WO2014180996A1 - Use of 5-azacytidine to inhibit nonsense-mediated rna decay (nmd) - Google Patents

Use of 5-azacytidine to inhibit nonsense-mediated rna decay (nmd) Download PDF

Info

Publication number
WO2014180996A1
WO2014180996A1 PCT/EP2014/059658 EP2014059658W WO2014180996A1 WO 2014180996 A1 WO2014180996 A1 WO 2014180996A1 EP 2014059658 W EP2014059658 W EP 2014059658W WO 2014180996 A1 WO2014180996 A1 WO 2014180996A1
Authority
WO
WIPO (PCT)
Prior art keywords
azacytidine
nmd
nonsense
pharmaceutically acceptable
prodrug
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/059658
Other languages
French (fr)
Inventor
Madhuri BHUVANAGIRI
Matthias Hentze
Joe Lewis
Andreas KULOZIK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Europaisches Laboratorium fuer Molekularbiologie EMBL
Universitaet Heidelberg
Original Assignee
Europaisches Laboratorium fuer Molekularbiologie EMBL
Universitaet Heidelberg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Europaisches Laboratorium fuer Molekularbiologie EMBL, Universitaet Heidelberg filed Critical Europaisches Laboratorium fuer Molekularbiologie EMBL
Publication of WO2014180996A1 publication Critical patent/WO2014180996A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system

Definitions

  • the invention relates to the use of 5-azacytidine, pharmaceutically acceptable salts and prodrugs thereof in a method of treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay.
  • Nonsense-mediated RNA decay is a cellular mechanism that specifically recognizes and degrades transcripts bearing premature termination codons (PTC), which may be introduced into mRNAs by mutation, transcriptional errors, and aberrant splicing. If translated, such mRNAs would produce a shortened version of the encoded protein.
  • PTC premature termination codons
  • the NMD surveillance mechanism reduces or prevents the formation of these defective proteins and peptides.
  • the medical importance and the beneficial effect of NMD are exemplified by mutations of the ⁇ - globin gene which lead to severe or less severe phenotypes of ⁇ -thalassemia, one of the most common single gene defects worldwide.
  • 'endoNMD targets' numerous physiological mRNAs are degraded by the NMD machinery (so-called 'endoNMD targets'). It is estimated that approximately one-third of all inherited disorders and some forms of cancer are caused by nonsense or frame shift mutations that introduce PTCs and NMD can modulate the clinical phenotype of these diseases.
  • NMD helps to protect against occasional mistakes that occur during RNA production, it also contributes to a number of genetic disorders and some forms of cancer.
  • aminoglycosides are able to bind the decoding center of the ribosome and decrease the accuracy of codon-anticodon pairing. The recognition of stop codons is suppressed and, instead of chain termination, an amino acid is incorporated into the polypeptide chain.
  • a number of studies pointed to the clinical significance of aminoglycosides pointed to the clinical significance of aminoglycosides (see, for instance, Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012) and the references cited therein).
  • PTC 124 a 1 ,2,4,-oxidiazole compound
  • Suppressor tRNAs are another approach. Chimeric tRNAs are used that can specially recognize one of the three termination codon triplets and introduce an amino acid instead of termination.
  • the major drawback of this therapy is the lack of efficient methods of delivery and stable retention of the expression of the suppressor tRNA in the correct cell types in patients.
  • the immune reaction against suppressor tRNA and the required vectors for proper delivery raises additional concerns regarding the clinical use of this approach.
  • a further approach is the use of antisense oligonucleotides to restore normal splicing in cases where splicing abnormalities give rise to PTCs.
  • the major setbacks to this approach are the current lack of availability of a proper delivery system, issues of transfection efficiency, potential immune responses and undesired side effects.
  • Small molecule therapeutics or prophylactics that modulate NMD via both stimulation and inhibition would be useful for the treatment of a number of diseases.
  • the discovery of small molecule drugs, particularly orally bioavailable drugs can lead to the introduction of a broad spectrum of selective therapeutics or prophylactics to the public and can be used against disease caused by nonsense mutations.
  • 5-Azacytidine (VidazaTM) is an analogue of the naturally occurring pyrimidine nucleoside cyti- dine. 5-Azacytidine is an approved and effective treatment for patients suffering from myelodis- plastic syndrome (MDS) and acute myeloid leukemia (AML).
  • MDS myelodis- plastic syndrome
  • AML acute myeloid leukemia
  • WO 2011/132085 describes a method for treating or ameliorating fibrosis or a fibrosis-associated disorder by administering a demethylating agent such as 4-azacytidine.
  • US 2006/0257866 A1 describes a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay by interacting with a preselected target ribonucleic acid (“RNA”), such as compounds that bind to regions of the 28S ribosomal RNA (“rRNA”) and analogs thereof.
  • RNA ribonucleic acid
  • rRNA 28S ribosomal RNA
  • That document includes list of a large number of known drugs such as azacytidine, but US 2006/0257866 A1 does not identify any one of said drugs as being a compound that interacts with a preselected target ribonucleic acid (“RNA”) such as regions of the 28S ribosomal RNA (“rRNA”) and analogs thereof.
  • WO 2010/093435 A1 relates to methods for treating non-small cell lung cancer using 5-azacytidine.
  • novel drugs for treating or preventing diseases responsive to the modulation of NMD Accordingly, it is an object of the present invention to provide such compound and thus a therapeutic option for treating or preventing NMD related diseases.
  • 5-azacytidine is an NMD inhibitor.
  • NMD nonsense-mediated decay
  • PTC ' s premature termination codons
  • NMD can eliminate mRNAs that would otherwise result in the production of partly or fully functional truncated protein. In such instances, intervention to decrease degradation of transcripts containing PTC ' s will be therapeutically useful.
  • 5-azacytidine induces a dose dependent inhibition of NMD and specifically up-regulates the expression of PTC-containing transcripts and of cellular NMD targets.
  • the mechanism of NMD inhibition was found to be independent of an induction of readthrough, an inhibition of translation and of changing the expression of the NMD proteins UPF1 , UPF2, UPF3A, UPF3B, RNPS1 , BTZ, Y14 and MAGOH.
  • the concentration needed for the effect of 5- azacytidine in cells corresponds to drug levels used in patients, which indicates that 5- azacytidine is expected to be a safe and effective treatment of Mendelian and acquired genetic diseases that are caused by PTC mutations and which benefit from an up-regulation of NMD target mRNAs.
  • the present invention relates to 5-azacytidine, a pharmaceutically acceptable salt of 5- azacytidine, or a prodrug thereof for use in a method of treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD).
  • the present invention also relates to the use of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof in the manufacture of a medicament for treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD).
  • the present invention further relates to a method for treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) comprising administering to a patient in need thereof an effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
  • NMD nonsense-mediated mRNA decay
  • the present invention provides pharmaceutical compositions for treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) comprising 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
  • NMD nonsense-mediated mRNA decay
  • Diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) are in particular diseases associated with mutant genes containing nonsense mutations or frameshift mutations that generate premature-termination codons.
  • About a third of human genetic diseases are associated with mutant genes containing nonsense or frameshift mutations that generate prema- ture-termination (nonsense) codons.
  • diseases responsive to inhibition of NMD by 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof include, but are not limited to, genetic diseases caused by premature translation termination associated with a nonsense mutation, such as cystic fibrosis and muscular dystrophy, e.g. Duchenne muscular dystrophy, Becker muscular dystrophy, Ullrich's disease, congenital muscular dystrophy, and limb-girdle muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, ⁇ °39- thalassemia, cancer, e.g.
  • genetic diseases caused by premature translation termination associated with a nonsense mutation such as cystic fibrosis and muscular dystrophy, e.g. Duchenne muscular dystrophy, Becker muscular dystrophy, Ullrich's disease, congenital muscular dystrophy, and limb-girdle muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia
  • PBD per
  • Figure 1 shows two bar graphs comparing the effect of 5-azacytidine, other nucleoside/nucleotide analogs (5-aza-2'-deoxycytidine to test the specificity of 5-azacytidine, 8- azaadenine, 6-azathymine, 6-azauracil) and positive controls (anisomycin, cycloheximide) on renilla ⁇ -globin NMD reporter (Fig. 1A) and on wildtype renilla ⁇ -globin reporter (Fig. 1 B) and two bar graphs depicting the response of 5-azacytidine treatment on renilla ⁇ -globin NMD reporter (Fig. 1 C) and on wildtype renilla ⁇ -globin reporter (Fig. 1 D) at given concentrations over time (from the left to the right: Ohr, 4hr, 8hr).
  • Figure 2 shows (A) a Northern blot analysis in stable HeLa cell lines expressing the wild type (W) and a mutant ⁇ -globin (NS39) (M) reporter after incubation with 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) and cycloheximide (Chx); (B) a bar graph depicting the percentage of upmodulation of normalized NMD reporter after incubation with the above com- pounds and (C) a bar graph depicting the effect of the above compounds on the expression level of premRNA of ⁇ -globin.
  • AC 5-azacytidine
  • Amini anisomycin
  • 5ADC 5-azadeoxycytidine
  • Chx cycloheximide
  • Figure 3 shows (A, B) two bar graphs depicting the effect of 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) on the expression level of various endo-NMD (from the left to the right: ⁇ -globin, SC35C, SC35D, ATF3, RPL3, SGK, C60RF, TIMP1 , SLC3A2, EPAS1 ) and non-NMD targets (from the left to the right: GAPDH, IVNS1 , CBFB, ACTG, ACTB); (C) a West- em blot analysis of DNMT1 and STAT3 antibodies used as a control; (D) a Western blot analysis of three NMD targets GADD45B, CHOP and SC35, and (E, F) two bar graphs depicting the percentage of upmodulation of SC35 and CHOP protein levels.
  • AC 5-azacytidine
  • Amini anisomycin
  • 5ADC 5-azade
  • Figure 4 shows (A) a graph depicting the dose response curve of cytotoxicity (lower curve) and renilla ⁇ -globin reporter luciferase activity (upper curve) of 5-azacytidine (AC); (B) a bar graph depicting the amount of S35 methionine in radiolabelled S35 methionine cells after treatment with 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) and cycloheximide (CHX); (C) and (D) gel images of Coomassie staining used as loading control and of S35 labelled autoradiography respectively.
  • Figure 5 shows (A) a bar graph comparing the percentage of read-through after treatment with DMSO, of 5-azacytidine (AC) and Geneticin (G418); (B) and (C) a bar graph depicting the effect of 5-azacytidine (AC) and Geneticin (G418) on the expression level of various endo-NMD (from the left to the right: RPL3, SC35C, EPAS1 , TBL2, SGK, SC35D, ATF3, RPL13, SLC3A2,) and non-NMD targets (from the left to the right: SCWT, HPRT1 , ACTB, GAPDH, RPL32, CBFB) respectively.
  • endo-NMD from the left to the right: RPL3, SC35C, EPAS1 , TBL2, SGK, SC35D, ATF3, RPL13, SLC3A2,
  • non-NMD targets from the left to the right: SCWT, HPRT1 , ACTB, GAPDH, R
  • Figure 6 shows a Western blot analysis of (A) NMD core factors (B) EJC complex and SMG proteins and (C) phospho UPF1 after cells incubation with 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) and wortmannin (Wort).
  • Figure 7 shows a graph depicting the dose response curve of the renilla ⁇ -globin luciferase activity for a set of compounds.
  • Figure 8 shows a graph depicting the dose response curve of the renilla ⁇ -globin luciferase activity for 5-azacytosine.
  • Figure 9 shows a qRT-PCR analysis of Calu-6 cells (carrying a homozygous PTC-mutation of the p53 gene) following treatment with either DMSO or increasing concentrations of 5- azacytidine for 18 hours.
  • the fold change on the y-axis represents the relative quantification of PTC-mutated p53 transcript vs GAPDH mRNA, which is used as a normalization control.
  • the signal detected in DMSO treated cells is set as 1.
  • Data represents the mean ⁇ SD of three independent experiments.
  • Figure 10 shows Figure 7 (A) Venn diagrams of the number of genes up/down-regulated upon 5-azacytidine treatment compared with DMSO or 5-azadeoxycytidine; (B). graphical representation of the reproducibility of the proteomics data. Average log 2 values of 5-azacytidine vs 5- azadeoxycytidine were plotted against 5-azacytidine vs DMSO. The R-value of 0.7 shows a modest reproducibility of the values among biological replicates; and (C) graphical representation of Gene ontology studies performed on the proteins up-regulated or down-regulated more than 1.5 fold upon 5-azacytidine treatment.
  • Figure 1 1 shows (A) qRT-PCR analysis of dose dependent effect of 5-azacytidine on c-MYC, DNMT1 and 18s is shown. GAPDH mRNA is used for normalization. The error bars indicate the SD of at least 3 independent experiments; (B) Western blot of HeLa cells following treatment with either DMSO as a negative control, or different doses of 5-azacytidine (AC) (0.1 , 1 .5 and 5 ⁇ ) for 18 hours and staining with antibodies that specifically detect c-MYC. Tubulin was used as a loading control.
  • AC 5-azacytidine
  • DMSO treated lysates Three different volumes of DMSO treated lysates termed 100%, 200% and 300% were used for quantification; (C) upregulation of reporter luciferase activity following treatment with DMSO and AC or with SiLUC, SiUPF and siMYC or with combined treatments of siLUC, siUPF and siMYC with DMSO and AC.
  • the x-axis shows the treatments used and the y- axix shows the fold changed of the normalized NMD reporter;
  • D Western blot of HeLa cells following treatment with either siLUC as negative control or with siMYC. Tubulin was used as a loading control.
  • Figure 12 shows quantitation of dystrophin mRNA expression in drug treated mice.
  • Groups of 3 male mice (C57BL/10ScSn-mdx/J) were treated with the indicated dose (5-azacytidine) by once daily inter peritoneal injection on days 1-5 and 8-12 and sacrificed on day 13.
  • Total RNA was extracted from the calf muscle of the hind leg and reverse transcribed.
  • qPCR was performed using dystrophin and GAPDH primers.
  • the relative expression levels of dystrophin was normal- ised to GAPDH on a per mouse basis and then the relative level with respect to the wild type mice (C57BL) dystrophin expression calculated as fold down regulation.
  • 5-Azacytidine (also known as azacitidine or 4-amino-1-(P-D-ribofuranosyl)-1 ,3,5-triazin-2(1 -/)- one; National Service Center designation NSC-102816; CAS Registry Number 320-67-2) is the compound of formula (I):
  • WO2004082618 These include methods which are amenable to large-scale synthesis and yield 5-azacytidine suitable for use in humans.
  • Suitable non-toxic acids for 5-azacytidine include, but are not limited to, inorganic and organic acids such as acetic, alginic, anthranilic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethenesulfonic, formic, fumaric, furoic, galacturonic, gluconic, glucuronic, glutamic, glycolic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, me- thanesulfonic, mucic, nitric, pamoic, pantothenic, phenylacetic, phosphoric, propionic, salicylic, stearic, succinic, sulfanilic, sulfuric, tartaric acid, and p-toluenesulfonic acid.
  • inorganic and organic acids such as acetic, alginic, anthranilic, benzenesulfonic, benzo
  • Specific non-toxic acids include hydrochloric, hydrobromic, phosphoric, sulfuric, and methanesulfonic acids.
  • Examples of specific salts thus include hydrochloride and mesylate salts.
  • Other examples of salts are well known in the art, see, e.g., Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990).
  • prodrug refers to derivatives of 5-azacytidine which have chemically or metabolically cleavable groups and are converted, by solvolysis, autohydrolysis or under physiological conditions, into 5-azacytidine.
  • a prodrug may be formed in a conventional manner with a functional group of 5-azacytidine such as with the amino group or a hydroxy group.
  • the prodrug form of- ten offers advantages of solubility, tissue compatibility, or delayed release in a mammalian or- ganism (see, Bundgard, H ., Design of Prodrugs, pp. 7-9, 21 -24, Elsevier, Amsterdam 1985).
  • Prodrugs of 5-azacytidine in particular include hydroxy derivatives well known to practitioners of the art, such as, for example, esters prepared by reaction of one or more hydroxy groups of the compound with a suitable acid and amino derivatives such as for example, amides prepared by reaction of the amino substituent with a suitable acid.
  • the prodrug is a 5-azacytidine ester.
  • suitable acid examples include amino acid esters and Ci-C6-alkyl esters of 5-azacytidine.
  • C rC 6 -alkyl ester
  • R is a straight-chain or branched alkyl group having from 1 to 6 carbon atoms. Examples include me- thyl, ethyl, propyl, iso-propyl, butyl, tert-butyl, pentyl, and hexyl.
  • amino acid ester refers to an ester resulting from the esterification of a hydroxy group of 5-azacytidine with an a-aminoacid.
  • examples include L-alanyl-O-, L-valyl-O-, L- isoleucyl-O-, and L-leucyl-O- esters of 5-azacytidine.
  • the prodrug is a bisulfite adduct of formula (II) as disclosed in US440561 1 , the content of which is incorporated herein by reference:
  • the prodrug is an amide derivative of formula (II I) as disclosed in WO 201 1 /012722, the content of which is incorporated herein by reference:
  • L is a non-biologically active linker containing
  • X 1 is C(R R 1a ) or a cyclic fragment selected from C3-C 7 -cycloalkyl, 4 to 7 membered heterocy- clyl, phenyl, naphthyl, indenyl, indanyl, tetralinyl, or 9 to 1 1 membered heterobicyclyl, wherein in case X 1 is a cyclic fragment, said cyclic fragment is incorporated into L 1 via two adjacent ring atoms and the ring atom of X 1 , which is adjacent to the carbon atom of the amide bond, is also a carbon atom;
  • X 2 is a chemical bond, -C(R 3 R 3a ), -N(R 3 ), -0-, -C(R 3 R 3a )-C(R 4 R 4a ), -C(R 3 R 3a )-N(R 4 ), -N(R 3 )- C(R 4 R 4a ), -C(R 3 R 3a )-0, or -0-C(R 3 R 3a ), wherein in case X 1 is a cyclic fragment, X 2 is a chemical bond, -C(R 3 R 3a ), -N(R 3 ), or -0-; optionally, in case X 1 is a cyclic fragment and X 2 is C(R 3 3a ), the order of the X 1 fragment and the X 2 fragment within L 1 may be changed and the cyclic fragment is incorporated into L 1 via two adjacent ring atoms; R 1 , R 3 and R 4 independently are H, C C -alkyl or
  • R 1a , R 2 , R 3a , R 4a and R 5a independently are H or CrC 4 -alkyl
  • R 5 is -C(0)R 6
  • R 6 is Ci-C 4 -alkyl; optionally, one of the pairs R 1a /R 4a , R 3a /R 4a or R 1a /R 3a form a chemical bond; and ii) a moiety L 2 , which is a chemical bond or a spacer, and L 2 is bound to a polymeric carrier group Z, wherein L 1 is substituted with one to four L 2 moieties, provided that the hydrogen marked with the asterisk in formula (IV) is not replaced by L 2 ; optionally, L is further substituted.
  • the non-biologically active linker L contains a moiety L 1 represented by formula (IV) wherein,
  • X 1 is -C(R 1 R 1a ), cyclohexyl, phenyl, pyridinyl, norbonenyl, furanyl, pyrrolyl or thienyl, wherein in case X 1 is a cyclic fragment, said cyclic fragment is incorporated into L 1 via two adjacent ring atoms;
  • X 2 is a chemical bond, -C(R 3 R 3a ), -N(R 3 ), -0-, or -C(R 3 R 3a )-0, wherein, in case X 1 is a cyclic fragment, X 2 is a chemical bond, -C(R 3 R 3a ), -N(R 3 ), -O- or - C(R 3 R 3a )-C(R 4 R 4a );
  • R 1 , R 3 and R 4 independently are H, C C -alkyl or -N(R 5 R 5a ); R 1a , R 2 , R 3a , R 4a and R 5a independently are H or C C 4 -alkyl; R 2 is Ci-C 4 -alkyl; R 5 is -C(0)R 6 R 6 is Ci-C 4 -alkyl.
  • non-biologically active linker refers to a linker which does not show the pharmaco- logical effects of 5-azacytidine.
  • spacer refers to a moiety present in the polymeric carrier of the invention suitable for connecting two moieties, such as Ci-C 5 o-alkyl, C2-C 5 o-alkenyl or C2-C 5 o-alkinyl, which fragment is optionally interrupted by one or more groups selected from -NH-, -N(CrC 4 -alkyl)-, -0-, -S-, - C(O)-, -C(0)NH-, -C(0)N(Ci-C 4 -alkyl)-, -O-C(O)-, -S(O)-, -S(0) 2 -, 4 to 7 membered heterocyclyl, phenyl or naphthyl.
  • interrupted means that between two carbon atoms of the spacer or at the end of the carbon chain between the respective carbon atom and the hydrogen atom a group as defined above is inserted.
  • the prodrug is a monophosphate derivative of formula (V) as disclosed in WO 201 1/153374, the content of which is incorporated herein by reference:
  • the prodrug is a 5-azacytidine ester (e.g. acetyl-O-, isobutyryl-O-, pivaloyl-O, valeryl- O, hexanoyl-O-, L-valyl-O-, L-isoleucyl-O-) and specifically, an acetylated 5-azacytidine.
  • a 5-azacytidine ester e.g. acetyl-O-, isobutyryl-O-, pivaloyl-O, valeryl- O, hexanoyl-O-, L-valyl-O-, L-isoleucyl-O-
  • an acetylated 5-azacytidine e.g. acetyl-O-, isobutyryl-O-, pivaloyl-O, valeryl- O, hexanoyl-O-, L-valyl-O-, L
  • 5-Azacytidine the pharmaceutically acceptable salts or the prodrugs thereof can be provided in crystalline or in amorphous form.
  • the crystalline form of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof is a solvate.
  • solvate means a crystalline form of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof, which further includes a stoichiometric or non-stoichiometric amount of a pharmaceutically acceptable solvent bound by non-covalent intermolecular forces.
  • the pharmaceutically acceptable solvent is water and thus the solvate is a hydrate.
  • Crystalline 5-azacytidine can further be provided in the form of a number of polymorphic forms such as those described in EP-A-0225871 1.
  • Polymorphic forms l-VIII disclosed in EP-A- 0225871 1 are incorporated herein by reference.
  • the term "polymorphic form” is meant to include pseudopolymorphic forms (i.e. solvates such as hydrates).
  • Polymorphic form I is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 1 of EP-A- 0225871 1.
  • Polymorphic form II is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 2 of EP- A-0225871 1.
  • Polymorphic form III is characterized by the X-Ray Powder Diffraction (XRPD) pattern compris- ing the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 3 of EP- A-0225871 1.
  • XRPD X-Ray Powder Diffraction
  • Polymorphic form IV is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 4 of EP- A-0225871 1.
  • Polymorphic form V is characterized by the X- ay Powder Diffraction (XRPD) pattern comprising the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 5 of EP- A-0225871 1.
  • Polymorphic form VI is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 6 of EP- A-0225871 1.
  • Polymorphic form VII is characterized by the X-Ray Powder Diffraction (XRPD) pattern compris- ing the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 7 of EP- A-0225871 1.
  • XRPD X-Ray Powder Diffraction
  • Polymorphic form VIII is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2 ⁇ angles, d-spacing and relative intensities as depicted in Fig. 8 of EP-A-0225871 1.
  • XRPD X-Ray Powder Diffraction
  • NMD has been demonstrated to have an effect on the clinical phenotype of various diseases. Modulation of NMD (via inhibition or augmentation) would therefore offer potential therapeutic strategies.
  • modulation of NMD refers to the regulation of gene expression by altering the level of nonsense suppression. For example, if it is desirable to increase production of a defective protein encoded by a gene with a premature stop codon, i.e., to permit read-through of the premature stop codon of the disease gene so that translation of the gene occurs, then modula- tion of premature translation termination and/or nonsense-mediated mRNA decay entails up- regulation of nonsense suppression.
  • nonsense suppression refers to the inhibition or suppression of premature translation termination and/or nonsense-mediated mRNA decay.
  • the present invention is based on the finding that 5-azacytidine inhibits NMD.
  • a disease responsive to inhibition of nonsense- mediated mRNA decay is a disease associated with a mutant gene containing a nonsense mutation.
  • the disease is associated with a mutant gene containing a frameshift mutation that generates a premature-termination codon.
  • nonsense-mediated mRNA decay refers to any mechanism that mediates the decay of mRNAs containing a premature translation termination codon.
  • premature translation termination refers to the result of a mutation that changes a codon corresponding to an amino acid to a stop codon and the term, "premature termination codon” or “premature stop codon” refers to the occurrence of a stop codon where a codon corresponding to an amino acid should be.
  • a PTC can also represent a physiological stop codon recognized by the cellular machinery as “premature” and therefore subjecting a physiological mRNA to degradation by the NMD machinery (endoNMD target).
  • frameshift refers to a genetic mutation caused by a deletion or insertion in a DNA sequence that shifts the way the sequence is read.
  • a "nonsense mutation” is a point mutation changing a codon corresponding to an amino acid to a stop codon.
  • NMD inhibition refers to a decrease in activity of NMD in a cell and to a decrease in the destruction of defective mRNA by any measurable amount, as compared to such cell in absence of inhibition.
  • NMD inhibition can be achieved in various ways, e.g. by blocking function of protein components of NMD pathway, by inhibiting translation, or by allowing the translation machine to by-pass the premature termination codon ("translational bypass therapy (TBT)" or "read-through”). See, for instance, Bashyam, Recent Patents on DNA & Gene Sequences 2009, 3, 7-15.
  • TBT translational bypass therapy
  • disease responsive to inhibition of nonsense-mediated mRNA decay is meant to denote a disease wherein the inhibition of NMD results in a reduction of the disease phenotype.
  • diseases wherein the disease phenotype is associated with aberrant gene expression due to one or more than one premature termination codon and the inhibition of NMD at least partially restores gene expression by increasing the expression of an at least partially functional protein.
  • Patients having such disease phenotype can be diagnosed using routine methods as carrying mutations such as nonsense mutation that create premature termination codons.
  • DMD Duchenne muscular dystrophy
  • Ulrich's disease is an autosomal recessive congenital muscular dystrophy characterized by proximal joint contractures, striking distant hyperextensibility, and normal intelligence.
  • Ulrich ' s disease it has been demonstrated that the pharmacological inhibition of NMD by wortmannin or caffeine, inhibitors of SMG-1 , up-regulated the PTC-containing COL oc2 (VI) mRNA and protein. Further, it has been found that this protein was incorporated into the triple- helical collagen VI with wild-type a1 and a3 chains, secreted, and integrated into the extracellu- lar matrix (ECM) in the fibroblasts obtained from a patient with Ulrich ' s disease.
  • ECM extracellu- lar matrix
  • MDC1A Merosin-deficient congenital muscular dystrophy type 1A
  • LAMA2 laminin alpha-2 gene
  • 20-30% of mutations are nonsense mutations.
  • Treatment with gentamicin and negamycin promotes significant read-through. It was also demonstrated that the mutant mRNAs were strongly stabilized in patient-derived myotubes after administration of negamycin (see, e.g., Allamand et al., J. Gene Med. 10(2): 217-224 (2008)).
  • the invention relates to treating or preventing muscular dystrophy such as Duchenne muscular dystrophy, Becker muscular dystrophy, Ulrich's disease, congenital muscular dystrophy type 1 A, and limb girdle muscular dystrophy.
  • CTFR cystic fibrosis trans-membrane conductance regulator
  • RNA silencing was used to reduce the abundance of several NMD factors in order to moderate NMD efficiency, the level of functional CFTR protein restored by suppression therapy was significantly increased (see, e.g., Keeling et al., Wiley Interdisciplinary Reviews: RNA, 2:837-852 (201 1 )). It has also been demonstrated that Amlexanox inhibits NMD and stabi- lizes CFTR mRNA. Furthermore, it has been shown that the combination of Amlexanox and PTC124 is more efficient than each molecule alone (see, e.g., Gonzales-Hilarion et al., Orphan- et Journal of Rare Diseases 7:58, 1 -14 (2012)).
  • the invention relates to treating or preventing cystic fibrosis.
  • Hurler syndrome also known as mucopolysaccharidosis I (MPS I) is the most severe form of a lysosomal storage disease caused by loss of the enzyme a-l-iduronidase (encoded by the IDUA gene), which participates in the degradation of glycosaminoglycans (GAGs) within the lyso- some.
  • GAGs glycosaminoglycans
  • premature stop mutations represent roughly two-thirds of the mutations that cause Hurler syndrome. It has been shown that aminoglycoside treatment induced PTC suppression and resulted in functional improvements.
  • a Hurler syndrome fibroblast cell line heterozygous for the IDUA stop mutations Q70X and W402X showed a significant increase in a-l-iduronidase activity when cultured in the presence of gentamicin, resulting in the restoration of 2.8% of normal ⁇ - ⁇ -iduronidase activity.
  • Determination of a-l- iduronidase protein levels by an immunoquantification assay indicated that gentamicin treatment produced a similar increase in ⁇ - ⁇ -iduronidase protein in Hurler cells.
  • the invention relates to treating or preventing Hurler syndrome.
  • the tumor suppressor gene p53 is mutated (see, for instance, the HDQ-P1 cell line, a human primary breast carcinoma cell line (Wang CS, et al., Cancer Genet. Cytogenet. 2000; 120: 58-72) and Calu-6 cell line, an adenocarcinoma cell line (Lehman et al., Cancer Res 1991 ;51 :4090-4096)). 8% of all the mutations identified are nonsense mutations, leading to the absence of functional p53. It has been demonstrated that G418 (Geneticin) inhibits the NMD pathway and leads to enhanced read-through.
  • G418 Geneticin
  • Li-Fraumeni syndrome is an autosomal inherited cancer predisposition syndrome, clinically defined by the occurrence of familial sarcoma and characterized by a cluster of early onset cancers (before 45 years), including brain cancer, adrenal cortical carcinoma, and breast cancer.
  • Germline p53 mutations have been detected in approximately 80% of families that comply with LFS criteria, and p53 is the only gene found to be associated with this syndrome.
  • FAP is an autosomal dominant disorder that accounts for less than 1 % of all cases of colorectal cancer (CRC).
  • adenomatous polyposis coli (APC) gene is affected in more than 90% of patients, mostly by nonsense (30%) or frameshift mutations (68%) that generate truncated pro- teins. Missense mutations have also been described as predisposing to development of colorectal tumors.
  • Attenuated adenomatous polyposis coli is characterized by the occurrence of fewer than 100 colonic adenomas, a milder colorectal phenotype with later onset of colorectal cancer (after 40 years of age), and characteristic mutations in the 50 and 30 ends of the APC gene.
  • Hereditary non-polyposis colorectal cancer is an autosomal dominant disorder characterized by a limited number of adenomas, early onset of CRC (before 50 years), and the development of extra-colonic cancers: gastric, endometrial, ovarian, renal, and hepatobiliary.
  • HNPCC is associated with DNA microsatellite instability (MSI) due to mutations in the MMR genes. 50% of these mutations occur in MLH1 , 40% in MSH2, and 10% in all the other genes described to be affected in this syndrome: MSH6, PMS2, PMS1 , and MLH3 [18].
  • MSI DNA microsatellite instability
  • PTEN germline mutations have been described in CS families with the frequencies of 20% missense, 20% insertions, 13% deletions, 10% splice-site, 3% referred to as deletion/insertion mutation, and 33% nonsense.
  • Peutz- Jeghers syndrome (PJS) is an autosomal dominant disorder associated with a 30-50% increased risk of developing breast cancer, as well as increased risk of other cancer types such as gastric, colon, or pancreatic.
  • PJS is associated with mutations in STK1 1/LKB1 , a gene encoding serine/threonine kinase 1 1 , which is a master regulator of AMPK and the AMPKrelated kinases.
  • STK1 1 mutations have been described in 69% of PJS probands, from which 27% were missense, 27% insertions, 18% deletions, 5% affected a splice-site, and 18% were nonsense.
  • Approximately 5% of all cases of breast cancer are associated with a hereditary cancer susceptibility syndrome with early onset (before 50 years) and are caused by mutations in high penetrance susceptibility genes, most involved in DNA repair (familial breast-ovarian cancer; BROVCA).
  • Nearly 16% of hereditary breast cancers are associated with germline mutations in either of the BRCA (breast cancer 1 and 2) genes.
  • Germline BRCA mutations are associated with a 50-80% risk of breast cancer, a 60% risk of contralateral breast cancer, and a 15-25% risk of ovarian cancer. Most BRCA1 (70%) and BRCA2 (90%) mutations are truncating, namely small insertions and deletions, nonsense substitutions, and splice-site mutations. Although rare, the contribution of missense mutations to breast cancer predisposition has also been demonstrated.
  • NMD can be used in a method for the treatment or prevention of cancer, in particular HDGC (hereditary diffuse gastric cancer) and cancer associated with a mutation of the p53 gene (e.g. Li-Fraumeni Syndrome, human breast cancer) or a mutation of the APC gene (e.g. colorectal cancer and familial adenomatous polyposis).
  • HDGC hereditary diffuse gastric cancer
  • cancer associated with a mutation of the p53 gene e.g. Li-Fraumeni Syndrome, human breast cancer
  • APC familial adenomatous polyposis
  • the invention relates to treating or preventing HDGC, cancer associated with a mutation of the p53 gene, and cancer associated with a mutation of the APC gene.
  • the invention relates to treating or preventing further cancer that are associated with nonsense muatations that create premature termination codons, such as hereditary non-polyposis colorectal cancer (HNPCC), Cowden Syndrome (CS), Peutz- Jeghers syndrome (PJS), familial breast-ovarian cancer (BROVCA)
  • HNPCC hereditary non-polyposis colorectal cancer
  • CS Cowden Syndrome
  • PJS Peutz- Jeghers syndrome
  • BROVCA familial breast-ovarian cancer
  • LINCL familial breast-ovarian cancer
  • Premature stop codon mutations in the gene CLN2 encoding the lysosomal tripeptidyl-peptidase 1 (TPP-I) are associated with disease in approximately half of children diagnosed with LINCL.
  • the invention relates to treating or preventing LINCL.
  • Spinal muscular atrophy (SMA) is a leading genetic cause of death in infants. It is a progressive disease of muscle weakness/atrophy and degeneration/loss of the anterior horn cells (AHC) in the spinal cord and brain stem nuclei, with four types of clinical severity, including Werdning- Hoffmann disease (SMA type I), Dubowitz disease (SMA type II), and Kugelberg-Welander disease (SMA type III).
  • SMA survival motor neuron
  • Ataxia telangiectasia is autosomal recessive genetic disorder caused by mutations in the ataxia telangiectasia mutated (ATM) gene.
  • ATM ataxia telangiectasia mutated
  • Most of the mutations determined in A-T patients are truncating mutations created by primary premature termination codons or secondarily by deletions, insertion or splicing mutations that lead to frameshift.
  • a library of compounds was screened and 12 low-molecular-mass non-aminoglycosides with potential PTC-read-through activity were identified.
  • the invention relates to treating or preventing A-T.
  • Beta-thalassemia is a blood disorder that reduces the production of hemoglobin.
  • stop codon mutations lead to premature translation termination and to mRNA de- stabilization through nonsense-mediated decay.
  • the production of ⁇ -globin by K562 cell clones expressing the 3°39-thalassemia globin gene has been demonstrated upon treatment with G418.
  • erythroid precursor cells from 3°39-thalassemia patients were demonstrated to be able to produce ⁇ -globin and adult hemoglobin after treatment with G418.
  • the invention relates to treating or preventing 3°39-thalassemia.
  • Methylmalonic acidemia is a progressive autosomal recessive metabolic disorder wherein the body is unable to breakdown certain proteins, lipids and cholesterol properly.
  • MUT methylmalonyl-CoA mutase
  • MMAA methylmalonic aciduria cbIA type
  • the invention relates to treating or preventing MMA.
  • CNS cystinosin
  • Obesity may be caused by a defect in the melanocortin 4 receptor (MC4R). Rescue of such nonsense mutations may be achieved by read-through treatment with aminoglycosides such as gentamicin and G418 (Brumm et al., 20(5): 1074-81 Obesity (2012)).
  • M4R melanocortin 4 receptor
  • PBDs Peroxisome biogenesis disorders
  • PLDs are multisystemic autosomal recessive disorders resulting from mutations in a gene coding a peroxin protein (PEX) required for normal peroxisome assembly and metabolic activities.
  • PX peroxin protein
  • Treatment with G418 leads to improvements in peroxisomal lipid catabolic and anabolic activities (Dranchak et al. J. Cell Biochem. 1 12(5): 1250-8 (201 1 )).
  • Renal tubular acidosis is a medical condition that involves an accumulation of acid in the body. It is caused by a nonsense mutation in the SCL4A4 gene encoding the electrogenic sodium bicarbonate cotransporter NBCe1 -A. G418 treatment induced read-through and increased the Na(+)- and HCO(3)(-)- dependent transport to a level that did not differ from wild-type NBCe1-A function (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
  • Retinitis pigmentosa is a disease resulting from premature termination codon (PCT) mutations causing retinal degeneration.
  • PCT premature termination codon
  • Treatment with gentamicin revealed an increase in read- through and enhanced photoreceptor survival (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
  • Rett syndrome is a neurodevelopment disorder of the grey matter of the brain. In about 35% of the cases it is caused by nonsense mutations in the MECP2 gene. Gentamicin and G418 induce read-through and lead to the production of protein similar to the wild type. Furthermore, a mouse model was generated carrying the R168X mutation in the MECP2 gene. Transfected HeLa cells expressing mutated MECP2 fusion proteins and mouse ear fibroblasts isolated from the new mouse model were treated with gentamicin and the novel aminoglycosides NB30, NB54, and NB84.
  • the Stuve-Wiedemann syndrome is a rare abnormality that belongs to the group of bent- bone dysplasias. It is caused by a mutation in the leukemia inhibitory factor receptor (LIFR). Gentamicin partially restores the synthesis of functional LIFR (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
  • X-linked nephrogenic diabetes insipidus is characterized by inability to concentrate the urine. It is caused by nonsense mutations in the AVPR2 gene. It has been demonstrated that treatment with read-through drugs such as gentamicin, paromomycin, G418 rescues partially AVPR2 function in vivo (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
  • Usher syndrome (USH1 ) is the most common form of combined congenital deaf-blindness. It is caused by a nonsense mutation in the USH1 C gene, which leads to the generation of a stop signal in a DNA base, resulting in premature termination of protein synthesis.
  • Hemophilia is a group of X-linked recessive bleeding disorders that slow the coagulation process. Two separate gene mutation databases reported that approximately 9%-10% of HA and about 8%-9% of HB is caused by nonsense mutations. HB is caused by the deficiency of the coagulation factor IX protein encoded by the F9 gene. Treatment with geneticin elicited a multi- day response and residual F9 antigen was detected after 3 weeks (Yang et. al., PNAS 104: 15394-15399 (2007)). Hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A) results in impaired hepatic long- chain fatty acid oxidation and ketogenesis.
  • CPT1A Hepatic carnitine palmitoyltransferase 1A deficiency
  • BMPR2 Bone morphogenetic protein receptor type 2 gene mutations are a major risk factor for heritable pulmonary arterial hypertension (HPAH), an autosomal dominant fatal disease. It has been shown that BMPR2 transcripts that contain premature termination codon (PTC) mutations are rapidly and nearly completely degraded through nonsense-mediated decay (NMD).
  • LAD1 Leukocyte adhesion deficiency I
  • C562T R188X
  • gentamicin Treatment in vivo and in vitro with gentamicin resulted in the expression of a corrected full-length dysfunctional or mislocalized CD18 protein (Simon et al., PLoS One 5(1 1 ): e13659 (2010)).
  • ADOKD Autosomal dominant polycystic kidney disease
  • PC2 functional polycystin 2
  • Nonsense mutations in coagulation factor (F) VII potentially cause a lethal hemorrhagic diathesis.
  • K316X and W364X FVII mutations, associated with intracranial hemorrhage, and their correction by aminoglycosides was investigated. Even tiny increases in the amount of functional protein in patients could ameliorate hemorrhagic phenotypes. In cells treated with aminoglyco- sides an increase in FVII activity was detected (Pinotti et al., J. of Thrombosis and Haemosta- sis, 4:1308-1314 (2006)).
  • Familial atrial fibrillation is a rhythm disorder characterized by chaotic electrical activity of cardiac atria. Predisposing to stroke and heart failure, this common condition is increasingly recog- nized as a heritable disorder.
  • Genomic DNA scanning revealed a nonsense mutation in KCNA5 that encodes Kv1.5, a voltage-gated potassium channel expressed in human atria.
  • the heterozygous E375X mutation present in a familial case of atrial fibrillation introduced a premature stop codon disrupting the Kv1.5 channel protein. Rescue of the genetic defect was achieved by aminoglycoside-induced translational read-through of the E375X premature stop codon, restor- ing channel function (Olson et al., Hum. Mol. Genet. 15(14): 2185-91 (2006)).
  • NMD neurodegenerative disease
  • RTA renal tubular acidosis
  • RP retinitis pigmentosa
  • RTT Rett syndrome
  • SMS Stuve-Wiedemann syndrome
  • USH1 X-linked nephrogenic diabetes insipidus
  • USH1 Usher syndrome
  • H2B limb girdle muscular dystrophy
  • HPAH heritable pulmonary arterial hypertension
  • LAD1 leukocyte adhesion deficiency I
  • ADOKD autosomal dominant polycystic kidney disease
  • factor VII deficiency familial atrial fibrillation.
  • the invention also re- lates to treating or preventing nephropatic cystinosis, obesity, peroxisome biogenesis disorders, renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), Stuve- Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), Usher syndrome (USH1 ), limb girdle muscular dystrophy (type 2B), Miyoshi myopathy, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), leukocyte adhesion deficiency I (LAD1 ), autosomal dominant polycystic kidney disease (ADOKD), factor VII deficiency and familial atrial fibrillation.
  • RTA renal tubular acidosis
  • RP retinitis pigmentosa
  • RTT Rett
  • the present invention is, in particular, concerned with treating or preventing the diseases disclosed herein wherein the disease is associated with a mutant gene containing a mutation se- lected from the group consisting of the mutations disclosed in table 1 of Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012), the content of which is incorporated herein by reference.
  • inhibition of NMD thereby increasing the amount of protein generated from otherwise NMD-susceptible mRNA, is therapeutically sufficient for the prevention or treatment of the disease.
  • a combination therapy comprising both NMD inhibition and suppressing nonsense codon recognition, e.g. by the use of a read- through enhancer.
  • Combinations of NMD inhibitors and read-through enhancer have proven to more effective than either agent alone (see, e.g. Martin et al., Cancer research, published online on March 24, 2014 under doi:10.1158/0008-5472.CAN-13-2235).
  • Non-limiting examples of compounds capable of suppressing nonsense codon recognition are embodied by certain aminoglycoside antibiotics (e.g. gentamicin) and analogs thereof (e.g. chemical compounds such as those depicted in Fig.
  • aminoglycoside antibiotics and analogs thereof are gentamicin derivatives of for- mula,
  • R-i and R 2 are both methyl or hydrogen, or R-i is methyl and R 2 is hydrogen;
  • neomycin tobramycin, paromomycin, amikacin, geneticin (G418), neomycin class ("TC" derivates) of formula
  • non-aminoglycoside compounds are negamycin, acetylamino benzoic acids (e.g. 3-[2-(4-isopropyl-3-methyl-phenoxy)-acetylamino]-benzoic acid, 3-[2-(4-tert-butyl-phenoxy)- acetylamino]-benzoic acid, and 3- ⁇ 2-[4-(1 ,1-dimethyl-propyl)-phenoxy]acetylamino ⁇ -benzoic acid), clitocine; macrolides (e.g. erythromycin, oleandomycin, tylosin, spiramycin, and josamycin) and readthrough compounds (RTCs), e.g. RTC#13 and RTC#14,
  • readthrough enhancer refers to a compound that increases the by-passing of the premature termination codon resulting in an increased production of full length protein.
  • the present invention also provides:
  • a pharmaceutical composition comprising a combination product as defined in i) above and at least one carrier, diluent or excipient;
  • kits-of-parts for use in the treatment of a disease as defined herein comprising a first dosage form comprising 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof and one or more further dosage forms each comprising one or more read-through enhancers for combined therapeutic administration,
  • adjunctive administration is meant the coterminous or overlapping administration of each of the components in the form of separate pharmaceutical compositions or devices.
  • This regime of therapeutic administration of two or more therapeutic agents is referred to generally by those skilled in the art and herein as adjunctive therapeutic administration; it is also known as add-on therapeu- tic administration.
  • Any and all treatment regimes in which a patient receives separate but coterminous or overlapping therapeutic administration of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof and at least one read-through enhancer are within the scope of the current invention.
  • a patient is typically stabilised on a therapeutic administration of one or more of the components for a period of time and then receives administration of another component.
  • the combination therapies of the invention may also be administered simultaneously.
  • simultaneous administration is meant a treatment regime wherein the individual components are administered together, either in the form of a single pharmaceutical composition or device com- prising or containing both components, or as separate compositions or devices, each comprising one of the components, administered simultaneously.
  • Such combinations of the separate individual components for simultaneous combination may be provided in the form of a kit-of- parts.
  • the terms "prevent”, “preventing” and “prevention” refer to the prevention of the onset, recurrence, spread or worsening of the disease or a symptom thereof in a patient resulting from the administration of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
  • a patient can be screened for the presence of a nonsense mutation.
  • an effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof can be administered to the patient to prevent the onset, recurrence, spread or worsening of the disease or a symptom thereof.
  • treat refers to the eradication or amelioration of the dis- ease or symptoms associated with the disease. In certain embodiments, such terms refer to minimizing the spread or worsening of the disease resulting from the administration of 5- azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof to a patient with such a disease.
  • the present invention further relates to a method for treating and preventing diseases respon- sive to inhibition of nonsense-mediated mRNA decay (NMD) comprising administering to a patient in need thereof an effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
  • NMD nonsense-mediated mRNA decay
  • an effective amount refers to that amount of 5-azacytidine, a pharmaceutically accepta- ble salt, or a prodrug thereof sufficient to provide a therapeutic benefit in the treatment or management of the disease or to delay or minimize symptoms associated with the disease.
  • the present invention also relates to the use of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof, in the manufacture of a medicament for inhibiting nonsense-mediated mRNA decay (NMD).
  • NMD nonsense-mediated mRNA decay
  • the present invention further provides pharmaceutical compositions for treating and preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) comprising 5- azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
  • NMD nonsense-mediated mRNA decay
  • the pharmaceutical compositions further comprise at least one pharmaceu- tically-acceptable carrier, excipient or diluent.
  • compositions can, for example, be administered orally, rectally, transdermally, subcuta- neously, intravenously, intramuscularly or intranasally. Oral administration is preferred.
  • suitable pharmaceutical formulations are solid medicinal forms, such as powders, granules, tablets, in particular film tablets, lozenges, sachets, cachets, sugar-coated tablets, capsules, such as hard gelatin capsules and soft gelatin capsules, suppositories or vaginal me- dicinal forms, semisolid medicinal forms, such as ointments, creams, hydrogels, pastes or plasters, and also liquid medicinal forms, such as solutions, emulsions, in particular oil-in-water emulsions, suspensions, for example lotions, injection preparations and infusion preparations, and eyedrops and eardrops. Implanted release devices can also be used for administering inhibitors according to the invention.
  • the compounds according to the invention are optionally mixed or diluted with one or more carriers (excipients).
  • Carriers can be solid, semisolid or liquid materials which serve as vehicles, carriers or medium for the active compound. Suitable carriers (excipients) are listed in the specialist medicinal monographs.
  • the formulations can comprise pharmaceutically acceptable auxiliary substances, such as wetting agents; emulsifying and suspending agents; preservatives; antioxidants; antiirritants; chelating agents; coating auxiliaries; emulsion stabilizers; film formers; gel formers; odor masking agents; taste corrigents; resin; hydrocolloids; solvents; solubilizers; neutralizing agents; diffusion accel- erators; pigments; quaternary ammonium compounds; refatting and overfatting agents; raw materials for ointments, creams or oils; silicone derivatives; spreading auxiliaries; stabilizers; steri- lants; suppository bases; tablet auxiliaries, such as binders, fillers, glidants, disintegrants or coatings; propellants; drying agents; opacifiers; thickeners; waxes; plasticizers and white mineral oils.
  • auxiliary substances such as wetting agents; emulsifying and suspending agents; preservatives; antioxidants
  • a formulation in this regard is based on specialist knowledge as described, for example, in Fiedler, H.P., Lexikon der Hilfsstoffe fur Pharmazie, Kosmetik und angrenzende füre [Encyclopedia of auxiliary substances for pharmacy, cosmetics and related fields], 4 th edition, Au- lendorf: ECV-Editio-Cantor-Verlag, 1996.
  • NMD nonsense-mediated mRNA decay
  • the basic design of the assay was to seed stable inducible HeLa cells expressing renilla reporter in 384 wells a day prior to treatment. The following day, cells were treated with the inhibitors from the library or DMSO for 16 hours. Renilla luminescence intensity between the cells treated vs the control (DMSO) was calculated.
  • the compounds which showed more than 2-fold up-regulation of the renilla ⁇ -globin reporter system were preferably selected for secondary screening using wildtype renilla ⁇ -globin expressing HeLa cells.
  • 5-azacytidine (VidazaTM; Pharmion Corporation) showed most significant up-regulation of the renilla ⁇ -globin reporter in our primary screen (Fig. 1A).
  • Example 2 5-Azacytidine increases the amount of nonsense mutation-containing mRNAs via stabilization of NMD reporter:
  • Fig. 3A and 3B clearly illustrate that 5-azacytidine caused specific up-regulation of endo-NMD targets while non-NMD targets were either unchanged or even down-regulated in some cases, further confirming the effect of 5-azacytidine as specific NMD inhibitor.
  • Example 5 5-Azacytidine does not inhibit NMD via read-through mechanism It was tested whether NMD inhibition was mediated via a read-through mechanism.
  • a luciferase based reporter was used to assay read-through efficiency [Ivanov PV et al., EMBO J. 27(5): 736-47 (2008)].
  • the wild type reporter is a fusion protein of renilla and firefly and under normal conditions the luminesence from both renilla and firefly are detected.
  • the NMD mutant has a codon between renilla and firefly cDNAs and the firefly luminescence is detected only when there is read-through.
  • Fig. 5B and 5C clearly illustrate that 5-azacytidine caused specific up- regulation of endo-NMD targets.
  • Example 8 5-Azacytidine up-regulates endogenous p53 mRNAs in the Calu6 cell line.
  • Example 9 5-Azacytidine inhibits NMD via overexpression of MYC.
  • siRNAs were purchased at Thermo Fisher Sci- entific (Waltham, MA, USA). Either 1.5x10 5 RWt or RNS cells were seeded in 6-well plates and after 24 h treated with siMYC, siUPFI and siLuc, respectively.
  • Oligofec- tamineTM Transfection Reagent (Invitrogen, Düsseldorf, Germany) was used according to the manufacturer's protocol. 6 h after the siRNA treatment, 10% FCS were added.
  • RIPA buffer 50 mM Tris-HCL at pH 7.5, 150 mM CaCI, 1 % NP- 40, 0.5% sodium deoxycholate, 0.1% SDS
  • Protein concentrations were measured either using BCA or Bradford assay (both from Bio-Rad Laboratories, Hercules, CA, USA).
  • Membranes were developed using either Western Lightning ® ECL or ECL-Plus Reagent (Perkin Elmer, Waltham, MA, USA) with FUSION FX machine (Vilber Lourmat, Eberhardzell, Germany).
  • RT-PCR was used to validate the knockdown of c-MYC after siMYC treatment as well as to show the effect on c-MYC after 5-azacytidine treatment. Also endogenous NMD targets were analysed. RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA of 1 g RNA was synthesised using the RevertAidTM First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany). cDNA was diluted 1 :10 and used for RT-PCR with Absolute SYBR Green mix (Thermo Fisher Scientific, Waltham, MA, USA) on StepOnePlusTM system (Applied Biosystems Inc., Life Technologies, Carlsbad, CA, USA). The primers in the following table were used to quantify c-MYC and various endogenous NMD targets. GAPDH was used for normalization. gene forward reverse
  • Cells were treated with DMSO or AC or 5ADC for 18 hours and then harvested in 1 ml PBS.
  • the cell pellet was later lysed in 8 M urea, 50 mM ammonium bicarbonate, 5 mM sodium phosphate, 1 mM potassium fluoride, 1 mM sodium orthovanadate, and EDTA-free protease inhibitor mixture (Roche).
  • Samples were reduced with DTT at a final concentration of 10 mM at 56 °C; sub- sequently samples were alkylated with iodoac-etamide at a final concentration of 55 mM at RT.
  • the samples were diluted to 2 M urea, 50 mM ammonium bicarbonate, and trypsin (1 :100; Promega) was added. Digestion was performed overnight at 37 °C.
  • Tryptic peptides were desalted, dried in vacuo, and resus- pended in 100 ul of triethylammoni- um bicarbonate (100 mM). Subsequently, formaldehyde-H2 (573 umol) was added and vor- texed for 2 min followed by the addition of freshly prepared sodium cyanoborohydride (278 umol). The resultant mixture was vortexed for 60 min at RT. A total of 60 ul of ammonia (25%) was added to consume the excess formaldehyde. Finally, 50 ul of formic acid (100%) was added to acidify the solution. For intermediate labels, formaldehyde-D2 (573 umol) was used. The light and intermediate dimethyl-labeled samples were mixed in 1 :1 ratio based on total peptide amount, which was determined by running an aliquot of the labeled samples on a regular LC- MS run and comparing overall peptide signal intensities.
  • DNMT1 (5-azacytidine is known to effect the only protein levels of DNMT1 not mRNA) and 18s were used as negative controls and they were not up-regulated upon 5-azacytidne treatment ( Figure 1 1 A).
  • Western blot analysis of lysates from 5-azacytidine treated cells also showed an up-regulation of c-myc at higher concentrations in a dose- dependent manner ( Figure 11 B).
  • siRNA-mediated knockdown in cells stably transfected with a luciferase-based NMD-reporter was performed ( Figure 1 1 C). After treatment with 5-azacytidine the NMD reporter was approximately 4.5-fold up- regulated when compared to the DMSO treated sample (compare DMSO and AC lanes) as pre- viously seen.
  • siRNA-mediated knockdown of c-MYC alone leads to a mild down-regulation of the NMD reporter when compared to the control (compare siLuc and siMYC lanes).
  • Example 10 5-Azacytidine partially reversed the nonsense mediated decay of the dystrophin mRNA in mdx mice.
  • 5-Azacytidine suspension was made up fresh each day just prior to use. 10 mg of 5-azacytidine (Sigma-Aldrich) powder was suspended in 10 ml of water for injection to make 1 mg/ml stock solution which is milky in appearance. For the different dose groups dilute as below. Vortex stock solution prior to taking aliquot and inject 100 ⁇ per 10g body weight I. P.
  • the mdx mouse strain is generally accepted to be a relevant animal model for human Du- chenne's Muscular Dystrophy.
  • the mdx mice (CSyBL/I OScSn-DmcT ⁇ /J) have a mutation in the dystrophin gene causing a premature stop codon which results in nonsense mediated decay of the mRNA.
  • Male mice (6-8 weeks old) were purchased directly from the Jackson Laboratory (Bar Harbor, Maine USA). The mice were randomly sorted in groups of three and dosed once daily intra peritoneal on days 1-5 and 8-12 at either 6, 3, 1 or 0.3 mg/kg body weight in the morning. A control group was injected with water for injection only.
  • mice Three wild type mice (C57BL) from the same strain were used untreated to determine the normal expression levels of the dystrophin mRNA. On day 14 mice were sacrificed and a small section of calf muscle (50-200 mg) dissected out and stored in 2 ml of RNA/aier RNA Stabilization Reagent (Qiagen) at for degrees centigrade overnight. Samples were then frozen at -20 degrees centigrade until there were processed further.
  • RNA extraction RNA extraction
  • 5-azacytidine to inhibit NMD is most significant from a medical perspective, because this drug has been in clinical use for many years as an approved drug for the treatment of myelodysplastic syndrome, chronic myelomonocytic leukemia and acute myeloid leukemia.
  • concentration of 5-azacytidine that is required for its effect as an NMD inhibitor is similar or even below the drug levels in patients, which are needed for its effect as an antileukemic agent.
  • 5-azacytidine is therefore envisaged to be re-purposed for the treatment of diseases that would benefit from an inhibition of NMD efficiency and an increased expression of PTC-mutated transcripts.
  • Such transcripts encode C-terminally truncated proteins, which may be (partially) functional and NMD inhibition might thus result in a therapeutic effect.
  • Some forms of Duchenne muscular dystrophy and cystic fibrosis which are caused by PTC-mutations in the 3' region of the dystrophin and the CFTR genes, respectively, exemplify diseases that may benefit from such an approach (Keeling, K.M. & Bedwell, D.M. Suppression of nonsense mutations as a therapeutic approach to treat genetic diseases. Wiley Interdiscip Rev RNA 2, 837-52 (201 1 ); Linde, L. & Kerem, B. Introducing sense into nonsense in treatments of human genetic diseases. Trends Genet 24, 552-63 (2008)).
  • NMD NMD mRNA surveillance pathway downregulates aberrant E-cadherin transcripts in gastric cancer cells and in CDH1 mutation carriers. Oncogene 27, 4255-60 (2008); Metzeler, K.H. et al. TET2 mutations improve the new European LeukemiaNet risk classification of acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol 29, 1373-81 (2011 )). Further, it is expected that 5- azacytidine acts synergistically with compounds that induce readthrough at premature termination codons.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to the use of 5-azacytidine and pharmaceutically acceptable salts thereof in a method of treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay, such as cystic fibrosis, muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, β039-thalassemia, cancer, factor VII deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency I (LAD1 ), methylmalonic academia (MMA), Hurler syndrome, nephropatic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve-Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), or Usher syndrome (USH 1 ).

Description

Use of 5-azacytidine to inhibit nonsense-mediated RNA decay (NMD)
FIELD OF THE INVENTION The invention relates to the use of 5-azacytidine, pharmaceutically acceptable salts and prodrugs thereof in a method of treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay.
BACKGROUND OF THE INVENTION
Nonsense-mediated RNA decay (NMD) is a cellular mechanism that specifically recognizes and degrades transcripts bearing premature termination codons (PTC), which may be introduced into mRNAs by mutation, transcriptional errors, and aberrant splicing. If translated, such mRNAs would produce a shortened version of the encoded protein. The NMD surveillance mechanism reduces or prevents the formation of these defective proteins and peptides. The medical importance and the beneficial effect of NMD are exemplified by mutations of the β- globin gene which lead to severe or less severe phenotypes of β-thalassemia, one of the most common single gene defects worldwide. In addition, numerous physiological mRNAs are degraded by the NMD machinery (so-called 'endoNMD targets'). It is estimated that approximately one-third of all inherited disorders and some forms of cancer are caused by nonsense or frame shift mutations that introduce PTCs and NMD can modulate the clinical phenotype of these diseases.
While NMD helps to protect against occasional mistakes that occur during RNA production, it also contributes to a number of genetic disorders and some forms of cancer.
Currently there are a number of available therapies for treatment of NMD related diseases. For instance, aminoglycosides are able to bind the decoding center of the ribosome and decrease the accuracy of codon-anticodon pairing. The recognition of stop codons is suppressed and, instead of chain termination, an amino acid is incorporated into the polypeptide chain. A number of studies pointed to the clinical significance of aminoglycosides (see, for instance, Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012) and the references cited therein). PTC 124, a 1 ,2,4,-oxidiazole compound, is a new drug in development for mutation-specific treatment of inherited diseases such as Duchenne muscular dystrophy and cystic fibrosis (Welch et al., Nature 447: 87-93 (2007). Suppressor tRNAs are another approach. Chimeric tRNAs are used that can specially recognize one of the three termination codon triplets and introduce an amino acid instead of termination. The major drawback of this therapy is the lack of efficient methods of delivery and stable retention of the expression of the suppressor tRNA in the correct cell types in patients. Moreover, the immune reaction against suppressor tRNA and the required vectors for proper delivery raises additional concerns regarding the clinical use of this approach.
A further approach is the use of antisense oligonucleotides to restore normal splicing in cases where splicing abnormalities give rise to PTCs. In spite of the potential therapeutic opportunity and the advantage to use it in variable ways, the major setbacks to this approach are the current lack of availability of a proper delivery system, issues of transfection efficiency, potential immune responses and undesired side effects. Small molecule therapeutics or prophylactics that modulate NMD via both stimulation and inhibition would be useful for the treatment of a number of diseases. The discovery of small molecule drugs, particularly orally bioavailable drugs can lead to the introduction of a broad spectrum of selective therapeutics or prophylactics to the public and can be used against disease caused by nonsense mutations.
5-Azacytidine (Vidaza™) is an analogue of the naturally occurring pyrimidine nucleoside cyti- dine. 5-Azacytidine is an approved and effective treatment for patients suffering from myelodis- plastic syndrome (MDS) and acute myeloid leukemia (AML). WO 2011/132085 describes a method for treating or ameliorating fibrosis or a fibrosis-associated disorder by administering a demethylating agent such as 4-azacytidine. US 2006/0257866 A1 describes a method of identifying a compound that modulates premature translation termination or nonsense-mediated mRNA decay by interacting with a preselected target ribonucleic acid ("RNA"), such as compounds that bind to regions of the 28S ribosomal RNA ("rRNA") and analogs thereof. That document includes list of a large number of known drugs such as azacytidine, but US 2006/0257866 A1 does not identify any one of said drugs as being a compound that interacts with a preselected target ribonucleic acid ("RNA") such as regions of the 28S ribosomal RNA ("rRNA") and analogs thereof. WO 2010/093435 A1 relates to methods for treating non-small cell lung cancer using 5-azacytidine. Thus, there remains a need to develop novel drugs for treating or preventing diseases responsive to the modulation of NMD. Accordingly, it is an object of the present invention to provide such compound and thus a therapeutic option for treating or preventing NMD related diseases. SUMMARY OF THE INVENTION It has now been found that 5-azacytidine is an NMD inhibitor. As nonsense-mediated decay (NMD) is known to specifically degrade transcripts containing premature termination codons (PTC's) NMD can eliminate mRNAs that would otherwise result in the production of partly or fully functional truncated protein. In such instances, intervention to decrease degradation of transcripts containing PTC's will be therapeutically useful.
More particularly, 5-azacytidine induces a dose dependent inhibition of NMD and specifically up-regulates the expression of PTC-containing transcripts and of cellular NMD targets. The mechanism of NMD inhibition was found to be independent of an induction of readthrough, an inhibition of translation and of changing the expression of the NMD proteins UPF1 , UPF2, UPF3A, UPF3B, RNPS1 , BTZ, Y14 and MAGOH. The concentration needed for the effect of 5- azacytidine in cells corresponds to drug levels used in patients, which indicates that 5- azacytidine is expected to be a safe and effective treatment of Mendelian and acquired genetic diseases that are caused by PTC mutations and which benefit from an up-regulation of NMD target mRNAs.
Thus, the present invention relates to 5-azacytidine, a pharmaceutically acceptable salt of 5- azacytidine, or a prodrug thereof for use in a method of treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD). The present invention also relates to the use of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof in the manufacture of a medicament for treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD).
The present invention further relates to a method for treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) comprising administering to a patient in need thereof an effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
The present invention provides pharmaceutical compositions for treating or preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) comprising 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof. Diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) are in particular diseases associated with mutant genes containing nonsense mutations or frameshift mutations that generate premature-termination codons. About a third of human genetic diseases are associated with mutant genes containing nonsense or frameshift mutations that generate prema- ture-termination (nonsense) codons.
According to the present invention, diseases responsive to inhibition of NMD by 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof include, but are not limited to, genetic diseases caused by premature translation termination associated with a nonsense mutation, such as cystic fibrosis and muscular dystrophy, e.g. Duchenne muscular dystrophy, Becker muscular dystrophy, Ullrich's disease, congenital muscular dystrophy, and limb-girdle muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, β°39- thalassemia, cancer, e.g. hereditary diffuse gastric cancer and cancer associated with a mutation of the p53 gene or a mutation of the APC gene, factor VI I deficiency, familial atrial fibrilla- tion, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency I (LAD1 ), methylmalonic academia (MMA), Hurler syndrome, nephropatic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stijve- Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), and Usher syndrome (USH1 ).
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows two bar graphs comparing the effect of 5-azacytidine, other nucleoside/nucleotide analogs (5-aza-2'-deoxycytidine to test the specificity of 5-azacytidine, 8- azaadenine, 6-azathymine, 6-azauracil) and positive controls (anisomycin, cycloheximide) on renilla β-globin NMD reporter (Fig. 1A) and on wildtype renilla β-globin reporter (Fig. 1 B) and two bar graphs depicting the response of 5-azacytidine treatment on renilla β-globin NMD reporter (Fig. 1 C) and on wildtype renilla β-globin reporter (Fig. 1 D) at given concentrations over time (from the left to the right: Ohr, 4hr, 8hr).
Figure 2 shows (A) a Northern blot analysis in stable HeLa cell lines expressing the wild type (W) and a mutant β-globin (NS39) (M) reporter after incubation with 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) and cycloheximide (Chx); (B) a bar graph depicting the percentage of upmodulation of normalized NMD reporter after incubation with the above com- pounds and (C) a bar graph depicting the effect of the above compounds on the expression level of premRNA of β-globin.
Figure 3 shows (A, B) two bar graphs depicting the effect of 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) on the expression level of various endo-NMD (from the left to the right: β-globin, SC35C, SC35D, ATF3, RPL3, SGK, C60RF, TIMP1 , SLC3A2, EPAS1 ) and non-NMD targets (from the left to the right: GAPDH, IVNS1 , CBFB, ACTG, ACTB); (C) a West- em blot analysis of DNMT1 and STAT3 antibodies used as a control; (D) a Western blot analysis of three NMD targets GADD45B, CHOP and SC35, and (E, F) two bar graphs depicting the percentage of upmodulation of SC35 and CHOP protein levels.
Figure 4 shows (A) a graph depicting the dose response curve of cytotoxicity (lower curve) and renilla β-globin reporter luciferase activity (upper curve) of 5-azacytidine (AC); (B) a bar graph depicting the amount of S35 methionine in radiolabelled S35 methionine cells after treatment with 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) and cycloheximide (CHX); (C) and (D) gel images of Coomassie staining used as loading control and of S35 labelled autoradiography respectively.
Figure 5 shows (A) a bar graph comparing the percentage of read-through after treatment with DMSO, of 5-azacytidine (AC) and Geneticin (G418); (B) and (C) a bar graph depicting the effect of 5-azacytidine (AC) and Geneticin (G418) on the expression level of various endo-NMD (from the left to the right: RPL3, SC35C, EPAS1 , TBL2, SGK, SC35D, ATF3, RPL13, SLC3A2,) and non-NMD targets (from the left to the right: SCWT, HPRT1 , ACTB, GAPDH, RPL32, CBFB) respectively.
Figure 6 shows a Western blot analysis of (A) NMD core factors (B) EJC complex and SMG proteins and (C) phospho UPF1 after cells incubation with 5-azacytidine (AC), anisomycin (Ani), 5-azadeoxycytidine (5ADC) and wortmannin (Wort). Figure 7 shows a graph depicting the dose response curve of the renilla β-globin luciferase activity for a set of compounds.
Figure 8 shows a graph depicting the dose response curve of the renilla β-globin luciferase activity for 5-azacytosine.
Figure 9 shows a qRT-PCR analysis of Calu-6 cells (carrying a homozygous PTC-mutation of the p53 gene) following treatment with either DMSO or increasing concentrations of 5- azacytidine for 18 hours. The fold change on the y-axis represents the relative quantification of PTC-mutated p53 transcript vs GAPDH mRNA, which is used as a normalization control. The signal detected in DMSO treated cells is set as 1. Data represents the mean ± SD of three independent experiments.
Figure 10 shows Figure 7 (A) Venn diagrams of the number of genes up/down-regulated upon 5-azacytidine treatment compared with DMSO or 5-azadeoxycytidine; (B). graphical representation of the reproducibility of the proteomics data. Average log2 values of 5-azacytidine vs 5- azadeoxycytidine were plotted against 5-azacytidine vs DMSO. The R-value of 0.7 shows a modest reproducibility of the values among biological replicates; and (C) graphical representation of Gene ontology studies performed on the proteins up-regulated or down-regulated more than 1.5 fold upon 5-azacytidine treatment.
Figure 1 1 shows (A) qRT-PCR analysis of dose dependent effect of 5-azacytidine on c-MYC, DNMT1 and 18s is shown. GAPDH mRNA is used for normalization. The error bars indicate the SD of at least 3 independent experiments; (B) Western blot of HeLa cells following treatment with either DMSO as a negative control, or different doses of 5-azacytidine (AC) (0.1 , 1 .5 and 5μΜ) for 18 hours and staining with antibodies that specifically detect c-MYC. Tubulin was used as a loading control. Three different volumes of DMSO treated lysates termed 100%, 200% and 300% were used for quantification; (C) upregulation of reporter luciferase activity following treatment with DMSO and AC or with SiLUC, SiUPF and siMYC or with combined treatments of siLUC, siUPF and siMYC with DMSO and AC. The x-axis shows the treatments used and the y- axix shows the fold changed of the normalized NMD reporter; (D).Western blot of HeLa cells following treatment with either siLUC as negative control or with siMYC. Tubulin was used as a loading control. Three different volumes of siLUC treated lysates termed 100%, 50%, 25% were used for quantification; and (E) qRT-PCR analysis of the endogenous NMD targets ATF3, SC35c, SC35d following treatment of HeLa cells with siLUC or siMYC combined with DMSO or 5-azacytidine. The fold change on the y-axis represents the relative quantification of transcripts vs GAPDH mRNA, which is used as a normalization control. The signal detected in si- LUC+DMSO treated cells is set as 1 . The data represent the mean ± SD of three independent experiments.
Figure 12 shows quantitation of dystrophin mRNA expression in drug treated mice. Groups of 3 male mice (C57BL/10ScSn-mdx/J) were treated with the indicated dose (5-azacytidine) by once daily inter peritoneal injection on days 1-5 and 8-12 and sacrificed on day 13. Total RNA was extracted from the calf muscle of the hind leg and reverse transcribed. qPCR was performed using dystrophin and GAPDH primers. The relative expression levels of dystrophin was normal- ised to GAPDH on a per mouse basis and then the relative level with respect to the wild type mice (C57BL) dystrophin expression calculated as fold down regulation.
DETAILED DESCRIPTION OF THE INVENTION
5-Azacytidine (also known as azacitidine or 4-amino-1-(P-D-ribofuranosyl)-1 ,3,5-triazin-2(1 -/)- one; Nation Service Center designation NSC-102816; CAS Registry Number 320-67-2) is the compound of formula (I):
Figure imgf000008_0001
Methods to synthesize 5-azacytidine are well known in the art, e.g. the methods described in
WO2004082618. These include methods which are amenable to large-scale synthesis and yield 5-azacytidine suitable for use in humans.
The term "pharmaceutically acceptable salt" refers to salts prepared from pharmaceutically ac- ceptable non-toxic acids. Suitable non-toxic acids for 5-azacytidine include, but are not limited to, inorganic and organic acids such as acetic, alginic, anthranilic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethenesulfonic, formic, fumaric, furoic, galacturonic, gluconic, glucuronic, glutamic, glycolic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, me- thanesulfonic, mucic, nitric, pamoic, pantothenic, phenylacetic, phosphoric, propionic, salicylic, stearic, succinic, sulfanilic, sulfuric, tartaric acid, and p-toluenesulfonic acid. Specific non-toxic acids include hydrochloric, hydrobromic, phosphoric, sulfuric, and methanesulfonic acids. Examples of specific salts thus include hydrochloride and mesylate salts. Other examples of salts are well known in the art, see, e.g., Remington's Pharmaceutical Sciences, 18th ed., Mack Publishing, Easton PA (1990).
The term "prodrug" refers to derivatives of 5-azacytidine which have chemically or metabolically cleavable groups and are converted, by solvolysis, autohydrolysis or under physiological conditions, into 5-azacytidine. A prodrug may be formed in a conventional manner with a functional group of 5-azacytidine such as with the amino group or a hydroxy group. The prodrug form of- ten offers advantages of solubility, tissue compatibility, or delayed release in a mammalian or- ganism (see, Bundgard, H ., Design of Prodrugs, pp. 7-9, 21 -24, Elsevier, Amsterdam 1985). Prodrugs of 5-azacytidine in particular include hydroxy derivatives well known to practitioners of the art, such as, for example, esters prepared by reaction of one or more hydroxy groups of the compound with a suitable acid and amino derivatives such as for example, amides prepared by reaction of the amino substituent with a suitable acid.
According to a particular embodiment of the invention, the prodrug is a 5-azacytidine ester.
The term "ester" refers to a group with the general structure -(C=0)-0- which results from the esterification of one or more hydroxy groups of 5-azacytidine with a suitable acid. Examples include amino acid esters and Ci-C6-alkyl esters of 5-azacytidine.
The term "C"rC6-alkyl ester" refers to a radical of the formula R-(C=0)-0-, wherein R is a straight-chain or branched alkyl group having from 1 to 6 carbon atoms. Examples include me- thyl, ethyl, propyl, iso-propyl, butyl, tert-butyl, pentyl, and hexyl.
The term "amino acid ester" refers to an ester resulting from the esterification of a hydroxy group of 5-azacytidine with an a-aminoacid. Examples include L-alanyl-O-, L-valyl-O-, L- isoleucyl-O-, and L-leucyl-O- esters of 5-azacytidine.
According to a further particular embodiment of the invention, the prodrug is a bisulfite adduct of formula (II) as disclosed in US440561 1 , the content of which is incorporated herein by reference:
Figure imgf000009_0001
According to a further particular embodiment of the invention, the prodrug is an amide derivative of formula (II I) as disclosed in WO 201 1 /012722, the content of which is incorporated herein by reference:
Figure imgf000010_0001
wherein
L is a non-biologically active linker containing
i) a moiety L1 represented by formula (IV),
Figure imgf000010_0002
(IV) wherein the dashed line indicates the attachment of L1 to the aromatic amino group of 5- azacytidine by forming an amide bond;
X1 is C(R R1a) or a cyclic fragment selected from C3-C7-cycloalkyl, 4 to 7 membered heterocy- clyl, phenyl, naphthyl, indenyl, indanyl, tetralinyl, or 9 to 1 1 membered heterobicyclyl, wherein in case X1 is a cyclic fragment, said cyclic fragment is incorporated into L1 via two adjacent ring atoms and the ring atom of X1, which is adjacent to the carbon atom of the amide bond, is also a carbon atom;
X2 is a chemical bond, -C(R3R3a), -N(R3), -0-, -C(R3R3a)-C(R4R4a), -C(R3R3a)-N(R4), -N(R3)- C(R4R4a), -C(R3R3a)-0, or -0-C(R3R3a), wherein in case X1 is a cyclic fragment, X2 is a chemical bond, -C(R3R3a), -N(R3), or -0-; optionally, in case X1 is a cyclic fragment and X2 is C(R3 3a), the order of the X1 fragment and the X2 fragment within L1 may be changed and the cyclic fragment is incorporated into L1 via two adjacent ring atoms; R1, R3 and R4 independently are H, C C -alkyl or -N(R5R5a);
R1a, R2, R3a, R4a and R5a independently are H or CrC4-alkyl;
R5 is -C(0)R6
R6 is Ci-C4-alkyl; optionally, one of the pairs R1a/R4a, R3a/R4a or R1a/R3a form a chemical bond; and ii) a moiety L2, which is a chemical bond or a spacer, and L2 is bound to a polymeric carrier group Z, wherein L1 is substituted with one to four L2 moieties, provided that the hydrogen marked with the asterisk in formula (IV) is not replaced by L2; optionally, L is further substituted.
According to a preferred particular embodiment, the non-biologically active linker L contains a moiety L1 represented by formula (IV) wherein,
X1 is -C(R1R1a), cyclohexyl, phenyl, pyridinyl, norbonenyl, furanyl, pyrrolyl or thienyl, wherein in case X1 is a cyclic fragment, said cyclic fragment is incorporated into L1 via two adjacent ring atoms;
X2 is a chemical bond, -C(R3R3a), -N(R3), -0-, or -C(R3R3a)-0, wherein, in case X1 is a cyclic fragment, X2 is a chemical bond, -C(R3R3a), -N(R3), -O- or - C(R3R3a)-C(R4R4a);
R1, R3 and R4 independently are H, C C -alkyl or -N(R5R5a); R1a, R2, R3a, R4a and R5a independently are H or C C4-alkyl; R2 is Ci-C4-alkyl; R5 is -C(0)R6 R6 is Ci-C4-alkyl.
The term, "non-biologically active linker" refers to a linker which does not show the pharmaco- logical effects of 5-azacytidine.
The term, "spacer" refers to a moiety present in the polymeric carrier of the invention suitable for connecting two moieties, such as Ci-C5o-alkyl, C2-C5o-alkenyl or C2-C5o-alkinyl, which fragment is optionally interrupted by one or more groups selected from -NH-, -N(CrC4-alkyl)-, -0-, -S-, - C(O)-, -C(0)NH-, -C(0)N(Ci-C4-alkyl)-, -O-C(O)-, -S(O)-, -S(0)2-, 4 to 7 membered heterocyclyl, phenyl or naphthyl.
The term, "interrupted" means that between two carbon atoms of the spacer or at the end of the carbon chain between the respective carbon atom and the hydrogen atom a group as defined above is inserted.
According to a further particular embodiment of the invention, the prodrug is a monophosphate derivative of formula (V) as disclosed in WO 201 1/153374, the content of which is incorporated herein by reference:
Figure imgf000012_0001
wherein R is H or -C02(Ci-C6-alkyl); and R1 is H or -C02(CrC6-alkyl). Preferably, the prodrug is a 5-azacytidine ester (e.g. acetyl-O-, isobutyryl-O-, pivaloyl-O, valeryl- O, hexanoyl-O-, L-valyl-O-, L-isoleucyl-O-) and specifically, an acetylated 5-azacytidine.
5-Azacytidine, the pharmaceutically acceptable salts or the prodrugs thereof can be provided in crystalline or in amorphous form.
According to a particular embodiment of the invention, the crystalline form of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof is a solvate. The term "solvate" means a crystalline form of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof, which further includes a stoichiometric or non-stoichiometric amount of a pharmaceutically acceptable solvent bound by non-covalent intermolecular forces.
Preferably, the pharmaceutically acceptable solvent is water and thus the solvate is a hydrate.
Crystalline 5-azacytidine can further be provided in the form of a number of polymorphic forms such as those described in EP-A-0225871 1. Polymorphic forms l-VIII disclosed in EP-A- 0225871 1 are incorporated herein by reference. The term "polymorphic form" is meant to include pseudopolymorphic forms (i.e. solvates such as hydrates).
Polymorphic form I is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 1 of EP-A- 0225871 1. Polymorphic form II is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 2 of EP- A-0225871 1.
Polymorphic form III is characterized by the X-Ray Powder Diffraction (XRPD) pattern compris- ing the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 3 of EP- A-0225871 1.
Polymorphic form IV is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 4 of EP- A-0225871 1. Polymorphic form V is characterized by the X- ay Powder Diffraction (XRPD) pattern comprising the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 5 of EP- A-0225871 1. Polymorphic form VI is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 6 of EP- A-0225871 1.
Polymorphic form VII is characterized by the X-Ray Powder Diffraction (XRPD) pattern compris- ing the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 7 of EP- A-0225871 1.
Polymorphic form VIII is characterized by the X-Ray Powder Diffraction (XRPD) pattern comprising the most prominent 2Θ angles, d-spacing and relative intensities as depicted in Fig. 8 of EP-A-0225871 1.
NMD has been demonstrated to have an effect on the clinical phenotype of various diseases. Modulation of NMD (via inhibition or augmentation) would therefore offer potential therapeutic strategies.
The term, "modulation of NMD" refers to the regulation of gene expression by altering the level of nonsense suppression. For example, if it is desirable to increase production of a defective protein encoded by a gene with a premature stop codon, i.e., to permit read-through of the premature stop codon of the disease gene so that translation of the gene occurs, then modula- tion of premature translation termination and/or nonsense-mediated mRNA decay entails up- regulation of nonsense suppression.
The term, "nonsense suppression" refers to the inhibition or suppression of premature translation termination and/or nonsense-mediated mRNA decay.
The present invention is based on the finding that 5-azacytidine inhibits NMD.
The invention thus relates to the use of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof in methods for treating or preventing a disease responsive to inhibition of non- sense-mediated mRNA decay. In a particular embodiment of the invention, a disease responsive to inhibition of nonsense- mediated mRNA decay is a disease associated with a mutant gene containing a nonsense mutation. In another embodiment the disease is associated with a mutant gene containing a frameshift mutation that generates a premature-termination codon.
The term, "nonsense-mediated mRNA decay" refers to any mechanism that mediates the decay of mRNAs containing a premature translation termination codon.
The term, "premature translation termination" refers to the result of a mutation that changes a codon corresponding to an amino acid to a stop codon and the term, "premature termination codon" or "premature stop codon" refers to the occurrence of a stop codon where a codon corresponding to an amino acid should be. A PTC can also represent a physiological stop codon recognized by the cellular machinery as "premature" and therefore subjecting a physiological mRNA to degradation by the NMD machinery (endoNMD target).
The term, "frameshift" refers to a genetic mutation caused by a deletion or insertion in a DNA sequence that shifts the way the sequence is read.
The term, a "nonsense mutation" is a point mutation changing a codon corresponding to an amino acid to a stop codon.
The term, "NMD inhibition" refers to a decrease in activity of NMD in a cell and to a decrease in the destruction of defective mRNA by any measurable amount, as compared to such cell in absence of inhibition. NMD inhibition can be achieved in various ways, e.g. by blocking function of protein components of NMD pathway, by inhibiting translation, or by allowing the translation machine to by-pass the premature termination codon ("translational bypass therapy (TBT)" or "read-through"). See, for instance, Bashyam, Recent Patents on DNA & Gene Sequences 2009, 3, 7-15.
For instance, it has been reported that down-regulation of UPF1 can be achieved with an indole derivative. The compound inhibits NMD by inducing the loss of interactions between hUPF1 and hSMG5 and the stabilization of the hyperphosphorylated isoforms of hUPF1 (Durand et al., J. Cell Biol. 178: 1 145-1 160 (2007)). Evidence suggests that NMD worsens the phenotype of many genetic diseases caused by nonsense and frameshift mutations. Thus, inhibition of NMD by 5-azacytidine will have beneficial effects, also if not limited, on such diseases. Thus, the term "disease responsive to inhibition of nonsense-mediated mRNA decay" is meant to denote a disease wherein the inhibition of NMD results in a reduction of the disease phenotype. These include in particular diseases wherein the disease phenotype is associated with aberrant gene expression due to one or more than one premature termination codon and the inhibition of NMD at least partially restores gene expression by increasing the expression of an at least partially functional protein. Patients having such disease phenotype can be diagnosed using routine methods as carrying mutations such as nonsense mutation that create premature termination codons.
More than 98% of Duchenne muscular dystrophy (DMD) mutations result in the premature ter- mination of the dystrophin open reading frame at various points over its 1 1 -kb length. Despite this wide variation in coding potential (0%-98.6% of the full-length protein), the truncating mutations are associated with a surprisingly uniform severity of phenotype. This uniformity is probably attributable to ablation of the message by nonsense-mediated decay (NMD). The rare truncating mutations that occur near the 3' end of the dystrophin gene can however result in ex- tremely various phenotypes. It has been suggested that most proteins encoded by such mutant genes are capable in principle of rescuing the DMD phenotype but that NMD abrogates the opportunity to effect this rescue. Beyond some threshold point, C-terminal sequence might be lost with only mild functional consequences, leading for example to the milder BMD (Becker muscular dystrophy) phenotype. Disruption of NMD has been suggested to afford a route for therapy in the NMD individuals with C-terminal mutations (see, e.g., Bhuvanagiri et al., Biochem. J. 430:365-377 (2010); Kerr et al., Hum. Genet. 109:402-407 (2001 ). Moreover, in a mouse model for Duchenne muscular dystrophy, gentamycin sulfate was found to suppress translational termination at premature stop codons in the dystrophin gene. Aminoglycoside antibiotics mediated misreading and insertion of alternative amino acids at the site of the premature stop codon. Dystrophin function to skeletal muscles of mdx mice was restored (see, e.g., Barton-Davis et al., J. Clin. Invest. 104: 375-381 (1999)). It has also been demonstrated that Amlexanox inhibits NMD and stabilizes dystrophin mRNA. Furthermore, it has been shown that the combination of Amlexanox and PTC124 is more efficient than each molecule alone (see, e.g., Gonzales- Hilarion et al., Orphanet Journal of Rare Diseases 7:58, 1-14 (2012)).
Ulrich's disease is an autosomal recessive congenital muscular dystrophy characterized by proximal joint contractures, striking distant hyperextensibility, and normal intelligence. In a study on Ulrich's disease, it has been demonstrated that the pharmacological inhibition of NMD by wortmannin or caffeine, inhibitors of SMG-1 , up-regulated the PTC-containing COL oc2 (VI) mRNA and protein. Further, it has been found that this protein was incorporated into the triple- helical collagen VI with wild-type a1 and a3 chains, secreted, and integrated into the extracellu- lar matrix (ECM) in the fibroblasts obtained from a patient with Ulrich's disease. This raised the intriguing possibility that the selective inhibition of NMD can rescue the mutant phenotypes exacerbated by NMD and that the inhibition of NMD may provide a novel therapeutic strategy for certain genetic diseases. In a further study the effect of NMD inhibition by siRNA-mediated knockdown of SMG-1 or UPF1 (essential proteins for NMD) on the phenotype of Ulrich's dis- ease was assessed. Inhibition of NMD cause the up-regulation of the mutant triple-helical collagen VI, resulting in the formation of partially functional extracellular matrix. The results indicate that the specific inhibition of NMD has the potential to rescue the mutant phenotype (see, e.g., Usuki et al., Molecular Therapy 14: 351 -360 (2006)). Merosin-deficient congenital muscular dystrophy type 1A (MDC1A) is the most common form of congenital muscular dystrophy. MDC1A is caused by mutation of the laminin alpha-2 gene (LAMA2). 20-30% of mutations are nonsense mutations. Treatment with gentamicin and negamycin promotes significant read-through. It was also demonstrated that the mutant mRNAs were strongly stabilized in patient-derived myotubes after administration of negamycin (see, e.g., Allamand et al., J. Gene Med. 10(2): 217-224 (2008)).
Mutations that result in the loss of the protein dysferlin result in defective muscle membrane repair and cause either a form of limb girdle muscular dystrophy (type 2B) or Miyoshi myopathy. It has been demonstrated that the nonsense suppression drug, ataluren (PTC124), is able to induce read-through of the premature stop codon in a patient with a R1905X mutation in dysferlin and produce sufficient functional dysferlin (approximately 15% of normal levels) to rescue myotube membrane blebbing (Wang et al., J. Appl. Phisiol. 109(3): 901 -905 (2010)).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of muscular dystrophy such as Duchenne muscular dystrophy, Becker muscular dystrophy, Ulrich disease, congenital muscular dystrophy type 1A, and limb girdle muscular dystrophy. Thus, in a particular embodiment, the invention relates to treating or preventing muscular dystrophy such as Duchenne muscular dystrophy, Becker muscular dystrophy, Ulrich's disease, congenital muscular dystrophy type 1 A, and limb girdle muscular dystrophy.
In cultured cells having premature stop codons in the cystic fibrosis trans-membrane conductance regulator (CFTR) gene, synthesis of full length CTFR was observed when the cells were treated with aminoglycosides (see, e.g., Bedwell et al., Nat. Med. 3:1280-1284 (1997); Howard et al., Nat. Med. 2:467-469 (1996)). Clinical trials in patients with cystic fibrosis (CF) were performed with gentamicin. These trials showed that aminoglycosides can promote in vivo read- through of nonsense mutations and can lead to the expression of full length proteins and/or the correction of protein function (see, e.g., Linde et al., The Journal of Clinical Investigation 1 17:683-692 (2007); Wilschanski et al., Am. J. Respir. Crit. Care Med. 161 :860-865 (2000)). It has been reported that NMD pathway reduces the efficiency of suppression therapy because it depletes the pool of PTC-containing transcripts available for translation and subsequent PTC suppression. A recent study reported that cystic fibrosis patients who responded most robustly to suppression therapy generally had a higher level of residual PTC-containing CFTR mRNA. In addition, when RNA silencing was used to reduce the abundance of several NMD factors in order to moderate NMD efficiency, the level of functional CFTR protein restored by suppression therapy was significantly increased (see, e.g., Keeling et al., Wiley Interdisciplinary Reviews: RNA, 2:837-852 (201 1 )). It has also been demonstrated that Amlexanox inhibits NMD and stabi- lizes CFTR mRNA. Furthermore, it has been shown that the combination of Amlexanox and PTC124 is more efficient than each molecule alone (see, e.g., Gonzales-Hilarion et al., Orphan- et Journal of Rare Diseases 7:58, 1 -14 (2012)).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of cystic fibrosis. Thus, in a particular embodiment, the invention relates to treating or preventing cystic fibrosis.
Hurler syndrome also known as mucopolysaccharidosis I (MPS I) is the most severe form of a lysosomal storage disease caused by loss of the enzyme a-l-iduronidase (encoded by the IDUA gene), which participates in the degradation of glycosaminoglycans (GAGs) within the lyso- some. In some populations, premature stop mutations represent roughly two-thirds of the mutations that cause Hurler syndrome. It has been shown that aminoglycoside treatment induced PTC suppression and resulted in functional improvements. It has been found that a Hurler syndrome fibroblast cell line heterozygous for the IDUA stop mutations Q70X and W402X showed a significant increase in a-l-iduronidase activity when cultured in the presence of gentamicin, resulting in the restoration of 2.8% of normal α-Ι-iduronidase activity. Determination of a-l- iduronidase protein levels by an immunoquantification assay indicated that gentamicin treatment produced a similar increase in α-Ι-iduronidase protein in Hurler cells. Both the a-l- iduronidase activity and protein level resulting from this treatment have previously been corre- lated with mild Hurler phenotypes (see, e.g., Keeling et al., Hum. Mol. Genet., 10:291 -299 (2001 ); Wang, Ph.D., The University of Alabama at Birmingham, (2012) (abstract)). For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of Hurler syndrome. Thus, in a particular embodiment, the invention relates to treating or preventing Hurler syndrome. The potential influence of NMD on cancer has previously been suggested by a study of patients with hereditary diffuse gastric cancer (HDGC; see, e.g., Karam et al., Oncogene 27:4255-4260 (2008)). Patients with germline mutations of the CHD1 (cadherin-1 ) gene (CDH1-PTCs) that were predicted to be NMD-competent showed an earlier age-of-onset of gastric cancer when compared to those patients who carried PTC mutations that were predicted to be NMD- insensitive. These data thus indicated that the elimination of CDH1 mRNA with C-terminally truncated open reading frames by NMD has an unfavorable effect on the clinical progression of HDGC (see, e.g., Bhuvanagiri et al., Biochem. J. 430:365-377 (2010)).
Further, in a number of human cancers, the tumor suppressor gene p53 is mutated (see, for instance, the HDQ-P1 cell line, a human primary breast carcinoma cell line (Wang CS, et al., Cancer Genet. Cytogenet. 2000; 120: 58-72) and Calu-6 cell line, an adenocarcinoma cell line (Lehman et al., Cancer Res 1991 ;51 :4090-4096)). 8% of all the mutations identified are nonsense mutations, leading to the absence of functional p53. It has been demonstrated that G418 (Geneticin) inhibits the NMD pathway and leads to enhanced read-through. This is evident from the production of increased amount of truncated p53 as well as full-length p53. For certain PTC- mutations of p53 a high level read-through even in the absence of a read-through enhancer has been shown (see, e.g., Floquet et al., Nucleic Acids Research 39:3350-3362 (201 1 ); Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012) and the references cited therein). It has also been demonstrated that Amlexanox inhibits NMD and stabilizes p53 mRNA. Furthermore, it has been shown that the combination of Amlexanox and PTC124 is more efficient than each molecule alone (see, e.g., Gonzales-Hilarion et al., Orphanet Journal of Rare Diseases 7:58, 1-14 (2012)). Li-Fraumeni syndrome (LFS is an autosomal inherited cancer predisposition syndrome, clinically defined by the occurrence of familial sarcoma and characterized by a cluster of early onset cancers (before 45 years), including brain cancer, adrenal cortical carcinoma, and breast cancer. Germline p53 mutations have been detected in approximately 80% of families that comply with LFS criteria, and p53 is the only gene found to be associated with this syndrome. Most mutations described are missense (>72%), approximately 14-16% are frameshift and splice-site, and about 7% are nonsense. Moreover, in some forms of colorectal cancer and familial adenomatous polyposis, the APC gene contains nonsense mutations and the use of read-through enhancers has been demonstrated to be effective (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012) and the references cited therein). FAP is an autosomal dominant disorder that accounts for less than 1 % of all cases of colorectal cancer (CRC). It is characterized by the development of hundreds to thousands of adenomatous polyps during the second and third decades of life, with a lifetime risk of developing CRC of nearly 100%. The adenomatous polyposis coli (APC) gene is affected in more than 90% of patients, mostly by nonsense (30%) or frameshift mutations (68%) that generate truncated pro- teins. Missense mutations have also been described as predisposing to development of colorectal tumors. Attenuated adenomatous polyposis coli (AAPC) is characterized by the occurrence of fewer than 100 colonic adenomas, a milder colorectal phenotype with later onset of colorectal cancer (after 40 years of age), and characteristic mutations in the 50 and 30 ends of the APC gene. Hereditary non-polyposis colorectal cancer (HNPCC) is an autosomal dominant disorder characterized by a limited number of adenomas, early onset of CRC (before 50 years), and the development of extra-colonic cancers: gastric, endometrial, ovarian, renal, and hepatobiliary. HNPCC is associated with DNA microsatellite instability (MSI) due to mutations in the MMR genes. 50% of these mutations occur in MLH1 , 40% in MSH2, and 10% in all the other genes described to be affected in this syndrome: MSH6, PMS2, PMS1 , and MLH3 [18]. Accord- ing to the HGMD, nonsense, splice-site, and small frameshift mutations that potentially create PTCs constitute at least 55% of all mutations occurring in MLH1 , 51 % in MSH2, 64% in MSH6, and 43% in PMS2. Although deletions (small and large) are overall the most frequent alterations, of all mutations described for each of these genes missense mutations make up from 15- 30% while nonsense mutations constitute about 10% (http:// www.hgmd.org). Very few muta- tions have been described for the PMS1 and MLH3 genes (http://www.hgmd.org). Cowden Syndrome (CS) is a rare autosomal dominant inherited cancer syndrome, characterized by a high risk of developing carcinomas and hamartomas of the breast, thyroid, and endometrium. It is associated with PTEN mutations in 85% of cases. PTEN germline mutations have been described in CS families with the frequencies of 20% missense, 20% insertions, 13% deletions, 10% splice-site, 3% referred to as deletion/insertion mutation, and 33% nonsense. Peutz- Jeghers syndrome (PJS) is an autosomal dominant disorder associated with a 30-50% increased risk of developing breast cancer, as well as increased risk of other cancer types such as gastric, colon, or pancreatic. PJS is associated with mutations in STK1 1/LKB1 , a gene encoding serine/threonine kinase 1 1 , which is a master regulator of AMPK and the AMPKrelated kinases. STK1 1 mutations have been described in 69% of PJS probands, from which 27% were missense, 27% insertions, 18% deletions, 5% affected a splice-site, and 18% were nonsense. Approximately 5% of all cases of breast cancer are associated with a hereditary cancer susceptibility syndrome with early onset (before 50 years) and are caused by mutations in high penetrance susceptibility genes, most involved in DNA repair (familial breast-ovarian cancer; BROVCA). Nearly 16% of hereditary breast cancers are associated with germline mutations in either of the BRCA (breast cancer 1 and 2) genes. One defective copy of BRCA1 or BRCA2 in the germline is sufficient for cancer predisposition, although the loss of the second allele is re- quired for cancer development. Germline BRCA mutations are associated with a 50-80% risk of breast cancer, a 60% risk of contralateral breast cancer, and a 15-25% risk of ovarian cancer. Most BRCA1 (70%) and BRCA2 (90%) mutations are truncating, namely small insertions and deletions, nonsense substitutions, and splice-site mutations. Although rare, the contribution of missense mutations to breast cancer predisposition has also been demonstrated. Variable mutation frequencies have been described in BROVCA families, depending on the population studies, but the most frequent are frameshift mutations, 43-61%, whereas splice-site and missense mutations are less frequent. Nonsense mutations account for 14-25% of the genetic changes observed. In fact, most mutations underlying cancer syndromes, as for many other inherited disorders, generate PTCs. Approximately 10-30% of all patients suffering from inherited cancer carry nonsense mutations, (for all this, see, for instance, (Renata Bordeira-Carrico, Trends in Molecular Medicine November 2012, Vol. 18, No. 1 1 ; and the corresponding citations therein).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of cancer, in particular HDGC (hereditary diffuse gastric cancer) and cancer associated with a mutation of the p53 gene (e.g. Li-Fraumeni Syndrome, human breast cancer) or a mutation of the APC gene (e.g. colorectal cancer and familial adenomatous polyposis). Thus, in a particular embodiment, the invention relates to treating or preventing HDGC, cancer associated with a mutation of the p53 gene, and cancer associated with a mutation of the APC gene. In a further particular embodiment, the invention relates to treating or preventing further cancer that are associated with nonsense muatations that create premature termination codons, such as hereditary non-polyposis colorectal cancer (HNPCC), Cowden Syndrome (CS), Peutz- Jeghers syndrome (PJS), familial breast-ovarian cancer (BROVCA) Classical late infantile neuronal ceroid lipofuscinosis (LINCL) is a fatal childhood neurodegenerative disease with currently no effective treatment. Premature stop codon mutations in the gene CLN2 encoding the lysosomal tripeptidyl-peptidase 1 (TPP-I) are associated with disease in approximately half of children diagnosed with LINCL. The ability of the aminoglycoside gentami- cin to restore TPP-I activity in LINCL cell lines has been examined. In one patient-derived cell line that was compound heterozygous for a commonly seen nonsense mutation (Arg208Stop) and a different rare nonsense mutation, approximately 7% of normal levels of TPP-I were maximally restored with gentamicin treatment. These results suggest that pharmacological suppression of nonsense mutations by aminoglycosides or functionally similar pharmaceuticals may have therapeutic potential in LINCL (Sleat et. al., Eur. J. Ped. Neurol. 5:Suppl A 57-62 (2001 )).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of late infantile neuronal ceroid lipofuscinosis (LINCL). Thus, in a particular embodiment, the invention relates to treating or preventing LINCL. Spinal muscular atrophy (SMA) is a leading genetic cause of death in infants. It is a progressive disease of muscle weakness/atrophy and degeneration/loss of the anterior horn cells (AHC) in the spinal cord and brain stem nuclei, with four types of clinical severity, including Werdning- Hoffmann disease (SMA type I), Dubowitz disease (SMA type II), and Kugelberg-Welander disease (SMA type III). Two survival motor neuron (SMN) genes are associated with SMA, SMN1 and SMN2. Treatment with G418 causes read-through and leads to elevated SMN levels (Hui- Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012) and the references cited therein).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of spinal muscular atrophy (SMA). Thus, in a particular embodiment, the invention relates to treating or preventing SMA. Ataxia telangiectasia (A-T) is autosomal recessive genetic disorder caused by mutations in the ataxia telangiectasia mutated (ATM) gene. Most of the mutations determined in A-T patients are truncating mutations created by primary premature termination codons or secondarily by deletions, insertion or splicing mutations that lead to frameshift. A library of compounds was screened and 12 low-molecular-mass non-aminoglycosides with potential PTC-read-through activity were identified. From these, two leading compounds consistently induced functional ATM protein in ATM-deficient cells containing disease-causing nonsense mutations, as demonstrated by direct measurement of ATM protein, restored ATM kinase activity, and colony survival assays for cellular radiosensitivity (Du et. al., J. Exp. Med. 206(10): 2285-97 (2009)). For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of Ataxia telangiectasia (A-T). Thus, in a particular embodiment, the invention relates to treating or preventing A-T.
Beta-thalassemia is a blood disorder that reduces the production of hemoglobin. In β°39- thalassemia stop codon mutations lead to premature translation termination and to mRNA de- stabilization through nonsense-mediated decay. The production of β-globin by K562 cell clones expressing the 3°39-thalassemia globin gene has been demonstrated upon treatment with G418. Moreover, erythroid precursor cells from 3°39-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. (Salvatori et al., Am. J. Hematol., 84 (1 1 ): 720-8 (2009). For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of 3°39-thalassemia. Thus, in a particular embodiment, the invention relates to treating or preventing 3°39-thalassemia. Methylmalonic acidemia (MMA) is a progressive autosomal recessive metabolic disorder wherein the body is unable to breakdown certain proteins, lipids and cholesterol properly. Approximately 60% of the cases are caused by mutations in the methylmalonyl-CoA mutase (MUT) gene. Of all the mutations documented for MUT about 14 % is caused by nonsense mutations. Another prevalent gene is the methylmalonic aciduria cbIA type (MMAA) gene and 38% of mu- tations reported for MMAA are nonsense mutations. To test the suppression of nonsense mutations, the effect of different compounds was studied. It was determined that treatment of the cells with gentamicin resulted in a 1.6-fold increase in reporter protein, whilst G418 treatment resulted in no change. It was further found that the two drugs together acted synergistically to increase the production of methylmalonyl-CoA mutase 2.0-fold. This study demonstrated the use of stop codon read-through drugs for the potential treatment of methylmalonic aciduria (Hui- Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012); Buck et. al., Mol. Genet. Metab. 97(4): 244-9 (2009)).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of methylmalonic acidemia (MMA). Thus, in a particular embodiment, the invention relates to treating or preventing MMA.
Response to drugs able to promote read-through has been further shown in a number of further diseases and disease models (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)):
Nephropatic cystinosis is caused by a premature termination codon in the cystinosin (CTNS) gene. Infants affected by this disease initially exhibit poor growth. It has been demonstrated that gentamicin leads to read-through (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
Obesity may be caused by a defect in the melanocortin 4 receptor (MC4R). Rescue of such nonsense mutations may be achieved by read-through treatment with aminoglycosides such as gentamicin and G418 (Brumm et al., 20(5): 1074-81 Obesity (2012)).
Peroxisome biogenesis disorders (PBDs) are multisystemic autosomal recessive disorders resulting from mutations in a gene coding a peroxin protein (PEX) required for normal peroxisome assembly and metabolic activities. Treatment with G418 leads to improvements in peroxisomal lipid catabolic and anabolic activities (Dranchak et al. J. Cell Biochem. 1 12(5): 1250-8 (201 1 )).
Renal tubular acidosis (RTA) is a medical condition that involves an accumulation of acid in the body. It is caused by a nonsense mutation in the SCL4A4 gene encoding the electrogenic sodium bicarbonate cotransporter NBCe1 -A. G418 treatment induced read-through and increased the Na(+)- and HCO(3)(-)- dependent transport to a level that did not differ from wild-type NBCe1-A function (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
Retinitis pigmentosa (RP) is a disease resulting from premature termination codon (PCT) mutations causing retinal degeneration. Treatment with gentamicin revealed an increase in read- through and enhanced photoreceptor survival (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
Rett syndrome (RTT) is a neurodevelopment disorder of the grey matter of the brain. In about 35% of the cases it is caused by nonsense mutations in the MECP2 gene. Gentamicin and G418 induce read-through and lead to the production of protein similar to the wild type. Furthermore, a mouse model was generated carrying the R168X mutation in the MECP2 gene. Transfected HeLa cells expressing mutated MECP2 fusion proteins and mouse ear fibroblasts isolated from the new mouse model were treated with gentamicin and the novel aminoglycosides NB30, NB54, and NB84. It was demonstrated that read-through of nonsense mutations can be achieved not only in transfected HeLa cells but also in fibroblasts of the newly generated MECP2(R168X) mouse model (Brendel et al., J. Mol. Med 89: 389-398 (201 1 )).
The Stuve-Wiedemann syndrome (SMS) is a rare abnormality that belongs to the group of bent- bone dysplasias. It is caused by a mutation in the leukemia inhibitory factor receptor (LIFR). Gentamicin partially restores the synthesis of functional LIFR (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)).
X-linked nephrogenic diabetes insipidus (XNDI) is characterized by inability to concentrate the urine. It is caused by nonsense mutations in the AVPR2 gene. It has been demonstrated that treatment with read-through drugs such as gentamicin, paromomycin, G418 rescues partially AVPR2 function in vivo (Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)). Usher syndrome (USH1 ) is the most common form of combined congenital deaf-blindness. It is caused by a nonsense mutation in the USH1 C gene, which leads to the generation of a stop signal in a DNA base, resulting in premature termination of protein synthesis. It has been demonstrated that the drugs paromomycin, gentamicin, NB30, NB54 and PTC124 (Ataluren) induce a read-through and lead to the production of functional full-length protein (Nudelman et al., J. Med. Chem. 52: 2836-2845 (2009)).
Hemophilia is a group of X-linked recessive bleeding disorders that slow the coagulation process. Two separate gene mutation databases reported that approximately 9%-10% of HA and about 8%-9% of HB is caused by nonsense mutations. HB is caused by the deficiency of the coagulation factor IX protein encoded by the F9 gene. Treatment with geneticin elicited a multi- day response and residual F9 antigen was detected after 3 weeks (Yang et. al., PNAS 104: 15394-15399 (2007)). Hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A) results in impaired hepatic long- chain fatty acid oxidation and ketogenesis. Treatment of CPT1 A deficient patient fibroblasts with PTC124 was capable of inducing nonsense suppression to produce detectable full-length CPT1A proteins (Wang et al., J. Inherit. Metab. Dis. 34(2): 443-447 (201 1 )). Bone morphogenetic protein receptor type 2 (BMPR2) gene mutations are a major risk factor for heritable pulmonary arterial hypertension (HPAH), an autosomal dominant fatal disease. It has been shown that BMPR2 transcripts that contain premature termination codon (PTC) mutations are rapidly and nearly completely degraded through nonsense-mediated decay (NMD). Treatment of the patient-derived cultured lymphocytes (CLs) containing the PTC with an aminoglyco- side decreased the truncated protein levels, with a reciprocal increase in full-length BMPR2 protein and, importantly, BMPR-II signaling (Hamid et al., Clinical Genetics 77: 280-286 (2010)).
Leukocyte adhesion deficiency I (LAD1 ) is an inherited disorder of neutrophil function. A premature termination codon, C562T (R188X), in exon 6 of the CD18 gene that caused a severe LAD1 phenotype was found in two unrelated patients. Treatment in vivo and in vitro with gentamicin resulted in the expression of a corrected full-length dysfunctional or mislocalized CD18 protein (Simon et al., PLoS One 5(1 1 ): e13659 (2010)).
Autosomal dominant polycystic kidney disease (ADOKD) is the most common hereditary renal disorder. It has been demonstrated that aminoglycoside antibiotics such as gentamicin are able to increase the level of functional polycystin 2 (PC2). Nonsense mutations in coagulation factor (F) VII potentially cause a lethal hemorrhagic diathesis. K316X and W364X FVII mutations, associated with intracranial hemorrhage, and their correction by aminoglycosides was investigated. Even tiny increases in the amount of functional protein in patients could ameliorate hemorrhagic phenotypes. In cells treated with aminoglyco- sides an increase in FVII activity was detected (Pinotti et al., J. of Thrombosis and Haemosta- sis, 4:1308-1314 (2006)).
Familial atrial fibrillation is a rhythm disorder characterized by chaotic electrical activity of cardiac atria. Predisposing to stroke and heart failure, this common condition is increasingly recog- nized as a heritable disorder. Genomic DNA scanning revealed a nonsense mutation in KCNA5 that encodes Kv1.5, a voltage-gated potassium channel expressed in human atria. The heterozygous E375X mutation, present in a familial case of atrial fibrillation introduced a premature stop codon disrupting the Kv1.5 channel protein. Rescue of the genetic defect was achieved by aminoglycoside-induced translational read-through of the E375X premature stop codon, restor- ing channel function (Olson et al., Hum. Mol. Genet. 15(14): 2185-91 (2006)).
For all this, it is plausible that inhibition of NMD can be used in a method for the treatment or prevention of nephropatic cystinosis, obesity, peroxisome biogenesis disorders, renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), Stuve-Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), Usher syndrome (USH1 ), limb girdle muscular dystrophy (type 2B), Miyoshi myopathy, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), leukocyte adhesion deficiency I (LAD1 ), autosomal dominant polycystic kidney disease (ADOKD), factor VII deficiency, familial atrial fibrillation. Thus, in a particular embodiment, the invention also re- lates to treating or preventing nephropatic cystinosis, obesity, peroxisome biogenesis disorders, renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), Stuve- Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), Usher syndrome (USH1 ), limb girdle muscular dystrophy (type 2B), Miyoshi myopathy, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), leukocyte adhesion deficiency I (LAD1 ), autosomal dominant polycystic kidney disease (ADOKD), factor VII deficiency and familial atrial fibrillation.
The present invention is, in particular, concerned with treating or preventing the diseases disclosed herein wherein the disease is associated with a mutant gene containing a mutation se- lected from the group consisting of the mutations disclosed in table 1 of Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012), the content of which is incorporated herein by reference. In one embodiment of the invention, inhibition of NMD, thereby increasing the amount of protein generated from otherwise NMD-susceptible mRNA, is therapeutically sufficient for the prevention or treatment of the disease. In other embodiments of the invention, it is therapeutically ex- pedient for the prevention or treatment of the disease to use a combination therapy comprising both NMD inhibition and suppressing nonsense codon recognition, e.g. by the use of a read- through enhancer. Combinations of NMD inhibitors and read-through enhancer have proven to more effective than either agent alone (see, e.g. Martin et al., Cancer research, published online on March 24, 2014 under doi:10.1158/0008-5472.CAN-13-2235). Non-limiting examples of compounds capable of suppressing nonsense codon recognition are embodied by certain aminoglycoside antibiotics (e.g. gentamicin) and analogs thereof (e.g. chemical compounds such as those depicted in Fig. 2 of Hui-Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012), all of which are incorporated herein by reference) or the experimental agent PTC124 (3-[5-(2-fluorophenyl)-1 ,2,4-oxadiazol-3-yl]benzoic acid; Ataluren™) and further non- aminoglycoside compounds (e.g. chemical compounds such as those depicted in Fig. 3 of Hui- Ling Rose Lee et. al., Pharmacology & Therapeutics 136: 227-266 (2012)), all of which are incorporated herein by reference).
Examples of aminoglycoside antibiotics and analogs thereof are gentamicin derivatives of for- mula,
Figure imgf000027_0001
wherein R-i and R2 are both methyl or hydrogen, or R-i is methyl and R2 is hydrogen;
Further examples are neomycin, tobramycin, paromomycin, amikacin, geneticin (G418), neomycin class ("TC" derivates) of formula
Figure imgf000028_0001
Figure imgf000029_0001
TC001 TC003 TC007
Figure imgf000029_0002
C) Kanamycin B class ("JL" derivatives). D) Paromomycin derivatives: NB30, NB54, NB74, and NB84. Examples of non-aminoglycoside compounds are negamycin, acetylamino benzoic acids (e.g. 3-[2-(4-isopropyl-3-methyl-phenoxy)-acetylamino]-benzoic acid, 3-[2-(4-tert-butyl-phenoxy)- acetylamino]-benzoic acid, and 3-{2-[4-(1 ,1-dimethyl-propyl)-phenoxy]acetylamino}-benzoic acid), clitocine; macrolides (e.g. erythromycin, oleandomycin, tylosin, spiramycin, and josamycin) and readthrough compounds (RTCs), e.g. RTC#13 and RTC#14,
Figure imgf000030_0001
These compounds cause ribosome read-through at the site of the nonsense stop codon in defective RNA, but are themselves either ineffective or inconsistently effective for treatment of diseases responsive to inhibition of nonsense-mediated mRNA decay due to the efficient NMD- mediated destruction of defective RNA in at least a large subset of NAD-relevant cells. Readthrough drugs do not protect mRNAs from NMD. However, if NMD-mediated destruction of defective RNA is rendered inefficient (e.g. by down-regulation of NMD), read-through-enhancing drugs cause synthesis of full-length protein. For example, it has been shown that when used in cells with PTC mutated p53, pharmacological NMD inhibition combined with a PTC "readthrough" drug led to restoration of full-length p53 protein, upregulation of p53 downstream transcripts, and cell death (see Martin et al., supra).
The term "readthrough enhancer" refers to a compound that increases the by-passing of the premature termination codon resulting in an increased production of full length protein.
Thus, the present invention also provides:
i) a combination comprising 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof with one or more read-through enhancers;
ii) a pharmaceutical composition comprising a combination product as defined in i) above and at least one carrier, diluent or excipient;
iii) the use of a combination as defined in i) above in the manufacture of a medicament for treating or preventing a disease as defined herein;
iv) a combination as defined in i) above for use in treating or preventing a disease as defined herein;
v) a kit-of-parts for use in the treatment of a disease as defined herein, comprising a first dosage form comprising 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof and one or more further dosage forms each comprising one or more read-through enhancers for combined therapeutic administration,
vi) a combination as defined in i) above for use in therapy; vii) a method of treatment or prevention of a disease as defined herein comprising administering an effective amount of a combination as defined in i) above;
viii) a combination as defined in i) above for treating or preventing a disease as defined herein. The combination therapies of the invention may be administered adjunctively. By adjunctive administration is meant the coterminous or overlapping administration of each of the components in the form of separate pharmaceutical compositions or devices. This regime of therapeutic administration of two or more therapeutic agents is referred to generally by those skilled in the art and herein as adjunctive therapeutic administration; it is also known as add-on therapeu- tic administration. Any and all treatment regimes in which a patient receives separate but coterminous or overlapping therapeutic administration of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof and at least one read-through enhancer are within the scope of the current invention. In one embodiment of adjunctive therapeutic administration as described herein, a patient is typically stabilised on a therapeutic administration of one or more of the components for a period of time and then receives administration of another component.
The combination therapies of the invention may also be administered simultaneously. By simultaneous administration is meant a treatment regime wherein the individual components are administered together, either in the form of a single pharmaceutical composition or device com- prising or containing both components, or as separate compositions or devices, each comprising one of the components, administered simultaneously. Such combinations of the separate individual components for simultaneous combination may be provided in the form of a kit-of- parts. The terms "prevent", "preventing" and "prevention" refer to the prevention of the onset, recurrence, spread or worsening of the disease or a symptom thereof in a patient resulting from the administration of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof. Because diseases associated with a nonsense mutation can be genetic, a patient can be screened for the presence of a nonsense mutation. In the case where it is determined through screening that a patient has a nonsense mutation, an effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof can be administered to the patient to prevent the onset, recurrence, spread or worsening of the disease or a symptom thereof.
The terms "treat", "treating" and "treatment" refer to the eradication or amelioration of the dis- ease or symptoms associated with the disease. In certain embodiments, such terms refer to minimizing the spread or worsening of the disease resulting from the administration of 5- azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof to a patient with such a disease.
The present invention further relates to a method for treating and preventing diseases respon- sive to inhibition of nonsense-mediated mRNA decay (NMD) comprising administering to a patient in need thereof an effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
The term "effective amount" refers to that amount of 5-azacytidine, a pharmaceutically accepta- ble salt, or a prodrug thereof sufficient to provide a therapeutic benefit in the treatment or management of the disease or to delay or minimize symptoms associated with the disease.
The present invention also relates to the use of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof, in the manufacture of a medicament for inhibiting nonsense-mediated mRNA decay (NMD).
The present invention further provides pharmaceutical compositions for treating and preventing diseases responsive to inhibition of nonsense-mediated mRNA decay (NMD) comprising 5- azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
In one embodiment, the pharmaceutical compositions further comprise at least one pharmaceu- tically-acceptable carrier, excipient or diluent.
These compositions can, for example, be administered orally, rectally, transdermally, subcuta- neously, intravenously, intramuscularly or intranasally. Oral administration is preferred.
Examples of suitable pharmaceutical formulations are solid medicinal forms, such as powders, granules, tablets, in particular film tablets, lozenges, sachets, cachets, sugar-coated tablets, capsules, such as hard gelatin capsules and soft gelatin capsules, suppositories or vaginal me- dicinal forms, semisolid medicinal forms, such as ointments, creams, hydrogels, pastes or plasters, and also liquid medicinal forms, such as solutions, emulsions, in particular oil-in-water emulsions, suspensions, for example lotions, injection preparations and infusion preparations, and eyedrops and eardrops. Implanted release devices can also be used for administering inhibitors according to the invention. In addition, it is also possible to use liposomes or micro- spheres. When producing the compositions, the compounds according to the invention are optionally mixed or diluted with one or more carriers (excipients). Carriers (excipients) can be solid, semisolid or liquid materials which serve as vehicles, carriers or medium for the active compound. Suitable carriers (excipients) are listed in the specialist medicinal monographs. In addition, the formulations can comprise pharmaceutically acceptable auxiliary substances, such as wetting agents; emulsifying and suspending agents; preservatives; antioxidants; antiirritants; chelating agents; coating auxiliaries; emulsion stabilizers; film formers; gel formers; odor masking agents; taste corrigents; resin; hydrocolloids; solvents; solubilizers; neutralizing agents; diffusion accel- erators; pigments; quaternary ammonium compounds; refatting and overfatting agents; raw materials for ointments, creams or oils; silicone derivatives; spreading auxiliaries; stabilizers; steri- lants; suppository bases; tablet auxiliaries, such as binders, fillers, glidants, disintegrants or coatings; propellants; drying agents; opacifiers; thickeners; waxes; plasticizers and white mineral oils. A formulation in this regard is based on specialist knowledge as described, for example, in Fiedler, H.P., Lexikon der Hilfsstoffe fur Pharmazie, Kosmetik und angrenzende Gebiete [Encyclopedia of auxiliary substances for pharmacy, cosmetics and related fields], 4th edition, Au- lendorf: ECV-Editio-Cantor-Verlag, 1996.
EXAMPLES
Example 1 Identification of 5-azacytidine as an NMD inhibitor:
A chemiluminescence based screening system, developed to identify NMD (nonsense-mediated mRNA decay) inhibitors from chemical libraries [Boelz S. et. al., Biochem. Biophys. Res. Com- mun. 349(1 ): 186-91 (2006)], was used in this study for the screening of small molecules as NMD inhibitors. Human β-globin gene with a nonsense mutation at position 39 was fused in frame to the 3'-end of the renilla luciferase. An increase in the renilla luciferase signal indicated inhibition of NMD and stabilization of the NMD reporter. The basic design of the assay was to seed stable inducible HeLa cells expressing renilla reporter in 384 wells a day prior to treatment. The following day, cells were treated with the inhibitors from the library or DMSO for 16 hours. Renilla luminescence intensity between the cells treated vs the control (DMSO) was calculated. The compounds which showed more than 2-fold up-regulation of the renilla β-globin reporter system were preferably selected for secondary screening using wildtype renilla β-globin expressing HeLa cells. Out of the 1 120 compounds tested, 5-azacytidine (Vidaza™; Pharmion Corporation) showed most significant up-regulation of the renilla β-globin reporter in our primary screen (Fig. 1A). The specificity of the effect on NMD reporter was further confirmed with our secondary assay using the wild type renilla β-globin reporter (Fig. 1 B). This primary data ob- tained clearly suggests that only the NMD mutant showed an up-regulation (>2 fold) on treatment with 5-azacytidine and on the other hand wild type showed no up-regulation but rather a mild down-regulation on treatment with 5-azacytidine. A further dose and time response experiment with 5-azacytidine was conducted on both mutant and wildtype reporter constructs. It was determined that 5-azacytidine shows maximum inhibition of NMD at 16hrs at a concentration of 1.56μΜ (Figure. 1 C and 1 D).
Example 2 5-Azacytidine increases the amount of nonsense mutation-containing mRNAs via stabilization of NMD reporter:
Stable HeLa cell lines expressing wild type and a mutant β-globin (nonsense mutation at codon 39) reporter were incubated with 5-azacytidine, DMSO and 5-azadeoxycytidine as negative controls and anisomycin as positive control for 16 hours. Total RNA was isolated and northern blot experiments were performed with all the samples (Fig. 2A). Similar to the positive control there was greater stabilization of the NMD reporter and hence more than 2-fold up-regulation of mutant RNA upon treatment with 5-azacytidine compare to the negative controls (Fig. 2B).
In a further experiment it was checked whether the up-regulation of the NMD reporter was due to a total transcriptional increase caused by the treatment of 5-azacytidine or due to the specific effect of NMD inhibition and up-regulation of mature mRNA. Stable cells expressing wild type and mutant β-globin reporter in a 6-well plate were treated with 5-azacytidine along with DMSO/5-aza-2'deoxycytidine as negative controls and anisomycin as positive control. The RNAs were purified, reverse transcribed and PCR was performed to measure the level of pre-β- globin. Pre-GAPDH was used to normalize the amount of the nonsense mutation-containing mRNA level. The results depicted in Fig. 2C show that the pre-mRNA levels were unchanged between the DMSO/5ADC, which were the negative controls, and 5-azacytidine treatment confirming that the RNA stabilization, that had been seen earlier for the mutant β-globin reporter, was indeed due to the inhibition of NMD and not to a non-specific transcriptional up-regulation effect of 5-azacytidine (which however seemed to be the case of anisomycin). Quantifications are based on at least 3 independent experiments and the average quantification is indicated with standard deviation.
Example 3 5-Azacytidine treatment stabilizes endoNMD targets: Cells were treated with 5-azacytidine along with DMSO (treatment control to which is given a value of 1 ), 5-aza-2'deoxycytidine and anisomycin for 16 hours. RNAs were purified, reverse transcribed and PCR was performed to measure the level of mRNA of various endo-NMD and non-NMD targets. 18s RNA was used as a normalization control. Fig. 3A and 3B clearly illustrate that 5-azacytidine caused specific up-regulation of endo-NMD targets while non-NMD targets were either unchanged or even down-regulated in some cases, further confirming the effect of 5-azacytidine as specific NMD inhibitor. In a further experiment, three endo NMD targets GADD45B, CHOP and SC35 were analyzed at the protein level. It was observed that two (CHOP and SC35) out of three show a clear up-regulation upon treatment with 5-azacytidine along with our positive controls anisomycin (Figure 3C-F).
Example 4 5-Azacytidine is not toxic, and does not inhibit general translation:
To test the specificity and cytotoxicity of 5-azacytidine an ATPIite luminescence-based cytotoxicity assay was performed. The effect of 5-azacytidine on cell survival was evaluated after 16 hours of treatment at the working concentration of 0.0049 -100μΜ. Fig. 4A shows that only at higher concentrations the cytotoxicity of 5-azacytidine was triggered. Moreover, at concentra- tions that showed maximum NMD inhibition and up-regulation of NMD reporter there was no cytotoxicity of 5-azacytidine indicating that 5-azacytidine was not toxic for cells at doses that are useful for NMD inhibition.
It is known that compounds like anisomycin and cycloheximide inhibit translation and as NMD is a translation-dependent process, NMD is also inhibited when treated with translation inhibitors. To test if 5-azacytidine also caused inhibition of translation an S35-methionine assay was performed. After 16 hours cells treatment with 5-azacytidine, 5-azadeoxycytidine as well as positive (anisomycin, cycloheximide) and negative controls a pulse of 1 hr with radiolabeled S35- methionine was given. After an hour the incorporated amount of S35-methionine incorporated into newly made proteins was measured using a scintillation counter. The results depicted in Fig. 4B show that 5-azacytidine at a concentration of 1.56 μΜ caused no significant decrease in the scintillation counts, in contrast to anisomycin or cycloheximide which showed a strong reduction in the scintillation counts, suggesting that the translation efficiency was not effected by 5-azacytidine (Fig 4C and 4D). Quantifications are based on at least 3 independent experiments and the average quantification is indicated with standard deviation.
Example 5 5-Azacytidine does not inhibit NMD via read-through mechanism: It was tested whether NMD inhibition was mediated via a read-through mechanism. A luciferase based reporter was used to assay read-through efficiency [Ivanov PV et al., EMBO J. 27(5): 736-47 (2008)]. The wild type reporter is a fusion protein of renilla and firefly and under normal conditions the luminesence from both renilla and firefly are detected. The NMD mutant has a codon between renilla and firefly cDNAs and the firefly luminescence is detected only when there is read-through. Cells were transiently transfected with the read-through reporter and 24 hours later they were treated with DMSO (negative control), 5-azacytidine and G418 (300μΜ) as positive control. Cells were harvested after 16hours of treatment, chemiluminescence was detected and the percentage of read-through was calculated (Figure 5A). Only G418 used at 300 μΜ concentration showed read-through effect and an increase in the firefly luminescence. 5-Azacytidine did not show any read-through activity. In a further experiment, the same lysates were tested for up-regulation of endo NMD and non-NMD targets. Cells were treated as men- tioned before with 5-azacytidine along with DMSO (treatment control to which is given a value of 1 ) and G418 for 16 hours. NAs were purified, reverse transcribed and PCR was performed to measure the level of mRNA of various endo-NMD and non-NMD targets. 18s RNA was used as a normalization control. Fig. 5B and 5C clearly illustrate that 5-azacytidine caused specific up- regulation of endo-NMD targets.
Example 6 Core NMD factors and EJC complex proteins tested show no significant changes upon treatment with 5-azacytidine:
In order to check whether 5-azacytidine has an effect on the core NMD factors or on EJC com- plex proteins, a set of crucial factors involved in the nonsense mediated decay pathway was tested. Cells were treated with 5-azacytidine (AC) along with DMSO, anisomycin (Ani), and 5- azadeoxycytidine (5ADC). No visible modulation of the tested proteins, core components (Fig. 6A), and EJC and SMG proteins (Fig. 6B) upon 5-azacytidine treatment was observed. In a further experiment, the effect on the phosphorylation of UPF1 (a key event important for nonsense mediated decay pathway) was evaluated. Cells were treated with 5-azacytidine (AC) along with DMSO, anisomycin (Ani), 5-azadeoxycytidine (5ADC) and wortmannin (Wort) (SMG-1 kinase inhibitor) as a positive control. No effect on the phosphorylation of phospho UPF1 upon treatment with 5-azacytidine was observed. Example 7 Nucloside/nucleotide analogues tested revealed 5-azacytidine to be the most potent NMD inhibitor:
In order to check whether slight chemical modifications of 5-azacytidine could vary the NMD inhibiting potential and also to cross-validate with other nucleotide and nucleotide analogues, a repertoire of 20 compounds (structures Fig. 7) was tested along with cycloheximide and anisomycin as positive controls. Out of 20 tested compounds, 5-azacytidine showed a robust, more than 2-fold up-regulation of NMD reporter. However, the rest of the analogues tested had no NMD inhibition activity (Fig.7).
In a further experiment it was tested whether 5-azacytosine could be an NMD inhibitor. Fig 8 shows that 5-azacytosine had no NMD inhibition activity.
Example 8 5-Azacytidine up-regulates endogenous p53 mRNAs in the Calu6 cell line.
Extending the analyses of cellular NMD targets, it was tested whether 5-azacytidine can specifi- cally up-regulate expression of p53 mRNAs in the Calu6 cell line that carries a homozygous CGA→TGA PTC-mutation at codon 196 of p53 (Lehman, T.A. et al. p53 mutations, ras mutations, and p53-heat shock 70 protein complexes in human lung carcinoma cell lines. Cancer Res 51 , 4090-6 (1991 )). The 5-azacytidine dose response curve of these cells showed a dose- dependent up-regulation of PTC-mutated p53 transcript (Figure 9). Together, these analyses demonstrate that 5-azacytidine up-regulates endogenous NMD target transcripts.
Example 9 5-Azacytidine inhibits NMD via overexpression of MYC.
Methods and Materials siRNA knockdown of c-MYC, UPF1, and Firefly Luciferase
To validate the working mechanism of 5-azacytidine through overexpression of c-MYC different siRNA knockdown experiments were performed. siRNAs were purchased at Thermo Fisher Sci- entific (Waltham, MA, USA). Either 1.5x105 RWt or RNS cells were seeded in 6-well plates and after 24 h treated with siMYC, siUPFI and siLuc, respectively. For siRNA treatment Oligofec- tamine™ Transfection Reagent (Invitrogen, Karlsruhe, Germany) was used according to the manufacturer's protocol. 6 h after the siRNA treatment, 10% FCS were added. 24 h hours after the siRNA treatment, medium was changed to DMEM GlutaMAX™ containing 1X penicil- lin/streptomycin and 10 % FCS. 30 h after the siRNA treatment, 1 :1000 of 1 mM doxycycline was added to induce luciferase expression. 24 h after induction of luciferase expression, cells were treated either with 1.56 μΜ 5-azacytidine (Tocris, Bristol, United Kingdom) or DMSO as a control. 24 h after drug treatment, cells were harvested and luciferase activity was determined using the Luciferase Assay System from Promega Corporation (Fitchburg, Wl, USA). Some samples were also harvested in RIPA buffer (50 mM Tris-HCL at pH 7.5, 150 mM CaCI, 1 % NP- 40, 0.5% sodium deoxycholate, 0.1% SDS) for further analysis with western blot and RT-PCR. Protein concentrations were measured either using BCA or Bradford assay (both from Bio-Rad Laboratories, Hercules, CA, USA).
Dose response experiments
To examine the dose response effect of 5-azacytidine, cells were treated with different doses of 5-azacytidine. Briefly, 3.0x105 RNS cells were seeded in 6-well plates and 1 :1000 doxycycline was added. 24 h after seeding cells were treated with either DMSO or different concentrations of AC (0.1 μΜ - 20 μΜ). 18 h after the treatment cells were harvested in RIPA buffer (50 mM Tris-HCL at pH 7.5, 150 mM CaCI, 1 % NP-40, 0.5% sodium deoxycholate, 0.1 % SDS) and protein concentration was determined by Bradford assay. The samples were further used for western blot analysis.
Western blot analysis
Western blot analysis was performed using 15-50 ng of cell lysate. Briefly, proteins were separated using either self-made or precasted 10 % SDS-PAGE gels (Expedeon, San Diego, CA, USA). Next proteins were transferred to PVDF membranes using semi-dry or tank blotting method. Subsequently, membranes were blocked with 5 % milk in TBS-Tween (0.1 %) and probed with antibodies against UPF1 (Bethyl Laboratories, Montgomery, TX, USA), elF2a, phospho-elF2a (both from Cell Signaling Technology, Cambridge, United Kingdom), c-MYC (Sigma-Aldrich, St. Louis, MO, USA) or DNMTI (Santa Cruz Biotechnoloy, Santa Cruz, CA, USA). Membranes were developed using either Western Lightning® ECL or ECL-Plus Reagent (Perkin Elmer, Waltham, MA, USA) with FUSION FX machine (Vilber Lourmat, Eberhardzell, Germany).
Real-time PCR
RT-PCR was used to validate the knockdown of c-MYC after siMYC treatment as well as to show the effect on c-MYC after 5-azacytidine treatment. Also endogenous NMD targets were analysed. RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA of 1 g RNA was synthesised using the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany). cDNA was diluted 1 :10 and used for RT-PCR with Absolute SYBR Green mix (Thermo Fisher Scientific, Waltham, MA, USA) on StepOnePlus™ system (Applied Biosystems Inc., Life Technologies, Carlsbad, CA, USA). The primers in the following table were used to quantify c-MYC and various endogenous NMD targets. GAPDH was used for normalization. gene forward reverse
ATF3 5'-GCCATTGGAGAGCTGTCTTC-3' 5'-GGGCCATCTGGAACATAAGA-3' c-MYC 5'-AAACACAAACTTG AACAGCTAC-3 ' 5'-ATTTGAGGCAGTTTACATTATGG-3'
GAPDH 5'-TGAGCTTGACAAAGTGGTCG-3' 5'-GGCTCTCCAGAACATCATCC-3'
HPRT1 5'-G ACC AGTC AACAG GG G ACAT-3 ' 5'-AACACTTCGTGGGGTCCTTTTC-3'
P53 5'-GAGGTTGGCTCTGACTGTACC-3' 5'-TCCGTCCCAGTAGATTACCAC-3'
SC35a 5'-CGTGCCTGAAACTGAAACCA-3' 5'-TTG CCAACTG AGG CAAAGC-3 '
SC35c 5'-GGCGTGTATTGGAGCAGATGTA-3' 5'- CTG CTACACAACTG CGCCTTTT-3 '
SC35d 5'-CGGTGTCCTCTTAAGAAAATGATGTA-3' 5'-CTGCTACACAACTGCGCCTTTT-3'
DNMT1 5'-AACCTTCACCTAGCCCCAG-3' 5'-CTCATCCGATTTGGCTCTTCA-3'
Proteomics Experiment Trypsination of cell lysates
Cells were treated with DMSO or AC or 5ADC for 18 hours and then harvested in 1 ml PBS. The cell pellet was later lysed in 8 M urea, 50 mM ammonium bicarbonate, 5 mM sodium phosphate, 1 mM potassium fluoride, 1 mM sodium orthovanadate, and EDTA-free protease inhibitor mixture (Roche). Samples were reduced with DTT at a final concentration of 10 mM at 56 °C; sub- sequently samples were alkylated with iodoac-etamide at a final concentration of 55 mM at RT. The samples were diluted to 2 M urea, 50 mM ammonium bicarbonate, and trypsin (1 :100; Promega) was added. Digestion was performed overnight at 37 °C.
Stable Isotope Labeling by Reductive Amination of Tryptic Peptides
Tryptic peptides were desalted, dried in vacuo, and resus- pended in 100 ul of triethylammoni- um bicarbonate (100 mM). Subsequently, formaldehyde-H2 (573 umol) was added and vor- texed for 2 min followed by the addition of freshly prepared sodium cyanoborohydride (278 umol). The resultant mixture was vortexed for 60 min at RT. A total of 60 ul of ammonia (25%) was added to consume the excess formaldehyde. Finally, 50 ul of formic acid (100%) was added to acidify the solution. For intermediate labels, formaldehyde-D2 (573 umol) was used. The light and intermediate dimethyl-labeled samples were mixed in 1 :1 ratio based on total peptide amount, which was determined by running an aliquot of the labeled samples on a regular LC- MS run and comparing overall peptide signal intensities.
Results Hela cells were treated either with 5-azacytidine or with DMSO or 5-azadeoxycytidine as negative controls for 18 hours and labelled the lysates with dimethyl light or heavy isotopes and subjected the peptides to mass spectrometric analysis (Figure 10A and 10B). Proteomics analyses have revealed 857 proteins to be up-regulated and 1002 proteins to be down-regulated upon 5- azacytidine treatment. Gene ontology studies suggested that proteins involved in ribosomal biogenesis were majorly up-regulated and kinases involved in amino acid phosphorylation were mostly down-regulated upon 5-azacytidine treatment (Figure 10C). Recently, Wang and colleagues reported that overexpression of the c-myc oncogene inhibits NMD in B lymphocytes (Wang et al., J. Biol. Chem. 2011, 286:40038-40043). The present results showed a more than two fold up-regulation of c-MYC upon 5-azacytidine treatment. c-MYC levels in HeLa cells treated with different doses by both qRT-PCR and western blot analysis were examined. qRT-PCR analysis revealed that c-MYC was up-regulated in a dose- dependent manner ranging from approximately 1 .8-fold (0.1 μΜ AC) to 24-fold (20 μΜ AC) compared to the DMSO control. DNMT1 (5-azacytidine is known to effect the only protein levels of DNMT1 not mRNA) and 18s were used as negative controls and they were not up-regulated upon 5-azacytidne treatment (Figure 1 1 A). Western blot analysis of lysates from 5-azacytidine treated cells also showed an up-regulation of c-myc at higher concentrations in a dose- dependent manner (Figure 11 B).
In order to establish the direct link between c-MYC and 5-azacytidine, siRNA-mediated knockdown in cells stably transfected with a luciferase-based NMD-reporter was performed (Figure 1 1 C). After treatment with 5-azacytidine the NMD reporter was approximately 4.5-fold up- regulated when compared to the DMSO treated sample (compare DMSO and AC lanes) as pre- viously seen. siRNA-mediated knockdown of c-MYC alone leads to a mild down-regulation of the NMD reporter when compared to the control (compare siLuc and siMYC lanes). UPF1 was used as a positive control for the experiment and an up-regulation of approximately 3-fold relative to the control was observed (see siUPFI lane). To test whether the effect of 5-azacytidine is dependent on c-MYC, the siRNA-mediated knockdown of the c-MYC was combined with 5-azacytidine treatment (Figure 1 1 C). Interestingly, there is no more up-regulation of the NMD reporter previously observed upon treatment of 5- azacytidine (compare Lanes siLUC+AC and siMYC+AC) when combined with knockdown of c- MYC, suggesting a pivotal role of c-MYC for inhibition of NMD by azacytidine. The effect seems to be quite specific to c-MYC because knockdown of UPF1 with either DMSO or 5-azacytidine treatment, showed neither a synergistic effect nor a significant difference in the fold-change of NMD reporter, suggesting that the down-regulation of the NMD reporter upon si NA-mediated knockdown of c-MYC and 5-azacytidine is specific for c-MYC
To confirm the knockdown efficiency of c-MYC, western blot analysis and qRT-PCR were per- formed. Both show a knockdown efficiency of approximately 50% (Figure 11 D and 1 1 E lanes MYC).
To prove that this effect is not only promotor-driven and valid for the NMD reporter tested, the expression of endogenous NMD targets was checked by qRT-PCR. All of these targets showed an up-regulation of approximately 1.5-fold to 3-fold when treated with 5-azacytidine combined with siRNA mediated knockdown of no template control compared to the DMSO treated control. On the other hand, when 5-azacytidine treatment was combined with siRNA-mediated knockdown of c-MYC, this effect was diminished. In summary, these data demonstrate that the effect of 5-azacytidine is strongly depending on c- MYC.
Example 10 5-Azacytidine partially reversed the nonsense mediated decay of the dystrophin mRNA in mdx mice.
Methods and Materials Vehicle injection Water for injection 5-Azacytidine
5-Azacytidine suspension was made up fresh each day just prior to use. 10 mg of 5-azacytidine (Sigma-Aldrich) powder was suspended in 10 ml of water for injection to make 1 mg/ml stock solution which is milky in appearance. For the different dose groups dilute as below. Vortex stock solution prior to taking aliquot and inject 100 μΙ per 10g body weight I. P.
stock vol. Conc of soln
Dose Add water for solution stock vol WFI to to inject Drug (mg/kg) injection (mg/ml) (ml) 5 ml
5-azacytidine 6 10ml 1 3 2 0.6
3 1 1.5 3.5 0.3
1 1 0.5 4.5 0.1 0.3 1 0.375 4.625 0.03
Drug treatment
The mdx mouse strain is generally accepted to be a relevant animal model for human Du- chenne's Muscular Dystrophy. The mdx mice (CSyBL/I OScSn-DmcT^/J) have a mutation in the dystrophin gene causing a premature stop codon which results in nonsense mediated decay of the mRNA. Male mice (6-8 weeks old) were purchased directly from the Jackson Laboratory (Bar Harbor, Maine USA). The mice were randomly sorted in groups of three and dosed once daily intra peritoneal on days 1-5 and 8-12 at either 6, 3, 1 or 0.3 mg/kg body weight in the morning. A control group was injected with water for injection only. Three wild type mice (C57BL) from the same strain were used untreated to determine the normal expression levels of the dystrophin mRNA. On day 14 mice were sacrificed and a small section of calf muscle (50-200 mg) dissected out and stored in 2 ml of RNA/aier RNA Stabilization Reagent (Qiagen) at for degrees centigrade overnight. Samples were then frozen at -20 degrees centigrade until there were processed further. RNA extraction
Approximately 20 mg of tissue was thawed and processed using a RNeasy Plus Universal Mini Kit (Qiagen) as described in the manufacturer's instructions. Reverse Transcription and RT-qPCR
Total RNA was quantified using Qubit Quant-it RNA (Invitrogen cat# Q10210) and diluted to 125 ng/μΙ. A total of 500 ng RNA was converted to cDNA using Superscript III First-Strand Synthesis SuperMix (Invitrogen cat# 11752) in a 10ul reaction volume as per manufactures protocol. RT-qPCR was carried out by combining 2x ABI SYBR Green (Applied Biosystems cat#
4309155) with 500nM final concentration of primers and 5ul of 1 :20 diluted cDNA then analyzed on ABI StepOnePlus real-time qPCR machines over 40 cycles followed by melt-curve analysis.
Primer sequences
Dystrophin
Forward: AAGGCACAGTGGTTGGAAAG Reverse: AGACATTTCAGCCCGTCAAC GAPDH
Forward: AAGGGCTCATGACCACAGTC
Reverse: ATCACGCCACAGCTTTCCA
Conclusions
The treatment of mdx mice with 5-azacytidine was able to partially reverse the nonsense medi- ated decay of the dystrophin mRNA in a dose dependent manner. Importantly there us a clear dose dependent increase in the mdx dystrophin mRNA being observed at 6 and 3 mg/kg dosing levels (Fig. 12).
The finding of 5-azacytidine to inhibit NMD is most significant from a medical perspective, because this drug has been in clinical use for many years as an approved drug for the treatment of myelodysplastic syndrome, chronic myelomonocytic leukemia and acute myeloid leukemia. Notably, the concentration of 5-azacytidine that is required for its effect as an NMD inhibitor is similar or even below the drug levels in patients, which are needed for its effect as an antileukemic agent. In contrast to other known but highly toxic NMD inhibitors, 5-azacytidine is therefore envisaged to be re-purposed for the treatment of diseases that would benefit from an inhibition of NMD efficiency and an increased expression of PTC-mutated transcripts. Such transcripts encode C-terminally truncated proteins, which may be (partially) functional and NMD inhibition might thus result in a therapeutic effect. Some forms of Duchenne muscular dystrophy and cystic fibrosis, which are caused by PTC-mutations in the 3' region of the dystrophin and the CFTR genes, respectively, exemplify diseases that may benefit from such an approach (Keeling, K.M. & Bedwell, D.M. Suppression of nonsense mutations as a therapeutic approach to treat genetic diseases. Wiley Interdiscip Rev RNA 2, 837-52 (201 1 ); Linde, L. & Kerem, B. Introducing sense into nonsense in treatments of human genetic diseases. Trends Genet 24, 552-63 (2008)). Similarly, some forms of cancer that are driven by PTC-mutations in tumor suppressor genes may benefit from an inhibition of NMD (Karam, R. et al. The NMD mRNA surveillance pathway downregulates aberrant E-cadherin transcripts in gastric cancer cells and in CDH1 mutation carriers. Oncogene 27, 4255-60 (2008); Metzeler, K.H. et al. TET2 mutations improve the new European LeukemiaNet risk classification of acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol 29, 1373-81 (2011 )). Further, it is expected that 5- azacytidine acts synergistically with compounds that induce readthrough at premature termination codons. The mechanistic principle of such compounds relies on the introduction of a near cognate aminoacide at the stop codon thus converting a PTC into a missense mutation (Bhuvanagiri, M., Schlitter, A.M., Hentze, M.W. & Kulozik, A.E. NMD: RNA biology meets human genetic medicine. Biochem J 430, 365-77 (2010); Burke, J.F. & Mogg, A.E. Suppression of a nonsense mutation in mammalian cells in vivo by the aminoglycoside antibiotics G-418 and paromomycin. Nucleic Acids Res 13, 6265-72 (1985)). The concept of this approach has been proven to be effective in cystic fibrosis and in Duchenne muscular dystrophy (Keeling, K.M., Wang, D., Conard, S.E. & Bedwell, D.M. Suppression of premature termination codons as a therapeutic approach. Crit Rev Biochem Mol Biol 47, 444-63 (2012). Linde, L. & Kerem, B. Introducing sense into nonsense in treatments of human genetic diseases. Trends Genet 24, 552-63 (2008)). Specifically, nonsense suppression has been shown to be more effective in patients with naturally less efficient NMD than in those with more efficient NMD (Linde, L, Boelz, S., Neu-Yilik, G., Kulozik, A.E. & Kerem, B. The efficiency of nonsense-mediated mRNA decay is an inherent character and varies among different cells. Eur J Hum Genet 15, 1 156-62 (2007)). 5-azacytidine will thus increase the abundance of the mRNA substrate that would be targeted by compounds that are currently being developed for the induction of translational readthrough (Lee, H.L. & Dougherty, J. P. Pharmaceutical therapies to recode nonsense mutations in inherited diseases. Pharmacol Ther 136, 227-66 (2012)).

Claims

5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in a method of treating or preventing a disease responsive to inhibition of nonsense-mediated mRNA decay.
5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of claim 1 , wherein the disease is associated with a mutant gene containing a nonsense mutation.
5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of claim 1 or 2, wherein the disease is cystic fibrosis or muscular dystrophy. 5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of claim 3, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.
5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of claim 1 or 2, wherein the disease is autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, 3°39-thalassemia, cancer, factor VII deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1 A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency I (LAD1 ), methylmalonic academia (MMA), Hurler syndrome, nephropatic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve-Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), or Usher syndrome (USH 1 ).
5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of claim 5, wherein the cancer is hereditary diffuse gastric cancer.
5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of claim 5, wherein the cancer is a cancer associated with a mutation of the p53 gene or a mutation of the APC gene.
5-Azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof for use in the method of any one of claims 1 to 7, wherein the method further comprises administering one or more readthrough enhancers.
A method for treating or preventing a disease responsive to inhibition of nonsense- mediated mRNA decay in a mammal comprising administering to the mammal in need of such treatment or prevention a therapeutically effective amount of 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof.
The method according to claim 9, wherein the mammal is a human.
1 1. The method of claim 9 or claim 10, further comprising administering to the mammal in need of such treatment or prevention a therapeutically effective amount of one or more readthrough enhancers.
12. A combination which comprises 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof and one or more readthrough enhancers for use in a method of treating or preventing a disease responsive to inhibition of nonsense-mediated mRNA decay.
13. The method according to any one of claims 9 to 1 1 or a combination according to claim 12, wherein the disease is as defined in any one of claims 2 to 7.
14. A pharmaceutical composition which comprises (i) 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof, (ii) one or more readthrough enhancers and (iii) a pharmaceutically acceptable carrier, excipient or diluent.
15. A kit-of-parts for use in the treatment of a disease responsive to inhibition of nonsense- mediated mRNA decay, comprising (i) a first dosage form comprising 5-azacytidine, a pharmaceutically acceptable salt, or a prodrug thereof and (ii) one or more further dosage forms each comprising one or more readthrough enhancers for combined therapeutic administration.
PCT/EP2014/059658 2013-05-10 2014-05-12 Use of 5-azacytidine to inhibit nonsense-mediated rna decay (nmd) Ceased WO2014180996A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13167328 2013-05-10
EP13167328.7 2013-05-10

Publications (1)

Publication Number Publication Date
WO2014180996A1 true WO2014180996A1 (en) 2014-11-13

Family

ID=48326185

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/059658 Ceased WO2014180996A1 (en) 2013-05-10 2014-05-12 Use of 5-azacytidine to inhibit nonsense-mediated rna decay (nmd)

Country Status (1)

Country Link
WO (1) WO2014180996A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016164463A1 (en) 2015-04-07 2016-10-13 The General Hospital Corporation Methods for reactivating genes on the inactive x chromosome
EP3207932A1 (en) * 2016-02-19 2017-08-23 Universität Stuttgart Dna methyltransferase inhibitors for rett syndrome therapy
FR3057774A1 (en) * 2016-10-21 2018-04-27 Museum National D'histoire Naturelle DERIVATIVES OF PURINE FOR THEIR USE IN THE TREATMENT OR PREVENTION OF DISEASES DUE TO NON-SENSE MUTATION
WO2018152095A1 (en) * 2017-02-14 2018-08-23 Celgene Corporation Treatment of cancer with smg1-inhibitors
WO2021087458A3 (en) * 2019-11-02 2021-06-10 Board Of Regents, The University Of Texas System Targeting nonsense-mediated decay to activate p53 pathway for the treatment of cancer
JP2023526315A (en) * 2020-05-12 2023-06-21 サントル ナシオナル ドゥ ラ ルシェルシェ サイアンティフィク Quinazoline compounds as inhibitors of premature stop codons
EP4295850A4 (en) * 2021-02-16 2025-03-05 Ribotech Co., Ltd. COMPOUND FOR INHIBITION OF NONSENSE-MEDIATED MRNA DEGRADATION

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257866A1 (en) * 2002-07-24 2006-11-16 Welch Ellen M Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mrna decay
WO2010093435A1 (en) * 2009-02-10 2010-08-19 Celgene International Sarl Methods for treating non-small cell lung cancer using 5-azacytidine

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060257866A1 (en) * 2002-07-24 2006-11-16 Welch Ellen M Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mrna decay
WO2010093435A1 (en) * 2009-02-10 2010-08-19 Celgene International Sarl Methods for treating non-small cell lung cancer using 5-azacytidine

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HUI-LING ROSE LEE ET AL: "Pharmaceutical therapies to recode nonsense mutations in inherited diseases", PHARMACOLOGY & THERAPEUTICS, vol. 136, no. 2, 1 November 2012 (2012-11-01), pages 227 - 266, XP055068955, ISSN: 0163-7258, DOI: 10.1016/j.pharmthera.2012.07.007 *
M. WILSCHANSKI ET AL: "Chronic ataluren (PTC124) treatment of nonsense mutation cystic fibrosis", EUROPEAN RESPIRATORY JOURNAL, vol. 38, no. 1, 1 July 2011 (2011-07-01), pages 59 - 69, XP055068778, ISSN: 0903-1936, DOI: 10.1183/09031936.00120910 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016164463A1 (en) 2015-04-07 2016-10-13 The General Hospital Corporation Methods for reactivating genes on the inactive x chromosome
EP3283502A4 (en) * 2015-04-07 2019-04-03 The General Hospital Corporation METHODS FOR REACTIVATION OF GENES ON INACTIVE X CHROMOSOME
US10961532B2 (en) 2015-04-07 2021-03-30 The General Hospital Corporation Methods for reactivating genes on the inactive X chromosome
US11912994B2 (en) 2015-04-07 2024-02-27 The General Hospital Corporation Methods for reactivating genes on the inactive X chromosome
EP3207932A1 (en) * 2016-02-19 2017-08-23 Universität Stuttgart Dna methyltransferase inhibitors for rett syndrome therapy
FR3057774A1 (en) * 2016-10-21 2018-04-27 Museum National D'histoire Naturelle DERIVATIVES OF PURINE FOR THEIR USE IN THE TREATMENT OR PREVENTION OF DISEASES DUE TO NON-SENSE MUTATION
WO2018152095A1 (en) * 2017-02-14 2018-08-23 Celgene Corporation Treatment of cancer with smg1-inhibitors
WO2021087458A3 (en) * 2019-11-02 2021-06-10 Board Of Regents, The University Of Texas System Targeting nonsense-mediated decay to activate p53 pathway for the treatment of cancer
JP2023526315A (en) * 2020-05-12 2023-06-21 サントル ナシオナル ドゥ ラ ルシェルシェ サイアンティフィク Quinazoline compounds as inhibitors of premature stop codons
EP4295850A4 (en) * 2021-02-16 2025-03-05 Ribotech Co., Ltd. COMPOUND FOR INHIBITION OF NONSENSE-MEDIATED MRNA DEGRADATION

Similar Documents

Publication Publication Date Title
WO2014180996A1 (en) Use of 5-azacytidine to inhibit nonsense-mediated rna decay (nmd)
US11352624B2 (en) Reducing nonsense-mediated MRNA decay
US20240277731A1 (en) 17a-monoesters and 17a,21-diesters of cortexolone for use in the treatment of tumors
CA2806825C (en) Compound useful for the treatment of nonsense-mutation-mediated diseases and pharmaceutical composition comprising said compound
CN101360422B (en) Oncogenic Ras-specific cytotoxic compound and methods of usethereof
JP6340162B2 (en) Apoptosis inducer
TR201706226T4 (en) 1,2,4-oxadiazole benzoic acid compounds and their use in meaningless suppression and treatment of diseases.
JP7557365B2 (en) Gemcitabine derivatives for the treatment of cancer
TW202340463A (en) Complement factor b-modulating compositions and methods of use thereof
KR20140038388A (en) Combination of anti-clusterin oligonucleotide with hsp90 inhibitor for the treatment of prostate cancer
CN103877069A (en) Small molecule modulators of microRNA-34a
WO2019113155A1 (en) Oxabicycloheptanes for treatment of secondary acute myeloid leukemia
WO2024163374A1 (en) Programmable dna proteolysis target chimeras and methods of their use
JP6393682B2 (en) Combination therapy III
JP2008517065A (en) Compositions and methods for disruption of BRCA2-RAD51 interaction
EP4069243B1 (en) Combinations of etc-159 and olaparib for use in the treatment of pancreatic cancer, ovarian cancer and cholangio-carcinomas
US20260053804A1 (en) Compositions and Methods for the Restoration of Ciliary Function
US10865176B2 (en) Small molecule modulators of microRNA-34a
US20240018522A1 (en) Oligonucleotides useful for modulation of splicing
TW202536177A (en) Antisense oligonucleotides targeting ezh2 splicing and their use for treating cancer and kidney disease
JP2026512883A (en) Compounds for upregulating eutrophin levels in muscle cells and methods for their application.
EP3377476A1 (en) Hydrogen isotope-enriched analogues of 1,2,4-oxadiazole benzoic acid compounds, compositions and uses thereof
WO2024254195A1 (en) Methods for treating pancreatic cancer with a combination of des-methyl pateamine a and a class 1 hdac inhibitor
WO2018121743A1 (en) Mir-96 for protecting livers, muscles, lungs, and kidneys, for regulating content of total protein and content of albumin in blood, and for insulin resistance
BR112019012647B1 (en) Antisense Oligomer Conjugates Inducing Exon 51 Skipping in the Human Dystrophy Gene

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14723434

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 14723434

Country of ref document: EP

Kind code of ref document: A1