substantially the same pharmaceutically acceptable carriers are suitable for oral administration.
- One aspect of the present invention pertains to methods of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; compositions of the present invention; pharmaceutical products of the present invention;
- the Mas receptor-mediated disorder is selected from: coronary heart disease, atherosclerosis, ischemia, reperfusion injury, reperfusion injury following cardioplegia, reperfusion injury following angioplasty, angina pectoris, myocardial infarction, no-reflow phenomenon, hypertension, pulmonary hypertension, anxiety, transient ischemic attack, erectile dysfunction, ischemic colitis, mesenteric ischemia, acute limb ischemia, skin discoloration caused by reduced blood flow to the skin, renal artery stenosis, renovascular hypertension, renal failure, chronic kidney disease, and diabetic nephropathy.
- the Mas receptor-mediated disorder is coronary heart disease. In some embodiments, the Mas receptor-mediated disorder is atherosclerosis. In some embodiments, the Mas receptor-mediated disorder is ischemia. In some embodiments, the Mas receptor-mediated disorder is reperfusion injury. In some embodiments, the Mas receptor-mediated disorder is reperfusion injury following cardioplegia. In some embodiments, the Mas receptor-mediated disorder is reperfusion injury following angioplasty. In some embodiments, the Mas receptor-mediated disorder is angina pectoris. In some embodiments, the Mas receptor-mediated disorder is myocardial infarction. In some embodiments, the Mas receptor-mediated disorder is the no-reflow phenomenon. In some
- the Mas receptor-mediated disorder is hypertension. In some embodiments, the Mas receptor-mediated disorder is pulmonary hypertension. In some embodiments, the Mas receptor- mediated disorder is transient ischemic attack. In some embodiments, the Mas receptor-mediated disorder is erectile dysfunction. In some embodiments, the Mas receptor-mediated disorder is ischemic colitis. In some embodiments, the Mas receptor-mediated disorder is mesenteric ischemia. In some embodiments, the Mas receptor-mediated disorder is acute limb ischemia. In some embodiments, the Mas receptor-mediated disorder is skin discoloration caused by reduced blood flow to the skin. In some embodiments, the Mas receptor-mediated disorder is renal artery stenosis. In some embodiments, the Mas receptor-mediated disorder is renovascular hypertension. In some embodiments, the Mas receptor- mediated disorder is renal failure. In some embodiments, the Mas receptor-mediated disorder is chronic kidney disease. In some embodiments, the Mas receptor-mediated disorder is diabetic nephropathy.
- One aspect of the present invention pertains to methods of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; compositions of the present invention; pharmaceutical products of the present invention;
- the arrhythmia is tachycardia. In some embodiments, the arrhythmia is bradycardia. In some embodiments, the arrhythmia is supraventricular arrhythmia. In some embodiments, the supraventricular arrhythmia is selected from: atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, and Wolff- Parkinson-White syndrome. In some embodiments, the arrhythmia is ventricular arrhythmia. In some embodiments, the ventricular arrhythmia is selected from: ventricular tachycardia and ventricular fibrillation. In some embodiments, the arrhythmia is reperfusion arrhythmia.
- compositions comprising a compound of the present invention.
- compositions comprising a compound of the present invention and a pharmaceutically acceptable carrier.
- One aspect of the present invention pertains to compositions obtained by a method of the present invention.
- Formulations may be prepared by any suitable method, typically by uniformly mixing the active compound(s) with liquids or finely divided solid carriers, or both, in the required proportions and then, if necessary, forming the resulting mixture into a desired shape.
- Liquid preparations for oral administration may be in the form of solutions, emulsions, aqueous or oily suspensions and syrups.
- the oral preparations may be in the form of dry powder that can be reconstituted with water or another suitable liquid vehicle before use. Additional additives such as suspending or emulsifying agents, non-aqueous vehicles (including edible oils), preservatives and flavorings and colorants may be added to the liquid preparations.
- Parenteral dosage forms may be prepared by dissolving the compound of the invention in a suitable liquid vehicle and filter sterilizing the solution before lyophilization, or simply filling and sealing an appropriate vial or ampule. These are just a few examples of the many appropriate methods well known in the art for preparing dosage forms.
- a compound of the present invention can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers, outside those mentioned herein, are known in the art; for example, see Remington, The Science and Practice of Pharmacy, 20th Edition, 2000, Lippincott Williams & Wilkins, (Editors: Gennaro et al.)
- a compound of the invention may, in an alternative use, be administered as a raw or pure chemical, it is preferable however to present the compound or active ingredient as a pharmaceutical formulation or composition further comprising a pharmaceutically acceptable carrier.
- Transdermal patches dispense a drug at a controlled rate by presenting the drug for absorption in an efficient manner with minimal degradation of the drug.
- transdermal patches comprise an impermeable backing layer, a single pressure sensitive adhesive and a removable protective layer with a release liner.
- the compounds of the invention may thus be placed into the form of pharmaceutical formulations and unit dosages thereof and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, gels or capsules filled with the same, all for oral use, in the form of suppositories for rectal administration; or in the form of sterile injectable solutions for parenteral (including
- Such pharmaceutical compositions and unit dosage forms thereof may comprise conventional ingredients in conventional proportions, with or without additional active compounds or principles and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed.
- the pharmaceutical composition may be in the form of, for example, a tablet, capsule, suspension or liquid.
- the pharmaceutical composition is preferably made in the form of a dosage unit containing a particular amount of the active ingredient.
- dosage units are capsules, tablets, powders, granules or a suspension, with conventional additives such as lactose, mannitol, corn starch or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators such as corn starch, potato starch or sodium carboxymethyl-cellulose; and with lubricants such as talc or magnesium stearate.
- the active ingredient may also be administered by injection as a composition wherein, for example, saline, dextrose or water may be used as a suitable pharmaceutically acceptable carrier.
- compositions can be used as active ingredients in pharmaceutical compositions, specifically as Mas receptor modulators.
- active ingredient defined in the context of a “pharmaceutical composition” refers to a component of a pharmaceutical composition that provides the primary pharmacological effect, as opposed to an "inactive ingredient” which would generally be recognized as providing no pharmaceutical benefit.
- the dose when using the compounds of the present invention can vary within wide limits and as is customary and is known to the physician, it is to be tailored to the individual conditions in each individual case.
- doses of the present invention include, but not limited to, about 0.001 mg to about 5000 mg, about 0.001 mg to about 2500 mg, about 0.001 mg to about 1000 mg, 0.001 mg to about 500 mg, 0.001 mg to about 250 mg, about 0.001 mg to 100 mg, about 0.001 mg to about 50 mg and about 0.001 mg to about 25 mg.
- Multiple doses may be administered during the day, especially when relatively large amounts are deemed to be needed, for example 2, 3 or 4 doses. Depending on the individual and as deemed appropriate from the patient's physician or caregiver it may be necessary to deviate upward or downward from the doses described herein.
- the amount of active ingredient, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will ultimately be at the discretion of the attendant physician or clinician.
- a model system typically an animal model
- these extrapolations may merely be based on the weight of the animal model in comparison to another, such as a mammal, preferably a human, however, more often, these extrapolations are not simply based on weights, but rather incorporate a variety of factors.
- compositions of this invention are selected in accordance with a variety factors as cited above.
- the actual dosage regimen employed may vary widely and therefore may deviate from a preferred dosage regimen and one skilled in the art will recognize that dosage and dosage regimen outside these typical ranges can be tested and, where appropriate, may be used in the methods of this invention.
- the desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day.
- the sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations.
- the daily dose can be divided, especially when relatively large amounts are administered as deemed appropriate, into several, for example 2, 3 or 4 part administrations. If appropriate, depending on individual behavior, it may be necessary to deviate upward or downward from the daily dose indicated.
- the compounds of the present invention can be administrated in a wide variety of oral and parenteral dosage forms. It will be obvious to those skilled in the art that the following dosage forms may comprise, as the active component, either a compound of the invention or a pharmaceutically acceptable salt, solvate, or hydrate of a compound of the invention.
- a suitable pharmaceutically acceptable carrier can be either solid, liquid or a mixture of both.
- Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories and dispersible granules.
- a solid carrier can be one or more substances which may also act as diluents, flavoring agents, solubilizers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.
- the carrier is a finely divided solid which is in a mixture with the finely divided active component.
- the active component is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted to the desire shape and size.
- the powders and tablets may contain varying percentage amounts of the active compound.
- a representative amount in a powder or tablet may contain from 0.5% to about 90% of the active compound; however, an artisan would know when amounts outside of this range are necessary.
- Suitable carriers for powders and tablets are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter and the like.
- the term "preparation” refers to the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active component, with or without carriers, is surrounded by a carrier, which is thus in association with it.
- cachets and lozenges are included. Tablets, powders, capsules, pills, cachets and lozenges can be used as solid forms suitable for oral administration.
- a low melting wax such as an admixture of fatty acid glycerides or cocoa butter
- the active component is dispersed homogeneously therein, as by stirring.
- the molten homogenous mixture is then poured into convenient sized molds, allowed to cool and thereby to solidify.
- Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or sprays containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
- Liquid form preparations include solutions, suspensions and emulsions, for example, water or water-propylene glycol solutions.
- parenteral injection liquid preparations can be formulated as solutions in aqueous polyethylene glycol solution.
- injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
- Suitable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil may be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid find use in the preparation of injectables.
- the compounds according to the present invention may thus be formulated for parenteral administration (e.g. by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative.
- the pharmaceutical compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g. sterile, pyrogen-free water, before use.
- Compounds of the present invention may be formulated as an aqueous solution, an aqua- alcoholic solution, a solid suspension, an emulsion, a liposomal suspension, or a freeze-dried powder for reconstitution.
- Such pharmaceutical compositions may be administered directly or as an admixture for further dilution/reconstitution.
- Route of administration includes intravenous bolus, intravenous infusion, irrigation, and instillation.
- Suitable solvents include water, alcohols, PEG, propylene glycol, and lipids; pH adjustments using an acid, e.g., HC1 or citric acid, can be used to increase solubility and resulting compositions subjected to suitable sterilization procedures know in the art, such as, aseptic filtration.
- the pH of the aqueous solution is about 2.0 to about 4.0.
- the pH of the aqueous solution is about 2.5 to about 3.5.
- Aqueous formulations suitable for oral use can be prepared by dissolving or suspending the active component in water and adding suitable colorants, flavors, stabilizing and thickening agents, as desired.
- Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, or other well-known suspending agents.
- viscous material such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, or other well-known suspending agents.
- solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for oral administration.
- liquid forms include solutions, suspensions and emulsions.
- These preparations may contain, in addition to the active component, colorants, flavors, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents and the like.
- the compounds according to the invention may be formulated as ointments, creams or lotions, or as a transdermal patch.
- Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agents.
- Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents.
- Formulations suitable for topical administration in the mouth include lozenges comprising active agent in a flavored base, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
- Solutions or suspensions are applied directly to the nasal cavity by conventional means, for example with a dropper, pipette or spray.
- the formulations may be provided in single or multi-dose form. In the latter case of a dropper or pipette, this may be achieved by the patient administering an appropriate, predetermined volume of the solution or suspension. In the case of a spray, this may be achieved for example by means of a metering atomizing spray pump.
- Administration to the respiratory tract may also be achieved by means of an aerosol formulation in which the active ingredient is provided in a pressurized pack with a suitable propellant.
- aerosol formulation in which the active ingredient is provided in a pressurized pack with a suitable propellant.
- the compounds of the present invention or pharmaceutical compositions comprising them are administered as aerosols, for example as nasal aerosols or by inhalation, this can be carried out, for example, using a spray, a nebulizer, a pump nebulizer, an inhalation apparatus, a metered inhaler or a dry powder inhaler.
- Pharmaceutical forms for administration of the compounds of the present invention as an aerosol can be prepared by processes well known to the person skilled in the art.
- solutions or dispersions of the compounds of the present invention in water, water/alcohol mixtures or suitable saline solutions can be employed using customary additives, for example benzyl alcohol or other suitable preservatives, absorption enhancers for increasing the bioavailability, solubilizers, dispersants and others and, if appropriate, customary propellants, for example include carbon dioxide, CFCs, such as, dichlorodifluoromethane, trichlorofluoromethane, or dichlorotetrafluoroethane; and the like.
- the aerosol may conveniently also contain a surfactant such as lecithin.
- the dose of drug may be controlled by provision of a metered valve.
- the compound In formulations intended for administration to the respiratory tract, including intranasal formulations, the compound will generally have a small particle size for example of the order of 10 microns or less. Such a particle size may be obtained by means known in the art, for example by micronization. When desired, formulations adapted to give sustained release of the active ingredient may be employed.
- the active ingredients may be provided in the form of a dry powder, for example, a powder mix of the compound in a suitable powder base such as lactose, starch, starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidone (PVP).
- a powder mix of the compound in a suitable powder base such as lactose, starch, starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidone (PVP).
- PVP polyvinylpyrrolidone
- the powder carrier will form a gel in the nasal cavity.
- the powder composition may be presented in unit dose form for example in capsules or cartridges of, e.g., gelatin, or blister packs from which the powder may be administered by means of an inhaler.
- Compounds of the present invention may also be administered via a rapid dissolving or a slow release composition, wherein the composition includes a biodegradable rapid dissolving or slow release carrier (such as a polymer carrier and the like) and a compound of the invention.
- Rapid dissolving or slow release carriers are well known in the art and are used to form complexes that capture therein an active compound(s) and either rapidly or slowly degrade/dissolve in a suitable environment (e.g., aqueous, acidic, basic, etc.). Such particles are useful because they degrade/dissolve in body fluids and release the active compound(s) therein.
- the particle size of a compound of the present invention, carrier or any excipient used in such a composition may be optimally adjusted using techniques known to those of ordinary skill in the art.
- Particle size can play an important role in formulation. Reducing the size of the particles can be used to modify the physical characteristics. Particle size reduction increases both the number of particles and the amount of surface area per unit of volume. The increased surface area can improve the rate of solvation and therefore solubility. In addition, particle size reduction can improve
- Particle size reduction can be obtained by any of the methods know in the art, for example, precipitation/crystallization, comminution (size reduction by a mechanical process), and the like, see for example Remington, The Science and Practice of Pharmacy, 20th Edition, 2000, Lippincott Williams & Wilkins, (Editors: Gennaro et al).
- the pharmaceutical preparations are preferably in unit dosage forms.
- the preparation is subdivided into unit doses containing appropriate quantities of the active component.
- the unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules and powders in vials or ampoules.
- the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.
- Tablets or capsules for oral administration and liquids for intravenous administration are preferred compositions.
- the compounds according to the invention may optionally exist as pharmaceutically acceptable salts including pharmaceutically acceptable acid addition salts prepared from pharmaceutically acceptable non-toxic acids including inorganic and organic acids.
- Representative acids include, but are not limited to, acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, dichloroacetic, formic, fumaric, gluconic, glutamic, hippuric, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, oxalic, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, oxalic, j-toluenesulfonic and the like.
- Certain compounds of the present invention which contain a carboxylic acid functional group may optionally exist as pharmaceutically acceptable salts containing non-toxic, pharmaceutically acceptable metal cations and cations derived from organic bases.
- Representative metals include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc and the like. In some embodiments the pharmaceutically acceptable metal is sodium.
- Representative organic bases include, but are not limited to, benzathine
- the acid addition salts may be obtained as the direct products of compound synthesis.
- the free base may be dissolved in a suitable solvent containing the appropriate acid and the salt isolated by evaporating the solvent or otherwise separating the salt and solvent.
- the compounds of this invention may form solvates with standard low molecular weight solvents using methods known to the skilled artisan.
- Pro-drugs refers to compounds that have been modified with specific chemical groups known in the art and when administered into an individual these groups undergo biotransformation to give the parent compound. Pro-drugs can thus be viewed as compounds of the invention containing one or more specialized nontoxic protective groups used in a transient manner to alter or to eliminate a property of the compound. In one general aspect, the "pro-drug” approach is utilized to facilitate oral absorption.
- T. Higuchi and V. Stella Pro-drugs as Novel Delivery Systems Vol. 14 of the A.C.S. Symposium Series; and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
- Some embodiments of the present invention include a method of producing a pharmaceutical composition for "combination-therapy" comprising admixing at least one compound according to any of the compound embodiments disclosed herein, together with at least one known pharmaceutical agent as described herein and a pharmaceutically acceptable carrier.
- Mas receptor modulators are utilized as active ingredients in pharmaceutical compositions, these are not intended for use in humans only, but in non-human mammals as well.
- active agents such as Mas receptor modulators
- livestock animals e.g., horses, cows, chickens, fish, etc.
- the dosage forms described herein may comprise, as the active component, either a compound described herein or a pharmaceutically acceptable salt or as a pharmaceutically acceptable solvate or hydrate thereof.
- various hydrates and solvates of the compounds described herein and their salts can find use as intermediates in the manufacture of pharmaceutical compositions. Typical procedures for making and identifying suitable hydrates and solvates, outside those mentioned herein, are well known to those in the art; see for example, pages 202-209 of K.J. Guillory, "Generation of Polymorphs, Hydrates, Solvates, and Amorphous Solids," in: Polymorphism in Pharmaceutical Solids, ed. Harry G. England, Vol.
- one aspect of the present invention pertains to methods of administering hydrates and solvates of compounds described herein and/or their pharmaceutical acceptable salts, that can be isolated and characterized by methods known in the art, such as, thermogravimetric analysis (TGA), TGA-mass spectroscopy, TGA-Infrared spectroscopy, powder X- ray diffraction (PXRD), Karl Fisher titration, high resolution X-ray diffraction, and the like.
- TGA thermogravimetric analysis
- TGA-mass spectroscopy TGA-mass spectroscopy
- TGA-Infrared spectroscopy TGA-Infrared spectroscopy
- PXRD powder X- ray diffraction
- Karl Fisher titration high resolution X-ray diffraction
- One aspect of the present invention pertains to solvates of salts of compounds of the present invention.
- One aspect of the present invention pertains to solvates of a hydrochloride salt of a compound of the present invention.
- the salt is (S)-.V-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide hydrochloride.
- Polymorphism is the ability of a substance to exist as two or more crystalline phases that have different arrangements and/or conformations of the molecules in the crystal lattice. Compounds that form polymorphs show the same properties in the liquid or gaseous state, but in the solid state their polymorphs behave differently.
- drugs can also exist as salts and other multicomponent crystalline phases.
- solvates and hydrates may contain an API host and either solvent or water molecules, respectively, as guests.
- the guest compound is a solid at room temperature, the resulting form is often called a cocrystal.
- Salts, solvates, hydrates, and cocrystals may show polymorphism as well. Crystalline phases that share the same API host, but differ with respect to their guests, may be referred to as pseudopolymorphs of one another.
- Solvates contain molecules of the solvent of crystallization in a definite crystal lattice. Solvates, in which the solvent of crystallization is water, are termed hydrates. Because water is a constituent of the atmosphere, hydrates of drugs may be formed rather easily and may be thermodynamically favored over anhydrous polymorphs.
- Crystalline forms such as those described herein, can be identified by their unique solid state signature with respect to, for example, differential scanning calorimetry (DSC), powder X-ray diffraction (PXRD), and other solid state methods.
- DSC differential scanning calorimetry
- PXRD powder X-ray diffraction
- thermogravimetric analysis TGA
- Karl Fischer analysis Karl Fischer analysis
- DSC DSC thermograms
- the temperatures observed will depend upon sample purity, the rate of temperature change, as well as sample preparation technique and the particular instrument employed.
- the values reported herein relating to DSC thermograms can vary by plus or minus about 4 °C (+ 4 °C).
- the values reported herein relating to DSC thermograms can also vary by plus or minus about 20 joules per gram (+ 20 joules per gram).
- the DSC thermogram values reported herein relate to desolvation events.
- the values reported herein are estimates. Scan rate and pan closure can influence DSC values for desolvation events, which can vary by plus or minus about 25 °C. DSC values for desolvation events reported herein were recorded using a sample in an aluminum pan with an uncrimped lid and a scan rate of 10 °C/min.
- the relative intensities of the peaks can vary, depending upon the sample preparation technique, the sample mounting procedure and the particular instrument employed.
- the peak assignments of diffraction patterns can vary by plus or minus 0.2 °2 ⁇ (+ 0.2 °2 ⁇ ).
- the features reported herein can vary by plus or minus about 5 °C (+ 5 °C).
- the TGA features reported herein can also vary by plus or minus about 2% (+ 2%) weight change due to, for example, sample variation.
- DMS dynamic moisture sorption
- the present invention is directed, inter alia, to crystalline forms of (S)-/V-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide (Compound 17) and salts, solvates, and hydrates thereof.
- One aspect of the present invention is directed to an anhydrous crystalline form of ( l S')-/Y-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide (Compound 17).
- Another aspect of the present invention is directed to a crystalline form of ( l S r )-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17) as the hydrochloride salt.
- One aspect of the present invention is directed to an anhydrous crystalline form of (S)-N-(4- chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)- 2,3-difluorobenzamide (Compound 17), Form I.
- Compound 17 Certain physical properties of Compound 17, Form I are summarized in Table B below.
- One aspect of the present invention is directed to a crystalline form of Compound 17 having an X-ray powder diffraction pattern comprising a peak, in terms of 2 ⁇ , at about 9.36 °.
- the crystalline form has an X-ray powder diffraction pattern comprising a peak, in terms of 2 ⁇ , at about 18.73 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 9.36 ° and about 18.73 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 9.36 ° and about 14.09 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 9.36 °, about 18.73 ° and about 14.09 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 26» at about 9.36 °, about 18.73 °, about 14.09 °, about 20.14 °, about 18.92 °, about 16.64 °, and about 18.50 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 9.36 °, about 18.73 °, about 14.09 °, about 20.14 °, about 18.92 °, about 16.64 °, about 18.50 °, about 22.22 °, about 11.09 °, and about 14.93 °.
- One aspect of the present invention is directed to a crystalline form of Compound 17 having an X-ray powder diffraction pattern comprising one or more peaks listed in Table C.
- the crystalline form has an X-ray powder diffraction pattern substantially as shown in Figure 8, wherein by “substantially” is meant that the reported peaks can vary by about + 0.2 °2 ⁇ , and also that the relative intensities of the reported peaks can vary.
- the crystalline form of Compound 17 has a differential scanning calorimetry thermogram comprising an endotherm with an extrapolated onset temperature between about 171 °C and about 191 °C. In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram comprising an endotherm with an extrapolated onset temperature at about 181 °C. In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram comprising an endotherm with an associated heat flow of about 87 joules per gram. In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram substantially as shown in Figure 9, wherein by
- the crystalline form of Compound 17 has a thermogravimetric analysis profile substantially as shown in Figure 9, wherein by “substantially” is meant that the reported TGA features can vary by about + 5 °C and by about + 2% weight change.
- the crystalline form of Compound 17 has a dynamic moisture sorption profile substantially as shown in Figure 10, wherein by “substantially” is meant that the reported DMS features can vary by about + 5% relative humidity and by about + 5% weight change.
- Form I of Compound 17 can be prepared by any of the suitable procedures known in the art for preparing crystalline polymorphs. In some embodiments Form I of Compound 17 can be prepared as described in Example 2.5. In some embodiments, Form I of Compound 17 can be prepared by slurrying solid Compound 17 containing one or more solid forms other than Form I. In some embodiments, the crystalline form of Compound 17 can be prepared by crystallizing or recrystallizing solid Compound 17 containing one or more solid forms other than Form I.
- One aspect of the present invention is directed to a solvated crystalline form of (S)-N-(4- Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)- 2,3-difluorobenzamide hydrochloride salt (Compound 17 hydrochloride salt solvate). Certain physical properties of Compound 17 hydrochloride salt solvate are summarized in Table D below.
- TGA analysis showed the hydrochloride salt of Compound 17 to be solvated.
- the weight loss corresponded to approximately 1.24 mole equivalents of water.
- Analysis by DSC showed a broad desolvation peak, followed by two other broad endotherms, but no definitive melting endotherm.
- One aspect of the present invention is directed to a crystalline form of Compound 17 hydrochloride salt solvate having an X-ray powder diffraction pattern comprising a peak, in terms of 2 ⁇ , at about 7.80 °.
- the crystalline form has an X-ray powder diffraction pattern comprising a peak, in terms of 2 ⁇ , at about 15.57 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 7.80 ° and about 15.57 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 7.80 ° and about 8.32 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 7.80 °, about 15.57 ° and about 8.32 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2(9, at about 7.80 °, about 15.57 °, about 8.32 °, about 14.05 °, about 21.93 °, about 24.13 °, and about 25.94 °.
- the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 ⁇ , at about 7.80 °, about 15.57 °, about 8.32 °, about 14.05 °, about 21.93 °, about 24.13 °, about 25.94 °, about 11.72 °, about 17.83 °, and about 17.55.
- One aspect of the present invention is directed to a crystalline form of Compound 17 hydrochloride salt solvate having an X-ray powder diffraction pattern comprising one or more peaks listed in Table E.
- the crystalline form has an X-ray powder diffraction pattern substantially as shown in Figure 11, wherein by “substantially” is meant that the reported peaks can vary by about + 0.2 °2 ⁇ , and also that the relative intensities of the reported peaks can vary.
- the crystalline form of Compound 17 hydrochloride salt solvate has a differential scanning calorimetry thermogram substantially as shown in Figure 12, wherein by “substantially” is meant that the reported DSC features can vary by about + 6 °C and by about + 20 joules per gram.
- the crystalline form of Compound 17 hydrochloride salt solvate has a thermogravimetric analysis profile substantially as shown in Figure 12, wherein by “substantially” is meant that the reported TGA features can vary by about + 5 °C and by about + 2% weight change.
- Compound 17 hydrochloride salt solvate can be prepared by any of the suitable procedures known in the art for preparing crystalline polymorphs. In some embodiments Compound 17
- hydrochloride salt solvate can be prepared as described in Example 2.6. In some embodiments,
- Compound 17 hydrochloride salt solvate can be prepared by slurrying solid Compound 17
- hydrochloride salt solvate containing one or more solid forms other than the form described herein can be prepared by crystallizing or recrystallizing solid Compound 17 hydrochloride salt solvate containing one or more solid forms other than the form described herein.
- Another object of the present invention relates to radiolabeled compounds of the present invention that would be useful not only in radio-imaging but also in assays, both in vitro and in vivo, for localizing and quantitating Mas receptors in tissue samples, including human and for identifying Mas receptor ligands by inhibition binding of a radiolabeled compound. It is a further object of this invention to develop novel Mas receptor assays of which comprise such radiolabeled compounds.
- the present disclosure includes all isotopes of atoms occurring in the present compounds, intermediates, salts and crystalline forms thereof.
- Isotopes include those atoms having the same atomic number but different mass numbers.
- One aspect of the present invention includes every combination of one or more atoms in the present compounds, intermediates, salts, and crystalline forms thereof that is replaced with an atom having the same atomic number but a different mass number.
- One such example is the replacement of an atom that is the most naturally abundant isotope, such as 3 ⁇ 4 or 12 C, found in one the present compounds, intermediates, salts, and crystalline forms thereof, with a different atom that is not the most naturally abundant isotope, such as 2 H or 3 H (replacing 3 ⁇ 4), or n C, 13 C, or 14 C (replacing 12 C).
- a compound wherein such a replacement has taken place is commonly referred to as being an isotopically-labeled compound.
- Isotopic-labeling of the present compounds, intermediates, salts, and crystalline forms thereof can be accomplished using any one of a variety of different synthetic methods know to those of ordinary skill in the art and they are readily credited with understanding the synthetic methods and available reagents needed to conduct such isotopic-labeling.
- isotopes of hydrogen include 2 H (deuterium) and 3 H (tritium).
- isotopes of carbon include n C, 13 C, and 14 C.
- Isotopes of nitrogen include 13 N and 15 N.
- Isotope of fluorine include F.
- Isotopes of phosphorous include P and P.
- Isotopes of sulfur include 35 S.
- Isotopes of chlorine include 36 C1.
- Isotopes of bromine include 75 Br, 76 Br,
- Isotopes of iodine include I, I, I, and I.
- Another aspect of the present invention includes compositions, such as, those prepared during synthesis, preformulation, and the like, and pharmaceutical compositions, such as, those prepared with the intent of using in a mammal for the treatment of one or more of the disorders described herein, comprising one or more of the present compounds, intermediates, salts, and crystalline forms thereof, wherein the naturally occurring distribution of the isotopes in the composition is perturbed.
- compositions and pharmaceutical compositions comprising compounds as described herein wherein the compound is enriched at one or more positions with an isotope other than the most naturally abundant isotope.
- isotope perturbations or enrichments such as, mass spectrometry
- isotopes that are radio-isotopes additional methods are available, such as, radio-detectors used in connection with HPLC or GC.
- Certain isotopically-labeled compounds of the present invention are useful in compound and/or substrate tissue distribution assays.
- the radionuclide 3 H and/or 14 C isotopes are useful in these studies.
- substitution with heavier isotopes such as deuterium (i.e. , 2 H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances.
- Isotopically labeled compounds of the present invention can generally be prepared by following procedures analogous to those disclosed in the Drawings and Examples by substituting an isotopically labeled reagent for a non-isotopically labeled reagent. Other synthetic methods that are useful are discussed below. Moreover, it should be understood that all of the atoms represented in the compounds of the invention can be either the most commonly occurring isotope of such atoms or a scarcer radioisotope or nonradioactive isotope.
- Synthetic methods for incorporating radio-isotopes into organic compounds are applicable to compounds of the invention and are well known in the art. These synthetic methods, for example, incorporating activity levels of tritium into target molecules, are as follows:
- Tritium Gas Exposure Labeling This procedure involves exposing precursors containing exchangeable protons to tritium gas in the presence of a suitable catalyst.
- Synthetic methods for incorporating activity levels of 125 I into target molecules include:
- Aryl and heteroaryl bromide exchange with 125 I This method is generally a two step process.
- the first step is the conversion of the aryl or heteroaryl bromide to the corresponding tri-alkyltin intermediate using for example, a Pd catalyzed reaction [i.e. Pd(Ph 3 P) 4 ] or through an aryl or heteroaryl lithium, in the presence of a tri-alkyltinhalide or hexaalkylditin [e.g., (CH 3 ) 3 SnSn(CH 3 )3] .
- Pd catalyzed reaction i.e. Pd(Ph 3 P) 4
- a tri-alkyltinhalide or hexaalkylditin e.g., (CH 3 ) 3 SnSn(CH 3 )3
- a radiolabeled form of a compound of Formula (la) can be used in a screening assay to identify/evaluate compounds.
- a newly synthesized or identified compound i.e., test compound
- a newly synthesized or identified compound can be evaluated for its ability to reduce binding of a radiolabeled form of a compound of Formula (la) to a Mas receptor.
- the ability of a test compound to compete with a radiolabeled form of a compound of Formula (la) for the binding to a Mas receptor directly correlates to its binding affinity.
- Certain labeled compounds of the present invention bind to certain Mas receptors.
- the labeled compound has an IC 50 less than about 500 ⁇ . In one embodiment the labeled compound has an IC 50 less than about 100 ⁇ . In one embodiment the labeled compound has an IC 50 less than about 10 ⁇ . In one embodiment the labeled compound has an IC 50 less than about 1 ⁇ . In one embodiment the labeled compound has an IC 50 less than about 0.1 ⁇ . In one embodiment the labeled compound has an IC 50 less than about 0.01 ⁇ . In one embodiment the labeled compound has an IC 50 less than about 0.005 ⁇ .
- Example 1 Syntheses of Compounds of the Present Invention.
- Proton nuclear magnetic resonance (3 ⁇ 4 NMR) spectra were recorded on a Bruker Avance-400 equipped with a QNP (Quad Nucleus Probe) or a BBI (Broad Band Inverse) and z-gradient. Chemical shifts are given in parts per million (ppm) with the residual solvent signal used as reference.
- Microwave irradiations were carried out using a Smith Synthesizer TM or an Emrys Optimizer TM (Biotage).
- TLC Thin-layer chromatography
- PK6F silica gel 60 A 1 mm plates (Whatman) and column chromatography was carried out on a silica gel column using Kieselgel 60, 0.063-0.200 mm (Merck). Evaporation was done under reduced pressure on a Biichi rotary evaporator.
- Example 1.1 Preparation of 4-(Aminomethyl)-N-(4-chloro-2-(4-(3,3,3-trifluoropropyl) piperazin- l-yl)phenyl)-2-fluorobenzamide (Intermediate 1).
- Step A Preparation of 4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline.
- the reaction was heated at 80 °C for 1 h.
- the reaction was cooled in an ice bath and aqueous NaOH (50 wt%) was added portionwise (in -20 mL portions).
- DCM, and H 2 0 were added (enough to sufficiently dissolve the tin chloride and form two layers separable in a separation funnel; -1.2 L each).
- the organic layer was removed and the aqueous layer was extracted with DCM (2 X 1 L). The organic layers were combined, dried, and concentrated.
- the residue was purified by column chromatography to give the title compound as a light-yellow/tan solid (42.7 g).
- Step B Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- cyano-2-fluorobenzamide.
- Step C Preparation of 4-(Aminomethyl)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl) piperazin-l-yl)phenyl)-2-fluorobenzamide (Intermediate 1).
- Example 1.2 Preparation of 4-(Aminomethyl)-N-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin- l-yl)phenyl)-2,3-difluorobenzamide (Intermediate 2).
- Step A Preparation of Ethyl 4-(Bromomethyl)-2,3-difluorobenzoate.
- Step B Preparation of 4-((ieri-Butoxycarbonylamino)methyl)-2,3-difluorobenzoic Acid.
- the ethyl acetate layer was dried over MgS0 4 and concentrated under reduced pressure.
- the residue was dissolved in DCM (10 mL) and di-feri-butyl dicarbonate (2.58 g, 11.82 mmol) and DIEA (1.528 g, 11.82 mmol) was added. After stirring for 2 h at room temperature, the mixture was washed with water, dried over MgS0 4 , and then concentrated under reduced pressure.
- Step C Preparation of 4-(Aminomethyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Intermediate 2).
- Example 1.3 Preparation of 2,5-Dioxopyrrolidin-l-yl 4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzylcarbamate (Intermediate 3).
- Example 1.5 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-(methylsulfonylmethyl)ureido)methyl)benzamide (Compound 3).
- Example 1.6 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-piperidin-4-ylureido)methyl)benzamide (Compound 5).
- Example 1.7 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3- (2-cyanoethyl)-3-methylureido)methyl)-2-fluorobenzamide (Compound 6) .
- Example 1.8 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-piperidin-3-ylureido)methyl)benzamide (Compound 7).
- Example 1.10 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2-fluoro-4-((3-(pyrrolidin-2-ylmethyl)ureido)methyl)benzamide (Compound 9).
- Example 1.12 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 11).
- Example 1.14 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-methyl-3-(l-methylpiperidin-4-yl)ureido)methyl)benzamide (Compound 13).
- Example 1.16 Preparation of 4-((3-(2-Amino-2-oxoethyl)ureido)methyl)-N-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 15).
- Example 1.17 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2-(dimethylamino)ethyl)ureido)methyl)-2,3-difluorobenzamide (Compound 16).
- Example 1.18 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17).
- Example 1.20 Preparation of 4-((3,3-Bis(2-hydroxyethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 19).
- Example 1.21 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l-hydroxycyclohexyl)methyl)ureido)methyl)benzamide (Compound 20).
- Example 1.22 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(l-hydroxy-2-methylpropan-2-yl)ureido)methyl)benzamide (Compound 21).
- Example 1.24 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(2-hydroxypropyl)ureido)methyl)benzamide (Compound 23).
- Example 1.25 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-((2/f,3/f)-l,3-dihydroxybutan-2-yl)ureido)methyl)-2,3-difluorobenzamide (Compound 24).
- Example 1.26 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(2-(2-(hydroxymethyl)pyrrolidin-l-yl)ethyl)ureido)methyl)benzamide
- Example 1.28 Preparation of 4-((3-(3-(l/ -Imidazol-l-yl)propyl)ureido)methyl)-N-(4-chloro-2-(4- (3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluorobenzamide (Compound 4).
- Example 1.30 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxy-3-methylbutan-2-yl)ureido)methyl)benzamide (Compound 38).
- Example 1.31 Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxypropan-2-yl)ureido)methyl)benzamide (Compound 39).
- Example 1.32 Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxy-3-methylbutan-2-yl)ureido)methyl)benzamide (Compound 40).
- Example 1.33 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((lS,2/f)-2-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 41).
- Example 1.35 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(3-hydroxypropyl)ureido)methyl)benzamide (Compound 43).
- Example 1.36 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(l-(hydroxymethyl)cyclopentyl)ureido)methyl)benzamide (Compound 44).
- Example 1.37 Preparation of 4-((3-ieri-Butyl-3-(2-hydroxyethyl)ureido)methyl)-N-(4-Chloro-2- (4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 46).
- Example 1.38 Preparation of 2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethanesulfonic acid (Compound 48).
- Example 1.41 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((lr,4r)-4-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 28).
- Example 1.42 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(5-methyl-2-oxo-l,2-dihydropyrimidin-4-yl)ureido)methyl)benzamide (Compound 29).
- Example 1.43 Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(tetrahydrofuran-3-yl)ureido)methyl)benzamide (Compound 30).
- Example 1.45 Preparation of Ethyl l-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)cyclopropanecarboxylate (Compound 32).
- Example 1.48 Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 35).
- Example 1.49 Preparation of 2-(l-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzylcarbamoyl)pyrrolidin-3-yl)acetic acid (Compound 36).
- Example 1.50 Preparation of Sodium Salt of (tf )-l-(3-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)propan-2-yl Dihydrogen Phosphate (Sodium Salt of Compound 67).
- Example 1.51 Preparation of (5)-2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)propyl Dihydrogen Phosphate (Compound 37).
- Example 1.56 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxyethyl)-3-isopropylureido)methyl)benzamide (Compound 52).
- Example 1.57 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l/f,2/f)-2-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 53).
- Example 1.58 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((ls,4s)-4-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 54).
- Example 1.59 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxypropan-2-yl)ureido)methyl)benzamide (Compound 55).
- Example 1.60 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l/f,2S)-2-hydroxycyclopentyl)ureido)methyl)benzamide (Compound 56).
- Example 1.62 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((ls,3s)-3-(hydroxymethyl)cyclobutyl)ureido)methyl)benzamide (Compound 58).
- Example 1.63 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((lr,3r)-3-(hydroxymethyl)cyclobutyl)ureido)methyl)benzamide (Compound 59).
- Example 1.64 Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((ls,4$)-4-(hydroxymethyl)cyclohexyl)ureido)methyl)benzamide (Compound 60).
- Example 1.66 Preparation of 4-((3-((l/ -Tetrazol-5-yl)methyl)ureido)methyl)-N-(4-chloro-2-(4- (3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 62).
- Step A Preparation of 2-Bromo-4-teri-butyl-l-nitrobenzene.
- Step B Preparation of l-(5-ieri-Butyl-2-nitrophenyl)-4-(3,3,3-trifluoropropyl)piperazine.
- Step C Preparation of 4-feri-Butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline.
- tin (II) chloride dihydrate (0.350 g, 1.550 mmol) in portions at 75 °C.
- the reaction was stirred at 75 °C for 2 h, and then it was cooled to room temperature.
- the solvent was removed under reduced pressure and EtOAc (10 mL) was added. It was washed with water and brine.
- the organic layer was dried over anhydrous MgS0 4 , filtered and concentrated under reduced pressure to give the title compound without further purification.
- LCMS m/z 330.4 [M+H] + .
- Step D Preparation of N-(4-(4-ieri-Butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)-4-(hydroxymethyl)piperidine-l-carboxamide
- Step A Preparation of Ethyl 4-Amino-3-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)benzoate.
- Step B Preparation of Ethyl 4-(4-((teri-Butoxycarbonylamino)methyl)-2,3- difluorobenzamido)-3-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)benzoate.
- Step C Preparation of (S)-Ethyl 4-(4-((3-(2,3-Dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamido)-3-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)benzoate (Compound 66).
- Example 1.72 Preparation of Sodium Salt of 2-(3-(4-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Dihydrogen Phosphate (Sodium Salt of Compound 71).
- Step A Preparation of Butyl 2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Butylphosphonate.
- V-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4-((3-(2- hydroxyethyl)ureido)methyl)benzamide 400 mg, 0.709 mmol
- 1/f-tetrazole 149 mg, 2.128 mmol
- di-feri-butyl diethylphosphoramidite 354 mg, 1.419 mmol
- Step B Preparation of Di-tert-butyl 2-(3-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl phosphate.
- Step C Preparation of 2,2,2-Trifluoroacetate Salt of 2-(3-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Dihydrogen Phosphate.
- Step D Preparation of 2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Dihydrogen Phosphate (Compound 71).
- the resin was re-suspended in MeOH H 2 0 (50:50, 6 mL). Ammonia in MeOH (2 M, ⁇ 2 mL) was added dropwise to the suspension to release the product from the resin. The resin was filtered and washed with MeOH H 2 0. The MeOH was evaporated and the product was frozen and lyophilized. The resulting material was then re-dissolved in H 2 0 (1 mL) and purified again on a C- 18 reverse phase column (5 - 30% MeOH/H 2 0) to give the title compound (155 mg).
- Example 1.73 Preparation of (5)-N-(4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,3-difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 63).
- Step A Preparation of (S)-teri-Butyl 4-(5-Chloro-2-nitrophenyl)-2-methylpiperazine-l- carboxylate.
- Step B Preparation of (5)-4-(5-Chloro-2-nitrophenyl)-2-methyl-l-(3,3,3- trifluoropropyl)piperazine.
- Step C Preparation of (5)-4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)aniline.
- Step D Preparation of Hydrochloride Salt of (S)-4-(Aminomethyl)-N-(4-chloro-2-(3- methyl-4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide.
- Step E Preparation of (5)-N-(4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,3-difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 63).
- Example 1.74 Preparation of N-(4-Chloro-2-((5)-3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-4-((3-((5)-2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 64).
- Example 2 Preparations of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17), Salts, Solvates, and Crystalline Forms.
- Example 2.1 Powder X-ray Diffraction.
- Powder X-ray Diffraction (PXRD) data were collected on an X'Pert PRO MPD powder diffractometer (PANalytical, Inc.) with a Cu source set at 45 kV and 40 mA, Cu(Ka) radiation and an X'Celerator detector. Samples were added to the sample holder and smoothed flat with a spatula and weigh paper. With the samples spinning, X-ray diffractogram was obtained by a 12-min scan over the range 5-40 °2 ⁇ . Diffraction data were viewed and analyzed with the X'Pert Data Viewer Software, version 1.0a and X'Pert HighScore Software, version 1.0b.
- Example 2.2 Differential Scanning Calorimetry.
- DSC Differential scanning calorimetry
- TGA Thermogravimetric analyses
- DMS dynamic moisture-sorption
- Example 2.5 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide, Form I (Compound 17, Form I).
- the title compound was prepared by slurrying (S)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide (prepared according to Example 1.18) in 9: 1 IP A/water for three days.
- the title compound was prepared by slurrying ( l S')-iV-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide, Form I in ethanol for 2 weeks, which greatly improved the crystallinity.
- Example 2.6 Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide Hydrochloride Salt Solvate (Compound 17 Hydrochloride Salt Solvate, Form I).
- Example 3.1 Homogeneous Time-Resolved Fluorescence (HTRF®) IPl Assay.
- Human and rat Mas receptors were either transiently or stably expressed in HEK293 cells.
- human or rat Mas in pHM6 vector were transfected into HEK293 cells using Lipofectamine® (Invitrogen #18324-012).
- HEK293 cells transfected with empty pHM6 vector were used as a control.
- cDNA expression plasmids encoding human or rat Mas genes and the neo r gene were transfected into HEK293 cells (ATCC# CRL-1573) using
- Lipofectamine® (Invitrogen) according to the manufacturer's instructions. Stable receptor expressing pools were then generated over 3 weeks by standard techniques in the presence of 500 ⁇ g/mL
- IPl standards (Sigma (#A3059) were added to each well and serial diluted IPl standards (Cisbio #62IP1CDA) were also added to corresponding wells at this step. After the cells were incubated for 4 h in a C0 2 incubator at 37 °C, d2-labeled IPl and cryptate-labeled anti-IPl monoclonal antibody diluted in lysis buffer were added sequentially in 10 ⁇ per well and the assay plates were kept in the dark at room temperature overnight. Ratiometric measurements of fluorescence emission at 665 nm and 620 nm were obtained using a Pherastar fluorometer (BMG Labtech). IPl levels in each well were calculated according to the standard curves on each plate.
- IC 50 values were obtained by fitting data to a nonlinear curve-fitting program (GraphPad Software, Inc., La Jolla CA). The average IC 50 value for Compound 17 obtained from several experiments using the rat Mas receptor was 30.6 nM (see Table B.l).
- the average IC 50 value for Compound 17 obtained from nine experiments using the human Mas receptor was 30.5 nM (see Table B.2).
- Example 3.2 Homogeneous Time-Resolved Fluorescence IP-One HTRF® Assay (Cisbio).
- the constitutive G q coupling of the Mas receptor provided a suitable assay signal with which to screen small molecule libraries for Mas receptor modulators. This assay was able to identify and optimize both agonists and inverse agonists to the Mas receptor.
- Functional G q agonism and inverse agonism for representative compounds was demonstrated in HEK cells stably expressing either human or rat Mas receptor ( Figure 18 and Figure 19, and TABLE C). There were detected effects of these compounds in control HEK293 cells.
- Example 3.3 cAMP assay.
- cAMP accumulation in HEK293 cells stably expressing human or rat Mas receptors was determined by the 384 well cAMP Dynamic2 Homogenous Time-Resolved Fluorescence (HTRF®) assay (CisBio Cat# 62AM4PEB) following the manufacturer's protocol. Briefly, cells were plated at 30,000 or 1000 cells per well in 5 ⁇ stimulation buffer (PBS containing 500 ⁇ IBMX and 0.1 % bovine serum albumin). 5 ⁇ of Mas compounds diluted in PBS were added to each well and serial diluted cAMP standards were also added to corresponding wells at this step. For detecting Gj-coupled activities, 10 ⁇ forskolin was included with the compounds for a final concentration of 5 ⁇ at the stimulation step.
- PBS stimulation buffer
- 0.1 % bovine serum albumin 5 ⁇
- 10 ⁇ forskolin was included with the compounds for a final concentration of 5 ⁇ at the stimulation step.
- d2-labeled cAMP and anti-cAMP cryptate conjugate diluted in detection buffer were added to cells sequentially at 5 ⁇ per well. The plates were incubated further for 1 h at room temperature. Ratiometic measurements of fluorescence emission at 665 nm and 620 nm were obtained by Pherastar fluorometer (BMG Labtech) and cAMP levels in each well were calculated according to the standard curves on each plate. IC 50 values were obtained by fitting data to a nonlinear curve-fitting program (GraphPad Software, Inc., La Jolla CA).
- Example 3.4 Ca + Measurements by Fluorometric Imaging Plate Reader (FLIPR) Assay.
- FLIPR-384 Molecular Devices, Sunnyvale, CA. Cells were seeded into black-walled clear-base 384-well plates at a density of 2 x 10 4 cells per well and incubated with Hank's Balanced Salt Solution (HBSS) containing 20 mM HEPES pH 7.4, 2 ⁇ Calcium 3 dye (Molecular Devices Corporation, Sunnyvale, CA) and 2.5 mM probenecid at 37 °C for 60 min.
- HBSS Hank's Balanced Salt Solution
- mice Male Sprague-Dawley rats (220 - 260 g) (Charles River) were housed four per cage and maintained in a humidity-controlled (40 - 60%) and temperature-controlled (68 - 72 °F) facility on a 12 h: 12 h light/dark cycle with free access to food and water.
- Polyethylene catheters were placed in the right internal carotid artery and the external jugular vein for measurement of mean arterial blood pressure and infusion of drug or vehicle, respectively.
- Myocardial I/R injury was produced as follows. A left thoracotomy was performed approximately 20 mm from the sternum to expose the heart at the fifth intercostal space. The pericardium was removed, and the left atrial appendage was moved to reveal the location of the left coronary artery. A ligature (6-0 prolene), along with a snare occluder, was placed around the left coronary artery close to the place of origin. After surgical preparation, the rat was allowed to stabilize for 15 min. Regional myocardial ischemia was produced by tightening the previously placed reversible ligature around the coronary artery to completely occlude the vessel. Sham-operated animals underwent the same surgical procedures but without ligation of the coronary artery. The ligature was untied after 30 min, and the ischemic myocardium was reperfused for 2 h.
- infarct size After ischemia and reperfusion treatment, the left coronary artery was re-occluded, and 5% Evans blue dye (1 mL) was administered to the circulation via the jugular cannula and allowed to perfuse the non-ischemic portions of the heart. The myocardium not stained with Evans blue dye represents the ischemia area at risk (AAR). Within the area at risk, ischemic injury (infarct) was measured by TTC staining and expressed as myocardial infarct size. Briefly, the entire heart was excised, rinsed of excess Evans blue dye, trimmed of atrial tissue, and sliced transversely into sections 2 mm thick.
- Rats were dosed i.v. via the jugular cannula with vehicle or test compound in a single bolus administration (loading dose) followed immediately by continuous i.v. infusion using a Harvard Apparatus 11+ syringe pump at a flow rate of 1 mL kg h.
- Compound 17 was dosed at, 0.216 mg kg (loading) + 0.252 mg kg h (low dose), 0.648 mg/kg (loading) + 0.756 mg kg h (medium dose), and 2.16 mg kg (loading) + 2.52 mg/kg/h (high dose).
- Results An example of a compound of the invention tested in this assay is shown in Figure 6.
- Compound 17 at both the medium and high doses were found to provide protection against ischemia-reperfusion injury in rat hearts as shown by a significant decrease in myocardial infarct size after reperfusion compared to vehicle treatment.
- Compound 17 at low, medium, and high doses has no significant effect on mean arterial blood pressure (MAP) compared to vehicle treatment.
- MAP mean arterial blood pressure
- Example 5 Inhibition of Mas G-Protein Signaling Improves Coronary Flow, Reduces Myocardial Infarct Size and Provides Cardioprotection - Mas Expression in the Heart.
- Example 5.1 Cloning of Human and Rat Mas Genes.
- the cDNA for human and rat Mas genes were obtained by PCR using genomic DNA as templates. The following were used as primer sets:
- PCR was performed using Pfu polymerase (Stratagene, San Diego, CA) with the buffer system provided by the manufacturer plus 10% DMSO, 2.5 ⁇ of each primer, and 300 ⁇ each of the four nucleotides. After an initial denaturation at 95 °C for 4 min, 30 cycles of 95 °C for 40 s, 60 °C for 50 s, 72 °C for 1 min 40 s were performed, which was followed by a final extension at 72 °C for 7 min.
- Pfu polymerase (Stratagene, San Diego, CA) with the buffer system provided by the manufacturer plus 10% DMSO, 2.5 ⁇ of each primer, and 300 ⁇ each of the four nucleotides. After an initial denaturation at 95 °C for 4 min, 30 cycles of 95 °C for 40 s, 60 °C for 50 s, 72 °C for 1 min 40 s were performed, which was followed by a final extension at 72 °C for 7 min.
- the 986 bp human Mas PCR fragment was digested with BamHI, and cloned into blunted Hindlll (5') - BamHI(3') sites of expression vector pHM6 (Invitrogen, Carlsbad, CA), while the 988 bp rat Mas PCR fragment was cloned into Hindlll (5') - EcoRI (3') sites of pHM6 after digestion with Hindlll and EcoRI.
- Example 5.2 Chemicals. Mas agonist (AR234960, l-((4-(3-fluorophenyl)- l-(2-methoxy-4- nitrophenylsulfonyl)pyrrolidin-3-yl)methyl)-4-(pyridin-2-yl)piperazine) and inverse agonist
- PLC inhibitor U-73122 (l-(6 ⁇ (8R,95,135,145,17S)-3-memoxy-13-methyl-7,8,9,l 1,12,13,14,15,16,17- decahydro-6/f-cyclopenta[a]phenanthren-17-ylamino)hexyl)- l/f-pyrrole-2,5-dione) was dissolved in DMSO.
- Example 5.3 Animals. Male Sprague-Dawley rats (270-330 g) were purchased from Harlan. The Mas knockout mouse line was purchased from Deltagen (San Mateo, CA) and confirmation of Mas mRNA deletion was performed by RT-PCR using Mas gene specific primers (sense:
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to compounds of Formula (la) and pharmaceutically acceptable salts, solvates, and hydrates thereof, that modulate the activity of the Mas receptor, and are useful in methods of treatment and alleviation of diseases and disorders of the heart, brain, kidney, immune system, and reproductive system resulting from ischemia, or reperfusion subsequent to ischemia, and any downstream complication(s) related thereto. These diseases and disorders include, for example, vascular disorders, such as: coronary heart disease, atherosclerosis, ischemia, reperfusion injury, angina pectoris, myocardial infarction, the no-reflow phenomenon, hypertension, transient ischemic attack, ischemic colitis, mesenteric ischemia, acute limb ischemia, and skin discoloration caused by reduced blood flow to the skin; and calcium-signaling disorders such as: arrhythmia, tachycardia, bradycardia, atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, Wolff-Parkinson-White syndrome, ventricular arrhythmia, ventricular tachycardia, ventricular fibrillation, reperfusion arrhythmia, and reperfusion-induced cardiomyocyte cell death.
Description
MODULATORS OF THE G PROTEIN-COUPLED MAS RECEPTOR AND THE TREATMENT OF DISORDERS RELATED THERETO
FIELD OF THE INVENTION
The present invention relates to compounds of Formula (la) and pharmaceutically acceptable salts, solvates, and hydrates thereof that modulate the activity of the Mas receptor, and are useful in methods of treatment and alleviation of diseases and disorders of the heart, brain, kidney, immune system, and reproductive system resulting from ischemia, or reperfusion subsequent to ischemia, and any downstream complication(s) related thereto. The present invention further relates to methods of treatment and alleviation of diseases and disorders of the vasculature resulting from vasoconstriction or hypertension and any downstream complication(s) resulting from elevated blood pressure and/or reduced tissue perfusion. These diseases and disorders include, for example, vascular disorders, such as: coronary heart disease, atherosclerosis, ischemia, reperfusion injury, angina pectoris, myocardial infarction, the no-reflow phenomenon, hypertension, anxiety, transient ischemic attack, erectile dysfunction, ischemic colitis, mesenteric ischemia, acute limb ischemia, skin discoloration caused by reduced blood flow to the skin, renal artery stenosis, renovascular hypertension, renal failure, chronic kidney disease, and diabetic nephropathy; and calcium-signaling disorders such as: arrhythmia, tachycardia, bradycardia, supraventricular arrhythmia, atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, Wolff-Parkinson-White syndrome, ventricular arrhythmia, ventricular tachycardia, ventricular fibrillation, reperfusion arrhythmia, and reperfusion-induced cardiomyocyte cell death.
BACKGROUND OF THE INVENTION
G protein-coupled receptors (GPCRs) share the common structural motif of having seven sequences of twenty-two to twenty-four hydrophobic amino acids that form seven alpha helices, each of which spans the cell membrane. The transmembrane helices are joined by strands of amino acids including a longer strand between the fourth and fifth transmembrane helices on the extracellular side of the membrane. Another longer strand, composed primarily of hydrophilic amino acids, joins transmembrane helices five and six on the intracellular side of the membrane. The carboxy terminus of the receptor lies intracellularly with the amino terminus residing in the extracellular space. It is believed that the intracellular amino acid strand joining helices five and six, as well as the carboxy terminus, interact with the G protein. In general, the G proteins that have been identified include Gq, Gs, Gj, and G0.
Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different states or conformations: an "inactive" state and an "active" state. A receptor in an inactive state is unable to link to the intracellular transduction pathway to produce a biological response. A change of the receptor conformation to the active state allows linkage to the transduction pathway and produces a biological response. Physiologically, these conformational changes are induced in response
to binding of a molecule to the receptor. Several types of biological molecules can bind to specific receptors, such as peptides, hormones or lipids, and can cause a cellular response. Modulation of particular cellular responses can be extremely useful for the treatment of disease states, as can a number of chemical agents that act on GPCRs.
The Mas receptor (Mas, or alternatively Masl) is a class I rhodopsin-like GPCR. In mammals,
Mas is expressed predominantly in brain and testis with moderate levels of expression in heart and kidney, and lower expression in several other tissues (Alenina N., et al., Exp Physiol 93:528-537 (2008); Metzger R., et al, FEBS Lett 357:27-32 (1995); Villar A. J. and Pedersen R. A., Nat Genet 8:373-379 (1994); Young D., et al, Cell 45:711-719 (1986)). The Mas proto-oncogene encodes a GPCR protein (Mas) and was first detected in vivo by its tumorigenic properties which originate from rearrangement of its 5' flanking region (Young, D., et al., Cell 45 :711-719 (1996)). Subsequent studies have indicated that the tumorigenic properties of Mas appear to be negligible.
Although it was suggested in early studies that Mas is an angiotensin II (Ang II) receptor (Jackson T. R., et al. Nature 335: 437-440, (1988)), later studies demonstrated that Ang II-mediated intracellular signaling in Mas-transfected cells was only observed in cells endogenously expressing the ATi receptor (Ambroz C, et al. Biochim Biophys Acta 1133: 107-111, (1991)). Dong et al. reported that the Mas receptor did not bind to angiotensins I and II, but did bind to a peptide called NPFF, although fairly weakly (EC50 about 400 nM) (Dong, et al , Cell 106:619-632 (2001)). Currently there is still uncertainty about the endogenous ligand for the Mas receptor although the peptide angiotensin^ 1- 7) (Ang-(l-7)), which is derived from Ang II, has recently been described as the endogenous agonist of Mas (Santos R. A., et al. Proc Natl Acad Sci U S A 100: 8258-8263, 2003).
The present invention describes, inter alia, the proximal signaling pathways activated by Mas and the role of the Mas receptor in cardiac ischemia/reperfusion (I/R) injury in vivo. In addition, described herein include small molecule, non-peptide modulators of the Mas-Gq-phospholipase C (PLC) signaling pathway. These results demonstrate that the Mas receptor is a Gq-coupled receptor and that a reduction of Mas signaling activity, either by genetic alteration or with the pharmacological use of Mas inverse agonists, is cardioprotective during ischemia/reperfusion injury. These results further indicate that therapies aimed at reducing Mas receptor Gq-PLC signaling, such as the use of inverse agonists and particularly those inverse agonists described herein, represent a promising new strategy for treatment of ischemia/reperfusion injury, such as in organs where the Mas receptor is expressed, for example, heart, kidney, brain, and testis.
Citation of any reference throughout this application is not to be construed as an admission that such reference is prior art to the present application.
SUMMARY OF THE INVENTION
The present invention is directed to, inter alia, certain urea derivatives and pharmaceutically acceptable salts, solvates, and hydrates thereof, which are useful, for example, in methods of treatment or alleviation of ischemia-related disorders of the heart, brain, kidney, and reproductive system.
While the literature cited herein may indicate that an agonist of the Mas receptor would be cardioprotective and decrease blood pressure, applicants have unexpectedly identified compounds that can act as inverse agonists of the Mas receptor which are cardioprotective and do not raise blood pressure.
One aspect of the present invention is directed to compounds, as described herein, and pharmaceutically acceptable salts, solvates, and hydrates thereof, which bind to and modulate the activity of a GPCR, referred to herein as Mas, and uses related thereto.
One aspect of the present invention pertains to compounds selected from compounds of Formula (la) and pharm ereof:
(la)
wherein:
(A) R1 is selected from: Ci-C6 alkyl, C3-C7 cycloalkyl, C4-Ci3 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl; each optionally substituted with one or more substituents selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, C1-C6 alkylsulfonyl, amino, carboxamide, cyano, C2- C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H and C1-C6 alkyl, wherein said C1-C6 alkyl is optionally substituted with one or more hydroxyl substituents;
provided that:
(i) when R1 and R2 are both C1-C6 alkyl then at least one C1-C6 alkyl group is substituted with one or more substituents; and
(ii) R1 is a group other than: 2-(ieri-butoxy)-2-oxoethyl, 3-(ieri-butoxy)-3-oxopropyl, A-(tert- butoxy)-4-oxobutyl, or 1 -(ieri-butoxy)-4-methyl- 1 -oxopentan-2-yl;
or
(B) R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl, C C6 haloalkyl, and hydroxy-Ci-C6-alkyl;
provided that when said heterocyclyl is substituted with said hydroxy-Ci-C6-alkyl then R5 is
C6 alkyl;
and
R3 is selected from: H and halogen;
R4 is halogen;
R5 is selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxyl, and halogen; and
R6 is selected from: H and C1-C6 alkyl.
One aspect of the present invention pertains to compounds wherein R5 is selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, and halogen.
One aspect of the present invention pertains to a crystalline form of (S)-N-(4-chloro-2-(4- (3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide .
One aspect of the present invention pertains to anhydrous (lS')-iV-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide .
One aspect of the present invention pertains to a crystalline form of anhydrous (S)-N-(4-chloio-
2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide .
One aspect of the present invention pertains to a crystalline form of anhydrous (S)-N-(4-chloio- 2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide, having an X-ray powder diffraction pattern comprising peaks, in terms of 2Θ, at about 9.36 °.
One aspect of the present invention pertains to compositions comprising a compound of the present invention.
One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention and a pharmaceutically acceptable carrier.
One aspect of the present invention pertains to compounds of Formula (la), and
pharmaceutically acceptable salts, solvates, and hydrates, thereof that are useful, inter alia, in methods of treatment or alleviation of diseases or disorders of the heart, brain, kidney, and reproductive system.
One aspect of the present invention pertains to compositions comprising a compound of the present invention or a crystalline form of the present invention.
One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit, each comprising a compound of the present invention or a crystalline form of the present invention.
One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention or a crystalline form of the present invention, and a
pharmaceutically acceptable carrier.
One aspect of the present invention pertains to methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention or a crystalline form of the present invention, and a pharmaceutically acceptable carrier.
One aspect of the present invention pertains to compositions comprising a compound of the present invention or a crystalline form of the present invention, and a second pharmaceutical agent.
One aspect of the present invention pertains to methods for preparing a composition comprising the step of admixing a compound of the present invention or a crystalline form of the present invention, and a second pharmaceutical agent.
One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a dosage form, a combined preparation, a twin pack, and a kit; comprising a compound of the present invention or a crystalline form of the present invention and a second pharmaceutical agent.
One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention or a crystalline form of the present invention, a second
pharmaceutical agent, and a pharmaceutically acceptable carrier.
One aspect of the present invention pertains to methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention or a crystalline form of the present invention, a second pharmaceutical agent, and a pharmaceutically acceptable carrier.
One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising administering to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention.
One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising prescribing to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention.
One aspect of the present invention pertains to the use of a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of a Mas receptor-mediated disorder.
One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising administering to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present
invention; or a pharmaceutical composition of the present invention; each in combination with a therapeutically effective amount of a second pharmaceutical agent.
One aspect of the present invention pertains to methods for the treatment of a Mas receptor- mediated disorder in an individual, comprising prescribing to the individual in need thereof, a therapeutically effective amount of a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a therapeutically effective amount of a second pharmaceutical agent.
One aspect of the present invention pertains to the use of a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; each in combination with a second pharmaceutical agent in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
One aspect of the present invention pertains to the use of a pharmaceutical agent in combination with a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a second pharmaceutical agent for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; each in combination with a second pharmaceutical agent for use in a method of treatment of a Mas receptor- mediated disorder.
One aspect of the present invention pertains to a pharmaceutical agent in combination with a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to a pharmaceutical agent in combination with a compound of the present invention; a crystalline form of the present invention; a composition of the present invention; a pharmaceutical product of the present invention; or a pharmaceutical composition of the present invention; for use in a method of treatment of a Mas receptor-mediated disorder.
One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising a compound of the present invention; a crystalline form of the present invention; or a composition of the present
invention; in combination with a second pharmaceutical agent; for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising a compound of the present invention; a crystalline form of the present invention; or a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method of treatment of a Mas receptor-mediated disorder.
One aspect of the present invention pertains to a composition of the present invention; methods of the present invention; a pharmaceutical product of the present invention; a pharmaceutical composition of the present invention; a use of the present invention; a compound of the present invention; a crystalline form of the present invention; or a pharmaceutical agent of the present invention; wherein the pharmaceutical agent or the second pharmaceutical agent is selected from: an ACE inhibitor, a beta blocker, a calcium channel blocker, a diuretic, a nitrate, a statin, aspirin, an antiplatelet, adenosine, an endothelin receptor antagonist, and a PDE5 inhibitor.
These and other aspects of the invention disclosed herein will be set forth in greater detail as the patent disclosure proceeds.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 to 3 show a general synthetic scheme for preparing intermediates useful for preparing compounds of the present invention.
Figure 4 shows a general synthetic scheme for preparing of compounds of Formula (la). Figure 5 shows a general synthetic scheme for preparing of compounds of Formula (la). Figure 6 shows the dose dependent effect of Compound 17 on myocardial infarction size in rats subjected to coronary artery ligation and reperfusion.
Figure 7 shows the effect of Compound 17 on mean arterial pressure (MAP) measured at drug steady state (25 min after starting dosing).
Figure 8 shows a powder X-ray diffraction pattern (PXRD) for a sample containing
Compound 17, Form 1.
Figure 9 shows a differential scanning calorimetry (DSC) thermogram for or a sample containing Compound 17, Form 1 , and a thermogravimetric analysis (TGA) thermogram of a sample containing Compound 17, Form 1.
Figure 10 shows a dynamic moisture sorption (DMS) profile for a sample containing
Compound 17, Form 1.
Figure 11 shows a powder X-ray diffraction pattern (PXRD) for a sample containing
Compound 17 hydrochloride salt solvate, Form 1.
Figure 12 shows a differential scanning calorimetry (DSC) thermogram for a sample containing Compound 17 hydrochloride salt solvate, Form 1, and a thermogravimetric analysis (TGA) thermogram of a sample containing Compound 17 hydrochloride salt solvate, Form 1.
Figure 13 shows Mas mRNA expression analysis by RT-PCR in rat heart. cDNA from adult male Sprague-Dawley rat atria, right ventricle and left ventricle was tested for Mas receptor mRNA expression. GAPDH expression in the same samples was used as an internal control for cDNA quality. Results are representative of three independent experiments.
Figure 14 shows cellular expression of Mas in coronary arteries. Adult rat ventricular cryosections were co-stained with antibodies for Mas and SM-actin (a marker for smooth muscle cells) or Mas and vWF (a marker for endothelial cells). Mas protein expression overlapped with markers for smooth muscle cells and endothelial cells indicating expression in both smooth muscle and endothelial cells in coronary arteries.
Figure 15 shows Mas mRNA expression analysis by RT-PCR in human cardiovascular cDNA panel. cDNA prepared from human cardiovascular and non-cardiovascular (placenta) tissues was analyzed for Mas mRNA expression. Actin mRNA expression was measured and used as a control for cDNA quality. Results are representative of three independent experiments.
Figure 16 shows immunohistochemical staining of Mas in human left ventricular sections. Human myocardial cryosections were stained with either Mas antibody or Mas antibody preabsorbed with blocking peptide. Panel A shows positive staining for Mas in cardiomyocytes. Panel B shows positive staining for Mas in coronary arteries (black arrow). Preincubation of Mas antibody with the blocking peptide demonstrates the level of non-specific staining in human myocardial sections. The dark staining indicates hematoxylin counterstaining of cell nuclei.
Figure 17 shows constitutive Mas Gq activity for human and rat receptor constructs. Human and rat Mas receptors were transiently transfected into HEK293 cells and Gq signaling was measured using an HTRF IP1 assay performed 48 h post transfection. HEK293 cells transfected with pHM6 empty vector (vector) served as a control, n = 14 per group; ***p < 0.001 vs vector control.
Figure 18 shows a Mas agonist and an inverse agonist that modulate Gq in HEK293 cells expressing human Mas. Increasing concentrations of Mas agonist (AR234960) and inverse agonist
(AR244555) (Zhang, T., et. al., Am J Physiol Heart Circ Physiol 302:H299-H311, (2012), incorporated herein by reference in its entirity) were incubated with HEK293 cells stably expressing human Mas for 4 h, then Gq signaling was measured using an HTRF IP1 assay. Measurements were made in triplicate.
Figure 19 shows a Mas agonist and an inverse agonist that modulate Gq in HEK293 cells expressing rat Mas. Mas agonist (AR234960) and inverse agonist (AR244555) were incubated with HEK293 cells stably expressing rat Mas for 4 h, then Gq signaling was measured using HTRF IP1 assays. Measurements were made in triplicate.
Figure 20 shows the effect of the Mas agonist (AR234960) on intracellular Ca2+ Levels. Fluorometric assays were used to monitor Ca2+ levels in HEK293 cells stably expressing human Mas receptor. Changes in intracellular Ca2+ were monitored before and after addition of the Mas agonist AR234960 at indicated concentrations. Measurements were made in triplicate.
Figure 21 shows Mas agonist-mediated decrease in coronary flow is Mas receptor dependent. Coronary flow was measured in isolated perfused mouse hearts. Mas agonist AR234960 (1 μΜ)
decreased coronary flow significantly in wild type (Mas+ +) mice but not in hearts from Mas knockout (Mas ' ) mice, n = 4-6 mice per group; *p < 0.05 vs. Mas+ +/vehicle.
Figure 22 shows the effects of Mas compounds on rat coronary flow. Coronary flow was measured in isolated perfused rat hearts. Coronary flow was significantly increased upon stimulation with Mas inverse agonist AR244555 (5 μΜ) and significantly decreased with Mas agonist AR234960 (1 μΜ). Pretreatment with the Mas inverse agonist AR244555 (5 μΜ) or the PLC inhibitor U-73122 (0.5 μΜ) prevented the decrease in coronary flow induced by AR234960. Changes in coronary flow induced by AR234960 with the pretreatment of AR244555 or U-73122 were calculated as percentage of the coronary flow at 10 min after AR234960 treatment relative to the coronary flow measured immediately prior to addition of AR234960. In endothelium denuded hearts (Endo (-)), the AR234960- mediated decrease in coronary flow was preserved, n = 4-6 hearts per group; ***p < 0.001 vs. vehicle.
Figure 23 shows the effects of Mas compounds on rat coronary flow after ischemia and reperfusion. Coronary flow was measured continuously in isolated perfused rat hearts that were subjected to 30 min of global ischemia followed by 30 min of reperfusion. Mas agonist (1 μΜ
AR234960), Mas inverse agonist (5 μΜ AR244555) or vehicle (0.01 % DMSO) was added to the perfusate during reperfusion. Changes in coronary flow were analyzed at 10 min intervals and are represented as a percentage of baseline flow determined 10 min prior to ischemia, n = 6-7 rats per group; *p < 0.05 vs. vehicle.
Figure 24 shows ablation of Mas receptor in mice is cardioprotective during
ischemia/reperfusion injury (I/R injury). Regional ischemia/reperfusion injury was produced in mice by ligation of the left anterior descending coronary artery for 30 min followed by release of the ligation (reperfusion). After 2 h of reperfusion, hearts were removed and infarct size was measured as a percentage of the area at risk (AAR), n = 7-9 mice per group; ** p < 0.01 vs. WT.
Figure 25 shows the inverse agonist of the Mas receptor (AR244555) was cardioprotective in rats when administered prior to ischemia or immediately before reperfusion. Regional
ischemia/reperfusion injury was produced in rats by ligation of the left anterior descending coronary artery for 30 min followed by reperfusion for 2 h. Vehicle (20% HPBCD, i.v.) or the Mas inverse agonist (AR244555, 10 mg/kg i.v.) was administered 10 min before ligation (pre-ischemia) or 3 min before reperfusion (pre -reperfusion). Infarct size was measured as a percentage of the area at risk (AAR); n = 8 rats per group; ***p < .001 vs. vehicle.
Figure 26 shows expression of Mas receptor following lipopolysaccharide (LPS) stimulation.
Figure 27 shows expression of mTNFa following LPS stimulation in mice.
Figure 28 shows suppression of TNFa induction with an inverse agonist of the Mas receptor (Compound A, see Compound 170 in PCT/US2012/063793) in mice.
Figure 29 shows that a Mas receptor inverse agonist (AR305352) suppresses paw swelling in the Carrageenan-Induced Inflammatory Paw Swelling Model.
Figure 30 shows the protocol for the left kidney artery ischemia reperfusion injury model used in Example 9.
Figure 31 shows Compound A, a Mas receptor inverse agonist, improves kidney function compared to vehicle treatment as measured by blood creatinine.
Figure 32 shows Compound A, a Mas receptor inverse agonist, improves kidney function compared to vehicle treatment as measured by blood urea nitrogen (BUN).
Figure 33 shows the protocol for the transient cerebral ischemia/stroke rat model used in
Example 10.
Figure 34 shows Compound A, a Mas receptor inverse agonist, reduced brain damage associated with transient ischemic injury in the rat. DETAILED DESCRIPTION OF THE INVENTION
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment.
Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. Accordingly, all combinations of uses and medical indications described herein specifically embraced by the present invention just as if each and every subcombination of uses and medical indications was individually and explicitly recited herein.
DEFINITIONS
For clarity and consistency, the following definitions will be used throughout this patent document.
The term "agonist" as used herein refers to a moiety that interacts with and activates a G- protein-coupled receptor, and can thereby initiate a physiological or pharmacological response characteristic of that receptor. For example, an agonist may activate an intracellular response upon binding to a receptor, or enhance GTP binding to a membrane.
The term "antagonist" as used herein refers to a moiety that competitively binds to the receptor at the same site as an agonist (for example, the endogenous ligand), but which does not activate the intracellular response initiated by the active form of the receptor and can thereby inhibit the intracellular responses by an agonist or partial agonist. An antagonist does not diminish the baseline intracellular response in the absence of an agonist or partial agonist.
The term "composition" refers to a compound of the present invention, including but not limited to, salts, solvates, and hydrates of a compound of the present invention, in combination with at least one additional component.
The term "Mas" as used herein includes the human amino acid sequences found in GeneBank accession number CR542261, and naturally-occurring allelic variants thereof, and mammalian orthologs thereof. A preferred human Mas for use in screening and testing of the compounds of the invention is provided by the nucleotide sequence and the corresponding amino acid sequence found in GeneBank accession number CR542261.
The term "in need of treatment" and the term "in need thereof when referring to treatment are used interchangeably and refer to a judgment made by a caregiver (e.g. physician, nurse, nurse practitioner, etc. in the case of humans; veterinarian in the case of animals, including non-human mammals) that an individual or animal requires or will benefit from treatment. This judgment is made based on a variety of factors that are in the realm of a caregiver's expertise, but that includes the knowledge that the individual or animal is ill, or will become ill, as the result of a disease, condition or disorder that is treatable by the compounds of the invention. Accordingly, the compounds of the invention can be used in a protective or preventive manner; or compounds of the invention can be used to alleviate, inhibit or ameliorate the disease, condition or disorder.
The term "individual" refers to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans.
The term "inverse agonist" refers to a moiety that binds to the endogenous form of the receptor or to the constitutively activated form of the receptor and which inhibits the baseline intracellular response initiated by the active form of the receptor below the normal base level of activity which is observed in the absence of an agonist or partial agonist, or decreases GTP binding to a membrane.
Preferably, the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, more preferably by at least 50% and most preferably by at least 75%, as compared with the baseline response in the absence of the inverse agonist.
The term "modulate or modulating" refers to an increase or decrease in the amount, quality, response or effect of a particular activity, function or molecule.
The term "partial agonist" refers to a moiety that by virtue of binding to a GPCR activates the GPCR so as to elicit an intracellular response mediated by the GPCR, albeit to a lesser extent or degree than does a full agonist.
The term "pharmaceutical composition" refers to a composition comprising at least one active ingredient, such as a compound of Formula (la) or a salt, solvate, or hydrate thereof, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, without limitation, a human). Those of ordinary skill in the art will understand and appreciate the techniques appropriate for determining whether an active ingredient has a desired efficacious outcome based upon the needs of the artisan.
The term "therapeutically effective amount" refers to the amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal, individual or human that is being sought by a researcher, veterinarian, medical doctor or other clinician or caregiver or by an individual, which includes one or more of the following:
(1) preventing the disease, for example, preventing a disease, condition or disorder in an individual that may be predisposed to the disease, condition or disorder but does not yet experience or display the pathology or symptomatology of the disease;
(2) inhibiting the disease, for example, inhibiting a disease, condition or disorder in an individual that is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., arresting further development of the pathology and/or symptomatology); and
(3) ameliorating the disease, for example, ameliorating a disease, condition or disorder in an individual that is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology and/or symptomatology).
CHEMICAL GROUP, MOIETY OR RADICAL
The term "Ci-C6 alkoxy" refers to a radical comprising a Ci-C6 alkyl group attached to an oxygen atom, wherein Ci-C6 alkyl has the same definition as found herein. Some embodiments contain 1 to 5 carbons. Some embodiments contain 1 to 4 carbons. Some embodiments contain 1 to 3 carbons. Some embodiments contain 1 or 2 carbons. Examples include, but are not limited to methoxy, ethoxy, M-propoxy, isopropoxy, w-butoxy, ieri-butoxy, isobutoxy, and sec-butoxy.
The term "amino" refers to the radical -NH2.
The term "Ci-C6 alkoxycarbonyl" refers to a radical comprising a Ci-C6 alkoxy group attached to a carbonyl, wherein Ci-C6 alkoxy has the same definition as found herein. Examples include, but are not limited to, methoxycarbonyl [i.e., -C02CH3], ethoxycarbonyl, propoxycarbonyl,
isopropoxycarbonyl, w-butoxycarbonyl, isobutoxycarbonyl, and feri-butoxycarbonyl.
The term "Ci-C6 alkyl" refers to a straight or branched carbon radical containing 1 to 6 carbons. Some embodiments contain 1 to 5 carbons. Some embodiments contain 1 to 4 carbons. Some embodiments contain 1 to 3 carbons. Some embodiments contain 1 or 2 carbons. Examples of an alkyl group include, but are not limited to, methyl, ethyl, w-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, i-pentyl, neopentyl, 1-methylbutyl [i.e. , -CH(CH3)CH2CH2CH3], 2- methylbutyl [i.e., -CH2CH(CH3)CH2CH3], and n-hexyl.
The term "Ci-C6 alkylsulfonyl" refers to a radical comprising a Ci-C6 alkyl group attached to the sulfur of a sulfonyl group, wherein Ci-C6 alkyl has the same definition as described herein.
Examples include, but are not limited to, methylsulfonyl, ethylsulfonyl, w-propylsulfonyl,
isopropylsulfonyl, w-butylsulfonyl, sec-butylsulfonyl, isobutylsulfonyl, and feri-butylsulfonyl.
The term "Ci-C6 haloalkyl" refers to a radical comprising a Ci-C6 alkyl group substituted with one or more halogens, wherein Ci-C6 alkyl has the same definition as found herein. The Ci-C6 haloalkyl may be fully substituted in which case it can be represented by the formula CqL2q+1, wherein L is a halogen and "q" is 1, 2, 3, 4, 5, or 6. When more than one halogen is present then they may be the same or different and selected from: fluorine, chlorine, bromine, and iodine. In some embodiments, haloalkyl contains 1 to 5 carbons. In some embodiments, haloalkyl contains 1 to 4 carbons. In some
embodiments, haloalkyl contains 1 to 3 carbons. In some embodiments, haloalkyl contains 1 or 2 carbons. Examples of haloalkyl groups include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, and 2-fluoropropan-2-yl.
The term "C2-C8 dialkylamino" refers to a radical comprising two C1-C4 alkyl groups, that are the same or different, attached to an amino group, wherein C1-C4 alkyl and amino have the same definitions as described herein.
The term "C3-C7 cycloalkyl" refers to a saturated ring radical containing 3 to 7 carbons. Some embodiments contain 3 to 4 carbons. Some embodiments contain 3 to 5 carbons. Some embodiments contain 4 to 6 carbons. Some embodiments contain 5 to 6 carbons. Examples include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.
The term "C4-C 13 cycloalkylalkyl" refers to a radical comprising a C3-C7 cycloalkyl group attached to a C1-C6 alkyl group, wherein the C3-C7 cycloalkyl and C1-C6 alkyl groups have the same definitions as described herein. Examples include, but are not limited to cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, and cyclopropylethyl.
The term "carboxamide" refers to the group -CONH2.
The term "carboxyl" refers to the group -C02H.
The term "carboxy-Ci-C6-alkyl" refers to a radical comprising a carboxyl group attached to a C1-C6 alkyl group, wherein the carboxyl and C1-C6 alkyl groups have the same definitions as described herein. Examples include, but are not limited to carboxymethyl [i.e., -CH2C02H], 2-carboxyethyl [i.e., -CH2CH2C02H], and 1-carboxyethyl [i.e., -CH(CH3)C02H].
The term "cyano" refers to the group -CN.
The term "halogen" refers to a fluoro, chloro, bromo, or iodo group.
The term "heteroaryl" refers to a ring system containing 5 to 10 ring atoms, that may contain a single ring or two fused rings, and wherein at least one ring is aromatic and at least one ring atom of the aromatic ring is a heteroatom selected from, for example: O, S and N, wherein N is optionally substituted with H, C1-C4 acyl, C1-C4 alkyl, or O (i.e., forming an iV-oxide) and S is optionally substituted with one or two oxygens. In some embodiments, the aromatic ring contains one heteroatom. In some embodiments, the aromatic ring contains two heteroatoms. In some embodiments, the aromatic ring contains three heteroatoms. Some embodiments are directed to heteroaryl rings that include, but are not limited to, furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, oxadiazolyl, triazolyl, tetrazolyl, thiadiazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Some embodiments are directed to 5-membered heteroaryl rings. Examples of a 5-membered heteroaryl ring include, but are not limited to, furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, oxadiazolyl, triazolyl, tetrazolyl, and thiadiazolyl. Some embodiments are directed to 6-membered heteroaryl rings. Examples of a 6- membered heteroaryl ring include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl.
The term "heterocyclyl" refers to a non-aromatic ring radical containing 3 to 10 ring atoms, wherein one, two or three ring atoms are heteroatoms selected independently from, for example: O, S, and N, wherein S is optionally substituted with one or two oxo groups. It is understood that a ring carbon of the heterocyclyl group can not be substituted with an oxo group. Examples of a heterocyclyl
group include, but are not limited to, aziridinyl, azetidinyl, piperidinyl, morpholinyl, piperazinyl, pyrrolidinyl, [l,3]-dioxolanyl, thiomorpholinyl, [l,4]oxazepanyl, 1, 1-dioxothiomorpholinyl, azepanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydrothiopyranyl, l-oxo-hexahydro-^4-thiopyranyl, 1, 1- dioxo-hexahydro- ^6-thiopyranyl, and azabicyclo[3.2.1]octanyl.
The term "heterocyclyl-Ci-C6-alkyl" refers to a radical comprising a heterocyclyl group attached to a C1-C6 alkyl radical, wherein heterocyclyl and C1-C6 alkyl have the same definitions as described herein. Examples of a heterocyclyl-Ci-C6-alkyl group include, but are not limited to, aziridinylmethyl, azetidinylmethyl, piperidinylmethyl, morpholinylmethyl, piperazinylmethyl, pyrrolidinylmethyl, [l,3]-dioxolanylmethyl, thiomorpholinylmethyl, [l ,4]oxazepanylmethyl, 1, 1- dioxothiomorpholinylmethyl, azepanylmethyl, tetrahydrofuranylmethyl, tetrahydropyranylmethyl, tetrahydrothiopyranylmethyl, 1 -oxo-hexahydro- 1 λ4-thiopyranylmethyl, 1 , 1 -dioxo-hexahydro- 1 λ6- thiopyranylmethyl, and azabicyclo[3.2.1]octanylmethyl.
The term "hydroxy-Ci-C6-alkyl" refers to a radical comprising a hydroxyl group attached to a C1-C6 alkyl radical, wherein hydroxyl and Ci-C6 alkyl have the same definitions as described herein. Examples include, but are not limited to hydroxymethyl, 2-hydroxyethyl, and 1-hydroxyethyl.
The term "hydroxyl" refers to the radical -OH.
The term "phosphonooxy" refers to the radical -OP03H2.
The term "sulfo" refers to the radical -S03H.
COMPOUNDS
One aspect of the present invention encompasses, inter alia, certain urea derivatives selected from compounds of Formul vates, and hydrates thereof:
(la)
wherein R1, R2, R3, R4, R5, and R6 have the same definitions as described herein. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the chemical groups represented by the variables (e.g., R1, R2, R3, R4, R5, and R6) contained within the generic chemical formulae described herein, for example, Formulae (la), (Ic), (Ie), (Ig), and (Ii), are specifically embraced by the present invention just as if each and every combination was individually and explicitly recited, to the extent that such combinations embrace compounds that result in stable compounds (i.e., compounds that can be isolated, characterized and
tested for biological activity). In addition, all subcombinations of the chemical groups listed in the embodiments describing such variables, as well as all subcombinations of uses and medical indications described herein, are also specifically embraced by the present invention just as if each and every subcombination of chemical groups and subcombination of uses and medical indications was individually and explicitly recited herein.
As used herein, "substituted" indicates that at least one hydrogen atom of the chemical group is replaced by a non-hydrogen substituent or group; the non-hydrogen substituent or group can be monovalent or divalent. When the substituent or group is divalent, then it is understood that this group is further substituted with another substituent or group. When a chemical group herein is "substituted" it may have up to the full valance of substitution; for example, a methyl group can be substituted by 1 , 2, or 3 substituents, a methylene group can be substituted by 1 or 2 substituents, a phenyl group can be substituted by 1, 2, 3, 4, or 5 substituents, a naphthyl group can be substituted by 1, 2, 3, 4, 5, 6, or 7 substituents, and the like. Likewise, "substituted with one or more substituents" refers to the substitution of a group with one substituent up to the total number of substituents physically allowed by the group. Further, when a group is substituted with more than one group they can be identical or they can be different.
Compounds of the invention can also include tautomeric forms, such as keto-enol tautomers and the like. Tautomeric forms can be in equilibrium or sterically locked into one form by appropriate substitution. It is understood that the various tautomeric forms are within the scope of the compounds of the present invention.
It is understood and appreciated that compounds of Formula (la) and formulae related thereto may have one or more chiral centers and therefore can exist as enantiomers and/or diastereoisomers. The invention is understood to extend to and embrace all such enantiomers, diastereoisomers and mixtures thereof, including but not limited to racemates. It is understood that compounds of Formula (la) and formulae used throughout this disclosure represent all individual enantiomers and mixtures thereof, unless stated or shown otherwise.
It is understood and appreciated that certain compounds of Formula (la) and formulae related thereto exist as meso isomers. Such meso isomers may be referred to as cis and trans isomers. The cis meso isomers of compounds of Formula (la) are named herein using the designation (Is, 3s) and the trans meso isomers of compounds of Formula (la) are named herein using the designation (lr,3r) as shown below:
(1 s,3s)- or cis- mesoisomers (1 r,3r)- or trans- mesoisomers
One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (ls,3s).
One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (l r,3r).
In addition, the cis meso isomers of compounds of Formula (la) are named herein using the designation (ls,4.y) and the trans meso isomers of compounds of Formula (la) are named herein using the designation (l r,4r) as shown below:
(1 s,4s)- or cis- mesoisomers (1 r,4r)- or trans- mesoisomers
One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (li,4i).
One aspect of the present invention pertains to compounds of the present invention wherein the mesoisomer stereochemistry is (l r,4r).
It is understood that R1 is a group other than a group selected from the following groups:
2- (feri-butoxy)-2-oxoethyl (i.e., -CH2C02-i-butyl),
3- (ieri-butoxy)-3-oxopropyl (i.e., -CH2CH2C02-i-butyl),
4- (feri-butoxy)-4-oxobutyl (i.e., -CH2CH2CH2C02-i-butyl), and
l-(ieri-butoxy)-4-methyl- l-oxopentan-2-yl (i.e., -CH(CH2CH(CH3)2)C02-i-butyl).
The Group R1
In some embodiments, R1 is selected from: C1-C6 alkyl, C3-C7 cycloalkyl, C4-C13
cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo.
In some embodiments, R1 is selected from: C1-C6 alkyl, C3-C7 cycloalkyl, C4-C13
cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo.
In some embodiments, R1 is selected from: C1-C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: C1-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl.
In some embodiments, R1 is selected from: ethyl, methyl, n-propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, w-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, C1-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6- alkyl, phosphonooxy, and sulfo.
In some embodiments, R1 is selected from: ethyl, methyl, n-propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo.
In some embodiments, R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: C1-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl.
In some embodiments, R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, w-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, pyrrolidinyl, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy.
In some embodiments, R1 is selected from: ethyl, methyl, w -propyl, piperidinyl, cyclohexyl,
(cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy.
In some embodiments, R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, and pyrrolidinyl.
In some embodiments, R1 is selected from: 2-aminoethyl, 2-hydroxyethyl,
(methylsulfonyl)methyl, 3-(l/f-imidazol- l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, pyrrolidin-2-ylmethyl, l-methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2- (dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (l-hydroxycyclohexyl)methyl, 1- hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, l,3-dihydroxybutan-2-yl, 2-(2- (hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5 -methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1-
(hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1- hydroxypropan-2-yl, l,3-dihydroxy-2-methylpropan-2-yl, 3-hydroxypropyl, 1- (hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4-hydroxybutyl, 2-sulfoethyl, 3- hydroxy-2,2-dimethylpropyl, (2-hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3- (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, (l/f-tetrazol-5-yl)methyl, l,3-dihydroxypropan-2-yl, l-amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2- (phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl.
In some embodiments, R1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, l-methylpiperidin-4- yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (1- hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3-dihydroxybutan-2- yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4- yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1- (hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1- hydroxypropan-2-yl, l,3-dihydroxy-2-methylpropan-2-yl, 3-hydroxypropyl, 1- (hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4-hydroxybutyl, 2-sulfoethyl, 3- hydroxy-2,2-dimethylpropyl, (2-hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3- (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, ( l/f-tetrazol-5-yl)methyl, l,3-dihydroxypropan-2-yl, l-amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2- (phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl.
In some embodiments, R1 is selected from: 2-aminoethyl, 2-hydroxyethyl,
(methylsulfonyl)methyl, 3-(l/f-imidazol-l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl.
[n some embodiments, R1 is l-(hydroxymethyl)cyclopropyl.
[n some embodiments, R1 is 2-hydroxypyrimidin-4-yl.
[n some embodiments, R1 is l-hydroxy-3-methylbutan-2-yl.
[n some embodiments, R1 is l-hydroxypropan-2-yl.
[n some embodiments, R1 is 1 ,3-dihydroxy-2-methylpropan-2-yl.
[n some embodiments, R1 is 3-hydroxypropyl.
[n some embodiments, R1 is l-(hydroxymethyl)cyclopentyl.
[n some embodiments, R1 is 1 -hydroxy-3-methylpentan-2-yl.
[n some embodiments, R1 is 4-hydroxybutyl.
[n some embodiments, R1 is 2-sulfoethyl.
[n some embodiments, R1 is 3-hydroxy-2,2-dimethylpropyl.
[n some embodiments, R1 is (2-hydroxycyclohexyl)methyl.
[n some embodiments, R1 is (4-(hydroxymethyl)cyclohexyl)methyl
[n some embodiments, R1 is 3-(hydroxymethyl)cyclobutyl.
[n some embodiments, R1 is 4-(hydroxymethyl)cyclohexyl.
[n some embodiments, R1 is 5-hydroxypentyl.
[n some embodiments, R1 is (l/f-tetrazol-5-yl)methyl.
[n some embodiments, R1 is l,3-dihydroxypropan-2-yl.
[n some embodiments, R1 is 1 -amino -3 -hydroxy- 1 -oxopropan-2-yl.
[n some embodiments, R1 is 2-(phosphonooxy)ethyl.
[n some embodiments, R1 is 2-(phosphonooxy)propyl.
[n some embodiments, R1 is l-(phosphonooxy)propan-2-yl. The Group R2
In some embodiments, R2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents.
In some embodiments, R2 is selected from: H and Ci-C6 alkyl.
In some embodiments, R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments, R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments, R2 is selected from: H and methyl.
In some embodiments, R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments, R2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and t- butyl.
In some embodiments, R2 is H.
In some embodiments, R2 is ethyl.
In some embodiments, R2 is methyl.
In some embodiments, R2 is 2-hydroxyethyl.
In some embodiments, R2 is isopropyl.
In some embodiments, R2 is i-butyl. The Groups R1 and R2
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy- Ci-C6-alkyl, Ci-C6 haloalkyl, and hydroxy-Ci-C6-alkyl; provided that when said heterocyclyl is substituted with said hydroxy-Ci-C6-alkyl then R5 is C1-C6 alkyl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl, Ci-C6 haloalkyl, and hydroxy-Ci-C6- alkyl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: trifluoromethyl, carboxymethyl, hydroxymethyl, and chloromethyl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: 4-(trifluoromethyl)piperidin-l-yl, 3- (carboxymethyl)pyrrolidin-l-yl, 4-(hydroxymethyl)piperidin-l-yl, and 4-(chloromethyl)piperidin-l-yl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form 4-(trifluoromethyl)piperidin-l-yl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form 3-(carboxymethyl)pyrrolidin-l-yl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form 4-(hydroxymethyl)piperidin-l-yl.
In some embodiments, R1 and R2 together with the nitrogen atom to which they are both bonded form 4-(chloromethyl)piperidin-l-yl. The Group R3
In some embodiments, R3 is H and halogen.
In some embodiments, R3 is H.
In some embodiments, R3 is halogen.
In some embodiments, R3 is fluorine.
The Group R4
In some embodiments, R4 is halogen.
In some embodiments, R4 is fluorine.
The Group R5
In some embodiments, R5 is selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxyl, and halogen.
In some embodiments, R5 is selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, and halogen.
In some embodiments, R5 is Ci-C6 alkoxycarbonyl.
In some embodiments, R5 is ethoxycarbonyl.
In some embodiments, R5 is Ci-C6 alkyl
In some embodiments, R5 is feri-butyl.
In some embodiments, R5 is carboxyl.
In some embodiments, R5 is a group other than carboxyl.
In some embodiments, R5 is halogen.
In some embodiments, R5 is chlorine.
The Group R6
In some embodiments, R6 is H and Ci-C6 alkyl.
In some embodiments, R6 is H.
In some embodiments, R6 is Ci-C6 alkyl.
In some embodiments, R6 is methyl.
Certain Combinations
In some embodiments: R1 is selected from: Ci-C6 alkyl, C3-C7 cycloalkyl, C4-Ci3
cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents.
In some embodiments: R1 is selected from: Ci-C6 alkyl, C3-C7 cycloalkyl, C4-Ci3
cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H and C1-C6 alkyl, wherein said C1-C6 alkyl is optionally substituted with one or more hydroxyl substituents.
In some embodiments: R1 is selected from: C1-C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
R2 is selected from: H and C1-C6 alkyl.
In some embodiments: R1 is selected from: ethyl, methyl, n -propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, n-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6- alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments: R1 is selected from: ethyl, methyl, n -propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments: R1 is selected from: ethyl, methyl, n -propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
R2 is selected from: H and methyl.
In some embodiments: R1 is selected from: ethyl, methyl, n -propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, n-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, pyrrolidinyl, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy; and
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments: R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy; and
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
In some embodiments: R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, and pyrrolidinyl; and
R2 is selected from: H and methyl.
In some embodiments: R1 is selected from: 2-aminoethyl, 2-hydroxyethyl,
(methylsulfonyl)methyl, 3-(l/f-imidazol- l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, pyrrolidin-2-ylmethyl, l-methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2- (dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (l-hydroxycyclohexyl)methyl, 1- hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, l,3-dihydroxybutan-2-yl, 2-(2-
(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5 -methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1- (hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1- hydroxypropan-2-yl, l,3-dihydroxy-2-methylpropan-2-yl, 3-hydroxypropyl, 1- (hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4-hydroxybutyl, 2-sulfoethyl, 3- hydroxy-2,2-dimethylpropyl, (2-hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3- (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, ( l/f-tetrazol-5-yl)methyl, l,3-dihydroxypropan-2-yl, l-amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2- (phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl; and
R2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl.
In some embodiments: R1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, l-methylpiperidin-4- yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (1- hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3-dihydroxybutan-2- yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4- yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1-
(hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1- hydroxypropan-2-yl, l,3-dihydroxy-2-methylpropan-2-yl, 3-hydroxypropyl, 1- (hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4-hydroxybutyl, 2-sulfoethyl, 3- hydroxy-2,2-dimethylpropyl, (2-hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3- (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, (l/f-tetrazol-5-yl)methyl, l,3-dihydroxypropan-2-yl, l-amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2- (phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl; and
R2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl.
In some embodiments: R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3-(l/f-imidazol- l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl; and
R2 is selected from: H and methyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceu of:
(lc)
wherein:
R1 is selected from: C1-C6 alkyl, C3-C7 cycloalkyl, C4-C13 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, C1-C6 alkylsulfonyl, amino, carboxamide, cyano, C2- C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo;
R2 is selected from: H and C1-C6 alkyl, wherein said C1-C6 alkyl is optionally substituted with one or more hydroxyl substituents;
R3 is selected from: H and halogen;
R4 is halogen;
R5 is selected from: C1-C6 alkoxycarbonyl, carboxyl, and halogen; and
R6 is selected from: H and C1-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: ethyl, methyl, n -propyl, piperidinyl, pyrrolidinyl, cyclohexyl,
(cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, n-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, C1-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6- alkyl, phosphonooxy, and sulfo;
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents;
R3 is selected from: H and halogen;
R4 is halogen;
R5 is selected from: C1-C6 alkoxycarbonyl, carboxyl, and halogen; and
R6 is selected from: H and C1-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, pyrrolidinyl, cyclohexyl,
(cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl,
tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n- butyl, 2,2-dimethylpropyl, cyclobutyl, w-pentyl, and (pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, 1/f-imidazolyl, cyano, pyrrolidinyl, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy;
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents;
R3 is selected from: H and halogen;
R4 is halogen;
R5 is selected from: Ci-C6 alkoxycarbonyl, carboxyl, and halogen; and
R6 is selected from: H and Ci-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3-(l/f-imidazol-l- yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, pyrrolidin-2-ylmethyl, 1 - methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2- hydroxycyclohexyl, (1 -hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, l,3-dihydroxybutan-2-yl, 2-(2-(hydroxymethyl)pyrrolidin-l -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy- 5-methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, 1 -(ethoxycarbonyl)cyclopropyl, l-(hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1 - hydroxypropan-2-yl, l,3-dihydroxy-2-methylpropan-2-yl, 3-hydroxypropyl, 1- (hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4-hydroxybutyl, 2-sulfoethyl, 3- hydroxy-2,2-dimethylpropyl, (2-hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3- (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, ( l/f-tetrazol-5-yl)methyl, l,3-dihydroxypropan-2-yl, l-amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2- (phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl;
R2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl;
R3 is selected from: H and fluorine;
R4 is fluorine;
R5 is selected from: ethoxycarbonyl, carboxyl, and chlorine; and
R6 is selected from: H and methyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceu of:
(le)
wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl and C1-C6 haloalkyl;
R3 is halogen;
R4 is halogen; and
R5 is selected from: C1-C6 alkyl and halogen.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl and Ci-C6 haloalkyl;
R3 is halogen;
R4 is halogen; and
R5 is selected from: C1-C6 alkyl and halogen.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: trifluoromethyl, carboxymethyl, and chloromethyl;
R3 is halogen;
R4 is halogen; and
R5 is selected from: C1-C6 alkyl and halogen.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ie) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: 4-(trifluoromethyl)piperidin-l-yl, 3-(carboxymethyl)pyrrolidin-l-yl, and 4- (chloromethyl)piperidin- 1 -yl;
R3 is fluorine;
R4 is fluorine; and
R5 is selected from: ieri-butyl and chlorine.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ig) and pharm ereof:
(Ig)
wherein:
R1 is selected from: Ci-C6 alkyl, C3-C7 cycloalkyl, C4-C13 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo;
R2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents; and
R6 is selected from: H and Ci-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ig) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: ethyl, methyl, n -propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2- methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, n-butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo;
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents; and
R6 is selected from: H and Ci-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of
Formula (Ig) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, cyclohexyl, (cyclohexyl)methyl, 2- methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3-methylpentan-2-yl, w-butyl, 2,2-dimethylpropyl, cyclobutyl, and w-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1/f-tetrazolyl, feri-butoxycarbonyl, and phosphonooxy;
R2 is selected from: H, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents; and
R6 is selected from: H and C1-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ig) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, l-methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2 -hydroxy cyclohexyl, (l-hydroxycyclohexyl)methyl, 1- hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, l,3-dihydroxybutan-2-yl, 2-(2- (hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5 -methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, l-(ethoxycarbonyl)cyclopropyl, 1- (hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, l-hydroxy-3-methylbutan-2-yl, 1- hydroxypropan-2-yl, l,3-dihydroxy-2-methylpropan-2-yl, 3-hydroxypropyl, 1- (hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4-hydroxybutyl, 2-sulfoethyl, 3- hydroxy-2,2-dimethylpropyl, (2-hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3- (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, ( l/f-tetrazol-5-yl)methyl, l,3-dihydroxypropan-2-yl, l-amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2- (phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl;
R2 is selected from: H, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl; and
R6 is selected from: H and methyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
R1 is selected from: Ci-C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
R2 is selected from: H and C1-C6 alkyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: C1-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
R2 is selected from: H and methyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, IH- imidazolyl, cyano, and pyrrolidinyl; and
R2 is selected from: H and methyl.
One aspect of the present invention pertains to compounds selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3-(l/f-imidazol-l- yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl; and R2 is selected from: H and methyl.
Some embodiments of the present invention include every combination of one or more of the compounds and pharmaceutically acceptable salts, solvates, and hydrates thereof selected from the following group shown in Table A.
Table A
Chemical Structure Chemical Name No.
Ethyl l-(3-(4-(4-chloro-2-(4- (3 , 3 ,3 - trifluoropropyl)piperazin-
32 1 -yl)phenylcarbamoyl)-2,3- difluorobenzyl)ureido) cyclopropanecarboxylate
N-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -
33 yl)phenyl)-2,3-difluoro-4-((3-(l- (hydroxymethyl)cyclopropyl) ureido)methyl)benzamide
N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -
34 yl)phenyl)-2,3-difluoro-4-((3-(2- hydroxypyrimidin-4- yl)ureido)methyl)benzamide
(R)-N-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -
35 yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido) methyl)-2,3-difluorobenzamide
2-(l-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -
36 yl)pheny lc arb amo yl) -2 , 3 - difluorobenzylcarbamoyl) pyrrolidin-3-yl)acetic acid
0S 2-(3-(4-(4-Chloro-2-(4- (3 , 3 ,3 - trifluoropropyl)piperazin-
-
-
-
- , 3 -
-
- , 3 - 1 -
-
-
Additionally, individual compounds and chemical genera of the present invention, for example those compounds found in the directly above group, including diastereoisomers and enantiomers thereof, encompass all pharmaceutically acceptable salts, solvates, and hydrates, thereof.
The compounds of Formula (la) of the present invention may be prepared according to relevant published literature procedures that are used by one skilled in the art. Exemplary reagents and procedures for these reactions appear hereinafter in the working Examples. Protection and deprotection may be carried out by procedures generally known in the art (see, for example, Greene, T. W. and Wuts, P. G. M., Protecting Groups in Organic Synthesis, 3rd Edition, 1999 [Wiley]).
It is understood that the present invention embraces each diastereoisomer, each enantiomer and mixtures thereof of each compound and generic formula disclosed herein just as if they were each individually disclosed with the specific stereochemical designation for each chiral carbon. Separation of the individual isomers (such as, by chiral HPLC, recrystallization of diastereoisomeric mixtures and the like) or selective synthesis (such as, by enantiomeric selective syntheses and the like) of the individual
isomers is accomplished by application of various methods which are well known to practitioners in the art.
Certain Embodiments: Compositions and Methods Related Thereto
One aspect of the present invention pertains to compositions comprising a compound of the present invention. One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising a compound of the present invention. One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention, and a pharmaceutically acceptable carrier. One aspect of the present invention pertains to methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention, and a
pharmaceutically acceptable carrier; some embodiments pertain to pharmaceutical compositions obtained by any of the methods described herein. One aspect of the present invention pertains to compositions comprising a compound of the present invention, and a second pharmaceutical agent.
In any of the embodiments that recites the terms "a pharmaceutical agent" and "a second pharmaceutical agent", it is appreciated that these terms in some aspects are further limited to a pharmaceutical agent/second pharmaceutical agent that is not a compound of Formula (la) or a compounds related thereto. It is understood that the terms "a pharmaceutical agent" and "a second pharmaceutical agent" may refer to a pharmaceutical agent that has an IC50 that is greater than a value selected from: 50 μΜ, 10 μΜ, 1 μΜ, and 0.1 μΜ, or that has no detectable activity, in a Mas receptor activity assay as described in Example 3, such as the HTRF assay in Example 3.1.
One aspect of the present invention pertains to methods for preparing a composition comprising the step of admixing a compound of the present invention, and a second pharmaceutical agent; some embodiments pertain to compositions obtained by any of the methods described herein. One aspect of the present invention pertains to pharmaceutical products selected from: a pharmaceutical composition, a formulation, a unit dosage form, a combined preparation, a twin pack, and a kit; each comprising a compound of the present invention, and a second pharmaceutical agent. One aspect of the present invention pertains to pharmaceutical compositions comprising a compound of the present invention, a second pharmaceutical agent, and a pharmaceutically acceptable carrier. One aspect of the present invention pertains to methods for preparing a pharmaceutical composition comprising the step of admixing a compound of the present invention, a second pharmaceutical agent, and a pharmaceutically acceptable carrier; some embodiments pertain to pharmaceutical compositions obtained by any of the methods described herein. Certain Embodiments: Methods, Pharmaceutical Products, Combinations, and Uses of the Present Invention
Mas Receptor
In mammals, Mas is expressed predominantly in brain and testis with moderate levels of expression in heart and kidney, and lower expression in several other tissues (Alenina N., et al, Exp Physiol 93:528-537 (2008); Metzger R., et al, FEBS Lett 357:27-32 (1995); Villar A. J. and Pedersen R. A., Nat Genet 8:373-379 (1994); Young D., et al, Cell 45:711-719 (1986)). As further described herein, Mas is expressed in cardiovascular tissue (Example 5.5). In the mouse heart, low levels of Mas mRNA transcripts have been detected in cardiomyocytes and higher concentrations in the endothelium of coronary arteries (Alenina N., et al., Exp Physiol 93:528-537 (2008)). We confirm Mas mRNA and protein expression in rat hearts, with cardiomyocytes and coronary arteries as sites of enriched expression (Example 5.5). Additionally, by co-localization studies we determined that both smooth muscle cells and endothelial cells in coronary arteries express Mas. Most importantly, as shown herein, the Mas is expressed in human heart (Example 5.5). Consistent with its expression in rodents, Mas is expressed in all human cardiac chambers, and in both human cardiomyocytes and human coronary arteries indicating that Mas plays a role in human heart function.
In addition, small molecule/non-peptide modulators were used to confirm the Mas-Gq-PLC signaling pathway (Example 3 and Example 5.7). These results demonstrate that Mas is a Gq -coupled receptor. The Mas receptor was discovered more than two decades ago. Based on the sequence, Mas was predicted to be a GPCR; however, an understanding of its intracellular signaling pathways has been slow to develop. Some studies have suggested that Mas may couple to Gq or Gj (Bikkavilli R. K., et al., Biochem Pharmacol 71 :319-337, (2006); Canals M, et al., J Biol Chem 281 : 16757-16767 (2006); and Singh A, et al., J Mol Signal 5: 11 (2010)). As disclosed herein we examined the G-protein coupling of Mas in both HEK293 cells and in the more biologically relevant cardiac myocytes. Our data demonstrate that in both cell types Mas constitutively couples to the Gq protein, which in turn activates PLC and causes inositol phosphate accumulation (Example 3). Mas-Gq coupling was confirmed using a novel Mas agonist and inverse agonists. These ligands modulated Mas-dependent IP accumulation and calcium mobilization in a dose-dependent manner. The absence of constitutive adenylate cyclase activity in the same cellular context suggests that Mas couples preferentially to Gq, although Gj coupling was activated by high concentrations of the Mas agonist. Our results demonstrate higher sensitivity for Gq coupling (IC50 = 0.351 + 0.055 μΜ) with agonist AR234960 compared to Gj coupling (IC50 = 0.719 + 0.012 μΜ). In addition, the preferred Gq coupling observed with the Mas agonist was also observed in cells expressing rat Mas (Table C and D) and was confirmed with additional Mas-Gq agonists (Example 3).
Although there is currently no direct evidence that Mas signals via activation of G12/G13 it has been reported that Mas transformation in NIH 3T3 cells is mediated through Racl, a member of the Rho family proteins (Zohn I. E., et al, Mol Cell Biol 18: 1225-1235 (1998)). Data described herein do not rule out the possibility that Mas is also coupled to G12/G13 in the heart.
While we have observed Gq coupling of the Mas receptor in Mas-expressing cells in vitro, it was also important to confirm the signaling pathway of the endogenous Mas receptor in the heart. To address this, and the relationship between Mas signaling and biological function in the heart, the ex vivo
coronary flow functional assay and the in vivo coronary artery ligation model was utilized as described herein.
Agonist stimulation of arterial smooth muscle Gq-coupled receptors {e.g. endothelin ETA), results in increased cytosolic Ca2+, vasoconstriction and decreased arterial blood flow (Seo B., et al., Circulation 89: 1203-1208 (1994); and Wynne B. M., et al, J Am Soc Hypertens 3:84-95 (2009)). Conversely, pharmacological blockade of the ETA receptor results in vasodilation and increased coronary flow (Halcox J. P., et al., Hypertension 49: 1134-1141, 2007; and Kyriakides Z. S., et al., Heart 84: 176-182 (2000)). Therefore, the activation of the Gq-coupled Mas receptor in coronary arteries would lead to vasoconstriction and decreased coronary flow. In the present study, we have
demonstrated that Mas-Gq agonist treatment causes vasoconstriction resulting in decreased coronary flow and conversely, Mas inverse agonist treatment results in vasodilation and increased coronary flow. Inhibition of PLC attenuated the effect of the Mas agonist, confirming that vasoconstriction via the endogenous Mas receptor is mediated through the Gq-PLC pathway. The observation that Mas agonist- induced vasoconstriction is preserved in endothelium-denuded hearts indicates that this response is mediated by Mas receptors on smooth muscle cells in coronary arteries.
The Mas receptor has been implicated in the regulation of cardiac function during ischemia and reperfusion in isolated hearts (Castro C.H., et al., Life Sci 80:264-268 (2006)). To determine whether the Mas receptor also plays a role in regional ischemia/reperfusion injury in vivo, we performed coronary artery ligation studies in Mas+ + (wild type) and Mas '" (Mas knockout) mice. The data demonstrate that infarct size is significantly reduced in Mas '" mice after ischemia/reperfusion
(Example 5.6). Interestingly, ablation of Mas expression in mice also renders the kidneys resistant to ischemia/reperfusion injury (Esteban V., et al., PLoS One 4:e5406 (2009)). Finally, we confirmed a role for Mas in myocardial ischemia/reperfusion injury by treating rats with Mas inverse agonists either prior to ischemia or immediately before reperfusion. Both treatment protocols resulted in reduced infarct size, indicating that excessive Mas-Gq signaling occurs both during ischemia and during reperfusion. These data are consistent with the cardioprotection observed with other inhibitors of other myocardial Gq-coupled receptors in the setting of reperfusion injury (Watanabe T., et al., Br J
Pharmacol 114:949-954, 1995; and Dai W., et al, Cardiovasc Ther 28:30-37 (2010)). Importantly, the decreased infarct size observed with Mas inverse agonist treatment in vivo resulted in improved long- term cardiac function.
One mechanism whereby Mas inverse agonists and antagonists provide cardioprotection is by improving cardiac blood flow. It has been suggested that reduced coronary flow is an important factor that contributes to ischemia/reperfusion injury (Collard C. D. and Gelman S., Anesthesiology 94: 1133- 1138 (2001)). The Mas receptor present on arterial smooth muscle cells promotes vasoconstriction, whereas inhibition of Mas signaling by Mas inverse agonists promotes vasodilation, resulting in improved blood flow. Thus, it is likely that the improved coronary flow resulting from Mas inverse agonist treatment accounts, at least in part, for the cardioprotective properties of these compounds.
A second mechanism whereby Mas inverse agonists can provide cardioprotection is by reducing apoptosis. Mas is expressed in cardiomyocytes where ischemia/reperfusion is known to cause a marked increase in intracellular Ca2+ content (Tani M. and Neely J. R., Circ Res 65: 1045-1056 (1989); and Murphy E. and Steenbergen C, Physiol Rev 88:581-609 (2008)). Cytosolic and subsequent mitochondrial Ca2+ overload results in cell death during myocardial ischemia/reperfusion injury (Talukder M. A., et al, Cardiovasc Res 84:345-352 (2009)). Therefore the activation of Mas in cardiomyocytes during ischemia/reperfusion should lead to activation of Gq-PLC-IP3-Ca2+ signaling, which should contribute to elevated cytosolic and mitochondrial Ca2+ loading and thus contribute to cell death by either apoptosis or necrosis. Cardiomyocyte loss by apoptosis has been recognized as a major factor contributing to ischemia/reperfusion injury (Mani K., Heart Fail Rev 13:193-209 (2008)). Indeed, we saw marked increases in cardiomyocyte apoptosis in rat hearts after ischemia/reperfusion injury. Our observation that administration of Mas receptor inverse agonists prior to reperfusion reduces cardiomyocyte apoptosis supports this mechanism.
In addition to reducing infarct size, the improved coronary flow and Ca2+ handling during reperfusion should result in fewer ventricular arrhythmias. Our observation that a Mas inverse agonist decreased the incidence of ventricular arrhythmias during reperfusion indicates that this is a third mechanism whereby Mas inverse agonists have the potential to provide cardioprotection.
As stated earlier, our data demonstrate that the Mas receptor is expressed in cardiomyocytes and coronary arteries across multiple species including humans. More importantly, our studies have focused on a previously underappreciated aspect of Mas receptor pharmacology; G-protein signaling. We find that the Mas receptor preferentially couples to Gq resulting in PLC activation and increased intracellular calcium, and that Gj coupling can also occur at higher drug concentrations (Example 3.3). Our coronary flow studies in isolated hearts support this signaling mechanism. Inhibition of Mas signaling was shown to provide cardioprotection through a mechanism involving improved coronary flow, reduced apoptosis, and reduced in the incidence of arrhythmias. Furthermore, we show that inhibition of Mas receptor Gq signaling in the heart protects against ischemia/reperfusion injury in vivo as demonstrated by reduced infarct size (Example 4). Together, these results reveal a previously unrecognized pathological role for excessive Mas-Gq signaling in the setting of myocardial ischemia/reperfusion injury, and indicate that inhibition of Mas-Gq signaling is therapeutically beneficial.
The standard treatment for myocardial infarction is reperfusion of the ischemic area by thrombolysis or percutaneous coronary angioplasty. Release of the blockage and return of blood flow to the affected area is crucial for heart tissue survival; however, damage beyond that generated by ischemia is typically observed in the reperfused heart tissue. The manifestations of reperfusion injury include arrhythmia, reversible contractile dysfunction-myocardial stunning, endothelial dysfunction and cell death. Currently, there is no effective treatment for reperfusion injury available. Inverse agonists/antagonists of the Mas receptor are cardio-protective. The cardio-protection observed with inhibitors of the Mas receptor is consistent with the inhibition of other myocardial Gq coupled
receptors, such as the angiotensin ATi receptor (De Gasparo, M. et al., Pharmacol Rev 52:415-472 (2000)) and the endothelin receptor ETA (Douglas, S. A. and Ohlstein, E. H. Vascular Research 34: 152- 164 (1997) and Takigawa, M. et al, Eur. L. Biochem. 228: 102-108 (1995)).
Based on expression data, the cellular signaling of the Mas receptor (Gq/PLC activation and increased intracellular Ca+2), and comparison with similar Gq coupled receptors {e.g., ATi and ΕΤΊ),
Mas inverse agonists of Formula (la) are useful in the treatment of a number of the conditions, such as, hypertension, recurrence of atrial fibrillation, reduction in the incidence of Alzheimer's disease, progression of Alzheimer' s disease, dementia, and other conditions provided herein. Angiotensin ATi receptor inhibitors are well known in medicine. Examples of ΑΤΊ receptor inhibitors include candesartan (Atacand™), eprosartan (Teveten™), irbesartan (Avapro™), telmisartan (Micardis™), valsartan (Diovan™), losartan (Cozaar™), and olmesartan (Benicar™). ΑΤΊ receptor inhibitors are useful in the treatment of hypertension (high blood pressure). Persistent hypertension is one of the risk factors for stroke, myocardial infarction, heart failure and arterial aneurysm, and is a leading cause of chronic kidney failure (Pierdomenico, S.D., et al., American J. Hypertension 22:842-847 (2009)). ATi receptor inhibitors also prevent/treat the recurrence of atrial fibrillation. In addition, ATi receptor inhibitors are associated with a significant reduction in the incidence and progression of Alzheimer' s disease and dementia compared with angiotensin converting enzyme inhibitors or other cardiovascular drugs (Li, N.-C. et al, BMJ 2010;340:b5465).
Inverse agonists and antagonists of the G protein-coupled Mas receptor and pharmaceutical compositions comprising the same are useful in methods of treatment or alleviation of diseases or disorders of the heart, brain, kidney, and reproductive system resulting from ischemia, or reperfusion subsequent to ischemia, and any downstream complication(s) related thereto. The present invention further relates to methods of treatment or alleviation of diseases or disorders of the vasculature resulting from vasoconstriction or hypertension and any downstream complication(s) resulting from elevated blood pressure and/or reduced tissue perfusion. Specifically, the Mas receptor inverse agonists and antagonists are useful in treating diseases or disorders characterized by an active, hyperactive, or an improperly active Mas receptor, and/or in ameliorating the symptoms thereof in a subject in need of such treatment. The methods involve contacting a cell, a tissue, or an organ expressing a Mas receptor of a subject in need of such treatment with an effective amount of an inverse agonist or antagonist of the Mas receptor. The contacted cell, tissue, or organ may be in a patient, or may be isolated from the patient, contacted with the Mas receptor inverse agonist or antagonist, and returned to the patient's body. The Mas receptor inverse agonist or antagonist decreases the activity of, or signaling through, the Mas receptor thereby treating the disease/disorder, reducing the risk of developing the disease/disorder, or alleviating the symptoms of the disease/disorder.
1. Regulation of the Vascular System
Mas receptor inverse agonists and antagonists are useful in prophylactic and therapeutic treatments, in part, because of their ability to reduce or inhibit vasoconstriction and/or promote
vasodilation. Regulating the vascular system (e.g., by vasodilation and/or vasorelaxation) is helpful in treating conditions where there is a restriction or impediment to normal blood flow, or reducing the symptoms of such conditions. Non-limiting examples of conditions that benefit from vascular regulation using Mas receptor inverse agonists and antagonists are provided below.
a. Heart
The compounds described herein are particularly useful in reducing the likelihood of developing coronary heart disease as well as in the treatment of coronary heart disease and the symptoms thereof. Coronary heart disease, also known as coronary artery disease, is a narrowing of the small blood vessels that supply blood and oxygen to the heart and is the leading cause of death in the United States for men and women. This disease is usually caused by a condition called atherosclerosis, which occurs when fatty material and other substances form a plaque build-up on the walls of the arteries causing them to get narrow. As the coronary arteries narrow, blood flow to the heart can slow down or stop.
A restriction in blood supply can lead to ischemia. Ischemia results in tissue damage because of a lack of oxygen and nutrients. Mas receptor inverse agonists and antagonists are effective in reducing ischemia by reducing vasoconstriction and removing the restriction on blood flow. Thus, compounds of the present invention are useful for providing cardioprotection during and/or following an obstruction or reduced blood flow in the heart.
Ischemia can result in a condition called angina pectoris, more commonly called angina, which is a temporary and often recurring chest pain caused by a lack of or inadequate oxygenated blood feeding the heart muscles. The compounds of the present invention are useful in reducing the risk of angina attacks or the symptoms thereof.
Myocardial infarction, more commonly known as heart attack, occurs when the blood supply to a part of the heart is interrupted by blockage of the coronary blood vessels causing heart cells in that part of the heart to die. The Mas receptor inverse agonists and antagonists are helpful in reducing vasoconstriction thereby reducing the risk of a myocardial infarction. In addition, the inverse agonists and antagonists of the present invention are helpful in promoting vasorelaxation following myocardial infarction.
The no-reflow phenomenon, which usually manifests as ECG changes and chest pain is a failure to restore normal myocardial blood flow despite removal of the coronary obstruction. The no- reflow phenomenon has been shown to complicate thrombolytic therapy and percutaneous revascularization. The compounds of the present invention are useful in the treatment of the no-reflow phenomenon and the symptoms thereof.
Hypertension is a cardiac chronic condition in which the systemic arterial blood pressure is elevated. Persistent hypertension is one of the risk factors for myocardial infarction. Pulmonary hypertension is an increase in blood pressure in the pulmonary artery, pulmonary vein, or pulmonary capillaries, together known as the lung vasculature. Pulmonary hypertension can be a severe disease with a markedly increased risk for heart failure. Mas receptor inverse agonists and antagonists are
useful in stabilizing blood pressure and thereby reducing hypertension and also ameliorating the symptoms thereof.
Angioplasty is a catheter-based technique used to open arteries obstructed by a blood clot. Mas receptor inverse agonists and antagonists, by promoting vasodilation, can have the effect of reducing the risk of the formation of blood clots following this procedure.
Coronary bypass surgery is a surgical procedure in which an artery or vein is taken from elsewhere in the body and grafted to a blocked coronary artery, rerouting blood around the blockage and through the newly attached vessel. The compounds of the present invention are helpful in reducing the risk of vasoconstriction following this procedure.
Ischemia/reperfusion Injury is the tissue damage that is caused when blood supply returns to the tissue after a period of ischemia. The absence of oxygen and nutrients from blood creates a condition in which the restoration of circulation results inflammation and oxidative damage through the induction of oxidative stress rather than restoration of normal function. Mas receptor inverse agonists and antagonists are useful in treating reperfusion injury. In some embodiments, the reperfusion injury is injury following cardioplegia. In some embodiments, the reperfusion injury is injury following angioplasty.
b. Brain
A transient ischemic attack or mini-stroke is a brief interruption of blood flow to the brain caused by an obstruction to blood flow. Example 10 shows that inhibiting Mas receptor signaling reduced brain damage associated with transient ischemic stroke. Thus, Mas receptor inverse agonists and antagonists are helpful in treating transient ischemic attack and the symptoms thereof.
A stroke is an event in which the brain does not receive adequate amounts of oxygenated blood and is usually caused by ischemia (resulting from blockage of a cerebral blood vessel) or a hemorrhage. The compounds of the present invention are useful in treating strokes and the symptoms thereof. In addition, these compounds are useful in reducing the risk of the reoccurrence of a stroke or a mini stroke.
Thus, compounds of the present invention are useful for providing neuroprotection during and/or following an obstruction or reduced blood flow in the brain and in the treatment of one or more of the following Mas receptor-mediated disorders: stroke, brain attack, neuroprotection, brain ischemia (thrombotic, embolic and hypoperfusion), focal or multifocal brain ischemia, global brain ischemia, ischemic brain injury, acute ischemic brain damage, acute ischemic brain injury, brain infarction, brain reperfusion injury, brain hypoxia, cerebral reperfusion injury, neuronal reperfusion injury, ischemic neurological disorders, ischemic brain damage, cerebral hypoxia, cerebral ischemia, cerebral ischemic injury, hypoxic-ischemic brain injury, anoxic brain injury, anoxic brain damage, anoxic
encephalopathy, subcortical ischemic depression, moyamoya disease, and cardiorespiratory arrest.
c. Reproductive System
Erectile dysfunction is the inability of a male subject to develop or maintain penile erection for normal sexual performance. A penile erection is the hydraulic effect of blood entering and being
retained in the corpus cavernosa, which are sponge-like bodies within the penis. Erectile dysfunction is indicated when an erection is difficult to produce. The Mas receptor is expressed in the corpus cavernosa and the vasodilatory properties of the inverse agonists and antagonists of the Mas receptor make them useful in treating erectile dysfunction.
d. Intestine
Both the large and small bowel can also be affected by ischemia. Ischemic colitis is a medical condition in which inflammation and injury of the large intestine result from inadequate blood supply usually caused by changes in the systemic circulation (e.g. low blood pressure) or local factors such as constriction of blood vessels or a blood clot. Ischemia of the small bowel is called mesenteric ischemia. The compounds of the present invention are useful in reducing ischemia of both the large and small intestine.
e. Limbs - Peripheral Vascular Disease
Acute limb ischemia is caused by the lack of, or reduced, blood flow to a limb. It is usually due to either an embolism or thrombosis of an artery in subjects with underlying peripheral vascular disease. A blockage in the legs can lead to leg pain or cramps with activity (claudication), changes in skin color, sores or ulcers, and feeling tired in the legs. Total loss of circulation can lead to gangrene and loss of a limb. Mas receptor inverse agonists and antagonists can improve blood flow thereby treating the risk of developing acute limb ischemia in subjects in need thereof.
f. Kidney
Renal artery stenosis is a decrease in the diameter of the renal arteries. The resulting restriction of blood flow to the kidneys may lead to impaired kidney function and high blood pressure, referred to as renovascular hypertension (RVHT). Renal artery stenosis is a major cause of RVHT and accounts for 1 %-10% of the roughly 50 million cases of hypertension in the United States. Renovascular hypertension occurs when the artery to one of the kidneys is narrowed, while renal failure occurs when the arteries to both kidneys are narrowed. The decreased blood flow to both kidneys increasingly impairs renal function. Example 9 demonstrates that Mas inverse agonists can be protective for kidney function following ischemia reperfusion injury. Thus, the compounds of the present invention are useful in improving blood flow to and within the kidneys. In addition, Mas receptor inverse agonists and antagonists are helpful in treating or reducing the risk of developing renal artery stenosis, renovascular hypertension, and renal failure. Furthermore, the compounds described herein are also useful in treating chronic kidney disease and diabetic nephropathy and the symptoms thereof.
Thus, compounds of the present invention are useful for providing renoprotection/renal protection during and/or following an obstruction or reduced blood flow in the kidney and in the treatment of one or more of the following Mas receptor-mediated disorders: nephropathy, nephrotic syndrome, obstruction nephropathy, obstructive nephropathy, diabetic nephropathy, renal hypertension, renovascular hypertension, renal ischemia, renal ischemic injury, renal ischemia-reperfusion injury, renal reperfusion injury, acute renal injury, acute kidney injury, acute renal failure, acute kidney failure, acute tubular necrosis, contrast nephropathy, chronic kidney disease, chronic renal failure, chronic renal
insufficiency, end stage renal disease, end stage renal failure, focal segmental glomerulosclerosis, glomerulonephritis, diabetes and diabetic kidney disease, diabetes insipidus, Fabry's disease, focal segmental glomerulosclerosis, focal sclerosis, focal glomerulosclerosis, Gitelman syndrome, glomerular diseases, high blood pressure and kidney disease, IgA nephropathy (Berger's disease), interstitial nephritis, lupus, malignant hypertension, microscopic polyangiitis (MP A), preeclampsia, polyarteritis, proteinuria, renal artery stenosis, renal infarction, reflux nephropathy, scleroderma renal crisis, tuberous sclerosis, and warfarin-related nephropathy.
2. Inhibiting Calcium Signaling
Mas receptor inverse agonists and antagonists are also useful in prophylactic and therapeutic treatments, in part, because of their ability to reduce or inhibit calcium signaling in cells or correct improper calcium handling by cells.
The Mas receptor is a Gq coupled receptor. Stimulation of the Mas receptor leads to the release of calcium stored within intracellular compartments. Contractility of cardiac myocytes is regulated by changes in intracellular calcium concentration. Improper calcium handling by cardiac myocytes can lead to inappropriate contractile activity. In addition, inappropriate calcium release from intracellular compartments can result in conditions such as cardiac arrhythmias, pathological structural changes in the myocardium, and apoptosis. Inverse agonists and antagonists of the Mas receptor are useful in treating any disease or disorder arising from improper regulation of calcium signaling and/or handling by cells, or the symptoms thereof,
a. Arrhythmias
An arrhythmia is a problem with the rate or rhythm of the heartbeat. During an arrhythmia, the heart can beat too fast, too slow, or with an irregular rhythm. A heartbeat that is too fast is called tachycardia. A heartbeat that is too slow is called bradycardia. When the heart rate is too fast, too slow, or irregular, the heart may not be able to pump enough blood to the body. Lack of blood flow can damage the brain, heart, and other organs. There are several known types of arrhythmias such as supraventricular arrhythmias, ventricular arrhythmias, and brady arrhythmias.
Supraventricular arrhythmias are tachycardias that start in the atria or the atrioventricular node and include atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, and Wolff - Parkinson-White syndrome. Atrial fibrillation, a condition which affects roughly two million
Americans each year, is the most common type of arrhythmia. In this condition, the atria (the upper chambers of the heart) rapidly fire electrical signals that cause them to quiver rather than contract normally. The result is an abnormally fast and highly irregular heartbeat.
Ventricular arrhythmias are abnormal rapid heart rhythms that originate in the ventricles (the lower chambers of the heart). Ventricular arrhythmias include ventricular tachycardia and ventricular fibrillation, both of which are life-threatening arrhythmias most commonly associated with heart attacks.
Bradyarrhythmias are arrhythmias in which the heart rate is slower than normal. If the heart rate is too slow, not enough blood reaches the brain.
Reperfusion of the ischemic myocardium may play an important role in the genesis of life- threatening reperfusion arrhythmias. Reflow may occur as a result of abrupt cessation of coronary artery spasm or upon dislodgment of platelet aggregates with the attendant washout of products of cellular ischemia and the released substances exert a transient but potent arrhythmo genie effect resulting in reperfusion arrhythmias.
The Mas receptor inverse agonists and antagonists are effective in treating and/or reducing the likelihood of developing arrhythmias and are also effective in treating the symptoms of arrhythmias.
b. Apoptosis
Apoptosis is an important component of normal development as well as the pathogenesis of several diseases including cardiovascular diseases. Calcium levels play a key role in apoptosis of cardiomyocytes. Signaling through the Mas receptor mobilizes calcium stores and triggers apoptosis by elevation of intracellular fee calcium. Inverse agonists and antagonists of the Mas receptor are useful in protecting the myocardium from cell death.
3. Inflammatory Disorders, Autoimmune Disorders, and Associated Conditions
Inflammation is a complex biological response of vascular tissues to harmful stimuli, such as pathogens, damaged cells, or irritants. While after injury or in certain conditions inflammation is a normal, healthy response, inflammation that results in the immune system attacking the body' s own cells or tissues may also cause abnormal inflammation, which results in chronic pain, redness, swelling, stiffness, and damage to normal tissues. Prolonged inflammation, known as chronic inflammation, can lead to a host of diseases, such as hay fever, periodontitis, atherosclerosis, rheumatoid arthritis, and even cancer (e.g., gallbladder carcinoma). Mas receptor inverse agonists and antagonists such as those described herein are useful in the treatment and /or prevention of inflammatory disorders as well as conditions associated with inflammation.
Inflammatory disorders are generally associated with elevated levels of certain cytokines. Cytokines include interleukins (IL), interferons (IFNs), chemokines (proteins that direct white blood cells to move to sites of inflammation), tumor necrosis factors (TNFs), and colony stimulating factors (CSFs). The cytokines associated with increased inflammation are called "proinflammatory cytokines" and include IL-la, IL-Ιβ, IL-2, IL-6, IL-10, IL-12, IL- 15, IL-18, TNFa, secreted lymphotoxin a (TNF ), lymphotoxin β, IFNa, ΙΡΝβ, ΙΡΝγ, GM-CSF, M-CSF, lymphotoxin αβ, LIGHT, CD40 ligand, Fas ligand, CD30 ligand, CD27 ligand, 4- IBB ligand, the Ox40 ligand, TRAIL, TWEAK, TRAMP, CXC chemokines (e.g., L-8, GRO-a, GRO-β, PF-4, IP- 10, and Mig), and CC chemokines (e.g., eotaxin, eotaxin-2, and MCP-4). The compounds of the present invention are useful in treating or preventing inflammation, at least in part, by reducing the levels of such proinflammatory cytokines.
For example, the compounds described herein can be used to treat inflammatory disorders such as, those mediated by tumor necrosis factor-a (TNFa). Mas receptor gene expression correlates with
TNFa expression by inflammatory immune cells, such macrophages (Example 6). TNFa is a cytokine that has been identified as a mediator of immunity, of inflammation, of cell proliferation, and of fibrosis. This mediator is present in large quantities in inflamed synovial tissues and plays an important role in the pathogenesis of autoimmunity (Black et, al., Annu. Rep. Med. Chem., 32:241 -250 (1997)). Elevated levels of TNFa levels have been associated with many inflammatory diseases such as sepsis and rheumatoid arthritis. Rheumatoid arthritis is a chronic inflammatory disorder that affects multiple peripheral joints. Over expression of TNFa and other proinflammatory cytokines has been observed in patients with arthritis (Feldmann et. al., Prog Growth Factor Res 4:247-55 (1992)). Furthermore, transgenic animals that over express human TNFa develop an erosive polyarthritis with many characteristics associated with the disease (Keffer et. al, EMBO J. 10(13):4025-31 (1991)). The success of anti-TNFa antibody therapy (Rituximab) has transformed the management of the disease (Edwards, et. al, N. Engl. J. Med., 350(25): 2572-81 (2004)). It has now been found that compounds of the present invention are capable of decreasing levels of TNFa, see Example 7, and have also been shown in a well-known animal model of inflammation (the carrageenan-induced inflammation paw swelling model) to be effective in reducing inflammation, see Example 8. Given the ability of the compounds of the present invention to reduce TNFa levels, the Mas receptor inverse agonists and antagonists are beneficial in treating TNFa-related disorders such as, but not limited to:
(A) acute and chronic immune and autoimmune pathologies, such as systemic lupus erythematosus (SLE), rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis, osteoarthritis, refractory rheumatoid arthritis, chronic non-rheumatoid arthritis, osteoporosis/bone resorption, thyroidosis, graft versus host disease, scleroderma, diabetes mellitus, Graves' disease, and the like;
(B) infections, including, but not limited to, sepsis syndrome, cachexia, septic shock, endotoxic shock, circulatory collapse and shock resulting from acute or chronic bacterial infection, acute and chronic parasitic and/or infectious diseases, bacterial, fungal, or viral such as AIDS (including symptoms of cachexia, autoimmune disorders, AIDS dementia complex and infections);
(C) inflammatory diseases, such as chronic inflammatory pathologies and vascular inflammatory pathologies, including chronic inflammatory pathologies such as sarcoidosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, systemic sclerosis, psoriasis, dermatomyositis, polyomyositis, and vascular inflammatory pathologies, such as, but not limited to, disseminated intravascular coagulation, atherosclerosis, and Kawasaki's pathology;
(D) neurodegenerative diseases, including, but not limited to, demyelinating diseases, such as multiple sclerosis and acute transverse myelitis; extrapyramidal and cerebellar disorders such as lesions of the corticospinal system; disorders of the basal ganglia or cerebellar disorders; hyperkinetic movement disorders such as Huntington's chorea and senile chorea; drug-induced movement disorders, such as those induced by drugs which block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; progressive supranucleo palsy; cerebellar and spinocerebellar disorders, such as astructural lesions of the cerebellum; spinocerebellar degenerations (spinal ataxia,
Friedreich's ataxia, cerebellar cortical degenerations, multiple systems degenerations (Mencel, Dejerine-Thomas, Shi-Drager, and Machado-Joseph); and systemic disorders (Refsum's disease, abetalipoprotemia, ataxia, telangiectasia, and mitochondrial multi-system disorder); demyelinating core disorders, such as multiple sclerosis, acute transverse myelitis; disorders of the motor unit, such as neurogenic muscular atrophies (anterior horn cell degeneration, such as amyotrophic lateral sclerosis, infantile spinal muscular atrophy and juvenile spinal muscular atrophy), Alzheimer's disease, Down's syndrome in middle age, diffuse Lewy body disease, senile dementia of Lewy body type, Wernicke- Korsakoff syndrome, chronic alcoholism, Creutzfeldt-Jakob disease, subacute sclerosing
panencephalitis, Hallerrorden-Spatz disease, and dementia pugilistica, or any subset thereof;
(E) malignant pathologies involving TNF-secreting tumors or other malignancies involving
TNF, such as, but not limited to leukemias (acute, chronic myelocytic, chronic lymphocytic and/or myelodyspastic syndrome); lymphomas (Hodgkin's and non-Hodgkin's lymphomas, such as malignant lymphomas (Burkitt's lymphoma or mycosis fungoides)); and
(F) alcohol-induced hepatitis.
The compounds of the invention are equally useful in treating and/or preventing IL-1 related disorders. In certain embodiments, the IL-1 related disorder includes (a) inflammatory diseases such as osteoarthritis, pancreatitis and asthma; (b) autoimmune diseases such as glomerular nephritis, rheumatoid arthritis, scleroderma, and alphosis; and (c) infectious diseases such as septicemia and septic shock.
The cytokine IL-6 acts as a proinflammatory cytokine in part through its effects on TNFa and
IL-1. Thus, the compounds of the present invention are also useful in treating IL-6 related disorders such as autoimmune diseases and chronic inflammatory proliferative diseases. In specific embodiments, the compounds of the present invention are useful in treating and/or preventing rheumatoid arthritis, systemic-onset juvenile chronic arthritis, osteoporosis, psoriasis, diabetes, atherosclerosis, depression, Alzheimer' s disease, systemic lupus erythematosus, and prostate cancer.
The compounds of the present invention are also useful to treat and/or prevent disorders associated with deregulated expression and/or activity of other proinflammatory cytokines such as IL-2, IL-10, IL-12, IL- 15, IL- 18, TNF , lymphotoxin β, IFNa, ΙΗΝΓβ, IFNy, GM-CSF, M-CSF, lymphotoxin αβ, LIGHT, CD40 ligand, Fas ligand, CD30 ligand, CD27 ligand, 4- IBB ligand, the Ox40 ligand, TRAIL, TWEAK, TRAMP, CXC chemokines (e.g., L-8, GRO-a, GRO-β, PF-4, IP-10, and Mig), and CC chemokines (e.g., eotaxin, eotaxin-2, and MCP-4).
Mas receptor inverse agonists and antagonists such as those described herein are useful in the treatment and /or prevention of autoimmune and autoinflammatory disorders. An autoimmune disorder is a condition that occurs when the immune system mistakenly attacks and destroys healthy body tissue. An autoimmune disorder may result in the destruction of one or more types of body tissue; abnormal growth of an organ; and/or changes in organ function. Autoinflammatory diseases are a relatively new category of diseases that are different from autoimmune diseases. However, autoimmune and
autoinflammatory diseases share common characteristics in that both groups of disorders result from the immune system attacking the body' s own tissues, and also result in increased inflammation.
The compounds of the present invention are useful in the treatment of one or more of the following inflammatory disorders, autoimmune disorders, and/or disorders related to inflammatory or autoimmune diseases: acne vulgaris, adult respiratory distress syndrome, allergy, allergic asthma, Alzheimer's disease, amyloidosis, ankylosing spondylitis, asthma, bronchopulmonary aspergillosis, allergic rhinitis, autoimmune hemolytic anemia, acanthosis nigricans, allergic contact dermatitis, Addison's disease, atopic dermatitis, alopecia areata, alopecia universalis, amyloidosis, anaphylactoid purpura, anaphylactoid reaction, aplastic anemia, hereditary angioedema, idiopathic angioedema, cranial arteritis, giant cell arteritis, Takayasu's arteritis, temporal arteritis, asthma, autoimmune oophoritis, autoimmune orchitis, autoimmune polyendocrine failure, bacterial septic shock, bacterial toxic shock, Behcet's disease, Berger's disease, Buerger's disease, bronchitis, bullous pemphigus, chronic mucocutaneous candidiasis, chronic grafts versus host disease, Caplan's syndrome, post- myocardial infarction syndrome, post- pericardiotomy syndrome, carditis, celiac disease, celiac sprue; Chagas disease, Chediak-Higashi syndrome, Churg-Strauss disease, chronic recurrent uveitis, Cogan's syndrome, cold agglutinin disease, CREST syndrome, Crohn's disease, cryoglobulinemia, cryptogenic fibrosing alveolitis, delayed type hypersensitivity disorders, dermatitis herpetifomis, dermatomyositis, juvenile dermatomyositis, diabetes mellitus, Diamond-Blackfan syndrome, DiGeorge syndrome, discoid lupus erythematosus, endometriosis, eosinophilic fasciitis, episcleritis, drythema elevatum diutinum, erythema marginatum, erythema multiforme, erythema nodosum, familial amyloid polyneuropathies, familial Mediterranean fever, Felty's syndrome, pulmonary fibrosis, anaphylactoid glomerulonephritis, autoimmune glomerulonephritis, post-streptococcal glomerulonephritis, posttransplantation glomerulonephritis, membranous glomerulopathy, Goodpasture's syndrome, immune- mediated granulocytopenia, graft versus host disease, granuloma annulare, allergic granulomatosis, granulomatous myositis, Grave's disease, Hashimoto's thyroiditis, hemolytic disease of the newborn, idiopathic hemochromatosis, Henoch- Schoenlein purpura, chronic active and chronic progressive hepatitis, histiocytosis X, hypereosinophilic syndrome, hypersensitivities, idiopathic thrombocytopenic purpura, immune deficiency, common variable immunodeficiency, interstitial cystitis, Job's syndrome, juvenile rheumatoid arthritis (juvenile chronic arthritis), Kawasaki's disease, keratitis,
keratoconjunctivitis sicca, Landry-Guillain-Barre-Strohl syndrome, lepromatous leprosy, Loeffler's syndrome, lupus, Lyell's syndrome, lyme disease, lymphomatoid granulomatosis, lymphoproliferative disease, malaria, meningitis, systemic mastocytosis, mixed connective tissue disease, mononeuritis multiplex, Muckle- Wells syndrome, mucocutaneous lymph node syndrome, mucocutaneous lymph node syndrome, multicentric reticulohistiocytosis, multiple sclerosis, myasthenia gravis, mycosis fungoides, myeloproliferative disorder, nephrotic syndrome, ovarian cancer, recurrent ovarian cancer, overlap syndrome, panniculitis, paroxysmal cold hemoglobinuria, paroxysmal nocturnal
hemoglobinuria, pelvic inflammatory diseases, pemphigoid, pemphigus, pemphigus erythematosus, pemphigus foliaceus, pemphigus vulgaris, pigeon breeder's disease, plasmacytoma, pneumonitis,
polyarteritis nodosa, refractory multiple myeloma, rheumatic polymyalgia, polymyositis, diopathic polyneuritis, pre-eclampsia/eclampsia, primary biliary cirrhosis, systemic sclerosis, progressive systemic sclerosis (scleroderma), multiple sclerosis, psoriasis, psoriatic arthritis, pulmonary alveolar proteinosis, pulmonary fibrosis, Raynaud's phenomenon/syndrome, Reidel's thyroiditis, Reiter's syndrome, relapsing polychrondritis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleritis, sclerosing cholangitis, serum sickness, Sezary syndrome, Sjogren's syndrome, Stevens- Johnson syndrome, Still's disease, subacute sclerosing panencephalitis, sympathetic ophthalmia, systemic lupus erythematosus, transplant rejection, tumor proliferation and metastasis, ulcerative colitis,
undifferentiated connective tissue disease, chronic urticaria, cold urticaria, uveitis, vasculitis, systemic necrotizing vasculitis, viral replication in AIDS, vitiligo, Weber-Christian disease, Wegener's granulomatosis, and Wiskott-Aldrich syndrome.
One aspect of the present invention pertains to methods selected from one or more of the following for: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in an individual; 12) the treatment of a disorder alleviated by inhibiting calcium signaling in cells in an individual; 13) the treatment of a disorder alleviated by correcting improper calcium handling by cells in an individual; 14) the treatment of arrhythmia in an individual; 15) the treatment of ischemia reperfusion-induced arrhythmia in an individual; 16) the treatment of reperfusion-induced myocardial injury in an individual; 17) the treatment of reperfusion-induced cardiomyocyte injury in an individual; 18) the treatment of reperfusion-induced cardiomyocyte cell death in an individual; 19) the treatment of an inflammatory disorder in an individual; 20) providing neuroprotection in an individual; and 21) providing renal protection in an individual; comprising administering to the individual in need thereof or prescribing to the individual in need thereof, a therapeutically effective amount of: A) a compound of the present invention; B) a crystalline form of the present invention; C) a composition of the present invention; D) a pharmaceutical product of the present invention; or E) a pharmaceutical composition of the present invention; each optionally in combination with a therapeutically effective amount of a second pharmaceutical agent.
One aspect of the present invention pertains to the use of: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; each optionally in combination with a second pharmaceutical agent, in the manufacture of a
medicament, selected from one or more of the following for: 1) the treatment of a Mas receptor- mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in an individual; 12) the treatment of a disorder alleviated by inhibiting calcium signaling in cells in an individual; 13) the treatment of a disorder alleviated by correcting improper calcium handling by cells in an individual; 14) the treatment of arrhythmia in an individual; 15) the treatment of ischemia reperfusion-induced arrhythmia in an individual; 16) the treatment of reperfusion-induced myocardial injury in an individual; 17) the treatment of reperfusion-induced cardiomyocyte injury in an individual; 18) the treatment of reperfusion-induced cardiomyocyte cell death in an individual; 19) the treatment of an inflammatory disorder in an individual; 20) providing neuroprotection in an individual; and 21) providing renal protection in an individual.
One aspect of the present invention pertains to: A) compounds of the present invention; B) crystalline forms of the present invention; C) compositions of the present invention; D) pharmaceutical products of the present invention; or E) pharmaceutical compositions of the present invention; each optionally in combination with a second pharmaceutical agent, for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to: A) compounds of the present invention; B) crystalline forms of the present invention; C) compositions of the present invention; D) pharmaceutical products of the present invention; or E) pharmaceutical compositions of the present invention; each optionally in combination with a second pharmaceutical agent, for use in a method selected from one or more for the following: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in an individual; 12) the treatment of a disorder alleviated by inhibiting calcium signaling in cells in an individual; 13) the
treatment of a disorder alleviated by correcting improper calcium handling by cells in an individual; 14) the treatment of arrhythmia in an individual; 15) the treatment of ischemia reperfusion-induced arrhythmia in an individual; 16) the treatment of reperfusion-induced myocardial injury in an individual; 17) the treatment of reperfusion-induced cardiomyocyte injury in an individual; 18) the treatment of reperfusion-induced cardiomyocyte cell death in an individual; 19) the treatment of an inflammatory disorder in an individual; 20) providing neuroprotection in an individual; and 21) providing renal protection in an individual.
One aspect of the present invention pertains to the use of a pharmaceutical agent in combination with: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; in the manufacture of a medicament, selected from one or more of the following for: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in an individual; 12) the treatment of a disorder alleviated by inhibiting calcium signaling in cells in an individual; 13) the treatment of a disorder alleviated by correcting improper calcium handling by cells in an individual; 14) the treatment of arrhythmia in an individual; 15) the treatment of ischemia reperfusion-induced arrhythmia in an individual; 16) the treatment of reperfusion-induced myocardial injury in an individual; 17) the treatment of reperfusion-induced cardiomyocyte injury in an individual; 18) the treatment of reperfusion-induced cardiomyocyte cell death in an individual; 19) the treatment of an inflammatory disorder in an individual; 20) providing neuroprotection in an individual; and 21) providing renal protection in an individual.
One aspect of the present invention pertains to pharmaceutical agents in combination with: A) a compound of the present invention; B) a crystalline form of the present invention; C) a composition of the present invention; D) a pharmaceutical product of the present invention; or E) a pharmaceutical composition of the present invention; for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to pharmaceutical agents in combination with: A) a compound of the present invention; B) a crystalline form of the present invention; C) compositions of the present invention; D) a pharmaceutical product of the present invention; or E) a pharmaceutical composition of the present invention; for use in a method selected from one or more for the following: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder
alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in an individual; 12) the treatment of a disorder alleviated by inhibiting calcium signaling in cells in an individual; 13) the treatment of a disorder alleviated by correcting improper calcium handling by cells in an individual; 14) the treatment of arrhythmia in an individual; 15) the treatment of ischemia reperfusion-induced arrhythmia in an individual; 16) the treatment of reperfusion-induced myocardial injury in an individual; 17) the treatment of reperfusion-induced cardiomyocyte injury in an individual; 18) the treatment of reperfusion-induced cardiomyocyte cell death in an individual; 19) the treatment of an inflammatory disorder in an individual; 20) providing neuroprotection in an individual; and 21) providing renal protection in an individual.
One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method of treatment of the human or animal body by therapy.
One aspect of the present invention pertains to a pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit; each comprising: A) a compound of the present invention; B) a crystalline form of the present invention; or C) a composition of the present invention; in combination with a second pharmaceutical agent; for use in a method selected from one or more for the following: 1) the treatment of a Mas receptor-mediated disorder in an individual; 2) the treatment of a disorder alleviated by vasodilation in an individual; 3) the treatment of a disorder alleviated by vasorelaxation in an individual; 4) the treatment of a disorder alleviated by inhibiting vasoconstriction in an individual; 5) the treatment of a disorder alleviated by promoting normal blood flow in an individual; 6) the treatment of the formation of blood clots following angioplasty in an individual; 7) reducing injury due to blood clot formation in an individual; 8) reducing injury due to blood clot formation following angioplasty in an individual; 9) the treatment of vasoconstriction following coronary bypass surgery in an individual; 10) the treatment of ischemia reperfusion injury during and/or following coronary bypass surgery in an individual; 11) the treatment of ischemia reperfusion myocardial injury during and/or following coronary bypass surgery in an individual; 12) the treatment of a disorder alleviated by inhibiting calcium signaling in cells in an individual; 13) the treatment of a disorder alleviated by correcting improper calcium handling by cells in an individual; 14) the treatment of arrhythmia in an individual; 15) the treatment of ischemia
reperfusion-induced arrhythmia in an individual; 16) the treatment of reperfusion-induced myocardial injury in an individual; 17) the treatment of reperfusion-induced cardiomyocyte injury in an individual; 18) the treatment of reperfusion-induced cardiomyocyte cell death in an individual; 19) the treatment of an inflammatory disorder in an individual; 20) providing neuroprotection in an individual; and 21) providing renal protection in an individual.
One aspect of the present invention pertains to pharmaceutical products of the present invention; methods of the present invention; or pharmaceutical agents of the present invention; wherein the pharmaceutical product comprises a pharmaceutical composition. In some embodiments, the pharmaceutical product comprises a formulation. In some embodiments, the pharmaceutical product comprises a unit dosage form. In some embodiments, the pharmaceutical product comprises a kit. In some embodiments, the pharmaceutical product comprises a combined preparation. In some embodiments, the pharmaceutical product comprises a twin pack.
One aspect of the present invention pertains to methods of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; compositions of the present invention; pharmaceutical products of the present invention;
pharmaceutical compositions of the present invention; or pharmaceutical agents of the present invention; wherein the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered simultaneously, separately, or sequentially. In some embodiments, the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered simultaneously. In some embodiments, the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered separately. In some embodiments, the compound or the crystalline form, and the pharmaceutical agent or the second pharmaceutical agent are administered sequentially. Certain Combination Therapies and Pharmaceutical Agents Related Thereto
The inverse agonists and antagonists described herein can be combined with one or more agents that are known to be useful in the treatment of the condition being treated. These agents may be formulated for administration to the subject as a single pharmaceutical composition with the Mas receptor inverse agonists and antagonists of the present invention, or may be formulated as separate compositions. These compositions may be administered to the subject separately, simultaneously, or sequentially.
Therefore, another aspect of the present invention includes methods of treatment or alleviation of diseases or disorders of the heart, brain, kidney, and reproductive system among others and/or in ameliorating the symptoms thereof, comprising administering to an individual in need thereof a therapeutically effective amount of a compound of Formula (la) or a pharmaceutically acceptable salt, solvate, or hydrate thereof, in combination with one or more additional pharmaceutical agents, as described herein.
One aspect of the present invention relates to compositions of the present invention; methods of the present invention; pharmaceutical products of the present invention; pharmaceutical compositions of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; or pharmaceutical agents of the present invention; wherein the pharmaceutical agent or the second pharmaceutical agent is selected from: an ACE inhibitor, a beta blocker, a calcium channel blocker, a diuretic, a nitrate, a statin, aspirin, an anti-platelet, adenosine, an endothelin receptor antagonist, a PDE5 inhibitor, an anti-TNF agent (i.e., an agent that inhibits the activity of TNF), and a cardioplegic solution.
In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an ACE inhibitor. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a beta blocker. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a calcium channel blocker. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a diuretic. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a nitrate. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a statin. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is aspirin. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an anti-platelet. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is adenosine. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an endothelin receptor antagonist. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a PDE5 inhibitor. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an anti-TNF agent. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a cardioplegic solution.
Non-limiting examples of ACE inhibitors include captopril, zofenopril, enalapril, ramipril, quinapril, perindopril, lisinopril, benazepril, fosinopril, casokinins, lactokinins, and the lactotripeptides Val-Pro-Pro and Ile-Pro-Pro, for example lactotripeptides produced by the probiotic Lactobacillus helveticus or derived from casein. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an ACE inhibitor selected from: captopril, zofenopril, enalapril, ramipril, quinapril, perindopril, lisinopril, benazepril, fosinopril, casokinins, lactokinins, Val-Pro-Pro, and Ile- Pro-Pro.
Non-limiting examples of beta-blockers include non-selective agents such as: alprenolol, bucindolol, carteolol, carvedilol, labetalol, nadolol, penbutolol, pindolol, propranolol, sotalol, and timolol; βΐ -selective agents such as: acebutolol, atenolol, betaxolol, bisoprolol, celiprolol, esmolol, metoprolol, and nebivolol; 2-selective agents such as: butaxamine and (2R,3R)-3-(isopropylamino)-l- (7-methyl-2,3-dihydro-l/f-inden-4-yloxy)butan-2-ol (ICI- 118,551); and 3-selective agents such as (S)- l-(2-ethylphenoxy)-3-((lSr)-l ,2,3,4-tetrahydronaphthalen-l-ylamino)propan-2-ol oxalate (SR 59230A). In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a beta blocker selected from: alprenolol, bucindolol, carteolol, carvedilol, labetalol, nadolol, penbutolol, pindolol, propranolol, sotalol, timolol, acebutolol, atenolol, betaxolol, bisoprolol, celiprolol, esmolol, metoprolol,
nebivolol, butaxamine, (2R,3R)-3-(isopropylamino)-l-(7-methyl-2,3-dihydro-l/f-inden-4-yloxy)butan- 2-ol (ICI-118,551), and (S)-l-(2-ethylphenoxy)-3-((S)-l,2,3,4-tetrahydronaphthalen-l-ylamino)propan- 2-ol oxalate (SR 59230A).
Non-limiting examples of calcium channel blockers include dihydropyridine calcium channel blockers such as: amlodipine, aranidipine, azelnidipine, barnidipine, benidipine, cilnidipine, clevidipine, isradipine, efonidipine, felodipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, and pranidipine; phenylalkylamine calcium channel blockers such as: verapamil and gallopamil; benzothiazepine calcium channel blockers such as diltiazem; and non-selective calcium blockers such as mibefradil, bepridil, fluspirilene, and fendiline. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a calcium channel blocker selected from: amlodipine, aranidipine, azelnidipine, barnidipine, benidipine, cilnidipine, clevidipine, isradipine, efonidipine, felodipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, pranidipine, verapamil, gallopamil, diltiazem, mibefradil, bepridil, fluspirilene, and fendiline.
Non-limiting examples of diuretics include loop diuretics such as: furosemide, ethacrynic acid, torsemide and bumetanide; thiazide-type diuretics such as: hydrochlorothiazide; carbonic anhydrase inhibitors such as acetazolamide and methazolamide; potassium-sparing diuretics such as:
spironolactone, potassium canreonate, amiloride and triamterene; calcium-sparing diuretics such as: the thiazides; osmotic diuretics such as: mannitol and glucose; and low ceiling diuretics such as: the thiazides; and digitalis. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a diuretic selected from: furosemide, ethacrynic acid, torsemide, bumetanide,
hydrochlorothiazide, acetazolamide, methazolamide, spironolactone, potassium canreonate, amiloride, triamterene; a thiazide, mannitol, glucose, and digitalis.
Non-limiting examples of nitrates include amyl nitrite, nitroglycerin, isosorbide dinitrate, isosorbide-5-mononitrate, and erythrityl tetranitrate. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a nitrate selected from: amyl nitrite, nitroglycerin, isosorbide dinitrate, isosorbide-5-mononitrate, and erythrityl tetranitrate.
Non-limiting examples of statins include atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a statin selected from: atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, and simvastatin.
Non-limiting examples of anti-platelet agents include clopidogrel (Plavix®), prasugrel (Effient®), ticlopidine (Ticlid®), and temanogrel. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an anti-platelet selected from: clopidogrel, prasugrel, ticlopidine, and temanogrel.
Non-limiting examples of endothelin receptor antagonists/inhibitors include bosentan, tezosentan, sitaxentan, ambrisentan, atrasentan, BQ-123 (i.e., cyclo(D-trp-D-asp-L-pro-D-val-L-leu)),
and BQ-788 (i.e., N-cw-2,6-dime lpiperidinocarbonyl-L-Y-MeLeu-D-Trp(MeOCO)-D-Nle-OH sodium sal
BQ-123 BQ-788
In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is an endothelin receptor antagonist selected from: bosentan, tezosentan, sitaxentan, ambrisentan, atrasentan, BQ-123, and BQ-788.
Non-limiting examples of PDE5 inhibitors include sildenafil, avanafil, lodenafil, mirodenafil, sildenafil citrate, tadalafil, vardenafil, and udenafil. In some embodiments, the pharmaceutical agent or the second pharmaceutical agent is a PDE5 inhibitor selected from: sildenafil, avanafil, lodenafil, mirodenafil, sildenafil citrate, tadalafil, vardenafil, and udenafil.
Non-limiting examples of agents that inhibit the activity of TNF include small molecules, small interfering RNAs (siRNAs), anti-sense RNAs, antibodies that specifically bind to TNF, soluble TNF receptors, or dominant negative-TNF molecules (such as a dominant negative TNF protein or a nucleic acid encoding a dominant negative TNF protein). It is understood that an agent that inhibits TNF can be one that inhibits the ability of TNF to activate a receptor, but does not inhibit the binding of TNF to the receptor. Anti-TNF antibodies include, e.g., infliximab (Remicade®), D2E7 (adalumimab; Humira™), certolizumab (CDP-870), and CDP-571 (see, e.g., Sandborn et al., Gut 53(10): 1485-1493 (2004); Choy et al., Rheumatology 41(10): 1133-1137 (2002); and Kaushik et al., Expert Opinion on Biological Therapy 5(4):601-606(6) (2005)). Soluble TNF receptors include, e.g., etanercept (sTNF-RILFc;
Enbrel®). Exemplary anti-TNF therapies are described in, e.g., U.S. Patent No. 6,270,766.
Compounds of the present invention can also be used in combination with a cardioplegic solution. As used herein, a cardioplegic or cardioplesia solution is a solution infused into the heart, such as into the aortic root or the coronary ostia, to induce cardiac arrest during heart surgery or as a solution for use in the storage of the heart in preparation for transportation and eventual transplantation into the recipient. Compounds of the present invention can be used in combination with a variety of cardioplegic solutions known in the art. In some embodiments, the cardioplegic solution has a potassium chloride concentration in the range of about 15 mmol L to about 35 mmol/L. In some embodiments, the cardioplegic solution has a potassium chloride concentration in the range of about 20 mmol/L to about 30 mmol/L. Examples of cardioplesia solutions include, but are not limited to, Plegisol™, Celsior®, Custodiol® HTK (Bretschneider' s cardioplegic solution), CoStorSol®
(University of Wisconsin) Solution, St. Thomas' Hospital solution (STH), and National Institutes of Health (NIH) solution.
One aspect of the present invention pertains to compounds of Formula (la) and compositions, pharmaceutical compositions, medicaments, unit dosage forms, methods, uses of compounds, compounds for use, and pharmaceutical products, each comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein.
One embodiment pertains to methods for the treatment of a disorder, as described herein, in an individual comprising administering to an individual in need thereof, a therapeutically effective amount of: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with a therapeutically effective amount of one or more agents selected from the agents as described herein.
One embodiment pertains to uses of: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein, in the manufacture of a medicament for the treatment of a disorder, as described herein, in an individual.
One embodiment pertains to: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein, for use in a method of treatment of the human or animal body by therapy.
One embodiment pertains to: a compound of Formula (la), a composition comprising a compound of Formula (la), a pharmaceutical composition comprising a compound of Formula (la), a medicament comprising a compound of Formula (la), and/or a unit dosage form comprising a compound of Formula (la), in combination with one or more agents selected from the agents as described herein for use, in a method of treatment of one or more disorder as described herein.
In some embodiments, a compound of Formula (la), either alone or present in a composition, a pharmaceutical composition, a medicament, and/or a unit dosage form; and the one or more agents are administered simultaneously, separately, or sequentially.
One aspect of the present invention relates to methods for preparing pharmaceutical products of the present invention comprising the steps: mixing said compound or said crystalline form with a first pharmaceutically acceptable carrier to prepare a compound unit dosage form; mixing said second pharmaceutical agent with a second pharmaceutically acceptable carrier to prepare a second pharmaceutical agent unit dosage form; and combining said compound unit dosage form and said
second pharmaceutical agent unit dosage form in a combined unit dosage form (for example, a combined unit dosage form in a blister pack) for simultaneous, separate, or sequential use.
In some embodiments, the first pharmaceutically acceptable carrier is different from the second pharmaceutically acceptable carrier. In some embodiments, the different pharmaceutically acceptable carriers are suitable for administration by the same route. In some embodiments, the different pharmaceutically acceptable carriers are suitable for administration by different routes. In some embodiments, the first pharmaceutically acceptable carrier is substantially the same as the second pharmaceutically acceptable carrier. In some embodiments, the substantially the same pharmaceutically acceptable carriers are suitable for oral administration.
Certain Indications of the Present Invention:
One aspect of the present invention pertains to methods of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; compositions of the present invention; pharmaceutical products of the present invention;
pharmaceutical compositions of the present invention; or pharmaceutical agents of the present invention; wherein the Mas receptor-mediated disorder is selected from: coronary heart disease, atherosclerosis, ischemia, reperfusion injury, reperfusion injury following cardioplegia, reperfusion injury following angioplasty, angina pectoris, myocardial infarction, no-reflow phenomenon, hypertension, pulmonary hypertension, anxiety, transient ischemic attack, erectile dysfunction, ischemic colitis, mesenteric ischemia, acute limb ischemia, skin discoloration caused by reduced blood flow to the skin, renal artery stenosis, renovascular hypertension, renal failure, chronic kidney disease, and diabetic nephropathy.
In some embodiments, the Mas receptor-mediated disorder is coronary heart disease. In some embodiments, the Mas receptor-mediated disorder is atherosclerosis. In some embodiments, the Mas receptor-mediated disorder is ischemia. In some embodiments, the Mas receptor-mediated disorder is reperfusion injury. In some embodiments, the Mas receptor-mediated disorder is reperfusion injury following cardioplegia. In some embodiments, the Mas receptor-mediated disorder is reperfusion injury following angioplasty. In some embodiments, the Mas receptor-mediated disorder is angina pectoris. In some embodiments, the Mas receptor-mediated disorder is myocardial infarction. In some embodiments, the Mas receptor-mediated disorder is the no-reflow phenomenon. In some
embodiments, the Mas receptor-mediated disorder is hypertension. In some embodiments, the Mas receptor-mediated disorder is pulmonary hypertension. In some embodiments, the Mas receptor- mediated disorder is transient ischemic attack. In some embodiments, the Mas receptor-mediated disorder is erectile dysfunction. In some embodiments, the Mas receptor-mediated disorder is ischemic colitis. In some embodiments, the Mas receptor-mediated disorder is mesenteric ischemia. In some embodiments, the Mas receptor-mediated disorder is acute limb ischemia. In some embodiments, the Mas receptor-mediated disorder is skin discoloration caused by reduced blood flow to the skin. In some embodiments, the Mas receptor-mediated disorder is renal artery stenosis. In some embodiments, the
Mas receptor-mediated disorder is renovascular hypertension. In some embodiments, the Mas receptor- mediated disorder is renal failure. In some embodiments, the Mas receptor-mediated disorder is chronic kidney disease. In some embodiments, the Mas receptor-mediated disorder is diabetic nephropathy.
One aspect of the present invention pertains to methods of the present invention; uses of the present invention; compounds of the present invention; crystalline forms of the present invention; compositions of the present invention; pharmaceutical products of the present invention;
pharmaceutical compositions of the present invention; or pharmaceutical agents of the present invention; for the treatment or in a method of treatment of arrhythmia. In some embodiments, the arrhythmia is tachycardia. In some embodiments, the arrhythmia is bradycardia. In some embodiments, the arrhythmia is supraventricular arrhythmia. In some embodiments, the supraventricular arrhythmia is selected from: atrial fibrillation, atrial flutter, paroxysmal supraventricular tachycardia, and Wolff- Parkinson-White syndrome. In some embodiments, the arrhythmia is ventricular arrhythmia. In some embodiments, the ventricular arrhythmia is selected from: ventricular tachycardia and ventricular fibrillation. In some embodiments, the arrhythmia is reperfusion arrhythmia.
COMPOSITIONS AND FORMULATIONS
One aspect of the present invention pertains to compositions comprising a compound of the present invention.
One aspect of the present invention pertains to compositions comprising a compound of the present invention and a pharmaceutically acceptable carrier.
One aspect of the present invention pertains to compositions obtained by a method of the present invention.
Formulations may be prepared by any suitable method, typically by uniformly mixing the active compound(s) with liquids or finely divided solid carriers, or both, in the required proportions and then, if necessary, forming the resulting mixture into a desired shape.
Conventional excipients, such as binding agents, fillers, acceptable wetting agents, tabletting lubricants and disintegrants may be used in tablets and capsules for oral administration. Liquid preparations for oral administration may be in the form of solutions, emulsions, aqueous or oily suspensions and syrups. Alternatively, the oral preparations may be in the form of dry powder that can be reconstituted with water or another suitable liquid vehicle before use. Additional additives such as suspending or emulsifying agents, non-aqueous vehicles (including edible oils), preservatives and flavorings and colorants may be added to the liquid preparations. Parenteral dosage forms may be prepared by dissolving the compound of the invention in a suitable liquid vehicle and filter sterilizing the solution before lyophilization, or simply filling and sealing an appropriate vial or ampule. These are just a few examples of the many appropriate methods well known in the art for preparing dosage forms.
A compound of the present invention can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers, outside
those mentioned herein, are known in the art; for example, see Remington, The Science and Practice of Pharmacy, 20th Edition, 2000, Lippincott Williams & Wilkins, (Editors: Gennaro et al.)
While it is possible that, for use in the prophylaxis or treatment, a compound of the invention may, in an alternative use, be administered as a raw or pure chemical, it is preferable however to present the compound or active ingredient as a pharmaceutical formulation or composition further comprising a pharmaceutically acceptable carrier.
Pharmaceutical formulations include those suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), vaginal or parenteral (including intramuscular, sub-cutaneous and intravenous) administration or in a form suitable for administration by inhalation, insufflation or by a transdermal patch. Transdermal patches dispense a drug at a controlled rate by presenting the drug for absorption in an efficient manner with minimal degradation of the drug. Typically, transdermal patches comprise an impermeable backing layer, a single pressure sensitive adhesive and a removable protective layer with a release liner. One of ordinary skill in the art will understand and appreciate the techniques appropriate for manufacturing a desired efficacious transdermal patch based upon the needs of the artisan.
The compounds of the invention, together with a conventional adjuvant, carrier, or diluent, may thus be placed into the form of pharmaceutical formulations and unit dosages thereof and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, gels or capsules filled with the same, all for oral use, in the form of suppositories for rectal administration; or in the form of sterile injectable solutions for parenteral (including
subcutaneous) use. Such pharmaceutical compositions and unit dosage forms thereof may comprise conventional ingredients in conventional proportions, with or without additional active compounds or principles and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed.
For oral administration, the pharmaceutical composition may be in the form of, for example, a tablet, capsule, suspension or liquid. The pharmaceutical composition is preferably made in the form of a dosage unit containing a particular amount of the active ingredient. Examples of such dosage units are capsules, tablets, powders, granules or a suspension, with conventional additives such as lactose, mannitol, corn starch or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators such as corn starch, potato starch or sodium carboxymethyl-cellulose; and with lubricants such as talc or magnesium stearate. The active ingredient may also be administered by injection as a composition wherein, for example, saline, dextrose or water may be used as a suitable pharmaceutically acceptable carrier.
Compounds of the present invention and solvates, hydrates and other physiologically functional derivatives thereof can be used as active ingredients in pharmaceutical compositions, specifically as Mas receptor modulators. The term "active ingredient", defined in the context of a "pharmaceutical composition", refers to a component of a pharmaceutical composition that provides the primary pharmacological effect, as opposed to an "inactive ingredient" which would generally be recognized as providing no pharmaceutical benefit.
The dose when using the compounds of the present invention can vary within wide limits and as is customary and is known to the physician, it is to be tailored to the individual conditions in each individual case. It depends, for example, on the nature and severity of the illness to be treated, on the condition of the patient, on the compound employed or on whether an acute or chronic disease state is treated or prophylaxis conducted or on whether further active compounds are administered in addition to the compounds of the present invention. Representative doses of the present invention include, but not limited to, about 0.001 mg to about 5000 mg, about 0.001 mg to about 2500 mg, about 0.001 mg to about 1000 mg, 0.001 mg to about 500 mg, 0.001 mg to about 250 mg, about 0.001 mg to 100 mg, about 0.001 mg to about 50 mg and about 0.001 mg to about 25 mg. Multiple doses may be administered during the day, especially when relatively large amounts are deemed to be needed, for example 2, 3 or 4 doses. Depending on the individual and as deemed appropriate from the patient's physician or caregiver it may be necessary to deviate upward or downward from the doses described herein.
The amount of active ingredient, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will ultimately be at the discretion of the attendant physician or clinician. In general, one skilled in the art understands how to extrapolate in vivo data obtained in a model system, typically an animal model, to another, such as a human. In some circumstances, these extrapolations may merely be based on the weight of the animal model in comparison to another, such as a mammal, preferably a human, however, more often, these extrapolations are not simply based on weights, but rather incorporate a variety of factors.
Representative factors include the type, age, weight, sex, diet and medical condition of the patient, the severity of the disease, the route of administration, pharmacological considerations such as the activity, efficacy, pharmacokinetic and toxicology profiles of the particular compound employed, whether a drug delivery system is utilized, on whether an acute or chronic disease state is being treated or prophylaxis conducted or on whether further active compounds are administered in addition to the compounds of the present invention and as part of a drug combination. The dosage regimen for treating a disease condition with the compounds and/or compositions of this invention is selected in accordance with a variety factors as cited above. Thus, the actual dosage regimen employed may vary widely and therefore may deviate from a preferred dosage regimen and one skilled in the art will recognize that dosage and dosage regimen outside these typical ranges can be tested and, where appropriate, may be used in the methods of this invention.
The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations. The daily dose can be divided, especially when relatively large amounts are administered as deemed appropriate, into several, for example 2, 3 or 4 part administrations. If appropriate, depending on individual behavior, it may be necessary to deviate upward or downward from the daily dose indicated.
The compounds of the present invention can be administrated in a wide variety of oral and parenteral dosage forms. It will be obvious to those skilled in the art that the following dosage forms may comprise, as the active component, either a compound of the invention or a pharmaceutically acceptable salt, solvate, or hydrate of a compound of the invention.
For preparing pharmaceutical compositions from the compounds of the present invention, the selection of a suitable pharmaceutically acceptable carrier can be either solid, liquid or a mixture of both. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories and dispersible granules. A solid carrier can be one or more substances which may also act as diluents, flavoring agents, solubilizers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.
In powders, the carrier is a finely divided solid which is in a mixture with the finely divided active component.
In tablets, the active component is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted to the desire shape and size.
The powders and tablets may contain varying percentage amounts of the active compound. A representative amount in a powder or tablet may contain from 0.5% to about 90% of the active compound; however, an artisan would know when amounts outside of this range are necessary. Suitable carriers for powders and tablets are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter and the like. The term "preparation" refers to the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active component, with or without carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets and lozenges can be used as solid forms suitable for oral administration.
For preparing suppositories, a low melting wax, such as an admixture of fatty acid glycerides or cocoa butter, is first melted and the active component is dispersed homogeneously therein, as by stirring. The molten homogenous mixture is then poured into convenient sized molds, allowed to cool and thereby to solidify.
Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or sprays containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
Liquid form preparations include solutions, suspensions and emulsions, for example, water or water-propylene glycol solutions. For example, parenteral injection liquid preparations can be formulated as solutions in aqueous polyethylene glycol solution. Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that
may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
The compounds according to the present invention may thus be formulated for parenteral administration (e.g. by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The pharmaceutical compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g. sterile, pyrogen-free water, before use.
Compounds of the present invention may be formulated as an aqueous solution, an aqua- alcoholic solution, a solid suspension, an emulsion, a liposomal suspension, or a freeze-dried powder for reconstitution. Such pharmaceutical compositions may be administered directly or as an admixture for further dilution/reconstitution. Route of administration includes intravenous bolus, intravenous infusion, irrigation, and instillation. Suitable solvents include water, alcohols, PEG, propylene glycol, and lipids; pH adjustments using an acid, e.g., HC1 or citric acid, can be used to increase solubility and resulting compositions subjected to suitable sterilization procedures know in the art, such as, aseptic filtration. In some embodiments, the pH of the aqueous solution is about 2.0 to about 4.0. In some embodiments, the pH of the aqueous solution is about 2.5 to about 3.5.
Aqueous formulations suitable for oral use can be prepared by dissolving or suspending the active component in water and adding suitable colorants, flavors, stabilizing and thickening agents, as desired.
Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, or other well-known suspending agents.
Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for oral administration. Such liquid forms include solutions, suspensions and emulsions. These preparations may contain, in addition to the active component, colorants, flavors, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents and the like.
For topical administration to the epidermis the compounds according to the invention may be formulated as ointments, creams or lotions, or as a transdermal patch.
Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and/or gelling agents. Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents.
Formulations suitable for topical administration in the mouth include lozenges comprising active agent in a flavored base, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
Solutions or suspensions are applied directly to the nasal cavity by conventional means, for example with a dropper, pipette or spray. The formulations may be provided in single or multi-dose form. In the latter case of a dropper or pipette, this may be achieved by the patient administering an appropriate, predetermined volume of the solution or suspension. In the case of a spray, this may be achieved for example by means of a metering atomizing spray pump.
Administration to the respiratory tract may also be achieved by means of an aerosol formulation in which the active ingredient is provided in a pressurized pack with a suitable propellant. If the compounds of the present invention or pharmaceutical compositions comprising them are administered as aerosols, for example as nasal aerosols or by inhalation, this can be carried out, for example, using a spray, a nebulizer, a pump nebulizer, an inhalation apparatus, a metered inhaler or a dry powder inhaler. Pharmaceutical forms for administration of the compounds of the present invention as an aerosol can be prepared by processes well known to the person skilled in the art. For their preparation, for example, solutions or dispersions of the compounds of the present invention in water, water/alcohol mixtures or suitable saline solutions can be employed using customary additives, for example benzyl alcohol or other suitable preservatives, absorption enhancers for increasing the bioavailability, solubilizers, dispersants and others and, if appropriate, customary propellants, for example include carbon dioxide, CFCs, such as, dichlorodifluoromethane, trichlorofluoromethane, or dichlorotetrafluoroethane; and the like. The aerosol may conveniently also contain a surfactant such as lecithin. The dose of drug may be controlled by provision of a metered valve.
In formulations intended for administration to the respiratory tract, including intranasal formulations, the compound will generally have a small particle size for example of the order of 10 microns or less. Such a particle size may be obtained by means known in the art, for example by micronization. When desired, formulations adapted to give sustained release of the active ingredient may be employed.
Alternatively the active ingredients may be provided in the form of a dry powder, for example, a powder mix of the compound in a suitable powder base such as lactose, starch, starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidone (PVP). Conveniently the powder carrier will form a gel in the nasal cavity. The powder composition may be presented in unit dose form for example in capsules or cartridges of, e.g., gelatin, or blister packs from which the powder may be administered by means of an inhaler.
Compounds of the present invention may also be administered via a rapid dissolving or a slow release composition, wherein the composition includes a biodegradable rapid dissolving or slow release carrier (such as a polymer carrier and the like) and a compound of the invention. Rapid dissolving or slow release carriers are well known in the art and are used to form complexes that capture therein an
active compound(s) and either rapidly or slowly degrade/dissolve in a suitable environment (e.g., aqueous, acidic, basic, etc.). Such particles are useful because they degrade/dissolve in body fluids and release the active compound(s) therein. The particle size of a compound of the present invention, carrier or any excipient used in such a composition may be optimally adjusted using techniques known to those of ordinary skill in the art.
Particle size can play an important role in formulation. Reducing the size of the particles can be used to modify the physical characteristics. Particle size reduction increases both the number of particles and the amount of surface area per unit of volume. The increased surface area can improve the rate of solvation and therefore solubility. In addition, particle size reduction can improve
gastrointestinal absorption for less soluble compounds. Particle size reduction can be obtained by any of the methods know in the art, for example, precipitation/crystallization, comminution (size reduction by a mechanical process), and the like, see for example Remington, The Science and Practice of Pharmacy, 20th Edition, 2000, Lippincott Williams & Wilkins, (Editors: Gennaro et al).
The pharmaceutical preparations are preferably in unit dosage forms. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.
Tablets or capsules for oral administration and liquids for intravenous administration are preferred compositions.
The compounds according to the invention may optionally exist as pharmaceutically acceptable salts including pharmaceutically acceptable acid addition salts prepared from pharmaceutically acceptable non-toxic acids including inorganic and organic acids. Representative acids include, but are not limited to, acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, dichloroacetic, formic, fumaric, gluconic, glutamic, hippuric, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, oxalic, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, oxalic, j-toluenesulfonic and the like. Certain compounds of the present invention which contain a carboxylic acid functional group may optionally exist as pharmaceutically acceptable salts containing non-toxic, pharmaceutically acceptable metal cations and cations derived from organic bases. Representative metals include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc and the like. In some embodiments the pharmaceutically acceptable metal is sodium. Representative organic bases include, but are not limited to, benzathine
1,2-diamine), chloroprocaine (2-(diethylamino)ethyl 4-(chloroamino)benzoate), choline,
diethanolamine, ethylenediamine, meglumine ((2R,3R,4R,5S)-6-(methylamino)hexane- 1,2, 3,4,5 - pentaol), procaine (2-(diethylamino)ethyl 4-aminobenzoate), and the like. Certain pharmaceutically acceptable salts are listed in Berge, et al , Journal of Pharmaceutical Sciences, 66: 1-19 (1977) and in
"Handbook of Pharmaceutical Salts, Properties, Selection, and Use; Stahl, P. H. and Wermuth, C. G. (Eds.), Wiley- VCH (2002).
The acid addition salts may be obtained as the direct products of compound synthesis. In the alternative, the free base may be dissolved in a suitable solvent containing the appropriate acid and the salt isolated by evaporating the solvent or otherwise separating the salt and solvent. The compounds of this invention may form solvates with standard low molecular weight solvents using methods known to the skilled artisan.
Compounds of the present invention can be converted to "pro-drugs." The term "pro-drugs" refers to compounds that have been modified with specific chemical groups known in the art and when administered into an individual these groups undergo biotransformation to give the parent compound. Pro-drugs can thus be viewed as compounds of the invention containing one or more specialized nontoxic protective groups used in a transient manner to alter or to eliminate a property of the compound. In one general aspect, the "pro-drug" approach is utilized to facilitate oral absorption. A thorough discussion is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems Vol. 14 of the A.C.S. Symposium Series; and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
Some embodiments of the present invention include a method of producing a pharmaceutical composition for "combination-therapy" comprising admixing at least one compound according to any of the compound embodiments disclosed herein, together with at least one known pharmaceutical agent as described herein and a pharmaceutically acceptable carrier.
It is noted that when the Mas receptor modulators are utilized as active ingredients in pharmaceutical compositions, these are not intended for use in humans only, but in non-human mammals as well. Recent advances in the area of animal health-care mandate that consideration be given for the use of active agents, such as Mas receptor modulators, for the treatment of a Mas receptor- associated disease or disorder in companionship animals (e.g., cats, dogs, etc.) and in livestock animals (e.g., horses, cows, chickens, fish, etc.) Those of ordinary skill in the art are readily credited with understanding the utility of such compounds in such settings.
HYDRATES AND SOLVATES
It is understood that when the phrase "pharmaceutically acceptable salts, solvates, and hydrates" or the phrase "pharmaceutically acceptable salt, solvate, or hydrate" is used when referring to compounds described herein, it embraces pharmaceutically acceptable solvates and/or hydrates of the compounds, pharmaceutically acceptable salts of the compounds, as well as pharmaceutically acceptable solvates and/or hydrates of pharmaceutically acceptable salts of the compounds. It is also understood that when the phrase "pharmaceutically acceptable solvates and hydrates" or the phrase "pharmaceutically acceptable solvate or hydrate" is used when referring to salts described herein, it embraces pharmaceutically acceptable solvates and/or hydrates of such salts.
It will be apparent to those skilled in the art that the dosage forms described herein may comprise, as the active component, either a compound described herein or a pharmaceutically acceptable salt or as a pharmaceutically acceptable solvate or hydrate thereof. Moreover, various hydrates and solvates of the compounds described herein and their salts can find use as intermediates in the manufacture of pharmaceutical compositions. Typical procedures for making and identifying suitable hydrates and solvates, outside those mentioned herein, are well known to those in the art; see for example, pages 202-209 of K.J. Guillory, "Generation of Polymorphs, Hydrates, Solvates, and Amorphous Solids," in: Polymorphism in Pharmaceutical Solids, ed. Harry G. Britain, Vol. 95, Marcel Dekker, Inc., New York, 1999. Accordingly, one aspect of the present invention pertains to methods of administering hydrates and solvates of compounds described herein and/or their pharmaceutical acceptable salts, that can be isolated and characterized by methods known in the art, such as, thermogravimetric analysis (TGA), TGA-mass spectroscopy, TGA-Infrared spectroscopy, powder X- ray diffraction (PXRD), Karl Fisher titration, high resolution X-ray diffraction, and the like. There are several commercial entities that provide quick and efficient services for identifying solvates and hydrates on a routine basis. Example companies offering these services include Wilmington
PharmaTech (Wilmington, DE), Avantium Technologies (Amsterdam) and Aptuit (Greenwich, CT).
One aspect of the present invention pertains to solvates of salts of compounds of the present invention. One aspect of the present invention pertains to solvates of a hydrochloride salt of a compound of the present invention. In some embodiments the salt is (S)-.V-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide hydrochloride.
POLYMORPHS AND PSEUDOPOLYMORPHS
Polymorphism is the ability of a substance to exist as two or more crystalline phases that have different arrangements and/or conformations of the molecules in the crystal lattice. Compounds that form polymorphs show the same properties in the liquid or gaseous state, but in the solid state their polymorphs behave differently.
Besides single-component polymorphs, drugs can also exist as salts and other multicomponent crystalline phases. For example, solvates and hydrates may contain an API host and either solvent or water molecules, respectively, as guests. Analogously, when the guest compound is a solid at room temperature, the resulting form is often called a cocrystal. Salts, solvates, hydrates, and cocrystals may show polymorphism as well. Crystalline phases that share the same API host, but differ with respect to their guests, may be referred to as pseudopolymorphs of one another.
Solvates contain molecules of the solvent of crystallization in a definite crystal lattice. Solvates, in which the solvent of crystallization is water, are termed hydrates. Because water is a constituent of the atmosphere, hydrates of drugs may be formed rather easily and may be thermodynamically favored over anhydrous polymorphs.
By way of example, Stanly recently published a polymorph screen of 245 compounds consisting of a "wide variety of structural types" that revealed about 90% of the compounds exhibited multiple solid forms. Overall, approximately half the compounds were polymorphic, often having one to three forms. About one-third of the compounds formed hydrates, and about one-third formed other solvates. Data from cocrystal screens of 64 compounds showed that 60% formed cocrystals other than hydrates or solvates (G. P. Stahly, Crystal Growth & Design (2007), 7(6), 1007-1026).
Crystalline forms, such as those described herein, can be identified by their unique solid state signature with respect to, for example, differential scanning calorimetry (DSC), powder X-ray diffraction (PXRD), and other solid state methods.
Further characterization with respect to water or solvent content of crystalline forms can be determined by any of the following methods, for example, thermogravimetric analysis (TGA), Karl Fischer analysis, and the like.
For DSC, it is known that the temperatures observed will depend upon sample purity, the rate of temperature change, as well as sample preparation technique and the particular instrument employed. Thus, the values reported herein relating to DSC thermograms can vary by plus or minus about 4 °C (+ 4 °C). The values reported herein relating to DSC thermograms can also vary by plus or minus about 20 joules per gram (+ 20 joules per gram).
In some embodiments, the DSC thermogram values reported herein relate to desolvation events. When DSC thermogram values reported herein relate to desolvation events, the values reported herein are estimates. Scan rate and pan closure can influence DSC values for desolvation events, which can vary by plus or minus about 25 °C. DSC values for desolvation events reported herein were recorded using a sample in an aluminum pan with an uncrimped lid and a scan rate of 10 °C/min.
For PXRD, the relative intensities of the peaks can vary, depending upon the sample preparation technique, the sample mounting procedure and the particular instrument employed.
Moreover, instrument variation and other factors can often affect the 2 lvalues. Therefore, the peak assignments of diffraction patterns can vary by plus or minus 0.2 °2Θ (+ 0.2 °2Θ).
For TGA, the features reported herein can vary by plus or minus about 5 °C (+ 5 °C). The TGA features reported herein can also vary by plus or minus about 2% (+ 2%) weight change due to, for example, sample variation.
Further characterization with respect to hygroscopicity of the crystalline forms can be gauged by, for example, dynamic moisture sorption (DMS). The DMS features reported herein can vary by plus or minus about 5% (+ 5%) relative humidity. The DMS features reported herein can also vary by plus or minus about 5% (+ 5%) weight change.
The present invention is directed, inter alia, to crystalline forms of (S)-/V-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide (Compound 17) and salts, solvates, and hydrates thereof. One aspect of the present invention is directed to an anhydrous crystalline form of (lS')-/Y-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-
difluorobenzamide (Compound 17). Another aspect of the present invention is directed to a crystalline form of (lSr)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17) as the hydrochloride salt.
Compound 17, Form I
One aspect of the present invention is directed to an anhydrous crystalline form of (S)-N-(4- chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)- 2,3-difluorobenzamide (Compound 17), Form I. Certain physical properties of Compound 17, Form I are summarized in Table B below.
Table B
DSC, TGA, and DMS data were generated for a blend of samples each demonstrated by PXRD to have the same crystal phase. Compound 17, Form I was anhydrous and had a melting onset of 181 °C (with decomposition). The enthalpy of fusion is a rough estimate, since the baseline of the DSC was not well behaved. DMS data showed that Compound 17, Form I was non-hygroscopic with less than 0.3% weight gain at 90% RH.
Certain powder X-ray diffraction peaks for Compound 17, Form I, are shown in Table C below.
Table C
Pos. (°26 Rel. Int. (%) Pos. (°26 Rel. Int. (%) Pos. (°26 Rel. Int. (%)
5.57 10.19 18.5 30.68 26.33 6.2
5.99 6.21 18.73 77.35 27.08 1.56
7.57 0.91 18.92 51.73 27.83 5.92
8.98 10.15 19.2 12.03 27.9 5.4
9.36 100 19.62 17.21 28.3 2.61
9.82 14 20.14 59.1 29.36 1.33
10.12 9.96 20.73 14.58 30.05 1.67
10.35 6.21 21.45 9.2 30.43 1.48
11.09 22.25 22.22 24.79 31.8 1.6
11.45 11.2 22.8 6.69 32.77 2.4
11.95 11.94 23.1 3.31 32.99 2.96
12.94 6.11 23.59 10.44 33.73 2.26
14.09 72.5 23.91 9.02 34.3 1.17
14.93 21.66 24.59 2.88 35.97 1.6
15.87 2.94 25.1 5.15 37.01 1.28
Pos. (°2Θ) Rel. Int. (%) Pos. (°26 Rel. Int. (%) Pos. (°26 Rel. Int. (%)
16.64 36.01 25.68 12.36 37.87 1.99
17.94 2.17 25.95 4.92
One aspect of the present invention is directed to a crystalline form of Compound 17 having an X-ray powder diffraction pattern comprising a peak, in terms of 2 Θ, at about 9.36 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising a peak, in terms of 2 Θ, at about 18.73 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2Θ, at about 9.36 ° and about 18.73 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 Θ, at about 9.36 ° and about 14.09 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 Θ, at about 9.36 °, about 18.73 ° and about 14.09 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 26» at about 9.36 °, about 18.73 °, about 14.09 °, about 20.14 °, about 18.92 °, about 16.64 °, and about 18.50 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2 Θ, at about 9.36 °, about 18.73 °, about 14.09 °, about 20.14 °, about 18.92 °, about 16.64 °, about 18.50 °, about 22.22 °, about 11.09 °, and about 14.93 °. One aspect of the present invention is directed to a crystalline form of Compound 17 having an X-ray powder diffraction pattern comprising one or more peaks listed in Table C. In some embodiments, the crystalline form has an X-ray powder diffraction pattern substantially as shown in Figure 8, wherein by "substantially" is meant that the reported peaks can vary by about + 0.2 °2 Θ, and also that the relative intensities of the reported peaks can vary.
In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram comprising an endotherm with an extrapolated onset temperature between about 171 °C and about 191 °C. In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram comprising an endotherm with an extrapolated onset temperature at about 181 °C. In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram comprising an endotherm with an associated heat flow of about 87 joules per gram. In some embodiments, the crystalline form of Compound 17 has a differential scanning calorimetry thermogram substantially as shown in Figure 9, wherein by
"substantially" is meant that the reported DSC features can vary by about + 6 °C and by about + 20 joules per gram.
In some embodiments, the crystalline form of Compound 17 has a thermogravimetric analysis profile substantially as shown in Figure 9, wherein by "substantially" is meant that the reported TGA features can vary by about + 5 °C and by about + 2% weight change.
In some embodiments, the crystalline form of Compound 17 has a dynamic moisture sorption profile substantially as shown in Figure 10, wherein by "substantially" is meant that the reported DMS features can vary by about + 5% relative humidity and by about + 5% weight change.
Form I of Compound 17 can be prepared by any of the suitable procedures known in the art for preparing crystalline polymorphs. In some embodiments Form I of Compound 17 can be prepared as described in Example 2.5. In some embodiments, Form I of Compound 17 can be prepared by slurrying solid Compound 17 containing one or more solid forms other than Form I. In some embodiments, the crystalline form of Compound 17 can be prepared by crystallizing or recrystallizing solid Compound 17 containing one or more solid forms other than Form I.
Compound 17 Hydrochloride Salt Solvate
One aspect of the present invention is directed to a solvated crystalline form of (S)-N-(4- Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)- 2,3-difluorobenzamide hydrochloride salt (Compound 17 hydrochloride salt solvate). Certain physical properties of Compound 17 hydrochloride salt solvate are summarized in Table D below.
Table D
TGA analysis showed the hydrochloride salt of Compound 17 to be solvated. The weight loss corresponded to approximately 1.24 mole equivalents of water. Analysis by DSC showed a broad desolvation peak, followed by two other broad endotherms, but no definitive melting endotherm.
Certain powder X-ray diffraction peaks for Compound 17 hydrochloride salt solvate, are shown in Table E below.
Table E
19.22 6.18 26.64 4.48 38.56 0.76
19.49 8.26 26.91 2.73 38.95 0.76
19.88 5.66 27.62 2.58 39.56 0.93
20.21 2.62 28.05 8.33
One aspect of the present invention is directed to a crystalline form of Compound 17 hydrochloride salt solvate having an X-ray powder diffraction pattern comprising a peak, in terms of 2Θ, at about 7.80 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising a peak, in terms of 2 Θ, at about 15.57 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2Θ, at about 7.80 ° and about 15.57 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2Θ, at about 7.80 ° and about 8.32 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2Θ, at about 7.80 °, about 15.57 ° and about 8.32 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2(9, at about 7.80 °, about 15.57 °, about 8.32 °, about 14.05 °, about 21.93 °, about 24.13 °, and about 25.94 °. In some embodiments, the crystalline form has an X-ray powder diffraction pattern comprising peaks, in terms of 2Θ, at about 7.80 °, about 15.57 °, about 8.32 °, about 14.05 °, about 21.93 °, about 24.13 °, about 25.94 °, about 11.72 °, about 17.83 °, and about 17.55. One aspect of the present invention is directed to a crystalline form of Compound 17 hydrochloride salt solvate having an X-ray powder diffraction pattern comprising one or more peaks listed in Table E. In some embodiments, the crystalline form has an X-ray powder diffraction pattern substantially as shown in Figure 11, wherein by "substantially" is meant that the reported peaks can vary by about + 0.2 °2 Θ, and also that the relative intensities of the reported peaks can vary.
In some embodiments, the crystalline form of Compound 17 hydrochloride salt solvate has a differential scanning calorimetry thermogram substantially as shown in Figure 12, wherein by "substantially" is meant that the reported DSC features can vary by about + 6 °C and by about + 20 joules per gram.
In some embodiments, the crystalline form of Compound 17 hydrochloride salt solvate has a thermogravimetric analysis profile substantially as shown in Figure 12, wherein by "substantially" is meant that the reported TGA features can vary by about + 5 °C and by about + 2% weight change.
Compound 17 hydrochloride salt solvate can be prepared by any of the suitable procedures known in the art for preparing crystalline polymorphs. In some embodiments Compound 17
hydrochloride salt solvate can be prepared as described in Example 2.6. In some embodiments,
Compound 17 hydrochloride salt solvate can be prepared by slurrying solid Compound 17
hydrochloride salt solvate containing one or more solid forms other than the form described herein. In some embodiments, the crystalline form of Compound 17 can be prepared by crystallizing or
recrystallizing solid Compound 17 hydrochloride salt solvate containing one or more solid forms other than the form described herein.
OTHER UTILITIES
Another object of the present invention relates to radiolabeled compounds of the present invention that would be useful not only in radio-imaging but also in assays, both in vitro and in vivo, for localizing and quantitating Mas receptors in tissue samples, including human and for identifying Mas receptor ligands by inhibition binding of a radiolabeled compound. It is a further object of this invention to develop novel Mas receptor assays of which comprise such radiolabeled compounds.
The present disclosure includes all isotopes of atoms occurring in the present compounds, intermediates, salts and crystalline forms thereof. Isotopes include those atoms having the same atomic number but different mass numbers. One aspect of the present invention includes every combination of one or more atoms in the present compounds, intermediates, salts, and crystalline forms thereof that is replaced with an atom having the same atomic number but a different mass number. One such example is the replacement of an atom that is the most naturally abundant isotope, such as ¾ or 12C, found in one the present compounds, intermediates, salts, and crystalline forms thereof, with a different atom that is not the most naturally abundant isotope, such as 2H or 3H (replacing ¾), or nC, 13C, or 14C (replacing 12C). A compound wherein such a replacement has taken place is commonly referred to as being an isotopically-labeled compound. Isotopic-labeling of the present compounds, intermediates, salts, and crystalline forms thereof can be accomplished using any one of a variety of different synthetic methods know to those of ordinary skill in the art and they are readily credited with understanding the synthetic methods and available reagents needed to conduct such isotopic-labeling. By way of general example, and without limitation, isotopes of hydrogen include 2H (deuterium) and 3H (tritium). Isotopes of carbon include nC, 13C, and 14C. Isotopes of nitrogen include 13N and 15N. Isotopes of oxygen
15 17 18 18 32 33 include O, O, and C. Isotope of fluorine include F. Isotopes of phosphorous include P and P. Isotopes of sulfur include 35S. Isotopes of chlorine include 36C1. Isotopes of bromine include 75Br, 76Br,
77 82 123 124 125 131
Br, and Br. Isotopes of iodine include I, I, I, and I. Another aspect of the present invention includes compositions, such as, those prepared during synthesis, preformulation, and the like, and pharmaceutical compositions, such as, those prepared with the intent of using in a mammal for the treatment of one or more of the disorders described herein, comprising one or more of the present compounds, intermediates, salts, and crystalline forms thereof, wherein the naturally occurring distribution of the isotopes in the composition is perturbed. Another aspect of the present invention includes compositions and pharmaceutical compositions comprising compounds as described herein wherein the compound is enriched at one or more positions with an isotope other than the most naturally abundant isotope. Methods are readily available to measure such isotope perturbations or enrichments, such as, mass spectrometry, and for isotopes that are radio-isotopes additional methods are available, such as, radio-detectors used in connection with HPLC or GC.
Certain isotopically-labeled compounds of the present invention are useful in compound and/or substrate tissue distribution assays. In some embodiments the radionuclide 3H and/or 14C isotopes are useful in these studies. Further, substitution with heavier isotopes such as deuterium (i.e. , 2H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances.
Isotopically labeled compounds of the present invention can generally be prepared by following procedures analogous to those disclosed in the Drawings and Examples by substituting an isotopically labeled reagent for a non-isotopically labeled reagent. Other synthetic methods that are useful are discussed below. Moreover, it should be understood that all of the atoms represented in the compounds of the invention can be either the most commonly occurring isotope of such atoms or a scarcer radioisotope or nonradioactive isotope.
Synthetic methods for incorporating radio-isotopes into organic compounds are applicable to compounds of the invention and are well known in the art. These synthetic methods, for example, incorporating activity levels of tritium into target molecules, are as follows:
A. Catalytic Reduction with Tritium Gas: This procedure normally yields high specific activity products and requires halogenated or unsaturated precursors.
B. Reduction with Sodium Borohydride [¾] : This procedure is rather inexpensive and requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters and the like.
C. Reduction with Lithium Aluminum Hydride [3H] : This procedure offers products at almost theoretical specific activities. It also requires precursors containing reducible functional groups such as aldehydes, ketones, lactones, esters and the like.
D. Tritium Gas Exposure Labeling: This procedure involves exposing precursors containing exchangeable protons to tritium gas in the presence of a suitable catalyst.
E. N-Methylation using Methyl Iodide [3H] : This procedure is usually employed to prepare O- methyl or N-methyl (3H) products by treating appropriate precursors with high specific activity methyl iodide (3H). This method in general allows for higher specific activity, such as for example, about 70-90 Ci/mmol.
Synthetic methods for incorporating activity levels of 125I into target molecules include:
A. Sandmeyer and like reactions: This procedure transforms an aryl amine or a heteroaryl amine into a diazonium salt, such as a diazonium tetrafluoroborate salt and subsequently to 125I labeled compound using Na125I. A representative procedure was reported by Zhu, G-D. and co-workers in J. Org. Chem., 2002, 67, 943-948.
B. Ortho 125Iodination of phenols: This procedure allows for the incorporation of 125I at the ortho position of a phenol as reported by Collier, T. L. and co-workers in J. Labelled Compd.
Radiopharm., 1999, 42, S264-S266.
C. Aryl and heteroaryl bromide exchange with 125I: This method is generally a two step process. The first step is the conversion of the aryl or heteroaryl bromide to the corresponding tri-alkyltin
intermediate using for example, a Pd catalyzed reaction [i.e. Pd(Ph3P)4] or through an aryl or heteroaryl lithium, in the presence of a tri-alkyltinhalide or hexaalkylditin [e.g., (CH3)3SnSn(CH3)3] . A representative procedure was reported by Le Bas, M.-D. and co-workers in J. Labelled Compd.
Radiopharm. 2001, 44, S280-S282.
A radiolabeled form of a compound of Formula (la) can be used in a screening assay to identify/evaluate compounds. In general terms, a newly synthesized or identified compound (i.e., test compound) can be evaluated for its ability to reduce binding of a radiolabeled form of a compound of Formula (la) to a Mas receptor. The ability of a test compound to compete with a radiolabeled form of a compound of Formula (la) for the binding to a Mas receptor directly correlates to its binding affinity.
Certain labeled compounds of the present invention bind to certain Mas receptors. In one embodiment the labeled compound has an IC50 less than about 500 μΜ. In one embodiment the labeled compound has an IC50 less than about 100 μΜ. In one embodiment the labeled compound has an IC50 less than about 10 μΜ. In one embodiment the labeled compound has an IC50 less than about 1 μΜ. In one embodiment the labeled compound has an IC50 less than about 0.1 μΜ. In one embodiment the labeled compound has an IC50 less than about 0.01 μΜ. In one embodiment the labeled compound has an IC50 less than about 0.005 μΜ.
Other uses of the disclosed receptors and methods will become apparent to those skilled in the art based upon, inter alia, a review of this disclosure.
As will be recognized, the steps of the methods of the present invention need not be performed any particular number of times or in any particular sequence. Additional objects, advantages, and novel features of this invention will become apparent to those skilled in the art upon examination of the following examples thereof, which are intended to be illustrative and not intended to be limiting. EXAMPLES
Example 1: Syntheses of Compounds of the Present Invention.
Illustrated syntheses for compounds of the present invention are shown in Figures 1 to 5 wherein the variables R1, R2, R3, R4, R5, and R6 have the same definitions as used throughout this disclosure.
The compounds of the invention and their syntheses are further illustrated by the following examples. The following examples are provided to further define the invention without, however, limiting the invention to the particulars of these examples. The compounds described herein, supra and infra, are named according to AutoNom version 2.2, AutoNom 2000, CS ChemDraw Ultra Version 7.0.1, CS ChemDraw Ultra Version 9.0.7, or ChemBioDraw Ultra 12.0.2.1076. In certain instances common names are used and it is understood that these common names would be recognized by those skilled in the art.
Proton nuclear magnetic resonance (¾ NMR) spectra were recorded on a Bruker Avance-400 equipped with a QNP (Quad Nucleus Probe) or a BBI (Broad Band Inverse) and z-gradient. Chemical
shifts are given in parts per million (ppm) with the residual solvent signal used as reference. NMR abbreviations are used as follows: s = singlet, d = doublet, dd = doublet of doublets, ddd = doublet of doublet of doublets, dt = doublet of triplets, t = triplet, td = triplet of doublets, tt = triplet of triplets, q = quartet, m = multiplet, br = broad, bs = broad singlet, bt = broad triplet. Microwave irradiations were carried out using a Smith Synthesizer TM or an Emrys Optimizer TM (Biotage). Thin-layer chromatography (TLC) was performed on silica gel 60 F254 (Merck), preparatory thin-layer chromatography (prep TLC) was preformed on PK6F silica gel 60 A 1 mm plates (Whatman) and column chromatography was carried out on a silica gel column using Kieselgel 60, 0.063-0.200 mm (Merck). Evaporation was done under reduced pressure on a Biichi rotary evaporator.
LCMS spec: HPLC-pumps: LC-10AD VP, Shimadzu Inc.; HPLC system controller: SCL-IOA
VP, Shimadzu Inc; UV-Detector: SPD-10A VP, Shimadzu Inc; Autosampler: CTC HTS, PAL, Leap Scientific; Mass spectrometer: API 150EX with Turbo Ion Spray source, AB MDS Sciex; Software: Analyst 1.2. Example 1.1: Preparation of 4-(Aminomethyl)-N-(4-chloro-2-(4-(3,3,3-trifluoropropyl) piperazin- l-yl)phenyl)-2-fluorobenzamide (Intermediate 1).
Step A: Preparation of 4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline.
Piperazine (36.8 g, 427 mmol) was dissolved in isopropanol (IPA, 150 mL) and the resulting solution was cooled in an ice bath. 4-Chloro-2-fluoro-l -nitrobenzene (25 g, 142 mmol), pre -dissolved in IPA (100 mL), was added to the solution slowly via an addition funnel. Upon completion of the addition, the reaction was warmed to room temperature and stirred overnight. The next day, the solvent was evaporated and the residue was partitioned between H20 (200 mL) and EtOAc (200 mL). The aqueous layer was further extracted with EtOAc (2 X 200 mL). The organic layers were combined, and washed with H20 brine (500 mL). The organic layer was dried over MgS04 and concentrated to yield l-(5-chloro-2-nitrophenyl)piperazine as a reddish oil. This material was dissolved in THF (50 mL) and MeOH (10 mL) and diisopropylethylamine (DIEA) (49.7 mL, 285 mmol) and 3-bromo- 1,1, 1 - trifluoropropane (22.84 mL, 214 mmol) were added. The reaction was refluxed overnight. The next day, the reaction was around 70% complete. Thus, more 3-bromo- 1,1,1 -trifluoropropane (10 mL) and DIEA (20 mL) were added and the reaction was again heated to reflux overnight. The solvent was evaporated to yield l-(5-chloro-2-nitrophenyl)-4-(3,3,3-trifluoropropyl)piperazine, as a reddish-yellow waxy solid. The solid was dissolved in EtOH (150 mL) and the reaction was cooled in an ice bath. To the stirring solution was added SnCl2 (81 g, 427 mmol) portionwise (in 10 g portions; allowing the tin chloride to fully dissolve and the reaction to cool in between). Upon completion of the addition, the reaction was heated at 80 °C for 1 h. The reaction was cooled in an ice bath and aqueous NaOH (50 wt%) was added portionwise (in -20 mL portions). DCM, and H20 were added (enough to sufficiently dissolve the tin chloride and form two layers separable in a separation funnel; -1.2 L each). The organic layer was removed and the aqueous layer was extracted with DCM (2 X 1 L). The organic layers were combined, dried, and concentrated. The residue was purified by column chromatography to give the
title compound as a light-yellow/tan solid (42.7 g). LCMS m/z = 308.2 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 2.43 - 2.66 (m, 8H) 2.76 - 2.89 (m, 4H) 4.81 - 4.82 (m, 2H) 6.69 (d, J = 8.21 Hz, 1H) 6.82 - 6.89 (m, 2H).
Step B: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- cyano-2-fluorobenzamide.
To a suspension of 4-cyano-2-fluorobenzoic acid (0.537 g, 3.25 mmol) in DCM (10 mL), was added oxalyl chloride (1.422 ml, 16.25 mmol) followed by few drops of DMF. After stirring for 2 h, the reaction was concentrated under reduced pressure. The residue was dissolved in fresh DCM (10 mL) and treated with 4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline (1.0 g, 3.25 mmol) followed by triethylamine (0.329 g, 3.25 mmol) at an ambient temperature. After stirring for 1 h, the reaction was washed with water, dried over MgS04, and then concentrated under reduced pressure. The residue was triturated with methanol and filtered to give the title compound (1.25 g). LCMS m/z = 455.3 [M+H]+.
Step C: Preparation of 4-(Aminomethyl)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl) piperazin-l-yl)phenyl)-2-fluorobenzamide (Intermediate 1).
To a suspension of iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-cyano-2- fluorobenzamide (0.1 g, 0.220 mmol) and cobalt(II) chloride hexahydrate (0.105 g, 0.440 mmol) in methanol (2 mL), was added NaBH4 (0.083 g, 2.199 mmol) at 0 °C. After stirring for 1 h at room temperature, the reaction was concentrated under reduced pressure. The residue was quenched with 2 M HC1 and washed with ether. The aqueous layer was basified with 1 M NaOH, and then extracted with DCM. The organic layer was dried over MgS04 and concentrated under reduced pressure. The residue was purified by column chromatography to give the title compound (0.056 g). LCMS m/z = 459.2
[M+H]+.
Example 1.2: Preparation of 4-(Aminomethyl)-N-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin- l-yl)phenyl)-2,3-difluorobenzamide (Intermediate 2).
Step A: Preparation of Ethyl 4-(Bromomethyl)-2,3-difluorobenzoate.
To a solution of ethyl 2,3-difluoro-4-methylbenzoate (1.0 g, 5.00 mmol) in CC14 (20 mL), was added l-bromopyrrolidine-2,5-dione (1.07 g, 5.99 mmol) followed by benzoic peroxyanhydride (0.12 g, 0.50 mmol). The reaction was heated at 90 °C for 3 h, cooled to room temperature and filtered. The filtrate was concentrated under reduced pressure and the residue was used for the next step without further purification.
Step B: Preparation of 4-((ieri-Butoxycarbonylamino)methyl)-2,3-difluorobenzoic Acid.
To a solution of ethyl 4-(bromomethyl)-2,3-difluorobenzoate (3.0 g, 10.75 mmol) in DCM (5 mL), was added potassium l,3-dioxoisoindolin-2-ide (1.991 g, 10.75 mmol) at ambient temperature. The reaction was stirred at room temperature, washed with water, and purified with silica gel column chromatography to give a solid. The solid material was dissolved in ethanol (50 mL) and hydrazine (0.689 g, 21.50 mmol) was added. After stirring for 2 h at 80 °C, the reaction was concentrated under reduced pressure and the residue was extracted with ethyl acetate. The ethyl acetate layer was dried
over MgS04 and concentrated under reduced pressure. The residue was dissolved in DCM (10 mL) and di-feri-butyl dicarbonate (2.58 g, 11.82 mmol) and DIEA (1.528 g, 11.82 mmol) was added. After stirring for 2 h at room temperature, the mixture was washed with water, dried over MgS04, and then concentrated under reduced pressure. The residue was dissolved in THF (10 mL) and a solution of LiOH (2 g) in H20 (10 mL) was added. After stirring for 5 h, the reaction mixture was concentrated to 10 mL under reduced pressure and acidified with 2 M HC1 to pH = 5. The resulting solid was filtered, washed with water, and dried under reduced pressure to give the title compound (1.38 g). ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.42 (s, 9H), 4.27 (d, J = 4.2 Hz, 2H), 7.21 (m, 2H), 7.52 (m, 1H), 7.68 (m, 1H), 12.1 (br, 1H).
Step C: Preparation of 4-(Aminomethyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Intermediate 2).
To a solution of 4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline (1.0 g, 3.25 mmol) in DMF (2 mL), were added 4-((feri-butoxycarbonylamino)methyl)-2,3-difluorobenzoic acid (0.933 g, 3.25 mmol), HATU (1.236 g, 3.25 mmol), and DIEA (0.420 g, 3.25 mmol) at ambient temperature. After stirring for 12 h, the reaction was extracted with ethyl acetate, dried over MgS04, and concentrated under reduced pressure. The residue was treated with 4 M HC1 in dioxane (2 mL) and stirred for 5 h. The mixture was concentrated under reduced pressure. The residue was poured into water and 1 M NaOH was added to adjust to pH 8. The mixture was extracted with ethyl acetate, dried over MgS04, and concentrated under reduced pressure to give the title compound (1.3 g). LCMS m/z = 477.5 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 9.75 (d, J = 8.4 Hz, 1H), 8.23 (d, J = 8.7 Hz, 1H), 7.75(m, 1H), 7.51 (m, 1H), 7.32 (s, 1H), 7.25 (m, 1H), 3.85 (s, 2H), 3.31 - 3.52 (br, 2H), 2.71 - 2.43 (br, 10H), 2.12 - 2.32 (br, 2H).
Example 1.3: Preparation of 2,5-Dioxopyrrolidin-l-yl 4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzylcarbamate (Intermediate 3).
To a solution of Intermediate 2 (1.05 g, 2.202 mmol) in DMF (1 mL), was added bis(2,5- dioxopyrrolidin- l-yl) carbonate (0.564 g, 2.202 mmol) at room temperature. The reaction was stirred for 1 h. The resulting solution comprising Intermediate 3 was used without further purification. Example 1.4: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 2).
To a solution of 4-(aminomethyl)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2-fluorobenzamide (15 mg, 0.033 mmol, Intermediate 1) and DIEA (4.22 mg, 0.033 mmol) in DMF (1 mL), was added bis(2,5-dioxopyrrolidin-l -yl) carbonate (8.37 mg, 0.033 mmol). After stirring for 30 min, 2-aminoethanol (1.997 mg, 0.033 mmol) was added. The reaction was heated to 100 °C for 30 min. The reaction was purified by HPLC to give the title compound (10 mg, 56.0%). LC/MS m/z = 546.2 [M+H]+. ¾ NMR (400 MHz, DMSO- ) δ ppm 2.89-3.51 (br, 16H), 4.35 (m, 2H), 4.80
(br, 1H), 6.12 (m, 1H), 6.61 (m, 1H), 7.23-7.38 (m, 3H) 7.40 (s, 1H), 7.90 (m, 1H), 8.31 (d, J = 8.0Hz, 1H), 9.65 (d, / = 8.4Hz, 1H).
Example 1.5: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-(methylsulfonylmethyl)ureido)methyl)benzamide (Compound 3).
From Intermediate 1 and methylsulfonylmethanamine, the title compound was obtained using a method similar to that described in Example 1.4. LCMS mlz = 595.4 [M+H]+.
Example 1.6: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-piperidin-4-ylureido)methyl)benzamide (Compound 5).
To a solution of 4-(aminomethyl)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2-fluorobenzamide (15 mg, 0.033 mmol) and DIEA (4.22 mg, 0.033 mmol) in DMF (2 mL), was added bis(2,5-dioxopyrrolidin-l -yl) carbonate (8.37 mg, 0.033 mmol). After stirring for 30 min, feri-butyl 4-aminopiperidine-l-carboxylate (6.55 mg, 0.033 mmol) was added. The reaction was heated to 100 °C for 30 min. The reaction was extracted with ethyl acetate and concentrated under vacuum. The resulting residue was treated with 4.0 M HC1 in dioxane and stirred overnight. The reaction mixture was concentrated under reduced pressure and purified by HPLC to give the title compound (10.2 mg, 53.3%). LC MS m/z = 585.5 [M+H]+. ¾ NMR (400 MHz, DMSO- ) δ ppm 1.31-1.39 (m, 2H), 1.82-1.89 (m, 2H), 2.72-3.49 (br, 17H), 4.12 (m, 2H), 4.62 (br, 1H), 6.27(m, 1H), 6.35(m, 1H), 7.12-7.03 (m, 3H), 7.20(s, 1H), 8.13(m, 1H), 8.34 (d, J = 8.0Hz, 1H), 9.45 (d, J = 8.3Hz, 1H).
Example 1.7: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3- (2-cyanoethyl)-3-methylureido)methyl)-2-fluorobenzamide (Compound 6) .
From Intermediate 1 and 3-(methylamino)propanenitrile, the title compound was obtained using a method similar to that described in Example 1.4. LCMS mlz = 569.3 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) ppm 2.72 ( m, 2H), 2.80 - 3.35 (br, 12H), 2.90 (s, 3H), 3.52 (m, 2H), 4.36 (d, J = 8.4 Hz, 2H), 7.19 - 7.40 (m, 4H), 7.41 (s, 1H), 7.89 (m, 1H), 8.34 (d, J = 8.7 Hz, 1H), 9.67 (d, J = 8.4 Hz, 1H). Example 1.8: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2- fluoro-4-((3-piperidin-3-ylureido)methyl)benzamide (Compound 7).
From Intermediate 1 and (S)-tert-b tyl 3-aminopiperidine-l-carboxylate, the title compound was obtained using a method similar to that described in Example 1.6. LCMS mlz = 585.4 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) ppm 1.27 - 1.59 (br, 2H), 1.65 - 1.72 (br, 2H), 2.98 - 3.49 (br, 15H), 3.62 (m, 1H), 4.25 (m, 4H), 6.25 (d, J = 9 Hz, 1H), 6.55 (m, 1H), 7.06 - 7.21 (m, 3H), 7.22 (s, 1H), 7.74 (m, 1H), 8.54 (d, J = 8.4 Hz, 1H), 9.49 (d, J = 8.4 Hz, 1H).
Example 1.9: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2-fluoro-4-((3-pyrrolidin-3-ylureido)methyl)benzamide (Compound 8).
From Intermediate 1 and (R)-feri-butyl 3-aminopyrrolidine-l-carboxylate, the title compound was obtained using a method similar to that described in Example 1.6. LCMS mlz = 571.2 [M+H]+.
Example 1.10: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2-fluoro-4-((3-(pyrrolidin-2-ylmethyl)ureido)methyl)benzamide (Compound 9).
From Intermediate 1 and (S)-tert-b tyl 2-(aminomethyl)pyrrolidine-l-carboxylate, the title compound was obtained using a method similar to that described in Example 1.6. LCMS mlz = 585.4 [M+H]+.
Example 1.11: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2-fluoro-4-((3-(pyrrolidin-2-ylmethyl)ureido)methyl)benzamide (Compound 10).
From Intermediate 1 and (R)-feri-butyl 2-(aminomethyl)pyrrolidine-l-carboxylate, the title compound was obtained using a method similar to that described in Example 1.6. LCMS mlz = 585.3 [M+H]+.
Example 1.12: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 11).
To a solution of Intermediate 3 (25 mg, 0.040 mmol) in DMF (1 mL), was added 2- aminoethanol (2.471 mg, 0.040 mmol), followed by a few drops of DIEA at room temperature. The reaction was heated at 50 °C for 1 h. After cooling, the precipitate was filtered off and purified by HPLC to give the title compound (18 mg). LCMS mlz = 564.3 [M+H]+. Example 1.13: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2-cyanoethyl)-3-methylureido)methyl)-2,3-difluorobenzamide (Compound 12).
From Intermediate 3 and 3-(methylamino)propanenitrile, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 587.5 [M+H]+. Example 1.14: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-methyl-3-(l-methylpiperidin-4-yl)ureido)methyl)benzamide (Compound 13).
From Intermediate 3 and iV,l-dimethylpiperidin-4-amine, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 631.6 [M+H]+. Example 1.15: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxyethyl)-3-methylureido)methyl)benzamide (Compound 14).
From Intermediate 3 and 2-(methylamino)ethanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 578.6 [M+H]+.
Example 1.16: Preparation of 4-((3-(2-Amino-2-oxoethyl)ureido)methyl)-N-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 15).
From Intermediate 3 and 2-aminoacetamide hydrochloride, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 577.5 [M+H]+.
Example 1.17: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2-(dimethylamino)ethyl)ureido)methyl)-2,3-difluorobenzamide (Compound 16).
From Intermediate 3 and A^A^-dimemylethane-l^-diamine, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 591.4 [M+H]+.
Example 1.18: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17).
From Intermediate 3 and (S)-3-aminopropane-l,2-diol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 594.4 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) ppm 2.72 - 2.95 (m, 2H), 3.15 - 3.59 (br, 13H), 3.51 - 4.01 (br, 2H), 3.61 (m, IH), 4.15 (br, IH), 4.25 (s, 2H), 5.95 (br, IH), 6.55 (m, IH), 7.10 - 7.22 (m, 2H), 7.21(s, IH), 7.50(m, IH), 8.15 (d, J = 8.4 Hz, IH), 9.52 (d, J = 8.1 Hz, IH). Example 1.19: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l/f,2S)-2-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 18).
From Intermediate 3 and (lS,2R)-2-aminocyclohexanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 618.4 [M+H]+. Example 1.20: Preparation of 4-((3,3-Bis(2-hydroxyethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 19).
From Intermediate 3 and 2,2'-azanediyldiethanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 608.8 [M+H]+. Example 1.21: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l-hydroxycyclohexyl)methyl)ureido)methyl)benzamide (Compound 20).
From Intermediate 3 and l-(aminomethyl)cyclohexanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 632.7 [M+H]+. Example 1.22: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(l-hydroxy-2-methylpropan-2-yl)ureido)methyl)benzamide (Compound 21).
From Intermediate 3 and 2-amino-2-methylpropan- l-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS mlz = 592.5 [M+H]+.
Example 1.23: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(2-hydroxypropyl)ureido)methyl)benzamide (Compound 22).
From Intermediate 3 and (R)- l-aminopropan-2-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 578.6 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) ppm 1.10 (d, 7 = 6.5 Hz, 3H), 2.91 - 3.05 (m, 2H), 3.15 - 3.69 (br, 12H), 3.61 (m, 1H), 4.15 (br, 1H), 4.32 (s, 2H), 6.15 - 6.21 (br, 1H), 6.75 (br, 1H), 7.21 - 7.32 (m, 2H), 7.52(s, 1H), 7.65 (m, 1H), 8.20 (d, J = 8.1 Hz, 1H), 9.65 (d, J = 8.2 Hz, 1H). Example 1.24: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(2-hydroxypropyl)ureido)methyl)benzamide (Compound 23).
From Intermediate 3 and (¾-l-aminopropan-2-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 578.6 [M+H]+. Example 1.25: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-((2/f,3/f)-l,3-dihydroxybutan-2-yl)ureido)methyl)-2,3-difluorobenzamide (Compound 24).
From Intermediate 3 and (2R,3R)-2-aminobutane-l,3-diol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 608.7 [M+H]+. Example 1.26: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(2-(2-(hydroxymethyl)pyrrolidin-l-yl)ethyl)ureido)methyl)benzamide
(Compound 25).
From Intermediate 3 and (¾-(l-(2-aminoethyl)pyrrolidin-2-yl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 647.5 [M+H]+.
Example 1.27: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(2-(2-(hydroxymethyl)pyrrolidin-l-yl)ethyl)ureido)methyl)benzamide
(Compound 26).
From Intermediate 3 and (R)-(l-(2-aminoethyl)pyrrolidin-2-yl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 647.6 [M+H]+.
Example 1.28: Preparation of 4-((3-(3-(l/ -Imidazol-l-yl)propyl)ureido)methyl)-N-(4-chloro-2-(4- (3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluorobenzamide (Compound 4).
From Intermediate 1 and [3-(l/f-imidazol-l -yl)propan-l -amine, the title compound was obtained using a method similar to that described in Example 1.4. LCMS m/z = 610.6 [M+H]+.
Example 1.29: Preparation of 4-((3-(2-Aminoethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-2-fluorobenzamide (Compound 1).
From Intermediate 1 and ethane- 1,2-diamine, the title compound was obtained using a method similar to that described in Example 1.4. LCMS m/z = 545.4 [M+H]+.
Example 1.30: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxy-3-methylbutan-2-yl)ureido)methyl)benzamide (Compound 38).
To a vial containing a solution of bis(2,5-dioxopyrrolidin-l-yl)carbonate (5.91 mg, 0.023 mmol) in DMF (0.1 mL) was added a solution of Intermediate 2 (10 mg, 0.021 mmol) in DMF (0.1 mL). To the resulting solution was added DIEA (30.0 μΕ, 0.172 mmol) and the reaction was stirred for 15 min at room temperature. After this time, (¾-2-amino-3-methylbutan-l -ol (2.6 mg, 0.025 mmol) was added and the reaction was heated to 80 °C for 1 h. The mixture was purified by preparative
LC/MS to give the title compound. LCMS m/z = 606.8 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 0.78-0.93 (m, 6H), 1.73-1.89 (m, 1H), 2.80-2.97 (m, 2H), 3.03-3.27 (m, 4H), 3.27-3.35 (m, 2H), 3.35-3.43 (m, 3H), 3.43-3.54 (m, 3H), 3.71 -3.83 (m, 2H), 4.36 (d, 7 = 4.04 Hz, 2H), 5.89 (d, 7 = 8.34 Hz, 1H), 6.48-6.60 (m, 1H), 7.19-7.32 (m, 2H), 7.36 (d, 7 = 2.15 Hz, 1H), 7.61 (t, 7 = 7.26 Hz, 1H), 8.16 (d, 7 = 7.83 Hz, 1H), 9.67 (d, 7 = 4.80 Hz, 1H).
Example 1.31: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxypropan-2-yl)ureido)methyl)benzamide (Compound 39).
From Intermediate 2 and (R)-2-aminopropan-l-ol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 578.4 [M+H]+.
Example 1.32: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxy-3-methylbutan-2-yl)ureido)methyl)benzamide (Compound 40).
From Intermediate 2 and (R)-2-amino-3-methylbutan-l-ol, using a method similar to that described in Example 1.30, the title compound was obtained. Exact mass calculated for
C27H33C1F5N503: 605.2, found: LCMS m/z = 606.6 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 0.79-0.93 (m, 6H), 1.72-1.89 (m, 1H), 2.72-2.94 (m, 2H), 2.94-3.77 (m, 14H), 4.35 (d, 7 = 5.81 Hz, 2H), 5.88 (d, 7 = 8.46 Hz, 1H), 6.50 (t, 7 = 6.13 Hz, 1H), 7.22-7.31 (m, 2H), 7.36 (d, 7 = 2.15 Hz, 1H), 7.62 (t, 7 = 6.88 Hz, 1H), 8.17 (d, 7 = 8.46 Hz, 1H), 9.67 (d, 7 = 5.05 Hz, 1H).
Example 1.33: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((lS,2/f)-2-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 41).
From Intermediate 2 and (lR,2S)-2-aminocyclohexanol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 618.4 [M+H]+.
Example 1.34: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(l,3-dihydroxy-2-methylpropan-2-yl)ureido)methyl)-2,3-difluorobenzamide (Compound 42).
From Intermediate 2 and 2-amino-2-methylpropane-l ,3-diol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 608.6 [M+H]+.
Example 1.35: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(3-hydroxypropyl)ureido)methyl)benzamide (Compound 43).
From Intermediate 2 and 3-aminopropan-l-ol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 578.6 [M+H]+.
Example 1.36: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(l-(hydroxymethyl)cyclopentyl)ureido)methyl)benzamide (Compound 44).
From Intermediate 2 and (l-aminocyclopentyl)methanol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 618.4 [M+H]+.
Example 1.37: Preparation of 4-((3-ieri-Butyl-3-(2-hydroxyethyl)ureido)methyl)-N-(4-Chloro-2- (4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 46).
From Intermediate 2 and 2-(feri-butylamino)ethanol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 620.6 [M+H]+.
Example 1.38: Preparation of 2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethanesulfonic acid (Compound 48).
From Intermediate 2 and 2-aminoethanesulfonic acid, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 628.4 [M+H]+.
Example 1.39: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-ethyl-3-(2-hydroxyethyl)ureido)methyl)-2,3-difluorobenzamide (Compound 49).
From Intermediate 2 and 2-(ethylamino)ethanol, using a method similar to that described in Example 1.30, the title compound was obtained. LCMS m/z = 592.0 [M+H]+.
Example 1.40: Preparation of N-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)-4-(trifluoromethyl)piperidine-l-carboxamide
(Compound 27).
From Intermediate 3 and 4-(trifluoromethyl)piperidine, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 656.6 [M+H]+. Example 1.41: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((lr,4r)-4-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 28).
From Intermediate 3 and (l r,4r)-4-aminocyclohexanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 618.4 [M+H]+.
Example 1.42: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(5-methyl-2-oxo-l,2-dihydropyrimidin-4-yl)ureido)methyl)benzamide (Compound 29).
From Intermediate 3 and 4-amino-5-methylpyrimidin-2(l//)-one, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 628.4 [M+H]+.
Example 1.43: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(tetrahydrofuran-3-yl)ureido)methyl)benzamide (Compound 30).
From Intermediate 3 and (R)-tetrahydrofuran-3-amine, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 590.4 [M+H]+.
Example 1.44: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l/f,2/f)-2-hydroxycyclopentyl)ureido)methyl)benzamide (Compound 31).
From Intermediate 3 and (lR,2R)-2-aminocyclopentanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 604.4 [M+H]+.
Example 1.45: Preparation of Ethyl l-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)cyclopropanecarboxylate (Compound 32).
From Intermediate 3 and ethyl 1-aminocyclopropanecarboxylate, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 632.6 [M+H]+.
Example 1.46: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(l-(hydroxymethyl)cyclopropyl)ureido)methyl)benzamide (Compound 33).
From Intermediate 3 and (l-aminocyclopropyl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 590.4 [M+H]+.
Example 1.47: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-oxo-l,2-dihydropyrimidin-4-yl)ureido)methyl)benzamide (Compound 34).
From Intermediate 3 and 4-aminopyrirnidin-2(l//)-one, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 614.4 [M+H]+.
Example 1.48: Preparation of (/f)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 35).
From Intermediate 3 and (R)-3-aminopropane-l,2-diol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 594.4 [M+H]+.
Example 1.49: Preparation of 2-(l-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzylcarbamoyl)pyrrolidin-3-yl)acetic acid (Compound 36).
To a solution of Intermediate 3 (30 mg, 0.049 mmol) in DMF (1 mL) was added feri-butyl 2- (pyrrolidin-3-yl)acetate (8.9 mg, 0.049 mmol) at room temperature. The reaction was heated to 50 °C for 30 min. After cooling to room temperature, the reaction was extracted with ethyl acetate and concentrated under reduced pressure. The resulting residue was treated with 4.0 M HC1 in dioxane (1 mL) and stirred for 12 h. The reaction was concentrated under reduced pressure and purified by HPLC to afford the title compound (18 mg, 58.7 %). LCMS m/z = 632.6 [M+H]+. Example 1.50: Preparation of Sodium Salt of (tf )-l-(3-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)propan-2-yl Dihydrogen Phosphate (Sodium Salt of Compound 67).
To a solution of (R)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxypropyl)ureido)methyl)benzamide hydrochloride (160 mg, 0.260 mmol) in DCM (2 mL), was added di-feri-butyl diisopropylphosphoramidite (361 mg, 1.302 mmol), followed by 1/f-tetrazole (2.77 mL, 1.302 mmol) at room temperature. After stirring for 2 h, 1-hydroperoxybutane (117 mg, 1.302 mmol) was added to the reaction and the reaction was stirred for 1 h. The reaction was poured into water, extracted with ethyl acetate, dried over MgS04, and concentrated under reduced pressure. The resulting residue was purified by column chromatography. The intermediate, (R)-di-tert- butyl l-(3-(4-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3- difluorobenzyl)ureido)propan-2-yl phosphate was treated with 50% TFA in DCM (5 mL). After 5 h, the reaction was concentrated under reduced pressure and the resulting residue was dissolved in acetonitrile (1 mL) and 2.0 M aqueous NaOH (3 mL) and then purified by C-18 reverse phase column
chromatography (5% acetonitrile/water) to give the title compound (65 mg, 35.6%). LCMS m/z = 657.8[M+H]+.
Example 1.51: Preparation of (5)-2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)propyl Dihydrogen Phosphate (Compound 37).
From (lSr)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4-((3-(l- hydroxypropan-2-yl)ureido)methyl)benzamide hydrochloride and di-ieri-butyl
diisopropylphosphoramidite, the title compound was obtained using a method similar to that described in Example 1.50. LCMS m/z = 657.6 [M+H]+.
Example 1.52: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((25,35)-l-hydroxy-3-methylpentan-2-yl)ureido)methyl)benzamide (Compound 45).
From Intermediate 3 and (2S,3¾-2-amino-3-methylpentan-l-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 620.4 [M+H]+.
Example 1.53: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(4-hydroxybutyl)ureido)methyl)benzamide (Compound 47).
From Intermediate 3 and 4-aminobutan-l-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 592.4 [M+H]+.
Example 1.54: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(3-hydroxy-2,2-dimethylpropyl)ureido)methyl)benzamide (Compound 50).
From Intermediate 3 and 3-amino-2,2-dimethylpropan- l-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 606.6 [M+H]+.
Example 1.55: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(((15,2/f)-2-hydroxycyclohexyl)methyl)ureido)methyl)benzamide (Compound 51).
From Intermediate 3 and (lR,2S)-2-(arninomethyl)cyclohexanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 632.6 [M+H]+.
Example 1.56: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxyethyl)-3-isopropylureido)methyl)benzamide (Compound 52).
From Intermediate 3 and 2-(isopropylamino)ethanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 606.6 [M+H]+.
Example 1.57: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l/f,2/f)-2-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 53).
From Intermediate 3 and (lR,2R)-2-aminocyclohexanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 618.4 [M+H]+.
Example 1.58: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((ls,4s)-4-hydroxycyclohexyl)ureido)methyl)benzamide (Compound 54).
From Intermediate 3 and (ls,4s)-4-aminocyclohexanol, the title compound was obtained using a method similar to that described in Example 1.12. Exact mass calculated for C28H33CIF5N5O3: 618.04, found: LCMS m/z = 618.4 [M+H]+.
Example 1.59: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluoro-4-((3-(l-hydroxypropan-2-yl)ureido)methyl)benzamide (Compound 55).
From Intermediate 3 and (S)-2-aminopropan-l-ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 578.4 [M+H]+.
Example 1.60: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((l/f,2S)-2-hydroxycyclopentyl)ureido)methyl)benzamide (Compound 56).
From Intermediate 3 and (lS,2R)-2-aminocyclopentanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 604.6 [M+H]+.
Example 1.61: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(((lr,4r)-4-(hydroxymethyl)cyclohexyl)methyl)ureido)methyl)benzamide
(Compound 57).
From Intermediate 3 and ((l r,4r)-4-(aminomethyl)cyclohexyl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 646.4 [M+H]+.
Example 1.62: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((ls,3s)-3-(hydroxymethyl)cyclobutyl)ureido)methyl)benzamide (Compound 58).
From Intermediate 3 and ((ls,3s)-3-aminocyclobutyl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 604.4 [M+H]+.
Example 1.63: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((lr,3r)-3-(hydroxymethyl)cyclobutyl)ureido)methyl)benzamide (Compound 59).
From Intermediate 3 and ((l r,3r)-3-aminocyclobutyl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 604.4 [M+H]+.
Example 1.64: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-((ls,4$)-4-(hydroxymethyl)cyclohexyl)ureido)methyl)benzamide (Compound 60).
From Intermediate 3 and ((ls,4s)-4-aminocyclohexyl)methanol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 632.6 [M+H]+.
Example 1.65: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(5-hydroxypentyl)ureido)methyl)benzamide (Compound 61).
From Intermediate 3 and 5-aminopentan-l -ol, the title compound was obtained using a method similar to that described in Example 1.12. LCMS m/z = 606.6 [M+H]+.
Example 1.66: Preparation of 4-((3-((l/ -Tetrazol-5-yl)methyl)ureido)methyl)-N-(4-chloro-2-(4- (3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound 62).
Bis(2,5-dioxopyrrolidin-l-yl) carbonate (5.91 mg, 0.023 mmol) was dissolved in DMF (0.1 mL). Then, Intermediate 2 (10 mg, 0.021 mmol) was dissolved in DMF (0.1 mL) and added to the above solution. The reaction was stirred at room temperature for 10 min. (l/f-Tetrazol-5- yl)methanamine (2.5 mg, 0.025 mmol) was added. The reaction was then heated to 80 °C and stirred at this temperature for 1 h. The mixture was purified by preparative LC MS to give the title compound
(8.2 mg). LCMS m/z = 602.4 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 2.53 - 2.59 (m, 2H), 2.79 - 2.98 (m, 3H), 3.01 - 3.26 (m, 7H), 4.36 (d, 7 = 5.81 Hz, 2H), 4.51 (d, 7 = 5.68 Hz, 2H), 6.80 - 6.96 (m, 2H), 7.28 (dd, 7 = 8.59, 2.15 Hz, 2H), 7.36 (d, 7 = 2.15 Hz, 1H), 7.60 (t, 7 = 6.95 Hz, 1H), 8.16 (d, 7 = 8.59 Hz, 1H), 9.68 (d, 7 = 4.67 Hz, 1H).
Example 1.67: Preparation of N-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)-4-(chloromethyl)piperidine-l-carboxamide (Compound
68) .
2,3-Difluoro-4-((4-(hydroxymethyl)piperidine-l-carboxamido)methyl)benzoic acid (35.2 mg, 0.107 mmol) was dissolved/suspended in DCM (2 mL). SOCl2 (71.2 μΐ^, 0.975 mmol) was added followed by DIEA (17.03 μΐ^, 0.097 mmol). The reaction was heated to reflux to dissolve the starting materials. After 0.5 h, the solvent was removed. The resulting dark purple oil was re-dissolved in DMF (2 mL). Another aliquot of DIEA was added (20 μΕ), along with 4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)aniline (30 mg, 0.097 mmol). The reaction was stirred with brief heating with a heat gun to -60 °C. Then, the reaction was stirred at room temperature overnight. The reaction mixture was extracted (2 x 2 mL of EtOAc and NaHC03/H20). After the organic solvent was dried and evaporated, the residue was purified by preparative LC/MS (5 - 70% ACN/H20, 25 min) to give the title compound (7.2 mg). LCMS m/z = 636.6 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.08 - 1.14 (m, 2H), 1.69 (d, 7 = 1.77 Hz, 2H), 1.77 - 1.88 (m, 7 = 3.54 Hz, 1H), 2.63 - 2.76 (m, 2H), 2.81 - 2.98 (m, 2H), 2.98 - 3.29 (m, 6H), 3.52 - 3.68 (m, 6H), 4.01 (d, 7 = 13.26 Hz, 2H), 4.34 (d, 7 = 5.31 Hz, 2H), 7.08 - 7.32 (m, 3H), 7.36 (d, 7 = 2.27 Hz, 1H), 7.60 (t, 7 = 6.82 Hz, 1H), 8.16 (d, 7 = 8.34 Hz, 1H), 9.67 (d, 7 = 4.80 Hz, 1H).
Example 1.68: Preparation of N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(l,3-dihydroxypropan-2-yl)ureido)methyl)-2,3-difluorobenzamide (HC1 Salt of Compound
69) .
Intermediate 2 (10 mg, 0.021 mmol), bis(2,5-dioxopyrrolidin-l-yl) carbonate (5.91 mg, 0.023 mmol), and DIEA (20 μΕ, 0.115 mmol) were dissolved in DMF (0.3 mL) and stirred at room temperature for 0.5 h. Next, 2-aminopropane-l,3-diol (2.67 mg, 0.029 mmol) was added and the reaction was heated at 100 °C for 1 h. The mixture was purified by preparative HPLC (5-70%
ACN H20, 25 min). The fractions containing the title compound were lyophilized, and the resulting solid was dissolved in ACN (0.3 mL) and H20 (0.1 mL) and aqueous HC1 (5 eq.) was added. The mixture was stirred at room temperature for 1 h, then it was frozen and lyophilized to give the HC1 salt of the title compound (12.8 mg). LCMS m/z = 594.4 [M+H]+.
Example 1.69: Preparation of (5)-4-((3-(l-Amino-3-hydroxy-l-oxopropan-2-yl)ureido)methyl)-N- (4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (Compound
70) .
From 4-(arninomethyl)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin- 1 -yl)phenyl)-2- fluorobenzamide and (¾-2-amino-3-hydroxypropanarnide, the title compound was obtained using a method similar to that described in Example 1.4. LCMS m/z = 607.4 [M+H]+. Example 1.70: Preparation of N-(4-(4-ieri-Butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)-4-(hydroxymethyl)piperidine-l-carboxamide
(Compound 65).
Step A: Preparation of 2-Bromo-4-teri-butyl-l-nitrobenzene.
To a mixture of 2-bromo-4-ieri-butylaniline (0.25 g, 1.096 mmol) in DCM (10 mL) was added mCPBA (0.756 g, 4.38 mmol) at room temperature. The mixture was stirred at 70 °C overnight. It was cooled to room temperature and was concentrated under reduced pressure. To the residue was added EtOAc (20 mL). It was washed with 1 N NaOH solution and brine, and then dried over anhydrous MgS04. It was filtered and concentrated under reduced pressure. The residue was purified by preparative HPLC (10% - 95% MeCN/H20) to give the title compound. LCMS m/z = 258.0 [M+H]+.
Step B: Preparation of l-(5-ieri-Butyl-2-nitrophenyl)-4-(3,3,3-trifluoropropyl)piperazine.
A mixture of 2-bromo-4-feri-butyl-l -nitrobenzene (0.1 g, 0.387 mmol), l-(3,3,3- trifluoropropyl)piperazine (0.071 g, 0.387 mmol) and K2C03 (0.064 g, 0.465 mmol) were taken up in ethanol (5 mL) and heated to 130 °C for 2 h in a 10 mL heavy- walled sealed tube under microwave irradiation. The mixture was purified by preparative HPLC (10% - 95% MeCN/H20) to give the title compound as a yellow solid. LCMS m/z = 360.2 [M+H]+.
Step C: Preparation of 4-feri-Butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline. To a solution l-(5-ieri-butyl-2-nitrophenyl)-4-(3,3,3-trifluoropropyl)piperazine (80 mg) in ethanol (5 mL) was added tin (II) chloride dihydrate (0.350 g, 1.550 mmol) in portions at 75 °C. The reaction was stirred at 75 °C for 2 h, and then it was cooled to room temperature. The solvent was removed under reduced pressure and EtOAc (10 mL) was added. It was washed with water and brine. The organic layer was dried over anhydrous MgS04, filtered and concentrated under reduced pressure to give the title compound without further purification. LCMS m/z = 330.4 [M+H]+.
Step D: Preparation of N-(4-(4-ieri-Butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)-4-(hydroxymethyl)piperidine-l-carboxamide
(Compound 65).
A mixture of 4-feri-butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline (10 mg, 0.030 mmol), 4-((feri-butoxycarbonylamino)methyl)-2,3-difluorobenzoic acid (575 mg, 2.000 mmol), HATU (1141 mg, 3.00 mmol) and TEA (0.836 mL, 6.00 mmol) in DMF (1 mL) was stirred at 50 °C overnight. The mixture was purified by preparative LCMS (10% - 95% MeCN/H20). To the purified material in acetonitrile (1 mL) was added HCl (0.5 mL, 2.000 mmol) at room temperature. The mixture was stirred at room temperature for 4 h, and then it was concentrated under reduced pressure to give 4- (aminomethyl)-iV-(4-feri-butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluorobenzamide as a white solid. To a solution of 4-(aminomethyl)-iV-(4-feri-butyl-2-(4-(3,3,3-
trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide (10 mg) in DMF (1 mL) was added bis(2,5-dioxopyrrolidin-l-yl) carbonate (15.03 mg, 0.059 mmol). After stirring for 30 min, the reaction was treated with piperidin-4-ylmethanol (6.76 mg, 0.059 mmol). The reaction was heated at 50 °C for 2 h and purified by preparative LCMS (10% - 95% MeCN/H20) to give the title compound as a white solid (2.1 mg). LCMS m/z = 640.6 [M+H]+.
Example 1.71: Preparation of (S)-Ethyl 4-(4-((3-(2,3-Dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamido)-3-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)benzoate (Compound 66).
Step A: Preparation of Ethyl 4-Amino-3-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)benzoate.
To a solution of ethyl 3-chloro-4-nitrobenzoate (5.0 g, 21.7 mmol) in THF (100 mL), was added l-(3,3,3-trifluoropropyl)piperazine (5.9 g, 32.7 mmol) followed by triethylamine (2.2 g) at room temperature. The reaction was heated to 80 °C for 5 h. After cooling, the reaction was concentrated under reduced pressure and extracted with ethyl acetate. The organic layer was washed with water, dried over MgS04, and then concentrated under reduced pressure. The resulting residue was dissolved in ethanol (100 mL) and SnCl2 (20.6 g, 109.1 mmol) was added at room temperature. The reaction was heated at 80 °C for 1 h. After cooling, the reaction was concentrated under reduced pressure, quenched with 2 M aqueous NaOH (50 mL), and extracted with DCM. The organic layer was washed with water, dried over MgS04, and then concentrated under reduced pressure. The resulting residue was crystallized in ethyl acetate hexane (10/90) and the precipitate was filtered and dried under reduced pressure to give the title compound (5.9 g). LCMS m/z = 346.01 [M+H]+; :H NMR (400 M Hz, DMSO- d6) δ ppm 1.35 (t, J = 7.0 Hz, 3H), 2.35 - 3.12 (m, 12H), 4.2 (q, J = 7.0 Hz, 2H), 5.62 - 5.73 (br, 2H), 6.72 (d, J = 8.3 Hz, 1H), 7.42 - 7.51 (m, 2H).
Step B: Preparation of Ethyl 4-(4-((teri-Butoxycarbonylamino)methyl)-2,3- difluorobenzamido)-3-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)benzoate.
To a solution of ethyl 4-amino-3-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)benzoate (1.0 g, 2.90 mmol) in DMF (1 mL), were added 4-((ieri-butoxycarbonylamino)methyl)-2,3-difluorobenzoic acid (0.83 g, 2.90 mmol), DIEA (0.37 g, 2.90 mmol), and HATU (1.10 g, 2.90 mmol) at ambient temperature. After stirring for 12 h, the reaction was extracted with ethyl acetate. The organic extract was dried over MgS04 and concentrated to give the title compound (1.58 g). LCMS m/z = 615.04 [M+H]+.
Step C: Preparation of (S)-Ethyl 4-(4-((3-(2,3-Dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamido)-3-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)benzoate (Compound 66).
Ethyl 4-(4-((feri-butoxycarbonylamino)methyl)-2,3-difluorobenzamido)-3-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)benzoate (250 mg, 0.41 mmol) was treated with 4.0 M dioxane and stirred for 3 h. The reaction was concentrated under reduced pressure. The resulting solid was dissolved in DMF (1 mL), and then bis(2,5-dioxopyrrolidin-l -yl) carbonate (376 mg, 1.47 mmol) was added. After stirring for 30 min, the reaction was treated with (S)-3-aminopropane-l,2-diol (37.1 mg, 0.41
mmol) . The reaction was stirred for 5 h at room temperature. The reaction was extracted with ethyl acetate and concentrated under reduced pressure. The resulting residue was purified by column chromatography to give the title compound (211 mg). LCMS m/z = 614.08 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.35 (t, 7 = 7.5 Hz, 3H), 2.42 - 3.51 (m, 17H), 4.32 - 4.46 (m, 4H), 4.56 (m, 1H), 4.89 (m, 1H), 6.15 (m, 1H), 6.69 (m, 1H), 7.29 (m, 1H), 7.75 (m, 1H), 7.85 (m, 2H), 8.52 (d, 7 = 8.4 Hz, 1H), 9.98 (d, 7 = 8.9 Hz, 1H).
Example 1.72: Preparation of Sodium Salt of 2-(3-(4-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Dihydrogen Phosphate (Sodium Salt of Compound 71).
Step A: Preparation of Butyl 2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Butylphosphonate.
V-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4-((3-(2- hydroxyethyl)ureido)methyl)benzamide (400 mg, 0.709 mmol), 1/f-tetrazole (149 mg, 2.128 mmol), and di-feri-butyl diethylphosphoramidite (354 mg, 1.419 mmol) were added to a vial with THF (2 mL). The reaction was stirred at room temperature for 1 h and 50 - 60 °C for 4 h. Another equivalent of di- feri-butyl diethylphosphoramidite was added and the reaction was stirred at room temperature over the weekend. The reaction was diluted with DCM. The solvent was evaporated and the residue was purified by chromatography (0, 20, 50% EtOAc/hexanes) to give the title compound (225 mg). LCMS m/z = 684.4 [M - feri-butyl + H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.16 (dd, 7 = 6.82, 4.93 Hz, 7H), 1.32 (s, 7H), 1.43 (s, 6H), 2.54-2.64 (m, 6H), 2.89 (t, 7 = 4.55 Hz, 4H), 3.18 (q, 7 = 5.89 Hz, 2H), 3.68 (q, 7 = 6.06 Hz, 2H), 4.34 (d, 7 = 5.94 Hz, 2H), 6.13 (t, 7 = 5.81 Hz, 1H), 6.58 (t, 7 = 6.06 Hz, 1H), 7.20-7.30 (m, 2H), 7.34 (d, 7 = 2.27 Hz, 1H), 7.68 (t, 7 = 7.96 Hz, 1H), 8.24 (d, 7 = 8.84 Hz, 1H), 9.72 (d, 7 = 8.08 Hz, 1H).
Step B: Preparation of Di-tert-butyl 2-(3-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl phosphate.
Butyl 2-(3-(4-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3- difluorobenzyl)ureido)ethyl butylphosphonate (220 mg, 0.297 mmol) was dissolved in THF (2 mL). feri-Butyl hydroperoxide (28.8 μΕ, 0.297 mmol) was added and the reaction was stirred at room temperature overnight. The solvent was evaporated and the residue purified by chromatography (0 -
70% EtOAc/hexanes, and then 5% MeOH/NH3/DCM) to give the title compound (69.8 mg). LCMS m/z = 756.6 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.16 (dd, 7 = 6.82, 4.93 Hz, 7H), 1.32 (s, 7H), 1.43 (s, 6H), 2.54 - 2.64 (m, 6H), 2.89 (t, 7 = 4.55 Hz, 4H), 3.18 (q, 7 = 5.89 Hz, 2H), 3.68 (q, 7 = 6.06 Hz, 2H), 4.34 (d, 7 = 5.94 Hz, 2H), 6.13 (t, 7 = 5.81 Hz, 1H), 6.58 (t, 7 = 6.06 Hz, 1H), 7.20 - 7.30 (m, 2H), 7.34 (d, 7 = 2.27 Hz, 1H), 7.68 (t, 7 = 7.96 Hz, 1H), 8.24 (d, 7 = 8.84 Hz, 1H), 9.72 (d, 7 = 8.08 Hz, 1H).
Step C: Preparation of 2,2,2-Trifluoroacetate Salt of 2-(3-(4-(4-Chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Dihydrogen Phosphate.
Di-ieri-butyl 2-(3-(4-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)- 2,3-difluorobenzyl)ureido)ethyl phosphate (69 mg, 0.091 mmol) was dissolved in ACN (0.2 mL) and H20 (0.2 mL). TFA (28.1 μΐ^, 0.365 mmol) was added. The reaction was stirred at room temperature for 5 h. Another aliquot of TFA (28.1 μΐ^, 0.365 mmol) was added and the reaction was left to stir overnight. The reaction mixture was frozen and lyophilized to give the title compound (65.4 mg). Exact mass calculated for C2 H28C1F5N506P: 643.1, found: LCMS mlz = 644.2 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 2.57-2.78 (m, 6H), 2.83-3.04 (m, 4H), 3.05-3.17 (m, 3H), 3.75-3.96 (m, 3H), 4.35 (d, 7 = 5.68 Hz, 2H), 6.18-6.31 (m, 1H), 6.62-6.77 (m, 1H), 7.20-7.31 (m, 7 = 11.75 Hz, 2H), 7.34 (s, 1H), 7.62-7.75 (m, 2H), 8.23 (d, 7 = 7.07 Hz, 2H), 9.71 (d, 7 = 6.95 Hz, 1H).
Step D: Preparation of 2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl Dihydrogen Phosphate (Compound 71).
The TFA salt of 2-(3-(4-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)ethyl dihydrogen phosphate (270.6 mg, 0.357 mmol) was dissolved in MeOH (3 mL) and H20 (3 mL). To the solution was added Dowex® 50W (Na form) resin (1.5 g). The mixture was stirred vigorously for 0.5 h. Then, the resin was filtered and washed with MeOH H20 (50:50, 10 mL). The resin was re-suspended in MeOH H20 (50:50, 6 mL). Ammonia in MeOH (2 M, ~2 mL) was added dropwise to the suspension to release the product from the resin. The resin was filtered and washed with MeOH H20. The MeOH was evaporated and the product was frozen and lyophilized. The resulting material was then re-dissolved in H20 (1 mL) and purified again on a C- 18 reverse phase column (5 - 30% MeOH/H20) to give the title compound (155 mg). LCMS mlz = 644.2 [M - 2Na + H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 2.55 - 2.67 (m, 6H), 2.87 (t, J = 4.55 Hz, 4H), 3.06 - 3.20 (m, 3H), 3.61 - 3.72 (m, 3H), 4.32 (d, J = 5.56 Hz, 2H), 6.65 (bs, 1H), 7.12 (bs, 1H), 7.21 (dd, 7 = 8.78, 2.34 Hz, 1H), 7.26 - 7.38 (m, 2H), 7.66 (t, 7 = 7.20 Hz, 1H), 8.24 (d, 7 = 8.84 Hz, 1H), 9.71 (d, 7 = 7.45 Hz, 1H).
Example 1.73: Preparation of (5)-N-(4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,3-difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 63).
Step A: Preparation of (S)-teri-Butyl 4-(5-Chloro-2-nitrophenyl)-2-methylpiperazine-l- carboxylate.
4-Chloro-2-fluoro-l-nitrobenzene (0.5 g, 2.85 mmol), (S)-tert-b tyl 2-methylpiperazine-l- carboxylate (0.856 g, 4.27 mmol), and DIEA (0.995 mL, 5.70 mmol) were dissolved in DCM (20 mL). The reaction was stirred at reflux overnight. The mixture was concentrated and the residue was purified by chromatography (0 - 30% EtOAc hexanes) to give the title compound (1.0 g, 98%). LCMS mlz = 356.4 [M+H]+; ¾ NMR (400 M Hz, DMSO - d6) δ ppm 1.16 (d, 7 = 6.87 Hz, 3H), 1.41 (s, 9H), 2.76 -
2.90 (m, 1H), 2.97 - 3.23 (m, 4H), 3.66 - 3.79 (m, 1H), 4.12 - 4.23 (m, 1H), 7.18 (d, 7 = 8.65 Hz, 1H), 7.32 - 7.40 (m, 1H), 7.85 (d, 7 = 8.90 Hz, 1H).
Step B: Preparation of (5)-4-(5-Chloro-2-nitrophenyl)-2-methyl-l-(3,3,3- trifluoropropyl)piperazine.
(S)-tert-B tyl 4-(5-chloro-2-nitrophenyl)-2-methylpiperazine-l-carboxylate (1.0 g, 2.81 mmol) was dissolved in DCM (10 mL). TFA (10 mL, 130 mmol) was added and the reaction was stirred at room temperature overnight. The next day, the solvent was removed and the resulting oil was dissolved in THF (10 mL) and MeOH (5 mL). DIEA (2.454 mL, 14.05 mmol) and 3-bromo- 1, 1,1- trifluoropropane (0.598 mL, 5.62 mmol) were added, and the reaction was heated to reflux and stirred at this temperature over 4 days. After this time, the reaction appeared approximately 30 - 40% complete. Thus, the solvent was removed and the resulting oil was dissolved in IPA (5 mL). DIEA (1 eq.) and 3-bromo- 1,1 ,1 -trifluoropropane (2 eq.) were added. The reaction was heated under microwave irradiation at 140 °C for 8 h. The solvent was removed and the product was purified by chromatography (0 - 50% EtOAc/hexanes) to give the title compound (0.42 g, 42.5 %). LCMS mlz = 352.4 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.22 (s, 3H), 2.54 - 3.20 (m, 11H), 7.22 (d, 7 = 7.63 Hz, 1H), 7.43 (s, 1H), 7.92 (d, 7 = 8.65 Hz, 1H).
Step C: Preparation of (5)-4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)aniline.
(S)-tert-B tyl 4-(5-chloro-2-nitrophenyl)-2-methylpiperazine-l-carboxylate (410 mg, 1.17 mmol) was dissolved in EtOH (20 mL). SnCl2 (221 mg, 1.166 mmol) was added, and the reaction was heated to 80 °C and stirred at this temperature for 3 h. The reaction was quenched by the addition of H20 (10 mL), 3 M NaOH (40 mL), and DCM (50 mL). The reaction was partitioned between
NaOH/H20 (50 mL) and DCM(50 mL). The organic layer was removed and the aqueous layer was extracted again with DCM (50 mL). The organic layers were combined, dried and concentrated. The residue was purified by chromatography (0 - 80% EtOAc/hexanes) to give the title compound (270 mg, 70.6%). LCMS mlz = 322.2 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.02 (d, 7 = 6.36 Hz, 3H), 2.31 - 2.46 (m, 3H), 2.51 - 2.72 (m, 4H), 2.78 - 2.97 (m, 4H), 4.81 (s, 2H), 6.61 - 6.69 (m, 1H), 6.77 - 6.86 (m, 2H).
Step D: Preparation of Hydrochloride Salt of (S)-4-(Aminomethyl)-N-(4-chloro-2-(3- methyl-4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluorobenzamide.
(lS')-4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l-yl)aniline (100 mg, 0.311 mmol), 4-((feri-butoxycarbonylamino)methyl)-2,3-difluorobenzoic acid (89 mg, 0.311 mmol), DIEA (81 μΕ, 0.466 mmol), and HATU (142 mg, 0.373 mmol) were dissolved in DMF (0.5 mL). The reaction was stirred with heating to 80 °C and stirred at this temperature for 2 h. The reaction was partitioned between H20 and EtOAc (2 x 2 mL). The organic layers were combined, dried and concentrated. The residue was purified by column chromatography (0 - 80% EtOAc/hexanes). The resulting Boc- protected intermediate (180 mg) was then re-dissolved in ACN (3 mL), and HC1 (4 M in dioxane) (420 μΕ, 1.679 mmol) was added. The reaction was stirred overnight at room temperature. The next day, a
precipitate had formed, which was filtered, washed with MTBE, and dried in a vacuum oven (80 °C) to give the title compound (171.3 mg, 98%). LCMS m/z = 491.2 [M+H]+; ¾ NMR (400 M Hz, DMSO- d6) δ ρριη 1.38 (s, 3H), 2.74 - 3.23 (m, 7H), 3.45 - 4.01 (m, 4H), 4.22 (s, 2H), 7.31 (d, 7 = 8.39 Hz, 1H), 7.37 (s, 1H), 7.56 (t, 7 = 6.87 Hz, 1H), 7.73 (t, 7 = 6.87 Hz, 1H), 7.99 - 8.21 (m, 1H), 8.57 (s, 3H), 9.80 - 9.87 (m, 1H), 10.98 - 11.89 (m, 7 = 82.65 Hz, 1H).
Step E: Preparation of (5)-N-(4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,3-difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide (Compound 63).
Bis(2,5-dioxopyrrolidin-l-yl) carbonate (4.54 mg, 0.018 mmol) was dissolved in DMF (0.1 mL). (5)-4-(Aminomethyl)-iV-(4-chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)- 2,3-difluorobenzamide dihydrochloride (10 mg, 0.018 mmol) and DIEA (12.39 μΕ, 0.071 mmol), pre- dissolved in DMF (0.1 mL), were added. The reaction was stirred at room temperature for 0.5 h. Then, 2-aminoethanol (1.19 mg, 0.020 mmol) was added. The reaction was stirred at 80 °C for 1 h. After this time, the reaction was complete. The product was purified by preparative LC/MS (5 - 70% ACN/H20, 30 min). After lyophilization, the product was dissolved in ACN (0.4 mL), and HC1 (3 eq.) and H20 (0.8 mL) were added. The mixture was frozen and lyophilized again to give the title compound (4.4 mg, 6.59 μιηοΐ, 37.1 %). LCMS m/z = 578.4 [M+H]+; ¾ NMR (400 M Hz, DMSO- ) δ ppm 1.37 (s, 3H), 2.93 - 3.18 (m, 3H), 3.19 - 3.36 (m, 3H), 3.42 - 3.73 (m, 4H), 3.72 - 4.24 (m, 8H), 4.35 (s, 2H), 7.19 - 7.31 (m, 7 = 8.52, 8.52 Hz, 2H), 7.32 - 7.37 (m, 1H), 7.58 - 7.65 (m, 1H), 8.05 - 8.25 (m, 1H), 9.65 - 9.71 (m, 1H), 10.18 - 10.98 (m, 1H).
Example 1.74: Preparation of N-(4-Chloro-2-((5)-3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-4-((3-((5)-2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 64).
From (¾-4-(aminomethyl)-iV-(4-chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,3-difluorobenzamide dihydrochloride and (S)-3-aminopropane-l,2-diol, using a method similar to that described in Example 1.74, Step E, the title compound was obtained. LCMS m/z = 608.6 [M+H]+.
Example 2: Preparations of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17), Salts, Solvates, and Crystalline Forms.
Preparations and solid-state analyses are described below for the following salt and/or crystalline forms:
(lS')- V-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide; and
(,S,)-iV-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide Hydrochloride Salt Solvate.
Example 2.1: Powder X-ray Diffraction.
Powder X-ray Diffraction (PXRD) data were collected on an X'Pert PRO MPD powder diffractometer (PANalytical, Inc.) with a Cu source set at 45 kV and 40 mA, Cu(Ka) radiation and an X'Celerator detector. Samples were added to the sample holder and smoothed flat with a spatula and weigh paper. With the samples spinning, X-ray diffractogram was obtained by a 12-min scan over the range 5-40 °2 Θ. Diffraction data were viewed and analyzed with the X'Pert Data Viewer Software, version 1.0a and X'Pert HighScore Software, version 1.0b.
Example 2.2: Differential Scanning Calorimetry.
Differential scanning calorimetry (DSC) studies were conducted using a TA Instruments, Q2000 at heating rate 10 °C/min. The instrument was calibrated for temperature and energy using the melting point and enthalpy of fusion of an indium standard. Thermal events (desolvation, melting, etc.) were evaluated using Universal Analysis 2000 software, version 4. ID, Build 4.1.0.16.
Example 2.3: Thermal Gravimetric Analysis.
Thermogravimetric analyses (TGA) were conducted using a TA Instruments TGA Q5000 at heating rate 10 °C/min. The instrument was calibrated using a standard weight for the balance, and Alumel and Nickel standards for the furnace (Curie point measurements). Thermal events such as weight-loss were calculated using the Universal Analysis 2000 software, version 4. ID, Build 4.1.0.16. Example 2.4: Dynamic Moisture-Sorption (DMS).
A dynamic moisture-sorption (DMS) study was conducted using a dynamic moisture-sorption analyzer, VTI Corporation, SGA-100. Samples were prepared for DMS analysis by placing 5 mg to 20 mg of a sample in a tared sample holder. The sample was placed on the hang-down wire of the VTI balance. A drying step was run, typically at 40 °C and 0.5-1 % RH for 1 h. The isotherm temperature was 25 °C. Defined % RH holds typically ranged from 10% RH to 90% RH, with intervals of 10 to
20% RH. A % weight change smaller than 0.010% over 10 min, or up to 2 h, whichever occurred first, was required before continuing to the next % RH hold. The water content of the sample equilibrated as described above was determined at each % RH hold. Example 2.5: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide, Form I (Compound 17, Form I).
Method A
To a solution of 4-(aminomethyl)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,3-difluorobenzamide (700 mg, 1.468 mmol) in DMF (2 mL), was added bis(2,5- dioxopyrrolidin- l-yl) carbonate (376 mg, 1.468 mmol). After stirring for 30 min, the reaction was treated with (S)-3-aminopropane-l,2-diol (401 mg, 4.40 mmol). The reaction was stirred for 5 h at room temperature. The reaction was extracted with ethyl acetate and concentrated under reduced pressure, the resulting residue was purified by column chromatography to give the desired compound, (S)-N-(4-
chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dmydroxypropyl)ureido)m 2,3-difluorobenzamide (650 mg, 74.6%).
Method B
The title compound was prepared by slurrying (S)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide (prepared according to Example 1.18) in 9: 1 IP A/water for three days.
Method C
The title compound was prepared by slurrying (lS')-iV-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide, Form I in ethanol for 2 weeks, which greatly improved the crystallinity.
The powder X-ray diffractogram for (lSr)-iV-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17, Form I) is shown in Figure 8.
The DSC and TGA thermograms for (lS')-iV-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17, Form I) are shown in Figure 9.
The DMS profile for (¾-iV-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3- (2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (Compound 17, Form I) is shown in Figure 10.
Example 2.6: Preparation of (5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide Hydrochloride Salt Solvate (Compound 17 Hydrochloride Salt Solvate, Form I).
(lS')- V-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide (19.67 mg, μιηοΐ) was suspended in acetone (383 μΐ.) and the mixture was heated to 50 °C. HCl (2 M, 166 μΐ.) was added giving a clear solution, which was allowed to cool to room temperature. The following day, a few drops of MTBE were added until cloudiness was observed. The mixture was placed in a 0-5 °C refrigerator for 30 min and then stirred at 25 °C for 3 days. The title compound was recovered by centrifugation at 10,000 rpm for 1 min using 0.22-micron nylon filter cups and allowed to dry in the open air for 4 h. The recovered solid was then recrystallized from water by slow evaporation.
The powder X-ray diffractogram for (lSr)-iV-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide Hydrochloride Salt (Compound 17, Hydrochloride Salt Solvate, Form I) is shown in Figure 11.
The DSC and TGA thermogram for (¾-iV-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin- 1 - yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide Hydrochloride Salt (Compound 17, Hydrochloride Salt Solvate, Form I) is shown in Figure 12.
Example 3: Mas Receptor Signaling Assays.
Example 3.1: Homogeneous Time-Resolved Fluorescence (HTRF®) IPl Assay.
Human and rat Mas receptors were either transiently or stably expressed in HEK293 cells. For transient transfections, human or rat Mas in pHM6 vector were transfected into HEK293 cells using Lipofectamine® (Invitrogen #18324-012). HEK293 cells transfected with empty pHM6 vector were used as a control. For generation of stable cell lines, cDNA expression plasmids encoding human or rat Mas genes and the neor gene were transfected into HEK293 cells (ATCC# CRL-1573) using
Lipofectamine® (Invitrogen) according to the manufacturer's instructions. Stable receptor expressing pools were then generated over 3 weeks by standard techniques in the presence of 500 μg/mL
Geneticin® (Gibco). Individual receptor stable pools were dilution cloned using standard techniques and clones were comparatively evaluated in inositol phosphate accumulation assays. Preferred clones were banked and cultured as needed. HEK293 cells were used as controls. The 384 well IP-One HTRF® Assay (Cisbio # 62P1APEJ) was performed as described by the manufacturer's protocol. Cells were plated in at 100,000 cells per well in 15 μΕ DMEM (Gibco #11960) and incubated in a C02 incubator at 37 °C for 2 h. Five μΕ of compounds diluted in 2X stimulation buffer plus 0.4% BSA
(Sigma (#A3059) were added to each well and serial diluted IPl standards (Cisbio #62IP1CDA) were also added to corresponding wells at this step. After the cells were incubated for 4 h in a C02 incubator at 37 °C, d2-labeled IPl and cryptate-labeled anti-IPl monoclonal antibody diluted in lysis buffer were added sequentially in 10 μΕ per well and the assay plates were kept in the dark at room temperature overnight. Ratiometric measurements of fluorescence emission at 665 nm and 620 nm were obtained using a Pherastar fluorometer (BMG Labtech). IPl levels in each well were calculated according to the standard curves on each plate. IC50 values were obtained by fitting data to a nonlinear curve-fitting program (GraphPad Software, Inc., La Jolla CA). The average IC50 value for Compound 17 obtained from several experiments using the rat Mas receptor was 30.6 nM (see Table B.l).
The observed IC50 values for several compounds of the present invention at the rat Mas receptor are listed in Table B.l.
TABLE B.l (Rat Mas Receptor)
Compounds in Table A were tested and observed to have IC50 values in the rat HTRF® IPl assay ranging from about 2 μΜ to about 4.4 nM (Compound 48 was not tested).
The average IC50 value for Compound 17 obtained from nine experiments using the human Mas receptor was 30.5 nM (see Table B.2).
The observed IC50 values for several compounds of the present invention at the human Mas receptor are listed in Table B.2.
TABLE B.2 (Human Mas Receptor)
A total of 41 compounds in Table A were also tested and observed to have IC50 values in the human HTRF® IPl assay ranging from about 87.6 nM to about 4.2 nM (Compounds 1, 3 to 5, 7 to 10, 13, 16, 25 to 27, 34, 35, 40, 46, 48, 50, 51, 53, 57, 61 to 65, and 68 to 70 were not tested). Example 3.2: Homogeneous Time-Resolved Fluorescence IP-One HTRF® Assay (Cisbio).
Many GPCRs are able to couple constitutively to their preferred G protein in the absence of ligand. To determine whether the Mas receptor has constitutive G protein coupling activity, human or rat Mas in HEK293 cells were expressed by transient transfection. An antibody to the hemagglutinin (HA) epitope tag on the Mas expression constructs was used to confirm expression by flow cytometry 48 h post transfection (data not shown). Gq coupling in these cells was measured by HTRF® IP-one assays. Expression of either human Mas or rat Mas receptor in HEK293 cells resulted in a significant increase in IPl accumulation compared to cells transfected with empty vector (Figure 17), indicating constitutive Gq coupling of the receptor. Similar results were seen when dog and pig Mas orthologs were transfected into HEK293 cells.
The constitutive Gq coupling of the Mas receptor provided a suitable assay signal with which to screen small molecule libraries for Mas receptor modulators. This assay was able to identify and optimize both agonists and inverse agonists to the Mas receptor. Functional Gq agonism and inverse agonism for representative compounds (agonist AR234960 and inverse agonist AR244555) was
demonstrated in HEK cells stably expressing either human or rat Mas receptor (Figure 18 and Figure 19, and TABLE C). There were detected effects of these compounds in control HEK293 cells.
Values are means + SEM
Example 3.3: cAMP assay.
cAMP accumulation in HEK293 cells stably expressing human or rat Mas receptors was determined by the 384 well cAMP Dynamic2 Homogenous Time-Resolved Fluorescence (HTRF®) assay (CisBio Cat# 62AM4PEB) following the manufacturer's protocol. Briefly, cells were plated at 30,000 or 1000 cells per well in 5 μΕ stimulation buffer (PBS containing 500 μΜ IBMX and 0.1 % bovine serum albumin). 5 μΕ of Mas compounds diluted in PBS were added to each well and serial diluted cAMP standards were also added to corresponding wells at this step. For detecting Gj-coupled activities, 10 μΜ forskolin was included with the compounds for a final concentration of 5 μΜ at the stimulation step. Following 1 h stimulation at room temperature, d2-labeled cAMP and anti-cAMP cryptate conjugate diluted in detection buffer (included in the kit) were added to cells sequentially at 5 μΕ per well. The plates were incubated further for 1 h at room temperature. Ratiometic measurements of fluorescence emission at 665 nm and 620 nm were obtained by Pherastar fluorometer (BMG Labtech) and cAMP levels in each well were calculated according to the standard curves on each plate. IC50 values were obtained by fitting data to a nonlinear curve-fitting program (GraphPad Software, Inc., La Jolla CA).
RESULTS: There was no detectable constitutive coupling to Gs or Gj in cells stably expressing human or rat Mas receptor. Furthermore, activation of the Gs/cAMP pathway by any of the other purported Mas receptor agonists was not detected. However, although no constitutive Mas-Gj signaling was evident in our cAMP assays, the Mas agonist AR234960 was able to stimulate Mas-Gj activity resulting in a dose dependent reduction in forskolin stimulated cAMP levels (Figure 20).
TABLE D: Summary of cAMP Assay IC50 Data
Values are means + SEM; NR = No Response
Example 3.4: Ca + Measurements by Fluorometric Imaging Plate Reader (FLIPR) Assay.
HEK293 cells stably expressing human Mas receptors were monitored for changes in intracellular Ca2+ using a FLIPR-384 (Molecular Devices, Sunnyvale, CA). Cells were seeded into black-walled clear-base 384-well plates at a density of 2 x 104 cells per well and incubated with Hank's Balanced Salt Solution (HBSS) containing 20 mM HEPES pH 7.4, 2 μΜ Calcium 3 dye (Molecular Devices Corporation, Sunnyvale, CA) and 2.5 mM probenecid at 37 °C for 60 min. Cells were washed with HBSS containing 20 mM HEPES, pH 7.4 and 2.5 mM probenecid and the plates were then placed into the FLIPR instrument to monitor cell fluorescence before and after the addition of the agonists at different concentrations.
RESULTS: Since GPCR activation of the Gq-PLC pathway typically results in increased intracellular calcium, Ca2+ was measured in HEK293 cells stably expressing the human Mas receptor. Consistent with its effect on inositol phosphate accumulation, AR234960 elicited a significant increase in intracellular Ca2+ in a dose-dependent manner further verifying that Mas activates the downstream Gq-PLC-Ca2+ pathway. Example 4: Effect of Compounds on Myocardial Ischemia/Reperfusion (I R) Injury.
Animals: Male Sprague-Dawley rats (220 - 260 g) (Charles River) were housed four per cage and maintained in a humidity-controlled (40 - 60%) and temperature-controlled (68 - 72 °F) facility on a 12 h: 12 h light/dark cycle with free access to food and water.
Induction of myocardial I R injury: Adult rats were anesthetized with sodium pentobarbital (50 mg/kg i.p.) and placed in the supine position on a surgery frame with a heating pad (37 °C) beneath. Rats were tracheostomized and ventilated with a SAR-830 small-animal ventilator (Model 683, Harvard Apparatus) to provide room air at a tidal volume of 2.5 mL/stroke and at a rate of 70 stroke/min.
Polyethylene catheters were placed in the right internal carotid artery and the external jugular vein for measurement of mean arterial blood pressure and infusion of drug or vehicle, respectively.
Myocardial I/R injury was produced as follows. A left thoracotomy was performed approximately 20 mm from the sternum to expose the heart at the fifth intercostal space. The pericardium was removed, and the left atrial appendage was moved to reveal the location of the left coronary artery. A ligature (6-0 prolene), along with a snare occluder, was placed around the left coronary artery close to the place of origin. After surgical preparation, the rat was allowed to stabilize for 15 min. Regional myocardial ischemia was produced by tightening the previously placed reversible ligature around the coronary artery to completely occlude the vessel. Sham-operated animals underwent the same surgical procedures but without ligation of the coronary artery. The ligature was untied after 30 min, and the ischemic myocardium was reperfused for 2 h.
Animals were randomly divided into the following 4 groups: (1-3) low, medium, and high doses of Compound 17 administered by continuous i.v. infusion starting 30 min before coronary artery ligation (n = 6 per dose), and (4) 20% HPBCD (vehicle, hydroxypropyl- -cyclodextrin) administered by continuous i.v. infusion beginning 30 min before coronary artery ligation (n = 6). All the rat hearts listed above were used for calculation of myocardial infarct size (see below). Mean arterial blood
pressure was measured after stabilization and just prior to drug infusion (baseline) and again following 25 min of drug or vehicle infusion, before coronary artery ligation.
Measurement of infarct size: After ischemia and reperfusion treatment, the left coronary artery was re-occluded, and 5% Evans blue dye (1 mL) was administered to the circulation via the jugular cannula and allowed to perfuse the non-ischemic portions of the heart. The myocardium not stained with Evans blue dye represents the ischemia area at risk (AAR). Within the area at risk, ischemic injury (infarct) was measured by TTC staining and expressed as myocardial infarct size. Briefly, the entire heart was excised, rinsed of excess Evans blue dye, trimmed of atrial tissue, and sliced transversely into sections 2 mm thick. These slices were incubated in a 1 % solution of TTC for 12 min to stain the viable myocardium brick red. The samples were then fixed in a 10% formalin solution for 24 h and both sides of each slice were photographed with an Olympus OM2 camera using a 90-mm macrolens and a 2x teleconverter. The ischemic risk area (unstained by Evans blue dye) and the infarcted area (unstained by TTC) were outlined on each photograph and measured by planimetry. The area from each region was averaged from the photographs of each side for each slice. Infarct size was expressed as a percentage of the ischemic area at risk (AAR).
Drug treatment: Rats were dosed i.v. via the jugular cannula with vehicle or test compound in a single bolus administration (loading dose) followed immediately by continuous i.v. infusion using a Harvard Apparatus 11+ syringe pump at a flow rate of 1 mL kg h. Compound 17 was dosed at, 0.216 mg kg (loading) + 0.252 mg kg h (low dose), 0.648 mg/kg (loading) + 0.756 mg kg h (medium dose), and 2.16 mg kg (loading) + 2.52 mg/kg/h (high dose).
Results: An example of a compound of the invention tested in this assay is shown in Figure 6. In this example, Compound 17 at both the medium and high doses were found to provide protection against ischemia-reperfusion injury in rat hearts as shown by a significant decrease in myocardial infarct size after reperfusion compared to vehicle treatment. In addition, as shown in Figure 7, Compound 17 at low, medium, and high doses has no significant effect on mean arterial blood pressure (MAP) compared to vehicle treatment.
Example 5: Inhibition of Mas G-Protein Signaling Improves Coronary Flow, Reduces Myocardial Infarct Size and Provides Cardioprotection - Mas Expression in the Heart.
Example 5.1: Cloning of Human and Rat Mas Genes. The cDNA for human and rat Mas genes were obtained by PCR using genomic DNA as templates. The following were used as primer sets:
5' -TGGATGGGTCAAACGTGACATCATT-3' (human Mas sense primer);
5'-CGCGGATCCTCAGACGACAGTCTCAACTGTGACC-3' (human Mas antisense primer);
5' -ACCAAGCTTGGACCAATCAAATATGACATCCTTTG-3' (rat Mas sense primer); and
5'-CAAGAATTCAGACCACAGTCTCAATGGATACA-3' (rat Mas antisense primer).
PCR was performed using Pfu polymerase (Stratagene, San Diego, CA) with the buffer system provided by the manufacturer plus 10% DMSO, 2.5 μΜ of each primer, and 300 μΜ each of the four
nucleotides. After an initial denaturation at 95 °C for 4 min, 30 cycles of 95 °C for 40 s, 60 °C for 50 s, 72 °C for 1 min 40 s were performed, which was followed by a final extension at 72 °C for 7 min. The 986 bp human Mas PCR fragment was digested with BamHI, and cloned into blunted Hindlll (5') - BamHI(3') sites of expression vector pHM6 (Invitrogen, Carlsbad, CA), while the 988 bp rat Mas PCR fragment was cloned into Hindlll (5') - EcoRI (3') sites of pHM6 after digestion with Hindlll and EcoRI.
Example 5.2: Chemicals. Mas agonist (AR234960, l-((4-(3-fluorophenyl)- l-(2-methoxy-4- nitrophenylsulfonyl)pyrrolidin-3-yl)methyl)-4-(pyridin-2-yl)piperazine) and inverse agonist
(AR244555, (r-(but-3-enyl)-l,2-dihydro-5-chloro-l -(2,6-difluoro-benzoyl)-spiro[3/f-indole-3,4'- piperidine], see WO2005/063745A2, Compound 359) were dissolved in dimethyl sulfoxide (DMSO) for in vitro and ex vivo assays and in 20% hydroxypropyl- -cyclodextrin (HPBCD) for in vivo experiment
Mas Agonist (AR234960) Mas Inverse Agonist (AR244555)
PLC inhibitor U-73122 (l-(6<(8R,95,135,145,17S)-3-memoxy-13-methyl-7,8,9,l 1,12,13,14,15,16,17- decahydro-6/f-cyclopenta[a]phenanthren-17-ylamino)hexyl)- l/f-pyrrole-2,5-dione) was dissolved in DMSO.
U-73122
Example 5.3: Animals. Male Sprague-Dawley rats (270-330 g) were purchased from Harlan. The Mas knockout mouse line was purchased from Deltagen (San Mateo, CA) and confirmation of Mas mRNA deletion was performed by RT-PCR using Mas gene specific primers (sense:
TCCCTTGCTGA AGAGA A AGC ; anti-sense: ATCTTTGA A AGCCCTGGTC A) . All animals were housed in standard cages and were maintained at 25 + 1 °C under 12-h light and dark cycles. The animals were fed standard diet and water ad libitum.
Example 5.4: Preparation of adenoviral constructs and adenoviral infection of cultured cardiomyocytes. Adenoviral constructs were prepared from expression plasmids encoding β- galactosidase (AdLacZ, as a control) or wild-type human Mas receptor (AdMas). Homologously recombinant adenoviruses were generated by Qbiogene (Carlsbad, CA). Neonatal rat ventricular
myocytes (NRVMs) were purchased from Cell Applications, Inc. (San Diego, CA) and plated overnight in serum-containing medium at a density of 0.3 x 106 cells per well in 24-well plates for inositol phosphate assays, or at a density of 0.25 x 106 cells per well in 2-well chamber slides for
immunocytochemistry. After overnight culture, the cells were washed and the medium was replaced with serum-free medium supplemented with insulin/transferrin/selenium (ITS, Sigma). Cells were infected for 6 h with AdLacZ or AdMas adenoviruses (1000 viral particles/cell). Using the control adenovirus encoding "LacZ" (AdLacZ) and β-galactosidase staining of AdLacZ-infected myocytes, it was determined that a viral titer of 1000 viral particles per cell resulted in nearly 100% infection efficiency without cytotoxicity. Cells were subsequently washed and maintained in serum-free medium with supplements for inositol phosphate assay or immunocytochemical staining.
Example 5.5: Mas Expression Analysis in Rat and Human Heart.
Example 5.5A: Immunocytochemistry in Neonatal Rat Ventricular Myocytes (NRVMs). NRVMs were plated on 2-well chamber slides and infected with adenoviruses as described above. Six h after adenovirus infection, cells were washed and then incubated with either vehicle or the Mas inverse agonist AR244555 at 10 μΜ for another 42 h. Cells were then fixed with 3.7% formaldehyde, washed with PBS, permeabilized with 0.3% Triton X-100 in PBS and blocked with 10% normal goat serum in PBS. Myocyte sarcomeres (F-actin) were stained with Rhodamin-Phalloidin (Molecular Probes) and visualized on a Zeiss fluorescence microscope. Cell size was quantitated by digital planimetry using Adobe Photoshop.
Example 5.5B: RNA isolation and semi-quantitative reverse transcription (RT)-PCR.
Total RNA was prepared from rat atrial and ventricular tissues using TRIzol® reagent (Invitrogen). First-strand cDNA synthesis was performed using the Superscript III First-Strand Synthesis System (Invitrogen) according to manufacturer's instructions. Semi-quantitative RT-PCR for the expression of rat Mas (and glyceraldehyde- 3 -phosphate dehydrogenase (GAPDH) as a control) was performed using Platinum® PCR SuperMix (Invitrogen). Primers used for rat Mas were as follows:
sense: GTCGGGCGGTCATCATCTTCATA; and
anti-sense: ACTCCCCCTGCGGTCCTCA.
Semi-quantitative RT-PCR for mRNA expression of human Mas receptor was performed in a human cardiovascular cDNA panel (AMS Biotechnology) using actin as a control. Human Mas primer sequences were:
sense: ACGGGCCTCTATCTGCTGACG; and
anti-sense: AAGGGTTGGCGCTACTGTTGATT.
Example 5.5C: Immuno histochemistry. Snap-frozen heart tissues from male Sprague- Dawley rats were cryosectioned at a thickness of 8 μιη and stored at -80 °C. Sections were removed from the freezer and allowed to come to room temperature. Sections were fixed with cold acetone, washed with PBS, and blocked with 10% normal goat serum in PBS containing 0.2% Tween (PBST). Sections were incubated with the primary rabbit Mas antibody (Novus Biologicals) diluted 1: 100 in PBST containing 1% BSA for overnight at 4 °C. Half of the primary antibody solution was pre-
absorbed for 30 min at room temperature with 10 μ§/ιηΕ (final) Mas blocking peptide (Novus Biologicals) and applied to control sections which were incubated overnight at 4 °C. Sections were washed three times with PBST and then incubated at room temperature for 45 min with secondary antibody solution composed of Texas Red goat anti-rabbit antibody diluted 1 : 100 in PBST containing 1 % BSA. Sections were then washed with PBS and mounted on glass slides using antifade reagent supplemented with 4',6-diamidino-2-phenylindole (DAPI; Invitrogen). For co-staining experiments, sections were concurrently stained with Mas antibody and an FITC-conjugated a-smooth muscle actin antibody (Sigma) or a mouse anti-Von Willbrand Factor (VWF) antibody (LifeSpan Biosciences). Immunofluorescence analysis was performed using a Zeiss fluorescence microscope.
Human left ventricular heart sections (AMS Biotechnology) were also used for
immunohistochemical detection using a DAB substrate kit (Abeam). Briefly, sections were fixed with acetone, washed with PBS, and blocked with 10% normal goat serum in PBST. Sections were incubated with the primary Mas antibody diluted 1 : 100 in PBST containing 1 % BSA or primary Mas antibody solution pre-absorbed with blocking peptide. Sections were incubated overnight at 4 °C, and then washed three times with PBST. Sections were incubated for 15 min in 0.3% H202 PBS and incubated at room temperature for 45 min with secondary antibody solution composed of HRP-conjugated goat anti- rabbit antibody diluted 1 : 1000 in PBST containing 1 % BSA. After being washed with PBS, sections were stained with DAB Chromagen (Abeam) for 10 min and counterstained with hematoxylin for 1 min. Sections were then washed with PBS and dehydrated with ethanol before mounting media and a cover slip were applied. Immunofluorescence analysis was performed on a Zeiss fluorescence microscope.
RESULTS: Mas mRNA and protein have been reported to be expressed in rat heart and cardiomyocytes (Tallant et. al, Am. J. Physiol. Heart Ore. Physiol. 289: H1560-H1566 (2005)). To confirm this, RT-PCR and immunohistochemical staining experiments were performed. RT-PCR in rat heart revealed mRNA expression in all chambers (Figure 13). Expression of Mas protein was evaluated in rat left ventricle by immunohistochemical staining. Mas protein expression was detected in cardiomyocytes and coronary arteries of rat heart. As a control to confirm that the staining was specific for Mas, the antibody solution was pre-absorbed with an equal molar concentration of the
corresponding immunogenic peptide prior to incubating with heart sections. The amount of staining was substantially reduced with pre-absorption, verifying that the antibody was specifically recognizing the correct Mas epitope. To clarify which cell types were expressing Mas protein in coronary arteries, left ventricle sections were co-stained concurrently with antibodies for Mas and a-smooth muscle actin (a marker for smooth muscle cells) or with antibodies for Mas and von Willibrand Factor (a marker for endothelial cells). Mas protein expression overlapped with the markers for both smooth muscle cells and endothelial cells, indicating that Mas was expressed in both cell types (Figure 14).
The expression pattern of the Mas receptor in human heart was also examined. RT-PCR analysis with human Mas receptor specific primers in a human cardiovascular cDNA panel demonstrated that the Mas mRNA transcript was detected in all four chambers of human heart, whereas
it was not detected in the placenta using the same primers (Figure 15). Immunohistochemical staining in human left ventricular sections using a Mas specific antibody revealed Mas protein expression in both cardiomyocytes (Figure 16, Panel A) and coronary arteries (Figure 16, Panel B). The specificity of Mas antibody was verified in control experiments in which staining was reduced by preincubation of the antibody with the blocking peptide prior to incubation with tissue sections (Figure 16, Panels C and D).
Example 5.6: Decreased Infarct Size in Mas '" Mice after Ischemia/Reperfusion Injury.
Example 5.6A: Coronary artery ligation model. Occlusion and reperfusion of the coronary artery was performed in male Mas knockout (Mas ' ) mice and wild type (Mas+ +) controls or in male Sprague-Dawley rats as previously reported (Means et. ah, Am. J. Physiol. Heart Circ. Physiol. 292: H2944-H2951 (2007)). Briefly, mice or rats were anesthetized with an intraperitoneal injection of pentobarbital (70 mg kg) and placed in a supine position under body-temperature control. Each animal was endotracheally intubated and ventilated with a tidal volume of 0.8 mL at a rate of 120 strokes/min (mice) or 2.5 mL at a rate of 70 strokes/min (rats) by using a rodent respirator (Harvard Apparatus).
After left thoracotomy, a 8-0 (mice) or 7-0 (rats) surgical suture was passed underneath the left anterior descending coronary artery (LAD) at a position 2 mm from the tip of the left auricle using the aid of a stereoscope (Nikon). PE-10 tubing (1-2 mm in length) was placed along the vessel as a cushion and was secured around the tubing to occlude the LAD. For the sham-operated control animals, the procedure was performed as above except that the suture was not secured around the LAD to occlude the vessel. Myocardial ischemia was verified by blanching of the left ventricle (LV) and by change in
electrocardiogram. To induce ischemia/reperfusion injury and determine infarction size the LAD was occluded for 30 min and then the heart was reperfused for 2 h. In experiments using rats with Mas inverse agonist, vehicle (20% HPBCD) or Mas inverse agonist (10 mg/kg) were injected as a bolus through the jugular vein either 10 min before ischemia or 3 min before reperfusion.
Example 5.6B: Assessment of LV area at risk and infarct size. For acute studies, following 2 h of reperfusion, the LAD was reoccluded and 5% Evans blue dye was injected into the LV cavity with a 27 -gauge needle to define the nonischemic zone (blue area). The heart was excised immediately and rinsed in saline to remove excess dye, and the LV was cut transversely into five slices of equal thickness. These samples were incubated in 1 % 2, 3, 5-triphenyltetrazolium chloride (TTC)-containing tris-HCl buffer (pH 7.8) at 37 °C for 2 x 10 min to stain the viable myocardium (red area). The unstained (white) area inside the red area defined the infarcted area. The area at risk (AAR, i.e. the ischemic area) was defined as the white infarcted necrotic tissue plus the red viable salvaged tissue. Each slice was photographed from both sides using a microscope equipped with a high-resolution digital camera. The AAR, infarcted area, and the total LV area were measured by digital planimetry using Adobe Photoshop. Infarct size was expressed as percentage of area at risk. For long-term studies, after measurements of cardiovascular hemodynamics (see below) LV was cut transversely into five
slices of equal thickness and the sections were stained with the TTC solution. Infarct size was expressed as a ratio of the infarcted area over the total LV area.
RESULTS: Decreased infarct size in Mas '" mice after ischemia/reperfusion injury: To determine whether the Mas receptor activation might contribute to ischemia/reperfusion injury in vivo, Mas+ + and Mas '" mice were compared using a well established model of regional myocardial ischemia/reperfusion injury. Myocardial infarction size was measured in hearts exposed to 30 min of left anterior descending coronary occlusion followed by 2 h of reperfusion. The infarct size, expressed as a percentage of the area at risk, was significantly decreased in Mas '" mice (34%) compared to Mas+ + mice (47%) (Figure 24). Thus, genetic ablation of the Mas receptor provides protection against in vivo myocardial ischemia/reperfusion injury in the mouse.
Reduction of myocardial ischemia/reperfusion injury by pharmacological inhibition of Mas: A pharmacological approach was used to verify the role of the Mas-Gq signaling pathway in ischemia/reperfusion injury. Since reduced Mas activity in the Mas '" mice resulted in smaller infarcts, the Mas inverse agonist AR244555 was tested in an in vivo rat ischemia/reperfusion injury model. In these studies, AR244555 was evaluated using two protocols; 1) i.v. bolus administration, then 30 min of ischemia followed by 2 h of reperfusion; and 2) 30 min ischemia, then i.v. bolus administration for 3 min followed by 2 h of reperfusion. Mas inverse agonist AR244555 treatment reduced infarct size by about half when compared with vehicle treatment in both protocols (Figure 25). These results demonstrate that Mas inverse agonist treatment provides protection from ischemia/reperfusion injury, and that the drug is effective when administered either prior to ischemia or immediately prior to reperfusion.
Example 5.7: Ex vivo coronary flow measurements. Coronary flow was measured in male Mas '" and Mas+ + mice, and in male Sprague-Dawley rats using Langendorff perfused isolated hearts. Freshly isolated hearts were placed on a Langendorff apparatus (Harvard Apparatus) and perfused at a constant pressure of 80 mmHg with a modified Krebs-Henseleit buffer solution (Sigma K3753) and aerated with 95% oxygen and 5% carbon dioxide, pH 7.35 - 7.4. The temperature was maintained at 37 °C by surrounding the heart with a water -heated glassware chamber. Coronary flow was measured using a flow measurement system (Harvard Apparatus) which included the transit time flow meter and a flow probe built into an adaptor block located at the perfusate inflow port. Data were recorded continuously using an ISOHEART data acquisition system (Harvard Apparatus). After a 20-min equilibration period, Mas compounds were added to the perfusion buffer reservoir at the desired concentration (agonist AR234960 at 1 μΜ, or inverse agonist AR244555 at 5 μΜ) and coronary flow was recorded for 10 min.
To determine the role of the Mas-Gq-PLC pathway in regulating coronary flow, the Mas inverse agonist AR244555 (5 μΜ) or the PLC inhibitor U-73122 (0.5 μΜ) was added to the perfusion buffer for 10 min and then the agonist AR234960 (1 μΜ) was added to the perfusion buffer. Coronary flow was recorded for another 10 min. Changes in coronary flow induced by AR234960 were calculated as percentage of the coronary flow at 10 min following AR234960 treatment, relative to the coronary flow
measured immediately prior to addition of AR234960. This protocol allowed for measurement of agonist mediated vasoconstrictor activity, and accounted for changes in baseline coronary flow due to inverse agonist treatment alone.
To determine whether Mas agonist-induced changes in coronary flow were endothelium- dependent, the responses in Langendorff perfused hearts were measured after chemical removal of endothelium with sodium deoxycholate. After a 20-min equilibration period, sodium deoxycholate was added to the perfusion buffer at 0.2 mg/mL for 3 min and then washed out for 10 min. Mas compounds were added and coronary flow was recorded for 10 min. Adenosine (1 μΜ), a coronary vasodilator that targets the endothelium, was used as a control to verify effective removal of endothelium.
For ischemia-reperfusion experiments, Langendorff perfused rat hearts were equilibrated for 20 min and then baseline coronary flow was recorded for 10 min. Thereafter, all hearts were subjected to 30 min of global ischemia by stopping perfusate flow, followed by 30 min of reperfusion with either vehicle (0.01 % DMSO), Mas agonist AR234960 (1 μΜ) or Mas inverse agonist AR244555 (5 μΜ) added to the perfusion buffer. Electrocardiography was also continuously recorded during the observation period through electrodes attached directly to the surface of the ventricles to detect cardiac arrhythmias during reperfusion.
RESULTS: Since Mas expression is enriched in coronary arteries, the experiment was designed to determine whether the Mas receptor plays a role in the regulation of coronary flow. Γη isolated perfused hearts from genetically altered Mas knockout (Mas ' ) and wild type (Mas+ +) mice there was no detectable difference in coronary flow at baseline or after vasoconstriction with Ang II or endothelin-1 (data not shown). However, treatment of Mas+ + mice with the Mas agonist AR234960 resulted in a significant reduction (64% of baseline) in coronary flow. This response was absent in Mas" hearts (Figure 21), indicating that the AR234960-mediated decrease in coronary flow is Mas receptor dependent. A decrease in coronary flow was also observed in isolated perfused rat hearts upon treatment with the agonist AR234960 (Figure 22). Furthermore, the Mas receptor inverse agonist
AR244555 caused a modest but significant increase in coronary flow in rat hearts. Pretreatment with the inverse agonist AR244555 prevented the decrease in coronary flow caused by the agonist
AR234960 (Figure 22). These data demonstrate that agonist stimulation of the Mas receptor causes vasoconstriction whereas inverse agonist treatment reverses the vasoconstriction and promotes dilation of the coronary arteries.
To determine if the Mas agonist-induced decrease in coronary flow was endothelium-mediated or smooth muscle-mediated, the change in coronary flow was measured following treatment with sodium deoxycholate, a chemical that removes the endothelial layer but leaves the smooth muscle intact. To validate this procedure, adenosine was used as an experimental control since it is known to cause vasodilation via activation of adenosine A2 receptors on endothelial cells (de Jong et. al.
Pharmacol Ther 87: 141-149 (2000)). The adenosine-mediated increase in coronary flow was abolished after sodium deoxycholate treatment (data not shown), verifying effective removal of endothelium. In contrast, the AR234960-mediated decrease in coronary flow was preserved in hearts denuded of
endothelium, (Figure 22), indicating that vasoconstriction is mediated through Mas receptors on smooth muscle cells. To confirm the role for Gq-PLC signaling in the vasoconstriction response, isolated rat hearts were treated with a PLC inhibitor (U-73122) prior to Mas agonist AR234960 treatment. PLC inhibition blocked the decrease in coronary flow caused by AR234960 (Figure 22).
To examine whether Mas activation might promote reperfusion injury following ischemia, isolated perfused rat hearts were subjected to 30 min of global ischemia followed by 30 minutes of reperfusion. During reperfusion, coronary flow in vehicle-treated rats initially returned to pre-ischemia levels but then progressively decreased thereafter (Figure 23). Treatment with the Mas agonist AR234960 during reperfusion resulted in a trend toward decreased coronary flow during reperfusion. Γη contrast, treatment of hearts with the Mas inverse agonist AR244555 during reperfusion resulted in significantly elevated coronary flow at all time points during reperfusion compared to vehicle treated hearts. These results suggest that in isolated perfused rat hearts, Mas receptor activity causes decreased coronary flow during reperfusion following ischemia, and that inhibition of Mas during reperfusion can significantly increase coronary flow under these conditions.
Electrocardiography was also continuously recorded during the observation period to detect cardiac arrhythmias during reperfusion. Two out of six hearts (33.3%) in the vehicle group exhibited prolonged (>10 min) ventricular arrhythmias, mainly ventricular fibrillation, during reperfusion. The frequency of arrhythmias was increased to three out of seven hearts (42.9%) with treatment with the Mas agonist AR234960. In contrast, no arrhythmias were observed in the six hearts treated with the Mas inverse agonist AR244555 during reperfusion.
Example 5.8: Statistical Analysis. All data are reported as mean + SEM. Statistical significance between two groups was determined using unpaired i-test or using one-way ANOVA followed by Tukey post-hoc test for three or more groups. A p value of < 0.05 was considered statistically significant.
Example 6: Expression of Mas is Upregulated on Thiogl collate Elicited Peritoneal Mouse
Macrophages Following LPS Stimulation
Animals: Male C57BL6 male mice [25-30 g] (Charles River Laboratories) were housed three per cage and maintained in a humidity controlled room under 12: 12 h light/dark cycles. All animal studies were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Academy of Sciences (1996). All study protocols were reviewed and approved by
Arena Pharmaceuticals Institutional Animal Care and Use Committee (IACUC). Water and standard diet was provided ad libitum.
Preparation of Thiogly collate peritoneal macrophages: Mice were injected intraperitoneally, with 5 mL of 3% (w/v) Brewer' s thioglycollate medium (Difco; sterilized by autoclave). After approximately 5 days, macrophages were harvested from the peritoneal cavity of euthanized animals by injecting the intact cavity with roughly 5 mL of ice cold RPMI 1640 (+10% fetal calf serum; PSN).
Peritoneal macrophages were then collected by spinning at 400 x g, 4 °C for 5 min. Cells were then
seeded in 6 well plates at 1.7 x 106 cells/mL (2 mL per plate) in RPMI medium and incubated at 5% C02, 37 °C overnight.
Treatment of Macrophages with LPS: After plating, overnight, the macrophages were either left in medium, or treated with 1 μg/mL lipopolysaccharide (LPS; SigmaAldrich) for 30, 60, 90, 120, 180, 240, or 360 min before harvesting in TRIzol® (Invitrogen). mRNA was prepared using the phenol chloroform method of extraction and the mRNA reverse transcribed into cDNA for qPCR analysis. qPCR was performed for Mas receptor and TNFa and normalized against the house keeping gene beta actin.
Mouse TNFa (f) 5-CACCGTCAGCCATTTGC-3'
Mouse TNFa (r) 5 ' TTGACGGC AGAG AGGAGGTT-3 '
Mouse TNFa (probe) 6FAM-ATCTCATACCAGGAGAAAG-MGBNFQ
Mouse beta-actin (f) 5'-TCCTGGCCTCACTGTCCAC-3'
Mouse beta actin (r ) 5 ' -GGGCCGGACTC ATCGTACT-3 '
Mouse beta actin probe VIC-CTGCTTGCTGATCCACATCTGCTGG
Mas 1 gene expression was detected using primer/probe set Mm00434823 (Life technologies).
Results: Combined triplicate experiments show that there is a baseline expression of Mas receptor that peaks 1 hour following LPS stimulation. Notably, Mas expression correlates with TNFa expression. This experiment shows that Mas receptor is upregulated in macrophages in response to endotoxin LPS; see Figure 26 and Figure 27.
Example 7: Mas Receptor Inverse Agonists Suppress LPS Induced TNFa Expression in Mice.
Systemic administration of endotoxin, such as lipopolysaccharide (LPS), is a common animal model for sepsis as it induces proinflammatory cytokines, such as TNFa, which correlate with the severity of disease (Rittirsch et. ah, J. Leukocyte biology. 81 : 137- 143 (2007)).
Animals: Male C57BL6 male mice [25-30 g] (Charles River Laboratories) were housed three per cage and maintained in a humidity controlled room under 12: 12 h light/dark cycles. All animal studies were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Academy of Sciences (1996). All study protocols were reviewed and approved by Arena Pharmaceuticals, Inc.'s Institutional Animal Care and Use Committee (IACUC). Water and standard diet was provided ad libitum.
Mas Receptor Inverse Agonist: Compound A was used and is a Mas receptor inverse agonist, see PCT US2012/063793, Compound 170, (,S,)-4-((l-Amino-3-hydroxy-l-oxopropan-2- ylarnino)methyl)-iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluorobenzamide; IC50 21.4 nM (rat MAS receptor) and 15.6 nM (human MAS receptor).
LPS model for Sepsis induction: Mice were treated intravenously with either 20% DMSO (vehicle), 1, 3, or 10 mg kg Compound A in 20% DMSO. Alternatively animals were treated with 1 mg kg IB-MECA in 0.1 % DMSO as a positive control (n = 6 per group). 1 h after drug treatment, animals received 500 μg of LPS intraperitoneally. Animals were bled 75 min after LPS treatment and
the blood was spun down for serum. An ELIS A for mouse TNFa (Invitrogen) was performed on 1 :50 diluted samples the following day.
Result: Suppression of TNFa induction with Compound A was significant compared to control treated animals at the 10 and 3 mg kg dose. The 10 mg kg dose was not statistically different from the positive control D3-MECA. This experiment demonstrates that Mas inverse agonists can suppress LPS induced TNFa; see Figure 28.
Example 8: Mas receptor Inverse Agonists Suppress Paw Swelling in the Carrageenan-Induced Inflammatory Paw Swelling Model.
The carrageenan-induced paw swelling model is associated with elevated levels of proinflammatory cytokines, such as TNFa, that peak at 3 h post-carrageenan injection (Lorman et. ah, J. Pain 8(2): 127-36 (2007)).
Animals: Male Sprague Dawley rats (Harlan Laboratories) were housed three per cage and maintained in a humidity controlled room under 12: 12 h light/dark cycles. All animal studies were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Academy of Sciences (1996). All study protocols were reviewed and approved by Arena Pharmaceuticals, Inc.'s Institutional Animal Care and Use Committee (IACUC). Water and standard diet was provided ad libitum.
Drug treatment: In a blinded and randomized fashion, rats were intraperitoneally dosed with a Mas receptor inverse agonist (AR305352, iV-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenyl)-2,6-difluorobenzamide, see Zhang, T., et. ah, Am J Physiol Heart Circ Physiol 302:H299- H311, (2012)) at 1, 3 and 10 mg kg, 20% HPCD or 2 mg/kg of dexamethasone, 30 minutes prior to injection of 100 μΕ of saline or 100 μg of λ-carrageenan into the left or right foot pad of anesthetized animals. The difference in footpad width was measured using a caliper at 1, 2, 3, 6 and 24 h post- injection.
Results: Duplicate experiments with the Mas receptor inverse agonist, AR305352, demonstrated that pre-treatment with Mas inverse agonists suppress foot-pad inflammation in a dose- dependent manner at all time points for the 3 and 10 mg/kg dose for up to 24 h. The positive control, 2 mg/kg of dexamethasone, inhibited swelling from 3 h onwards which is consistent with its pharmacokinetics. This experiment demonstrates that Mas inverse agonists can suppress inflammation in the carrageenan foot-pad model; see Figure 29.
Example 9: Mas Inverse Agonist (Compound A) can Protect Kidneys Subjected to Ischemia Reperfusion Injury.
Animals: Male Sprague-Dawley Rats (Charles River Laboratories) were maintained in a humidity controlled room under 12: 12 h light/dark cycles. All animal studies were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Academy of Sciences (1996). Water and standard diet was provided ad libitum.
Ischemia-Reperfusion Injury Model: Rats were anesthetized with pentobarbital (70 mg kg). Normal body temperature was maintained by placing the animals on heating pads until recovery from anesthesia. Following a midline abdominal incision, the left renal pedicle was localized and the renal artery and vein were dissected. An atraumatic microvascular clamp was placed, and the left renal artery was occluded for 45 min. After inspection for signs of ischemia, the wound was covered with PBS soaked cotton. After release of the clamp, restoration of blood-flow was inspected visually and the wound was closed with surgical staples and the animal was allowed to recover. 24 h following the end of ischemia, blood was collected and markers of kidney function, creatinine and blood urea nitrogen (BUN) were measured.
Treatment of Animals with an Mas Inverse Agonist (Compound A): 15 min prior to renal artery occlusion either vehicle (20% hydro xypropyl-3-cyclodextrin) or a loading dose of 6.26 mg/kg Mas inverse agonist (Compound A) was administered i.v. followed by a i.v. maintenance dose of 1.64 mg/kg/h lasting for 2 h following removal of the renal artery clamp. A renoprotective positive control peptide, Atrial natriuretic peptide (ANP, 0.2 μg/kg/min), was administered by continuous i.v. infusion starting 15 min prior to renal artery occlusion and lasting for 2 h following removal of the renal artery clamp, see Figure 30 for protocol.
Results: The data demonstrate that administration of the Mas inverse agonist, Compound A, improves kidney function compared to vehicle treatment as measured by blood creatinine (Figure 31) and BUN levels (Figure 32). The degree of renal protection is at the same activity compared to ANP which is known to be renoprotective in this model (Chujo, K. et. al., J. Biosci. Bioeng. Jun, 109(6):526- 30 (2010)) and in human clinical studies (Nigwekar, S. U., Cochrane Database Syst. Rev. Oct 7, (4):CD006028 (2009)).
Example 10: Mas Receptor Inverse Agonist (Compound A) Reduces Brain Damage in a Rat Model of Stroke.
Animals: Male Sprague Dawley rats (Charles River Laboratories) were housed three per cage and maintained in a humidity controlled room under 12: 12 h light/dark cycles. All animal studies were performed according to the Guide for the Care and Use of Laboratory Animals published by the National Academy of Sciences (1996). All study protocols were reviewed and approved by Arena Pharmaceuticals, Inc.'s Institutional Animal Care and Use Committee (IACUC). Water and standard diet was provided ad libitum.
Rat Model of Transient Cerebral Ischemia/Stroke: Rats were anesthetized with pentobarbital (70 mg/kg). Normal body temperature was maintained by placing the animals on heating pads. A midline neck incision was made and soft tissues were pulled apart, and the external carotid artery (ECA), and internal carotid artery (ICA) were exposed. The ECA was ligated with a 5-0 silk suture and the ICA was temporarily blocked by a microvascular clip. An incision was made around the left hind leg area and exposing the femoral vein. A 30-mm length of 3-0 monofilament nylon suture coated with 0.1 % poly-lysine was inserted into the right ICA lumen through a small incision at about 4-
mm proximal to the carotid bifurcation. The filament was advanced 18-22 mm from the start of the carotid bifurcation to block the origin of the right middle cerebral artery (MCA) for the ischemia time designed. Reperfusion was obtained by pulling out the occluding filament at the end of the MCA. After occlusion the tissues around the neck were closed with 4-0 silk suture (Ethicon, 1677G). The skin around the neck was closed with metal clips and the cutting area was treated with iodine. At the end of the reperfusion period (e.g. 24 h) the rats were anesthetized with Nembutal® (70 mg kg) and the brains were removed. Brains were then sectioned coronally with a razor blade at 2-mm intervals and incubated for 60 min in a 2% solution of 2,3,5 triphenyltetrazolium chloride (TTC) at 37 °C for vital staining. Whole area (WA) and infarct area (IA) were measured for each coronal section. Brain damage was assessed by IA/(IA+WA). See Figure 33 for protocol.
Treatment of Animals with Mas Inverse Agonists: A bolus i.v. dose of vehicle (20% hydroxypropyl-3-cyclodextrin) or 3 mg kg Mas inverse agonist (Compound A) was administered either 1 min prior to MCA occlusion or at the onset of reperfusion. A known neuroprotective drug tacrolimus (FK506, 0.32 mg/min i.v. bolus) was administered in the same fashion as a positive control (Bochelen D. et. al., J Pharmacol Exp Ther. Feb, 288(2):653-9 (1999)).
Result: Inhibition of Mas G-protein signaling with the Mas Inverse Agonist (Compound A) reduced brain damage associated with transient ischemic injury in the rat (Figure 34).
Claims
What is claimed is:
1. A compound selected from compounds of Formula (la) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
wherein:
(A) R1 is selected from: C1-C6 alkyl, C3-C7 cycloalkyl, C4-C13 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl; each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents;
provided that:
(i) when R1 and R2 are both Ci-C6 alkyl then at least one Ci-C6 alkyl group is substituted with one or more substituents; and
(ii) R1 is a group other than: 2-(tert-butoxy)-2-oxoethyl, 3-(teri-butoxy)-3- oxopropyl, 4-(tert-butoxy)-4-oxobutyl, or l-(tert-butoxy)-4-methyl-l-oxopentan-2-yl; or
(B) R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy-Cr C6-alkyl, C1-C6 haloalkyl, and hydroxy-Ci-C6-alkyl;
provided that when said heterocyclyl is substituted with said hydroxy-Ci-C6-alkyl then R5 is C C6 alkyl;
and
R3 is selected from: H and halogen;
R4 is halogen;
R5 is selected from: C1-C6 alkoxycarbonyl, C1-C6 alkyl, and halogen; and
R6 is selected from: H and C1-C6 alkyl.
2. The compound according to claim 1 , wherein:
R1 is selected from: C1-C6 alkyl, C3-C7 cycloalkyl, C4-C13 cycloalkylalkyl, heteroaryl, heterocyclyl, and heterocyclyl-Ci-C6-alkyl, each optionally substituted with one or more substituents selected from: Ci-C6 alkoxycarbonyl, Ci-C6 alkyl, Ci-C6 alkylsulfonyl, amino, carboxamide, cyano, C2-C8 dialkylamino, heteroaryl, heterocyclyl, hydroxyl, hydroxy-Ci-C6-alkyl, phosphonooxy, and sulfo; and
R2 is selected from: H and Ci-C6 alkyl, wherein said Ci-C6 alkyl is optionally substituted with one or more hydroxyl substituents.
3. The compound according to claim 1 , wherein:
R1 is selected from: Ci-C6 alkyl and heterocyclyl, each optionally substituted with one or more substituents selected from: C1-C6 alkylsulfonyl, amino, cyano, heteroaryl, heterocyclyl, and hydroxyl; and
selected from: Η and C1-C6 alkyl.
4. The compound according to claim 1 , wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, cyclohexyl,
(cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3- methylpentan-2-yl, «-butyl, 2,2-dimethylpropyl, cyclobutyl, and «-pentyl; each optionally substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1H- tetrazolyl, tert-butoxycarbonyl, and phosphonooxy; and
R2 is selected from: Η, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents.
5. The compound according to claim 1 , wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, lH-imidazolyl, cyano, and pyrrolidinyl; and
selected from: H and methyl.
6. The compound according to claim 1 , wherein:
R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3- (lH-imidazol-l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, pyrrolidin-2-ylmethyl, l-methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2- (dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (1- hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3- dihydroxybutan-2-yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, 1- (ethoxycarbonyl)cyclopropyl, 1 -(hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, 1 -hydroxy-3-methylbutan-2-yl, 1 -hydroxypropan-2-yl, 1 ,3-dihydroxy-2-methylpropan-2- yl, 3-hydroxypropyl, l-(hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4- hydroxybutyl, 2-sulfoethyl, 3-hydroxy-2,2-dimethylpropyl, (2- hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3 - (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, (1H- tetrazol-5-yl)methyl, l ,3-dihydroxypropan-2-yl, l -amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2-(phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl; and
R2 is selected from: Η, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl.
7. The compound according to claim 1 , wherein:
R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3- (lH-imidazol-l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl; and
selected from: Η and methyl.
8 The compound according to claim 1 , wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical substituted with one or more substituents selected from: carboxy-Ci- C6-alkyl, Ci-C6 haloalkyl, and hydroxy-Ci-C6-alkyl.
9. The compound according to claim 1 , wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: carboxy-Ci-C6-alkyl, C1-C6 haloalkyl, and hydroxy- Ci-Cs-alkyl.
10. The compound according to claim 1 , wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: trifluoromethyl, carboxymethyl, hydroxymethyl, and chloromethyl.
11. The compound according to claim 1 , wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: 4-(trifluoromethyl)piperidin-l-yl, 3- (carboxymethyl)pyrrolidin-l-yl, 4-(hydroxymethyl)piperidin-l-yl, and 4- (chloromethyl)piperidin- 1 -yl.
12. The compound according to any one of claims 1 to 17, wherein R3 is H or fluorine.
13. The compound according to any one of claims 1 to 20, wherein R4 is fluorine.
14. The compound according to any one of claims 1 to 21 , wherein R5 is ethoxycarbonyl, tert-b tyl, or chlorine.
15. The compound according to any one of claims 1 to 28, wherein R6 is H or methyl.
16. The compound according to claim 1 , selected from compounds of Formula (Ic) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, pyrrolidinyl, cyclohexyl, (cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3- methylpentan-2-yl, «-butyl, 2,2-dimethylpropyl, cyclobutyl, «-pentyl, and
(pyrrolidenyl)methyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, lH-imidazolyl, cyano, pyrrolidinyl, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1H- tetrazolyl, teri-butoxycarbonyl, and phosphonooxy;
R2 is selected from: Η, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents;
R3 is selected from: Η and halogen;
R4 is halogen;
R5 is selected from: Ci-C6 alkoxycarbonyl, and halogen; and
R6 is selected from: Η and Ci-C6 alkyl.
The compound according to claim 1 , selected from compounds of Formula (Ic) and pharmaceutically
wherein:
R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3- (lH-imidazol-l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, pyrrolidin-2-ylmethyl, l-methylpiperidin-4-yl, 2-amino-2-oxoethyl, 2- (dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (1- hydroxycyclohexyl)methyl, 1 -hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3- dihydroxybutan-2-yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, 1- (ethoxycarbonyl)cyclopropyl, 1 -(hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, 1 -hydroxy-3-methylbutan-2-yl, 1 -hydroxypropan-2-yl, 1 ,3-dihydroxy-2-methylpropan-2- yl, 3-hydroxypropyl, l-(hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4- hydroxybutyl, 2-sulfoethyl, 3-hydroxy-2,2-dimethylpropyl, (2- hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3 - (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, (1H- tetrazol-5-yl)methyl, l ,3-dihydroxypropan-2-yl, l -amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2-(phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl;
R2 is selected from: Η, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl;
R3 is selected from: Η and fluorine;
R4 is fluorine;
R5 is selected from: ethoxycarbonyl, and chlorine; and
R6 is selected from: Η and methyl.
The compound according to claim 1 , selected from compounds of Formula (Ie) and pharmaceutically
(Ie)
wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form a heterocyclyl radical selected from: piperidinyl and pyrrolidinyl; each substituted with one or more substituents selected from: trifluoromethyl, carboxymethyl, and chloromethyl;
R3 is halogen;
R4 is halogen; and
R5 is selected from: C1-C6 alkyl and halogen.
The compound according to claim 1 , selected from compounds of Formula (Ie) and pharmaceutically
(Ie)
wherein:
R1 and R2 together with the nitrogen atom to which they are both bonded form heterocyclyl radical selected from: 4-(trifluoromethyl)piperidin-l-yl, 3- (carboxymethyl)pyrrolidin- 1 -yl, and 4-(chloromethyl)piperidin- 1 -yl;
R3 is fluorine;
R4 is fluorine; and
R5 is selected from: teri-butyl and chlorine.
The compound according to claim 1 , selected from compounds of Formula (Ig) and pharmaceutically
(ig)
wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, cyclohexyl,
(cyclohexyl)methyl, 2-methylpropan-2-yl, butan-2-yl, (pyrrolidinyl)ethyl, pyrimidinyl, tetrahydrofuranyl, cyclopentyl, cyclopropyl, 3-methylbutan-2-yl, propan-2-yl, 3- methylpentan-2-yl, «-butyl, 2,2-dimethylpropyl, cyclobutyl, and «-pentyl; each optionally
substituted with one or more substituents selected from: hydroxy, cyano, methyl, carboxamide, dimethylamino, hydroxymethyl, ethoxycarbonyl, carboxy, sulfo, 1H- tetrazolyl, teri-butoxycarbonyl, and phosphonooxy;
R2 is selected from: Η, ethyl, methyl, isopropyl, and i-butyl, wherein said ethyl, methyl, isopropyl, and i-butyl are each optionally substituted with one or more hydroxyl substituents; and
R6 is selected from: Η and Ci-C6 alkyl.
The compound according to claim 1 , selected from compounds of Formula (Ig) and pharmaceutically
(Ig)
wherein:
R1 is selected from: 2-hydroxyethyl, 2-cyanoethyl, 1 -methylpiperidin-4-yl, 2- amino-2-oxoethyl, 2-(dimethylamino)ethyl, 2,3-dihydroxypropyl, 2-hydroxycyclohexyl, (l-hydroxycyclohexyl)methyl, l-hydroxy-2-methylpropan-2-yl, 2-hydroxypropyl, 1 ,3- dihydroxybutan-2-yl, 2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl, 4-hydroxycyclohexyl, 2-hydroxy-5-methylpyrimidin-4-yl, tetrahydrofuran-3-yl, 2-hydroxycyclopentyl, 1- (ethoxycarbonyl)cyclopropyl, 1 -(hydroxymethyl)cyclopropyl, 2-hydroxypyrimidin-4-yl, 1 -hydroxy-3-methylbutan-2-yl, 1 -hydroxypropan-2-yl, 1 ,3-dihydroxy-2-methylpropan-2- yl, 3-hydroxypropyl, l-(hydroxymethyl)cyclopentyl, l-hydroxy-3-methylpentan-2-yl, 4- hydroxybutyl, 2-sulfoethyl, 3-hydroxy-2,2-dimethylpropyl, (2- hydroxycyclohexyl)methyl, (4-(hydroxymethyl)cyclohexyl)methyl, 3 - (hydroxymethyl)cyclobutyl, 4-(hydroxymethyl)cyclohexyl, 5-hydroxypentyl, (1H- tetrazol-5-yl)methyl, l ,3-dihydroxypropan-2-yl, l -amino-3-hydroxy-l-oxopropan-2-yl, 2-(phosphonooxy)ethyl, 2-(phosphonooxy)propyl, and 1 -(phosphonooxy)propan-2-yl;
R2 is selected from: Η, ethyl, methyl, 2-hydroxyethyl, isopropyl, and i-butyl; and
R6 is selected from: Η and methyl.
The compound according to claim 1 , selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
(Ii)
wherein:
R1 is selected from: ethyl, methyl, w-propyl, piperidinyl, and pyrrolidinyl; each optionally substituted with one or more substituents selected from: amino, hydroxy, methylsulfonyl, lH-imidazolyl, cyano, and pyrrolidinyl; and
R2 is selected from: Η and methyl.
The compound according to claim 1 , selected from compounds of Formula (Ii) and pharmaceutically acceptable salts, solvates, and hydrates thereof:
(Ii)
wherein:
R1 is selected from: 2-aminoethyl, 2-hydroxyethyl, (methylsulfonyl)methyl, 3- (lH-imidazol-l-yl)propyl, piperidin-4-yl, 2-cyanoethyl, piperidin-3-yl, pyrrolidin-3-yl, and pyrrolidin-2-ylmethyl; and
R2 is selected from: Η and methyl.
The compound according to claim 1 , selected from the following compounds pharmaceutically acceptable salts, solvates, and hydrates thereof:
4-((3-(2-Aminoethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-2-fluorobenzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4-((3-(2- hydroxyethyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4-((3- (methylsulfonylmethyl)ureido)methyl)benzamide;
4-((3-(3-(lH-Imidazol-l-yl)propyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-2-fluorobenzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4-((3- piperidin-4-ylureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2- cyanoethyl)-3-methylureido)methyl)-2-fluorobenzamide;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4- ((3 -piperidin-3 -ylureido)methyl)benzamide ;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4- ((3-pyrrolidin-3-ylureido)methyl)benzamide;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4- ((3-(pyrrolidin-2-ylmethyl)ureido)methyl)benzamide;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2-fluoro-4- ((3-(pyrrolidin-2-ylmethyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-(2-hydroxyethyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2- cyanoethyl)-3-methylureido)methyl)-2,3-difluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-methyl-3-(l -methylpiperidin-4-yl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-(2-hydroxyethyl)-3-methylureido)methyl)benzamide;
4-((3-(2-Amino-2-oxoethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-2,3-difluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2- (dimethylamino)ethyl)ureido)methyl)-2,3-difluorobenzamide;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((lR,25)-2-hydroxycyclohexyl)ureido)methyl)benzamide;
4-((3,3-Bis(2-hydroxyethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-2,3-difluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3 -(( 1 -hydroxycyclohexyl)methyl)ureido)methyl)benzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-(l-hydroxy-2-methylpropan-2-yl)ureido)methyl)benzamide;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3 -(2-hydroxypropyl)ureido)methyl)benzamide ;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3 -(2-hydroxypropyl)ureido)methyl)benzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-((2R,3R)- l ,3-dihydroxybutan-2-yl)ureido)methyl)-2,3-difluorobenzamide;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3 -(2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl)ureido)methyl)benzamide ;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3 -(2-(2-(hydroxymethyl)pyrrolidin- 1 -yl)ethyl)ureido)methyl)benzamide ;
N-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3- difluorobenzyl)-4-(trifluoromethyl)piperidine- 1 -carboxamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((l r,4r)-4-hydroxycyclohexyl)ureido)methyl)benzamide;
N-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-(2-hydroxy-5-methylpyrimidin-4-yl)ureido)methyl)benzamide;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3-(tetrahydrofuran-3-yl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((lR,2R)-2-hydroxycyclopentyl)ureido)methyl)benzamide;
Ethyl l-(3-(4-(4-chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l - yl)phenylcarbamoyl)-2,3-diiluorobenzyl)ureido)cyclopropanecarboxylate;
N-(4-Chloro-2-(4-(3,3,3-triiluoropropyl)piperazin-l-yl)phenyl)-2,3-diiluoro-4- ((3-(l-(hydroxymethyl)cyclopropyl)ureido)methyl)benzamide;
N-(4-chloro-2-(4-(3,3,3-triiluoropropyl)piperazin-l-yl)phenyl)-2,3-diiluoro-4- ((3-(2-hydroxypyrimidin-4-yl)ureido)methyl)benzamide;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(2,3- dihydroxypropyl)ureido)methyl)-2,3-diiluorobenzamide;
2-(l -(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenylcarbamoyl)- 2,3-difluorobenzylcarbamoyl)pyrrolidin-3-yl)acetic acid;
(5)-2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-dilluorobenzyl)ureido)propyl dihydrogen phosphate;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3 -( 1 -hydroxy-3-methylbutan-2-yl)ureido)methyl)benzamide ;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro- 4-((3 -( 1 -hydroxypropan-2-yl)ureido)methyl)benzamide ;
(R)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro- 4-((3 -( 1 -hydroxy-3-methylbutan-2-yl)ureido)methyl)benzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-((15,2R)-2-hydroxycyclohexyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-triiluoropropyl)piperazin-l-yl)phenyl)-4-((3-(l ,3- dihydroxy-2-methylpropan-2-yl)ureido)methyl)-2,3-dilluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-(3-hydroxypropyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-(l-(hydroxymethyl)cyclopentyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-((25,35)-l -hydroxy-3-methylpentan-2-yl)ureido)methyl)benzamide;
4-((3-tert-Butyl-3-(2-hydroxyethyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trilluoropropyl)piperazin- 1 -yl)phenyl)-2,3-dilluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-(4-hydroxybutyl)ureido)methyl)benzamide;
2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenylcarbamoyl)- 2,3-difluorobenzyl)ureido) ethanesulfonic acid;
N-(4-Chloro-2-(4-(3,3,3-triiluoropropyl)piperazin-l-yl)phenyl)-4-((3-ethyl-3-(2- hydroxyethyl)ureido)methyl)-2,3-dilluorobenzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-(3-hydroxy-2,2-dimethylpropyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-(((15,2R)-2-hydroxycyclohexyl)methyl)ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-dilluoro-4- ((3-(2-hydroxyethyl)-3-isopropylureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((lR,2R)-2-hydroxycyclohexyl) ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3 -(( 1 s ,4s)-4-hydroxycyclohexyl) ureido)methyl)benzamide ;
(5)-N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro- 4-((3 -( 1 -hydroxypropan-2-yl)ureido)methyl)benzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((lR,2S)-2-hydroxycyclopentyl) ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3 -((( 1 r,4r)-4-(hydroxymethyl) cyclohexyl)methyl)ureido)methyl)benzamide ;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((li,3*)-3-(hydroxymethyl)cyclobutyl) ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((lr,3 )-3-(hydroxymethyl)cyclobutyl) ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-((ls,4s)-4-(hydroxymethyl)cyclohexyl) ureido)methyl)benzamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3-difluoro-4- ((3-(5-hydroxypentyl)ureido) methyl)benzamide;
4-((3-((lH-Tetrazol-5-yl)methyl)ureido)methyl)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin- 1 -yl)phenyl)-2,3-difluorobenzamide;
(5)-N-(4-Chloro-2-(3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-2,3- difluoro-4-((3-(2-hydroxyethyl)ureido)methyl)benzamide;
N-(4-Chloro-2-((5)-3-methyl-4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4- ((3-((5)-2,3-dihydroxypropyl)ureido)methyl)-2,3-difluorobenzamide;
N-(4-(4-tert-Butyl-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)- 2,3-difluorobenzyl)-4-(hydroxymethyl)piperidine- 1 -carboxamide;
(S)-Ethyl 4-(4-((3-(2,3-dihydroxypropyl)ureido) methyl)-2,3- difluorobenzamido)-3-(4-(3,3,3-trifluoropropyl) piperazin-l-yl)benzoate;
N-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenylcarbamoyl)-2,3- difluorobenzyl)-4-(chloromethyl)piperidine-l -carboxamide;
N-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l-yl)phenyl)-4-((3-(l ,3- dihydroxypropan-2-yl)ureido) methyl)-2,3-difluorobenzamide;
(5)-4-((3 -(1- Amino-3 -hydroxy- 1-oxopropan -2-yl)ureido)methyl)-N-(4-chloro-2- (4-(3 ,3 ,3 -trifluoropropyl)piperazin- 1 -yl)phenyl)-2,3 -difluorobenzamide;
2-(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l -yl)phenylcarbamoyl)- 2,3-difluorobenzyl)ureido)ethyl dihydrogen phosphate; and
(R)-l -(3-(4-(4-Chloro-2-(4-(3,3,3-trifluoropropyl)piperazin-l- yl)phenylcarbamoyl)-2,3-difluorobenzyl)ureido)propan-2-yl dihydrogen phosphate.
25. A compound according to claim 24 that is anhydrous (5)-N-(4-chloro-2-(4-(3,3,3- trifluoropropyl)piperazin-l -yl)phenyl)-4-((3-(2,3-dihydroxypropyl)ureido)methyl)-2,3- difluorobenzamide.
26. A crystalline form of the compound according to claim 25, having an X-ray powder diffraction pattern comprising one or more peaks listed in Table C.
27. A crystalline form of the compound according to claim 25, having:
1) an X-ray powder diffraction pattern substantially as shown in Figure 8;
2) a differential scanning calorimetry thermogram substantially as shown in Figure 9;
3) a thermogravimetric analysis profile substantially as shown in Figure 9; and/or
4) a dynamic moisture sorption profile substantially as shown in Figure 10.
28. A composition comprising a compound according to any one of claims 1 to 25 or a
crystalline form according to claim 26 or 27.
29. A pharmaceutical product selected from: a pharmaceutical composition, a formulation, a unit dosage form, and a kit, each comprising a compound according to any one of claims 1 to 25 or a crystalline form according to claim 26 or 27.
30. A pharmaceutical composition comprising a compound according to any one of claims 1 to 25 or a crystalline form according to claim 26 or 27, and a pharmaceutically acceptable carrier.
31. A method for preparing a pharmaceutical composition comprising the step of admixing a compound according to any one of claims 1 to 25 or a crystalline form according to claim 26 or 27, and a pharmaceutically acceptable carrier.
32. A method for the treatment of a Mas receptor-mediated disorder in an individual, comprising administering to said individual in need thereof, a therapeutically effective amount of a compound according to any one of claims 1 to 25 ; a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30.
33. A method for the treatment of: a disorder alleviated by vasodilation in an individual, ischemia reperfusion injury during and/or following coronary bypass surgery, ischemia reperfusion myocardial injury during and/or following coronary bypass surgery, a disorder alleviated by inhibiting calcium signaling in cells in an individual, a disorder alleviated by correcting improper calcium handling by cells in an individual, arrhythmia in an individual, ischemia reperfusion-induced arrhythmia, reperfusion-induced myocardial injury in an individual, reperfusion-induced cardiomyocyte injury in an individual, reperfusion-induced cardiomyocyte cell death in an individual, or an inflammatory disorder in an individual, comprising administering to said individual in need thereof, a therapeutically effective amount of a compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30.
34. A method for: reducing injury due to blood clot formation in an individual, reducing injury due to blood clot formation following angioplasty in an individual, providing neuroprotection in an individual, or providing renal protection in an individual, comprising administering to said individual in need thereof, a therapeutically effective amount of a compound according to any one of claims 1 to 25 ; a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30.
35. Use of a compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; or a composition according to claim 28; in the manufacture of a medicament for the treatment of a Mas receptor-mediated disorder.
36. Use of a compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; or a composition according to claim 28; in the manufacture of a
medicament for the treatment of: a disorder alleviated by vasodilation in an individual, ischemia reperfusion injury during and/or following coronary bypass surgery, ischemia reperfusion myocardial injury during and/or following coronary bypass surgery, a disorder alleviated by inhibiting calcium signaling in cells in an individual, a disorder alleviated by correcting improper calcium handling by cells in an individual, arrhythmia in an individual, ischemia reperfusion-induced arrhythmia, reperfusion-induced myocardial injury in an individual, reperfusion-induced cardiomyocyte injury in an individual, reperfusion-induced cardiomyocyte cell death in an individual, or an inflammatory disorder in an individual.
37. Use of a compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; or a composition according to claim 28; in the manufacture of a medicament for: reducing injury due to blood clot formation in an individual, reducing injury due to blood clot formation following angioplasty in an individual, providing neuroprotection in an individual, or providing renal protection in an individual.
38. A compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30; for use in a method of treatment of the human or animal body by therapy.
39. A compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30; for use in a method of treatment of a Mas receptor-mediated disorder.
40. A compound according to any one of claims 1 to 25; a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30; for use in a method of treatment of: a disorder alleviated by vasodilation in an individual, ischemia reperfusion injury during and/or following coronary bypass surgery, ischemia reperfusion myocardial injury during and/or following coronary bypass surgery, a disorder alleviated by inhibiting calcium signaling in cells in an individual, a disorder alleviated by correcting improper calcium handling by cells in an individual, arrhythmia in an
individual, ischemia reperfusion-induced arrhythmia, reperfusion-induced myocardial injury in an individual, reperfusion-induced cardiomyocyte injury in an individual, reperfusion-induced cardiomyocyte cell death in an individual, or an inflammatory disorder in an individual.
41. A compound according to any one of claims 1 to 25; or a crystalline form according to claim 26 or 27; a composition according to claim 28; a pharmaceutical product according to claim 29; or a pharmaceutical composition according to claim 30; for use in a method for: reducing injury due to blood clot formation in an individual, reducing injury due to blood clot formation following angioplasty in an individual, providing neuroprotection in an individual, or providing renal protection in an individual.
42. A method according to claim 32; a use according to claim 35; or a compound according to claim 39; wherein said Mas receptor-mediated disorder is selected from: coronary heart disease, atherosclerosis, ischemia, reperfusion injury, reperfusion injury following cardioplegia, reperfusion injury following angioplasty, angina pectoris, myocardial infarction, no-reflow phenomenon, hypertension, pulmonary hypertension, anxiety, transient ischemic attack, erectile dysfunction, ischemic colitis, mesenteric ischemia, acute limb ischemia, skin discoloration caused by reduced blood flow to the skin, renal artery stenosis, renovascular hypertension, renal failure, chronic kidney disease, and diabetic nephropathy.
43. A method according to claim 32; a use according to claim 35; or a compound according to claim 39; wherein said Mas receptor-mediated disorder is selected from: stroke, brain attack, neuroprotection, brain ischemia (thrombotic, embolic and hypoperfusion), focal or multifocal brain ischemia, global brain ischemia, ischemic brain injury, acute ischemic brain damage, acute ischemic brain injury, brain infarction, brain reperfusion injury, brain hypoxia, cerebral reperfusion injury, neuronal reperfusion injury, ischemic neurological disorders, ischemic brain damage, cerebral hypoxia, cerebral ischemia, cerebral ischemic injury, hypoxic-ischemic brain injury, anoxic brain injury, anoxic brain damage, anoxic encepalopathy, subcortical ischemic depression, moyamoya disease, and cardiorespiratory arrest.
A method according to claim 32; a use according to claim 35; or a compound according to claim 39; wherein said Mas receptor-mediated disorder is selected from: nephropathy, nephrotic syndrome, obstruction nephropathy, obstructive nephropathy, diabetic nephropathy, renal hypertension, renovascular hypertension, renal ischemia, renal ischemic injury, renal ischemia-reperfusion injury, renal reperfusion injury, acute renal injury, acute kidney injury, acute renal failure, acute kidney failure, acute tubular necrosis, contrast nephropathy, chronic kidney disease, chronic renal failure, chronic renal insufficiency, end stage renal disease, end stage renal failure, focal segmental glomerulosclerosis, glomerulonephritis, diabetes and diabetic kidney disease, diabetes insipidus, Fabry's disease, focal segmental glomerulosclerosis, focal sclerosis, focal glomerulosclerosis, Gitelman syndrome, glomerular diseases, high blood pressure and kidney disease, IgA nephropathy (Berger's disease), interstitial nephritis, lupus, malignant hypertension, microscopic polyangiitis (MPA), preeclampsia, polyarteritis, proteinuria, renal artery stenosis, renal infarction, reflux nephropathy, scleroderma renal crisis, tuberous sclerosis, and warfarin-related nephropathy.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361820309P | 2013-05-07 | 2013-05-07 | |
| US61/820,309 | 2013-05-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014182673A1 true WO2014182673A1 (en) | 2014-11-13 |
Family
ID=50841986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/036928 Ceased WO2014182673A1 (en) | 2013-05-07 | 2014-05-06 | Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014182673A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022256267A1 (en) * | 2021-06-01 | 2022-12-08 | Arena Pharmaceuticals, Inc. | Methods of treatment |
| WO2025104706A3 (en) * | 2023-11-15 | 2025-07-17 | Xitra Therapeutics Gmbh | Small molecule modulators of mas and mrgd receptors |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998024771A1 (en) * | 1996-12-02 | 1998-06-11 | Fujisawa Pharmaceutical Co., Ltd. | Benzamide derivatives having a vasopressin antagonistic activity |
| WO1999065874A1 (en) * | 1998-06-19 | 1999-12-23 | Wakamoto Pharmaceutical Co., Ltd. | Benzanilide derivatives and medicinal compositions |
| US6270766B1 (en) | 1992-10-08 | 2001-08-07 | The Kennedy Institute Of Rheumatology | Anti-TNF antibodies and methotrexate in the treatment of arthritis and crohn's disease |
| WO2005063745A2 (en) | 2003-12-23 | 2005-07-14 | Arena Pharmaceuticals, Inc. | Novel spiroindoline or spiroisoquinoline compounds, methods of use and compositions thereof |
| WO2006094246A2 (en) * | 2005-03-03 | 2006-09-08 | Sirtris Pharmaceuticals, Inc. | N-arylmethyl benzamide sirtuin modulators |
| US20100273781A1 (en) * | 2009-04-27 | 2010-10-28 | Boehringer Ingelheim International Gmbh | Cxcr3 receptor antagonists |
| WO2013070657A1 (en) * | 2011-11-08 | 2013-05-16 | Arena Pharmaceuticals, Inc. | Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto |
-
2014
- 2014-05-06 WO PCT/US2014/036928 patent/WO2014182673A1/en not_active Ceased
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6270766B1 (en) | 1992-10-08 | 2001-08-07 | The Kennedy Institute Of Rheumatology | Anti-TNF antibodies and methotrexate in the treatment of arthritis and crohn's disease |
| WO1998024771A1 (en) * | 1996-12-02 | 1998-06-11 | Fujisawa Pharmaceutical Co., Ltd. | Benzamide derivatives having a vasopressin antagonistic activity |
| WO1999065874A1 (en) * | 1998-06-19 | 1999-12-23 | Wakamoto Pharmaceutical Co., Ltd. | Benzanilide derivatives and medicinal compositions |
| WO2005063745A2 (en) | 2003-12-23 | 2005-07-14 | Arena Pharmaceuticals, Inc. | Novel spiroindoline or spiroisoquinoline compounds, methods of use and compositions thereof |
| WO2006094246A2 (en) * | 2005-03-03 | 2006-09-08 | Sirtris Pharmaceuticals, Inc. | N-arylmethyl benzamide sirtuin modulators |
| US20100273781A1 (en) * | 2009-04-27 | 2010-10-28 | Boehringer Ingelheim International Gmbh | Cxcr3 receptor antagonists |
| WO2013070657A1 (en) * | 2011-11-08 | 2013-05-16 | Arena Pharmaceuticals, Inc. | Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto |
Non-Patent Citations (58)
| Title |
|---|
| ALENINA N. ET AL., EXP PHYSIOL, vol. 93, 2008, pages 528 - 537 |
| AMBROZ C. ET AL., BIOCHIM BIOPHYS ACTA, vol. 1133, 1991, pages 107 - 111 |
| BERGE ET AL., JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 66, 1977, pages 1 - 19 |
| BIKKAVILLI R. K. ET AL., BIOCHEM PHARMACOL, vol. 71, 2006, pages 319 - 337 |
| BLACK, ANNU. REP. MED. CHEM., vol. 32, 1997, pages 241 - 250 |
| BOCHELEN D., J PHARMACOL EXP THER., vol. 288, no. 2, February 1999 (1999-02-01), pages 653 - 9 |
| CANALS M ET AL., J BIOL CHEM, vol. 281, 2006, pages 16757 - 16767 |
| CASTRO C.H. ET AL., LIFE SCI, vol. 80, 2006, pages 264 - 268 |
| CHOY ET AL., RHEUMATOLOGY, vol. 41, no. 10, 2002, pages 1133 - 1137 |
| CHUJO, K., J. BIOSCI. BIOENG., vol. 109, no. 6, June 2010 (2010-06-01), pages 526 - 30 |
| COLLARD C. D.; GELMAN S., ANESTHESIOLOGY, vol. 94, 2001, pages 1133 - 1138 |
| COLLIER, T. L., J. LABELLED COMPD. RADIOPHARM., vol. 42, 1999, pages 5264 - 5266 |
| DAI W. ET AL., CARDIOVASC THER, vol. 28, 2010, pages 30 - 37 |
| DE GASPARO, M. ET AL., PHARMACOL REV, vol. 52, 2000, pages 415 - 472 |
| DE JONG, PHARMACOL THER, vol. 87, 2000, pages 141 - 149 |
| DONG ET AL., CELL, vol. 106, 2001, pages 619 - 632 |
| DOUGLAS, S. A.; OHLSTEIN, E. H., VASCULAR RESEARCH, vol. 34, 1997, pages 152 - 164 |
| EDWARD B. ROCHE: "Bioreversible Carriers in Drug Design", 1987, AMERICAN PHARMACEUTICAL ASSOCIATION AND PERGAMON PRESS |
| EDWARDS, N. ENGL. J. MED., vol. 350, no. 25, 2004, pages 2572 - 81 |
| ESTEBAN V. ET AL., PLOS ONE, vol. 4, 2009, pages E5406 |
| FELDMANN, PROG GROWTH FACTOR RES, vol. 4, 1992, pages 247 - 55 |
| G. P. STAHLY, CRYSTAL GROWTH & DESIGN, vol. 7, no. 6, 2007, pages 1007 - 1026 |
| GREENE, T. W.; WUTS, P. G. M.: "Protecting Groups in Organic Synthesis, 3rd ed.", 1999, WILEY |
| HALCOX J. P. ET AL., HYPERTENSION, vol. 49, 2007, pages 1134 - 1141 |
| HARRY G. BRITAIN: "Polymorphism in Pharmaceutical Solids", vol. 95, 1999, MARCEL DEKKER, INC., article K.J. GUILLORY: "Generation of Polymorphs, Hydrates, Solvates, and Amorphous Solids", pages: 202 - 209 |
| JACKSON T. R. ET AL., NATURE, vol. 335, 1988, pages 437 - 440 |
| KAUSHIK ET AL., EXPERT OPINION ON BIOLOGICAL THERAPY, vol. 5, no. 4, 2005, pages 601 - 606 |
| KEFFER, EMBO J., vol. 10, no. 13, 1991, pages 4025 - 31 |
| KYRIAKIDES Z. S. ET AL., HEART, vol. 84, 2000, pages 176 - 182 |
| LE BAS, M.-D., J. LABELLED COMPD. RADIOPHARM., vol. 44, 2001, pages S280 - S282 |
| LI, N.-C. ET AL., BMJ, vol. 340, 2010, pages B5465 |
| LORMAN, J. PAIN, vol. 8, no. 2, 2007, pages 127 - 36 |
| MANI K., HEART FAIL REV, vol. 13, 2008, pages 193 - 209 |
| MEANS, AM. J. PHYSIOL. HEART CIRC. PHYSIOL., vol. 292, 2007, pages H2944 - H2951 |
| METZGER R. ET AL., FEBS LETT, vol. 357, 1995, pages 27 - 32 |
| MURPHY E.; STEENBERGEN C., PHYSIOL REV, vol. 88, 2008, pages 581 - 609 |
| NIGWEKAR, S. U., COCHRANE DATABASE SYST. REV., 7 October 2009 (2009-10-07), pages CD006028 |
| P. H. AND WERMUTH, C. G.: "Handbook of Pharmaceutical Salts, Properties, Selection, and Use", 2002, WILEY-VCH |
| PIERDOMENICO, S.D. ET AL., AMERICAN J. HYPERTENSION, vol. 22, 2009, pages 842 - 847 |
| REMINGTON: "The Science and Practice of Pharmacy, 20th ed.", 2000, LIPPINCOTT WILLIAMS & WILKINS |
| RITTIRSCH, J. LEUKOCYTE BIOLOGY, vol. 81, 2007, pages 137 - 143 |
| SANDBORN ET AL., GUT, vol. 53, no. 10, 2004, pages 1485 - 1493 |
| SANTOS R. A. ET AL., PROC NATL ACAD SCI U S A, vol. 100, 2003, pages 8258 - 8263 |
| SEO B. ET AL., CIRCULATION, vol. 89, 1994, pages 1203 - 1208 |
| SINGH A ET AL., J MOL SIGNAL, vol. 5, 2010, pages 11 |
| T. HIGUCHI; V. STELLA: "Pro-drugs as Novel Delivery Systems", vol. 14, A.C.S. SYMPOSIUM SERIES |
| TAKIGAWA, M. ET AL., EUR. L. BIOCHEM., vol. 228, 1995, pages 102 - 108 |
| TALLANT, AM. J. PHYSIOL. HEART CIRC. PHYSIOL., vol. 289, 2005, pages H1560 - H1566 |
| TALUKDER M. A. ET AL., CARDIOVASC RES, vol. 84, 2009, pages 345 - 352 |
| TANI M.; NEELY J. R., CIRC RES, vol. 65, 1989, pages 1045 - 1056 |
| VILLAR A. J.; PEDERSEN R. A., NAT GENET, vol. 8, 1994, pages 373 - 379 |
| WATANABE T. ET AL., BR J PHARMACOL, vol. 114, 1995, pages 949 - 954 |
| WYNNE B. M. ET AL., J AM SOC HYPERTENS, vol. 3, 2009, pages 84 - 95 |
| YOUNG D. ET AL., CELL, vol. 45, 1986, pages 711 - 719 |
| YOUNG, D. ET AL., CELL, vol. 45, 1996, pages 711 - 719 |
| ZHANG, T., AM J PHYSIOL HEART CIRC PHYSIOL, vol. 302, 2012, pages H299 - H311 |
| ZHU, G-D., J. ORG. CHEM., vol. 67, 2002, pages 943 - 948 |
| ZOHN 1. E. ET AL., MOL CELL BIOL, vol. 18, 1998, pages 1225 - 1235 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022256267A1 (en) * | 2021-06-01 | 2022-12-08 | Arena Pharmaceuticals, Inc. | Methods of treatment |
| WO2025104706A3 (en) * | 2023-11-15 | 2025-07-17 | Xitra Therapeutics Gmbh | Small molecule modulators of mas and mrgd receptors |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20140309192A1 (en) | Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto | |
| TWI290553B (en) | Indolylmaleimide derivatives | |
| JP5346292B2 (en) | Pyrazole derivatives as modulators of 5-HT2A serotonin receptors useful for the treatment of disorders associated with 5-HT2A serotonin receptors | |
| DE60218511T2 (en) | DIHYDROXYPYRIMIDINE CARBOXYLAMIDE INHIBITORS OF THE HIV INTEGRASE | |
| FI88504B (en) | PROTECTION OF THERAPEUTIC FRAME THERAPEUTIC 4-BENZYL-1- (2H) -Phthalazine derivative | |
| JP4493503B2 (en) | Heterocyclic compounds and antitumor agents containing the same as active ingredients | |
| JP5595402B2 (en) | Novel imidazolidine compounds as androgen receptor modulators | |
| JP5821079B2 (en) | Bicyclo-substituted pyrazolone-azo derivative salt, process for its production and use thereof | |
| JP4861591B2 (en) | Novel 1,3-dihydro-2H-indol-2-one derivatives, their preparation and pharmaceutical compositions containing them | |
| CA2754613C (en) | Piperazine compound capable of inhibiting prostaglandin d synthase | |
| JP2019527717A (en) | Aminopyrimidine SSAO inhibitor | |
| CA3150701A1 (en) | Alkynyl quinazoline compounds | |
| WO2005087729A1 (en) | 5-hydroxyindole-3-carboxylates derivatives and their use | |
| PT1024138E (en) | Pyrazole derivatives | |
| CZ288173B6 (en) | Indoline derivatives, process of their preparation, intermediates for this process and pharmaceutical preparation in which these derivatives are comprised | |
| EA016370B1 (en) | Pyrazoline compounds as mineralocorticoid receptor antagonists | |
| JP6906449B2 (en) | Heterocyclic sulfonamide derivative and pharmaceuticals containing it | |
| DK2207776T3 (en) | Drug active in neuropathic pain | |
| CN102807575B (en) | 3-aryl-5-thienyl-5H-thiazolo [3,2-a] pyrimidine derivative and application thereof | |
| JP5128126B2 (en) | Its use as a substituted diketopiperazine oxytocin antagonist | |
| WO2015113521A1 (en) | Deuterated quinazolinone compound and pharmaceutical composition comprising same | |
| WO2014182673A1 (en) | Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto | |
| TW201718548A (en) | Piperazine derivative | |
| WO2014182688A1 (en) | Modulators of the g protein-coupled mas receptor and the treatment of disorders related thereto | |
| JP5057982B2 (en) | Histamine H3 receptor inhibitor, manufacture and therapeutic use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14727148 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14727148 Country of ref document: EP Kind code of ref document: A1 |







































