WO2014178389A1

WO2014178389A1 - Pharmaceutical composition for treatment of diabetes

Info

Publication number: WO2014178389A1
Application number: PCT/JP2014/061909
Authority: WO
Inventors: 渉宮永; 亘竹下; 瑞季土肥; 忠清中川; 佳代松本; 順子岡松; 香織小林
Original assignee: 味の素株式会社
Priority date: 2013-05-01
Filing date: 2014-04-28
Publication date: 2014-11-06
Also published as: JP2016130215A

Abstract

Provided is a new compound having glycogen synthase activation potency, high muscular transition, minimal activation of receptor PPAR, and a high degree of safety. Provided is a compound represented by the following general formula, or a pharmaceutically acceptable salt thereof. In the formula, R is represented by one of the following formulae, and Ar is represented by one of the following rings.

Description

Pharmaceutical composition for the treatment of diabetes

The present invention relates to a novel compound having an action of activating glycogen synthase and a pharmaceutical composition for treating diabetes containing the compound.

Diabetes is an important disease for modern people, and the incidence of diabetes has been increasing in recent years. Many antidiabetic drugs have been developed and used in practice due to the mechanism of diabetes occurrence. For example, insulin sensitivity enhancers, α-glycosidase inhibitors, insulin secretagogues, insulin preparations and the like are used alone or in combination.
Under such circumstances, a technique for treating diabetes has been developed by activating glycogen synthase, which is a new mechanism different from the conventional antidiabetic drugs. Specifically, biaryloxymethylarene carboxylic acids have been proposed as compounds capable of activating glycogen synthase (Patent Documents 1 to 9).
On the other hand, new pharmaceutically active compounds are required to have safety such as the absence of side effects in addition to their expected effects on disease treatment. Peroxisome proliferators-activated It has been proposed to examine a receptor PPAR (peroxisome proliferator-activated receptor) (Non-patent Document 1). In animal experiments such as in rats, hepatic hypertrophy, marked induction of enzymes in the liver, and long-term administration of the drug cause liver cancer. It is remarkable growth. It has been clarified that the mechanism of drug-hepatic peroxisome proliferation-hepatocarcinoma involves a receptor PPAR activated by a peroxisome proliferating drug (PP), particularly its subfamily PPARα. Has attracted attention in the drug development stage (especially carcinogenicity assessment).

WO2005 / 000781 WO2006 / 058648 WO2011 / 057956 WO2011 / 057959 WO2011 / 057993 WO2011 / 058122 WO2011 / 058154 WO2011 / 067174 WO2011 / 067266

An object of this invention is to provide the novel compound which has glycogen synthase activation ability and has high muscular migration property.
Another object of the present invention is to provide a pharmaceutical composition containing the above compound.
Another object of the present invention is to provide a pharmaceutical composition for treating diabetes containing the above compound.
Another object of the present invention is to provide a glycogen synthase activator containing the above compound.

The present invention has been intensively studied on the biaryloxymethylarene carboxylic acid compounds described in Patent Documents 1 to 9, and has a specific aryl group as the terminal aryl group of the biaryl ring located at one terminal, and another terminal. It has been found that a compound having a specific amide amino group as an amino group located in can easily migrate to a tissue (particularly muscle) and can be expected to reduce the dose, and that the use of these compounds can efficiently solve the above problems. It was made based on the knowledge of. In addition, the compound of the present invention is a novel compound with high safety because the receptor PPAR is hardly activated.
That is, the present invention provides the following [1] to [12].
[1] A compound represented by the following general formula (I) or a pharmaceutically acceptable salt thereof.
Formula (I):

(In the formula, R is represented by the following formula (II) or (III):

(Wherein L ₁ and L ₂ represent a bond, an alkylene group or a cycloalkylene group,
R _a and R _b are hydrogen atom, halogen atom, hydroxyl group, cyano group, halogenoalkyl group, aminocarbonyl group, monoalkylaminocarbonyl group, dialkylaminocarbonyl group, alkylsulfonyl group, amino group, monoalkylamino group, Dialkylamino group, alkoxy group, alkylsulfonylamino group, alkylcarbonylamino group, aminosulfonyl group, monoalkylaminosulfonyl group, dialkylaminosulfonyl group, monoalkoxyaminocarbonyl group, cyanoalkoxy group, phenyl group, or at least one Represented by a 5- or 6-membered heterocyclic group having a nitrogen atom, an oxygen atom or a sulfur atom;
R _c is represented by —O—R _d , a cyano group or a tetrazolyl group,
R _d is represented by an alkyl group, a hydroxyalkyl group, a halogenoalkyl group, an alkoxyalkyl group, a cyanoalkyl group or a carboxyalkyl group.
Ar is represented by any of the following rings (IV) to (VI):

(IV) (V) (VI)
These rings may have one or a plurality of substituents, and the substituents are acetamido group, aminocarbonyl group, halogen atom, hydroxyalkyl group, alkyl group, alkoxyalkyl group, cyano group, cyanoalkyl group. Selected from the group consisting of: an amino group, an aminoalkyl group, a monoalkylaminoalkyl group, a dialkylaminoalkyl group, an alkoxy group, and a halogenoalkoxy group;
R ₁ represents a halogen atom, a hydroxyl group, an alkyl group, an alkoxy group, a halogenoalkoxy group, or an alkylthio group, and R ₂ represents a hydrogen atom or an alkyl group. )

[2] In general formula (I), the heterocyclic group in R _a of formula (II) and R _b of formula (III) may have a substituent, a tetrahydropyran ring, a tetrahydrofuran ring, a pyrrolidine ring, Represented by piperidine ring, pyridine ring, pyrimidine ring, pyrazine ring, pyridazine ring, furan ring, thiophene ring, oxazole ring, isoxazole ring, thiazole ring, isothiazole ring, imidazole ring, pyrazole ring, oxadiazole ring or thiadiazole ring Or a pharmaceutically acceptable salt thereof according to [1].

[3] In general formula (I), R _{c in} formula (III) is represented by —O—R _d ;
R _a and R _b are hydrogen atom, halogen atom, hydroxyl group, cyano group, halogenoalkyl group, aminocarbonyl group, monoalkylaminocarbonyl group, dialkylaminocarbonyl group, alkylsulfonyl group, amino group, monoalkylamino group, A dialkylamino group, an alkoxy group, an alkylsulfonylamino group, an alkylcarbonylamino group, or any one of the following formulas (VII) to (IX):

The compound or a pharmaceutically acceptable salt thereof according to [1], wherein R _e is a hydrogen atom, an alkyl group or a halogenoalkyl group.

[4] In the general formula (I), R _a and R _b in formula (III) of the formula (II) is, aminosulfonyl groups, mono- alkylaminosulfonyl group, a dialkylamino sulfonyl group, monoalkoxy aminocarbonyl group, cyanoalkoxy A group, a phenyl group, or a group represented by the following formula (X) or (XI):

[1] The compound described in [1] or a pharmaceutically acceptable salt thereof.

[5] The compound according to [1], [2] or [4], wherein R _C in formula (III) is represented by a cyano group or a tetrazolyl group in the general formula (I), or a pharmaceutically acceptable salt thereof Acceptable salt.

[6] The compound or a pharmaceutically acceptable salt thereof according to any one of [1] to [5], wherein in general formula (I), Ar has a substituent of 1 or 2, and these are halogen atoms .

[7] In the ring (IV) or (V) of the general formula (I), R ₁ is a halogen atom, a hydroxyl group, a methoxy group or a methylthio group, and R ₂ is a hydrogen atom or a methyl group. ] To [6] or a pharmaceutically acceptable salt thereof.

[8] The compound according to any one of [1] to [7], wherein in formula (II) or formula (III), L ₁ is a bond, and L ₂ is an alkylene group having 1 to 3 carbon atoms. Its pharmaceutically acceptable salt.

[9] In the ring (IV) of the general formula (I), R ₁ is a halogen atom, a methoxy group, a —OCD ₃ group (D represents deuterium) or a methylthio group. The compound or pharmaceutically acceptable salt according to any one of the above.

[10] A pharmaceutical composition comprising the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof.

[11] A pharmaceutical composition for treating diabetes comprising the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof.

[12] A glycogen synthase activator comprising the compound according to any one of [1] to [9] or a pharmaceutically acceptable salt thereof.

Hereinafter, the definition of the compound of the formula (I) will be described.
In the present specification, an “alkyl group” is derived by removing one arbitrary hydrogen atom from a linear or branched aliphatic hydrocarbon having 1 to 12 carbon atoms, preferably 1 to 6 carbon atoms. Is a monovalent group. Specific examples include groups such as methyl, ethyl, isopropyl, butyl, n-butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, 2,3-dimethylpropyl, hexyl and the like. More preferably, it is C _1-4 alkyl.
The “alkylene group” is a divalent group derived by removing any two hydrogen atoms from a linear or branched aliphatic hydrocarbon having 1 to 12, preferably 1 to 6 carbon atoms. is there. Specifically, methylene, ethylene, n-propylene, 2-methylethylene, n-butylene, 2-methylpropylene, 2,2-dimethylethylene, n-hexylene, n-heptylene, n-octylene, n-dodecylene, etc. The group of is mentioned. More preferred is alkylene having 1 to 4 carbon atoms.
“Halogen atom” means a fluorine, chlorine, bromine, iodine atom or the like.
“Alkoxy group” means alkyl-O— having 1 to 6 carbon atoms. Specifically, methoxy, ethoxy, 1-propoxy, 2-propoxy, n-butoxy, i-butoxy, sec-butoxy, t-butoxy, 1-pentyloxy, 2-pentyloxy, 3-pentyloxy, 2- Methyl-1-butyloxy, 3-methyl-1-butyloxy, 2-methyl-2-butyloxy, 3-methyl-2-butyloxy, 2,2-dimethyl-1-propyloxy, 1-hexyloxy, 2-hexyloxy And groups such as 3-hexyloxy. Preferred is alkoxy having 1 to 3 carbon atoms.

The “alkylthio group” is a thio group substituted by the alkyl and means alkyl-S—. Alkyl is as described above. C _1-3 alkylthio is preferable.
The “monoalkylamino group” is an amino group in which one hydrogen atom on a nitrogen atom is substituted with the alkyl, and means alkyl-NH—. Specific examples include groups such as methylamino and ethylamino. Preferably, it is monoalkylamino having 1 to 3 carbon atoms.
The “monoalkylaminocarbonyl group” is a carbonyl group having an amino group in which one hydrogen atom on a nitrogen atom is substituted with the alkyl, and means alkyl-NH—C (O) —. The alkyl groups may be the same or different. Specific examples include groups such as methylaminocarbonyl and ethylaminocarbonyl. Preferably, it is a monoalkylaminocarbonyl group having 1 to 3 carbon atoms in the alkyl group.
The “monoalkylaminoalkyl group” is an alkyl group substituted with the monoalkylamino group, and means alkyl-N-alkyl-. The alkyl group is as described above. Preferably, each alkyl group is a monoalkylaminoalkyl group having 1 to 3 carbon atoms.

The “dialkylamino group” is an amino group in which two hydrogen atoms on a nitrogen atom are each substituted by the alkyl, and means (alkyl) ₂ N—. The alkyl groups may be the same or different. Specific examples include groups such as dimethylamino and diethylamino. Preferably, each alkyl group is a dialkylamino having 1 to 4 carbon atoms. Two alkyl groups may be combined to form a ring such as a pyrrolidine ring or a piperidine ring.
The “alkylsulfonyl group” is a sulfonyl group substituted by the above alkyl and means alkyl-SO ₂ —. Alkyl is as described above. Preferred is alkylsulfonyl having 1 to 3 carbon atoms.
The “alkylsulfonylamino group” is a sulfonylamino group substituted by the above alkyl and means alkyl-SO ₂ —NH—. Alkyl is as described above. Preferred is alkylsulfonylamino having 1 to 3 carbon atoms.
“Dialkylaminocarbonyl group” is a carbonyl group having an amino group in which two hydrogen atoms on a nitrogen atom are each substituted by the above alkyl, and means (alkyl) ₂ N—C (O) — To do. The alkyl groups may be the same or different. Specific examples include carbonyl groups with groups such as dimethylamino and diethylamino. Further, alkyls may form a ring, and specific examples include pyrrolidinylcarbonyl, piperidinylcarbonyl and the like.

The “dialkylaminoalkyl group” is an alkyl group substituted with the dialkylamino group, and means (alkyl) ₂ N-alkyl-. The alkyl group is as described above. Preferably, each alkyl group is a dialkylaminoalkyl group having 1 to 4 carbon atoms.
The “alkylcarbonylamino group” is an amino group in which one hydrogen atom on a nitrogen atom is substituted with an alkylcarbonyl group, and means alkyl-C (O) —NH—. Alkyl is as described above. Preferably, it is an alkylcarbonylamino group having 1 to 3 carbon atoms in the alkyl group.
An “alkoxyalkyl group” is an alkyl group substituted with an alkoxy group and means alkyl-O-alkyl-. The alkoxy group and the alkyl group are as described above. An alkoxyalkyl group having 1 to 4 carbon atoms in each of the alkoxy group and the alkyl group is preferable.
“Hydroxyalkyl group” means an alkyl group substituted with a hydroxy group, and means HO-alkyl-. The alkyl group is as described above, and is preferably a hydroxyalkyl group having 1 to 5 carbon atoms.
“Carboxyalkyl group” is an alkyl group substituted with a carboxyl group, and means HO (O) C-alkyl-. The alkyl group is as described above, and is preferably a hydroxycarbonylalkyl group having 2 to 5 carbon atoms.
The “cyanoalkyl group” is an alkyl group substituted with a cyano group, and means NC-alkyl-. The alkyl group is as described above, and is preferably a cyanoalkyl group having 2 to 5 carbon atoms.
The “halogenalkoxy group” means the above alkoxy group substituted with one or more halogen atoms. Preferably, it is an alkoxy group having 1 to 3 carbon atoms substituted with 1 to 3 halogen atoms. More preferred are trifluoromethoxy and trifluoroethoxy.
The “halogenoalkyl group” means the above alkyl group substituted with one or more halogen atoms. Preferred is an alkyl group having 1 to 3 carbon atoms substituted with 1 to 3 halogen atoms. More preferred are trifluoromethyl and trifluoroethyl.

The “cycloalkylene group” is a divalent group derived by removing any two hydrogen atoms from a cycloalkane having 3 to 12, preferably 1 to 6 carbon atoms. Specifically, 1,2-cyclopropylene, 1,2-cyclobutylene, 1,3-cyclobutylene, 1,2-cyclopentylene, 1,3-cyclopentylene, 1,2-cyclohexylene, , 3-cyclohexylene, 1,4-cyclohexylene and 1,3-cycloheptylene. 1,3-cyclobutylene, 1,3-cyclopentylene, 1,3-cyclohexylene or 1,4-cyclohexylene is preferred.
The “aminosulfonyl group” is a sulfonyl group substituted with an amino group, and means NH ₂ —SO ₂ —.
The “monoalkylaminosulfonyl group” is a sulfonyl group substituted by a monoalkylamino group, and means alkyl-NH—SO ₂ —. Preferably, it is a monoalkylaminosulfonyl group having 1 to 3 carbon atoms in the alkyl group.
The “dialkylaminosulfonyl group” is a sulfonyl group substituted by a dialkylamino group, and means (alkyl) ₂ N—SO ₂ —. The alkyl group is as described above. Preferably, each alkyl group is a dialkylaminosulfonyl group having 1 to 3 carbon atoms.
“Monoalkoxyaminocarbonyl group” is a carbonyl group having an amino group in which one hydrogen atom on a nitrogen atom is substituted by an alkoxy group, and means alkyl-O—NH—C (O) — To do. The alkyl group is as described above. Preferably, the alkyl group is a monoalkoxyaminocarbonyl group having 1 to 3 carbon atoms.
The “cyanoalkoxy group” is an alkoxy group in which alkyl is substituted with a cyano group, and means CN-alkylene-O—. A cyanoalkoxy group having 1 to 3 carbon atoms of alkylene is preferable.

Ra is preferably a hydrogen atom or a hydroxyl group. Ra is preferably an aminocarbonyl group, an alkoxy group or a cyanoalkoxy group.
R _b is preferably an aminocarbonyl group or a dialkylaminocarbonyl group, an alkoxy group, an alkylsulfonyl group, a dialkylamino group, a hydroxy group, or a group represented by the following formula.

In the formula, Re is preferably a hydrogen atom.
Or, R _b is represented by a cyano group, a monoalkylsulfonylamino group, a dialkylamino group, an aminosulfonyl group, a monoalkylaminosulfonyl group, a dialkylaminosulfonyl group, a monoalkoxyaminocarbonyl group, a phenyl group, or the following formula: It is preferably a group.

The heterocyclic group in R _a and R _b may have a substituent, such as a tetrahydropyran ring, tetrahydrofuran ring, pyrrolidine ring, piperidine ring, pyridine ring, pyrimidine ring, furan ring, thiophene ring, oxazole ring, It is preferably represented by an isoxazole ring, thiazole ring, isothiazole ring, imidazole ring, pyrazole ring, oxadiazole ring or thiadiazole ring. Here, as this heterocyclic group, a 5- or 6-membered heterocyclic group having one nitrogen atom or an oxygen atom, a 5- or 6-membered heterocyclic group having one nitrogen atom and one oxygen atom, Alternatively, a 5- or 6-membered heterocyclic group having two nitrogen atoms is preferable, and those represented by any one of the above formulas (VII) to (XI) are preferable.

R _c is represented by —O—R _d , and R _d is preferably an alkyl group.
Alternatively, Rc is —O—R _d , a cyano group, or a tetrazolyl group, and R _d is preferably a halogenoalkyl group, a —CD ₃ group, an alkoxyalkyl group, or a cyanoalkyl group.
L ₁ is a bond, and L ₂ is preferably an alkylene group having 1 to 3 carbon atoms.

The group of the general formula (IV) representing Ar can have 1 to 4 groups, and the groups of the general formulas (V) and (VI) representing Ar can have 1 to 5 same or different substituents. Of these, a halogen atom, hydroxyalkyl, alkyl, cyano group, and amino group are preferred, more preferably 1 to 3 thereof, and particularly preferably a halogen atom such as fluorine or chlorine. R ₁ is preferably a halogen atom, a hydroxyl group, a methyl group, a methoxy group or a methylthio group. Alternatively, R ₁ is preferably a —OCD ₃ group. R ₂ is preferably a hydrogen atom or a methyl group.
In the group represented by the formula (II), the bond between the pyrrolidine ring and the carbonyl carbon can take any configuration, for example, the configuration represented by the following formula (II-1).

(II-1)

The compound of the present invention represented by the general formula (I) and a pharmaceutically acceptable salt thereof (when R is represented by the formula (II) and R _c is represented by —O—R _d ) are: It can be synthesized according to a synthesis scheme.
(Reaction Formula A)

Action of a phenol derivative (1) in which X ₁ is a boronic acid derivative in the presence of a base such as potassium carbonate in a solvent such as DMF in the presence of a benzoate derivative (2) in which X ₂ is a halogen atom. Thus, an ester derivative can be obtained, which was led to carboxylic acid (3) by hydrolysis in the presence of a base such as lithium hydroxide in a solvent such as methanol. Carboxylic acid (3) is subjected to a coupling reaction in the presence of a base such as sodium carbonate using various derivatives (4) in which X ₃ is a halogen atom in a solvent such as dioxane or water and Pd as a catalyst. By performing, a compound (5) can be obtained. Then, after converting into acid chloride using, for example, thionyl chloride, amide compound (6) is obtained by allowing various amino acids to act in the presence of a base such as sodium hydroxide in a solvent such as dichloromethane. Can do. The alkoxyamide (7) can be obtained by reacting the amide (6) with an alkoxyamine in a solvent such as dichloromethane in the presence of a condensing agent.

In addition, the compound of the present invention represented by the general formula (I) and a pharmaceutically acceptable salt thereof (when R is represented by the formula (III)) can be synthesized according to the following synthesis scheme.

Synthesis how glycine ester derivative (B-3) (Scheme B)

Reaction of the corresponding amine derivative and its salt (B-1) with a corresponding ester derivative (B-2) such as bromobenzylacetic acid in the presence of a base such as potassium carbonate in a solvent such as acetonitrile, if necessary. A glycine derivative (B-3) can be obtained by cooling, heating and the like of the system.

Method for synthesizing amide ester derivative (C-2) (Scheme C)

The corresponding carboxylic acid derivative (5) obtained by the same method as in formula (A) can be derived into the amide ester derivative (C-2) using, for example, two production methods. One is a production method using a condensing agent or the like. Corresponding carboxylic acid derivative (A-6) such as, for example, corresponding glycine ester derivative (B-3) and 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide hydrochloride in a solvent such as dichloromethane In the presence of a condensing agent and a base such as diisopropylethylamine, the amide ester derivative (C-2) can be obtained by cooling and heating the reaction system as necessary. As another production method, it can be produced via an acid halide (C-1). The corresponding carboxylic acid derivative (5) is cooled, heated, or the like, if necessary, in the absence of a solvent or in the presence of an acid halogenating agent such as thionyl chloride in a solvent such as N, N-dimethylformamide. Thus, an acid halogenated derivative (C-1) can be obtained. The obtained acid halogen derivative (C-1) is cooled and heated in a solvent such as dichloromethane in the presence of the corresponding glycine ester derivative (B-3) and a base such as diisopropylethylamine as necessary. The amide ester derivative (C-2) can be obtained by performing etc.

Method for synthesizing amic acid derivative (D-2) (reaction formula D)

The corresponding amide ester derivative (C-2) is cooled, heated, etc., if necessary, in a solution such as tetrahydrofuran and methanol in the presence of a base such as sodium hydroxide or lithium hydroxide aqueous solution. Thus, an amide carboxylic acid derivative (D-1) can be obtained. Corresponding amide carboxylic acid derivative (D-1), for example, corresponding amine derivative (E-1) or a salt thereof and 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide hydrochloride in a solvent such as dichloromethane The amide derivative (D-2) can be obtained by cooling and heating the reaction system as necessary in the presence of a condensing agent such as a salt and a base such as diisopropylethylamine.

In the present invention, when the compound represented by the general formula (I) can form a salt form, the salt may be pharmaceutically acceptable, for example, an acidic group such as a carboxyl group in the formula For acidic groups in the presence of ammonium salts, salts with alkali metals such as sodium and potassium, salts with alkaline earth metals such as calcium and magnesium, aluminum salts, zinc salts, triethylamine, ethanolamine, Examples thereof include salts with organic amines such as morpholine, piperidine and dicyclohexylamine, and salts with basic amino acids such as arginine and lysine. Among them, sodium is preferable.
When a basic group is present in the formula, for a basic group, salts with inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, hydrobromic acid, acetic acid, trifluoroacetic acid, citric acid, benzoic acid Organic carboxylic acids such as acid, maleic acid, fumaric acid, tartaric acid, succinic acid, tannic acid, butyric acid, hibenzic acid, pamoic acid, enanthic acid, decanoic acid, teocric acid, salicylic acid, lactic acid, oxalic acid, mandelic acid, malic acid And salts with organic sulfonic acids such as methanesulfonic acid, benzenesulfonic acid and p-toluenesulfonic acid, among which hydrochloric acid and trifluoroacetic acid are preferably used.
As a method for forming a salt, a compound represented by the general formula (I) and a necessary acid or base are mixed in an appropriate amount ratio in a solvent or a dispersing agent, or a cation is obtained from other salt forms. It can also be obtained by exchange or anion exchange.
The compounds of the present invention also include solvates of the compounds represented by the general formula (I), such as hydrates and alcohol adducts.

The compounds of the present invention can also be converted into prodrugs. The prodrug in the present invention represents a compound that is converted in the body to produce the compound of the present invention. For example, when the active main body contains a carboxyl group or the like, an ester or amide thereof can be mentioned. Further, when the active main body contains an amino group, its amide, carbamate and the like can be mentioned. When the active main body contains a hydroxyl group, its ester, carbonate, carbamate and the like can be mentioned. When the compound of the present invention is converted into a prodrug, it may be bound to an amino acid or a saccharide.
The present invention includes all isotopes of the compound represented by the general formula (I). The isotope of the compound of the present invention is one in which at least one atom is substituted with an atom having the same atomic number (number of protons) and a different mass number (sum of the number of protons and neutrons). Examples of isotopes contained in the compounds of the present invention include a hydrogen atom, a carbon atom, a nitrogen atom, an oxygen atom, a phosphorus atom, a sulfur atom, a fluorine atom, a chlorine atom, and the like, respectively 2H, 3H, 13C, 14C, 15N, 17O, 18O, 31P, 32P, 35S, 18F, 36Cl and the like are included. In particular, unstable radioisotopes that emit radioactivity and emit neutrons, such as 3H and 14C, are useful in the tissue distribution test of pharmaceuticals or compounds. Stable isotopes can be used safely because they do not decay, their abundances are almost unchanged, and there is no radioactivity. The isotope of the compound of the present invention can be converted according to a conventional method by replacing the reagent used in the synthesis with a reagent containing the corresponding isotope.
The pharmaceutical composition of the present invention can be suitably used for the treatment of diseases mediated by a decrease in glycogen synthase activity. In particular, it can be suitably used for the treatment of diabetes, especially type 2 diabetes and impaired glucose tolerance.
The pharmaceutical composition and the glycogen synthase activator of the present invention vary depending on the administration subject, administration route, target disease, symptom, etc., but the administration route is preferably used by oral administration, and a single administration is effective. The amount is preferably 1 mg to 1000 mg / person of the ingredient, more preferably 1 mg to 100 mg / person of the active ingredient, and it is desirable to administer this amount once to three times a day.

The pharmaceutical composition and the glycogen synthase activator of the present invention contain the compound represented by the above general formula (I) and / or a pharmaceutically acceptable salt thereof as an active ingredient. Various components used, for example, pharmaceutically and physiologically acceptable solid or liquid carriers, additives and the like may be contained.
Examples of the carrier include glucose, lactose, sucrose, starch, mannitol, dextrin, fatty acid glyceride, polyethylene glycol, hydroxyethyl starch, ethylene glycol, polyoxyethylene sorbitan fatty acid ester, gelatin, albumin, amino acid, water, and physiological saline. Water etc. are mentioned. Further, if necessary, conventional additives such as a stabilizer, a wetting agent, an emulsifier, a binder, and an isotonic agent can be appropriately added.
The additive is not particularly limited as long as it is usually used for the purpose according to the purpose. Examples include amino acids such as (MSG), nucleic acids such as inosine monophosphate (IMP), inorganic salts such as sodium chloride, and water.

The pharmaceutical composition and glycogen synthase activator of the present invention can be used in a form that can be administered orally without any limitation on the physical properties such as dry powder, paste, and solution.
Examples of such orally administrable forms include tablets (including sugar-coated tablets, film-coated tablets, sublingual tablets, orally disintegrating tablets), capsules (including soft capsules and microcapsules), granules, powders, and troches. Agents, syrups, emulsions, suspensions, films (eg, orally disintegrating films), lyophilizers and the like.
In addition, the pharmaceutical composition and the glycogen synthase activator of the present invention can be used for injections (eg, subcutaneous injections, intravenous injections, intramuscular injections, intraperitoneal injections, infusions), and external preparations (eg, transdermal). Skin preparations, ointments), suppositories (eg, rectal suppositories, vaginal suppositories), pellets, nasal preparations, pulmonary preparations (inhalants), ophthalmic preparations, etc. .

These can be safely administered orally or parenterally (eg, topical, rectal, intravenous administration). These preparations may be controlled-release preparations (eg, sustained-release microcapsules) such as immediate-release preparations or sustained-release preparations. These preparations can be prepared by conventional means on the preparation.
In addition, the pharmaceutical composition and the glycogen synthase activator of the present invention can be used for other diabetes therapeutic agents, diabetic complication therapeutic agents, hyperlipidemia therapeutic agents, antihypertensive agents, anti-obesity agents (hereinafter referred to as concomitant drugs). ). These concomitant drugs may be small molecules, high molecular proteins, polypeptides, antibodies, nucleic acids (including antisense nucleic acids, siRNA, shRNA), or vaccines. These concomitant drugs can be used alone or in combination of two or more.
The administration timing of the pharmaceutical composition, glycogen synthase activator, or concomitant drug of the present invention is not limited, and these may be administered simultaneously to the administration subject, or may be administered with a time difference.

Antidiabetic agents include insulin preparations (eg, animal insulin preparations extracted from bovine and porcine pancreas; human insulin preparations genetically engineered using Escherichia coli and yeast; insulin zinc; protamine insulin zinc; insulin Fragment or derivative (eg, INS-1), oral insulin preparation), insulin resistance improving agent (eg, pioglitazone or a salt thereof (preferably hydrochloride), rosiglitazone or a salt thereof (preferably maleate) Tesaglitazar, Ragaglitazar, Muraglitazar, Edaglitazone, Metaglidasen, Naveglitazar, AMG-131, THR-0921, α-glucosidase, α-glucosidase , Acarbose, mig Ritole, emiglitate), biguanides (eg, metformin, buformin or their salts (eg, hydrochloride, fumarate, succinate)), insulin secretagogues [sulfonylurea (eg, tolbutamide, glibenclamide, gliclazide, Chlorpropamide, tolazamide, acetohexamide, glyclopyramide, glimepiride, glipizide, glybsol), repaglinide, nateglinide, mitiglinide or its calcium salt hydrate], dipeptidyl peptidase IV inhibitors (eg, alogliptin, vildaguri) Vitinagliptin, Sitagliptin, Saxagliptin, T-6666, TS-021), β3 agonist (eg, AJ-9677), GPR40 agonist, GPR120 agonist, GLP-1 receptor agonist [Examples: GLP-1, GLP-1MR agent, NN-2211, AC-2993 (exendin-4), BIM-51077, Aib (8,35) hGLP-1 (7,37) NH ₂ , CJC-1131] , Amylin agonist (eg, pramlintide), phosphotyrosine phosphatase inhibitor (eg, sodium vanadate), gluconeogenesis inhibitor (eg, glycogen phosphorylase inhibitor, glucose-6-phosphatase inhibitor, glucagon antagonist), SGLT (sodium- glucose cotransporter) inhibitors (eg, dapagliflozin, canagliflozin, ipragliflozin, BI-10773), 11β-hydroxysteroid dehydrogenase inhibitors (eg, BVT-3498), adiponectin or agonists thereof, IKK inhibitors (eg, AS-2868), leptin resistance improver, somatostatin receptor agonist, glucokinase activator (eg, Ro-28-1675), GIP (Glucose-dependent insulinotropic peptide), etc. And the like.
Further, it may be in a form in which the compound represented by the above general formula (I) and / or a pharmaceutically acceptable salt thereof is stored in granules, tablets, gelatin capsules and the like used in supplements.

EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited to these Examples.
Intermediate 1-A Synthesis of 3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoic acid

Step 1 Synthesis of 7-bromo-4,5-difluoro-1-benzofuran N of 2-bromo-4,5-difluorophenol (2.51 g, 12.0 mmol) and potassium carbonate (3.32 g, 24.0 mmol) , N-dimethylformamide (hereinafter DMF) (60 mL) was added bromoacetaldehyde dimethylacetal (2.82 mL, 24.0 mmol) and a catalytic amount of sodium iodide, and the mixture was stirred at 80 ° C. overnight.
The solvent was evaporated under reduced pressure, the residue was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent under reduced pressure was purified by silica gel chromatography (hexane / ethyl acetate), and the compound (3.00 g, 10.1 mmol) obtained was dissolved in chlorobenzene (40 mL) to obtain polyphosphoric acid. (3.0 g) in chlorobenzene suspension (20 mL) was added at 120 ° C. The reaction solution was stirred at 120 ° C. overnight, then the solvent was distilled off under reduced pressure, and ethyl acetate and water were added to the residue. The mixture was poured into 1N aqueous sodium hydroxide solution under ice cooling and stirred, and then insolubles were filtered off and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. The resulting residue was purified by silica gel chromatography (hexane) to give the title compound.
Yield: 572 mg (2.45 mmol) Yield: 20%
¹ H NMR (400 MHz, CDCl ₃ ) δ 7.69 (d, J = 2.2 Hz, 1H), 7.31-7.38 (m, 1H), 6.98 (d, J = 2.2 Hz, 1H).

Step 2 Synthesis of Intermediate 1-A 4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenol (8.46 g, 38.4 mmol), 3- (bromomethyl ) DMF (125 mL) was added to methyl benzoate (8.80 g, 38.4 mmol) and potassium carbonate (10.6 g, 76.8 mmol), and the mixture was stirred overnight at room temperature. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. Methanol (150 mL), water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added to the residue obtained by evaporating the solvent under reduced pressure, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. Of the residue obtained by distilling off the solvent under reduced pressure, 3.34 g (9.4 mmol) was added to the compound obtained in Step 1 (2.2 g, 9.4 mmol), 1,4-dioxane (75 mL). , Water (25 mL), sodium carbonate (1.5 g, 14.2 mmol) and [1,1′-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (hereinafter, PdCl ₂ (dppf)) (catalytic amount) And stirred at 100 ° C. for 2 hours. The insoluble material was filtered off, the solvent was distilled off under reduced pressure, diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by evaporating the solvent under reduced pressure was washed with acetonitrile to give the title compound.
Yield: 2.95 g (7.76 mmol) Yield: 83%

Intermediate 1-B Synthesis of 3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl chloride

To intermediate 1-A (2.95 g, 7.76 mmol) was added thionyl chloride (15 mL), and the mixture was stirred at 50 ° C. for 2 hr. After cooling, the solvent was distilled off under reduced pressure to obtain the title compound.
Yield: 2.4 g (6.0 mmol) Yield: 77%

Intermediate 2-A Synthesis of 3-[[4- (4,5-Difluoro-2-sulfanyl-phenyl) phenoxy] methyl] benzoic acid

Step 1 Synthesis of 1-bromo-4,5-difluoro-2-methylsulfanyl-benzene To a DMF solution (100 mL) of 2-bromo-4,5-difluorothiophenol (9.78 g, 43.5 mmol), potassium carbonate (7.5 g, 54.3 mmol) and iodomethane (3.39 mL, 54.3 mmol) were added and stirred at room temperature overnight. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent was purified by silica gel chromatography (hexane / ethyl acetate) to obtain the title compound.
Yield: 10.4 g (43.5 mmol) Yield: 100%
¹ H NMR (CDCl ₃ , 400 MHz) δ 7.39 (dd, J = 9.5, 7.6 Hz, 1H), 6.97 (dd, J = 10.9, 7.6 Hz, 1H), 2.46 (s, 3H).
Step 2 Synthesis of Intermediate 2-A 4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenol (8.46 g, 38.4 mmol), 3- (bromomethyl ) DMF (125 mL) was added to methyl benzoate (8.80 g, 38.4 mmol) and potassium carbonate (10.6 g, 77 mmol), and the mixture was stirred overnight at room temperature. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. Methanol (150 mL), water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added to the residue obtained by evaporating the solvent under reduced pressure, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent under reduced pressure was added to 3.74 g (10.6 mmol) of 1-bromo-4,5-difluoro-2- (methylthio) benzene (2.53 g) obtained in Step 1. , 10.6 mmol), 1,4-dioxane (75 mL), water (25 mL), sodium carbonate (2.24 g, 21.2 mmol) and PdCl ₂ (dppf) (catalytic amount), and stirred at 100 ° C. for 2 hours. did. The insoluble material was filtered off, the solvent was distilled off under reduced pressure, diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by evaporating the solvent under reduced pressure was washed with acetonitrile to give the title compound.
Yield: 4.02 g (10.4 mmol) Yield: 98%

Intermediate 2-B Synthesis of 3-[[4- (4,5-Difluoro-2-sulfanyl-phenyl) phenoxy] methyl] benzoyl chloride

To intermediate 2-A (4.0 g, 10.4 mmol) was added thionyl chloride (15 mL), and the mixture was stirred at 50 ° C. for 2 hr. After cooling, the solvent was distilled off under reduced pressure to obtain the title compound.
Yield: 3.3 g (8.5 mmol) Yield: 82%

Intermediate 3 Synthesis of 3-[[4- (4,5-Difluoro-3-methyl-benzofuran-7-yl) phenoxy] methyl] benzoyl chloride

Step 1 Synthesis of 7-bromo-4,5-difluoro-3-methyl-1-benzofuran The same operation as in Step 1 of Intermediate 1-A was performed using bromoacetone (0.504 mL, 6 (0.000 mmol) to give the title compound.
Yield: 150 mg (0.607 mmol) Yield: 12%
¹ H NMR (400 MHz, CDCl ₃ ) δ 7.43-7.40 (m, 1H), 7.27-7.32 (m, 1H), 2.35 (d, J = 0.9 Hz, 3H).
Step 2 Synthesis of Intermediate 3 4- (4,4,5,5-Tetramethyl-1,3,2-dioxaborolan-2-yl) phenol (8.46 g, 38 mmol), methyl 3- (bromomethyl) benzoate DMF (125 mL) was added to (8.8 g, 38 mmol) and potassium carbonate (10.6 g, 77 mmol), and the mixture was stirred overnight at room temperature. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. Methanol (150 mL), water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added to the residue obtained by evaporating the solvent under reduced pressure, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. Of the residue obtained by distilling off the solvent under reduced pressure, 6.25 g (17.7 mmol) was added to 7-bromo-4,5-difluoro-3-methylbenzofuran (4.8 g, 19.4 mmol), 1 , 4-dioxane (75 mL) and water (25 mL) sodium carbonate (3.74 g, 35.3 mmol) and PdCl ₂ (dppf) (catalytic amount) were added and stirred at 100 ° C. for 2 hours. The insoluble material was filtered off, the solvent was distilled off under reduced pressure, diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by evaporating the solvent under reduced pressure was washed with acetonitrile. Thionyl chloride (15 mL) was added to the resulting residue, and the mixture was stirred at 50 ° C. for 2 hours. After cooling, the solvent was distilled off under reduced pressure to obtain the title compound.
Yield: 4.0 g (9.7 mmol) Yield: 55%

Intermediate 4-A (2S, 3S) -3-hydroxy-1- [3-[[4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenoxy] Synthesis of methyl] benzoyl] pyrrolidine-2-carboxylic acid

4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenol (8.46 g, 38.4 mmol), methyl 3- (bromomethyl) benzoate (8.80 g, 38.4 mmol) and potassium carbonate (10.6 g, 77 mmol) were added DMF (125 mL) and stirred at room temperature overnight. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. Methanol (150 mL), water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added to the residue obtained by evaporating the solvent under reduced pressure, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N aqueous hydrochloric acid solution and saturated brine, and dried over anhydrous magnesium sulfate. The residue was obtained by distilling off the solvent under reduced pressure. To a portion of the obtained residue (4.5 g, 12.7 mmol), 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (hereinafter referred to as WSC) hydrochloride (2.93 g, 15.3 mmol), trans- (L) -3-hydroxyproline methyl ester hydrochloride (2.0 g, 15.3 mmol), triethylamine (3.5 mL, 25.4 mmol) and dichloromethane (50 mL) were added and stirred overnight.
After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N aqueous hydrochloric acid solution and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent under reduced pressure was purified by silica gel chromatography to obtain an ester (3.81 g). The obtained ester (2.71 g, 5.63 mmol) was dissolved in a mixed solvent of methanol (10 mL) and tetrahydrofuran (hereinafter referred to as THF) (10 mL), 1N aqueous sodium hydroxide solution (10 mL) was added, and the mixture was stirred overnight. did. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N aqueous hydrochloric acid solution and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound without purification.

Intermediate 4-B (2S, 3S) -3-Hydroxy-N-methoxy-1- [3-[[4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolane-2- Yl) phenoxy] methyl] benzoyl] pyrrolidine-2-carboxamide

4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenol (8.46 g, 38.4 mmol), methyl 3- (bromomethyl) benzoate (8.80 g, 38.4 mmol) and potassium carbonate (10.6 g, 77 mmol) were added DMF (125 mL) and stirred at room temperature overnight. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. Methanol (150 mL), water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added to the residue obtained by evaporating the solvent under reduced pressure, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. Of the residue obtained by distilling off the solvent under reduced pressure, (4.5 g, 12.7 mmol) was added to 1-ethyl-3- (3-dimethylaminopropyl) -carbodiimide (hereinafter referred to as WSC) hydrochloride (2 .93 g, 15.3 mmol), trans- (L) -3-hydroxyproline methyl ester hydrochloride (2.0 g, 15.3 mmol), triethylamine (3.5 mL, 25.4 mmol), dichloromethane (50 mL) were added, Stir overnight. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. Of the 3.81 g of the compound obtained by purifying the residue obtained by distilling off the solvent under reduced pressure by silica gel chromatography, a part (2.71 g, 5.63 mmol) of methanol (10 mL), tetrahydrofuran (hereinafter referred to as “the compound”) was obtained. , THF) (10 mL) 1N aqueous sodium hydroxide solution (10 mL) was added and stirred overnight. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. Of the residue obtained by distilling off the solvent under reduced pressure (730 mg, 1.56 mmol), WSC hydrochloride (328 mg, 15.3 mmol), methoxyamine hydrochloride (144 mg, 1.72 mmol), 1-hydroxy Benzotriazol (hereinafter HOBt) monohydrate (263 mg, 1.72 mmol), triethylamine (0.42 mL, 3.1 mmol) and dichloromethane (50 mL) were added and stirred overnight. The residue obtained after evaporation of the solvent under reduced pressure was subjected to reverse phase HPLC using ODS as a filler, and water and acetonitrile containing 0.1% (v / v) trifluoroacetic acid (hereinafter TFA) were mixed. The title compound was obtained by elution with a solution and freeze-drying the desired fraction.
Yield: 230 mg (0.46 mmol) Yield: 30%
MS (ESI, m / z) 497 [M + H] ⁺

Intermediate 5 Synthesis of 3-[[4- (4,5-Difluoro-2-methoxy-phenyl) phenoxy] methyl] benzoyl chloride

Step 1 Synthesis of 3-[[4- (4,5-difluoro-2-methoxy-phenyl) phenoxy] methyl] benzoic acid In the same manner as in Intermediate 2-A, 2-bromo-4,5-difluorothio The title compound was obtained by using 2-bromo-4,5-difluorophenol instead of phenol.
Step 2 Synthesis of Intermediate 5 In the same manner as in Intermediate 2-B, the compound of Step 1 was used instead of Intermediate 2-A to give the title compound.

Example 1 (2S) -1- [3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -N-methoxy-pyrrolidine-2-carboxamide Step 1 1- (3 Synthesis of — {[4- (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenoxy] methyl} benzoyl) -L-proline 4- (4,4,5 5-tetramethyl-1,3,2-dioxaborolan-2-yl) phenol (8.46 g, 38.4 mmol), methyl 3- (bromomethyl) benzoate (8.80 g, 38.4 mmol), and potassium carbonate ( DMF (125 mL) was added to 10.6 g (77 mmol), and the mixture was stirred overnight at room temperature. The mixture was diluted with ethyl acetate, washed with water and saturated brine, and dried over anhydrous magnesium sulfate. Methanol (150 mL), water (30 mL), and lithium hydroxide (4.8 g, 114 mmol) were added to the residue obtained by evaporating the solvent under reduced pressure, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the residue was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and dried over anhydrous magnesium sulfate. The residue obtained by distilling off the solvent under reduced pressure was dissolved in dichloromethane (150 mL), WSC hydrochloride (7.34 g, 38.2 mmol), tert-butyl (2S) -pyrrolidine-2-carboxylate (7.95 g, 38 .2 mmol) and triethylamine (9.65 mL, 69.4 mmol) were added and stirred at room temperature overnight. The extract was washed with water, 1N hydrochloric acid, 1N sodium hydroxide and saturated brine, and then dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and TFA (150 mL) was added to the compound obtained by purifying the residue by silica gel chromatography (hexane / ethyl acetate), followed by stirring at room temperature for 3 hours. The solvent was distilled off under reduced pressure to obtain the title compound.
Yield: 15.1 g (33.5 mmol) Yield: 88%
MS (ESI, m / z) 452 [M + H] ⁺

Step 2 Synthesis of 1- (3-{[4- (4,5-difluoro-1-benzofuran-7-yl) phenoxy] methyl} benzoyl) -L-proline Compound of Step 1 (36.1 mg, 0.0800 mmol ), Intermediate 1-A step 1 compound (22.4 mg, 0.0960 mmol), sodium carbonate (18.7 mg, 0.176 mmol) and PdCl ₂ (dppf) (catalytic amount) to 1,4-dioxane. (0.75 mL) and water (0.25 mL) were added and stirred at 100 ° C. for 2 hours. The insoluble material was filtered off, and the filtrate was purified by reverse phase HPLC in the same manner as Intermediate 4-B to give the title compound.
Yield: 21.1 mg (0.0459 mmol) Yield: 46%
MS (ESI, m / z) 460 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.24 (d, J = 2.2 Hz, 1H), 7.85-7.91 (m, 2H), 7.38-7.70 (m, 5H), 7.28 (d, J = 2.2 Hz, 1H), 7.21-7.26 (m, 2H), 5.23-5.36 (m, 2H), 4.38-4.50 (m, 2H), 3.46-3.68 (m, 2H), 2.26-2.38 (m, 1H), 1.81-2.05 (m, 3H).
Step 3 Synthesis of Example 1 Compound Step 2 Compound Na salt (30 mg, 0.060 mmol) and methoxyamine hydrochloride (6.53 mg, 0.078 mmol) were dissolved in dichloromethane (2 mL) and WSC hydrochloride (15. 0 mg, 0.078 mmol) and triethylamine (0.019 mL, 0.18 mmol) were added, and the mixture was stirred at room temperature for 15 hours. After distilling off the organic solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as Intermediate 4-B to obtain the title compound.
Yield: 6.6 mg (0.013 mmol) Yield: 22%
MS (ESI, m / z) 507 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.28-10.99 (m, 1H), 8.19 (d, J = 2.2 Hz, 1H), 7.87-7.78 (m, 2H), 7.69-7.29 (m, 5H ), 7.23 (d, J = 2.2 Hz, 1H), 7.21-7.14 (m, 2H), 5.29-5.15 (m, 1H), 4.31-4.07 (m, 1H), 3.60 (s, 3H), 3.44- 3.39 (m, 1H), 3.35-3.26 (m, 1H), 2.22-2.11 (m, 1H), 1.95-1.71 (m, 3H).

Example 2 (2S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -N-methoxy-pyrrolidine-2-carboxamide Intermediate 2- B (300 mg, 0.77 mmol), L-proline (354 mg, 3.08 mmol), 1N aqueous sodium hydroxide solution (5 mL) and dichloromethane (5 mL) were added and stirred overnight. After neutralization with 2N hydrochloric acid, the residue obtained after evaporation of the solvent under reduced pressure was purified by reverse-phase HPLC in the same manner as in Intermediate 4-B, and some of the resulting compounds (130 mg, 0.27 mmol) were purified. ), WSC hydrochloride (62 mg, 0.32 mmol), HOBt monohydrate (49 mg, 0.32 mmol), methoxyamine hydrochloride (27 mg, 0.32 mmol), triethylamine (0.075 mL, 0.54 mmol) and Dichloromethane (5 mL) was added and stirred overnight. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse-phase HPLC in the same manner as Intermediate 4-B to obtain the title compound.
Yield: 230 mg (0.46 mmol) Yield: 30%
MS (ESI, m / z) 513 [M + H] ⁺

Example 3 (2S, 3S) -1- [3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy-pyrrolidine-2-carboxamide Step 1 Synthesis of methyl (2S, 3S) -1- [3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -3-hydroxy-pyrrolidine-2-carboxylate ( A hydrochloric acid / methanol solution prepared from 2S, 3S) -3-hydroxypyrrolidine-2-carboxylic acid (19.6 mg, 0.15 mmol) and acetyl chloride (0.103 mL) and methanol (3.0 mL) under ice-cooling. After addition and stirring for 4 hours, the solvent was distilled off under reduced pressure. To the obtained residue, dichloromethane (1.5 mL), WSC hydrochloride (56.4 mg, 0.300 mmol), intermediate 1-A (57.0 mg, 0.150 mmol), HOBt · monohydrate (41.1 mg) , 0.300 mmol) and triethylamine (0.0626 mL, 0.450 mmol) were added and stirred at room temperature overnight. The residue obtained by concentration under reduced pressure was purified by reverse phase HPLC in the same manner as in Intermediate 4-B to obtain the title compound.
Yield: 38.5 mg (0.0759 mmol)
MS (ESI, m / z) 508 [M + H] ⁺
Step 2 Synthesis of (2S, 3S) -1- [3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -3-hydroxy-pyrrolidine-2-carboxylic acid Step 1 The compound obtained in 1 was dissolved in THF (1.7 mL), 1N aqueous sodium hydroxide solution (1.7 mL) was added under ice cooling, and the mixture was stirred at room temperature for 2 hr. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as Intermediate 4-B to obtain the title compound.
Yield: 30.0 mg (0.0607 mmol)
MS (ESI, m / z) 494 [M + H] ⁺
Step 3 Synthesis of Example 3 Compound Compound (30.0 mg, 0.0607 mmol) obtained in Step 2 was added to dichloromethane (0.6 mL), WSC hydrochloride (14.0 mg, 0.0729 mmol), methoxyamine hydrochloride ( 6.0 mg, 0.0729 mmol), HOBt.monohydrate (10.0 mg, 0.0729 mmol) and triethylamine (0.017 mL, 0.121 mmol) were added and stirred at room temperature overnight. The residue obtained by concentration under reduced pressure was purified by reverse phase HPLC in the same manner as in Intermediate 4-B to obtain the title compound.
Yield: 18.0 mg (0.0344 mol) Yield: 57%
MS (ESI, m / z) 523 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ11.43-11.23 (m, 1H), 8.19 (d, J = 2.2 Hz, 1H), 7.87-7.79 (m, 2H), 7.73-7.41 (m, 5H), 7.24 (d, J = 2.3 Hz, 1H), 7.22-7.14 (m, 2H), 5.29-5.17 (m, 2H), 4.19-3.89 (m, 2H), 3.60 (s, 3H), 3.53 (dt, J = 7.3, 3.7 Hz, 2H), 2.13-1.71 (m, 3H).

Example 4 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfonyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy-pyrrolidine-2 -Carboxamide intermediate 4-B (110 mg, 0.221 mmol) and 1-bromo-4,5-difluoro-2-methylsulfanyl-benzene (63.6 mg, 0.266 mmol) in 1,4-dioxane (4 mL) And water (1 mL). PdCl ₂ (dppf) (32.2 mg, 0.044 mmol) and sodium carbonate (76.3 mg, 0.553 mmol) were added to the solution, and the mixture was stirred at 125 ° C. for 30 minutes. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Intermediate 4-B to obtain the title compound.
Yield: 75.9 mg (0.144 mmol) Yield: 65%
MS (ESI, m / z) 529 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.44-11.20 (m, 1H), 7.72-7.40 (m, 7H), 7.38-7.25 (m, 1H), 7.21-7.09 (m, 3H), 5.27 -5.14 (m, 2H), 4.49-4.10 (m, 2H), 3.78-3.46 (m, 2H), 3.60 (s, 3H), 3.36 (s, 1H), 2.11-1.92 (m, 1H), 1.89 -1.70 (m, 1H).

Example 5 (2S, 3S) -1- [3-[[4- (2,4-Difluorophenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy-pyrrolidine-2-carboxamide Example 4 The same operation was performed using 1-bromo-2,4-difluoro-benzene instead of 1-bromo-4,5-difluoro-2-methylsulfanyl-benzene to obtain the title compound.
Yield: 54.0 mg (0.112 mmol) Yield: 47%
MS (ESI, m / z) 483 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.48-11.19 (m, 1H), 7.79-7.41 (m, 4H), 7.41-7.20 (m, 4H), 7.20-6.97 (m, 2H), 5.26 -5.12 (m, 2H), 4.26-4.06 (m, 2H), 4.03-3.44 (m, 6H), 3.44-3.24 (m, 1H), 2.58-2.28 (m, 3H), 2.13-1.92 (m, 1H), 1.92-1.65 (m, 1H).
Example 6 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methoxy-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy-pyrrolidine-2- Carboxamide By performing the same operation as Example 4 using 1-bromo-4,5-difluoro-2-methoxy-benzene instead of 1-bromo-4,5-difluoro-2-methylsulfanyl-benzene. The title compound was obtained.
Yield: 17.4 mg (0.0340 mmol) Yield: 19%
MS (ESI, m / z) 513 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.47-11.21 (m, 1H), 7.70-7.19 (m, 8H), 7.10-7.01 (m, 2H), 5.46 (bs, 1H), 5.26-5.11 (m, 2H), 4.21-3.89 (m, 2H), 3.79-3.37 (m, 8H), 2.07-1.71 (m, 2H).

Example 7 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-3-methyl-benzofuran-7-yl) phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy- Pyrrolidine-2-carboxamide The title compound was obtained by carrying out the same operation as Example 4 using the compound of Step 1 of Intermediate 3 instead of 1-bromo-4,5-difluoro-2-methylsulfanyl-benzene. Got.
Yield: 38.1 mg (0.0710 mmol) Yield: 41%
MS (ESI, m / z) 537 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.42-11.23 (m, 1H), 7.91 (d, J = 1.7 Hz, 1H), 7.84-7.76 (m, 2H), 7.72-7.26 (m, 5H ), 7.20-7.14 (m, 2H), 5.40 (bs, 1H), 5.32-5.14 (m, 2H), 4.23-3.87 (m, 2H), 3.81-3.49 (m, 5H), 2.39-2.26 (m , 3H), 2.12-1.68 (m, 2H).

Example 8 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2- Methoxyethyl) benzamide Step 1 Synthesis of ethyl 2-[[3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-methoxyethyl) amino] acetate 2 -Potassium carbonate (69 mg, 0.50 mmol) was added to a solution of 4-methoxyethanamine (0.043 mL, 0.50 mmol) in acetonitrile (4 mL), cooled to −10 ° C. to −15 ° C., and diluted with acetonitrile (1 mL) 2-Bromoethyl acetate (0.055 mL, 0.50 mmol) was added dropwise and stirred for 2 hours. The insoluble material was filtered off, and the residue obtained after concentration under reduced pressure was diluted with dichloromethane (4 mL), and diisopropylethylamine (hereinafter, DIPEA) (0.0871 mL, 0.500 mmol) and intermediate 2-B (81 mg, 81 mg, 0.20 mmol) was added and stirred at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with dichloromethane and washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine. The organic layer was dried over anhydrous magnesium sulfate and the solvent was distilled off under reduced pressure to obtain the title compound without purification.
MS (ESI, m / z) 530 [M + H] ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-methoxyethyl) amino] acetic acid obtained in Step 1 The compound was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.6 mL) was added, and the mixture was stirred at room temperature for 2 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as Intermediate 4-B to give the title compound.
Yield: 63.1 mg (0.0126 mmol) Yield: 63%
MS (ESI, m / z) 502 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.60-7.23 (m, 8H), 7.08 (d, J = 8.8 Hz, 2H), 5.29-5.13 (m, 2H), 4.20-3.97 (m, 2H ), 3.66-3.31 (m, 4H), 3.30-3.10 (m, 3H), 2.39 (s, 3H).
Step 3 Synthesis of Example 8 Compound (30 mg, 0.0598 mmol) obtained in Step 2, methoxyamine hydrochloride (6 mg, 0.0778 mmol), WSC hydrochloride (15 mg, 0.0778 mmol), HOBt · monohydrate The Japanese product (9 mg, 0.0598 mmol) was dissolved in dichloromethane (1 mL), DIPEA (0.021 mL, 0.20 mmol) was added, and the mixture was stirred at room temperature for 2 hr. The reaction solution was evaporated under reduced pressure, and the obtained residue was purified by reverse phase HPLC in the same manner as in Intermediate 4-B to give the title compound.
Yield: 20.0 mg (0.0380 mmol) Yield: 63%
MS (ESI, m / z) 531 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.24-11.07 (m, 1H), 7.60-7.22 (m, 8H), 7.08 (d, J = 8.3 Hz, 2H), 5.28-5.10 (m, 2H ), 4.08-3.74 (m, 2H), 3.70-3.06 (m, 7H), 2.39 (s, 3H).

Example 9 N- (2-amino-2-oxo-ethyl) -3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] -N- [2- (methoxyamino)- 2-oxo-ethyl] benzamide step 1 2-[(2-amino-2-oxo-ethyl)-[3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] amino Synthesis of benzyl acetate Methanol (2.5 mL) and 25 wt% sodium methoxide / methanol solution (0.114 mL) were added to 2-aminoacetamide hydrochloride (55.3 mg, 0.500 mmol) and stirred at room temperature for 10 minutes. Thereafter, the solvent was distilled off under reduced pressure. The obtained residue was diluted with acetonitrile (4 mL), potassium carbonate (69.1 mg, 0.500 mmol) was added, and the mixture was cooled to −10 ° C. to −15 ° C. and then diluted with acetonitrile (1 mL). Benzyl (0.0784 mL, 0.500 mmol) was added dropwise and stirred for 2.5 hours. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (0.0871 mL, 0.500 mmol) and intermediate 1-B (80.0 mg, 0) were added under ice cooling. .201 mmol) was added and stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure, and the residue was diluted with ethyl acetate and washed with 0.5N hydrochloric acid, saturated aqueous sodium hydrogen carbonate solution and saturated brine. The organic layer was dried over anhydrous magnesium sulfate and the solvent was distilled off under reduced pressure to obtain the title compound without purification.
Yield: 173 mg
MS (ESI, m / z) 585 [M + H] ⁺

Step 2 Synthesis of 2-[(2-amino-2-oxo-ethyl)-[3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] amino] acetic acid In Step 1 The obtained compound was dissolved in a mixed solvent of THF (3 mL) and methanol (1.5 mL), 1N lithium hydroxide aqueous solution (0.9 mL) was added under ice cooling, and the mixture was stirred at room temperature for 2 hours. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and the residue was purified by reverse phase HPLC in the same manner as Intermediate 4-B to obtain the title compound.
Yield: 41.2 mg (0.0832 mmol) Yield: 42%
MS (ESI, m / z) 495 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 13.19-12.77 (m, 1H), 8.19 (d, J = 2.3 Hz, 1H), 7.86-7.80 (m, 2H), 7.66-7.46 (m, 5H ), 7.37-7.26 (m, 2H), 7.24 (d, J = 2.3 Hz, 1H), 7.22-7.15 (m, 2H), 5.22 (s, 2H), 4.13-3.87 (m, 4H).
Step 3 Synthesis of Example 9 Compound The compound obtained in Step 2 (50.0 mg, 0.101 mmol), methoxyamine hydrochloride (16.9 mg, 0.202 mmol), WSC hydrochloride (38.7 mg, 0.202 mmol) ), HOBt · monohydrate (30.9 mg, 0.202 mmol) was dissolved in dichloromethane (5 mL), triethylamine (0.042 mL, 0.301 mmol) was added, and the mixture was stirred at room temperature for 1.5 hours. The reaction solution was evaporated under reduced pressure, and the obtained residue was purified by reverse phase HPLC in the same manner as in Intermediate 4-B to give the title compound.
Yield: 32.5 mg (0.0621 mmol) Yield: 61%
MS (ESI, m / z) 524 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.83-11.24 (m, 1H), 8.19 (d, J = 2.3 Hz, 1H), 7.87-7.78 (m, 2H), 7.77-7.44 (m, 5H ), 7.42-7.14 (m, 5H), 5.22 (s, 2H), 4.04-3.84 (m, 4H), 3.67-3.59 (m, 3H).

Example 10 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2- Methylsulfonylethyl) benzamide step 1 2-[[3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-methylsulfonylethyl) amino] ethyl acetate Synthesis To 2-methylsulfonylethanamine hydrochloride (192 mg, 1.20 mmol) was added THF (12 mL) and 25 wt% sodium methoxide / methanol solution (0.274 mL), and the mixture was stirred at room temperature for 30 minutes. did. The filtrate was concentrated under reduced pressure, and the resulting residue was diluted with acetonitrile (9.6 mL), potassium carbonate (166 mg, 1.20 mmol) was added, and the mixture was cooled to −10 ° C. to −15 ° C. Ethyl 2-bromoacetate (0.133 mL, 1.20 mmol) diluted with acetonitrile (2.4 mL) was added dropwise, and the mixture was stirred overnight while slowly returning from −10 ° C. to room temperature. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (0.087 mL, 0.500 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were diluted. ) And stirred at room temperature for 1 hour. Water was added to the reaction mixture, and the mixture was extracted with dichloromethane and washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine. The organic layer was dried over anhydrous magnesium sulfate and the solvent was distilled off under reduced pressure to obtain the title compound without purification.
MS (ESI, m / z) 578 [M + H] ⁺

Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-methylsulfonylethyl) amino] acetic acid Step of Example 8 2 in place of 2-[[3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-methoxyethyl) amino] acetic acid The title compound was obtained by performing the compound obtained in Step 1 by the method.
Yield: 67.8 mg (0.0123 mmol) Yield: 62%
MS (ESI, m / z) 550 [M + H] ⁺
Step 3 Synthesis of Example 10 Compound The same operation as in Step 3 of Example 8 was performed according to 2-[[3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]. The title compound was obtained by using the compound obtained in Step 2 instead of-(2-methoxyethyl) amino] acetic acid.
Yield: 27.2 mg (0.0470 mmol) Yield: 86%
MS (ESI, m / z) 579 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.34-11.14 (m, 1H), 7.69-7.17 (m, 8H), 7.12-7.02 (m, 2H), 5.26-5.11 (m, 2H), 4.04 -3.27 (m, 9H), 3.09-2.82 (m, 3H), 2.39 (s, 3H).

Example 11 (2S, 3S) -1- [3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -N-ethoxy-3-hydroxy-pyrrolidine-2-carboxamide The same operation as in Example 3 was performed using ethoxyamine hydrochloride instead of methoxyamine hydrochloride to obtain the title compound.
Yield: 9.0 mg (0.0172 mol) Yield: 29%
MS (ESI, m / z) 537 [M + H] ⁺
Example 12 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- (2-dimethylaminoethyl) -N- [2- (methoxyamino) -2- Synthesis Step 1 of Oxo-Ethyl] benzamide Trifluoroacetate 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-dimethylaminoethyl ) Amino] acetic acid Synthesis of trifluoroacetate salt N, N-dimethylaminoethylamine (44.1 mg, 0.5 mmol) was dissolved in acetonitrile (1.0 mL) and cooled to 0 ° C. Potassium carbonate (104 mg, 0.55 mmol) was added to the solution, and then benzyl 2-bromoacetate (126 mg, 0.55 mmol) was added, followed by stirring at room temperature for 15 hours while naturally heating. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (2 mL). DIPEA (0.054 mL, 0.313 mmol) and intermediate 2-B (50.6 mg, 0.125 mmol) Was added.
Stir at room temperature for 18 hours. The reaction mixture was diluted with ethyl acetate and washed with saturated aqueous ammonium chloride solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine. The organic layer was dried over anhydrous sodium sulfate and the solvent was distilled off under reduced pressure. THF (1 mL) and MeOH (1 mL) were added to the resulting residue and dissolved. 2N aqueous sodium hydroxide solution (0.13 mL) was added to the solution, and the mixture was stirred at room temperature for 1.5 hours. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as Intermediate 4-B to obtain the title compound.
Yield: 33.7 mg (0.054 mmol) Yield: 43%
MS (ESI, m / z) 515 [M + H] ⁺
Step 2 Synthesis of Example 12 The same operation as in Step 3 of Example 9 was carried out using 2-[(2-amino-2-oxo-ethyl)-[3-[[4- (4,5-difluorobenzofuran-7 -Il) phenoxy] methyl] benzoyl] amino] acetic acid was used in place of the compound obtained in step 1 to give the title compound.
Yield: 27.3 mg (0.0415 mmol) Yield: 87%
MS (ESI, m / z) 544 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.6-10.93 (m, 1H), 9.38 (bs, 1H), 7.62-7.42 (m, 3H), 7.42-7.24 (m, 5H), 7.08 (d , J = 8.3 Hz, 2H), 5.25-5.14 (m, 2H), 4.26-3.78 (m, 3H), 3.68-3.62 (m, 6H), 2.93-2.57 (m, 6H), 2.40 (s, 3H ).

Example 13 3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] -N- [2- (dimethylamino) -2-oxo-ethyl] -N- [2- (methoxy Amino) -2-oxo-ethyl] benzamide Step 1 2-[[3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl]-[2- (dimethylamino) -2 Synthesis of -Oxo-ethyl] amino] acetic acid benzyl 2-amino-N, N-dimethylacetamide (51.1 mg, 0.500 mmol) was dissolved in acetonitrile (4 mL) and potassium carbonate (104 mg, 0.750 mmol) was added. After cooling to −10 ° C. to −15 ° C., benzyl 2-bromoacetate (0.086 mL, 0.550 mmol) diluted with acetonitrile (1 mL) was added dropwise, gradually warmed to room temperature and stirred overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (2.5 mL), and DIPEA (0.044 mL, 0.250 mmol) and intermediate 1-B (100 mg, 0) were added under ice cooling. .251 mmol) was added and stirred at room temperature for 2 hours. 0.5N Hydrochloric acid was added to the reaction mixture, and the mixture was extracted with dichloromethane and washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine. The organic layer was dried over anhydrous magnesium sulfate and the solvent was distilled off under reduced pressure to obtain the title compound without purification.
Yield: 207 mg
MS (ESI, m / z) 613 [M + H] ⁺

Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl]-[2- (dimethylamino) -2-oxo-ethyl] amino] acetic acid The same operation as in Step 2 of Example 8 was carried out using 2-[[3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-methoxyethyl) amino. The title compound was obtained by using the compound obtained in Step 1 instead of ethyl acetate.
Yield: 99.5 mg (0.190 mmol) Yield: 76%
MS (ESI, m / z) 523 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 13.18-12.63 (m, 1H), 8.19 (d, J = 2.3 Hz, 1H), 7.86-7.80 (m, 2H), 7.66-7.55 (m, 2H ), 7.53-7.43 (m, 2H), 7.31-7.25 (m, 1H), 7.24 (d, J = 2.3 Hz, 1H), 7.21-7.15 (m, 2H), 5.26-5.18 (m, 2H), 4.37-3.91 (m, 4H), 3.04-2.65 (m, 6H).
Step 3 Synthesis of Example 13 Compound The same operation as in Step 3 of Example 9 was carried out using 2-[(2-amino-2-oxo-ethyl)-[3-[[4- (4,5-difluorobenzofuran- The title compound was obtained by using the compound obtained in Step 2 (52.3 mg, 0.100 mmol) instead of 7-yl) phenoxy] methyl] benzoyl] amino] acetic acid.
Yield: 48.6 mg (0.0881 mmol) Yield: 88%
MS (ESI, m / z) 552 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.62-11.37 (m, 1H), 8.19 (d, J = 2.3 Hz, 1H), 7.87-7.79 (m, 2H), 7.67-7.15 (m, 8H ), 5.28-5.18 (m, 2H), 4.39-3.79 (m, 4H), 3.64-3.54 (m, 3H), 3.06-2.65 (m, 6H).

Example 14 3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] -N- (3-hydroxypropyl) -N- [2- (methoxyamino) -2-oxo-ethyl ] Benzamide Step 1 Synthesis of 3- (tert-butoxycarbonylamino) propyl acetate 3- (tert-butoxycarbonyl) amino-1-propanol (3.2 g, 18.3 mmol) was dissolved in dichloromethane (30 mL) and DIPEA ( 4.7 mL, 27.1 mmol) and acetyl chloride (1.43 mL, 20.1 mmol) were added at 0 ° C. and stirred overnight. The reaction mixture was diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and the organic layer was dried over anhydrous magnesium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by silica gel chromatography (hexane / ethyl acetate) to give the title compound.
Yield: 4.95 g (22.8 mmol) Yield: Quantitative
¹ H NMR (CDCl ₃ , 400 MHz) δ 4.68 (br, 1H), 4.13 (t, J = 6.2 Hz, 2H), 3.20 (q, J = 6.6 Hz, 2H), 2.05 (s, 3H), 1.82 ( m, 2H), 1.44 (s, 9H).
MS (ESI, m / z) 218 [M + H] ⁺

Step 2 Synthesis of 2- (3-acetoxypropylamino) acetic acid methyl hydrochloride To the compound obtained in Step 1 (18.3 mmol), 4N hydrochloric acid / 1,4-dioxane solution (10 mL) was added and stirred at room temperature overnight. did. The reaction solution was concentrated under reduced pressure. The obtained residue was dissolved in THF (30 mL), methyl bromoacetate (1.14 mL, 12.0 mmol) and DIPEA (6.8 mL, 39.2 mmol) were added at 0 ° C., and the mixture was stirred overnight. The reaction mixture was concentrated under reduced pressure, diluted with chloroform, washed with 1N aqueous sodium hydroxide solution and saturated brine, and the organic layer was dried over anhydrous sodium sulfate. The residue obtained by evaporating the solvent under reduced pressure was dissolved in dichloromethane (30 mL), and di-tert-butyl dicarbonate (3.9 g, 17.9 mmol) and DIPEA (4.7 mL, 27.1 mmol) were added. And stirred for 2 hours. The reaction mixture was concentrated under reduced pressure, diluted with ethyl acetate, washed with 1N hydrochloric acid and saturated brine, and the organic layer was dried over anhydrous magnesium sulfate. The residue obtained by evaporating the solvent under reduced pressure was purified by silica gel chromatography (hexane / ethyl acetate) to give a colorless oil. A 4N hydrochloric acid / 1,4-dioxane solution (10 mL) was added to the obtained oily substance, and the mixture was stirred overnight at room temperature. The reaction solution was distilled off under reduced pressure to obtain the title compound.
MS (ESI, m / z) 190 [M + H] ⁺
Step 3 Synthesis of 2-[[3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl]-(3-hydroxypropyl) amino] acetic acid Compound obtained in Step 2 ( 90.3 mg, 0.400 mmol) was dissolved in dichloromethane (3 mL), DIPEA (0.139 mL, 0.800 mmol) was added, and intermediate 1-B (79.8 mg, 0.200 mmol) in dichloromethane was cooled with ice. The solution (1 mL) was added and stirred at room temperature for 3 hours. The reaction mixture was diluted with dichloromethane and washed with 1N hydrochloric acid, saturated aqueous sodium hydrogen carbonate solution and saturated brine, and the organic layer was dried over anhydrous magnesium sulfate, and the solvent was evaporated under reduced pressure. To the resulting residue were added THF (2 mL) and methanol (1 mL), 1N aqueous lithium hydroxide solution was added under ice cooling, and the mixture was stirred at room temperature for 1 hr. The mixture was neutralized with 2M aqueous trifluoroacetic acid solution under ice cooling and then concentrated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as Intermediate 4-B to obtain the title compound.
Yield: 72.2 mg (0.145 mmol) Yield: 73%
MS (ESI, m / z) 496 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 12.81 (bs, 1H), 8.19 (d, J = 2.2 Hz, 1H), 7.86-7.79 (m, 2H), 7.66-7.42 (m, 4H), 7.37-7.25 (m, 1H), 7.23 (d, J = 2.2 Hz, 1H), 7.21-7.15 (m, 2H), 5.30-5.19 (m, 2H), 4.14-3.93 (m, 2H), 3.51- 3.22 (m, 4H), 1.80-1.60 (m, 2H).

Step 4 Synthesis of Example 14 Compound Methoxyamine hydrochloride (41.8 mg, 0.500 mmol), WSC hydrochloride (21.1 mg, 0.110 mmol), HOBt monohydrate (16.8 mg, 0.110 mmol) Was dissolved in dichloromethane (1.5 mL), triethylamine (0.836 mL, 0.600 mmol) and the compound obtained in Step 3 (49.5 mg, 0.100 mmol) were added, and the mixture was stirred at room temperature overnight. The reaction solution was evaporated under reduced pressure, and the obtained residue was purified by reverse phase HPLC in the same manner as in Intermediate 4-B to give the title compound.
Yield: 17.9 mg (0.0341 mmol) Yield: 34%
MS (ESI, m / z) 525 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.21 (s, 1H), 8.19 (d, J = 2.3 Hz, 1H), 7.86-7.80 (m, 2H), 7.66-7.32 (m, 5H), 7.23 (d, J = 2.3 Hz, 1H), 7.21-7.15 (m, 2H), 5.30-5.14 (m, 2H), 4.04-3.18 (m, 10H), 1.81-1.56 (m, 2H).

Example 15 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2- Oxo-2-pyrrolidin-1-yl-ethyl) benzamide Step 1 Synthesis of tert-butyl N- (2-oxo-2-pyrrolidin-1-yl-ethyl) carbamate 2- (tert-butoxycarbonylamino) acetic acid ( 1.05 g, 6.00 mmol), WSC hydrochloride (1.15 g, 6.00 mmol) and HOBt monohydrate (919 mg, 6.00 mmol) were dissolved in dichloromethane (20 mL) and triethylamine (0.836 mL, 6.00 mmol) and pyrrolidine (0.496 mL, 6.00 mmol) were added and stirred overnight at room temperature. The reaction mixture was diluted with dichloromethane and washed with saturated aqueous sodium hydrogen carbonate solution, 1N hydrochloric acid and saturated brine, and the organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. A mixed solvent of hexane / ethyl acetate was added to the resulting residue and stirred, and the precipitated solid was collected by filtration to obtain the title compound.
Yield: 598 mg (2.62 mmol) Yield: 44%
MS (ESI, m / z) 229 [M + H] ⁺
Step 2 Synthesis of 2 amino-1pyrrolidin-1-yl-ethanone hydrochloride The compound of Step 1 (598 mg, 2.62 mmol) was dissolved in 1,4-dioxane (3 mL), and 4N hydrochloric acid / 1,4-dioxane solution was obtained. (10 mL) was added and stirred at room temperature for 1.5 hours. The reaction mixture was concentrated under reduced pressure, suspended in toluene and concentrated under reduced pressure. Ethyl acetate was added to the resulting residue and stirred, and the precipitated solid was collected by filtration to give the title compound.
Yield: 437 mg (2.65 mmol) Yield: Quantitative

Step 3 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-oxo-2-pyrrolidin-1-yl-ethyl) amino] Synthesis of acetic acid The same procedure as in Steps 1 and 2 of Example 13 was carried out except that the compound (82.3 mg, 0.500 mmol) obtained in Step 2 instead of 2-amino-N, N-dimethylacetamide was used as an intermediate. Intermediate 2-B (103 mg, 0.254 mmol) was used in place of 1-B to give the title compound.
Yield: 98.5 mg (0.178 mmol) Yield: 71%
MS (ESI, m / z) 555 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 13.16-12.73 (m, 1H), 7.59-7.54 (m, 1H), 7.52-7.44 (m, 2H), 7.39-7.25 (m, 5H), 7.11 -7.05 (m, 2H), 5.23-5.15 (m, 2H), 4.29-3.94 (m, 4H), 3.51-3.00 (m, 4H), 2.39 (s, 3H), 1.97-1.61 (m, 4H) .
Step 4 Synthesis of Example 15 Compound The same operation as in Step 3 of Example 9 was carried out by subjecting 2-[(2-amino-2-oxo-ethyl)-[3-[[4- (4,5-difluorobenzofuran- The title compound was obtained by using the compound obtained in Step 3 (52.3 mg, 0.100 mmol) instead of 7-yl) phenoxy] methyl] benzoyl] amino] acetic acid.
Yield: 39.2 mg (0.0672 mmol) Yield: 67%
MS (ESI, m / z) 584 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.83-11.46 (m, 1H), 7.60-7.44 (m, 3H), 7.40-7.26 (m, 5H), 7.10-7.05 (m, 2H), 5.22 -5.14 (m, 2H), 4.27-3.82 (m, 4H), 3.64-3.57 (m, 3H), 3.50-3.01 (m, 4H), 2.39 (s, 3H), 1.97-1.60 (m, 4H) .

Example 16 N- (2-cyanoethyl) -3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo- Ethyl] benzamide Step 1 Synthesis of 2- [2-cyanoethyl- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] amino] acetic acid 2- (2-cyanoethyl Amino) acetic acid (288 mg, 2.25 mmol) was dissolved in a mixed solution of dichloromethane (3 mL) and 1N aqueous sodium hydroxide solution (3 mL), and intermediate 2-B (300 mg, 0.741 mmol) was added under ice-cooling. And stirred at room temperature for 1 hour. After neutralizing the reaction solution, the residue obtained by removing the solvent under reduced pressure was subjected to reverse phase HPLC using ODS as a filler, and contained 0.1% (v / v) trifluoroacetic acid (hereinafter TFA). The title compound was obtained by elution with a mixed solution of water and acetonitrile and lyophilizing the desired fraction.
Yield: 182 mg (0.367 mmol) Yield: 49%
MS (ESI) m / z 497 [M + H] ⁺
Step 2 Synthesis of Compound of Example 16 Compound (34.8 mg, 0.0700 mmol) obtained in Step 1, WSC hydrochloride (14.8 mg, 0.077 mmol), HOBt monohydrate (11.8 mg, 0 0.077 mmol), methoxyamine hydrochloride (8.8 mg, 0.105 mmol), TEA (0.024 mL, 0.175 mmol) and dichloromethane (2 mL) were added, and the mixture was stirred at room temperature for 3 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 20.0 mg (0.0381 mmol) Yield: 54%
MS (ESI) m / z 526 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.42-10.66 (m, 1H), 7.63-7.43 (m, 3H), 7.43-7.20 (m, 5H), 7.15-7.01 (m, 2H), 5.28 -5.09 (m, 2H), 4.24-3.30 (m, 7H), 2.97-2.73 (m, 2H), 2.39 (s, 3H).

Example 17 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2- Pyridylmethyl) benzamide trifluoroacetate step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-pyridylmethyl) amino] acetic acid To a solution of ethyl 2-pyridylmethanamine (0.051 mL, 0.50 mmol) in acetonitrile (4 mL) was added potassium carbonate (69 mg, 0.50 mmol), and the mixture was cooled to −10 ° C. to −15 ° C., and then acetonitrile (1 mL) Ethyl 2-bromoacetate (0.055 mL, 0.50 mmol) diluted with 1 was added dropwise and gradually returned to −10 ° C. to −15 ° C. and stirred overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (0.087 mL, 0.500 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added. And stirred at room temperature for 1.5 hours. The solvent was distilled off under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 563 [M + H] ⁺
Step 2 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-pyridylmethyl) amino] acetic acid Synthesis of trifluoroacetate Step 1 The compound obtained in 1 was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.6 mL) was added, and the mixture was stirred at room temperature for 2 hr. A 1N aqueous lithium hydroxide solution (0.3 mL) was added and stirred, and then the reaction solution was neutralized with a 1N aqueous trifluoroacetic acid solution. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 58.6 mg (0.0903 mmol) Yield: 45%
MS (ESI) m / z 535 [M + H] ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.68-8.54 (m, 1H), 8.08-7.17 (m, 11H), 7.17-6.92 (m, 2H), 5.29-5.10 (m, 2H), 4.89 -4.55 (m, 2H), 4.20-4.04 (m, 2H), 2.39 (s, 3H).
Step 3 Synthesis of Example 17 Compound The compound obtained in Step 2 (35 mg, 0.054 mmol), WSC hydrochloride (13 mg, 0.070 mmol), HOBt monohydrate (8.0 mg, 0.054 mmol), Methoxyamine hydrochloride (8.0 mg, 0.096 mmol), DIPEA (38 μL, 0.22 mmol) and dichloromethane (1 mL) were added and stirred at room temperature for 1 hour. Furthermore, WSC hydrochloride (10 mg, 0.054 mmol), HOBt • monohydrate (8.0 mg, 0.054 mmol), methoxyamine hydrochloride (4.0 mg, 0.054 mmol), DIPEA (19 μL, 0.11 mmol) ) And stirred. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 28.5 mg (0.00401 mmol) Yield: 78%
MS (ESI) m / z 564 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ11.51-11.26 (m, 1H), 8.76-7.21 (m, 12H), 7.09-7.00 (m, 2H), 5.24-5.06 (m, 2H), 4.89-4.57 (m, 2H), 4.02-3.89 (m, 2H), 3.63-3.53 (m, 3H), 2.39 (s, 3H).

Example 18 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (3- Pyridylmethyl) benzamide trifluoroacetate step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(3-pyridylmethyl) amino] acetic acid Synthesis of ethyl To a solution of 3-pyridylmethanamine (51 μL, 0.50 mmol) in acetonitrile (4 mL) was added potassium carbonate (69 mg, 0.50 mmol), cooled to −10 ° C. to −15 ° C., and then acetonitrile (1 mL) Ethyl 2-bromoacetate (55 μL, 0.50 mmol) diluted with 1 was added dropwise, gradually returned to −10 ° C. to −15 ° C. and stirred overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (87 μL, 0.50 mmol) and intermediate 2-B (80 mg, 0.20 mmol) were added to room temperature. For one and a half hours. The reaction solution was concentrated under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 563 (M + H) ⁺
Step 2 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(3-pyridylmethyl) amino] acetic acid Synthesis of trifluoroacetate Step 1 The compound obtained in 1 was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.8 mL) was added, and the mixture was stirred at room temperature for 1 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 35.0 mg (0.0540 mmol) Yield: 27%
MS (ESI) m / z 535 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.84-8.42 (m, 3H), 8.15-7.15 (m, 10H), 7.15-6.93 (m, 2H), 5.18 (s, 2H), 4.82-4.52 (m, 2H), 4.13-3.97 (m, 2H), 2.39 (s, 3H).
Step 3 Synthesis of Example 18 Compound The compound obtained in Step 2 (35 mg, 0.054 mmol), WSC hydrochloride (21 mg, 0.11 mmol), HOBt monohydrate (8.0 mg, 0.054 mmol), Methoxyamine hydrochloride (9.0 mg, 0.11 mmol), DIPEA (47 μL, 0.27 mmol) and dichloromethane (1 mL) were added and stirred at room temperature for 2 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 25.2 mg (0.0372 mmol) Yield: 69%
MS (ESI) m / z 564 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.31-10.82 (m, 1H), 8.95-7.19 (m, 12H), 7.19-6.92 (m, 2H), 5.18 (s, 2H), 4.86-4.58 (m, 2H), 4.28-3.44 (m, 5H), 2.40 (s, 3H).

Example 19 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methanesulfonamido) ethyl] -N- [2- (methoxyamino) 2-Oxo-ethyl] benzamide Step 1 Synthesis of benzyl 2- [2- (methanesulfonamido) ethylamino] acetate N- [2- (methanesulfonamido) ethyl] carbamate tert-butyl (250 mg, 1.05 mmol ) Was dissolved in 4N hydrochloric acid / 1,4-dioxane solution (1.1 mL) and 1,4-dioxane (5 mL), and the mixture was stirred at room temperature for 17 hours. Concentrated under reduced pressure and lyophilized. The obtained residue was dissolved in acetonitrile (3 mL) and DMF (3 mL) and cooled to 0 ° C. To the solution was added potassium carbonate (173 mg, 1.25 mmol), and then benzyl 2-bromoacetate (252 mg, 1.10 mmol) was added, and the mixture was stirred at room temperature for 16 hours with natural temperature rise. The insoluble material was filtered off and concentrated under reduced pressure to give the title compound without purification.
MS (ESI) m / z 287 [M + H] ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-[2- (methanesulfonamido) ethyl] amino] acetic acid Step 1 Half of the compound obtained in 1 was dissolved in dichloromethane (2 mL), DIPEA (0.087 mL, 0.50 mmol) and intermediate 2-B (81.0 mg, 0.200 mmol) were added, and the mixture was stirred at room temperature for 17 hours. . The reaction mixture was diluted with ethyl acetate and washed with saturated aqueous ammonium chloride solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine. The organic layer was dried over anhydrous sodium sulfate and the solvent was distilled off under reduced pressure. To the obtained residue, THF (1 mL) and methanol (1 mL) were added and dissolved. 2N aqueous sodium hydroxide solution (0.3 mL) was added to the solution, and the mixture was stirred at room temperature for 1.5 hours. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 62.5 mg (0.111 mmol) Yield: 55%
MS (ESI) m / z 565 [M + H] ⁺
Step 3 Synthesis of Example 19 Compound (50.7 mg, 0.0898 mmol) obtained in Step 2, WSC hydrochloride (11.3 mg, 0.135 mmol), HOBt monohydrate (25.6 mg, 0 180 mmol), methoxyamine hydrochloride (11.3 mg, 0.135 mmol), DIPEA (0.063 mL, 0.359 mmol) and dichloromethane (1 mL) were added and stirred at room temperature for 16 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 11.5 mg (0.0194 mmol) Yield: 22%
MS (ESI) m / z 594 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.50-10.77 (m, 1H), 7.60-7.43 (m, 3H), 7.43-7.24 (m, 5H), 7.23-6.91 (m, 3H), 5.28 -5.07 (m, 2H), 4.08-3.74 (m, 2H), 3.58-3.48 (m, 1H), 3.40-3.31 (m, 1H), 3.28-3.04 (m, 2H), 2.98-2.75 (m, 3H), 2.39 (s, 3H).

Example 20 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (4- Pyridylmethyl) benzamide trifluoroacetate step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(4-pyridylmethyl) amino] acetic acid Synthesis of ethyl To a solution of 4-pyridylmethanamine (51 μL, 0.50 mmol) in acetonitrile (4 mL) was added potassium carbonate (69 mg, 0.50 mmol), and the mixture was cooled to −10 ° C. to −15 ° C., and then acetonitrile (1 mL) 2-Bromoacetic acid ethyl diluted (55 μL, 0.50 mmol) was added dropwise, and the temperature was gradually returned to −10 ° C. to −15 ° C. and stirred overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (87 μL, 0.50 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added to room temperature. For one and a half hours. The reaction mixture was concentrated under reduced pressure, and the obtained residue was purified by silica gel chromatography (hexane / ethyl acetate) to give the title compound.
Yield: 68.6 mg (0.128 mmol) Yield: 64%
MS (ESI) m / z 563 (M + H) ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(4-pyridylmethyl) amino] trifluoroacetate In Step 1 The obtained compound (68.6 mg, 0.128 mmol) was dissolved in 1,4-dioxane (1 mL), 1N aqueous lithium hydroxide solution (0.256 mL) was added, and the mixture was stirred at room temperature for 1 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 47 mg (0.073 mmol) Yield: 57%
MS (ESI) m / z 535 (M + H) ⁺
Step 3 Synthesis of Example 20 Compound (47 mg, 0.073 mmol) obtained in Step 2, WSC hydrochloride (28 mg, 0.15 mmol), HOBt monohydrate (11 mg, 0.072 mmol), methoxyamine Hydrochloride (12 mg, 0.15 mmol), DIPEA (63 μL, 0.36 mmol) and dichloromethane (1 mL) were added, and the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 35.8 mg (0.0528 mmol) Yield: 73%
MS (ESI) m / z 564 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.36-10.83 (m, 1H), 8.86-8.64 (m, 2H), 7.99-7.17 (m, 10H), 7.16-6.94 (m, 2H), 5.26 -5.06 (m, 2H), 4.94-4.67 (m, 2H), 4.34-3.26 (m, 5H), 2.40 (s, 3H).

Example 21 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (oxazole- 5-ylmethyl) benzamide Step 1 Synthesis of benzyl 2- (oxazol-5-ylmethylamino) acetate Oxazol-5-ylmethanamine hydrochloride (67.3 mg, 0.500 mmol) was diluted with acetonitrile (3 mL) and carbonated. After potassium (173 mg, 1.25 mmol) was added and cooled to 0 ° C., benzyl 2-bromoacetate (0.078 mL, 0.50 mmol) diluted with acetonitrile (1 mL) was added dropwise, gradually returning to room temperature. Stir for 15 hours. The insoluble material was filtered off and concentrated under reduced pressure to give the title compound without purification.
Yield: 100mg
MS (ESI) m / z 247 (M + H) ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(oxazol-5-ylmethyl) amino] acetic acid obtained in Step 1 The compound (100 mg, 1.00 mmol) was diluted with dichloromethane (4 mL), and DIPEA (0.350 mL, 2.00 mmol) and intermediate 2-B (101 mg, 0.250 mmol) were added under ice cooling. And stirred at room temperature for 1.5 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was dissolved in a mixed solvent of THF (2 mL) and methanol (2 mL), 1N aqueous sodium hydroxide solution (1 mL) was added under ice cooling, and the mixture was stirred at room temperature for 2 hr. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 88.3 mg (0.168 mmol) Yield: 67%
MS (ESI) m / z 525 (M + H) ⁺
Step 3 Synthesis of Compound of Example 21 Compound obtained in Step 2 (50.0 mg, 0.0953 mmol), WSC hydrochloride (36.5 mg, 0.191 mmol), HOBt · monohydrate (29.3 mg, 0 191 mmol), methoxyamine hydrochloride (11.9 mg, 0.143 mmol), DIPEA (0.066 mL, 0.381 mmol) and dichloromethane (2 mL) were added and stirred at room temperature for 5 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 45.0 mg (0.0813 mmol) Yield: 85%
MS (ESI) m / z 554 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.3-10.8 (m, 1H), 8.34 (s, 1H), 7.70-7.12 (m, 11H), 7.07 (d, J = 8.3 Hz, 2H), 5.31-5.10 (m, 2H), 4.82-4.48 (m, 2H), 4.01-3.48 (m, 5H), 2.39 (s, 3H).

Example 22 N- (2-diethylaminoethyl) -3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo -Ethyl] benzamide trifluoroacetate step 1 of 2- [2-diethylaminoethyl- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] amino] ethyl acetate Synthesis After adding potassium carbonate (69 mg, 0.50 mmol) to a solution of N, N-diethylethane-1,2-diamine (71 μL, 0.50 mmol) in acetonitrile (4 mL) and cooling to −10 ° C. to −15 ° C. Then, ethyl 2-bromoacetate (55 μL, 0.50 mmol) diluted with acetonitrile (1 mL) was added dropwise, and gradually returned to −10 ° C. to −15 ° C. and stirred overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (87 μL, 0.50 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added to room temperature. For 1 hour. The reaction solution was concentrated under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 571 (M + H) ⁺
Step 2 Synthesis of 2- [2-diethylaminoethyl- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] amino] acetic acid trifluoroacetate salt obtained in Step 1 The obtained compound was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.8 mL) was added, and the mixture was stirred at room temperature for 2 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 98.7 mg (0.150 mmol) Yield: 75% (from step 1)
MS (ESI) m / z 543 (M + H) ⁺
Step 3 Synthesis of Example 22 Compound (35 mg, 0.053 mmol) obtained in Step 2, WSC hydrochloride (20 mg, 0.11 mmol), HOBt · monohydrate (8.0 mg, 0.11 mmol), Methoxyamine hydrochloride (9.0 mg, 0.11 mmol), DIPEA (47 μL, 0.27 mmol) and dichloromethane (1 mL) were added and stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the obtained residue was purified by silica gel column chromatography (dichloromethane / methanol) to obtain the title compound.
Yield: 3.2 mg (0.0047 mmol) Yield: 9%
MS (ESI) m / z 572 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 12.00-10.71 (m, 1H), 7.76-6.97 (m, 10H), 5.29-5.08 (m, 2H), 4.39-2.80 (m, 13H), 2.40 (s, 3H), 1.28-0.74 (m, 6H).

Example 23 (2S, 5R) or (2S, 5S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -N2-methoxy-pyrrolidine -2,5-dicarboxamide Step 1 (2S, 5R) or (2S, 5S) -5-carbamoyl-1- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] Methyl] benzoyl] pyrrolidine-2-carboxylic acid Tetrahedron Lett. 2002, 43, 1597-1598. (2S) -5-oxopyrrolidine-2-carboxylate (1.0 g, 6.62 mmol) to (2S, 5R) or (2S, 5S) -5-cyanopyrrolidine-2-carboxylic acid Ethyl was obtained. The obtained compound was dissolved in 4N hydrochloric acid / dioxane solution and stirred overnight at room temperature. After distilling off the organic solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain (2S, 5R) or (2S, 5S) -5-carbamoylpyrrolidine-2. -Obtained ethyl carboxylate. The obtained compound (285 mg, 1.00 mmol) was diluted with dichloromethane (5 mL), DIPEA (0.440 mL, 2.50 mmol) and intermediate 2-B (202 mg, 0.500 mmol) were added, and then at room temperature. Stir for 18 hours. The reaction mixture was concentrated under reduced pressure, and the resulting residue was dissolved in a mixed solvent of THF (3 mL) and methanol (3 mL), 1N aqueous sodium hydroxide solution (2.5 mL) was added under ice cooling, and the mixture was stirred at room temperature for 1 hr. did. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 50.3 mg (0.0955 mmol) Yield: 19%
MS (ESI) m / z 527 (M + H) ⁺
Step 2 Synthesis of Compound of Example 23 Compound obtained in Step 2 (8.0 mg, 0.0152 mmol), WSC hydrochloride (5.83 mg, 0.0304 mmol), HOBt · monohydrate (4.66 mg, 0 0.0304 mmol), methoxyamine hydrochloride (1.91 mg, 0.0228 mmol), DIPEA (0.013 mL, 0.076 mmol) and dichloromethane (1 mL) were added, and the mixture was stirred at room temperature for 18 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 1.0 mg (0.00180 mmol) Yield: 12%
MS (ESI) m / z 556 (M + H) ⁺

Example 24 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2- Sulfamoylethyl) benzamide Step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-sulfamoylethyl) amino] acetic acid Synthesis of Ethyl To 2-aminoethanesulfonamide hydrochloride (96 mg, 0.60 mmol) was added methanol (2 mL) and 25 wt% sodium methoxide / methanol solution (0.137 mL), and the mixture was stirred at room temperature for 15 minutes. The reaction mixture was concentrated under reduced pressure, acetonitrile (4 mL), DMF (2 mL) and potassium carbonate (83 mg, 0.60 mmol) were added, and the mixture was cooled to −10 ° C. to −15 ° C. and diluted with acetonitrile (1 mL). Ethyl acetate (0.066 mL, 0.60 mmol) was added dropwise, and the mixture was gradually returned to room temperature from −10 ° C. to −15 ° C. and stirred overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (5 mL), and DIPEA (104 μL, 0.600 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added. Stir at room temperature for 2 hours. The reaction solution was concentrated under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 579 (M + H) ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-sulfamoylethyl) amino] acetic acid Obtained in Step 1 The obtained compound was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.8 mL) was added, and the mixture was stirred at room temperature for 2 hr. Further, 1N lithium hydroxide aqueous solution (0.3 mL) was added and stirred overnight, and then the reaction solution was neutralized with 1N trifluoroacetic acid aqueous solution. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 65.5 mg (0.119 mmol) Yield: 59% (from step 1)
MS (ESI) m / z 551 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.74-7.19 (m, 8H), 7.14-6.80 (m, 4H), 5.30-5.06 (m, 2H), 4.23-3.97 (m, 2H), 3.88 -3.61 (m, 4H), 2.40 (s, 3H).
Step 3 Synthesis of Example 24 Compound Compound (35 mg, 0.064 mmol) obtained in Step 2, WSC hydrochloride (24 mg, 0.13 mmol), HOBt monohydrate (10 mg, 0.064 mmol), methoxyamine Hydrochloric acid salt (11 mg, 0.13 mmol), DIPEA (11 μL, 0.19 mmol) and dichloromethane (1 mL) were added and stirred at room temperature for 3 hours. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 26.3 mg (0.00454 mmol) Yield: 71%
MS (ESI) m / z 580 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.36-10.78 (m, 1H), 7.64-6.78 (m, 12H), 5.28-5.08 (m, 2H), 4.21-3.25 (m, 9H), 2.39 (s, 3H).

Example 25 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- [2- (Methylsulfamoyl) ethyl] benzamide Step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-[2- (methylsulfamoyl) Synthesis of ethyl) amino] ethyl acetate To a solution of 2-amino-N-methyl-ethanesulfonamide (59 mg, 0.50 mmol) in acetonitrile (4 mL) was added DMF (1 mL) and potassium carbonate (69 mg, 0.50 mmol). After cooling to −10 ° C. to −15 ° C., ethyl 2-bromoacetate (55 μL, 0.50 mmol) diluted with acetonitrile (1 mL) was added dropwise, and gradually returned to room temperature from −10 ° C. to −15 ° C. Stir overnight. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (87 μL, 0.50 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added to room temperature. For 1 hour. The reaction solution was concentrated under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 593 (M + H) ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-[2- (methylsulfamoyl) ethyl] amino] acetic acid The compound obtained in 1 was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.8 mL) was added, and the mixture was stirred overnight at room temperature. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 69.9 mg (0.124 mmol) Yield: 62%
MS (ESI) m / z 565 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.74-6.80 (m, 11H), 5.30-5.01 (m, 2H), 4.24-3.95 (m, 2H), 3.83-3.28 (m, 4H), 2.70 -2.57 (m, 2H), 2.44-2.33 (m, 4H).
Step 3 Synthesis of Example 25 Compound The compound obtained in Step 2 (36 mg, 0.064 mmol), WSC hydrochloride (24 mg, 0.13 mmol), HOBt monohydrate (10 mg, 0.064 mmol), methoxyamine Hydrochloric acid salt (11 mg, 0.13 mmol), DIPEA (11 μL, 0.19 mmol) and dichloromethane (1 mL) were added and stirred at room temperature for 3 hours. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 21.3 mg (0.00359 mmol) Yield: 56%
MS (ESI) m / z 594 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.35-10.82 (m, 1H), 7.62-6.90 (m, 11H), 5.25-5.10 (m, 2H), 4.26-3.22 (m, 9H), 2.66 -2.33 (m, 6H).

Example 26 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (dimethylsulfamoyl) ethyl] -N- [2- (methoxyamino ) -2-Oxo-ethyl] benzamide Step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-[2- (dimethylsulfamoyl) Synthesis of ethyl) amino] ethyl acetate 2-amino-N, N-dimethyl-ethanesulfonamide hydrochloride (94 mg, 0.50 mmol) in acetonitrile (4 mL) was added to DMF (1 mL), potassium carbonate (173 mg, 1 .25 mmol) was added, and the mixture was cooled to −10 ° C. to −15 ° C., and 2-bromoethyl acetate (55 μL, 0.50 mmol) diluted with acetonitrile (1 mL) was added dropwise. It returned to room temperature and stirred for 6 hours. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (87 μL, 0.50 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added to room temperature. For 1 hour. The reaction solution was concentrated under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 607 (M + H) ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-[2- (dimethylsulfamoyl) ethyl] amino] acetic acid The compound obtained in 1 was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.8 mL) was added, and the mixture was stirred at room temperature for 2 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 27.0 mg (0.0466 mmol) Yield: 23%
MS (ESI) m / z 579 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.65-7.20 (m, 8H), 7.14-7.01 (m, 2H), 5.32-5.11 (m, 2H), 4.25-4.02 (m, 2H), 3.83 -3.38 (m, 4H), 2.82 (s, 3H), 2.61 (s, 3H), 2.39 (s, 3H).
Step 3 Synthesis of Example 26 Compound The compound obtained in Step 2 (35 mg, 0.058 mmol), WSC hydrochloride (33 mg, 0.17 mmol), HOBt monohydrate (13 mg, 0.086 mmol), methoxyamine Hydrochloride (14 mg, 0.17 mmol), DIPEA (40 μL, 0.23 mmol) and dichloromethane (1 mL) were added and stirred overnight at room temperature. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 25.2 mg (0.00414 mmol) Yield: 72%
MS (ESI) m / z 608 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.44-10.75 (m, 1H), 7.71-7.19 (m, 8H), 7.19-7.00 (m, 2H), 5.29-5.08 (m, 2H), 4.26 -3.27 (m, 9H), 2.90-2.53 (m, 6H), 2.39 (s, 3H).

Example 27 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2- Pyrrolidin-1-ylethyl) benzamide Step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-pyrrolidin-1-ylethyl) amino Synthesis of benzyl acetate 2-Pyrrolidin-1-ylethanamine (0.063 mL, 0.500 mmol) was diluted with acetonitrile (4 mL), and potassium carbonate (104 mg, 0.750 mmol) was added and cooled to −10 ° C. Thereafter, benzyl 2-bromoacetate (0.086 mL, 0.550 mmol) diluted with acetonitrile (1 mL) was added dropwise and stirred overnight. The insoluble material was filtered off and concentrated under reduced pressure to give a residue.
MS (ESI) m / z 263 [M + H] ⁺
The obtained residue was diluted with dichloromethane (3 mL), and DIPEA (0.044 mL, 0.250 mmol) and intermediate 2-B (103 mg, 0.254 mmol) were added under ice cooling, followed by 1 hour at room temperature. Stir. Dichloromethane was added to the reaction solution for dilution, and the organic layer was washed successively with 1N aqueous hydrochloric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous magnesium sulfate. The title compound was obtained without purification by concentrating the organic solvent under reduced pressure.
Yield: 193 mg
MS (ESI) m / z 631 [M + H] ⁺
Step 2 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(2-pyrrolidin-1-ylethyl) amino] acetic acid of trifluoroacetate Synthesis The crude product obtained in Step 1 was dissolved in a mixed solvent of THF (2 mL) and methanol (2 mL), 1N aqueous lithium hydroxide solution (1 mL) was added under ice cooling, and the mixture was stirred at room temperature for 1.5 hours. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 91.6 mg (0.140 mmol) Yield: 56% (from step 1)
MS (ESI) m / z 541 (M + H) ⁺
Step 3 Synthesis of Example 27 Compound The compound obtained in Step 2 (50.0 mg, 0.0764 mmol), WSC hydrochloride (29.3 mg, 0.153 mmol), HOBt monohydrate (23.4 mg, 0 .153 mmol), methoxyamine hydrochloride (12.8 mg, 0.153 mmol), DIPEA (0.040 mL, 0.229 mmol) and dichloromethane (2 mL) were added and stirred at room temperature overnight. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 35.5 mg (0.0519 mmol) Yield: 68%
MS (ESI) m / z 570 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.7-10.9 (m, 1H), 9.78-9.30 (m, 1H), 7.65-7.45 (m, 3H), 7.41-7.24 (m, 5H), 7.08 (d, J = 8.3 Hz, 2H), 5.33-5.04 (m, 2H), 4.26-2.73 (m, 15H), 2.40 (s, 3H), 2.14-1.69 (m, 2H).

Example 28 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -N, 3-dimethoxy-pyrrolidine-2-carboxamide Step 1 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-pyrrolidine-2-carboxylate Synthesis Intermediate 2-A (58.0 mg, 0.150 mmol) and methyl (2S, 3S) -3-hydroxypyrrolidine-2-carboxylate (22.0 mg, 0.150 mmol) were dissolved in dichloromethane (1.5 mL). WSC hydrochloride (57.0 mg, 0.300 mmol), HOAt (41.0 mg, 0.300 mmol) and triethylamine (0.063 mL, 0.45 mmol) were added, and the mixture was stirred at room temperature for 1.5 hours. Titled by concentrating under reduced pressure The compound was obtained without purification.
MS (ESI) m / z 514 (M + H) ⁺
Step 2 Synthesis of methyl (2S, 3S) -1- [3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -3-hydroxy-pyrrolidine-2-carboxylate A THF solution (1 mL) of the compound (50 mg, 0.094 mmol) obtained in 1 was cooled to 0 ° C., sodium hydride (13 mg, 0.29 mmol) and THF (0.5 mL) were added, and the mixture was stirred at room temperature for 1.5 hours. Stir. Methyl iodide (18 μL, 0.29 mmol) was added dropwise, and the mixture was stirred at room temperature for 20 minutes. Further, methyl iodide (30 μL, 0.49 mmol) was added and stirred for 30 minutes, and water was added to the reaction solution. The obtained residue was purified by reverse phase HPLC as in Step 1 of Example 16 to give the title compound.
Yield: 25.2 mg (0.0491 mmol) Yield: 50%
MS (ESI) m / z 514 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ7.69-7.21 (m, 8H), 7.16-7.02 (m, 2H), 5.27-5.12 (m, 2H), 4.50-4.18 (m, 1H), 4.07-3.96 (m, 1H), 3.70-3.36 (m, 2H), 3.34-3.19 (m, 3H), 2.39 (s, 3H), 2.08-1.85 (m, 2H).
Step 3 Synthesis of Example 28 Compound The compound obtained in Step 1 (24 mg, 0.047 mmol), WSC hydrochloride (27 mg, 0.14 mmol), HOBt monohydrate (11 mg, 0.070 mmol), methoxyamine Hydrochloride (12 mg, 0.14 mmol), DIPEA (33 μL, 0.19 mmol) and dichloromethane (1 mL) were added, and the mixture was stirred overnight at room temperature. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 18.3 mg (0.00337 mmol) Yield: 72%
MS (ESI) m / z 543 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.56-11.32 (m, 1H), 7.78-7.18 (m, 8H), 7.18-6.99 (m, 2H), 5.27-5.13 (m, 2H), 4.37 -3.21 (m, 10H), 2.39 (s, 3H), 2.13-1.86 (m, 2H).

Example 29 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (pyrimidine- 4-ylmethyl) benzamide Step 1 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(pyrimidin-4-ylmethyl) amino] ethyl acetate Synthesis To a solution of pyrimidin-4-ylmethanamine (55 mg, 0.50 mmol) in acetonitrile (4 mL) was added potassium carbonate (69 mg, 0.50 mmol), cooled to −10 ° C. to −15 ° C., and then acetonitrile (1 mL). 2-Bromoacetic acid ethyl diluted (55 μL, 0.50 mmol) was added dropwise, and the temperature was gradually returned to −10 ° C. to −15 ° C. and stirred for 4 hours. The insoluble material was filtered off, and the residue obtained by concentration under reduced pressure was diluted with dichloromethane (4 mL), and DIPEA (87 μL, 0.50 mmol) and intermediate 2-B (81 mg, 0.20 mmol) were added to room temperature. For 1 hour. The reaction solution was concentrated under reduced pressure to obtain the title compound without purification.
MS (ESI) m / z 564 (M + H) ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl]-(pyrimidin-4-ylmethyl) amino] acetic acid obtained in Step 1 The compound was dissolved in 1,4-dioxane (3 mL), 1N aqueous lithium hydroxide solution (0.8 mL) was added, and the mixture was stirred at room temperature for 2 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 54.7 mg (0.102 mmol) Yield: 51%
MS (ESI) m / z 536 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 9.14 (d, J = 3.7, 1.4 Hz, 1H), 8.76 (t, J = 5.7 Hz, 1H), 7.66-7.17 (m, 9H), 7.09 ( d, J = 8.7 Hz, 1H), 6.99 (d, J = 8.7 Hz, 1H), 5.26-5.07 (m, 2H), 4.80-4.57 (m, 2H), 4.20-4.09 (m, 2H), 2.39 (s, 3H).
Step 3 Synthesis of Example 29 Compound (33 mg, 0.062 mmol) obtained in Step 2, WSC hydrochloride (35 mg, 0.19 mmol), HOBt monohydrate (14 mg, 0.092 mmol), methoxyamine Hydrochloride (15 mg, 0.19 mmol), DIPEA (43 μL, 0.25 mmol) and dichloromethane (1 mL) were added, and the mixture was stirred overnight at room temperature. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 19.6 mg (0.00347 mmol) Yield: 56%
MS (ESI) m / z 565 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.38-10.83 (m, 1H), 9.24-9.06 (m, 1H), 8.85-8.68 (m, 1H), 7.73-6.92 (m, 11H), 5.27 -5.05 (m, 2H), 4.81-4.54 (m, 2H), 4.31-3.75 (m, 2H), 3.70-3.50 (m, 3H), 2.39 (s, 3H).

Example 30 (2S, 4R) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -4-hydroxy-N-methoxy-pyrrolidine-2 -Carboxamide Step 1 (2S, 4R) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -4-hydroxy-pyrrolidine-2-carboxylic acid Synthesis of benzyl (2S, 4R) -4-hydroxypyrrolidine-2-carboxylic acid benzyl hydrochloride (247 mg, 0.958 mmol) in dichloromethane (18 mL) solvent, DIPEA (447 μL, 2.74 mmol) and intermediate 2-B (369 mg, 0.912 mmol) was added and stirred at room temperature for 1 hour. The extract was washed successively with 0.1M aqueous hydrochloric acid solution, saturated multilayered water and saturated brine, and the organic layer was dried over anhydrous magnesium sulfate and concentrated under reduced pressure to give the title compound without purification.
Yield: 514 mg
MS (ESI) m / z 590 (M + H) ⁺
Step 2 Synthesis of (2S, 4R) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -4-hydroxy-pyrrolidine-2-carboxylic acid The compound obtained in Step 1 (80 mg, 0.14 mmol) was dissolved in 1,4-dioxane (1.5 mL), 1N aqueous lithium hydroxide solution (0.217 mL) was added, and the mixture was stirred at room temperature for 3 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
MS (ESI) m / z 500 (M + H) ⁺
Step 3 Synthesis of Example 30 Compound Compound obtained in Step 2, WSC hydrochloride (72 mg, 0.41 mmol), HOBt · monohydrate (31 mg, 0.20 mmol), methoxyamine hydrochloride (34 mg, .0. 41 mmol), DIPEA (95 μL, 0.54 mmol) and dichloromethane (2 mL) were added, and the mixture was stirred at room temperature for 2.5 hours. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 47.4 mg (0.00897 mmol) Yield: 66% (from step 2)
MS (ESI) m / z 529 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.39-10.95 (m, 1H), 7.76-7.18 (m, 8H), 7.19-6.99 (m, 2H), 5.30-5.07 (m, 2H), 4.44 -4.19 (m, 2H), 3.77-3.68 (m, 1H), 3.59 (s, 3H), 3.52-3.16 (m, 2H), 2.39 (s, 3H), 2.16-2.02 (m, 1H), 2.00 -1.83 (m, 1H).

Example 31 (2S, 3S) -3- (cyanomethoxy) -1- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -N-methoxy- Pyrrolidine-2-carboxamide Step 1 (2S, 3S) -3- (Cyanomethoxy) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] pyrrolidine 2-Carboxylic Acid Synthesis The compound obtained in Step 1 of Example 28 (150 mg, 0.292 mmol) in a dichloromethane (2.5 mL) solvent was mixed with 2-bromoacetonitrile (41 μL, 0.58 mmol), silver oxide ( I) (169 mg, 0.730 mmol) and tetrabutylammonium iodide (22 mg, 0.058 mmol) were added, and the mixture was stirred overnight at room temperature. The insoluble material was filtered off, diluted with dichloromethane, washed with saturated multilayered water and saturated brine, and dried over anhydrous magnesium sulfate. The residue was dissolved in 1,4-dioxane (2 mL), 1N aqueous lithium hydroxide solution (0.467 mL) was added, and the mixture was stirred at room temperature for 1.5 hr. The reaction mixture was neutralized with 1N aqueous trifluoroacetic acid solution and evaporated under reduced pressure, and the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 30.5 mg (0.00567 mmol) Yield: 19%
MS (ESI) m / z 539 (M + H) ⁺
Step 2 Synthesis of Example 31 Compound The compound obtained in Step 1 (30 mg, 0.056 mmol), WSC hydrochloride (32 mg, 0.17 mmol), HOBt monohydrate (13 mg, 0.084 mmol), methoxyamine Hydrochloric acid salt (14 mg, 0.17 mmol), DIPEA (40 μL, 0.22 mmol) and dichloromethane (1 mL) were added and stirred at room temperature for 2 hours. The residue obtained by evaporation under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 21.6 mg (0.00381 mmol) Yield: 68%
MS (ESI) m / z 568 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.59-11.19 (m, 1H), 7.62-7.18 (m, 8H), 7.12-6.95 (m, 2H), 5.24-5.00 (m, 2H), 4.61 -3.20 (m, 9H), 2.33 (s, 3H), 2.17-1.88 (m, 2H).

Example 32 3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] -N, N-bis [2- (methoxyamino) -2-oxo-ethyl] benzamide Step 1 N- Synthesis of tert-butyl [2- (methoxyamino) -2-oxo-ethyl] carbamate 2- (tert-butoxycarbonylamino) acetic acid (1.05 g, 6.00 mmol), WSC hydrochloride (1.15 g, 6 .00 mmol), HOBt · monohydrate (919 mg, 6.00 mmol), methoxyamine hydrochloride (501 mg, 6.00 mmol), TEA (1.67 mL, 12.0 mmol) and dichloromethane (20 mL) at room temperature. Stir overnight. The reaction solution was diluted with dichloromethane, and the organic layer was washed successively with 0.5N hydrochloric acid aqueous solution, saturated sodium hydrogen carbonate and saturated brine, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure to obtain the title compound without purification.
Yield: 286 mg
MS (ESI) m / z 205 [M + H] ⁺
Step 2 2-[[3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl]-[2- (methoxyamino) -2-oxo-ethyl] amino] acetate of benzyl acetate Synthesis The compound obtained in Step 1 (283 mg, 1.39 mmol) was dissolved in a mixed solution of dichloromethane (5 mL) and 4N hydrochloric acid / 1,4-dioxane solution (10 mL) and stirred at room temperature for 1 hour. The reaction solution was removed under reduced pressure to obtain a residue. The obtained residue was dissolved in methanol (5 mL), a methanol solution of 25 wt% sodium methoxide (0.318 mL, 1.40 mmol) was added, and the mixture was stirred at room temperature for 10 minutes. The precipitate was filtered off and the solvent was removed under reduced pressure. The resulting residue was diluted with acetonitrile (8 mL), potassium carbonate (289 mg, 2.09 mmol) was added, and the mixture was cooled to −15 ° C., and then acetonitrile (4 mL) was added. ) 2-bromobenzyl acetate (0.24 mL, 1.53 mmol) diluted with was added dropwise and stirred overnight. The insoluble material was filtered off and concentrated under reduced pressure to give a residue. The obtained residue was dissolved in dichloromethane (4 mL), intermediate 1-B (140 mg, 0.350 mmol) and DIPEA (0.061 mL, 0.350 mmol) were added, and the mixture was stirred at room temperature for 2 hr. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 25.0 mg (0.0407 mmol) Yield: 12%
MS (ESI) m / z 615 [M + H] ⁺
Step 3 Synthesis of 2-[[3-[[4- (4,5-Difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl]-[2- (methoxyamino) -2-oxo-ethyl] amino] acetic acid The compound obtained in Step 1 (25.0 mg, 0.0407 mmol) is dissolved in a mixed solvent of THF (1 mL) and methanol (0.5 mL), and 1N lithium hydroxide aqueous solution (0.12 mL) is added under ice cooling. And stirred at room temperature for 3 hours. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 16.5 mg (0.0315 mmol) Yield: 77%
MS (ESI) m / z 525 [M + H] ⁺
Step 4 Synthesis of Example 32 Compound The compound obtained in Step 3 (13.4 mg, 0.0255 mmol), WSC hydrochloride (5.9 mg, 0.0306 mmol), HOBt monohydrate (4.7 mg, 0 0.0306 mmol), methoxyamine hydrochloride (3.2 mg, 0.0383 mmol), TEA (0.009 mL, 0.0638 mmol) and dichloromethane (1 mL) were added, and the mixture was stirred at room temperature for 1 hour. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 5.9 mg (0.0107 mmol) Yield: 42%
MS (ESI) m / z 554 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.5-10.8 (m, 2H), 8.19 (d, J = 2.2 Hz, 1H), 7.87-7.79 (m, 2H), 7.66-7.45 (m, 4H ), 7.42-7.27 (m, 1H), 7.24 (d, J = 2.2 Hz, 1H), 7.21-7.14 (m, 2H), 5.31-5.17 (m, 2H), 4.97-3.26 (m, 10H).

Example 33 N-Benzyl-3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] benzamide Step 1 2 Synthesis of benzyl- (benzylamino) acetate Benzylamine (53.6 mg, 0.500 mmol) was diluted with acetonitrile (1 mL), potassium carbonate (104 mg, 0.750 mmol) was added, and the mixture was cooled to 0 ° C., then acetonitrile ( Benzyl 2-bromoacetate (126 mg, 0.550 mmol) diluted with 1 mL) was added dropwise and stirred for 14 hours. The insoluble material was filtered off and concentrated under reduced pressure to give the title compound without purification.
Yield: 140mg
MS (ESI) m / z 256 [M + H] ⁺
Step 2 Synthesis of 2- [benzyl- [3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] amino] acetic acid Intermediate 1-B (99.7 mg, 0.250 mmol ) Was dissolved in dichloromethane (2 ml). The compound obtained in Step 1 (140 mg, 0.548 mmol) and DIPEA (0.087 mL, 0.500 mmol) were added to the solution, and the mixture was stirred at room temperature for 15 hours. The reaction mixture was diluted with ethyl acetate, washed successively with aqueous ammonium chloride solution, water and saturated brine, and dried over anhydrous sodium sulfate. After the organic layer was concentrated under reduced pressure, the resulting residue was dissolved in a mixed solvent of THF (1 mL) and methanol (1 mL), 1N aqueous sodium hydroxide solution (0.38 mL) was added under ice cooling, and the mixture was stirred at room temperature for 2 hours. did. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 108 mg (0.204 mmol) Yield: 83%
MS (ESI) m / z 528 [M + H] ⁺
Step 3 Synthesis of Example 33 Compound The compound obtained in Step 2 (40 mg, 0.0758 mmol), WSC hydrochloride (29.1 mg, 0.152 mmol), HOBt monohydrate (23.3 mg, 0.152 mmol) ), Methoxyamine hydrochloride (9.52 mg, 0.114 mmol), DIPEA (0.053 mL, 0.303 mmol) and dichloromethane (2 mL) were added, and the mixture was stirred at room temperature for 5 and a half hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 37.1 mg (0.0667 mmol) Yield: 88%
MS (ESI) m / z 557 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.3-10.8 (m, 1H), 8.19 (d, J = 2.2 Hz, 1H), 7.91-7.74 (m, 2H), 7.71-7.52 (m, 3H), 7.52-7.03 (m, 10H), 5.23 (s, 2H), 4.72-4.44 (m, 2H), 3.93-3.65 (m, 2H), 3.47-3.36 (m, 3H).

Example 34 3-[[4- (4,5-Difluoro-2-methoxy-phenyl) phenoxy] methyl] -N- [2- (methoxyamino) -2-oxo-ethyl] -N- (2-methoxy Ethyl) benzamide step 1 Synthesis of benzyl 2-[[3-[[4- (4,5-difluoro-2-methoxy-phenyl) phenoxy] methyl] benzoyl]-(2-methoxyethyl) amino] acetate 2-methoxy Ethaneamine (0.172 mL, 2.00 mmol) was diluted with acetonitrile (12 mL), potassium carbonate (415 mg, 3.00 mmol) was added, and the mixture was cooled to −10 ° C. and then diluted with acetonitrile (4 mL). Benzyl acetate (0.329 mL, 2.10 mmol) was added dropwise and stirred overnight. The insoluble material was filtered off and concentrated under reduced pressure to give a residue.
MS (ESI) m / z 224 [M + H] ⁺
The obtained residue was diluted with dichloromethane (12 mL), and DIPEA (0.174 mL, 1.00 mmol) and intermediate 5 (389 mg, 1.00 mmol) were added under ice-cooling, followed by stirring at room temperature for 2 hours. . Dichloromethane was added to the reaction solution for dilution, and the organic layer was washed successively with 1N aqueous hydrochloric acid solution, saturated aqueous sodium hydrogen carbonate solution and saturated brine, and dried over anhydrous magnesium sulfate. The title compound was obtained without purification by concentrating the organic solvent under reduced pressure.
Yield: 687mg
MS (ESI) m / z 576 [M + H] ⁺
Step 2 Synthesis of 2-[[3-[[4- (4,5-Difluoro-2-methoxy-phenyl) phenoxy] methyl] benzoyl]-(2-methoxyethyl) amino] acetic acid Crude obtained in Step 1 The product was dissolved in a mixed solvent of THF (5 mL) and methanol (5 mL), 1N aqueous lithium hydroxide solution (2.4 mL) was added under ice cooling, and the mixture was stirred at room temperature for 1.5 hours. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 407 mg (0.140 mmol) Yield: 84% (from step 1)
MS (ESI) m / z 486 [M + H] ⁺
Step 3 Synthesis of Compound of Example 34 Compound obtained in Step 2 (40.0 mg, 0.0824 mmol), WSC hydrochloride (19.2 mg, 0.100 mmol), HOBt monohydrate (15.3 mg, 0 .100 mmol), methoxyamine hydrochloride (10.4 mg, 0.124 mmol), DIPEA (0.038 mL, 0.220 mmol) and dichloromethane (2 mL) were added and stirred at room temperature for 2 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 38.2 mg (0.0742 mmol) Yield: 90%
MS (ESI) m / z 515 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.2-10.7 (m, 1H), 7.59-7.28 (m, 7H), 7.23 (dd, J = 7.1, 13.0 Hz, 1H), 7.05 (d, J = 8.1 Hz, 2H), 5.26-5.09 (m, 2H), 4.05-3.79 (m, 2H), 3.76 (s, 3H), 3.67-3.51 (m, 5H), 3.45-3.30 (m, 2H), 3.31-3.09 (m, 3H).

Example 35 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-hydroxy-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy-pyrrolidine-2- Carboxamide intermediate 4-B (76.0 mg, 0.153 mmol) and (4,5-difluoro-2-hydroxy-phenyl) boronic acid (40.0 mg, 0.230 mmol) were combined with 1,4-dioxane (1.5 mL). ) And water (0.5 mL), PdCl ₂ (dppf) (11.2 mg, 0.0153 mmol) and sodium carbonate (35.7 mg, 0.337 mmol) were added, and the mixture was stirred at 100 ° C. for 1 hour. Stir. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 40.2 mg (0.0806 mmol) Yield: 53%
MS (ESI) m / z 499 [M + H] ⁺

Example 36 (2S, 3S) -1- [3-[[4- [4,5-Difluoro-2- (triduteriomethoxy) phenyl] phenoxy] methyl] benzoyl] -3-hydroxy-N-methoxy- Pyrrolidine-2-carboxamide Step 1 (2S, 3S) -1- [3-[[4- [4,5-Difluoro-2- (triduteriomethoxy) phenyl] phenoxy] methyl] benzoyl] -3-hydroxy- Synthesis of pyrrolidine-2-carboxylic acid Intermediate 4-A (98.1 mg, 0.210 mmol) and 1-bromo-4,5-difluoro-2- (trideuteriomethoxy) benzene (39.6 mg, 0.175 mmol) ) Was dissolved in a mixed solution of 1,4-dioxane (1.2 mL) and water (0.4 mL), and PdCl ₂ (dppf) (12.8 mg, 0.0175 mmol) and sodium carbonate (40.8 mg, .0. 385 mmol) was added, and the mixture was stirred at 100 ° C. for 1 hour. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 64.7 mg (0.133 mmol) Yield: 76%
MS (ESI) m / z 499 [M + H] ⁺
Step 2 Synthesis of Example 36 Compound The compound obtained in Step 2 (64.7 mg, 0.133 mmol), WSC hydrochloride (38.3 mg, 0.200 mmol), HOBt monohydrate (30.6 mg, 0 .200 mmol), methoxyamine hydrochloride (22.2 mg, 0.266 mmol), DIPEA (0.070 mL, 0.399 mmol) and dichloromethane (5 mL) were added and stirred at room temperature overnight. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 48.2 mg (0.0935 mmol) Yield: 70%
MS (ESI) m / z 516 (M + H) ⁺

Example 37 (2S, 3S) -N-tert-butoxy-1- [3-[[4- (4,5-difluorobenzofuran-7-yl) phenoxy] methyl] benzoyl] -3-hydroxy-pyrrolidine-2 -Carboxamide Compound obtained in Step 1 of Example 3 (100 mg, 0.20 mmol), WSC hydrochloride (38 mg, 0.20 mmol), O-tert-butylhydroxylamine hydrochloride (26 mg, 0.20 mmol), HOBt -Monohydrate (30 mg, 0.20 mmol) and triethylamine (0.055 mL, 0.40 mmol) were added and stirred overnight at room temperature. The residue obtained by concentration under reduced pressure was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 18.0 mg (0.032 mol) Yield: 16%
MS (ESI) m / z 565 (M + H) ⁺

Example 38 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- (2-methoxyethyl) -N- [2-oxo-2- (2,2 , 2-Trifluoroethoxyamino) ethyl] benzamide Compound obtained in Step 2 of Example 8 (75.2 mg, 0.150 mmol), WSC hydrochloride (34.5 mg, 0.180 mmol), HOBt monohydrate Product (27.6 mg, 0.180 mmol), O- (2,2,2-trifluoroethyl) hydroxylamine hydrochloride (30.7 mg, 0.200 mmol), DIPEA (0.070 mL, 0.400 mmol) and dichloromethane (2 mL) was added and stirred at room temperature for 14 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 22.8 mg (0.0381 mmol) Yield: 25%
MS (ESI) m / z 599 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.9-11.5 (m, 1H), 7.66-7.20 (m, 8H), 7.08 (d, J = 8.2 Hz, 2H), 5.40-5.02 (m, 2H ), 4.63-4.27 (m, 2H), 4.16-3.77 (m, 2H), 3.66-3.37 (m, 4H), 3.31-3.08 (m, 3H), 2.39 (s, 3H).

Example 39 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N- (2,2, 2-Trifluoroethoxy) pyrrolidine-2-carboxamide Step 1 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3 Of 2-hydroxy-pyrrolidine-2-carboxylic acid Intermediate 2-A (58.0 mg, 0.15 mmol) and (2S, 3S) -3-hydroxypyrrolidine-2-carboxylic acid (22.0 mg, 0.15 mmol) Was dissolved in dichloromethane (1.5 mL), WSC hydrochloride (57.0 mg, 0.30 mmol), HOAt (41.0 mg, 0.30 mmol), TEA (0.063 mL, 0.45 mmol) were added at room temperature. Stir for 1.5 hours. The reaction solution was concentrated under reduced pressure to obtain a residue. The obtained residue was dissolved in a mixed solvent of THF (1 mL) and methanol (1 mL), 2N aqueous sodium hydroxide solution (0.5 mL) was added under ice cooling, and the mixture was stirred at room temperature for 1 hr. After neutralizing the reaction solution, the organic solvent was distilled off under reduced pressure, and then the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 6.01 mg (0.0759 mmol) Yield: 12%
MS (ESI) m / z 500 [M + H] ⁺
Step 2 Synthesis of Example 39 Compound The compound obtained in Step 1 (9.0 mg, 0.0018 mmol), WSC hydrochloride (6.90 mg, 0.036 mmol), HOBt monohydrate (5.5 mg, 0 0.036 mmol), trifluoroethoxyamine hydrochloride (4.10 mg, 0.027 mmol), DIPEA (0.013 mL, 0.072 mmol) and dichloromethane (1 mL) were added, and the mixture was stirred at room temperature for 19 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 2.5 mg (0.00419 mmol) Yield: 23%
MS (ESI) m / z 597 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 12.0-11.9 (m, 1H), 7.71-7.23 (m, 8H), 7.15-7.01 (m, 2H), 5.58-5.39 (m, 1H), 5.32 -5.09 (m, 2H), 4.50-4.24 (m, 1H), 4.24-3.94 (m, 2H), 3.76-3.43 (m, 2H), 2.39 (s, 3H), 2.14-1.93 (m, 1H) , 1.89-1.69 (m, 1H).

Example 40 3-[[4- (4,5-Difluoro-2-methoxy-phenyl) phenoxy] methyl] -N- (2-methoxyethyl) -N- [2-oxo-2- (2,2, 2-Trifluoroethoxyamino) ethyl] benzamide Compound of Step 2 of Example 34 (80.8 mg, 0.166 mmol), WSC hydrochloride (35.1 mg, 0.183 mmol), HOBt monohydrate (28. 0 mg, 0.183 mmol), O- (2,2,2-trifluoroethyl) hydroxylamine hydrochloride (10.4 mg, 0.124 mmol), DIPEA (0.038 mL, 0.220 mmol) and dichloromethane (2 mL). In addition, the mixture was stirred overnight at room temperature. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 21.5 mg (0.0369 mmol) Yield: 22%
MS (ESI) m / z 583 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.7 (brs, 1H), 7.58-7.28 (m, 7H), 7.23 (dd, J = 7.1, 13.0 Hz, 1H), 7.05 (d, J = 8.3 Hz, 2H), 5.30-5.08 (m, 2H), 4.56-4.30 (m, 2H), 4.13-3.81 (m, 2H), 3.76 (s, 3H), 3.66-3.49 (m, 2H), 3.43- 3.36 (m, 2H), 3.30-3.10 (m, 3H).

Example 41 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N- (trideuteriomethoxy ) Pyrrolidine-2-carboxamide Step 1 Preparation of a solution of O- (trideuteriomethyl) hydroxylamine in dichloromethane N-hydroxyphthalimide (326 mg, 2.00 mmol), trideuterio (iodo) methane (435 mg, 3.00 mmol), Potassium carbonate (1.38 g, 10.0 mmol) and DMF (6 mL) were added, and the mixture was stirred at 60 ° C. for 3 hr. The reaction solution was diluted with ethyl acetate, washed successively with an aqueous solution of ammonium chloride, an aqueous solution of sodium bicarbonate and saturated brine, and then dried over anhydrous sodium sulfate. After evaporating the solvent under reduced pressure, the obtained residue was dissolved in dichloromethane (10 mL), hydrazine monohydrate (96.0 mg, 2.00 mmol) was added, and the mixture was stirred at room temperature for 14 hr. The insoluble matter generated in the reaction solution was filtered through celite to obtain the title compound prepared in about 0.2M dichloromethane solution without purification.
Step 2 Synthesis of Example 41 Compound Compound of Step 1 of Example 39 (75.0 mg, 0.150 mmol), about 0.2 M solution obtained in Step 1 (1.5 mL, 0.300 mmol), WSC hydrochloric acid Salt (57.5 mg, 0.300 mmol), HOBt monohydrate (45.9 mg, 0.300 mmol), DIPEA (0.105 mL, 0.600 mmol) and dichloromethane (0.5 mL) were added at room temperature. Stir for half an hour. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 48.4 mg (0.0910 mmol) Yield: 61%
MS (ESI) m / z 532 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.53-11.18 (m, 1H), 7.76-7.23 (m, 8H), 7.17-7.02 (m, 2H), 5.48 (s, 1H), 5.30-5.06 (m, 2H), 4.30-3.88 (m, 2H), 3.80-3.48 (m, 2H), 2.39 (s, 3H), 2.17-1.93 (m, 1H), 1.92-1.70 (m, 1H).

Example 42 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N- (2-methoxyethoxy ) Pyrrolidine-2-carboxamide Step 1 Preparation of O- (2-methoxyethyl) hydroxylamine in dichloromethane N-hydroxyphthalamide (326 mg, 2.00 mmol), methoxyethyl bromide (417 mg, 3.00 mmol), triethylammonium ( 0.31 mL, 3.00 mmol) and DMF (4 mL) were added, and the mixture was stirred at 60 ° C. for 29 hours. The reaction solution was diluted with ethyl acetate, washed successively with an aqueous solution of ammonium chloride, an aqueous solution of sodium bicarbonate and saturated brine, and then dried over anhydrous sodium sulfate. After evaporating the solvent under reduced pressure, the obtained residue was dissolved in dichloromethane (7 mL), hydrazine monohydrate (72.6 mg, 1.45 mmol) was added, and the mixture was stirred at room temperature for 15 hr and half. The insoluble matter generated in the reaction solution was filtered through celite to obtain the title compound prepared in about 0.2M dichloromethane solution without purification.
Step 2 Synthesis of Compound of Example 42 Compound of Step 1 of Example 39 (75.0 mg, 0.150 mmol), about 0.2 M solution obtained in Step 1 (1.5 mL, 0.300 mmol), WSC hydrochloric acid Add salt (57.5 mg, 0.300 mmol), HOBt monohydrate (45.9 mg, 0.300 mmol), DIPEA (0.105 mL, 0.600 mmol) and dichloromethane (0.5 mL) and add 4 at room temperature. Stir for half an hour. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 35.0 mg (0.0611 mmol) Yield: 41%
MS (ESI) m / z 573 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.4-11.2 (m, 1H), 7.70-7.21 (m, 8H), 7.15-7.03 (m, 2H), 5.62-5.38 (m, 1H), 5.29 -5.09 (m, 2H), 4.35-4.11 (m, 2H), 3.99-3.84 (m, 1H), 3.77-3.04 (m, 7H), 2.45-2.33 (m, 3H), 2.15-1.91 (m, 1H), 1.89-1.70 (m, 1H).

Example 43 (2S, 3S) -N- (Cyanomethoxy) -1- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy- Pyrrolidine-2-carboxamide Step 1 Preparation of 2-aminooxyacetonitrile in dichloromethane solution N-hydroxyphthalamide (326 mg, 2.00 mmol), cyanomethyl bromide (360 mg, 3.00 mmol), triethylammonium (0.31 mL, 3. 00 mmol) and DMF (4 mL) were added, and the mixture was stirred at 60 ° C. for 4 hours. The reaction solution was diluted with ethyl acetate, washed successively with an aqueous solution of ammonium chloride, an aqueous solution of sodium bicarbonate and saturated brine, and then dried over anhydrous sodium sulfate. After evaporating the solvent under reduced pressure, the obtained residue was dissolved in dichloromethane (9 mL), hydrazine monohydrate (87.9 mg, 1.76 mmol) was added, and the mixture was stirred at room temperature for 15 hr. The insoluble matter generated in the reaction solution was filtered through celite to obtain the title compound prepared in about 0.2M dichloromethane solution without purification.
Step 2 Synthesis of Example 43 Compound Compound of Step 1 of Example 39 (75.0 mg, 0.150 mmol), about 0.2 M solution obtained in Step 1 (1.5 mL, 0.300 mmol), WSC hydrochloric acid Salt (57.5 mg, 0.300 mmol), HOBt monohydrate (45.9 mg, 0.300 mmol), DIPEA (0.105 mL, 0.600 mmol) and dichloromethane (0.5 mL) were added at room temperature. Stir for half an hour. After evaporating the solvent under reduced pressure, the resulting residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 25.3 mg (0.0457 mmol) Yield: 31%
MS (ESI) m / z 554 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.70-7.22 (m, 8H), 7.15-7.03 (m, 2H), 5.61-5.42 (m, 1H), 5.30-5.11 (m, 2H), 4.90 -4.51 (m, 2H), 4.31-3.90 (m, 2H), 3.83-3.45 (m, 2H), 2.39 (s, 3H), 2.19-1.69 (m, 1H).

Example 44 (2S, 3S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-N-isopropoxy-pyrrolidine- 2-Carboxamide Step 1 Preparation of dichloromethane solution of O-isopropylhydroxylamine N-hydroxyphthalamide (326 mg, 2.00 mmol), isopropyl iodide (510 mg, 3.00 mmol), triethylammonium (0.31 mL, 3.00 mmol) And DMF (4 mL) was added and it stirred at 60 degreeC for 4 hours. The reaction solution was diluted with ethyl acetate, washed successively with an aqueous solution of ammonium chloride, an aqueous solution of sodium bicarbonate and saturated brine, and then dried over anhydrous sodium sulfate. After evaporating the solvent under reduced pressure, the obtained residue was dissolved in dichloromethane (9.0 mL), hydrazine monohydrate (87.9 mg, 1.76 mmol) was added, and the mixture was stirred at room temperature for 15 hr. The insoluble matter generated in the reaction solution was filtered through celite to obtain the title compound prepared in about 0.2M dichloromethane solution without purification.
Step 2 Synthesis of Example 44 Compound Compound of Step 1 of Example 39 (75.0 mg, 0.150 mmol), about 0.2 M solution obtained in Step 1 (1.5 mL, 0.300 mmol), WSC hydrochloric acid Add salt (57.5 mg, 0.300 mmol), HOBt monohydrate (45.9 mg, 0.300 mmol), DIPEA (0.105 mL, 0.600 mmol) and dichloromethane (0.5 mL) at room temperature to add 7 Stir for hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 46.7 mg (0.0839 mmol) Yield: 56%
MS (ESI) m / z 557 (M + H) +
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.10-10.86 (m, 1H), 7.66-7.34 (m, 4H), 7.34-7.14 (m, 5H), 7.02 (d, J = 8.2 Hz, 2H ), 5.22-5.03 (m, 2H), 4.21-4.04 (m, 2H), 4.03-3.90 (m, 1H), 3.73-3.44 (m, 2H), 2.32 (s, 3H), 2.06-1.85 (m , 1H), 1.85-1.61 (m, 1H), 1.12-0.85 (m, 6H).

Example 45 N- [2- (cyanoamino) -2-oxo-ethyl] -3-[[4- (4,5-difluoro-2-methoxy-phenyl) phenoxy] methyl] -N- (2-methoxyethyl ) Benzamide Compound of step 2 of Example 34 (50.0 mg, 0.103 mmol), WSC hydrochloride (39.5 mg, 0.206 mmol), HOBt monohydrate (31.6 mg, 0.206 mmol), cyanoamine Hydrochloric acid salt (13.1 mg, 0.154 mmol), DIPEA (0.090 mL, 0.515 mmol) and dichloromethane (2 mL) were added, and the mixture was stirred at room temperature for 21 hours and a half. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 44.8 mg (0.0879 mmol) Yield: 85%
MS (ESI) m / z 510 (M + H) +
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.71-7.15 (m, 8H), 7.15-6.97 (m, 2H), 5.31-5.08 (m, 2H), 4.34-4.07 (m, 2H), 3.76 (s, 3H), 3.69-3.21 (m, 4H), 3.15 (s, 3H).

Example 46 (2S, 3S) -N-cyano-1- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -3-hydroxy-pyrrolidine-2 -Carboxamide Compound obtained in Step 1 of Example 39 (95.0 mg, 0.190 mmol), WSC hydrochloride (72.8 mg, 0.380 mmol), HOBt monohydrate (58.2 mg, 0.380 mmol) ), Cyanoamine (24.3 mg, 0.285 mmol), DIPEA (0.135 mL, 0.760 mmol) and dichloromethane (2 mL) were added and stirred at room temperature for 66 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 68.3 mg (0.130 mmol) Yield: 69%
MS (ESI) m / z 524 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.75-7.65 (m, 1H), 7.65-7.44 (m, 3H), 7.44-7.23 (m, 4H), 7.14-7.05 (m, 2H), 5.29 -5.13 (m, 2H), 4.38-4.27 (m, 1H), 4.28-4.08 (m, 1H), 3.80-3.51 (m, 2H), 2.39 (s, 3H), 2.11-1.95 (m, 1H) , 1.94-1.75 (m, 1H).

Example 47 N- [2- (cyanoamino) -2-oxo-ethyl] -3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- (2-methoxy Ethyl) benzamide Compound obtained in Step 2 of Example 8 (95.0 mg, 0.189 mmol), WSC hydrochloride (72.5 mg, 0.378 mmol), HOBt monohydrate (57.9 mg, .0. 378 mmol), cyanoamine (24.2 mg, 0.284 mmol), DIPEA (0.132 mL, 0.756 mmol) and dichloromethane (2 mL) were added and stirred at room temperature for 14 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 57.5 mg (0.110 mmol) Yield: 58%
MS (ESI) m / z 526 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.61-7.23 (m, 8H), 7.13-7.03 (m, 2H), 5.33-5.07 (m, 2H), 4.33-3.94 (m, 2H), 3.68 -3.37 (m, 4H), 3.27-3.08 (m, 3H), 2.39 (s, 3H).

Example 48 (2S) -N-cyano-1- [3-[[4- (4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] pyrrolidine-2-carboxamide Implementation of WO2013 / 0665835 Example 38 Compound (75.0 mg, 0.155 mmol), WSC hydrochloride (59.4 mg, 0.310 mmol), HOBt monohydrate (47.5 mg, 0.310 mmol), cyanoamine (19.8 mg, 0.35 mmol). 233 mmol), DIPEA (0.108 mL, 0.620 mmol) and dichloromethane (2 mL) were added and stirred at room temperature for 62 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 66.7 mg (0.131 mmol) Yield: 85%
MS (ESI) m / z 508 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.76-7.23 (m, 8H), 7.17-7.01 (m, 2H), 5.31-5.11 (m, 2H), 4.55-4.32 (m, 1H), 3.69 -3.43 (m, 2H), 2.39 (s, 3H), 2.36-2.18 (m, 1H), 2.04-1.75 (m, 3H).

Example 49 N- (2-acetamido-2-oxo-ethyl) -3-[[4- (4,5-difluoro-2-methoxy-phenyl) phenoxy] methyl] -N- (2-methoxyethyl) benzamide The compound of Step 2 of Example 34 (42.8 mg, 0.0883 mmol) was dissolved in a mixed solution of pyridine (1 mL) and dichloromethane (1 mL), and acetyl chloride (0.0094 mL, 0.133 mmol), a small amount under ice-cooling. Of DMAP was added and stirred at 60 ° C. overnight. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 14.7 mg (0.0279 mmol) Yield: 32%
MS (ESI) m / z 527 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.9-10.7 (m, 1H), 7.59-7.31 (m, 7H), 7.28-7.19 (m, 1H), 7.10-6.99 (m, 2H), 5.26 -5.10 (m, 2H), 4.44-4.24 (m, 2H), 3.76 (s, 3H), 3.64-3.35 (m, 4H), 3.29-3.09 (m, 3H), 2.21-2.00 (m, 3H) .

Example 50 (2S) -1- [3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] benzoyl] -N- (1H-tetrazol-5-yl) pyrrolidine- 2-Carboxamide Example 48 compound (35.0 mg, 0.0690 mmol), sodium azide (8.97 mg, 0.138 mmol), ammonium chloride (7.38 mg, 0.138 mmol) and DMF (2 mL) were added to add 120 The mixture was stirred at ° C for 14 and a half hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 11.4 mg (0.0207 mmol) Yield: 30%
MS (ESI) m / z 551 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 12.4-12.0 (m, 1H), 7.72-7.23 (m, 8H), 7.13-6.93 (m, 2H), 5.33-4.97 (m, 2H), 4.77 -4.48 (m, 1H), 4.13-3.46 (m, 2H), 2.39 (s, 3H), 2.38-2.28 (m, 1H), 2.01-1.79 (m, 3H).

Example 51 3-[[4- (4,5-Difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl] -N- (2-methoxyethyl) -N- [2-oxo-2- (1H-tetrazole) -5-ylamino) ethyl] benzamide Example 47 compound (30.0 mg, 0.0571 mmol), sodium azide (14.4 mg, 0.229 mmol), ammonium chloride (12.2 mg, 0.229 mmol) and DMF (2 mL) ) And stirred at 130 ° C. for 14 hours. After evaporating the solvent under reduced pressure, the obtained residue was purified by reverse phase HPLC in the same manner as in Step 1 of Example 16 to obtain the title compound.
Yield: 9.80 mg (0.0172 mmol) Yield: 30%
MS (ESI) m / z 569 (M + H) ⁺
¹ H NMR (400 MHz, DMSO-d ₆ ) δ 12.5-11.9 (m, 1H), 7.65-7.15 (m, 8H), 7.14-6.92 (m, 2H), 5.35-5.03 (m, 2H), 4.48 -4.15 (m, 2H), 3.74-3.38 (m, 4H), 3.28-3.10 (m, 3H), 2.39 (s, 3H).

The structural formulas and physical property values of the compounds obtained in the above Examples are shown in Table 1-1 to Table 1-8.
Table 1-1

Table 1-2

Table 1-3

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Table 1-8

Test Example 1 Glycogen synthase activity measurement A human GYS1 expression plasmid (pCDNA3.1 (+)-hGYS1) was constructed by the following method. Human GYS1 gene was amplified by PCR using human MTC Panel I (Takara Bio, 636742) as a template, and using a cloning primer (Forward Primer: ATGCCTTTAAACCGCAC, Reverse Primer: TTAGTTACGCTCTCTCGC). The amplified human GYS1 sequence was used as a template, a restriction enzyme sequence was added by PCR using subcloning primers (Forward Primer: CCCTCGAGACCATGCCTTTAAACCGCACTTT, Reverse Primer: GGTCTAGATTTAGTTTACGCTCTCTCGCCCAG), and then added to pC3. The human GYS1 gene was introduced into the Xho I site and Xba I site.

Glycogen synthase was prepared by the following method. HEK293T cells derived from human kidney were seeded in a dish (Thermo Fisher Scientific, 168381) using DMEM (Nacalai Tesque, 0845874) medium containing 10% FBS, cultured overnight, and then Lipofectamine LTX (Invitrogen, 15338). -100) was used to transfect the human GYS1 expression vector according to the attached manual. After culturing at 37 ° C. under 5% CO ₂ conditions for 2 days, a lysis buffer (50 mM Tris-HCl (pH 8.0), 10 mM EDTA, 2 mM EGTA, 100 mM NaF, 1 mM PMSF, 1 mM DTT, 1 × Complete (Roche, 1873580) And then homogenized, the mixture was centrifuged at 16000 × g and 4 ° C. for 15 minutes, and the precipitate fraction was re-dissolved by adding a lysis buffer and used for evaluation as glycogen synthase.

The activity of glycogen synthase was measured by the following method. In a polystyrene 96-well half area plate, 30 mM glycylglycine (pH 7.3), 40 mM KCl, 20 mM MgCl ₂ , 9.2% DMSO containing various concentrations of test compound, 10 mM Glucose-6-phosphate ( A solution containing Sigma-Aldrich, G7879) was added at 12 μL / well.
Next, 30 mM glycylglycine (pH 7.3), 4.3 mg / mL glycogen (Sigma Aldrich, G8876), 21.6 mM UDP-glucose (Sigma Aldrich, U4625), 21.6 mM phosphoenolpyruvate A substrate solution containing (Sigma Aldrich, P0564) and 4.05 mM NADH (Sigma Aldrich, N8129) was added at 18 μL / well.
Furthermore, 50 mM Tris-HCl (pH 8.0), 27 mM DTT (Nacalai Tesque, 14128-04), 0.2 mg / mL bovine serum albumin, 0.17 mg / mL glycogen synthase, 1.5 μL pyruvate An enzyme solution containing a kinase / lactate dehydrogenase solution (Sigma Aldrich, P0294) was added at 18 μL / well to obtain a reaction solution. After incubating the reaction solution at 37 ° C. for 25 minutes, absorbance at 340 nm was measured using Benchmark Plus (Bio-Rad Laboratories).

The activity of the test compound was calculated by the following method. The absorbance change (ΔA340) was calculated by subtracting the absorbance at 340 nm of the reaction solution containing the compound and DMSO from the absorbance at 340 nm of the reaction solution containing only DMSO but not the compound. WO / 2011/058154 Example 1 The relative activity (%) at various concentrations of the test compound was calculated by setting ΔA340 of a reaction solution containing 10 μM of the compound at the final concentration to 100%. The compound concentration causing an increase in relative activity of 50% was defined as EC50, and calculated by XLfit (idbs). The results are shown in Tables 2-1 and 2-2.

Table 2-1.

Table 2-2

Test Example 2 PPAR-α Activity Measurement The activity of PPAR-α was measured according to a previous report (THE JOUNAL OF BIOLOGICAL CHEMISTRY Vol.270, No.22: 12953-12956, 1995).
The plasmid used for measuring the activity of PPAR-α was constructed as follows. As the luciferase expression plasmid (UASx5-TK-Luc), a plasmid in which a sequence in which five GAL4 binding sequences of yeast were linked in tandem upstream of the thymidine kinase promoter of pTAL-Luc (Takara Bio, 6252-1) was used. . The PPAR-α receptor expression plasmid (hGR-GAL4-hPPARα) is the N-terminal region (1-76aa) of human GR at the Not I site and Sal I site of pExchange-1 Core Vector (Invitrogen, 21176), and the GAL4 DNA of yeast. A product into which a binding region (1-147aa) and a ligand binding region (167-468aa) of PPARα were introduced was used.

The reporter assay was performed by the following method using CV-1 cells derived from African green monkey kidney. CV-1 cells were seeded in a 96 well plate (Thermo Fisher Scientific, 4938) at 2 × 10 ⁴ cells / well using DMEM (Nacalai Tesque, 0845874) medium containing 10% FBS. After culturing for 2 hours under 5% CO ₂ conditions, plasmid transfection was performed. Transfection was performed using Lipofectamine LTX (Invitrogen, 15338-100) according to the attached manual. A plasmid solution was prepared by adding a mixed solution of a luciferase expression plasmid and a PPAR-α receptor expression plasmid to OPTI-MEM I (Invitrogen, 11058-021). After transfection, a test compound was added, and the cells were cultured at 37 ° C. in the presence of 5% CO ₂ for 18 to 20 hours. After completion of the culture, luciferase activity was measured by Luminescence JNR (ATTO) using Bright-Glo (Promega, E2620).
The PPAR-α induction magnification of the test compound was calculated by the following method. 100 (A / B) where A is the maximum PPAR-α activity at 3 μM, 10 μM, 30 μM, and 100 μM of the test compound, and B is the PPAR-α activity at 100 μM of the compound of WO / 2011/058154. ) As PPAR-α relative induction magnification (%). The results are shown in Tables 3-1 and 3-2.

Table 3-1.

Table 3-2

Test Example 3 Muscle Transferability Test The sodium salt of Example 4 of the compound of the present invention was weighed and dissolved in 0.5% (w / v) methylcellulose # 400 to give a male ob / Ob-mouse (9 weeks old, reared under light-dark reversal illumination, satiety) forcibly single oral administration 30, 60, 120, 300, 480 minutes later, isoflurane under anesthesia and blood collected over time from the jugular vein The plasma was subjected to deproteinization pretreatment, and the plasma drug concentration was quantified by LC / MS / MS.
Further, 480 minutes after administration, which is the final time point, muscles that are medicinal target tissues were collected, subjected to homogenization and preproteinization pretreatment, and the drug concentration in the tissues was quantified by LC / MS / MS.
Similarly, the tissue drug concentrations of the sodium salts of Examples 5, 6, 35 and 36 of the compound of the present invention and the hydrochloride of the compound of Example 27 were also quantified.

On the other hand, the sodium salt of Example 1 compound of WO / 2011/058154 was dissolved in 0.5% (w / v) methylcellulose # 400, and 75 mg / 5 mL / kg administration solution was used as a male ob / ob mouse (7 (Week-old, reared under light-dark reversal illumination, satiety) for 24 days, forced continuous oral administration twice a day, and 2 hours after the final administration, the drug concentration in the tissue was quantified using the same method as described above.
The muscle migration index Kp, app value of each test compound was calculated by the following formula.
Kp, app = muscle drug concentration / plasma drug concentration Table 4 shows the results.

Table 4

Therefore, considering the dose, number of administrations, and collection time, it was estimated that the muscle transferability of the compound of the present invention was much better than the compound of Example 1 of WO / 2011/058154. In particular, the compounds of Examples 4, 6, and 36 of the present invention are at least 10 times or more (for example, 0.74 (Example 4 compound of the present invention) /0.7 (Example 1 compound of WO / 2011/058154)). Is considered excellent.

Test Example 3 Evaluation of L6 Glycogen Accumulation Glycogen accumulation activity in skeletal muscle cells was evaluated according to the following method (ANALYTICAL BIOCHEMISTRY, Vol.261, 159-163, 1998) by the following method. Rat skeletal muscle-derived L6 myoblasts (ATCC) were grown in 96-well collagen using growth medium (α-MEM medium (Nacalai Tesque, 21444-05) containing 10% FBS) at ⁴ × 10 ⁴ cells / 100 μL / well. After seeding on a coated plate (IWAKI, 4860-010) and culturing overnight at 37 ° C. and 5% CO ₂ , the culture medium is replaced with a differentiation medium (α-MEM medium containing 2% FBS) and cultured for 3 days. Thus, differentiation into myotube cells was performed. On the day of evaluation, the medium was replaced with glucose starvation medium (DMEM medium containing 0.1% BSA (Gibco, 11966)) and cultured for 4 hours, and then the test compound at twice the final evaluation concentration and 0.6% Assay medium containing DMSO (DMEM medium containing 0.1% BSA (Nacalai Tesque, 08456-65)) was replaced with 15 μL / well, and D- [U-C14] glucose (PerkinElmer, NEC042V) was replaced with 1.9 μL. After adding 15 μL / well of assay medium containing / well to a final volume of 30 μL / well, incubation was performed at 37 ° C. under 5% CO ₂ for 3 hours. After the incubation, the medium was removed by suction with an aspirator, and after washing twice with PBS, 200 μL / well, 1N NaOH was added at 50 μL / well, and the cells were lysed by incubation at 60 ° C. for 10 minutes. . After returning the lysed cells to room temperature, 5 μL / well of total lysed cells and 10 mg / mg glycogen (Sigma Aldrich, G8876) were added to Multiscreen HTS (Millipore, MSFCN6B) to which 100% ethanol was added in advance at 100 μL / well. Incubation at 20 ° C. for 20 minutes was performed. After the incubation, suction with Multiscreen HTS Vacuum Manifold (Millipore) was performed, and washing was performed twice with 66% ethanol at 200 μL / well. After completely removing ethanol remaining on the filter by drying, 50 μL / well of MicroScint40 (Perkin Elmer) was added, and the amount of [14C] glycogen was measured by TopCount NXT (Perkin Elmer).
The activity of the test compound was calculated by the following method. The measurement value (cpm) of a well containing only DMSO without a compound is A, the measurement value of a well containing a compound and DMSO is B, and the measurement value of a well containing 30 μM of a compound at a final concentration of WO / 2011/058154. The relative activity (%) was calculated as 100 × (BA) / (CA) with C. The compound concentration causing an increase in activity of 50% was defined as EC ₅₀ and calculated by XLfit (idbs).
The results are shown in Table 5.
Table 5

Claims

A compound represented by the following general formula (I) or a pharmaceutically acceptable salt thereof.
Formula (I):

(In the formula, R is represented by the following formula (II) or (III):

(Wherein L 1 and L 2 represent a bond, an alkylene group or a cycloalkylene group,
R a and R b are hydrogen atom, halogen atom, hydroxyl group, cyano group, halogenoalkyl group, aminocarbonyl group, monoalkylaminocarbonyl group, dialkylaminocarbonyl group, alkylsulfonyl group, amino group, monoalkylamino group, Dialkylamino group, alkoxy group, alkylsulfonylamino group, alkylcarbonylamino group, aminosulfonyl group, monoalkylaminosulfonyl group, dialkylaminosulfonyl group, monoalkoxyaminocarbonyl group, cyanoalkoxy group, phenyl group, or at least one Represented by a 5- or 6-membered heterocyclic group having a nitrogen atom, an oxygen atom or a sulfur atom;
R C is represented by —O—R d , a cyano group or a tetrazolyl group,
R d is represented by an alkyl group, a hydroxyalkyl group, a halogenoalkyl group, an alkoxyalkyl group, a cyanoalkyl group or a carboxyalkyl group.
Ar is represented by any of the following rings (IV) to (VI):

(IV) (V) (VI)
These rings may have one or a plurality of substituents, and the substituents are acetamido group, aminocarbonyl group, halogen atom, hydroxyalkyl group, alkyl group, alkoxyalkyl group, cyano group, cyanoalkyl group. Selected from the group consisting of: an amino group, an aminoalkyl group, a monoalkylaminoalkyl group, a dialkylaminoalkyl group, an alkoxy group, and a halogenoalkoxy group;
R 1 represents a halogen atom, a hydroxyl group, an alkyl group, an alkoxy group, a halogenoalkoxy group or an alkylthio group, and R 2 represents a hydrogen atom or an alkyl group. )
In general formula (I), the heterocyclic group in R a of formula (II) and R b of formula (III) may have a substituent, a tetrahydropyran ring, a tetrahydrofuran ring, a pyrrolidine ring, a piperidine ring, Claims represented by a pyridine ring, pyrimidine ring, pyrazine ring, pyridazine ring, furan ring, thiophene ring, oxazole ring, isoxazole ring, thiazole ring, isothiazole ring, imidazole ring, pyrazole ring, oxadiazole ring or thiadiazole ring Item 6. The compound according to Item 1 or a pharmaceutically acceptable salt thereof.
In general formula (I), R c in formula (III) is represented by —O—R d ,
R a and R b are hydrogen atom, halogen atom, hydroxyl group, cyano group, halogenoalkyl group, aminocarbonyl group, monoalkylaminocarbonyl group, dialkylaminocarbonyl group, alkylsulfonyl group, amino group, monoalkylamino group, A dialkylamino group, an alkoxy group, an alkylsulfonylamino group, an alkylcarbonylamino group, or any one of the following formulas (VII) to (IX):

R e is a hydrogen atom, an alkyl group or a halogeno-compound or a pharmaceutically acceptable salt thereof according to claim 1 which is represented by an alkyl group.
In the general formula (I), R a and R b in formula (III) of the formula (II) is, aminosulfonyl groups, mono- alkylaminosulfonyl group, a dialkylamino sulfonyl group, monoalkoxy aminocarbonyl group, cyanoalkoxy group, phenyl Or a group represented by the following formula (X) or (XI):

The compound according to claim 1 or a pharmaceutically acceptable salt thereof.
In general formula (I), R C in formula (III) is represented by a cyano group or a tetrazolyl group.
The compound according to claim 1, 2 or 4, or a pharmaceutically acceptable salt thereof.
The compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, wherein, in the general formula (I), Ar has a substituent of 1 or 2, and these are halogen atoms.
The ring (IV) or (V) in the general formula (I), wherein R 1 is a halogen atom, a hydroxyl group, a methoxy group or a methylthio group, and R 2 is a hydrogen atom or a methyl group. Or a pharmaceutically acceptable salt thereof.
In the formula (II) or formula (III), L 1 is a bond, and L 2 is an alkylene group having 1 to 3 carbon atoms, or the compound according to any one of claims 1 to 7 or a pharmaceutically acceptable salt thereof. Salt.
9. The ring (IV) in the general formula (I), wherein R 1 is a halogen atom, a methoxy group, a —OCD 3 group (D represents deuterium) or a methylthio group. Or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition comprising the compound according to any one of claims 1 to 9, or a pharmaceutically acceptable salt thereof.
A pharmaceutical composition for treating diabetes, comprising the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof.
A glycogen synthase activator comprising the compound according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof.