WO2014181023A1

WO2014181023A1 - Beta-glucosidase variants having reduced transglycosylation activity

Info

Publication number: WO2014181023A1
Application number: PCT/ES2014/070391
Authority: WO
Inventors: Bruno Díez García; Ana GÓMEZ RODRÍGUEZ; Jorge GIL MARTÍNEZ; Noelia VALBUENA CRESPO; Antonio Javier MORENO PÉREZ; Rafael DUEÑAS SÁNCHEZ; Ana María MUÑOZ GONZÁLEZ; Dolores PÉREZ GÓMEZ; Sandra GAVALDÁ MARTÍN; Laura SÁNCHEZ ZAMORANO; Consolación ÁLVAREZ NÚÑEZ; María De Los Angeles BERMÚDEZ ALCANTARA; Pablo GUTIÉRREZ GÓMEZ; Ricardo ARJONA ANTOLÍN
Original assignee: Abengoa Bioenergía Nuevas Tecnologías, S.A.
Priority date: 2013-05-10
Filing date: 2014-05-09
Publication date: 2014-11-13
Also published as: ES2521940B1; ES2521940A1

Abstract

The invention relates to beta-glucosidase variants having reduced transglycosylation activity. The invention also relates to a gene construct, a host cell and an enzyme composition comprising said variants. The invention further relates to a method for producing said variants, a method for producing fermentable sugar and a method for producing a bioproduct, such as bioethanol, from cellulose material with the beta-glucosidase variants, the host cell or the enzyme composition comprising said variants.

Description

BETA-GLUCOSIDASA VARIANTS WITH ACTIVITY OF

REDUCED TRANSGLICOSILATION

DESCRIPTION

The invention pertains to the field of enzymes useful for the production of bioproducts and, more particularly, to beta-glucosidase vanants and their use in the production of fermentable sugars and ethanol from cellulosic material.

STATE OF THE TECHNIQUE

Vegetable biomass provides an abundant source of potential energy in the form of sugars and, therefore, is an important renewable source for the generation of fermentable sugars. Fermentation of these sugars can lead to commercially valuable end products, such as ethanol also called bioethanol.

Although the fermentation of sugars to ethanol is relatively straightforward, the efficient conversion of cellulosic biomass into fermentable sugars, such as glucose, is a major challenge. The enormous potential energy of the large amounts of carbohydrates that make up the plant biomass is not sufficiently used because sugars are part of complex polymers (polysaccharides, such as cellulose and hemicellulose) and, therefore, are not easily accessible for fermentation. . Therefore, cellulose can be pretreated, mechanically, chemically, enzymatically or in other ways, to increase its susceptibility to hydrolysis. Then, after this pretreatment process a saccharification stage takes place, which is an enzymatic process by which complex carbohydrates (such as starch or cellulose) are hydrolyzed into their monosaccharide components. The purpose of any saccharification technology is to alter or eliminate structural and compositional impediments to hydrolysis in order to improve the rate of Enzymatic hydrolysis and increase yields of fermentable sugars from cellulose or hemicelluloses (N. Mosier et al., 2005, Bioresource Technology 96, 673-686). After this saccharification stage a fermentation process is carried out.

The enzymatic hydrolysis of polysaccharides in soluble sugars and, finally, in monomers such as xylose, glucose and other pentoses and hexoses, is catalyzed by various enzymes that together are called "cellulases." Cellulases (1,4-beta-D-glucan-4-glucanhydrolase, EC 3.2.1.4) are multienzyme complexes comprising three main components, endo-p-glucanase (EC 3.2.1 .4), exo-p-glucanase or cellobiohydrolase (EC 3.2.1 .9.1) and β-glucosidase (EC 3.2.1 .21), which have been shown to act synergistically in cellulose hydrolysis (Ekperigin, MM, 2007, African Journal of Biotechnology, Vol. 6 (1), p. 028-033).

Specifically, beta-glucosidase is a glucosidase enzyme that acts on the β1 -> 4 bonds that bind two glucoses or glucose-substituted molecules (i.e., the cellobiose disaccharide). It is an exocellulase with specificity for various substrates of beta-D-glycosides. It catalyzes the hydrolysis of non-reducing terminal residues in beta-D-glycosides with glucose release. Therefore, it is widely used together with other cellulases in processes for the conversion of cellulosic biomass into fermentable sugars. Its application in the conversion of biomass with a high cellulose content into fermentable sugars for the production of fuel ethanol is an area extensively studied.

Consequently, microbial cellulases have become focal biocatalysts due to their complex nature and extensive industrial applications (Kuhad RC et al., 201 1, Enzyme Research, Article ID 280696). Nowadays, considerable attention has been given to current knowledge about cellulose production and cellulose research challenges, especially in the direction of improving Economics of the process of several industries, in order to obtain cellulases with greater activity and better properties. In this sense, beta-glucosidases with better hydrolytic activity or thermostability have been designed (WO201 1063308A2).

Beta-glucosidases (BGLs, EC 3.2.1 .21) catalyze the transfer of glycosyl groups between oxygen nucleophiles on different types of substrates. BGLs with a retention mechanism (Rye et al., 2000. Curr. Opin. Chem. Biol. 4), as is the case with Bgl1, have reduced hydrolytic activity at high concentrations of substrate or product and this depends at least that two different phenomena occur: inhibition and transglycosylation (Bohlin et al., 2013, Appl. Microbiol. Biotechnol., 97 (1): 159-169). The retention mechanism initially forms a covalent glycosyl complex with the enzyme. This intermediate decomposes in the second stage of the reaction, which can be produced by a water molecule (hydrolytic activity) or by an acceptor sugar (transglycosylation activity). In the simplest transglycosylation reaction, the acceptor is the substrate itself. However, cellobiose has been described as a preferential substrate to retain BGLs in their transglycosylation reaction.

A beta glucosidase with a hydrolytic activity capable of producing glucose efficiently but with a reduced transglycosylating activity would be useful, being able to decrease the synthesis of other compounds, such as ethyl-beta-D-glucopyranoside in the presence of ethanol, so as to increase the production of fermentable sugars and will improve the performance of an enzyme mixture containing BGL.

DESCRIPTION OF THE INVENTION

The present invention describes new beta-glucosidase vanants with reduced transglycosylation capacity for the hydrolysis of cellulosic material in fermentable sugars, as well as a process for producing said beta-glucosidase variants, a process for producing fermentable sugars and a process for producing bioproducts, such as ethanol, with said variants.

Therefore, the present invention represents a solution to the need to provide beta-glucosidase vanants with the enhanced property of reduced transglycosylation activity for optimization of the stage of hydrolysis of cellulosic material in fermentable sugars.

The transglycosylation capacity of beta-glucosidases decreases the final concentration of fermentable sugars in ethanol and, consequently, the yield of the final product of the process. However, the inventors have demonstrated that the beta-glucosidase vanants of the present invention have reduced transglycosylation activity and, therefore, significantly increase the yield of the hydrolysis stage, which leads to an increase in the production of the bioproduct, preferably ethanol.

The present invention also provides a method for the selection of beta-glucosidase cleavages with reduced transglycosylation activity. Therefore, a first aspect of the present invention relates to a method for the selection of beta-glucosidase variants with reduced transglycosylation activity compared to the native beta-glucosidase, hereinafter referred to as "first method of the invention", which comprises: a) Incubate the beta-glucosidase vahants with p-nitro-phenyl-glucopyranoside in the presence of cellobiose,

b) Measure the release of p-nitrophenol,

c) Compare the p-nitrophenol value measured in step (b) with a reference value, and

d) Select those variants of beta-glucosidase whose values measured in step (b) are higher than the reference value. The term "beta-glucosidase," as used herein, refers to an enzyme that catalyzes the hydrolysis of a sugar dimer, including, but not limited to, cellobiose, with the release of a corresponding sugar monomer, which is used. , but without limitation, for the synthesis of ethanol. The beta-glucosidase enzyme acts on the β1 -> 4 bonds that bind two glucoses or glucose-substituted molecules (i.e. cellobiose disaccharide). It is an exocellulase with specificity for a variety of beta-D-glycoside substrates. It catalyzes the hydrolysis of non-reducing terminal residues in beta-D-glycosides with glucose release.

The term "vanant", as used herein, refers to an enzyme that comes from a native enzyme by one or more deletions, insertions and / or substitutions of one or more amino acids at the point (s) within its amino acid sequence. and, therefore, has a different sequence from that of the native enzyme. As used herein, the term "vacancy of beta-glucosidase" means a polypeptide that has beta-glucosidase activity produced by an organism that expresses a modified nucleotide sequence encoding a native beta-glucosidase. Said modified nucleotide sequence is obtained by human intervention by modification of the nucleotide sequence encoding a native beta-glucosidase. The term "modification" means herein any chemical modification of the amino acid or nucleic acid sequence of a native beta-glucosidase.

The term "native beta-glucosidase" refers to a beta-glucosidase enzyme or its preprotein, expressed by a microorganism such as bacteria or filamentous fungi. Preferably, the native beta-glucosidase enzyme referred to in the present invention is expressed by a filamentous fungus, more preferably by a fungus belonging to the genus Myceliophthora, even more preferably by Myceliophthora thermophila, even more preferably the enzyme beta- Native glucosidase is the enzyme of SEQ ID NO: 1 (also called BgM) or SEQ ID NO: 2. SEQ ID NO: 2 is the preprotein of SEQ ID NO: 1 and consists of a signal peptide corresponding to amino acids 1 to 19 of SEQ ID NO: 2 linked to SEQ ID NO: 1.

The "transglycosylation activity" of beta-glucosidases consists in the initial formation of a covalent glycosyl complex with the enzyme and its subsequent decomposition in the second stage of the reaction by means of an acceptor sugar, instead of being produced by a water molecule ( hydrolytic activity). In the simplest transglycosylation reaction, the acceptor sugar is the substrate itself.

The p-nitro-phenyl-glucopyranoside substrate is also called pNGP. This substrate is hydrolyzed by beta-glucosidase. Therefore, this substrate is incubated under conditions that allow beta-glucosidase variants to perform the hydrolytic process in step (a) of the first process of the invention. Additionally, said incubation is performed in the presence of cellobiose, since this disaccharide has been described as a preferential substrate to retain beta-glucosidases in their transglycosylation activity. Therefore, in the presence of cellobiose, the hydrolytic activity of beta-glucosidase on pNGP shows a reduction due to the transglycosylation activity. A high percentage of hydrolytic capacity, measured by the p-nitrophenol released in the presence of the cellobiose substrate highly susceptible to transglycosylation, is used as an indication of a low transglycosylation capacity. Therefore, the more p-nitrophenol is measured in step (b) of the first process of the invention, the lower the transglycosylation capacity of the beta-glucosidase vane analyzed.

The term "reference value" refers to the measurement of p-nitrophenol released by a native beta-glucosidase, preferably SEQ ID NO: 1 or SEQ ID NO: 2, incubated with pNGP in the presence of cellobiose. A native beta-glucosidase incubated with pNGP in the presence of cellobiose has a low production of p-nitrophenol, since the enzyme will use cellobiose as substrate to carry out the transglycosylation process instead of using pNGP to carry out the hydrolytic process that generates p-nitrophenol. Therefore, the measurement of p-nitrophenol released after incubation in step (a) and its comparison with the measurement of p-nitrophenol released after incubation of a native beta-glucosidase with pNGP in the presence of cellobiose allows the selection of beta-glucosidase vanants with lower transglycosylation capacity than that of a native beta-glucosidase. The comparison in step (c) can be performed manually or by computer.

A low transglycosylation activity can also be recognized when a hydrolytic capacity in pNGP of between 30-70% is measured in step (b).

The beta-glucosidase vanants used in the first process of the invention can be derived either from a library of mutants already known in the state of the art or commercially available or can be designed by any method known to those skilled in the art. matter to generate a library of mutants of an enzyme. The mutants that constitute said library may comprise substitutions, deletions and / or insertions of one or more amino acids in their amino acid sequences, as well as substitution of one or more amino acid side chains. Therefore, another aspect of the invention refers to a process for producing beta-glucosidase variants with reduced transglycosylation activity compared to native beta-glucosidase, hereinafter "second process of the invention", which comprises the design of a library of beta-glucosidase enzyme mutants and the selection of beta-glucosidase vanants with reduced transglycosylation activity according to steps (a) to (d) of the first method of the invention

Another aspect of the invention refers to an isolated beta-glucosidase vanant produced by the second process of the invention.

Another aspect of the invention refers to a beta-vacancy Isolated glucosidase comprising an amino acid sequence having a sequence identity of at least 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEQ ID NO: 2 and comprises an amino acid substitution at position Q21 1 corresponding to positions 1 to 871 of SEQ ID NO: 2, where the beta-glucosidase vanant has a reduced transglycosylation activity compared to native beta-glucosidase, hereinafter referred to as "beta-glucosidase vanant of the invention". The reduced transglycosylation activity compared to native beta-glucosidase is preferably measured by the first method of the invention described above.

In a preferred embodiment, the amino acid substitution of said vane is Q21 1 H.

The term "identity", as used herein, in the context of describing two or more polypeptide sequences, refers to a specified percentage of amino acid residue matches at positions from an alignment of two amino acid sequences. Sequence alignment procedures for comparison are well known in the art. The degree of identity can be determined by the Clustal method (Higgins, 1989, CABIOS 5: 151-153), the Wilbur-Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726- 730), the GAG program, including GAP (Devereux et al. 1984, Nucleic Acids Research 12: 287 Genetics Computer Group University of Wisconsin, Madison, (Wl)); BLAST or BLASTN, EMBOSS Needle and FASTA (Altschul et al. 1999, J. Mol. Biol. 215: 403-410). In addition, the Smüth Waterman algorithm can be used in order to determine the degree of identity between two sequences.

The beta-glucosidase vahant of the invention may exhibit limited changes in its amino acid sequence. These changes allow maintenance of the beta-glucosidase variant function and reduced transglycosylation activity compared to native beta-glucosidase. These changes may be substitutions, deletions or additions. The substitutions are conserved amino acids that are amino acids with side chains and similar properties with respect to, for example, hydrophobic or aromatic properties. These substitutions include, but are not limited to, substitutions between Glu and Asp, Lys and Arg, Asn and Gln, Ser and Thr, and / or among the amino acids included in the following list: Ala, Leu, Val e lie. The changes do not lead to relevant modifications in the essential characteristics or properties of the beta-glucosidase variant of the invention.

Likewise, the amino acid substitution at position Q21 1, corresponding to positions 1 to 871 of SEQ ID NO: 2, is by amino acids having the same properties, on, for example, hydrophobic or aromatic properties, as the amino acid H. Thus, such substitutions allow the beta-glucosidase vanants of the invention to maintain the same function as the preferred vanant of SEQ ID NO: 4, including reduced transglycosylation activity compared to native beta-glucosidase.

In a more preferred embodiment, the beta-glucosidase variant of the invention comprises the amino acid sequence SEQ ID NO: 4. An example of a beta-glucosidase variant of the invention comprising the amino acid sequence SEQ ID NO: 4 is the polypeptide of SEQ ID NO: 5, which is the preprotein of SEQ ID NO: 4, which consists of a signal peptide corresponding to amino acids 1 to 19 of SEQ ID NO: 5 linked to SEQ ID NO: 4. Therefore In a more preferred embodiment, the beta-glucosidase vanant of the invention consists of the amino acid sequence SEQ ID NO: 5. This SEQ ID NO: 5 corresponds to the native beta-glucosidase of SEQ ID NO: 2, which comprises amino acid substitution Q21 1 H. As shown in the examples below, substitution Q21 1 H reduces the activity of transglycosylation of the enzyme, which increases the final concentration of fermentable sugars in a hydrolytic process from cellulosic material. Said sequence SEQ ID NO: 5 will also be referred to hereinafter as Bgl1 Q21 1 H preprotein. In an even more preferred embodiment, the beta-glucosidase vanant of the invention consists of the amino acid sequence SEQ ID NO: 4. This SEQ ID NO: 4 corresponds to the mature beta-glucosidase of SEQ ID NO: 5. Said sequence SEQ ID NO: 4 will also be referred to as mature Bgl1 Q21 1 H protein.

The beta-glucosidase vanant of the invention can be synthesized, for example, but without limitations, in vitro. For example, through the synthesis of solid phase peptides or recombinant DNA approaches. The beta-glucosidase variant of the invention can be produced recombinantly, including its production as a mature peptide or as a preprotein that includes a signal peptide.

The preparation of the beta-glucosidase vanant of the invention can be carried out by any means known in the art, such as modification of a DNA sequence encoding a native beta-glucosidase, such as, for example, but not limited to, the SEQ ID NO: 3, which encodes the preprotein of SEQ ID NO: 2, transformation of the modified DNA sequence into a suitable host cell and expression of the modified DNA sequence to form the enzymatic vanant.

Due to the degeneracy of the genetic code, several nucleotide sequences can encode the same amino acid sequence. Therefore, in another aspect, the invention provides an isolated nucleic acid sequence encoding the beta-glucosidase vanant of the invention or the beta-glucosidase vahant produced by the second process of the invention, hereinafter referred to as "nucleic acid sequence of the invention ", and the nucleic acid sequence complementary thereto.

In accordance with the present invention, an "isolated nucleic acid molecule", "nucleotide sequence", "nucleic acid sequence" or "polynucleotide" is a nucleic acid molecule (polynucleotide) that has been removed from its natural environment (ie, that has undergone human manipulation) and may include DNA, RNA or derivatives of DNA or RNA, including cDNA. The nucleotide sequence of the present invention may or may not be chemically or biochemically modified, and may be obtained artificially by cloning and selection procedures or by sequencing. The nucleic acid sequence of the invention can encode the mature polypeptide or a preprotein consisting of a signal peptide bound to the mature enzyme that will have to be further processed.

The nucleotide sequence of the present invention may also comprise other elements, such as introns, non-coding sequences at the 3 'and / or 5' ends, ribosome binding sites, etc. This nucleotide sequence may also include coding sequences for additional amino acids that are useful for purification or stability of the encoded peptide.

In a preferred embodiment, the nucleic acid sequence of the invention is SEQ ID NO: 6, which is the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 5 (preprotein of SEQ ID NO: 4).

The expression, "complementary nucleic acid sequence" of a nucleic acid sequence encoding the beta-glucosidase variant of the invention or the beta-glucosidase variant produced by the second process of the invention, refers to the acid sequence nucleic of the strand complementary to that encoding the beta-glucosidase vanant of the invention, or the beta-glucosidase vanant produced by the second method of the invention. It will be appreciated that a double-stranded DNA or encoding a given amino acid sequence comprises a monocatenaho DNA and its complementary strand, which has a sequence that is complementary to the monocatenaho DNA.

Table 1 below shows a detailed description of some of the sequences mentioned throughout the present invention.

Table 1 . Description of some of the sequences mentioned in the present invention.

The nucleic acid sequence of the invention can be included in a genetic construct, preferably in an expression vector. Said genetic construct may further comprise one or more gene expression regulatory sequences, such as promoters, terminators etc. Therefore, in another aspect, the invention provides a genetic construct comprising the nucleic acid sequence of the invention or the nucleic acid sequence complementary thereto, hereinafter "gene construct of the invention". In a preferred embodiment, said gene construct is an expression vector.

The expression "gene construct" or "nucleic acid construct" as used herein refers to a functional unit necessary for the transfer or expression of a gene of interest, herein, the nucleic acid sequence of the invention as described, and regulatory sequences, including, for example, a promoter , operably linked to the sequence encoding the protein. It refers to a single or double stranded nucleic acid molecule that is isolated from a natural gene or that is modified to contain nucleic acid segments in a way that would not otherwise exist in nature. The term "nucleic acid construct" is synonymous with the expression "expression cassette," when the nucleic acid construct contains the control sequences required for the expression of the coding sequence.

The term "expression vector", also known as "expression construct" or "plasmid," refers to a linear or circular DNA molecule, which comprises the nucleic acid sequence of the invention and is operably linked to segments. additional that provide transcription of the encoded peptide. Generally, a plasmid is used to introduce a specific gene into a target cell. Once the expression vector is inside the cell, the protein that is encoded by the gene is produced by the ribosomal complexes of the cell transcription and translation machinery. Often the plasmid is engineered to contain regulatory sequences that act as enhancer and promoter regions and that lead to efficient transcription of the gene carried in the expression vector. The objective of a well-designed expression vector is the production of large amounts of stable messenger RNA and, therefore, of proteins. Expression vectors are basic tools of biotechnology and protein production, such as enzymes. The expression vector of the invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as an extrachromosomal self-replicating vector.

Examples of expression vectors are phages, cosmids, phagemids, artificial yeast chromosomes (YAC), artificial chromosomes. bacterial (BAC), human artificial chromosomes (HAC) or viral vectors, such as adenovirus, retrovirus or lentivirus.

The gene constructs of the present invention encompass an expression vector, where the expression vector can be used to transform a suitable host or host cell so that the host can express the beta-glucosidase vanant of the invention or the beta-vanant glucosidase produced by the second process of the invention. Methods for recombinant protein expression in fungi and other organisms are well known in the art and numerous expression vectors are available or can be constructed using routine procedures.

The term "control sequences" is defined herein to include all components that are necessary or advantageous for the expression of the nucleic acid sequence of the present invention. Such control sequences include, but are not limited to, a leader, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence and a transcription terminator. At a minimum, the control sequences include a promoter and termination signals of transcription and translation. Control sequences can be provided with linkers in order to introduce specific restriction sites that facilitate the binding of control sequences with the coding region of the nucleic acid sequence of the present invention. The term "operably linked" indicates herein a configuration in which a control sequence is placed in a suitable position relative to the nucleic acid sequence of the present invention, such that the control sequence directs the expression of the nucleic acid sequence of the present invention.

The expression vector of the invention can be an autonomous replication vector, that is a vector that exists as an extrachromosomal entity, whose replication is independent of chromosome replication, for example a plasmid, an extrachromosomal element, a minichromosome or a chromosome. artificial. The vector may contain any means to guarantee self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome (s) in which it has been integrated.

In addition, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon can be used.

The vectors used in the present invention preferably contain one or more selectable markers that allow easy selection of transformed, transfected, transduced or similar cells. A selectable marker is a gene product that provides resistance to a biocide or a virus, to heavy metals, prototrophy to auxotrophs and the like. Markers selected for use in a host cell of a filamentous fungus include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG ( orotidin-5'-phosphate decarboxylase), cysC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.

The vectors used in the present invention preferably contain one or more elements that allow the integration of the vector into the genome of the host cell or the autonomous replication of the vector into the cell irrespective of the genome. For integration into the genome of the host cell, the vector may depend on the nucleic acid sequence of the present invention or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences to direct integration by homologous recombination into the genome of the host cell at one or more precise location (s) on the chromosome (s). For autonomous replication, the vector may further comprise an origin of replication that allows the vector to replicate autonomously in the host cell in question. The origin of replication can be any plasmid replicator that participates in autonomous replication that works in a cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that allows a plasmid or vector to replicate in vivo. Examples of useful origins of replication in a filamentous fungal cell are AMAI and ANSI.

More than one copy of the nucleic acid sequence of the present invention can be inserted into the host cell to increase the production of the gene product. An increase in the number of copies of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the genome of the host cell or by including a selectable marker gene amplifiable with the polynucleotide, where cells containing amplified copies of the marker gene select it and, consequently, additional copies of the polynucleotide, can be selected by culturing the cells in the presence of the appropriate selection agent. The methods used to link the elements described above to construct the recombinant expression vectors referred to in the present invention are well known to one skilled in the art.

In another aspect, the invention provides a host cell comprising the gene construct of the invention, hereinafter referred to as "host cell of the invention". Therefore, said host cell expresses the beta-glucosidase vanant of the invention. The "host cell", as used herein, includes any cell type that is susceptible to transformation, transfection, transduction and the like with the gene construct of the invention. The host cell can be eukaryotic, such as a mammalian, insect, plant or fungal cell. In a preferred embodiment, the host cell is a filamentous fungus cell. Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, morning and other complex polysaccharides. In a more preferred embodiment, the filamentous fungus host cell is a cell of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Gibberella, Humicola, Magnaporthe, Mucor, Neceliophthora, Neceliophthora, Myceliophthora Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma. In a more preferred embodiment, the filamentous fungus host cell is a cell of Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae. In another more preferred embodiment, the filamentous fungus host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium pseusgramusarum Fusarium, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum. In another more preferred embodiment, the host cell of filamentous fungus is a cell of Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis su b rufa, Ceriprepsus corustrous, Ceriporiopsus corusorus, Ceriporiopsis corusorus Cerustrous , Gibberella zeae, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes trichoderma, Trichoderma, trichoderma, Trichoderma, trichoderma, Trichoderma trichtema, Trichoderma trichtema, Trichoderma trichtema, Trichoderma trichtema, Trichoderma trichtema, Trichoderma trichtema, Trichoderma trichtema, Trichtema trichite, Trichtema, Trichtema, Trichromatum, Trichtema, Trichimus, Trichimus Trichoderma reesei or Trichoderma viride. In another even more preferred embodiment, the host cell of the invention is any strain of the Myceliophthora thermophila species. In an even more preferred embodiment, the host cell of the invention is strain C1 of the Myceliophthora thermophila species. It will be understood that, for the aforementioned species, the invention encompasses both perfect and imperfect states and other taxonomic equivalents, for example anamorphs, regardless of the name of the species by which they are known. Those skilled in the art will readily recognize the identity of suitable equivalents. For example, Myceliophthora thermophila is equivalent to Chrysosporium lucknowense.

The beta-glucosidase vanant of the invention or the beta-glucosidase vanant produced by the second process of the invention has a reduced transglycosylation activity, whereby its use in an enzymatic composition for the stage of hydrolysis of the cellulosic material in sugars Fermentable in the processes for the production of a bioproduct, preferably ethanol, it is interesting to improve the activity of the entire enzyme composition.

Therefore, in another aspect of the invention there is provided an enzymatic composition comprising the beta-glucosidase vanant of the invention or the beta-glucosidase variant produced by the second method of the invention, hereinafter referred to as "enzymatic composition of the invention ". In a preferred embodiment, the enzyme composition of the invention further comprises other cellulolytic enzymes.

It should be understood that the beta-glucosidase variant of the invention or the beta-glucosidase variant produced by the second process of the invention can be combined with one or more of the cellulolytic enzymes described herein or with any other available enzyme. and suitable to produce a multienzyme composition. One or more components of the multienzyme composition (apart from the enzymes described in the present invention) can be obtained or derived from a microbial, plant or other source or combination thereof, and will contain enzymes capable of degrading the cellulosic material. The term "cellulolytic enzymes", also known as "cellulases" refers to a category of enzymes capable of hydrolyzing cellulose (p-1, 4-glucan or β-D-glucosidic bonds) in shorter, cellobiose and / or oligosaccharides glucose. Examples of cellulolytic enzymes are, but are not limited to, endoglucanases, beta-glucosidases, cellobiohydrolases or beta-xylosidases. Therefore, in a more preferred embodiment, these cellulolytic enzymes are selected from the list consisting of: endoglucanases, beta-glucosidases, cellobiohydrolases, beta-xylosidases or any combination thereof. These cellulolytic enzymes can be derived from the host cell of the invention or other microorganisms producing cellulolytic enzymes other than the host cell of the invention. They can also be produced naturally or recombinantly.

The term "endoglucanase" or "EG" refers to a group of cellulase enzymes classified as E.C. 3.2.1 .4. These enzymes hydrolyse the glucosidic β-1, 4 cellulose bonds.

The term "cellobiohydrolase" refers to a protein that catalyzes the hydrolysis of cellulose in cellobiose through an exoglucanase activity, sequentially releasing cellobiose molecules from the reducing or non-reducing ends of cellulose or cellooligosaccharides.

The term "β-xylosidase" refers to a protein that hydrolyzes the short 1,4-β-ϋ-xylo-oligomers in xylose.

In a preferred embodiment, the enzyme composition of the invention further comprises the host cell of the invention.

The composition of the invention can be prepared according to methods known in the art and can be in the form of a liquid or a dry composition. For example, the composition may be in the form of a granulate or a microgranulate. The enzymes to be included in the Composition can be stabilized according to procedures known in the art.

The beta-glucosidase vanant of the invention or the beta-glucosidase vanant produced by the second method of the invention, as well as the host cell or the composition of the present invention can be used in the production of monosaccharides, disaccharides and polysaccharides as chemical or fermentation reserves from cellulosic material for the production of ethanol, plastics or other products or intermediates.

The host cell of the present invention can be used as a source of the beta-glucosidase variant of the invention or the beta-glucosidase variant produced by the second method of the invention and other cellulolytic enzymes, in a fermentation process from the cellulosic material

Therefore, another aspect of the invention refers to an enzymatic composition obtained by the host cell of the invention.

The degradation or hydrolysis of the cellulosic material in fermentable sugars, a process also known as "saccharification", by means of the beta-glucosidase variant of the invention, the beta-glucosidase vahant produced by the second method of the invention, the host cell of the invention or the composition of the invention can be accompanied after a fermentation process in which the fermentable sugars obtained are used in order to finally obtain a bioproduct such as bioethanol.

Therefore, in another aspect, the present invention relates to a process for producing fermentable sugars, hereinafter referred to as "third process of the invention", which comprises: a) Incubate the cellulosic material with the beta-glucosidase steamer of the invention , the beta-glucosidase vahante produced by the second method of the invention, the host cell of the invention or the enzymatic composition of the invention, and

b) Recover the fermentable sugar obtained after the incubation in step (a).

The term "fermentable sugar", as used herein, refers to simple sugars, such as glucose, xylose, arabinose, galactose, mannose, rhamnose, sucrose or fructose.

In another aspect, the present invention relates to a method of producing a bioproduct, hereafter referred to as "fourth process of the invention", comprising: a) Incubate the cellulosic material with the beta-glucosidase vanant of the invention, the vanant of beta-glucosidase produced by the second method of the invention, the host cell of the invention or the enzymatic composition of the invention,

b) Ferment the fermentable sugars obtained after the incubation of step (a) with at least one fermenting microorganism, and

c) Recover the bioproduct obtained after fermentation in step (b).

The term "cellulosic material" means the biodegradable fraction of products, residues and wastes of biological origin from agriculture (including vegetables, such as crop residues and animal substances), forestry (such as timber resources) and related industries, including fishmongers and aquaculture , as well as the biodegradable fraction of industrial and municipal waste, such as municipal solid waste or paper. In a preferred embodiment, the cellulosic material is straw or organic fraction of municipal solid waste. In a more preferred embodiment, the cellulosic material is plant biomass, more preferably selected from the list consisting of: biomass rich in fermentable sugars, such as sugar cane, starch biomass, for example, wheat grain or corn straw. Yet more preferably, the plant biomass is grain of cereals, such as starch, wheat, barley or mixtures thereof.

In some embodiments, the third and / or fourth process of the invention preferably comprises a pretreatment process before step (a). In general, a pretreatment process will result in the cellulosic material components being more accessible for later stages or more digestible by enzymes after treatment in the absence of hydrolysis. The pretreatment can be a chemical, physical or biological pretreatment, or any mixture thereof.

The term "recovery", as used herein, refers to the recovery of fermentable sugars obtained after incubation in step (a) of the third process of the invention or the bioproduct obtained after fermentation of step (b) of Fourth process of the invention. Recovery may occur by any procedure known in the art, including mechanical or manual.

The term "fermentation", as used herein, refers to a process of biological transformation caused by the activity of some microorganisms in which sugars such as glucose, fructose and sucrose are converted into ethanol. Therefore, the microorganisms used are fermenting microorganisms that have a fermentation capacity, such as yeasts, preferably Saccharomyces cerevisiae.

In another preferred embodiment, steps (a) and (b) of the fourth process of the invention can be performed simultaneously.

The term "bioproduct" or "biological products" refers to the materials, chemicals and energy derivatives of renewable biological resources. Examples of these bioproducts are, but are not limited to, hydrocarbon compounds in their different forms, such as aliphatic hydrocarbons (saturated, unsaturated, cyclic) or aromatic, such as alkanes, alkenes, alkynes, cyclic forms of these compounds or aromatic hydrocarbons; oxygenated substances such as alcohols, ethers, aldehydes, ketones or carboxylic acids; nitrogenous substances such as amines, amides, nitrogen compounds or nit; halogenated substances such as halides. The term "bioproducts" also includes any combination of the compounds described above, compounds that also derive from the compounds described above by any type of physical, chemical or biological treatment, polymers of the compounds described above, compounds described above substituted by any group or functional element in one or more of its bonds and branched forms of the compounds described above.

Ethanol can be produced by enzymatic degradation of cellulosic material and the conversion of saccharides released into ethanol. This type of ethanol is often called bioethanol. It can be used as a fuel additive or as an expander in mixtures of less than 1% and up to 100% (a fuel substitute).

Therefore, in a more preferred embodiment, the bioproduct is biofuel. The term "biofuel," as used herein, refers to a hydrocarbon, or a mixture thereof, that can be used as fuel and is obtained using fermentable cellulosic material as the starting material. Examples of biofuels include, but are not limited to, ethanol or bioethanol and biodiesel. In a preferred embodiment, the biofuel is bioethanol.

The term "bioethanol" or "ethanol" refers to an alcohol made by fermentation, mainly from fermentable cellulosic material such as carbohydrates produced by the beta-glucosidase vanant of the invention or the beta-glucosidase vanant produced by the second process of the invention, or starch cultures such as corn or sugarcane. Unless otherwise defined, all the technical and scientific terms used in this document have the same meaning as that given by an expert in the art to which this invention belongs. In the practice of the present invention procedures and materials similar or equivalent to those described herein can be used. Throughout the description and the claims, the word "comprises" and its variations is not intended to exclude other technical characteristics, additives, components or steps. Other objects, advantages and additional features of the invention will be obvious to those skilled in the art from the analysis of the description or can be learned through the practice of the invention. The following examples and drawings and the sequence listing are provided by way of illustration and are not intended to be limiting of the present invention.

BRIEF DESCRIPTION OF THE FIGURES

Fig. 1. Expression vector with Tcbhl as termination sequence and pyr5 as selection marker. SacI and Notl were the restriction sites chosen for the cloning of the Pcbh1-bgl1 fragment.

Fig. 2. Myceliophthora thermophila C1 bgll cDNA expression plasmid.

Fig. 3. Relative activity beta-glucosidase of 31 L2D and other transformants analyzed using pNGP as a substrate in the presence and absence of cellobiose.

Fig. 4. Amplified bgl1Q211H expression plasmid of strain 31 L2D.

Fig. 5. SDS-PAGE of the purified beta-glucosidase enzymes. 20 g of protein were loaded in each lane. Lane 1: Marker; Lane 2: Bgl1; Lane 3: mature Bgl1 Q21 1 H protein.

Fig. 6. Indirect transglycosylation assay of the BgM enzyme and the mature Bgl1Q211 H protein. All measurements were analyzed in triplicate and the error bars correspond to the standard deviation.

Fig. 7. Thermal studies using the BgM enzyme and the mature Bgl1Q211 H protein. A. Determination of the denaturation temperature. B. Thermal resistance in biomass hydrolysis conditions. All measurements were analyzed in triplicate and the error bars correspond to the standard deviation.

EXAMPLES

Example 1. Mutagenesis of bgll. Construction of an expression vector, mutagenesis, amplification of the banks with bgll mutations.

M. thermophila C1 has been described as a good quality transformation system for expressing and secreting heterologous proteins and polypeptides. The bgll gene of M. thermophila C1 beta-glucosidase was chosen to improve its enzymatic quality in the present invention. This enzyme shows a high transglycosylation profile, so that the objective of mutagenesis was to reduce this transglycosylation activity without affecting the hydrolytic activity of beta-glucosidase per se.

The bgll cDNA sequence was synthesized in vitro after optimization, to eliminate recognition sites for the most common restriction enzymes without altering the amino acid sequence. The bgll cDNA nucleotide sequence and the deduced amino acid sequence are shown in SEQ ID NO: 3 and SEQ ID NO: 2, respectively. The coding sequence has a length of 2616 including the termination codon. The protein encoded by this sequence has a length of 871 amino acids with an expected molecular mass of 95 KDa and an islectric point of 5.10. Using the Signal IP program (Petersen et al., 201 1, Nature Methods, 8: 785-786), a signal peptide of 19 residues was predicted. The predicted mature protein (SEQ ID NO: 1) contains 852 amino acids with an expected molecular mass of 93 KDa and an islectric point of 5.04.

The bgll gene was synthesized in vitro together with the promoter of the cellobiohydrolase 1 (Pcbhl) gene of M. thermophila C1. The Pcbhl sequence includes a region of 1796 bp upstream of the cellobiohydrolase 1 gene of M. thermophila C1 (cbhl, NCBI registration number XP_003660789.1). This fragment (Pcbh1-bgl1) was synthesized in vitro, including the sequence of the Sacl and Notl restriction enzymes at the ends (Sacl at the 5 ^' end and Notl at the 3 ^' end) to be cloned into an expression vector called pBASEI . The pBASEI expression vector also contained the terminator sequence of the Myceliophthora thermophila C1 cellobiohydrolase 1 gene (Tcbhl, corresponding to a region of 1014 bp downstream of cbhl) and the pyr5 gene (accession number in NCBI XP_003660657.1) of the same strain as a selection marker. The pyr5 gene encodes a functional orotate phosphoribosyl transferase and its expression vector allows the complement of uridine auxotrophy in the corresponding auxotrophic host strain, M. thermophila C1 pyr5-. The expression vector pBASEI is shown in Figure 1.

The Pcbhl-bgll fragment was digested with the restriction enzymes Sacl and Not \ and cloned into pBASEI, previously digested with the same restriction enzymes. The pBASEI expression vector and the Pcbhl-bgll cassette were ligated and the binding product was transformed into electrocompetent cells of Escherichia coli XLI Blue MRF following the protocol provided by the manufacturer (Agilent Technologies Inc.). The recombinant plasmid obtained was named pABC334 and is shown in Figure 2.

The bgll gene cloned in pABC344 was subjected to random mutagenesis by PCR amplification using the GeneMorpholl EZClone mutagenesis kit Domain Mutagenesis Kit (Agilent Technologies Inc.). Mutagenic amplification was performed using oligonucleotides 1 and 2 shown below. The signal peptide and termination codon were excluded from mutagenic amplification. Thus, these oligonucleotides amplify a 2553 bp fragment corresponding to the bgll sequence without signal peptide or termination codon.

Oligonucleotide 1 (SEQ ID NO: 7):

5 ^' -GCTGACAATCATCGTCAGGTTCACCAGAAGCCCCTCGCGA-3 ^' Oligonucleotide 2 (SEQ ID NO: 8):

5 ^' -AGGAAGCTCAATCTTGAGATCCAACTTCCGGCTGCTCCTC-3

The GeneMorpholl EZClone Domain Mutagenesis system allows different mutation rates depending on the amount of target DNA and the amplification cycles used during the process. With these premises, two different mutant banks were generated: the first with a mutation frequency between 0-1 mutations / kb and the second with a mutation frequency between 1 -4.5 mutations / kb. The initial target amount was 2 g and 0.8 g of pABC344 respectively for each bank. The conditions for the amplification reaction were a 95 ° C cycle for 2 minutes; and 30 cycles each at 95 ° C for 30 seconds, 57 ° C for 30 seconds and 72 ° C for 3 minutes. The heat block was maintained at 72 ° C for 10 minutes, followed by a 12 ° C retention cycle. The PCR products corresponding to mutated versions of bgll were purified on agarose gel with a QIAquick gel extraction kit (Qiagen) and used as mega primers in a second PCR to amplify the complete pABC344 using the following conditions: one cycle at 95 ° C for 1 minute and 25 cycles of 95 ° C for 50 seconds, 60 ° C for 50 seconds and 68 ° C for 10 minutes. The amplification reactions were digested with Dpn? (10U / L) for 2 hours at 37 ° C to remove the parental expression plasmid pABC344 used as the target, since Dpn only recognizes methylated DNA. Therefore, only amplified plasmids during this second PCR reaction remain after digestion with Dpn.

Both mutation banks were transformed into ultracompetent Escherichia coli XL-10 Gold cells following the protocol provided by the manufacturer (Agilent Technologies Inc.) and the plasmid DNA from a total of 320,000 colonies transformed with both mutant banks was purified using the Plasmid Maxi kit (Omega bio-tek, Inc).

Example 2. Transformation of the bgll mutant banks in Myceliophthora thermophila C1 and selection of an improved version of bgll.

The plasmid DNA of the banks containing the different mutated versions of bgll were transformed into the auxotrophic host strain M. thermophila C1 pyr5- (Verdoes et al., 2007, Ind. Biotechnol., 3 (1)), previously used in others High performance selections in M. thermophila. DNA was introduced into the host strain using a protoplast transformation method (US7399627B2). The transformants were seeded on agar plates without uridine supplement. After 5 days of incubation at 35 ° C, the resulting prototrophic transformants (expressing the pyrS gene) were analyzed. The transformants obtained were inoculated in 96-well microtiter plate (PMT) cultures to carry out high-throughput screening (US7794962B2).

The objective of the selection or screening was to identify the mutated versions of bgll with low transglycosylation activity. Therefore, an indirect assay was established to estimate the transglycosylation capacity of a BGL enzyme (beta-glucosidase). Hydrolytic activity in pNGP (p-nitro-phenyl-glucopyranoside) was measured in the presence and absence of cellobiose (5.5, mM). Cellobiose has been described as a preferential substrate of BGL with retention mechanism or "retainining" in its transglycosylation reaction. Therefore in Presence of cellobiose, BGL activity on pNGP shows a reduction due to transglycosylation activity. The percentage of hydrolytic capacity, measured by the released p-nitrophenol (and the consequent increase in A4-10) in the presence of the cellobiose substrate highly susceptible to transglycosylation, was used as an indication of low transglycosylation capacity. Beta-glucosidase activity is measured in units per liter of culture (U / 1). One unit of pNGP hydrolysis activity was defined as the amount of enzyme equivalent to the release of 1 pmol of p-nitrophenol per minute.

The 5 μΙ beta-glucosidase activity of supernatants of each transformant was analyzed with 100 mg / l pNGP (Sigma N7006) for 10 minutes at 50 ° C in a final volume of 100 μΙ. The reaction was stopped by adding 100 μΙ of 1 M sodium carbonate to the reaction mixtures. Each reaction was also carried out in the presence of cellobiose (5.5 mM). Hydrolytic capacity was measured by the release of p-nitrophenol in the presence and in the absence of cellobiose as an indication of low transglycosylation capacity.

To select the bgll mutants that show reduced transglycosylation activity, it was established that a low transglycosylation activity corresponded to the decrease of their hydrolytic capacity on pNGP between 30-70% when there was cellobiose in the reaction. Among the 6,900 transformants analyzed, one of them, called 31 L2D, showed a 62% pNGP hydrolytic capacity in the presence of cellobiose. All transformants with the desired activity were confirmed in a second round of PMT tests. Protein production of the best transformants, including 31 L2D, was also carried out at a flask production scale (Verdoes et al., 2007, Ind. Biotechnoi. 3 (1); Visser et al., 201 1, Ind. Biotechnoi ., 7 (3)) and it was confirmed that the 31 L2D transformant showed the best profile according to screenlng conditions (62% hydrolytic beta-glucosidase activity in the presence of cellobiose). Beta- activity Glucosidase of strain 31 L2D selected and other transformants analyzed in the presence and absence of cellobiose is shown in Figure 3.

To determine the sequence of the bgll gene expressed in 31 L2D, a DNA fragment containing Pcbh1-bgl1 was amplified from the genomic DNA using oligonucleotides 3 and 4.

Oligonucleotide 3 (SEQ ID NO: 9): The Sacl restriction site is underlined. 5 ^' -CGAGGAGCTCCTTACAAAAAAAAGGTATCC-3 ^'

Oligonucleotide 4 (SEQ ID NO: 10): The restriction sites SamHI, Smal and Pst \ are underlined. The termination codon is in box.

5TTCCTGCAGCCCGGGGGATCCITCAAGGAAGCTCAATCTTGAGATCCAAC TTCC-3 ^'

Oligonucleotide 3 includes the Sacl and hybrid restriction site at the 3 'end of Pcbhl. The oligonucleotide 4 hybrid at the 3 'end of bgll and includes the bgll termination codon and the restriction sites SamHI, Smal and Pst \ to clone in the pBASEI expression plasmid. Oligonucleotides 3 and 4 were used to amplify the Pcbhl-bgll fragment using genomic DNA from strain 31 L2D as the target (obtained using the Qiagen DNeasy Plant Mini Kit) with the Proof High-Fidelity DNA polymerase (BioRad) and were programmed during a cycle at 98 ° C for 2 minutes and 30 cycles of 98 ° C for 10 seconds, 72 ° C for 90 seconds and 72 ° C for 10 minutes. The amplified DNA fragment was digested with the restriction enzymes Sacl and SamHI and cloned into pABC344 previously digested with the same restriction enzymes. The ligation mixture was transformed into electrocompetent cells of Escherichia coli XLI Blue MRF following the protocol provided by the manufacturer (Stratagene). The recombinant plasmid was named pABC410 and is shown in Figure 4.

The bgll gene of pABC410 was sequenced. The mutated bgll showed a mutation: the guanine from position 633 of the native bgll nucleotide sequence SEQ ID NO: 3 had been mutated to thymine, thus giving a nucleotide sequence of SEQ ID NO: 6, which encoded a preprotein (SEQ ID NO: 5 , Bgl1 Q21 1 H), in which the glutamine (Q) in residue 21 1 of the native preprotein SEQ ID NO: 2 had been exchanged for histidine (H), so that 31 L2D expressed a mutated mature version ( SEQ ID NO: 4) of mature BgM in which the glutamine (Q) in residue 192 of the mature native protein of SEQ ID NO: 1 had been exchanged for histidine (H), called mature Bgl1 protein Q21 1 H. The nucleotide sequence encoding the Bgl1 Q21 1 H preprotein and the amino acid sequence of the mature protein are shown in SEQ ID NO: 6 and SEQ ID NO: 4, respectively. The coding sequence has a length of 2616 including the termination codon. The predicted encoded preprotein has 871 amino acids (SEQ ID NO: 5) with an expected molecular mass of 95 KDa and an isoelectric point of 5.14. Plasmid pABC410 was transformed into M. thermophila C1 in order to confirm the phenotype of low transglycosylation activity observed in strain 31 L2D. The transformation, selective detection and measurement of BGL activity was carried out as described previously in the present invention. All transformants expressing Bgl1 Q21 1 H of pABC410 showed the same low transglycosylation activity as strain 31 L2D.

Example 3. Comparative analysis of BgM of strain C1 of Myceliophthora thermophila and the mutant Bgl1Q211 H.

Production of enzymes Bgl1 and BgM Q21 1 H.

The production of the enzyme mixtures was carried out as described in Verdoes et al., 2007, Ind. Biotechnol. 3 (1), and Visser et al., 201 1, Ind. Biotechnol., 7 (3), using the expression platform for industrial enzymes based on M. tehrmophila C1 developed by Dyadic Netherlands.

Purification of the enzymes Bgl1 and Bgl1 Q21 1 H. Both the native Bgl1 enzyme (SEQ ID NO: 1) and the mature Bgl1 Q21 1 H protein (SEQ ID NO: 4) were purified using ion exchange chromatography. Samples were prepared by centrifuging at 4,000xg for 10 minutes flask productions. The sediments were discarded and the supernatants filtered through a 0.45 pm sterile syringe cellulose filter (VWR). The resulting enzyme preparations (15 ml samples) were then desalted on a HiPrep Desalting Sephadex G-25 column (GE Helthcare) in 100 mM Tris-HCI buffer, at pH 7.0 at a flow rate of 15 ml min ^"1 .

A sample containing 150 mg of total protein was subsequently applied on a HiLoad 26/10 Q-Sepharose HP column (GE Helthcare) equilibrated with the same buffer. The column was washed with the starting buffer and the proteins bound thereto were eluted with a NaCI gradient at a flow rate of 5 mL min ^"1 using a linear elution profile of 0 to 30%. In total nine cycles were performed of purification for each enzyme, thus pure 109 and 11 mg of the native Bgl1 enzymes and Q21 1 H, respectively, were obtained.

The purified BGLs were loaded on SDS-PAGE electrophoresis gels with a concentration of 7.5% acrylamide, in order to check the homogeneity of the samples (Fig. 5). According to the amino acid sequence of Bgl1, this enzyme can be expected to have a molecular size of 93kDa. However, fungal glycoside hydrolases and other enzymes belonging to different protein families are often glycosylated, bearing both O-linked and N-linked glycans. In fact, glycosylation is the most frequent post-translational modification in these proteins. A single band of 11-16 kDa was detected for both samples, indicating that electrophoretically pure enzymes have been obtained and that glycosylated versions of the enzymes have been successfully purified.

Kinetic characterization of the hydrolytic activity of the native Bgl1 protein and mature mutant of Bgl1 Q21 1 H.

Beta-glucosidases (BGLs, EC 3.2.1 .21) catalyze the transfer of glycosyl groups between oxygen nucleophiles on different types of substrates. BGLs with a retention mechanism, as in the case of Bgl1, have reduced hydrolytic activity at high concentrations of substrate or product and this depends at least on the existence of two different phenomena: inhibition and transglycosylation. The kinetic characterization of Bgl1 and the mature mutant protein of Bgl1 Q21 1 H was performed based on its hydrolytic capacity.

The hydrolytic activity of BGL was determined using p-nitrophenyl-beta-D-glucopyranoside (pNGP, Sigma) as a substrate. For this pNGP assay, the enzymatic reaction mixtures (1 ml final volume) containing 100 pmol of sodium acetate buffer (pH 5.0), 100 g of pNGP (0.33 pmol) and an adequate amount of the enzyme purified, incubated at 50 ° C for 10 minutes. The amount of p-nitrophenol released was measured at A410 (ε ₄ ι ₀ = 15.2 mM ^"1 cm ^{" 1} ) after the addition of 100 g of sodium carbonate to the reaction mixtures. One unit of hydrolysis activity on pNGP was defined as the amount of enzyme equivalent to the release of 1 pmol of p-nitrophenol per minute. When the effect of a soluble compound (glucose or xylose) on Bgl activity is studied, appropriate amounts of the corresponding sugar are added to the enzyme reaction mixture.

The purified BGLs were characterized in terms of enzymatic activity (V _max ), affinity for the substrate (K _m ), thermal resistance and effect on the enzymatic activity of glucose, which is the most abundant compound at the end of the enzymatic hydrolysis processes. of biomass V _max and K _m were calculated using a Hanes-Woolf graph. Inhibition kinetics was calculated using an Eadie-Hofstee graph. Results are shown in table 2. Enzyme K _m (mM) V _max (U mg ^" ) K¡, Glucose (mM)

Bgl1 0.66 20.02 3.83

Protein

mature of

Bgl1 Q21 1 H 0.25 25.36 1, 38

Table 2. Kinetic characterization of purified beta-glucosidases.

No evidence of a direct impact of affinity for the substrate (K _m ) on the enzymatic hydrolysis performance of the corresponding BGL-containing enzyme mixture was obtained. However, a reasonable impact of enzyme activity (V _max ) on dose reduction was observed. Mutant Bgl1 Q21 1 H was selected as a more active enzyme on pNGP and this was confirmed using purified enzymes: mature BgM protein Q21 1 H showed a 25% increase in specific beta-glucosidase activity compared to purified Bgl1 (25.36 Vs. 20.02 mg mg prot ^"1 ).

Glucose is a potent competitive inhibitor of most BGLs. This was also true for the native enzyme and for the purified Bgl1 Q21 1 H mature protein. Assays in the presence of different glucose concentrations adjusted to a competitive pattern inhibition by glucose using an Eadie-Hofstee graph. The calculated K¡ were 3.83 and 1.38 mM ^"1 for the Bgl1 enzyme and the mature Bgl1 Q21 1 H protein, indicating a potent competitive glucose inhibition for both enzymes.

Transglycosylation studies using the native Bgl1 enzyme and the mature Bgl1 Q21 1 H protein.

In Bgl1, the retention mechanism initially forms a covalent glycosyl complex with the enzyme. This intermediate decomposes in the second stage of the reaction, which can be produced by a water molecule (hydrolytic activity) or by means of an acceptor sugar (transglycosylation activity). In the simplest transglycosylation reaction, the acceptor is the substrate itself. However, cellobiose has been described as a preferential substrate for BGLs with retention mechanism in their transglycosylation reaction.

Therefore, an indirect assay was established to estimate the ability to transglycosylate a BGL enzyme. Hydrolytic activity on pNGP was measured in the presence of increasing concentrations of cellobiose. The percentage of hydrolytic capacity, measured by the released p-nitrophenol (and the consequent increase in A4-10) in the presence of the cellobiose substrate highly susceptible to transglycosylation, was used as an indication of low transglycosylation capacity. This assay was carried out for native Bgl1 and for the mature mutant protein of Bgl1 Q21 1 H. The results are shown in Figure 6. A greater transglycosylation capacity for the native Bgl1 enzyme was determined.

In order to verify whether these indirect tests correlated with the actual transglycosylation capacity, tests were carried out to measure the actual formation of oligomers. Enzymatic reaction mixtures (final volume of 1 ml) containing 138 mM cellobiose (50 g / L), 100 mM sodium acetate buffer (pH 5.0) and 0.1 U (cellobiose activity) of Bgl1 native or mature mutant Bgl1 Q21 1 H protein was incubated at 50 ° C for 24 hours. The reactions were stopped after 24 hours of incubation by adding 100 g of carbonate to the reaction mixtures. The mixtures were then analyzed by HPLC (Agilent Technologies, 1200 Series) using a refractive index detector (DIR) and an Aminex HPX-87 H column. Retention times and peak areas obtained due to the formation of Each sugar is shown in Table 3. Time of

Relative area (%)

retention

Sugar Protein

(min) Mature Bgl1 of

Bgl1 Q21 1 H

Glucose 9.23 59, 13 78.81

Cellobiose 7.49 38.36 21, 18

Celotriose 6.79 2.50 0.00

Table 3. Retention times and relative areas for sugars detected after the transglycosylation test. The relative area represents the percentage of each sugar in the total concentration in the reaction mixture after the transglycosylation test.

In this transglycosylation assay, glucose is the product of the hydrolytic capacity of BGLs on the real, cellobiose substrate. Celotriose can only be formed within a transglycosylation reaction whereby a cellobiose molecule acts as an acceptor for glucose retained at the active site of the BGL enzyme. Cellobiose can be the result of (1) non-hydrolyzed substrate that remains in the reaction mixture or (2) the product of a transglycosylation reaction, with glucose being both the acceptor and the donor. Since after incubation of the mature Bgl1 Q21 1 H mutant protein with cellobiose, celotriose was not determined and a significantly lower concentration of cellobiose was determined, it can be concluded that this mutant enzyme has a reduced ability to transglycosylate and improved hydrolytic activity at high concentrations of cellobiose.

Considering these results, it has been shown that the mature muieie enzyme of Bgl1 Q21 1 H has a lower capacity for transglycosylation compared to Bgl1 of M. thermophila C1. In the direct HPLC coupled test, complete cancellation of oligomer formation was demonstrated for the mature protein of Bgl1 Q21 1 H, and was detectable for Bgl1. Considering the indirect method for estimating transglycosylation, a reduction interval of 75% of transglycosylation capacity was estimated.

The reduction of the transglycosylation capacity of the mature protein of the BgM Q21 1 H enzyme seems to be responsible for an improvement of this enzyme in terms of efficiency in the enzymatic hydrolysis of biomass, a process in which there is a high concentration of substrates of transglycosylation that impairs the hydrolysis of said substrates in fermentable sugars.

Thermal studies using the Bgl1 enzyme and the mature Bgl1 Q21 1 H mutant protein.

The purified Bgl1 enzyme and the mature Bgl1 Q21 1 H protein were analyzed in terms of thermal stability based on the pNGP assay. Two types of tests were carried out: determination of the denaturation temperature and stability studies in biomass hydrolysis conditions.

For the determination of the denaturation temperature, the purified enzymes were incubated for 10 minutes at temperatures ranging between 30 and 80 ° C, then conventional pNGP assays were performed using treated enzymes and the activity was represented as a relative percentage compared to the lack of treatment In these studies a characteristic parameter can be calculated by which the temperature responsible for a 50% loss of enzymatic activity (T1 / 2) is determined. The results are shown in Figure 7A. In the stability study under biomass hydrolysis conditions, the reaction mixtures (1 ml of final volume) containing 0.1 mg of purified enzyme and 100 pmol of sodium acetate buffer (pH 5.0) were incubated at 50 ° C for 72 hours and under agitation conditions (300 rpm, Thermomixer Comfort, Eppendorf). Samples were taken at 24, 48 and 72 hours and pNGP assays were performed conventional. The results are shown in Figure 7B.

No significant differences were observed in terms of denaturation temperature between Bgl1 and the mature BgM protein Q21 1 H. T1 / 2 was calculated to be 65 and 62 ° C for the enzyme Bgl1 and the mature protein of Bgl1 Q21 1 H, respectively. , both above the biomass hydrolysis temperature (50 ° C). Regarding the thermal stability in the biomass hydrolysis conditions both enzymes remained active after 72 h at 50 ° C. In addition, 20% activation was determined for the mutant enzyme.

Claims

one . A beta-glucosidase vanant comprising an amino acid sequence that has a sequence identity of at least 80% with SEQ ID NO: 2 and comprises an amino acid substitution at position Q21 1 corresponding to positions 1 to 871 of SEQ ID NO: 2, where the beta-glucosidase vanant has reduced transglycosylation activity compared to native beta-glucosidase.

2. The beta-glucosidase vahant according to claim 1, wherein the amino acid substitution is Q21 1 H.

3. The beta-glucosidase variant according to any one of claims 1 or 2, which comprises the amino acid sequence SEQ ID NO: 4.

4. The beta-glucosidase variant according to claim 3, which consists of the amino acid sequence SEQ ID NO: 4.

5. The beta-glucosidase variant according to claim 3, which consists of the amino acid sequence SEQ ID NO: 5.

6. An isolated nucleic acid sequence encoding the beta-glucosidase vanant according to any one of claims 1 to 5.

7. An isolated nucleic acid sequence complementary to the nucleic acid sequence according to claim 6.

8. A gene construct comprising the nucleic acid sequence according to any of claims 6 or 7.

9. The gene construct of claim 8, wherein the construct Gene is an expression vector.

10. A host cell comprising the gene construct according to any of claims 8 or 9.

eleven . The host cell of claim 10, wherein said cell is Myceliophthora thermophila C1.

12. An enzymatic composition comprising the beta glucosidase vanant according to any one of claims 1 to 5.

13. The enzymatic composition of claim 12, further comprising other cellulolytic enzymes.

14. The enzyme composition according to claim 13, wherein the other cellulolytic enzymes are selected from the list consisting of: endoglucanases, beta-glucosidases, cellobiohydrolases, beta-xylosidases or any combination thereof.

15. The enzyme composition according to any of claims 12 to 14 further comprising the cell according to any of claims 10 or 1 1.

16. A method for the selection of the beta-glucosidase vanant with reduced transglycosylation activity compared to the native beta-glucosidase, according to any one of claims 1 to 5, comprising:

to. Incubate beta-glucosidase vanants comprising an amino acid sequence that has a sequence identity of at least 80% with SEQ ID NO: 2 and comprises an amino acid substitution at position Q21 1 corresponding to positions 1 to 871 of SEQ ID NO: 2, with p-nitro-phenyl glucopyranoside in the presence of cellobiose, b. Measure the release of p-nitrophenol,

C. Compare the value of p-nitrophenol measured in step (b) with a reference value, and

d. Select those vacancies of beta-glucosidase whose values measured in step (b) are higher than the reference value.

17. A method for producing the beta-glucosidase vanant according to any one of claims 1 to 5, comprising the design of a library of beta-glucosidase enzyme mutants having an amino acid sequence having a sequence identity of at least 80% with SEQ ID NO: 2 and comprise an amino acid substitution at position Q21 1 corresponding to positions 1 to 871 of SEQ ID NO: 2, and the selection of the beta-glucosidase vanant with transglycosylation activity reduced, according to steps (a) to (d) of the process of claim 16.

18. A process for producing fermentable sugar, comprising: a. Incubate cellulosic material with the beta-glucosidase vane according to any one of claims 1 to 5, with the host cell according to any one of claims 10 or 1 or with the enzyme composition according to any of claims 12 to 15 and b. Recover the fermentable sugar obtained after the incubation in step (a).

19. A process for producing a bioproduct comprising:

to. Incubate cellulosic material with the beta-glucosidase vane according to any one of claims 1 to 5, with the host cell according to any one of claims 10 or 1 or with the enzyme composition according to any of claims 12 to 15, b. Ferment the fermentable sugars obtained after the incubation of step (a) with at least one fermenting microorganism, and

C. Recover the bioproduct obtained after fermentation in step (b).

20. The process according to claim 19, wherein the bioproduct is ethanol.