WO2014168447A1 - 천연물 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품 - Google Patents

천연물 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품 Download PDF

Info

Publication number
WO2014168447A1
WO2014168447A1 PCT/KR2014/003138 KR2014003138W WO2014168447A1 WO 2014168447 A1 WO2014168447 A1 WO 2014168447A1 KR 2014003138 W KR2014003138 W KR 2014003138W WO 2014168447 A1 WO2014168447 A1 WO 2014168447A1
Authority
WO
WIPO (PCT)
Prior art keywords
weight
parts
cancer
kiom
extract
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2014/003138
Other languages
English (en)
French (fr)
Inventor
마진열
김애영
임남희
임민주
김태수
정영필
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Institute of Oriental Medicine KIOM
Original Assignee
Korea Institute of Oriental Medicine KIOM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Institute of Oriental Medicine KIOM filed Critical Korea Institute of Oriental Medicine KIOM
Publication of WO2014168447A1 publication Critical patent/WO2014168447A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/23Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
    • A61K36/234Cnidium (snowparsley)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/02Medicinal preparations containing materials or reaction products thereof with undetermined constitution from inanimate materials
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/17Gnetophyta, e.g. Ephedraceae (Mormon-tea family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/23Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
    • A61K36/232Angelica
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/23Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
    • A61K36/238Saposhnikovia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/28Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/28Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
    • A61K36/284Atractylodes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/29Berberidaceae (Barberry family), e.g. barberry, cohosh or mayapple
    • A61K36/296Epimedium
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/34Campanulaceae (Bellflower family)
    • A61K36/346Platycodon
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/35Caprifoliaceae (Honeysuckle family)
    • A61K36/355Lonicera (honeysuckle)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/48Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
    • A61K36/484Glycyrrhiza (licorice)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/53Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • A61K36/534Mentha (mint)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/53Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • A61K36/539Scutellaria (skullcap)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/63Oleaceae (Olive family), e.g. jasmine, lilac or ash tree
    • A61K36/634Forsythia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/65Paeoniaceae (Peony family), e.g. Chinese peony
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/69Polygalaceae (Milkwort family)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/70Polygonaceae (Buckwheat family), e.g. spineflower or dock
    • A61K36/708Rheum (rhubarb)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/74Rubiaceae (Madder family)
    • A61K36/744Gardenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/88Liliopsida (monocotyledons)
    • A61K36/906Zingiberaceae (Ginger family)
    • A61K36/9068Zingiber, e.g. garden ginger
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • the present invention administers a pharmaceutical composition for the prevention or treatment of cancer comprising a mixed medicinal herb extract derived from natural plants as an active ingredient, a health functional food for preventing or improving cancer, and a composition comprising a mixed medicinal herb extract derived from natural plants.
  • It relates to a method for preventing or treating cancer, including the step of, more specifically, cheongung, windproof, Angelica, peony, pontoon, peppermint, ephedra, manganese, rhubarb, gypsum, Giltyeong, golden, baekchul, gardenia, mold, ginger,
  • a method for preventing or treating cancer comprising administering a composition comprising an extract.
  • Cancer has the highest mortality rate worldwide and is the second most common cause of death in Western society after cardiovascular disease.
  • lung cancer is increasing due to the aging population and the increase of smoking population and air pollution.
  • eating habits are westernized due to westernized eating habits, and rapid increase in environmental pollutants and increase in alcohol consumption.
  • Prostate cancer is on the rise.
  • the creation of anti-cancer substances that can contribute to the promotion of human health, the improvement of healthy quality of life and the promotion of human health by enabling early prevention and treatment of cancer are urgently required.
  • Cancer metastasis refers to the migration of early tumors into blood vessels or lymphatic vessels to other organs with respect to the growth and proliferation of cancer cells (Cavallaro U, Christofori G. Cell adhesion in tumor invasion and metastasis: loss of the glue is not enough Biochem Biophys Acta 2001; 1552: 39-45), metastasis is a secondary process of metastatic cancer cells that proliferate at other sites by invasion through the blood vessels into the surrounding tissues after metastases are released from the site of origin. By a series of processes that form a tumor. This process begins with the breakdown of the extracellular matrix.
  • the enzymes that break down the extracellular matrix include matrix metalloproteinase (MMP), serine protease (plasmin), and urokinase plasminogen activator (urokinase).
  • MMP matrix metalloproteinase
  • plasmin serine protease
  • urokinase plasminogen activator
  • uPA urokinase plasminogen activator
  • cysteine protease cysteine protease
  • has Liotta LA, Trygguason K, Garbisa S, Hart I, Foltz CM, Shafie S. Metastasis potent alcor relate with enzymatic degradation of basement membrane collagen Nature 1980; 284.: 67-68).
  • MMPs Matrix metalloproteinases
  • MMPs are proteolytic enzymes that play an important role in inducing and metastasis of cancer cells by decomposing extracellular matrix and basement membrane. Thus, more than 20 species have been isolated and identified.
  • MMP is an endoproteinase that uses zinc as a coenzyme, and is divided into collagenase, gelatinase, stromelysins, and Membrane-type MMP according to structure and characteristics. .
  • MMP-2 72 kDa type IV collagenase; gelatinase A
  • MMP-9 92 kDa type IV collagenase; gelatinase B
  • MMP-9 is known to play an important role in the invasion and metastasis of breast cancer (Scorilas A. et al., Br. J. Cancer , 84, pp 1488-96, 2001).
  • cancer-causing stimulants such as cytokines and PMA (phorbol 12-mysistate 13-acetate) may It is known to regulate the expression of MMP-9 by regulating the activation of transcription factors such as NF- ⁇ B (Sato H., et al., Oncogene , 19, pp2904-2912, 2000; Lee SO, et al., Biochem Biophys.Res.Commun . , 354, pp165-171, 2007).
  • cytokines and PMA phorbol 12-mysistate 13-acetate
  • a method for treating cancer is to remove cancer tissue from the body at the cellular level.
  • Current cancer treatments are divided into surgical, radiotherapy, and chemotherapy.
  • Surgery is the removal of cancer from the body at the tissue level, which is most rational, but at the cellular level, it is difficult to completely remove the microscopic lesions that invade surrounding tissue or metastasize to the lymph gland. Therefore, surgery is very effective for early cancers or cancers with only a limited number of lesions (cancer stage 1 or 2), but for advanced stage 3 cancers, radiotherapy or chemotherapy is used. It is necessary to use together.
  • Radiotherapy and chemotherapy are mainly used for advanced cancer or terminal cancer after stage 3, but in laryngeal cancer and cervical cancer, even one stage of cancer is cured only by radiotherapy, and radiotherapy is the first priority.
  • the first stage in order to preserve the function of the vocal cords, the first stage may be radiotherapy only, and the second stage may be combined with partial surgery or chemotherapy.
  • small cell carcinoma of lung cancer has a poor prognosis even when conventionally performed by surgical therapy, but now chemotherapy is a priority and often use radiation therapy in combination. This therapy has recently been able to increase the survival rate, albeit slightly.
  • Cnidii Rhizoma is a dried perennial herbaceous perennial herb, Cnidium officinale MAKINO, which is taken from September to October to remove heat. It has a pain relief effect that helps blood circulation and alleviates pain, so it is often applied to headaches, and it is known to have a hematopoietic effect when applied to anemia in addition to activating the function of the liver.
  • Windproof (Ledebouriella seseloides WOLFF.) Is made using the roots and rhizomes of Sapshnikovia divaricata Schiskin. It has a peculiar smell, weakness, spicy, sweet and warm. It is effective for all kinds of symptoms such as external headache, chills, fever, systemic pain, sore throat, etc., and it is used for cold-limb joint pain, tetanus, muscle cramps, paralysis of paralysis, paralytic pain, itching, and ringworm.
  • antipyretics, anti-inflammatory, jingyeong, immune activation, anti-allergic, anti-ulcer, antibacterial, inhibiting skin improvement bacteria have been reported.
  • Angelica Gigantis Radix is the root of the umbeliferae plant, Angelicae, which is warm in nature, sweet in taste and very non-poisonous. It is known to be effective in improving blood circulation, blood pressure lowering effect, pain relief, spasm control, constipation improvement through promoting colon circulation, and removing blood blood, which alleviates all wind sickness, blood clots and pain.
  • Peony (Paeonia lactiflora Pall.) Is a perennial herb and peony perennial herb, distributed in Korea, Mongolia and East Siberia, and used for horticulture because of its beautiful flowers. Root is known to be effective in the treatment of pain, abdominal pain, amenorrhea, dysmenorrhea, hemostasis, anemia, bruises.
  • Forsythia Viridissima Lindley or Forsythia suspensa Vahi which belongs to Oleaceae. It has a peculiar smell, taste and bitterness. Yeonkyo lowers and detoxifies the fever, so the heart heat is lowered early in the fever and used for high fever and mental confusion. Boils, rashes, appendicitis, lung abscesses, lymphadenitis, and sore throat are known to have diuretic and anti-inflammatory effects. In addition, pharmacological action is known to have antibacterial action, anti-inflammatory action, blood pressure lowering, hemostatic action, liver treatment action, fever, clay, diuretic action.
  • Peppermint leaf is a leaf of Mentha arvensis var. Piperascens, a perennial herb that is a dicotyledon plant moth plant. It is cold, sour, dry, dry, and feverish. Therefore, it is widely used as a treatment for indigestion, chest bloating, bloating (cold), headache, toothache, sore throat, purpose, and sores.
  • Ephedra sinica is a medicinal herb made from Ephedra sinica Stepf or soft stems of the same plant. It has a tendency to numb the tongue slightly, tastes spicy, bitter, and warm. . Dissipate the wind, sweating, chills, fever, headache, asthma, seawater, species, paralysis of the upper body, skin paralysis, hyperemia, blood is used.
  • the forget-me-not (Erigeron canadensis) is a biennial plant of the dicotyledon plant Campanula Asteraceae. It is known to be effective in stomatitis, globules, stool irritation, swelling, pain, diarrhea, sebum, detoxification, fever, fatigue, and customs.
  • Rhubarb is an adverse odor that is made by using the root stems of Rheum palmatum L., Rheum tanguticum Maximowicz, and Rheum officinale Baillon, a perennial herb that belongs to the genus. If you chew it in, it feels like chewing on the fine sand, and it is steamed, bitter, and cold. Headache, congestion, sore throat, constipation, nosebleeds, bleeding, boils and is effective for diuretic, edema. Pharmacological action is known to promote colon movement, fever, body temperature, bile secretion, blood clotting time, antibacterial, diuretic, liver function protection.
  • Gypsum fibrosum is a very good medicine that lowers heat, tastes sweet and sweet and is very cold. It is also effective for headaches and toothaches caused by severe heat in the body. Recently, it is known that it is used for epidemic type B encephalitis, epidemic meningitis, and pneumonia. In addition, antipyretic, sedative, hypoglycemic, anti-inflammatory, mild diuretic effects have been reported.
  • Gilkyung is a medicine made by removing the roots or cuticles of Platycodon grandiflorum A.
  • De Candolle which has a slight smell, tastes bitter, and has a flat nature. It is used for sore throat, cold cough, phlegm, nasal congestion, asthma, bronchitis, pleurisy, headache, chills, tonsillitis, etc.As pharmacological actions include expectorant action, hypoglycemic action, cholesterol lowering action, and inhibitory action. have.
  • Gold is a medicinal herb made from the root of Scutellaria baicalensis GEORGE, a perennial herb that belongs to the Lamiaceae family.It is effective in pediatric acute respiratory infections, chronic bronchitis, acute dysentery, infectious hepatitis, nephritis, pyelonephritis, and hypertension. Pharmacological actions include anti-inflammatory, antipyretic, diuretic, lowering blood pressure, lowering blood sugar and hyperlipidemia, promoting bile secretion, and sedative effects.
  • Baekchul is a dried herb that removes rhizome or bark of Atractylodes japonica Koidzumi or Atractylodes macrocephala Koidzumi. It is slightly viscous and chewy and warm when chewed. Intestinal inhibitory and excitatory control, anti-ulcer and hepatic function protection, immune hyperactivity, vasodilation, diuretic and hypoglycemic activity have been reported.
  • Gardenia jasminoides is the fruit of the gardenia jasminoides, which is known for its effects on diarrhea, rhizome, clear heat, diuresis, bleeding and detoxification.
  • Schizonepeta rhizome is an annual herb that belongs to the Lamiaceae family. It has antipyretic effect and is used for sweating and antipyretic in the early stage of cold. It is used for sore throat, skin disease, stroke, etc., and it is applied to uterine bleeding, nosebleed, fecal bleeding, hemorrhage, urine bleeding when it is blackened. .
  • Ginger means fresh rhizome of Zingiber officinale Roscoe in Korea, China and Japan. Ginger treats chills, fever, headache, vomiting, seawater, and phlegm caused by an external cold, and it is effective for abdominal diarrhea and abdominal pain caused by food poisoning. Pharmacological action has been reported to promote gastric juice secretion, digestion, cardiac excitement, blood circulation, fungi.
  • Talc is a drug whose main effect is to stimulate water metabolism. Temper is sweet, light and cold. Talc has been reported to protect the skin mucosa, antibacterial action, diuresis, sedation (stop thirst), fever, detoxification, anti-inflammatory, urination pain, fever of heat stroke, canning, diarrhea.
  • Licorice (Glycyrrhiza uralensis Fischer or Glycyrrhiza glabra L.) is a perennial herb of the dicotyledonous rosewood legume, with an unusual smell and taste. Licorice harmonizes the toxic effects of all drugs to make the drug appear well, manages the heat and morale of the book, and communicates all blood vessels, and strengthens muscles and bones. Pharmacological action is effective in detoxification, hepatitis, urticaria, dermatitis, eczema, etc. It is known to have antitussive, expectorant, muscle relaxation, diuretic, anti-inflammatory and inhibit peptic ulcer.
  • Gold and silver coins refer to the buds of the locust (Lonicera japonica Thunberg) or its varieties. It has a peculiar smell, sweet taste and cold nature. Gold and silver coins are used to reduce heat, when the chest is stuffy and thirsty. It is used for inflammation, and it is used to release boils, skin toxins, organ inflammation, and pus. In addition, it is used for necrosis of the skin tissue due to dysentery and heat poisoning, mastitis, etc., and has been applied to colitis, gastric ulcer, cystitis, sore throat, tonsillitis, bronchitis, conjunctivitis and swelling, mumps and musculitis. Pharmacological action, antibacterial action, anti-inflammatory action, antipyretic action, leukocyte phagocytosis increase, central nervous system excitability, serum cholesterol lowering, ulcer prevention effect has been reported.
  • Eum yang-gyeok means the perennial herbaceous plant (Epimedium koreanum Nakai) or other perennial roots (stems and leaves) of dicotyledonous plant (Prunus paniculata). It is odorless, tastes sweet and warm.
  • Yin and Yang are used for erectile dysfunction, oil well, cold uterus, cold limb, skin paralysis, ophthalmology, forgetfulness, paraplegia, low back and knee weakness, hypertension, polio.
  • Pharmacological actions include semen secretion promotion, blood pressure strengthening, coronary blood flow increase, hypoglycemia, cholesterol lowering, immune function enhancement, Jinhae, expectoration, Pyeongcheon, sedation, fungi, anti-inflammatory action, chicken femoral growth and protein polysaccharide activation Is reported.
  • Polygala tenuifolia is a perennial herb of the dicotyledonous mouse handicap grass family. It is used as an expectorant, tonic, or pill.
  • the elecampane refers to the root of the perennial herbaceous Aucklandia lappa Decne., Which has a peculiar smell, the taste is spicy, bitter and warm. Mokyang is used for abdominal pain caused by the abdomen, flat stomach symptoms, vomiting and diarrhea. It is effective for chronic inflammation of the digestive organs and stomach pain. Pharmacological action is to release bronchial and small intestine spasms, blood pressure lowering action, antibacterial action is known.
  • HT1080 is a classic cancer cell line extract consisting of Peony, Peony, Mint Leaf, Ephedra, Forget-me-not, Rhubarb, Gypsum, Giltyeong, Golden, Whitening, Gardenia, Hungae, Ginger, Talc, Licorice, Gold Silver Coin, Yin Yang Kwak, Wonji and Mokji.
  • One object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer, which is safe for the human body and contains a mixed medicinal herb extract having an effective anticancer effect as an active ingredient.
  • Another object of the present invention to provide a health functional food for the prevention or improvement of cancer comprising the mixed medicinal herb extract as an active ingredient.
  • Still another object of the present invention is to provide a method for preventing or treating cancer, comprising administering to a subject in need thereof a composition comprising the mixed medicinal extract.
  • the present invention relates to a natural extract effective for the prevention or treatment of cancer, and has an effective metastasis inhibition, induction of cell death and cell growth inhibitory activity against cancer cells, as well as pharmaceutically usable as a composition for the prevention or treatment of cancer It can also be usefully used as a dietary supplement.
  • Figure 1 shows the results of analyzing the cell death induction effect of the mixed medicinal herb extract (KIOM-C) against various classical cancer cell lines (B16F10, HT1080, AGS and A431).
  • KIOM-C mixed medicinal herb extract
  • Figure 2 shows the results of analyzing the effect on the HT1080 cell cycle progression according to the treatment of the mixed medicinal extract (KIOM-C).
  • Figure 3 shows the results of analyzing the expression of the cell cycle-related protein changes according to the treatment of the mixed medicinal extract (KIOM-C).
  • 4A to 4E show the results of analysis of apoptosis and autophagy induction according to the treatment of the mixed medicinal extract (KIOM-C).
  • 5a to 5e show the results of analyzing the cell death induction mechanism by the treatment of the mixed medicinal extract (KIOM-C) by Western blot.
  • 6a to 6c show the results of analyzing the effect of tumor cell death caused by the induction of intracellular oxidative stress following the treatment of the mixed medicinal herb extract (KIOM-C).
  • Figure 8 shows the non-adherent colony forming ability of cancer cells (B16F10 (A) and HT1080 (B)) according to the treatment of the mixed medicinal extract (KIOM-C).
  • 9A and 9B show wound healing assay results according to the treatment of the mixed medicinal herb extract (KIOM-C).
  • 10A and 10B show the results of a transwell migration and invaation assay according to the treatment of the mixed medicinal herb extract (KIOM-C).
  • Figure 11 shows the effect of mixed medicinal herb extract (KIOM-C) on MMP-9 activity according to the treatment of mixed medicinal herb extract (KIOM-C) RT-PCR (A), Western blot (B and D) and gelatin The results are analyzed by Gelatin zymography (B and C).
  • KIOM-C mixed medicinal herb extract
  • Figure 12 shows the results of Western blot analysis of the effect of the mixed medicinal extract (KIOM-C) on NF- ⁇ B activation by PMA stimulation.
  • the mixed medicinal herb extract (KIOM-C) was administered to mice injected with B16F10 lung cancer cell line, and the degree of lung metastasis was analyzed by visual observation analysis (FIG. 13A) and the number of colonies (FIG. 13B). One result is shown.
  • FIG. 14a shows the tumor volume change for about 15 days (Fig. 14a) and tumors extracted 15 days later.
  • FIG. 14b The results of the mass observation (FIG. 14b), tumor mass change (FIG. 14c) and interferon-gamma (IFN- ⁇ ) secretion concentration (FIG. 14d) are shown.
  • Fig. 15 shows the results of comparative analysis of cancer cell viability (cancer apoptosis effect) of the mixed medicinal herb extracts (KIOM-C) and the extracts of each sweetener component.
  • FIG. 16 shows the results of analysis of gelatin zymography on the change of MMP-9 activity caused by rhubarb extract and ephedra extract in the sweetening ingredients.
  • the present invention is a cheongung, windproof, donkey, peony, yeonkyo, peppermint, ephedra, forget-me-not, rhubarb, gypsum, gilyeong, golden, white leach, gardenia, mold, ginger, talc, licorice It provides a pharmaceutical composition for the prevention or treatment of cancer, including the extract of the mixed medicinal herb, gold and silver, yin and yang, paper and neck.
  • the composition is based on 1 part by weight of yin and yang, 1 part by weight to 3 parts by weight, 1 part by weight to 3 parts by weight windproof, 1 part by weight to 3 parts by weight, peony 1 part by weight to 3 parts by weight, 1 part by weight of duct bridge To 3 parts by weight, peppermint 1 to 3 parts by weight, ephedra 1 to 3 parts by weight, 1 to 3 parts by weight of forget-me-not, 1 to 3 parts by weight of rhubarb, 0.5 to 3 parts by weight of gypsum, 0.5 to 3 parts by weight, 0.5 to 3 parts by weight of gold, 0.5 to 2 parts by weight, 0.5 to 2 parts by weight, 0.5 to 2 parts by weight of gardenia, 0.5 to 2 parts by weight, 1 part by weight of ginger 3 parts by weight, talc 1 part by weight to 5 parts by weight, licorice 1 part by weight to 3 parts by weight, 1 part by weight to 3 parts by weight of gold coins, 1 part by weight to 3 parts by weight
  • extract refers to a formulation prepared by squeezing the herbal medicine with a suitable leach solution and evaporating the leach solution, but not limited thereto, but the extract obtained by the extraction treatment, the dilution or concentrate of the extract, the extract It may be a dried product obtained by drying, these adjustment products, or a refined product.
  • the mixed medicinal extract can be prepared using common extraction methods, separation and purification methods known in the art.
  • the extraction method is not limited thereto, but preferably, hot water extraction, hot water extraction, cold needle extraction, reflux cooling extraction, or ultrasonic extraction may be used.
  • the extract may be prepared by extracting with an extracting solvent or by fractionating the fractional solvent to an extract prepared by extracting with an extracting solvent.
  • the extraction solvent is not limited thereto, but water, an organic solvent or a mixed solvent thereof may be used, and the organic solvent may be a C 1-4 alcohol, a polar solvent such as ethyl acetate or acetone, hexane or dichloro Non-polar solvents of methane or mixed solvents thereof can be used.
  • preferably water, alcohols having 1 to 4 carbon atoms or mixed solvents thereof may be used, and more preferably ethanol may be used.
  • an extract using ethanol was prepared as the solvent.
  • the extract of the mixed medicinal herb of the present invention is the above-mentioned ratios of Cheongung, Windproof, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Forget-me-not, Rhubarb, Gypsum, Giltyeong, Golden, White, Red Gardenia, Penguin, Ginger, Active, Licorice, Gold and Silver Coin ,
  • the mixed medicine consisting of raw paper and wood was obtained by adding 2-10 times the amount of water and hot water extraction for 3 to 4 hours at a temperature of 70 °C to 125 °C.
  • the mixed medicinal herb extract was concentrated and lyophilized, and the lyophilized sample was dissolved in distilled water and used for the experiment.
  • cancer refers to a lump grown abnormally by autonomous overgrowth of body tissue, and may be classified into benign tumor and malignant tumor. While benign tumors grow relatively slowly and do not metastasize, malignant tumors grow rapidly as they infiltrate surrounding tissues and spread or spread to various parts of the body, thereby threatening life. Malignant tumors can therefore be thought of as cancer.
  • the subject cancer which can be prevented or treated by the composition of the present invention is not limited to a particular cancer, preferably breast cancer, lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer , Skin or eye melanoma, uterine sarcoma, ovarian cancer, rectal cancer, anal cancer, colon cancer, fallopian tube cancer, endometrial cancer, cervical cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, kidney cancer, soft tissue tumor, urethral cancer It may be prostate cancer, bronchial cancer or bone marrow cancer. More preferably, the cancer may be fibrosarcoma, skin cancer, lung cancer, breast cancer, gastric cancer, but is not limited thereto.
  • HT1080 human fibroscarcoma
  • B16F10 murine melanoma
  • A431 human epidermoid carcinoma
  • AGS human gastric carcinoma
  • the cancer is a disease that is the object of prevention or treatment by the mixed medicinal herb extract of the present invention, the composition comprising the mixed medicinal herb extract to inhibit the metastasis of cancer cells, induce cell death or inhibit cell growth It can show anticancer effect by showing activity.
  • the mixed medicinal herb extracts were treated in the classical ear cancer cell line and the effects on cell metastasis (cell migration and cell invasion activity), cell death and cell growth through in vitro and in vivo animal experiments. Confirmed.
  • the mixed medicinal herb extracts KIOM-C
  • the extracts of each of the sweeteners constituting the same the cancer cell killing effect and metastasis after treatment of each extract to HT1080, respectively.
  • the anti-cancer effect such as cell death or metastasis inhibition did not show when the individual extracts of sweeteners were treated at low concentrations equal to the concentration ratios of the sweeteners contained in the mixed medicinal extracts (KIOM-C). 15 and 16.
  • the mixed medicinal herb extract of the present invention was confirmed to have a synergistic effect of the mixing of the 22 medicinal herbs.
  • prevention means any action that inhibits or delays the disease by administration of the composition containing the mixed drug extract.
  • treatment used in the present invention means all the actions that improve or cure the symptoms of the disease by administration of the composition containing the mixed drug extract.
  • the composition of the present invention may include a pharmaceutically acceptable carrier, excipient or diluent in addition to the above-described active ingredient for administration.
  • the carrier, excipient and diluent may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • compositions of the present invention can be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, or the like, oral preparations, suppositories, or sterile injectable solutions, respectively, according to conventional methods.
  • oral preparations suppositories, or sterile injectable solutions, respectively, according to conventional methods.
  • it may be prepared by using diluents or excipients such as fillers, weighting agents, binders, wetting agents, disintegrating agents, and surfactants which are commonly used.
  • Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like.
  • Such solid preparations may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like, in the mixed medicinal extract.
  • excipients for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like
  • lubricants such as magnesium stearate, talc can also be used.
  • It may be prepared by adding various excipients such as humectants, sweeteners, fragrances, preservatives and the like in addition to liquid oral liquids or liquid paraffin for oral use.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations and tasks.
  • non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used.
  • base of the suppository uthepsol, macrosol, tween 61, cacao butter, laurin butter, glycero gelatin and the like can be used.
  • composition of the present invention can be administered orally or parenterally (eg, applied intravenously, subcutaneously, intraperitoneally or topically) according to the desired method, and the dosage is based on the condition and weight of the patient, the extent of the disease, Depending on the drug form, route of administration, and time, it may be appropriately selected by those skilled in the art.
  • the daily dosage of the mixed medicinal extract is preferably 1 mg / kg to 600 mg / kg, may be administered once to several times daily if necessary.
  • the present invention provides a method for preventing or treating cancer, comprising administering to a subject in need thereof a composition comprising a mixed medicinal extract.
  • the cancer-related diseases may be various cancer diseases such as skin cancer, stomach cancer, lung cancer, but are not limited thereto.
  • the term "individual” means all animals, including humans, who have already developed or may develop cancer, and the composition of the present invention is effective in effectively preventing and treating the disease by administering to the individual. have.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment in a medical treatment, the effective dose level being the type of subject and its severity, age , Sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical arts.
  • the compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.
  • the present invention is a cheongungung, windproof, donkey, peony, yeonkyo, peppermint, ephedra, forget-me-not, rhubarb, gypsum, Gilgyeong, golden, baekchul, gardenia, hyungge, ginger, talc, licorice, gilding, yin and yang, It provides a health functional food for the prevention or improvement of cancer containing the extract of the mixed medicinal herb consisting of raw paper and throat.
  • the health functional food includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and salts thereof, Organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like. It may also contain natural fruit juices and pulp for the production of fruit juices and vegetable drinks. These components can be used independently or in combination.
  • the dietary supplement may be any one of meat, sausage, bread, chocolate, candy, snacks, confectionary, pizza, ramen, gum, ice cream, soup, beverage, tea, functional water, drink, alcohol and vitamin complex. Can be.
  • the health functional food may further include food additives, and the suitability as a "food additive" is applied to the item according to the General Regulations of the Food Additives Code and General Test Law, etc., unless otherwise specified. Determined by the relevant standards and standards.
  • Items listed in the "Food Additives Code” include, for example, chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, cinnamon acid, natural additives such as color pigments, licorice extract, crystalline cellulose, high-quench pigments, guar gum, L Mixed preparations, such as a sodium glutamate preparation, a noodles addition alkali preparation, a preservative preparation, and a tar pigment preparation, etc. are mentioned.
  • the mixed medicinal extract according to the present invention added to the food in the process of manufacturing a health functional food can be appropriately added or subtracted as needed, preferably 1 to 15% by weight in 100% by weight food It is preferable to add as much as possible.
  • KIOM a mixed herb consisting of Cheongung, Windproof, Angelica, Peony, Episode, Peppermint, Ephedra, Forget-me-not, Rhubarb, Gypsum, Giltyeong, Golden, White, Gardenia, Hungae, Ginger, Talc, Licorice, Gold and Silver Coins, Yin and Yang
  • the herbal medicines were purchased from the Yeongcheon Herbal Medicine Market (Youngcheon, South Korea), and large-scale hot water extraction was performed.
  • KIOM-C is a mixed medicine, 1 part by weight of Cheongung, windproof, Angelica, Peony, Peony, Peppermint Leaf, ephedra, forget-me-not and rhubarb, based on 1 part by weight of yin and yang, and 0.5 parts by weight of gypsum, gilyeong and gold 1 part to 2 parts by weight, 1 part to 3 parts by weight, 1 part to 3 parts by weight, 1 part to 5 parts by weight of talc, 1 part to 5 parts by weight of licorice, gold and silver, and 1 part to 3 parts by weight of raw wood, 1 part by weight It is made by mixing the medicines in a ratio of 3 to 3 parts by weight, and 15 L of distilled water is added to 2456.5 g of KIOM-C mixed medicines, and the extractor (Cosmos-600 extractor, Gyeongseo Machinery Industry, Incheon, South Korea) is 115 °C. Hot water was extracted for 3 hours to the temperature.
  • the extracted KIOM-C blended medicinal herb extract was filtered using a standard test sieve (sieve) (150 ⁇ m, Retsch, Han, Germany) and concentrated to dryness in a freeze dryer.
  • the lyophilized KIOM-C mixed medicinal herb extract powder (50 mg) was dissolved in 1 ml of distilled water, filtered through a 0.22 ⁇ m disk filter, and stored at ⁇ 20 ° C. until use.
  • the hot water extracted sweetwood extract was filtered using a test sieve (150 ⁇ m, Retsch, Han, Germany), and concentrated to dryness in a freeze dryer.
  • the freeze-dried sweetwood extract powder 50 mg was dissolved in 1 ml of distilled water, filtered through a 0.45 ⁇ m syringe filter, and stored at 4 ° C. until use.
  • HT1080 human fibroscarcoma; human fibrosarcoma
  • AGS human gastric carcinoma
  • A431 human epidermoid carcinoma
  • B16F10 murine melanoma; Mouse melanoma
  • HT1080 human fibroscarcoma; human fibrosarcoma
  • AGS human gastric carcinoma
  • A431 human epidermoid carcinoma; human squamous cell carcinoma
  • B16F10 murine melanoma; mouse melanoma
  • the various cancer cell lines were prepared using DMEM medium (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS), 100 U / ml penicillin and 100 ug / ml streptomycin. Incubation was carried out in an incubator where temperature (37 ° C.) and humidity were kept constant and supplied with 5% CO 2 .
  • MTT assay was performed. At this time, using the normal hepatocyte (hepatocyte) as a control, the cytotoxicity of the mixed medicinal herb extract (KIOM-C) of the Example to the normal cells was evaluated. In addition, using an inverted microscope, the change in cell morphology of the cancer cell line by the mixed medicinal extract (KIOM-C) was also observed.
  • each cancer cell line (5 ⁇ 10 3 cells / Well / 96-well plate) was incubated after treatment with the mixed medicinal herb extract (KIOM-C) at a concentration of 100 ⁇ g / ml to 1000 ⁇ g / ml prepared in Example 1.
  • 10 ⁇ l of MTT solution (5 mg / ml in PBS) was added to the cells and further incubated for 4 hours.
  • the formazan precipitate was dissolved in dimethyl sulfoxide (DMSO), and then absorbance was measured at 570 nm using an Infinite® M200 microplate reader (TECAN Group Ltd, Switzerland) to confirm cell viability. It was.
  • DMSO dimethyl sulfoxide
  • hepatic cells did not show any cytotoxicity even when the mixed medicinal extract (KIOM-C) was treated at a concentration of 1000 ⁇ g / ml (FIG. 1A). This means that the mixed medicinal extract (KIOM-C) exhibits a concentration-dependent cancer cell proliferation inhibitory effect specifically for all cancer cell lines.
  • the mixed medicinal extract does not show cytotoxicity to normal hepatocytes, and has the effect of inhibiting concentration-dependent cancer cell proliferation and autophagic and apoptotic cancer cells in all cancer cell lines except normal hepatocytes. It means to have an effect.
  • HT1080 cells were seeded to 5 ⁇ 10 5 per 60 mm dish and then incubated for 24 hours in a 37 ° C., 5% CO 2 incubator. After incubation, the mixed medicinal extract (KIOM-C) prepared in Example 1 was treated at a concentration of 1000 ⁇ g / ml, and further cultured for 12 hours and 24 hours. After further incubation, the cells that were not attached to the dish and attached cells were collected and washed twice with PBS, and the cells were fixed by the slow addition of 70% ethanol. Fixed cells were stored at ⁇ 20 ° C. for 24 hours.
  • KIOM-C mixed medicinal extract
  • the mixed medicinal herb extract (KIOM-C) of the present invention induces G 1 cell cycle arrest (cell cycle arrest) to delay cell proliferation, which means that effectively induced cell death.
  • Example 1 In order to determine how the mixed medicinal extract (KIOM-C) prepared in Example 1 affects the expression of the G 1 phase regulatory proteins p21, p27 and cyclin D1, Western blot was performed.
  • HT1080 cells were seeded to 5 ⁇ 10 5 cells per 60 mm dish, and then cultured in 37 ° C., 5% CO 2 incubator for 24 hours. After incubation, the mixed medicinal herb extract (KIOM-C) prepared in Example 1 was treated at a concentration of 500 ⁇ g / ml and 1000 ⁇ g / ml, and further cultured for 12 hours and 24 hours. After further incubation, the cells that were not attached to the dish and attached cells were collected and washed twice with PBS, and the whole cell lysate of the cells was washed with M-PER Mammalian Protein Extraction. Reagent) (Thermo Scientific, Rockford, Ill.).
  • KIOM-C mixed medicinal herb extract
  • Cell lysates were quantified for protein concentration by BCA protein assay (Bicinchoninic Acid) assay, and the same amount of protein was obtained from 10% sodium dodecyl sulfate polyacrylamide gel (SDS). Each well was injected and electrophoresed. Proteins developed on gels were transferred to Immunobilon PVDF transfer membranes (Millipore, Bedford, Mass.). After transferring the expression protein to the membrane, immunoblotting was performed using anti- p21 Waf1 / Cip1 , anti-p27 Kip1 and anti-cyclin D1.
  • the mixed medicinal herb extract (KIOM-C) of the present invention regulates cyclin-dependent kinase inhibitors such as cell cycle regulators p21 and p27, thereby inhibiting abnormal cell proliferation and cell death It can be derived.
  • Example 2-5 Induction Assay of Apoptosis and Autophagy Action
  • Example 2-5-1 Absorption Detection of YO-PRO-1
  • the HT1080 cell line was treated with the mixed medicinal extract (KIOM-C) prepared in Example 1 at concentrations of 500 ⁇ g / ml and 1000 ⁇ g / ml and incubated for 12 hours and 24 hours.
  • KIOM-C mixed medicinal extract
  • YO-PRO-1 (1 uM, Molecular Probes, Eugene, OR), which is an apoptosis-specific dye, was added thereto, followed by shading staining at 4 ° C. for 30 minutes. After staining, YO-PRO-1 uptake was measured using a FACSSCalibur flow cytometer without cell washing or fixation, and analyzed using WinMDI 2.8 software.
  • TUNEL staining was performed using an in situ cell death detection kit (Roche diagnostics GmbH, Mannheim, Germany).
  • Example 2-5-3 RFP-LC3 distribution fluorescence analysis and LC3 protein expression analysis
  • microtubule-associated protein1 light chain 3 (LC-3), which is an important molecular marker of autophagy Fluorescence analysis was performed using this fluorescently labeled RFP-LC3, and Western blot was performed to confirm the expression level of the LC3 protein.
  • Bafilomycin A1 a lysosomal inhibitor known to exacerbate cell death
  • it has no effect on autophagy-inducing activity. Influence was also confirmed.
  • the HT1080 cell line (5 ⁇ 10 4 ) grown in a 24-well culture plate containing coverslips was prepared by transiting an LC3 plasmid tagged with RFP to TransIT2020 (Mirus, Madison, WI). Transfection was performed using.
  • the transfected cells were cultured as described above for 24 hours, and after the culture, the mixed medicinal extracts (KIOM-C) were treated with the concentration of 500 ⁇ g / ml and 1000 ⁇ g / ml for 24 hours.
  • a loading medium (Vector Laboratories, Burlingame, Calif.) Containing DAPI, which stains the nucleus, was added and then sealed with a coverslip to confocal microscope (FV10i-W; Olympus Optical Co. LTD) was examined and photographed the distribution of RFP-LC3.
  • confocal microscope FV10i-W; Olympus Optical Co. LTD
  • Western blots were performed using antibodies LC3 and anti-p62 / SQSTM1, the major markers of autophagy, as described in Examples 2-4 above.
  • Bacillomycin A1 at a concentration of 10 nM a lysosomal inhibitor known to exacerbate cell death
  • a mixed medicinal extract KIOM-C
  • RFP-LC3 fluorescence dot was increased more than the mixed medicinal extract (KIOM-C) alone compared to the untreated control group.
  • KIOM-C mixed medicinal extract
  • Western blot analysis of LC-3 protein it was confirmed that the amount of LC-3II protein was increased.
  • Example 2-5-4 Autophagic Vacuole Detection
  • the HT1080 cell line was treated with the mixed medicinal extract (KIOM-C) prepared in Example 1 at a concentration of 500 ⁇ g / ml and 1000 ⁇ g / ml and incubated for 24 hours. At this time, 50 uM of MDC (monodansyl cadaverine; Sigma Chemical), an autophagy vacuole tracer, was added thereto, and stained at 37 ° C. for 40 minutes. After staining, the cells were washed twice with PBS, and then microscopically and photographed using a fluorescence microscope.
  • MDC monodansyl cadaverine
  • the mixed medicinal extract means that cancer cells can be killed by inducing autophagy as well as apoptosis (apoptosis).
  • Example 1 How does the mixed medicinal extract (KIOM-C) prepared in Example 1 affect the protein expression of various factors related to induction of apoptosis and autophagy, and inhibition of cancer cell proliferation and death-inducing activity Western blots were analyzed to confirm their association with the activation of this cellular signaling system.
  • KIOM-C mixed medicinal extract
  • Example 1 In order to determine how the mixed medicinal extract (KIOM-C) prepared in Example 1 affects the protein expression of various factors related to induction of apoptosis and autophagy, various cancer cell lines (HT1080) , B16F10 and AGS) treated with the mixed medicinal extract (KIOM-C) at a concentration of 500 ⁇ g / ml or 1000 ⁇ g / ml and after 24 and 48 hours, the protein was recovered from each cell and then important for cell death.
  • Western blot analysis revealed the expression of Beclin-1, which is important for the caspase-3 activity, PARP cleavage, LC3 and p62 proteins involved in autophagy, and autophagosome formation.
  • the B16F10 and AGS cell lines like the HT1080 cell line, after 24 hours of treatment with the mixed medicinal extract (KIOM-C), confirmed that the autophagy marker LC3 protein was converted from 16 kDa LC3 I to 14 kDa LC3 II. It was.
  • the expression level of Beclin-1 protein which is important for the formation of autophagosomes during autophagy, was markedly increased and PARP cleavage was identified (FIG. 5B).
  • Example 2-6-2 Analysis of Cell Signaling System Related to Tumor Apoptosis Induction
  • Example 1 In order to determine whether cancer cell proliferation inhibition and death-inducing activity by the mixed medicinal herb extract (KIOM-C) prepared in Example 1 is related to activation of related cellular signaling systems, various cancer cell lines (HT1080, B16F10 and AGS) treated with the mixed medicinal extract (KIOM-C) at a concentration of 500 ⁇ g / ml or 1000 ⁇ g / ml and after 3 hours, 6 hours and 24 hours, the protein was recovered from each cell, and then cell death was controlled. Expression patterns of AMPK, ULK, JNK, c-jun, p53, p38 and ERK 1/2, which are factors related to signal transduction system activation, were confirmed by Wester blot analysis.
  • the B16F10 and AGS cell lines like the HT1080 cell line, when the activity of JNK, which is important for induction of autophagy and apoptosis, was measured after 3 hours of the mixed medicinal extract (KIOM-C) treatment, the mixed medicinal extract (KIOM) -C) showed an increase in phosphorylation with time. In contrast, there was no effect on the activation of p38 and ERK 1/2 (FIG. 5E).
  • the mixed medicinal extract (KIOM-C) is involved in apoptosis and autophagy by regulating various signaling systems.
  • the mixed medicinal extract self-kills cancer cells by regulating the protein expression and cell signaling system of various factors related to induction of apoptosis and autophagy. (apoptosis) as well as autophagy (induced autophagy), it was confirmed that the cells can be killed.
  • KIOM-C mixed medicinal extract
  • ROS reactive oxygen species
  • SP600125 which is a NAC (N-acetyl-L-cysteine) or a JNK-specific inhibitor (JNK-specific inhibitor), which is known as an antioxidant, is treated simultaneously with the mixed medicinal extract (KIOM-C), and the mixed medicinal extract (KIOM- JNK activity by C) was directly related to ROS activity and CHOP expression.
  • NAC N-acetyl-L-cysteine
  • JNK-specific inhibitor JNK-specific inhibitor
  • Example 2-7-1 Measurement of Reactive Oxygen Species (ROS) Levels in Cells
  • Intracellular reactive oxygen species (ROS) levels were measured using DCF-DA, a peroxide-sensitive fluorescent probe.
  • the mixed medicinal extract (KIOM-C) prepared in Example 1 was treated with cells at a concentration of 500 ⁇ g / ml or 1000 ⁇ g / ml and incubated for 3 hours.
  • NAC (1 mM) or J600-specific inhibitor SP600125 (5 uM) was pretreated for 1 hour.
  • 5 M of DCF-DA was added to the cells incubated as above and incubated at 37 ° C. for 30 minutes.
  • Example 2-7-2 Reverse Transcriptase Chain Reaction (RT-PCR)
  • RNA of the cell is extracted PureHelix RNA
  • cDNA was synthesized using the Helixcript 1'st strand cDNA synthesis kit (NanoHelix, Daejeon), and then PCR was performed.
  • the hCHOP and GAPDH primer sequence information used is shown in Table 1 below.
  • the mRNA expression level of CHOP which is an important factor of cell death process, was increased depending on the treatment concentration and time-dependently of the mixed medicinal extract (KIOM-C), and more specifically, about 20 times in the high concentration treatment group after 48 hours.
  • the amount of CHOP mRNA expression could be increased (Fig. 6b). Accordingly, it was found that the mixed medicinal extract (KIOM-C) induces oxidative stress in cells and increases the mRNA expression of CHOP, which is an important factor in the cell death process, thereby causing cell death.
  • Example 2-7-3 Western blot analysis
  • the mixed medicinal herb extract (KIOM-C) prepared in Example 1 affects the protein expression level of CHOP, SP600125 (5 uM), a JNK-specific inhibitor, was used for 1 hour.
  • the mixed medicinal extract (KIOM-C) was treated with cells at a concentration of 500 ⁇ g / ml or 1000 ⁇ g / ml and incubated for 24 hours.
  • Whole cell lysates of cells incubated as described above were prepared using M-PER Mammalian Protein Extraction Reagent, according to the manufacturer's instructions.
  • Cell lysates were quantified for protein concentration by BCA protein assay (Bicinchoninic Acid) assay, and after immunoblotting, the protein was subjected to a power-opti-chemiluminescent Weston blotting detection reagent ( Visualization was performed using Power Opti-ECL Western blotting detection reagent (Animal Genetics, Inc., Korea) and ImageQuant LAS 4000 mini (GE Healthcare, Piscataway, NJ, USA). The degree of expression of CHOP was derived by quantifying the visualized protein bands using software ImageJ (National Institutes of Health, USA).
  • the expression level of CHOP protein was significantly increased depending on the treatment concentration of the mixed medicinal extract (KIOM-C) compared to the untreated control group.
  • the simultaneous treatment of the JNK-specific inhibitor SP600125 it was confirmed that the expression of the CHOP protein is inhibited when the generated active oxygen species are lost (Fig. 6c). Accordingly, it can be seen that the mixed medicinal extract (KIOM-C) induces oxidative stress in cells and increases the expression level of CHOP protein, which is an important factor in the cell death process, thereby inducing cell death.
  • Example 2-8 Simultaneous Induction of Apoptosis and Autophagy Actions
  • JNK-specific inhibitor and JNK-targeted siRNA the following experiment was performed.
  • Example 2-8-1 Inhibition of Apoptosis Induction of Mixed Medicinal Herb Extracts (KIOM-C) by JNK-Specific Inhibitors
  • the HT1080 cell line was pretreated with pharmaceutical inhibitors such as JNK-specific inhibitor SP600125, p38 inhibitor SB203580, ERK 1/2 inhibitor PD98059, and lysosome inhibitor Bafilomycin A1 for 1 hour.
  • pharmaceutical inhibitors such as JNK-specific inhibitor SP600125, p38 inhibitor SB203580, ERK 1/2 inhibitor PD98059, and lysosome inhibitor Bafilomycin A1 for 1 hour.
  • the mixed medicinal extract (KIOM-C) at a concentration of 500 ⁇ g / ml
  • After recovering the protein in each cell, including JNK a factor involved in the activation of signal transduction systems that regulate cell death,
  • the expression of Beclin-1 important for autophagosome formation, PARP cleavage and Bcl-2 important for cell death, and p62 protein involved in autophagy were confirmed by Wester blot analysis.
  • the observed cytotoxicity and cell morphological changes may be induced.
  • Example 2-8-2 Inhibition of apoptosis induction of mixed medicinal herb extracts (KIOM-C) by siRNA targeted to JNK
  • HT1080 cells were cultured about 60% confluent in a 60 mm culture dish.
  • Cells cultured as described above were transfected with JNK-specific siRNA (small interfering RNA) using TransIT2020 (Mirus, Madison, Wis.).
  • Mcr siRNA scrambled siRNA
  • the transfected cells were cultured as described above for 72 hours, and after the culture, the mixed medicinal extract (KIOM-C) was treated for 24 hours at a concentration of 500 ⁇ g / ml.
  • KIOM-C Mixed medicinal extract prepared in Example 1 (25 ⁇ g / ml, 50 ⁇ g / ml, 100 ⁇ g / ml and 250 ⁇ g / ml), 3 ml containing 0.3% agar, and 10% FBS Suspension of cancer cells (B16F10 and HT1080) (1 ⁇ 10 4 ) in the medium of and applied to the solidified bottom agar containing 0.6% agar and 10% FBS, followed by a phase-contrast with incubation for 3 weeks. The microscope observed colonies formed in soft agar and photographed them.
  • KIOM-C Mixed medicinal extract prepared in Example 1 (25 ⁇ g / ml, 50 ⁇ g / ml, 100 ⁇ g / ml and 250 ⁇ g / ml), 3 ml containing 0.3% agar, and 10% FBS Suspension of cancer cells (B16F10 and HT1080) (1 ⁇ 10 4 ) in the medium of and applied to
  • cancer cells B16F10 and HT1080 were suspended in 1 ml of 10% FBS / DMEM medium, plated in a 12-well plate, and cultured to adhere to the plate, followed by mixed medicinal extract (KIOM-C). (25 ⁇ g / ml, 50 ⁇ g / ml, 100 ⁇ g / ml and 250 ⁇ g / ml) were incubated for 10 days. After 10 days, the colonies formed were stained with 0.2% crystal violet / 20% methanol stain and observed under a microscope.
  • KIOM-C mixed medicinal extract
  • wound healing assays were performed as follows to determine whether cell migration ability was inhibited.
  • cancer cell lines (B16F10 and HT1080) were cultured in a 60 mm culture dish about 80% confluent. To exclude the healing by cell proliferation after wound formation, as described above, about 25% of mitomycin C (mitomycin C) in cancer cells (B16F10 and HT1080) proliferated in monolayers was about 25%. C; Sigma chemical Co.) was stopped for 30 minutes to stop cell proliferation, and then the single layer was about 2 mm wide. Then, after removing the suspended cell suspension, and filled with 10% FBS-DMEM culture medium containing the mixed medicinal extract (KIOM-C) (50 ⁇ g / ml-250 ⁇ g / ml) prepared in Example 1 , And cultured in the medium.
  • mitomycin C mitomycin C
  • C mixed medicinal extract
  • the cells were cultured for 24 hours and 48 hours for the B16F10 cell line and 40 hours for the HT1080 cell line. After incubation for the above time, the ability of cell migration at the site of injury was observed through a phase contrast microscope. The interval between the time points at which the wound was formed (0 hour) was set at 100% and the extent to which the interval was narrowed due to cell movement was calculated as time passed.
  • the mixed medicinal herb extract (KIOM-C) of the present invention means that it effectively inhibited cell migration.
  • Mobility analysis was performed by filling 600 ⁇ l of 10% FBS / DMEM medium in the lower chamber of a 10 mm diameter transwell chamber with an 8 ⁇ m pore size polycarbonate membrane (Corning costar, Cambridge, Mass.), the upper chamber and then fill in the mixed medicine extract (KIOM-C) and tumor cells (B16F10 and HT1080) (1 ⁇ 10 5 gae / 100 ⁇ l) a, 100 ⁇ l DMEM medium without serum containing the 24 hours at 37 °C to Incubate for 36 hours.
  • KIOM-C mixed medicine extract
  • B16F10 and HT1080 tumor cells
  • the HT1080 cell line was confirmed the efficacy of the mixed medicinal extract (KIOM-C) under PMA stimulation conditions.
  • Invasion assays were performed by coating the transwell chamber with a 20 ⁇ l of Matrigel: DMEM 1: 2 mixture (Matrigel, BD Biosciences, Bedford, Mass., USA) to form an intervening invasive barrier. It was performed after.
  • the mixed medicinal herb extract (KIOM-C) of the present invention effectively inhibits cell migration and cell invasion of cancer cell lines.
  • MMP-9 is known to play an essential role in cancer metastasis by breaking down the extracellular matrix (ECM).
  • ECM extracellular matrix
  • KIOM-C mixed drug extract
  • B16F10 and HT1080 cancer cells
  • RT-PCR Reverse Transcriptase Polymerase Chain Reaction
  • PMA phorbol myristate acetate
  • RNA of PMA-stimulated cells was isolated using PureHelix RNA extraction kit (NanoHelix, Daejeon), and then synthesized Helixcript 1'st strand cDNA. PCR was performed after cDNA was synthesized using the kit (NanoHelix, Daejeon).
  • the hMMP-9 and GAPDH primer sequence information used is shown in Table 3 below.
  • the total cell lysate and nuclear / cytosolic extract of PMA-stimulated cells according to the manufacturer's instructions M-PER Mammalian Protein Extraction Reagent and NE-PER Nuclear & Cytosolic Extraction Reagent (Pierce Biotechnology, Inc., Rockford, IL, USA Each).
  • Cell lysates were quantified for protein concentration by BCA protein assay (Bicinchoninic Acid) assay, and after immunoblotting, the protein was subjected to a power-opti-chemiluminescent Weston blotting detection reagent ( Visualization was performed using Power Opti-ECL Western blotting detection reagent (Animal Genetics, Inc., Korea) and ImageQuant LAS 4000 mini (GE Healthcare, Piscataway, NJ, USA). The expression level of MMP-9 was derived by quantifying the visualized protein bands using software ImageJ (National Institutes of Health, USA).
  • the culture medium of the PMA-stimulated cells was electrophoresed in 8% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) containing 0.1% gelatin, and the gel was washed with buffer (50 mM Tris-HCl, pH 7.5, 100). After washing thoroughly with mM NaCl, 2.5% Triton X-100), it was soaked in active buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM CaCl 2 , 0.02% NaN 3 , 1 ⁇ M ZnCl 2 ) And incubated at 37 ° C.
  • buffer 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM CaCl 2 , 0.02% NaN 3 , 1 ⁇ M ZnCl 2
  • the gel was then stained with Coomassie Brilliant Blue R-250 staining solution (Bio-Rad Laboratories, Hercules, Calif., USA) and 10% isopropanol / 10% acetic acid (v / v) Destained with solution.
  • the gelatin degradation capacity of MMP-9 was detected at 92 kDa with a transparent band on a dark blue background.
  • Example 7 Analysis of Efficacy of Mixed Herbal Extract (KIOM-C) on NF- ⁇ B Activity by PMA Stimulation
  • NF- ⁇ B is a transcription factor known to regulate MMP-9 gene expression and enhance cancer cell migration and invasiveness.
  • KIOM-C mixed medicinal extract
  • Example 1 inhibits NF- ⁇ B activity
  • the degree of pI ⁇ B and I ⁇ B expression and the degree of nuclear transfer of the NF- ⁇ B p65 subunit were analyzed by Western blot as described in Example 6-2.
  • the cell lysate was performed by dividing the cytosol and the nuclear part.
  • the expression levels of pI ⁇ B, I ⁇ B and the nuclear transfer NF- ⁇ B p65 subunits were quantified by standardizing ⁇ -tublin or TBP, which is an internal control.
  • HT1080 cell line pretreated with 250 ⁇ g / ml of mixed medicinal extract (KIOM-C) was treated with PMA 5 nM to stimulate NF- ⁇ B by stimulating the cell line.
  • PMA 5 nM mixed medicinal extract
  • each protein was harvested, and the expression levels of pI ⁇ B, I ⁇ B, and NF- ⁇ B p65 subunits transferred in the nucleus were confirmed.
  • -C pI ⁇ B was increased after PMA stimulation and I ⁇ B expression was decreased in the untreated control group, but there was no increase in pI ⁇ B due to PMA stimulation in the group treated with the mixed medicinal extract (KIOM-C). I ⁇ B expression did not decrease.
  • the mixed medicinal extract inhibits the expression and activity of MMP-9 by inhibiting the activity of NF- ⁇ B, resulting in the effect of inhibiting the migration and invasion of cancer cells.
  • B16F10 cell line 3 ⁇ 10 5 cells / 0.2 ml PBS
  • mice After 17 days, the mice were sacrificed and the lungs of each mouse were fixed with Bowin's solution (Sigma), and the number of black colonies of B16F10 cells on the surface of the lungs was visually examined. The test results were calculated as the average number of colonies in each group.
  • the mixed medicinal herb extract (KIOM-C) of the present invention is a result supporting the excellent efficacy of inhibiting cancer cell metastasis in vivo.
  • Example 8-2 Anticancer Activity Evaluation of Mixed Medicinal Extracts (KIOM-C) Using Tumor xenograft Model
  • the dosage of the mixed medicinal extract (KIOM-C) was divided into three dose groups of 85 mg / kg, 170 mg / kg, and 340 mg / kg in consideration of the amount taken by a 60 kg adult and the yield of agar.
  • saline administration group was included.
  • the mixed medicinal extract (KIOM-C) was orally administered daily for about 15 days, and the tumor volume was measured and calculated through the following calculation formula.
  • interferon-gamma an important cytokine that kills cancer
  • INF- ⁇ interferon-gamma
  • the negative control group began to observe tumor mass after 5 days of tumor inoculation, and showed rapid growth after about 10 days, whereas the group of the mixed medicinal extract (KIOM-C) showed significantly reduced tumor growth. It was confirmed (Fig. 14a). In addition, it was confirmed that the size of the tumor mass extracted after 15 days was also significantly smaller in the group to which the mixed medicinal extract (KIOM-C) was administered (FIG. 14B). After 15 days, tumors were collected from nude mice and the tumor weight was measured. The average weight of the tumors in the negative control group was 0.62 ⁇ 0.18g, and the mixed medicinal extract 85 mg / kg administered group was 0.16 ⁇ 0.06g, 170 mg / g.
  • the kg administration group was 0.16 ⁇ 0.09g and the 340 mg / kg administration group was 0.19 ⁇ 0.11g (Fig. 14c).
  • the INF- ⁇ concentration significantly increased compared to the untreated control (FIG. 14D).
  • the mixed medicinal herb extract (KIOM-C) of the present invention significantly inhibits tumor growth even in in-vivo experiments, and there is no specific toxicity by repeated long-term administration.
  • Example 9-1 Analysis of tumor cell death effect of the mixed medicinal extract and each sweetener
  • KIOM-C Mixed medicinal herb extract prepared in Example 1 and the sweet constituents (Kungung, Windproof, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Manganese, Rhubarb, Gypsum, Giltyeong, Golden, Baekchul, Maize , Ginseng, ginger, talc, licorice, gilding, yin and yang, and paper and neck).
  • sweet constituents Kungung, Windproof, Angelica, Peony, Yeongyo, Peppermint, Ephedra, Manganese, Rhubarb, Gypsum, Giltyeong, Golden, Baekchul, Maize , Ginseng, ginger, talc, licorice, gilding, yin and yang, and paper and neck.
  • the group treated with the mixed medicinal herb extract (KIOM-C) prepared in Example 1 showed cancer cell survival rate (77.7% cancer cell death) of 22.3% compared to the group not treated, but each sweet rice Processed ash extracts (bowung, windbreak, donkey, peony, pontoon, peppermint, ephedra, forget-me-not, rhubarb, gypsum, gilsheng, gold, white peach, wild jasmine, hedgehog, ginger, talc, licorice, sterling silver, yin and yang, spring and wood) In the group, cancer cell survival inhibition (cancer apoptosis) efficacy was not confirmed (FIG. 15).
  • the mixed medicinal herb extract (KIOM-C) of the present invention exhibits an effective anticancer activity (apoptosis) that can not be provided by each of the sweeteners alone by using a mixture of each of the sweeteners of low concentration that does not exhibit cancer cell death effects. It was confirmed.
  • Example 9-2 Analysis of Tumor Metastasis Inhibitory Effects of the Mixed Medicinal Extracts and Each Sweet Rice
  • the mixed medicinal herb extract (KIOM-C) of the above example has an effect of remarkably improving anti-transduction activity by using a mixture of low concentrations of safe sweeteners having no cancer cell killing effect (cytotoxicity).

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Botany (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 천연식물 유래의 혼합 약재 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물, 암의 예방 또는 개선용 건강기능식품, 및 천연식물 유래의 혼합 약재 추출물을 포함하는 조성물을 투여하는 단계를 포함하는 암의 예방 또는 치료 방법에 관한 것으로, 더욱 자세하게는 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합 약재의 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물, 암의 예방 또는 개선용 건강기능식품, 및 천연식물 유래의 혼합 약재 추출물을 포함하는 조성물을 투여하는 단계를 포함하는 암의 예방 또는 치료 방법에 관한 것이다. 이에 따른 혼합 약재 추출물은 암 세포에 대하여 효과적인 전이 억제, 세포 사멸 유도 및 세포 성장 억제 활성을 가짐으로써 암의 예방 또는 치료용 조성물로 약학적으로 이용 가능할 뿐 아니라 건강기능식품으로도 유용하게 이용될 수 있다.

Description

천연물 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품
본 발명은 천연식물 유래의 혼합 약재 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물, 암의 예방 또는 개선용 건강기능식품, 및 천연식물 유래의 혼합 약재 추출물을 포함하는 조성물을 투여하는 단계를 포함하는 암의 예방 또는 치료 방법에 관한 것으로, 더욱 자세하게는 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합 약재의 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물, 암의 예방 또는 개선용 건강기능식품, 및 천연식물 유래의 혼합 약재 추출물을 포함하는 조성물을 투여하는 단계를 포함하는 암의 예방 또는 치료 방법에 관한 것이다.
암은 세계적으로 높은 사망률을 보이고 있으며, 서구 사회에서는 심혈관 질환 다음으로 가장 일반적인 사망 원인이다. 특히, 인구의 고령화와 더불어 흡연 인구의 증가 및 대기 오염으로 인해 폐암이 증가하고 있으며, 식생활이 서구화되어 고지방식의 섭취가 일반화되고, 환경 오염 물질의 급격한 증가, 음주량의 증가 등으로 대장암, 유방암, 전립선암 등이 지속적으로 증가하는 추세에 있다. 이러한 실정에서 암의 조기 예방 및 치료를 가능하게 하여 인간 건강의 증진, 건강한 삶의 질 향상 및 인류 보건 증진에 기여할 수 있는 항암 물질의 창출이 절실히 요구되고 있다.
암 전이는 암세포의 성장과 증식에 관련하여, 초기종양이 혈관이나 림프관을 타고 다른 장기로 이동하는 것을 의미하며(Cavallaro U, Christofori G. Cell adhesion in tumor invasion and metastasis: loss of the glue is not enough. Biochem Biophys Acta 2001; 1552: 39-45), 암 전이(metastasis)의 과정은 전이성 암세포가 최초 발생부위에서 이탈하여 혈관을 통하여 주변조직으로 침윤(invasion)하여 다른 부위에서의 증식에 의해 2차 종양을 형성하게 되는 일련의 과정에 의해 이루어진다. 이 과정은 세포외기질이 분해되면서 시작되는데, 세포외기질을 분해하는 효소로는 매트릭스 메탈로프로티나아제(matrix metalloproteinase, MMP), 세린 프로테아제(serine protease, plasmin), 유로키나제 플라스미노겐 액티베이터(urokinase plasminogen activator, uPA), 시스테인 프로테아제(cysteine protease)가 있다(Liotta LA, Trygguason K, Garbisa S, Hart I, Foltz CM, Shafie S. Metastasis potent alcor relate with enzymatic degradation of basement membrane collagen. Nature 1980; 284: 67-68).
매트릭스 메탈로프로티나아제(MMP)는 암세포가 세포외기질과 기저막을 분해하여 암세포의 침윤을 유도하고 전이하는데 중요한 역할을 하는 단백질분해효소로서, 지금까지 20종 이상이 분리, 확인되었다. MMP는 아연을 보조효소로 이용하는 엔도프로티나아제(endoproteinase)로, 구조와 특성에 따라 콜라겐분해효소(collagenase), 젤라틴분해효소(gelatinase), 스트로멜라이신(stromelysins), Membrane-type MMP로 나뉘어진다. 특히, 이들 MMP 중에서도 Type IV collagenase인 MMP-2(72 kDa type IV collagenase; gelatinase A)와 MMP-9(92 kDa type IV collagenase; gelatinase B)은 기저막의 중요 성분인 Type IV collagen을 분해하는 효소로, 암의 이동과 전이에 가장 직접적인 관련이 있는 것으로 알려져 있다(Nabeshima, K. et al., Pathol. Int., 52, pp255-64, 2002). 뿐만 아니라, MMP-9은 유방암의 침윤과 전이에 있어서 중요한 역할을 하는 것으로 알려져 있다(Scorilas A. et al., Br. J. Cancer, 84, pp1488-96, 2001). 또한, MMP-9의 프로모터 영역에는 전사인자인 AP-1과 NF-κB 결합영역을 가지고 있기 때문에 사이토카인이나 PMA(phorbol 12-mysistate 13-acetate)와 같은 암 유발 자극원들은 이들 AP-1과 NF-κB 등의 전사인자의 활성화를 조절함으로서 MMP-9의 발현을 조절하는 것으로 알려져 있다(Sato H., et al., Oncogene, 19, pp2904-2912, 2000; Lee S. O., et al., Biochem. Biophys. Res. Commun., 354, pp165-171, 2007).
한편, 암의 치료 방법은 암조직을 세포레벨에서 체내로부터 제거하는 데 있다. 현재의 암 치료방법은 외과요법, 방사선요법, 화학요법 등으로 나뉜다. 외과요법은 암을 조직레벨에서 체내로부터 제거하는 것으로서, 가장 합리적이지만 세포레벨에서 보면 주위의 조직 속에 침윤하거나 림프선에 전이해 있는 현미경적 병소를 완전히 제거하는 것은 힘든 문제점이 있다. 그러므로 조기암 또는 병소가 일부에 국한되어 있는 암(병기가 1기 또는 2기인 암)에 대해서는 외과요법이 매우 효과적이지만, 어느 정도 진행된 3기의 암인 경우에는 외과요법뿐 아니라 방사선요법이나 화학요법을 병용할 필요가 있다. 방사선요법, 화학요법은 3기 이후의 진행암 또는 말기암에 주로 쓰이나, 후두암, 자궁경부암에서는 1기의 암이라도 방사선요법만으로 완치되므로 방사선요법이 제일 우선시 되고 있다. 특히, 후두암에서는 성대의 기능을 보존하기 위하여 1기에는 방사선요법만을 하고, 2기에는 방사선요법에 부분수술 또는 화학요법을 병용하는 수가 있다. 또, 폐암 중 소세포암은 종래부터 외과요법으로 시술하여도 예후가 좋지 않았는데, 지금은 화학요법을 우선으로 하며 방사선용법을 병용하는 경우가 많다. 이 요법에 의해 최근에는 근소하나마 5년 생존율을 상승시킬 수 있게 되었다. 이상과 같이 암 치료법은 조기암을 제외하고는 어느 것이나 안전하다고 말하기 어려우며, 상기의 외과요법, 방사선요법 및 화학요법들은 모두 정상세포들에게도 영향을 주어 심각한 부작용을 초래하는 문제가 있다. 따라서 보다 안전하고, 치료 효과가 높은 대체적인 암치료 방법이 요구되고 있으며, 이에 최근에는 안정성이 보장된 식물, 미생물 유래 등 천연자원을 이용한 기능성 식품 및 의약품 연구에 관심이 집중되고 있다. 실제로 신약개발 기초자원으로 천연물은 주요비중을 차지하고 있으며, 아스피린(aspirin)이 버드나무 추출물에서 유래한 것과 같이 오늘날 사용 약물의 60% 정도가 천연물로부터 유래하고 있다.
특히, 천연 추출물의 인체 면역계 조절작용에 대한 연구가 활발히 이루어지고 있는데, 이는 면역계의 이상현상이 건강을 깨뜨리고 다양한 질환을 일으키기 때문이다. 따라서, 부작용을 최소화시킬 수 있는 안전한 천연물에 대한 면역조절제의 개발은 식품, 화장품 및 의약품 개발에 매우 중요한 소재가 될 수 있다. 실례로 상백피, 인삼의 사포닌, 표고버섯 등이 면역증강제로, 별불가사리, 영지ㆍ상황버섯, 인삼유래 진세노사이드가 항암보조제로 연구가 이루어지고 있고, 감초, 감초성분 글리시진(glycyrrhizin), 해삼, 웅담 성분 UDCA 등이 세포분화물질로 연구가 진행되고 있다. 이러한 천연물 소재를 이용한 면역조절제의 개발은, 부작용 없이 암이나 만성적인 염증 질환 등을 안전하게 치료할 수 있기 때문에 많은 사람들의 관심과 흥미를 불러일으키고 있다.
한편, 천궁(Cnidii Rhizoma)은 산형과에 속한 다년생 초본인 천궁 시디움 오피스내일 마키노(Cnidium officinale MAKINO)의 근경을 건조한 것으로, 9~10월에 채취하여 전열을 제거한 것을 주건한다. 혈액순환을 돕고 통증을 가라앉히는 진통효과가 있어 두통에도 자주 응용되며, 간장의 기능을 활성화시켜 주는 효능과 더불어 빈혈에 적용하면 조혈작용을 하는 것으로 알려져 있다.
방풍(Ledebouriella seseloides WOLFF.)은 산형과의 방풍(Saposhnikovia divaricata Schiskin)의 뿌리 및 뿌리줄기를 사용해 만든 것으로, 특이한 냄새가 있고 약성은 맵고 달며 따뜻하다. 외감성 두통, 오한, 발열, 전신통, 인후통 등 모든 풍증에 효과가 있으며, 풍한습의 사지관절동통, 파상풍, 근육경련, 중풍으로 인한 반신불수, 마비동통, 피부가려움증, 버짐 등에 쓰인다. 또한, 약리작용으로는 해열, 항염증, 진경, 면역활성화, 항알레르기, 항궤양, 항균, 피부개선균 억제 등이 보고되었다.
당귀(Angelicae Gigantis Radix)는 산형과(Umbeliferae) 식물인 참당귀의 뿌리로 성질은 따뜻하고 맛은 달고 매우며 독이 없다. 모든 풍병, 혈병, 허로를 낫게하며 피를 원활히 순환하게 해주는 혈액순환 촉진과 혈압강하작용, 진통, 경련억제, 대장운동촉진을 통한 변비개선, 어혈제거 등의 효과가 강한 것으로 알려져 있다.
작약(Paeonia lactiflora Pall.)은 쌍떡잎식물 작약과 작약속의 여러해살이 풀로, 한국, 몽골, 동시베리아 등지에 분포하며, 꽃이 아름다워 원예용으로도 쓰이고 있다. 뿌리는 진통, 복통, 무월경, 월경통, 토혈, 빈혈, 타박상의 치료 등에 효과가 있다고 알려져 있다.
연교는 물푸레나무과(Oleaceae)에 속한 의성개나리(Forsythia Viridissima Lindley) 또는 연교(Forsythia suspensa Vahi)의 열매로, 특이한 냄새가 있으며 맛은 쓰고 성질은 약간 차다. 연교는 열을 내리고 해독하므로 온열병 초기에 심장의 열을 내리고 고열과 정신혼몽에 쓰이며, 종기, 반진, 맹장염, 폐농양, 림프절염, 인후염 등에 사용하고 이뇨, 소염효과가 있다고 알려져 있다. 또한, 약리작용으로는 항균작용, 항염증작용, 혈압강하, 지혈작용, 간치료작용, 해열, 진토, 이뇨작용이 있다고 알려져 있다.
박하엽은 쌍떡잎식물 통화식물목 꿀풀과의 여러해살이 숙근초인 박하(Mentha arvensis var. piperascens)의 잎으로, 약성이 냉하고, 신하며 건위, 구풍, 산열, 소종의 효능이 있다. 따라서, 소화불량, 흉복창만, 감모(감기), 두통, 치통, 인후종통, 목적, 창개 등의 치료제로 많이 쓰이고 있다.
마황(Ephedra sinica)은 마황과의 초마항(Ephedra sinica Stepf) 또는 동속식물의 부드러운 줄기(초질경)를 사용해 만든 약재로, 혀를 약하게 마비시키는 성질이 있으며 맛은 떫고 맵고 쓰며, 성질은 따뜻하다. 풍한을 소산시키고, 발한해표, 오한발열, 두통, 천식, 해수, 수종, 신체상부 마비, 피부마비, 충혈, 어혈에 쓰이고 있다.
망초(Erigeron canadensis)는 쌍떡잎식물 초롱꽃목 국화과의 두해살이풀로 성질은 차고 맛은 약간 쓰다. 구내염, 구창, 대변불통, 부종, 동통, 설사, 안질, 해독, 해열, 피로호복, 풍습 등에 효능이 있다고 알려져 있다.
대황은 여귀과에 속하는 여러해살이 초본식물인 장엽대황(Rheum palmatum L.), 당고특대황(Rheum tanguticum Maximowicz), 약용대황(Rheum officinale Baillon)의 뿌리줄기를 사용하여 만든 악재로, 특이한 냄새가 있으며 입에 넣고 씹으면 가는 모래를 씹는 느낌이 나며 떫고 쓴맛이 나고 찬 성질을 가지고 있다. 두통, 충혈, 인후통, 변비, 코피, 토혈, 종기에 효과가 있고 이뇨, 부종에도 사용하고 있다. 약리작용으로는 대장운동촉진, 해열, 체온강하, 담즙분비 촉진, 혈액응고 시간 단축, 항균, 이뇨, 간기능 보호 등이 알려져 있다.
석고(Gypsum fibrosum)는 열을 내려주는 작용이 매우 좋은 약재로, 맛은 맵고 달며 성질은 매우 차갑다. 몸에 열이 심해서 나타나는 두통과 치통에도 효과가 있으며, 근래에는 유행성 B형 뇌염, 유행성 뇌척수막염, 폐렴 등에 이용되고 있는 것으로 알려져 있다. 또한, 해열작용, 진정작용, 혈당량 강하작용, 항염작용, 경미한 이뇨작용 등이 보고되어 있다.
길경은 초공꽃과의 도라지(Platycodon grandiflorum A. De Candolle)의 뿌리 또는 주피를 제거하여 만든 약재로, 냄새가 약간 있고 맛은 쓰고 성질은 어느 한쪽으로 치우치지 않고 평하다. 인후통, 감기로 인한 기침, 가래, 코막힘, 천식, 기관지염증, 흉막염, 두통, 오한, 편도선염 등에 사용되고 있으며, 약리작용으로는 거담작용, 혈당강하작용, 콜레스테롤 강하작용, 개선균 억제작용이 보고되어 있다.
황금은 꿀풀과에 속하는 여러해살이 초본식물인 황금(Scutellaria baicalensis GEORGE)의 뿌리로 만든 약재로, 소아급성호흡기 감염증, 만성기관지염, 급성이질, 전염성 간염, 신염, 신우신염, 고혈압 등에 유효한 반응이 있으며, 약리작용으로는 항염, 해열, 이뇨, 혈압강하 작용, 혈당과 고지혈증 강하, 담즙 분비촉진, 진정작용 등이 알려져 있다.
백출은 국화과의 삽주(Atractylodes japonica Koidzumi) 또는 백출(Atractylodes macrocephala Koidzumi)의 뿌리 줄기 또는 주피를 제거하여 말린 약재로, 약간 쓰고 달며 씹으면 점성을 띠고 성질은 따뜻하다. 장관 억제 작용과 흥분 작용 조절, 항궤양 및 간 기능 보호 작용, 면역 기능 항진작용, 혈관 확장 작용, 이뇨 작용 및 혈당 강하 작용 등이 보고되어 있다.
산치자(Gardenia jasminoides)는 산치자나무의 열매로, 사화, 제번, 청열, 이뇨, 양혈, 해독에 효과가 있다고 알려져 있다.
형개(Schizonepeta rhizome)는 꿀풀과에 속하는 일년생 초본식물로 전초를 약재로 이용하고 있다. 약효는 해열작용이 있어 감기 초기의 발한, 해열 목적으로 사용하고 인후염, 피부질환, 중풍 등에 이용되고 있으며, 까맣게 볶아 쓰면 지혈작용이 있어 자궁출혈, 코피, 대변출혈, 토혈, 소변출혈 등에 응용되고 있다.
생강(Zingiberis Rhizoma)은 한국, 중국, 일본에서는 생강과의 생강(Zingiber officinale Roscoe)의 신선한 뿌리줄기를 의미한다. 생강은 외감성 감기로 인한 오한, 발열, 두통, 구토, 해수, 가래를 치료하며, 식중독으로 인한 복통설사, 복만에도 효과가 있다. 약리작용으로는 위액분비촉진, 소화력 증진, 심장흥분 작용, 혈액순환촉진, 억균작용 등이 보고되었다.
활석(Talc)은 수분대사를 활발히 하는 것을 주요 효능으로 하는 약물로, 성미는 달고 담백하며 차갑다. 활석은 피부점막보호작용, 항균작용, 이뇨, 지갈(갈증을 멈추게 함), 해열, 해독, 소염, 배뇨통, 열사병의 발열, 통림, 이수 등의 효능이 보고되어 있다.
감초(Glycyrrhiza uralensis Fischer 또는 Glycyrrhiza glabra L.)는 쌍떡잎식물 장미목 콩과의 여러해살이 풀로, 특이한 냄새가 나며 맛은 달다. 감초는 모든 약의 독성을 조화시켜서 약효가 잘 나타나게 하며 장부의 한열과 사기를 다스리고 모든 혈맥의 소통을 잘 시키며 근육과 뼈를 튼튼히 하는 효과가 있다. 약리작용으로는 해독작용, 간염, 두드러기, 피부염, 습진 등에 효과가 있으며, 진해, 거담, 근육이완, 이뇨작용, 항염작용이 있고 소화성궤양을 억제한다고 알려져 있다.
금은화는 인동과의 인동덩굴(Lonicera japonica Thunberg) 또는 그 변종의 꽃봉오리를 말하는 것으로, 특이한 냄새가 있고 맛은 달고 성질은 차다. 금은화는 열을 내리고 가슴이 답답하고 갈증이 있을 때 사용하며 염증에 좋아 종기, 피부가 헐어 생긴 독, 장기의 염증, 농을 배출하는데 사용한다. 또한, 이질, 열독으로 인한 피부 조직 괴사, 유선염 등에 사용되고 있으며, 대장염, 위궤양, 방광염, 인후염, 편도선염, 기관지염, 결막염 및 부스럼, 유행성 이하선염으로 인한 고열, 화농성 감염증 등에 응용하고 있다. 약리작용으로는 항균작용, 항염증작용, 해열작용, 백혈구 탐식작용 증가, 중추신경 흥분작용, 혈청 콜레스테롤 강하, 궤양 예방 효과 등이 보고되고 있다.
음양곽은 쌍떡잎식물 미나리아재비목 매자나무과의 여러해살이풀인 삼지구엽초(Epimedium koreanum Nakai) 또는 기타 동속근연식물의 지상부(줄기와 잎)를 의미하며, 냄새가 없으며 맛은 맵고 달며 성질은 따뜻하다. 음양곽은 발기부전, 유정, 자궁냉증, 사지냉증, 피부마비, 구안와사, 건망증, 반신불수, 허리와 무릎 연약증, 고혈압, 소아마비 등에 쓰이고 있다. 약리작용으로는 정액분비촉진, 혈압강화, 관상동맥 혈류량 증가, 혈당강하, 콜레스테롤 강하, 면역기능증진, 진해, 거담, 평천, 진정작용, 억균, 소염작용, 닭의 대퇴골 생장과 단백다당 합성 활성화 등이 보고되어 있다.
원지(Polygala tenuifolia)는 쌍떡잎식물 쥐손이풀목 원지과의 여러해살이 풀로, 한방에서는 뿌리를 원지라고 한다. 거담제, 강장제, 강정제 등으로 쓰이고 있다.
목향(elecampane)은 쌍떡잎식물 초롱꽃목 국화과의 여러해살이 풀인 목향(Aucklandia lappa Decne.)의 뿌리를 말하며, 특이한 냄새가 있고 맛은 맵고 쓰며 성질은 따뜻하다. 목향은 복부가 차서 생기는 복통, 헛배 부른 증상, 구토, 설사에 사용하며 기를 잘 통하게 해 소화기의 만성 염증, 위통에 효과가 있고, 항균작용이 있어 이질과 고환염에 쓰이고 있다. 약리작용으로는 기관지와 소장 경련을 풀어 주며 혈압강하작용, 항균작용 등이 알려져 있다.
본 발명자들은 정상세포들에게도 영향을 주어 심각한 부작용을 초래하는 종래의 항암 치료법을 대체할 수 있는 보다 인체에 안전하고, 효과가 높은 암 치료 방법을 연구하던 중, 안전성이 보장된 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합약재의 추출물을 고전이 암세포주인 HT1080(human fibroscarcoma; 인간 섬유육종) 및 B16F10(murine melanoma; 마우스 흑색종) 세포주에 처리한 결과 암 세포의 이동 및 침윤을 효과적으로 억제함은 물론, 다양한 암세포주(HT1080(human fibroscarcoma; 인간 섬유육종), AGS(human gastric carcinoma; 인간 위암종), A431(human epidermoid carcinoma; 인간 편평세포암종) 및 B16F10(murine melanoma; 마우스 흑색종))에 처리한 결과 효과적으로 세포 사멸을 유도하고 종양 성장을 억제하는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 하나의 목적은 인체에 안전하며, 효과적인 항암 효과를 갖는 혼합 약재 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 혼합 약재 추출물을 유효성분으로 포함하는 암의 예방 또는 개선용 건강기능식품을 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 혼합 약재 추출물을 포함하는 조성물을 필요로 하는 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공하는 것이다.
본 발명은 암의 예방 또는 치료에 효과적인 천연 추출물에 관한 것으로, 암 세포에 대하여 효과적인 전이 억제, 세포 사멸 유도 및 세포 성장 억제 활성을 가짐으로써 암의 예방 또는 치료용 조성물로 약학적으로 이용 가능할 뿐 아니라 건강기능식품으로도 유용하게 이용될 수 있다.
도 1은, 다양한 고전이 암세포주(B16F10, HT1080, AGS 및 A431)에 대한 혼합 약재 추출물(KIOM-C)의 세포 사멸 유도 효과를 분석한 결과를 나타낸 것이다.
도 2는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 HT1080 세포 주기 진행에 대한 영향을 분석한 결과를 나타낸 것이다.
도 3은, 혼합 약재 추출물(KIOM-C)의 처리에 따른 세포 주기 관련 단백질의 발현 변화 정도를 분석한 결과를 나타낸 것이다.
도 4a 내지 도 4e는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 세포 사멸(apoptosis) 및 자가포식(autophagy) 작용 유도를 분석한 결과를 나타낸 것이다.
도 5a 내지 도 5e는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 세포 사멸 유도 기작을 웨스턴 블롯으로 분석한 결과를 나타낸 것이다.
도 6a 내지 도 6c는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 세포 내 산화 스트레스 유도로 인해 유발된 종양 세포 사멸 효과를 분석한 결과를 나타낸 것이다.
도 7a 내지 도 7e는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 JNK 활성화에 대한 영향을 분석한 결과를 나타낸 것이다.
도 8은, 혼합 약재 추출물(KIOM-C)의 처리에 따른 암세포(B16F10(A) 및 HT1080(B))의 비-부착성 콜로니 형성능을 나타낸 것이다.
도 9a 및 도 9b는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 상처 치유 분석(wound healing assay) 결과를 나타낸 것이다.
도 10a 및 도 10b는, 혼합 약재 추출물(KIOM-C)의 처리에 따른 트랜스웰 세포 이동 및 세포 침윤 활성 분석(Transwell migration and invation assay) 결과를 나타낸 것이다.
도 11은, 혼합 약재 추출물(KIOM-C)의 처리에 따른 MMP-9 활성에 대한 혼합 약재 추출물(KIOM-C)의 영향을 RT-PCR(A), 웨스턴블롯(B 및 D) 및 젤라틴 자이모그래피(Gelatin zymography)(B 및 C)로 분석한 결과를 나타낸 것이다.
도 12는, PMA 자극에 의한 NF-κB 활성화에 대한 혼합 약재 추출물(KIOM-C)의 영향을 웨스턴블롯으로 분석한 결과를 나타낸 것이다.
도 13a 및 도 13b는, B16F10 폐암 세포주가 주입된 마우스에 상기 혼합 약재 추출물(KIOM-C)를 투여하고 폐 전이 정도를 육안 관찰 분석(도 13a) 및 콜로니(colony) 개수(도 13b)를 분석한 결과를 나타낸 것이다.
도 14a 내지 도 14d는, 고전이 암세포주인 HT1080을 대퇴부에 접종한 마우스에 상기 혼합 약재 추출물(KIOM-C)를 투여하고 약 15일 동안의 종양 부피 변화(도 14a) 및 15일 후 적출한 종양괴 관찰(도 14b), 종양 질량 변화(도 14c) 및 인터페론-감마(IFN-γ) 분비 농도(도 14d)를 분석한 결과를 나타낸 것이다.
도 15는, 혼합 약재 추출물(KIOM-C)과 각 단미재 성분 추출물의 암 세포 생존율(암 세포사멸 효과) 비교 분석 결과를 나타낸 것이다.
도 16은, 단미재 성분 중 대황 추출물 및 마황 추출물 처리에 의한 MMP-9 활성 변화를 젤라틴 자이모그래피(gelatin zymography)로 분석한 결과를 나타낸 것이다.
상기의 목적을 달성하기 위한 하나의 양태로서, 본 발명은 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합 약재의 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 조성물은 음양곽 1 중량부에 대하여, 천궁 1 중량부 내지 3 중량부, 방풍 1 중량부 내지 3 중량부, 당귀 1 중량부 내지 3 중량부, 작약 1 중량부 내지 3 중량부, 연교 1 중량부 내지 3 중량부, 박하엽 1 중량부 내지 3 중량부, 마황 1 중량부 내지 3 중량부, 망초 1 중량부 내지 3 중량부, 대황 1 중량부 내지 3 중량부, 석고 0.5 중량부 내지 3 중량부, 길경 0.5 중량부 내지 3 중량부, 황금 0.5 중량부 내지 3 중량부, 백출 0.5 중량부 내지 2 중량부, 산치자 0.5 중량부 내지 2 중량부, 형개 0.5 중량부 내지 2 중량부, 생강 1 중량부 내지 3 중량부, 활석 1 중량부 내지 5 중량부, 감초 1 중량부 내지 3 중량부, 금은화 1 중량부 내지 3 중량부, 원지 1 중량부 내지 3 중량부, 및 목향 1 중량부 내지 3 중량부의 비율로 생약 혼합물을 제조한 후 추출하는 것이 바람직하다.
본 발명의 용어 "추출물(extract)"은 생약을 적절한 침출액으로 짜내고 침출액을 증발시켜 농축한 제제를 의미하는 것으로, 이에 제한되지는 않으나, 추출처리에 의해 얻어지는 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물, 이들의 조정제물 또는 정제물일 수 있다. 상기 혼합 약재 추출물은 당업계에 공지된 일반적인 추출방법, 분리 및 정제방법을 이용하여 제조할 수 있다. 상기 추출방법으로는, 이에 제한되지는 않으나, 바람직하게 열탕 추출, 열수 추출, 냉침 추출, 환류 냉각 추출 또는 초음파 추출 등의 방법을 사용할 수 있다.
본 발명에 있어서, 상기 추출물은 추출용매로 추출하거나 추출용매로 추출하여 제조한 추출물에 분획용매를 가하여 분획함으로써 제조할 수 있다. 상기 추출용매는 이에 제한되지 않으나, 물, 유기용매 또는 이들의 혼합용매 등을 사용할 수 있으며, 상기 유기용매는 탄소수 1 내지 4의 알코올이나, 에틸아세테이트 또는 아세톤 등의 극성용매, 헥산 또는 디크로로메탄의 비극성용매 또는 이들의 혼합용매를 사용할 수 있다. 또한, 바람직하게는 물, 탄소수 1 내지 4의 알코올 또는 이들의 혼합용매를 사용할 수 있으며, 보다 바람직하게는 에탄올을 사용할 수 있다. 본 발명의 일 실시예에서는 상기 용매로서 에탄올을 이용한 추출물을 제조하였다.
본 발명의 혼합 약재의 추출물은 상기 기술한 비율의 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활성, 감초, 금은화, 원지 및 목향으로 구성되는 혼합약재를 2-10 배량의 물을 가한 후 70℃ 내지 125℃의 온도에서 3시간 내지 4시간 동안 열수추출하여 수득하였다. 상기 혼합 약재 추출물은 농축 후 동결건조하였으며, 동결건조된 시료는 증류수에 녹여 실험에 사용하였다.
본 발명에서 사용되는 용어 "암"은, 신체 조직의 자율적인 과잉 성장에 의해 비정상적으로 자라난 덩어리를 의미하며, 양성종양과 악성종양으로 구분할 수 있다. 양성종양이 비교적 성장 속도가 느리고 전이되지 않는 것에 반해 악성종양은 주위 조직에 침윤하면서 빠르게 성장하고 신체 각 부위에 확산되거나 전이되어 생명을 위협하게 된다. 따라서 악성종양을 암과 동일한 의미로 생각할 수 있다.
본 발명의 조성물에 의해 예방 또는 치료될 수 있는 대상 암은 특정 암으로 한정되지 않으며, 바람직하게는 유방암, 폐암, 위암, 간암, 혈액암, 뼈암, 췌장암, 피부암, 두경부암(head or neck cancer), 피부 또는 안구 흑색종, 자궁육종, 난소암, 직장암, 항문암, 대장암, 난관암, 자궁내막암, 자궁경부암, 소장암, 내분비암, 갑상선암, 부갑상선암, 신장암, 연조직종양, 요도암, 전립선암, 기관지암 또는 골수암 일 수 있다. 보다 바람직하게는 상기 암은 섬유육종, 피부암, 폐암, 유방암, 위암일 수 있으나, 이에 제한되지는 않는다.
본 발명의 일 실시예에 의하면, HT1080(human fibroscarcoma), B16F10(murine melanoma), A431(human epidermoid carcinoma) 및 AGS(human gastric carcinoma) 총 4종의 세포주를 사용하였으며, 본 발명의 혼합 약재 추출물에 의한, HT1080 세포 사멸 및 성장 억제를 통해 섬유육종을, B16F10 세포 사멸 및 성장 억제를 통해 피부암을, A431 세포 사멸 및 성장 억제를 통해 폐암 및 유방암을, AGS 세포 사멸 및 성장 억제를 통해 위암을 예방 또는 치료할 수 있음을 입증하였다.
본 발명의 목적상, 상기 암은 본 발명의 혼합 약재 추출물에 의해 예방 또는 치료의 목적이 되는 질병으로서, 상기 혼합 약재 추출물을 포함하는 조성물은 암세포의 전이 억제, 세포 사멸 유도 또는 세포 성장을 억제하는 활성을 보임으로써 항암효과를 나타낼 수 있다.
본 발명의 일 실시예에 의하면, 상기 혼합 약재 추출물을 고전이암 세포주에 처리하고 세포 전이(세포 이동 및 세포 침윤 활성) 및 세포 사멸과 세포 성장에 미치는 영향을 in vitro in vivo 동물실험을 통해 확인하였다.
먼저 상기 혼합 약재 추출물의 전이 억제에 대한 효능을 보기 위한 in vitro 연구에서 정상 세포와 다양한 암세포주에 혼합 약재 추출물을 처리한 결과, 정상세포에 대해서는 독성이 없으면서, 고전이암의 세포 사멸능이 유의적으로 억제됨을 확인하였다(도 1). 또한, 혼합 약재 추출물의 처리에 따른, 세포 주기 진행에 대한 영향 및 세포 주기 관련 단백질의 발현 정도를 분석해 본 결과, G1 세포 주기 억류를 유도하여 세포 증식을 지연시키고, 효과적으로 비정상적인 세포 증식 저해 및 세포 사멸을 유도함을 확인하였다(도 2 및 도 3). 그리고 상기 혼합 약재 추출물에 의한 세포 사멸(apoptosis) 및 자가포식(autophagy)와 관련된 인자들을 분석해 본 결과, 혼합 약재 추출물이 관련 인자들과 밀접한 관계를 가짐을 확인함으로써, 세포 사멸 및 자가포식 작용을 유도함을 입증하였다(도 4a 내지 도 5e). 아울러, 혼합 약재 추출물의 처리에 따른 세포 내 산화 스트레스 유도로 인해, 종양 세포 사멸 효과를 보임을 확인하였다(도 6a 내지 도 6c). 뿐만 아니라, 혼합 약재 추출물은 세포신호전달체계 경로 중, JNK 활성화에 영향을 주어 세포 사멸을 유도함을 확인하였다(도 7a 내지 도 7e). 이외에, 혼합 약재 추출물에 의해 암세포의 비-부착능 콜로니 형성능이 억제되고(도 8), 세포 이동 및 세포 침윤능이 억제되는 것을 확인하였다(도 9a 내지 도 10b). 또한, 혼합 약재 추출물의 처리에 따른 MMP-9 및 NF-κB와 같은 암 전이에 관련된 인자들의 발현 정도가 서로 밀접한 관련성이 있음이 확인되었다(도 11 및 도 12).
마찬가지로, in vivo 실험 결과에서도, 혼합 약재 추출물을 투여한 마우스의 경우 정맥주사된 고전이 암세포주의 폐전이능이 현저히 감소됨을 확인하였다(도 13a 및 도 13b). 고농도의 혼합 약재 추출물을 다양한 암세포주에 처리한 경우, 암세포 생존율을 현저히 저하시켰으며, 혼합 약재 추출물을 누드 마우스에 경구 투여한 경우, 암세포주의 성장을 현저하게 억제하는 것을 확인하였다(도 14a 내지 도 14d).
추가적으로, 본 발명의 상기 혼합 약재 추출물(KIOM-C)과 이를 구성하는 각 단미재 추출물들의 효과를 비교 분석하기 위하여, 상기 각 추출물을 고전이암 세포 HT1080에 각각 처리한 후 암 세포 사멸 효과 및 전이 억제 효과를 확인한 결과, 각 단미재 추출물을 상기 혼합 약재 추출물(KIOM-C)에 포함되어 있는 각 단미재의 농도 비율과 동일한 저농도로 처리하였을 때는 세포 사멸이나 전이 억제와 같은 항암 효과를 나타내지 않음을 확인하였다(도 15 및 도 16). 이를 통해, 본 발명의 혼합 약재 추출물은 상기 22가지 약재의 혼합에 따른 시너지 효과를 가진다는 것을 확인할 수 있었다.
본 발명에서 사용되는 용어 "예방"은, 상기 혼합약재 추출물을 함유하는 조성물의 투여로 질환을 억제 또는 지연시키는 모든 행위를 의미한다. 또한, 본 발명에서 사용되는 용어 "치료"는, 상기 혼합약재 추출물을 함유하는 조성물의 투여로 질환의 증세가 호전되거나 완치되는 모든 행위를 의미한다.
본 발명의 조성물은 투여를 위하여, 상기 기재한 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함할 수 있다. 상기 담체, 부형제 및 희석제로는 락토오스, 덱스트로오스, 수크로오스, 소르비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
본 발명의 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사 용액의 형태로 제형화하여 사용할 수 있다. 상세하게는, 제형화할 경우 통상 사용하는 충진제, 중량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형제제로는 정제, 환제, 산제, 과립제, 캡슐제 등을 포함하나, 이에 한정되는 것은 아니다. 이러한 고형제제는 상기 혼합약재 추출물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘 카보네이트, 수크로오스, 락토오스, 젤라틴 등을 섞어 조제될 수 있다. 또한, 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등을 첨가하여 조제될 수 있다. 비경구 투여를 위한 제제는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제 및 과제를 포함한다. 비수성 용제 및 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 오일, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로솔, 트윈 61, 카카오지, 라우린지, 글리세로 젤라틴 등이 사용될 수 있다.
본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여 경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다. 상기 혼합약재 추출물의 일일 투여량은 바람직하게는 1 mg/kg 내지 600 mg/kg이며, 필요에 따라 일일 1회 내지 수회로 나누어 투여할 수 있다.
다른 하나의 양태로서, 본 발명은 혼합 약재 추출물을 포함하는 조성물을 필요로 하는 개체에 투여하는 단계를 포함하는 암의 예방 또는 치료 방법을 제공한다.
상기 암 관련 질환은 피부암, 위암, 폐암 등의 각종 암 질환일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 사용되는 용어, "개체"란 암이 이미 발병하였거나 발병할 수 있는 인간을 포함한 모든 동물을 의미하고, 본 발명의 조성물은 개체에게 투여함으로써, 상기 질환을 효과적으로 예방 및 치료할 수 있는 효과가 있다.
본 발명의 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에서 사용된 용어, "약학적으로 유효한 양"은 의학적 치료에 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
또 다른 하나의 양태로서, 본 발명은 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합 약재의 추출물을 유효성분으로 함유하는 암의 예방 또는 개선용 건강기능식품을 제공한다.
상기 건강기능식품은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 천연 과일 주스 및 과일 주스 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 또한, 건강기능식품은 육류, 소세지, 빵, 초콜릿, 캔디류, 스넥류, 과자류, 피자, 라면, 껌류, 아이스크림류, 스프, 음료수, 차, 기능수, 드링크제, 알코올 및 비타민 복합제 중 어느 하나의 형태일 수 있다.
또한, 상기 건강기능식품은 식품첨가물을 추가로 포함할 수 있으며, "식품첨가물"로서의 적합여부는 다른 규정이 없는 한 식품의약품안정청에 승인된 식품첨가물공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다.
상기 "식품첨가물공전"에 수재된 품목으로 예를 들어, 케톤류, 글리신, 구연산 칼륨, 니코틴산, 계피산 등의 화학적 합성품, 감색소, 감초추출물, 결정셀룰로오스, 고랭색소, 구아검 등의 천연첨가물, L-글루타민산나트륨제제, 면류첨가알칼리제, 보존료제제, 타르색소제제 등의 혼합 제제류 등을 들 수 있다.
이때, 건강기능식품을 제조하는 과정에서 식품에 첨가되는 본 발명에 따른 혼합약재 추출물은 필요에 따라 그 함량을 적절히 가감할 수 있으며, 바람직하게는 식품 100 중량%에 1 중량% 내지 15 중량% 포함되도록 첨가하는 것이 바람직하다.
실시예를 통하여 본 발명의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들 실시예에 의해 한정되는 것은 아니다.
실시예 1: 혼합 약재 추출물의 제조
천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성되는 혼합 약재인 KIOM-C를 제조하기 위하여, 영천 한약재 시장(영천, 대한민국)에서 상기 약재들을 구입하여, 대용량 열수 추출을 시행하였다.
상기 혼합 약재인 KIOM-C는 음양곽 1 중량부에 대하여, 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초 및 대황 1 중량부 내지 3 중량부, 석고, 길경 및 황금 0.5 중량부 내지 3 중량부, 백출, 산치자 및 형개 1 중량부 내지 2 중량부, 생강 1 중량부 내지 3 중량부, 활석 1 중량부 내지 5 중량부, 감초, 금은화 및 원지 1 중량부 내지 3 중량부, 목향 1 중량부 내지 3 중량부의 비율로, 상기 약재들을 혼합하여 이루어지고, KIOM-C 혼합 약재 2456.5 g에 15 L의 증류수를 가하여, 추출기(코스모스-600 추출기, 경서기계산업, 인천, 대한민국)에서 115℃의 온도로 3시간 동안 열수 추출하였다.
상기 추출된 KIOM-C 혼합 약재 추출물을 표준 시험 시브(체)(150 ㎛, Retsch, Han, 독일)를 이용하여 필터링하고, 동결 건조기에서 건조될 때까지 농축하였다. 상기 동결 건조된 KIOM-C 혼합 약재 추출물 분말(50 ㎎)을 1 ㎖의 증류수에 녹이고, 0.22 ㎛의 디스크 필터를 통해 필터링한 다음, 사용하기 전까지 -20℃에 보관하였다.
비교예 1 내지 22: 각 단미재 추출물의 제조
상기 실시예에서 제조한 혼합 약재 추출물(KIOM-C)과 각 단미재 추출물의 항암 효과에 대한 비교 실험을 위하여, 혼합 약재 추출물(KIOM-C)을 구성하는 각 단미재 중 천궁(비교예 1), 방풍(비교예 2), 당귀(비교예 3), 작약(비교예 4), 연교(비교예 5), 박하엽(비교예 6), 마황(비교예 7), 망초(비교예 8), 대황(비교예 9), 석고(비교예 10), 길경(비교예 11), 황금(비교예 12), 백출(비교예 13), 산치자(비교예 14), 형개(비교예 15), 생강(비교예 16), 활석(비교예 17), 감초(비교예 18), 금은화(비교예 19), 음양곽(비교예 20), 원지(비교예 21) 및 목향(비교예 22) 추출물을 제조하였다.
각 단미재 50 g에 1 L의 증류수를 가하여, 추출기(코스모스-600 추출기, 경서기계산업, 인천, 대한민국)에서 115℃의 온도로 3시간 동안 열수 추출하였다.
상기 열수 추출한 단미재 추출물을 시험 시브(체)(150 ㎛, Retsch, Han, 독일)를 이용하여 필터링하고, 동결 건조기에서 건조될 때까지 농축하였다. 상기 동결 건조된 단미재 추출물 분말(50 ㎎)을 1 ㎖의 증류수에 녹이고, 0.45 ㎛의 시린지 필터를 통해 필터링한 다음, 사용하기 전까지 4℃에 보관하였다.
실시예 2: 혼합 약재 추출물(KIOM-C)의 암세포 증식 저해 활성 평가 및 작용기작 분석
기원 및 특징을 달리하는 총 4종의 세포주, HT1080(human fibroscarcoma; 인간 섬유육종), AGS(human gastric carcinoma; 인간 위암종), A431(human epidermoid carcinoma; 인간 편평세포암종) 및 B16F10(murine melanoma; 마우스 흑색종)을 이용하여 혼합 약재 추출물(KIOM-C)의 암세포 증식 저해 활성 평가 및 작용 기전을 분석하였다.
실시예 2-1: 암 세포주 배양
HT1080(human fibroscarcoma; 인간 섬유육종), AGS(human gastric carcinoma; 인간 위암종), A431(human epidermoid carcinoma; 인간 편평세포암종) 및 B16F10(murine melanoma; 마우스 흑색종) 세포는 ATCC(American Type Culture Collection)로부터 구입하여 이용하였다. 상기 다양한 암세포주는 10% 소 태아 혈청(fetal bovine serum; FBS), 100 U/ml 페니실린(penicillin) 및 100 ug/ml의 스트렙토마이신(streptomycin)이 포함된 DMEM 배지(Dulbecco's modified Eagle's medium)를 사용하여, 온도(37℃) 및 습도가 일정하게 유지되고 5% CO2가 공급되는 인큐베이터에서 배양하였다.
실시예 2-2: 암세포 증식 저해 활성 및 세포 독성 평가
다양한 암세포주에 대한 혼합 약재 추출물(KIOM-C)의 암세포 증식 저해 활성을 평가하기 위하여, MTT assay를 수행하였다. 이때, 정상 간세포(hepatocyte)를 대조군으로 사용하여, 상기 실시예의 혼합 약재 추출물(KIOM-C)의 정상 세포에 대한 세포 독성을 평가하였다. 또한, 도립현미경(inverted microscope)을 사용하여, 혼합 약재 추출물(KIOM-C)에 의한 암세포주의 세포 형태(morphology) 변화도 관찰하였다.
구체적으로, 상기 실시예 2-1과 같이 배양한, 다양한 암세포주에 대한 혼합 약재 추출물(KIOM-C)의 세포 생존율에 미치는 영향을 확인하기 위하여, 각각의 암세포주(5×103 개의 세포/웰/96-웰 플레이트)에 상기 실시예 1에서 제조한 100 ㎍/㎖ 내지 1000 ㎍/㎖ 농도의 혼합 약재 추출물(KIOM-C)을 처리한 후 인큐베이션하였다. 48시간 처리 후, 상기 세포에 10 ㎕의 MTT 용액(PBS에서 5 ㎎/㎖)을 가하여 4시간 더 추가적으로 인큐베이션하였다. 그 다음, 포르마잔(formazan) 침전물을 디메틸 설폭사이드(dimethyl sulfoxide, DMSO)로 녹인 후, Infinite® M200 마이크로플레이트 리더(TECAN Group Ltd, 스위스)를 이용하여 570 nm에서 흡광도를 측정하여 세포 생존율을 확인하였다.
실험 결과, 무처리 대조군 세포와 비교하여, 상기 다양한 4종의 암세포주에 500 ㎍/㎖ 내지 1000 ㎍/㎖의 농도의 혼합 약재 추출물(KIOM-C)로 처리한 경우, 세포 독성이 두드러지게 관찰되었다. 50%의 세포 생존율을 나타내는 농도 IC50 값이 각각 720.34 ㎍/㎖(B16F10 세포주), 408.22 ㎍/㎖(HT1080 세포주), 406.59 ㎍/㎖(AGS 세포주) 및 607.86 ㎍/㎖(A431 세포주)로 도출된 데 반해, 정상 세포인 간세포의 경우, 혼합 약재 추출물(KIOM-C)을 1000 ㎍/㎖의 농도로 처리하여도 어떠한 세포 독성도 보이지 않았다(도 1의 A). 이는, 상기 혼합 약재 추출물(KIOM-C)이 모든 암세포주에만 특이적으로, 농도 의존적인 암세포 증식 저해 효능을 나타냄을 의미한다.
또한, 혼합 약재 추출물(KIOM-C)에 의한 암세포주의 세포 형태 변화를 현미경으로 관찰한 결과, 농도 의존적으로 디쉬에 부착되어 있는 세포의 수가 감소하였으며, 세포의 모양이 둥글게 변하면서 부착되지 못하고, 세포질에 많은 액포가 관찰되는 등의, 암세포의 자가포식(autophagic) 및 자가사멸(apoptotic)을 유도하는 것을 확인할 수 있었다(도 1의 B).
따라서, 혼합 약재 추출물(KIOM-C)은 정상 간세포에는 세포 독성을 나타내지 않으면서, 정상 간세포를 제외한 모든 암세포주에서 농도 의존적인 암세포 증식 저해 효능 및 암세포의 자가포식(autophagic) 및 자가사멸(apoptotic) 효과를 지님을 의미한다.
실시예 2-3: 세포 주기 분석
혼합 약재 추출물(KIOM-C)의 암세포 증식 저해 효과가 세포 주기 진행 조절과 어떠한 관련성이 있는지 확인하기 위하여, 하기와 같은 실험을 수행하였다.
HT1080 세포를 60 mm 디쉬 당 5×105개가 되도록 시딩(seeding)한 다음, 37℃, 5% CO2 인큐베이터에서 24시간 동안 배양하였다. 배양 후, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 1000 ㎍/㎖의 농도로 처리하여, 12시간 및 24시간 동안 추가 배양하였다. 추가 배양 후, 디쉬에 부착되지 않은 세포와 부착된 세포를 모두 모은 다음 PBS로 2회 세척하고, 70% 에탄올을 천천히 가하여 세포를 고정시켰다. 고정된 세포는 24시간 동안 -20℃에서 보관하였다. 에탄올을 제거하기 위하여, 원심분리 후, 세포는 PBS로 2회 세척하고 RNase A(0.05 ㎎/㎖), 0.1% Triton X-100 및 0.1 mM EDTA가 포함되어 있는 50 ㎍/㎖ 프로피디움 요오드화물(propidium iodide; PI) 용액을 가하여 30분 동안, 4℃에서 차광 염색하였다. 염색 후 PI 용액을 제거하고 염색된 세포를 PBS로 현탁한 뒤, 폴리스티렌 둥근 바닥 튜브(polystyrene round-bottom tube)로 옮겨서, CellQuest 소프트웨어를 이용한 FACS 칼리버 유동 세포 계수기(FACSCalibur flow cytometer)(BD Biosciences, San Jose, CA)를 이용하여 세포 주기를 분석하였다. 세포 내 DNA 변화 양상은 WinMDI 2.8 소프트웨어(J. Trotter, Scripps Research Institute, La Jolla, CA)를 이용하여 각 세포 주기 당 분포 비율을 계산하였다.
실험 결과, 미처리 대조군과 비교하여, 혼합 약재 추출물(KIOM-C)에 의하여 G1 phase에 분포하는 세포의 비율이 57.14%(12시간) 및 55.53%(24시간)로 증가하였으며, G1 phase에 분포하는 세포 비율의 증가는 S 및 G2/M phase에 분포하는 세포 비율의 감소를 유도하였다. 세포 사멸적 sub-G1/G0 피크(peak)는 혼합 약재 추출물(KIOM-C)을 처리한 경우, 미처리 대조군과 비교하여, 7.92%(12시간) 및 13.96%(24시간)로 상당히 증가하였다(도 2).
따라서, 본 발명의 상기 혼합 약재 추출물(KIOM-C)이 G1 세포 주기 억류(cell cycle arrest)를 유도하여 세포 증식을 지연시키고, 효과적으로 세포 사멸을 유도하였음을 의미한다.
실시예 2-4: 세포 주기 관련 단백질 발현 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)이 G1 Phase 조절 단백질인 p21, p27 및 cyclin D1의 발현에 어떠한 영향을 미치는지 확인하기 위하여, 웨스턴 블롯을 수행하였다.
구체적으로, HT1080 세포를 60 mm 디쉬 당 5×105개가 되도록 시딩(seeding)한 다음, 37℃, 5% CO2 인큐베이터에서 24시간 동안 배양하였다. 배양 후, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 처리하여, 12시간 및 24시간 동안 추가 배양하였다. 추가 배양 후, 디쉬에 부착되지 않은 세포와 부착된 세포를 모두 모은 다음 PBS로 2회 세척하고, 세포의 전체 세포 용해물(lysate)은 M-PER 포유동물 단백질 추출 시약(M-PER Mammalian Protein Extraction Reagent)(Thermo Scientific, Rockford, IL)을 사용하여 준비하였다. 세포 용해질(cell lysate)은 BCA 단백질 분석(BCA(Bicinchoninic Acid) protein assay)으로 단백질 농도를 정량하였고, 동량의 단백질을 10% 도데실 황산나트륨 폴리아크릴아미드 겔(SDS(sodium dodecyl sulfate) polyacrylamide gel)의 각 웰에 주입하여 전기영동을 실시하였다. 겔 상에 전개된 단백질을 Immunobilon PVDF 트랜스퍼 멤브레인(Millipore, Bedford, MA)에 옮겼다. 상기 멤브레인에 발현 단백질을 옮긴 후, 항-p21Waf1/Cip1, 항-p27Kip1 및 항-cyclin D1을 사용하여 면역학적 블로팅(immunoblotting)을 수행하였다. 후에, 단백질은 파워-옵티-화학발광 웨스톤 블롯팅 검출 시약(Power Opti-ECL Western blotting detection reagent)(Animal Genetics, Inc., Korea)과 ImageQuant LAS 4000 mini(GE Healthcare, Piscataway, NJ, USA)를 사용하여 가시화하였다. 상기 G1 Phase 조절 단백질인 p21, p27 및 cyclin D1의 발현 정도는, 가시화된 단백질 밴드(band)를 소프트웨어 ImageJ(National Institutes of Health, USA)를 이용하여 정량화함에 의해 도출하였다.
실험 결과, 미처리 대조군과 비교하여, 혼합 약재 추출물(KIOM-C)을 처리한 군에서는 사이클린-의존성 인산화 효소 억제제(cyclin-dependent kinase inhibitor)인 p21 및 p27의 발현 수준이 상향 조절되었고, 반면에 cyclin D1의 발현 수준은 하향 조절됨을 확인할 수 있었다(도 3).
따라서, 본 발명의 상기 혼합 약재 추출물(KIOM-C)은 세포 주기 조절 인자인 p21 및 p27과 같은 사이클린-의존성 인산화 효소 억제제(cyclin-dependent kinase inhibitor)를 조절함으로써, 비정상적인 세포의 증식 저해 및 세포 사멸을 유도할 수 있음을 의미한다.
실시예 2-5: 세포 사멸(apoptosis) 및 자가포식(autophagy) 작용 유도 분석
혼합 약재 추출물(KIOM-C)이 프로그램 세포사(PCD:programed cell death)를 유도하는지 확인하기 위하여, 하기와 같은 실험을 수행하였다.
실시예 2-5-1: YO-PRO-1의 흡수 탐지
HT1080 세포주에 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 처리하여, 12시간 및 24시간 동안 배양하였다. 이때, 세포 사멸 특이 염료(apoptosis-specific dye)인 YO-PRO-1(1 uM, Molecular Probes, Eugene, OR)을 가하여 30분 동안, 4℃에서 차광 염색하였다. 염색 후, 세포 세척이나 고정(fixation) 과정 없이 FACS 칼리버 유동 세포 계수기(FACSCalibur flow cytometer)를 이용하여 YO-PRO-1 흡수(uptake) 정도를 측정하고, WinMDI 2.8 소프트웨어를 이용하여 분석하였다.
실험 결과, 미처리 대조군과 비교하여, 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 24시간 처리한 경우, 각각 5.9% 및 8.9%의 세포 사멸을 보였다. 또한, 혼합 약재 추출물(KIOM-C)을 1000 ㎍/㎖의 농도로 48시간 처리한 경우, 미처리 대조군(3.6%)과 비교하여, 사멸된 세포가 7.5배(26.95%) 증가함을 확인할 수 있었다(도 4a).
실시예 2-5-2: TUNEL assay
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)의 세포사멸(apoptosis) 유도 활성을 평가하기 위하여, in situ cell death detection kit(Roche diagnostics GmbH, Mannheim, Germany)를 이용한 TUNEL 염색을 실시하였다.
구체적으로, 200 ㎕의 PBS로 현탁시킨 1×104 개의 HT1080 세포주를 사이토스핀(cytospin)하여 현미경 슬라이드(microscope slide)에 부착시킨 후, 4% 포름알데히드로 20℃에서 1시간 동안 고정시켰다. 1시간 고정 후, 3% 과산화수소(H2O2)로 20℃에서 10분간 블로킹(blocking)하고, 얼음(ice) 중에서 permeabilization(투과화) 용액인 0.1% TritonX-100을 가하여 2분 동안 방치하였다. 다음으로, 상기 세포에 말단전이효소(terminal transferase)와 플루오레세인-dUTP(fluorescein-dUTP)가 함유되어 있는 라벨링 용액(labeling solution)인, TUNEL 반응 혼합물(reaction mixture)을 가하여 37℃에서 1시간 동안 차광 염색하였다. 2×SSC(0.3 M NaCl, 30 mM sodium citrate)를 가하여 상기 염색 반응을 정지시키고, 핵을 염색하는 DAPI가 포함된 봉입제(mounting medium)(Vector Laboratories, Burlingame, CA)를 가한 다음, 커버슬립(coverslip)으로 밀봉시켜 형광 현미경(Olympus TH4-200; Olympus Optical Co. LTD)을 사용하여 검경, 촬영하였다.
실험 결과, 미처리 대조군과 비교하여, 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 처리한 경우, 각각 15.53% 및 57.33%의 TUNEL 양성세포가 관찰되었다(도 4b). 이에 따라, 혼합 약재 추출물(KIOM-C)의 농도에 의존적으로, TUNEL 양성세포가 현저히 증가함을 확인함으로써, 혼합 약재 추출물(KIOM-C)이 세포사멸과 밀접히 관련되어 있음을 알 수 있었다.
실시예 2-5-3: RFP-LC3 분포 형광 분석 및 LC3 단백 발현량 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)의 자가포식(autophagy) 유도 활성을 확인하기 위하여, 자가포식(autophagy)의 중요한 분자표식자인 microtubule-associated protein1 light chain 3(LC-3)이 형광 표지된 RFP-LC3를 사용하여 형광 분석을 실시하고, 웨스턴블롯을 수행하여 LC3 단백의 발현량을 확인하였다. 또한, 세포 사멸을 악화시키는 것으로 이미 알려져 있는 라이소좀 저해제인 바필로마이신 A1(Bafilomycin A1)을 본 발명의 혼합 약재 추출물(KIOM-C)과 함께 처리하였을 때, 자가포식(autophagy) 유도 활성에 어떠한 영향을 미치는지도 확인하였다.
구체적으로, 커버슬립(coverslip)이 들어있는 24-웰 배양 플레이트에서 자란 HT1080 세포주(5×104 개)에 RFP가 태킹(tagging)되어 있는 LC3 플라스미드(plasmid)를 TransIT2020(Mirus, Madison, WI)를 이용하여 형질주입(transfection) 하였다. 상기와 같이 트랜스펙션 된 세포를 24시간 배양하고, 배양 후, 세포에 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖l 및 1000 ㎍/㎖의 농도로 24시간 처리하였다. 24시간 후, 핵을 염색하는 DAPI가 포함된 봉입제(mounting medium)(Vector Laboratories, Burlingame, CA)를 가한 다음, 커버슬립(coverslip)으로 밀봉시켜 공초점 현미경(confocal microscope)(FV10i-W; Olympus Optical Co. LTD)으로 RFP-LC3의 분포를 검경, 촬영하였다. 또한, 상기 실시예 2-4에 기재한 바와 같이, 자가포식(autophagy)의 주요한 마커인 항체 LC3 및 항-p62/SQSTM1을 사용하여 웨스턴블롯을 수행하였다.
실험 결과, 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 처리한 경우, 미처리 대조군과 비교하여, RFP-LC3 형광 dot이 현저히 증가함을 확인할 수 있었다(도 4c).
혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 농도로 24시간 동안 처리한 세포에, 세포 사멸을 악화시키는 것으로 이미 알려져 있는 라이소좀 저해제인 10 nM 농도의 바필로마이신 A1(Bafilomycin A1)을 1시간 동안 전처리한 결과, 미처리 대조군에 비해 RFP-LC3 형광 dot이, 혼합 약재 추출물(KIOM-C) 단독 처리보다 더 증가하였고, 혼합 약재 추출물(KIOM-C) 처리 후, 자가포식의 중요한 분자표식자인 LC-3 단백양을 웨스턴 블롯으로 분석해 본 결과, LC-3II 단백질 양이 증가함을 확인할 수 있었다. 또한, 혼합 약재 추출물(KIOM-C)과 자가포식소체(autophagosome) 형성을 억제하는 바필로마이신 A1(Bafilomycin A1) 함께 처리한 경우, 혼합 약재 추출물(KIOM-C) 단독으로 처리한 경우보다 자가포식 표지자인 p62 및 LC3 단백의 발현량이 상당히 증가함을 확인할 수 있었다(도 4d). 이에 따라, 혼합 약재 추출물(KIOM-C)에 의한 암세포의 사멸에 자가포식도 관련되어 있으며, 혼합 약재 추출물(KIOM-C)에 의해 증가된 LC-3II가 자가포식에 의해 일어남을 알 수 있었다.
실시예 2-5-4: 자가포식 액포(autophagic vacuole) 탐지
HT1080 세포주에 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 처리하여, 24시간 동안 배양하였다. 이때, 자가포식 액포 트레이서(tracer)인 MDC(monodansyl cadaverine; Sigma Chemical) 50 uM을 가하여 40분 동안, 37℃에서 염색하였다. 염색 후, PBS로 2번 세척한 다음, 형광 현미경을 사용하여 검경, 촬영하였다.
실험 결과, 미처리 대조군과 비교하여, 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 및 1000 ㎍/㎖의 농도로 처리한 경우, 각각 33.10% 및 57.63%의 MDC 양성세포가 관찰되었다(도 4e). 이에 따라, 혼합 약재 추출물(KIOM-C)의 농도에 의존적으로, MDC 양성세포가 현저히 증가함을 확인함으로써, 혼합 약재 추출물(KIOM-C)이 자가포식 액포 형성과 밀접히 관련되어 있음을 알 수 있었다.
따라서, 상기의 결과들을 통하여, 혼합 약재 추출물(KIOM-C)은 암세포를 자가사멸(apoptosis) 뿐만 아니라 자가포식(autophagy)을 유도함으로써, 세포를 사멸시킬 수 있음을 의미한다.
실시예 2-6: 종양세포사멸 유도 기작 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)이 자가사멸(apoptosis) 및 자가포식(autophagy) 유도와 관련 있는 여러 인자들의 단백질 발현에 어떠한 영향을 미치는지, 그리고 암세포 증식 저해 및 사멸 유도 활성이 관련 세포 신호 전달체계의 활성화와 어떠한 관련성이 있는지 확인하기 위하여, 웨스턴 블롯을 수행하여 분석하였다.
실시예 2-6-1: 종양세포사멸 유도 관련 단백질의 발현 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)이 자가사멸(apoptosis) 및 자가포식(autophagy) 유도와 관련 있는 여러 인자들의 단백질 발현에 어떠한 영향을 미치는지 확인하기 위하여, 다양한 암세포주(HT1080, B16F10 및 AGS)에 상기 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 또는 1000 ㎍/㎖ 농도로 처리하고 24시간 및 48시간 경과 후, 각 세포에서 단백질을 회수한 후, 세포 사멸에 중요한 caspase-3 활성 및 PARP cleavage, 그리고 자가포식(autophagy)에 관여하는 LC3 및 p62 단백의 발현양상 및 자가포식소체(autophagosome) 형성에 있어서 중요한 Beclin-1의 발현 정도를 웨스턴 블롯 분석을 통해 확인하였다.
실험 결과, HT1080 세포주에 상기 혼합 약재 추출물(KIOM-C) 처리 24시간 경과 후부터, 자가포식 마커인 LC3 단백질이 16 kDa의 LC3 I에서 14 kDa의 LC3 II로 전환되는 것을 확인하였고, p62의 발현은 혼합 약재 추출물(KIOM-C) 처리 시, 효율적으로 감소됨을 확인하였다. 또한, 자가포식 동안 자가포식소체를 형성하는데 중요한 Beclin-1 단백질의 발현 수준이 두드러지게 증가되었고, 48시간 경과 후의 고농도 처리군에서는 caspase-3 활성 및 PARP cleavage가 확인되었다(도 5a).
또한, B16F10 및 AGS 세포주도 HT1080 세포주와 마찬가지로, 상기 혼합 약재 추출물(KIOM-C) 처리 24시간 경과 후부터, 자가포식 마커인 LC3 단백질이 16 kDa의 LC3 I에서 14 kDa의 LC3 II로 전환되는 것을 확인하였다. 또한, 자가포식 동안 자가포식소체를 형성하는데 중요한 Beclin-1 단백질의 발현 수준이 두드러지게 증가되고, PARP cleavage가 확인되었다(도 5b).
이를 통하여, 상기 혼합 약재 추출물(KIOM-C)에 의해 capase-3 활성에 의한 세포사멸 및 자가포식이 복합적으로 관여하는 것을 확인하였다.
실시예 2-6-2: 종양세포사멸 유도 관련 세포 신호 전달 체계의 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)에 의한, 암세포 증식 저해 및 사멸 유도 활성이 관련 세포 신호 전달체계의 활성화와 어떠한 관련성이 있는지 확인하기 위하여, 다양한 암세포주(HT1080, B16F10 및 AGS)에 상기 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 또는 1000 ㎍/㎖ 농도로 처리하고 3시간, 6시간 및 24시간 경과 후, 각 세포에서 단백질을 회수한 후, 세포 사멸을 조절하는 신호 전달 체계 활성화와 관련이 있는 인자인 AMPK, ULK, JNK, c-jun, p53, p38 및 ERK 1/2의 발현 양상을 웨스터 블롯 분석을 통해 확인하였다.
실험 결과, HT1080 세포주에 상기 혼합 약재 추출물(KIOM-C) 처리 3시간 경과 후부터, AMPK 및 ULK1의 인산화는 시간에 따라 점차적으로 증가되었고, 자가포식 및 세포 사멸 유도에 있어서 중요한 JNK 활성 및 p53의 인산화를 측정하였을 때, 상기 혼합 약재 추출물(KIOM-C)에 의해, 시간에 따라 두드러지게 인산화가 증가된 양상을 보였다. 또한, 상기 혼합 약재 추출물(KIOM-C)에 의해, 인산화된 c-jun의 발현 레벨도 시간에 따라 지속적으로 증가되었다(도 5c). p38의 경우, 24시간 경과 후 시초(0 시간)보다, 활성화된 p38의 레벨이 2배 정도 증가됨을 확인할 수 있었다. 반면, ERK 1/2의 활성화에는 어떠한 영향도 미치지 않았다(도 5d).
또한, B16F10 및 AGS 세포주도 HT1080 세포주와 마찬가지로, 상기 혼합 약재 추출물(KIOM-C) 처리 3시간 경과 후부터, 자가포식 및 세포 사멸 유도에 있어서 중요한 JNK의 활성을 측정하였을 때, 상기 혼합 약재 추출물(KIOM-C)에 의해, 시간에 따라 인산화가 증가된 양상을 보였다. 반면, p38 및 ERK 1/2의 활성화에는 어떠한 영향도 미치지 않았다(도 5e).
이를 통하여, 상기 혼합 약재 추출물(KIOM-C)이 다양한 신호전달 체계를 조절하여 세포사멸 및 자가포식에 복합적으로 관여하는 것을 확인하였다.
따라서, 상기의 결과들을 통하여, 혼합 약재 추출물(KIOM-C)이 자가사멸(apoptosis) 및 자가포식(autophagy) 유도와 관련 있는 여러 인자들의 단백질 발현 및 세포 신호 전달체계를 조절함으로써, 암세포를 자가사멸(apoptosis) 뿐만 아니라 자가포식(autophagy)을 유도하여, 세포를 사멸시킬 수 있음을 확인할 수 있었다.
실시예 2-7: 산화 스트레스에 의한 종양세포사멸 유도 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)이 세포 내 산화 스트레스(oxidative stress)를 유도하여 세포 사멸을 일으키는지 확인하기 위하여, JNK 매개에 의한 세포 내 활성산소종(reactive oxygen species; ROS)의 증가 여부를 유세포 분석기(flow cytometry)를 사용하여 평가하였다. 또한, 역전사중합효소 연쇄 반응(RT-PCR) 및 웨스턴 블롯을 수행하여, 세포 사멸 과정의 중요 인자인 CHOP(Protein-Homologous Protein) 발현 정도를 확인하였다. 이때, 항산화제로 알려져 있는 NAC(N-acetyl-L-cysteine) 또는 JNK-특이 저해제(JNK-specific inhibitor)인 SP600125를 상기 혼합 약재 추출물(KIOM-C)과 동시에 처리하여, 혼합 약재 추출물(KIOM-C)에 의한 JNK 활성이 직접적으로 ROS 활성과 CHOP 발현과 관련이 있는지 평가하였다.
실시예 2-7-1: 세포 내 활성산소종(reactive oxygen species; ROS) 레벨 측정
세포 내 활성산소종(reactive oxygen species; ROS) 레벨은 과산화물-민감 형광 프로브(peroxide-sensitive fluorescent probe)인, DCF-DA를 사용하여 측정하였다. 구체적으로, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 또는 1000 ㎍/㎖ 농도로 세포에 처리하여 3시간 동안 배양하였다. 이때, NAC(1 mM) 또는 JNK-특이 저해제인 SP600125(5 uM)을 1시간 동안 전처리하였다. 상기와 같이 배양한 세포에 5 M의 DCF-DA를 가하고 37℃에서 30분간 배양하였다. 배양 후, 세포를 PBS로 2번 세척하고, 떼어낸 후 PBS에 현탁하여 FACS 칼리버 유동 세포 계수기를 이용하여 세포 내 활성산소종의 생성 여부를 측정하고, WinMDI 2.8 소프트웨어를 이용하여 세포 내 활성산소종의 생성 비율을 계산하였다.
실험 결과, 미처리 대조군과 비교하여, 세포 내 ROS가 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 또는 1000 ㎍/㎖ 농도로 처리한 경우, 각각 2.9배 및 4.7배 가량 뚜렷하게 증가되는 것을 확인하였다. 또한, 이러한 활성은 NAC 또는 SP600125를 동시에 처리한 경우, 생성된 세포 내 활성산소종이 소실되는 것으로 나타났다(도 6a). 이에 따라, 혼합 약재 추출물(KIOM-C)의 농도에 의존적으로, 세포 내 활성산소종이 현저히 증가함을 확인함으로써, 혼합 약재 추출물(KIOM-C)이 세포 내 산화 스트레스(oxidative stress)를 유도하여 세포 사멸을 유발함을 알 수 있었다.
실시예 2-7-2: 역전사중합효소 연쇄 반응(RT-PCR)
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)(500 ㎍/㎖ 또는 1,000 ㎍/㎖)이 포함된 배지에서 세포를 24시간 및 48시간 동안 배양한 다음, 세포의 RNA를 PureHelix RNA 추출 키트(NanoHelix, 대전)를 사용하여 분리한 후, Helixcript 1'st strand cDNA 합성 키트(NanoHelix, 대전)를 사용하여 cDNA를 합성한 후 PCR을 수행하였다. 사용한 hCHOP 및 GAPDH 프라이머 서열 정보는 하기 표 1과 같다.
표 1
타겟 프라이머 서열번호
방향 서열(5'-3')
hCHOP Forward GCTTGGCTGACTGAGGAGGAG 1
hCHOP Reverse CTGACTGGAATCTGGAGAGTGAGG 2
GAPDH Forward TCATGACCACAGTCCATGCC 3
GAPDH Reverse TCCACCACCCTGTTGCTGTA 4
실험 결과, 세포 사멸 과정의 중요 인자인 CHOP의 mRNA 발현 수준은, 혼합 약재 추출물(KIOM-C)의 처리 농도 및 시간 의존적으로 증가하였고, 보다 구체적으로, 48시간 경과 후의 고농도 처리군에서는 약 20배 정도 CHOP mRNA의 발현량이 증가함을 할 수 있었다(도 6b). 이에 따라, 혼합 약재 추출물(KIOM-C)이 세포 내 산화 스트레스(oxidative stress)를 유도하여, 세포 사멸 과정의 중요 인자인 CHOP의 mRNA 발현량을 증가시킴으로써, 세포 사멸을 유발함을 알 수 있었다.
실시예 2-7-3: 웨스턴 블롯 분석(western blot analysis)
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)에 의한 세포 내 ROS 증가가 CHOP의 단백 발현 수준에 어떠한 영향을 미치는지 확인하기 위하여, JNK-특이 저해제인 SP600125(5 uM)을 1시간 동안 전처리한 뒤, 상기 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 또는 1000 ㎍/㎖ 농도로 세포에 처리하여 24시간 동안 배양하였다. 상기와 같이 배양한 세포의 전체 세포 용해물(lysate)을 제조업자의 지시에 따라, M-PER 포유동물 단백질 추출 시약(M-PER Mammalian Protein Extraction Reagent)을 사용하여 각각 준비하였다. 세포 용해질(cell lysate)은 BCA 단백질 분석(BCA(Bicinchoninic Acid) protein assay)으로 단백질 농도를 정량하였고, 면역학적 블로팅(immunoblotting) 후에, 단백질은 파워-옵티-화학발광 웨스톤 블롯팅 검출 시약(Power Opti-ECL Western blotting detection reagent)(Animal Genetics, Inc., Korea)과 ImageQuant LAS 4000 mini(GE Healthcare, Piscataway, NJ, USA)를 사용하여 가시화하였다. CHOP의 발현 정도는, 가시화된 단백질 밴드(band)를 소프트웨어 ImageJ(National Institutes of Health, USA)를 이용하여 정량화함에 의해 도출하였다.
실험 결과, 미처리 대조군과 비교하여, CHOP 단백의 발현량은 혼합 약재 추출물(KIOM-C)의 처리 농도에 의존적으로 현저히 증가되었다. 또한, JNK-특이 저해제인 SP600125를 동시에 처리하여, 생성된 세포 내 활성산소종이 소실된 경우, CHOP 단백의 발현 정도가 저해됨을 확인할 수 있었다(도 6c). 이에 따라, 혼합 약재 추출물(KIOM-C)이 세포 내 산화 스트레스를 유도하여, 세포 사멸 과정의 중요 인자인 CHOP 단백질의 발현량을 증가시킴으로써, 세포 사멸을 유도함을 알 수 있었다.
따라서, 상기의 결과들을 통하여, 혼합 약재 추출물(KIOM-C)에 의한 세포 내 ROS 증가는, 혼합 약재 추출물(KIOM-C)에 의한 암세포 증식 저해 및 사멸 유도 활성과 밀접한 관련이 있음을 알 수 있었다.
실시예 2-8: 세포 사멸(apoptosis) 및 자가포식(autophagy) 작용 동시 유도
세포 사멸(apoptosis) 및 자가포식(autophagy)을 동시에 유도하여 세포사(cell death)를 매개하는, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)이 세포신호전달체계 중 매우 중요한 JNK의 활성화에 어떠한 영향을 미치는지 확인하기 위하여, JNK-특이 저해제와 JNK를 타겟으로 한 siRNA를 사용하여, 하기와 같은 실험을 수행하였다.
실시예 2-8-1: JNK-특이 저해제에 의한, 혼합 약재 추출물(KIOM-C)의 세포사멸 유도 저해
HT1080 세포주에 JNK-특이 저해제인 SP600125을 비롯하여, p38 저해제인 SB203580, ERK 1/2 저해제인 PD98059 및 라이소좀 저해제인 바필로마이신 A1(Bafilomycin A1)와 같은 약학적 저해제를 1시간 동안 전처리한 후, 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖ 농도로 처리하고 24시간 경과 후, 각 세포에서 단백질을 회수한 후, 세포 사멸을 조절하는 신호 전달 체계 활성화와 관련이 있는 인자인 JNK를 비롯하여, 자가포식소체(autophagosome) 형성에 있어서 중요한 Beclin-1, 세포 사멸에 중요한 PARP cleavage 및 Bcl-2, 그리고 자가포식(autophagy)에 관여하는 p62 단백의 발현양상을 웨스터 블롯 분석을 통해 확인하였다. 또한, 상기 약학적 저해제와 본 발명의 혼합 약재 추출물(KIOM-C)을 함께 처리하고 48시간 경과 후, 유발될 수 있는 세포 독성 및 세포 형태 변화를 관찰하였다.
실험 결과, 상기 혼합 약재 추출물(KIOM-C) 처리 24시간 경과 후, 자가포식 및 세포 사멸 유도에 있어서 중요한 JNK 활성을 측정하였을 때, 미처리 대조군과 비교하여, 두드러지게 인산화가 증가된 양상을 보였으며, 자가포식 동안 자가포식소체를 형성하는데 중요한 Beclin-1 단백질의 발현 수준 또한 두드러지게 증가되었다. p62 단백 및 BCl-2는 상기 혼합 약재 추출물(KIOM-C) 처리시, 발현 레벨이 감소하였고, PARP cleavage가 확인되었다. 그러나, 혼합 약재 추출물(KIOM-C)에 의하여 발현 레벨이 조절되었던 상기 세포사 관련 인자들의 발현 양상이, JNK-특이 저해제인 SP600125의 전처리에 의하여 미처리 대조군과 유사한 수준으로 회복되었다(도 7a). 또한, SP600125과 혼합 약재 추출물(KIOM-C)을 함께 처리한 경우, 세포 사멸이 유도되지 않았고 세포질의 액포 형성도 저해함을 확인하였다(도 7b). 이에 따라, JNK-특이 저해제인 SP600125에 의해, 본 발명의 혼합 약재 추출물(KIOM-C)에 의한 세포사 유도 및 관련 인자들의 발현 조절이 차단됨을 알 수 있었다.
실시예 2-8-2: JNK를 타겟으로 한 siRNA에 의한, 혼합 약재 추출물(KIOM-C)의 세포사멸 유도 저해
먼저, 60 mm 배양 디쉬에 약 20% confluent하게 HT1080 세포를 배양하였다. 상기와 같이 배양한 세포에 TransIT2020(Mirus, Madison, WI)를 이용하여 JNK-특이 siRNA(small interfering RNA)를 형질주입하였다. 이때, 스크램블드 siRNA(scrambled siRNA; Scr siRNA)를 대조군으로 사용하였다. 상기와 같이 트랜스펙션 된 세포를 72시간 배양하고, 배양 후, 세포에 혼합 약재 추출물(KIOM-C)을 500 ㎍/㎖의 농도로 24시간 처리하였다. 상기 시간 경과 후, 각 세포에서 단백질을 회수한 후, 세포 사멸을 조절하는 신호 전달 체계 활성화와 관련이 있는 인자인 JNK를 비롯하여, 세포 사멸에 중요한 caspase-3 활성 및 PARP cleavage, 그리고 자가포식(autophagy)에 관여하는 LC3 단백의 발현양상 및 자가포식소체(autophagosome) 형성에 있어서 중요한 Beclin-1의 발현 정도를 웨스턴 블롯 분석을 통해 확인하였다. 사용한 Scr siRNA와 JNK siRNA의 서열 정보는 하기 표 2와 같다.
표 2
타겟 서열 정보(5'-3') 서열번호
Scr siRNA CCUACGCCACCAAUUUCGU 5
JNK siRNA AAAAAGAAUGUCCUACCUUCU 6
실험 결과, JNK-특이 siRNA를 형질전환한 세포에서 JNK 단백질 발현이 현저히 감소되는 것을 확인하였으며(도 7c), 각 세포에 상기 혼합 약재 추출물(KIOM-C) 처리 24시간 경과 후, 자가포식 및 세포 사멸 유도에 있어서 중요한 JNK 활성을 측정하였을 때, Scr siRNA를 트랜스펙션 한 대조군의 경우, 두드러지게 인산화가 증가된 양상을 보였으며, 세포 형태의 변화도 관찰해 본 결과, 세포질의 액포 형성 및 세포 사멸 유도 양상을 관찰할 수 있었다(도 7d 및 도 7e). 또한, 자가포식 마커인 LC3 단백질이 16 kDa의 LC3 I에서 14 kDa의 LC3 II로 전환되는 것을 확인하였고, 자가포식 동안 자가포식소체를 형성하는데 중요한 Beclin-1 단백질의 발현 수준이 두드러지게 증가되었을 뿐만 아니라, caspase-3 활성 및 PARP cleavage도 확인되었다(도 7e). 그러나, JNK-특이 siRNA를 트랜스펙션하고 혼합 약재 추출물(KIOM-C)을 함께 처리한 경우, 세포사 관련 인자들의 발현 레벨 및 세포 형태 변화 등이 회복되어 세포 사멸이 유도되지 않았고, 세포질의 액포 형성도 저해함을 확인하였다(도 7d 및 도 7e). 이에 따라, JNK-특이 siRNA에 의해, 본 발명의 혼합 약재 추출물(KIOM-C)에 의한 세포사 유도 및 관련 인자들의 발현 조절이 차단됨을 알 수 있었다.
따라서, 상기 결과들을 통하여, 세포신호전달체계 관련 인자의 저해제 및 siRNA를 사용할 경우, 세포사 유도를 저해할 수 있음을 알 수 있었다. 즉, 이는 혼합 약재 추출물(KIOM-C)이 세포 사멸(apoptosis) 및 자가포식(autophagy)을 동시에 유도하여 세포사(cell death)를 매개함을 의미한다.
실시예 3: 비-부착성 콜로니 형성능 분석
암세포에 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 처리하는 경우, 비-부착성 콜로니 형성능이 억제되는지 여부를 확인하기 위하여 하기와 같은 실험을 수행하였다.
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)(25 ㎍/㎖, 50 ㎍/㎖, 100 ㎍/㎖ 및 250 ㎍/㎖), 0.3% 한천, 및 10% FBS가 포함된 3 ㎖의 배지에 암세포(B16F10 및 HT1080)(1×104개)를 현탁시키고, 이를 0.6% 한천 및 10% FBS가 포함된 응고된 바닥 한천에 적용한 후, 3주 동안 인큐베이션하면서 위상차 현미경(phase-contrast microscope)으로 부드러운 한천 내에 형성된 콜로니를 관찰하고 그 사진을 촬영하였다.
또한, 200개의 암세포(B16F10 및 HT1080)를 10% FBS/DMEM 배지 1 ㎖로 부유하여 12-웰 플레이트에 플레이팅(plating)하고, 플레이트에 부착하도록 배양시킨 후에, 혼합 약재 추출물(KIOM-C)(25 ㎍/㎖, 50 ㎍/ ㎖, 100 ㎍/㎖ 및 250 ㎍/㎖)을 처리하여 10일 동안 배양하였다. 10일 후, 형성된 콜로니는 0.2% 크리스탈 바이올렛(crystal violet)/20% 메탄올 염색액으로 염색한 후 현미경으로 관찰하였다.
실험 결과, 혼합 약재 추출물(KIOM-C)은 미처리 대조군과 비교하여 농도 의존적으로 비-부착성 콜로니 형성능이 두드러지게 감소하는 것으로 나타났으며, 대조군 세포에서의 비-부착성 콜로니 형성능 대비 비-부착성 콜로니 형성능이 약 60% 내지 95% 정도로 유의미하게 감소되는 것으로 확인되었다(도 8).
실시예 4: 세포 이동(cell migration) 능력 분석
암세포에 혼합 약재 추출물(KIOM-C)을 처리하는 경우, 세포 이동 능력이 억제되는지 여부를 확인하기 위하여 하기와 같이 상처 치유 분석(wound healing assays)을 수행하였다.
먼저, 60 mm 배양 디쉬에 약 80% confluent하게 암세포주(B16F10 및 HT1080)를 배양하였다. 손상(wound) 형성 후 세포 증식에 의한 치유능(healing)을 배제하기 위해, 상기와 같이, 약 80% 정도 단일층으로 증식된 암세포(B16F10 및 HT1080)에 25 ㎍/㎖의 미토마이신 C(mitomycin C; Sigma chemical Co.)로 30분 동안 처리하여 세포 증식을 정지시킨 후, 상기 단일층에 폭이 약 2 ㎜ 정도인 손상(wound)을 만들었다. 그 다음, 떨어진 세포 부유물을 제거한 후, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)(50 ㎍/㎖ 내지 250 ㎍/㎖)이 포함된 10% FBS-DMEM 배양 배지를 채워 준 다음, 상기 배지 내에서 배양하였다. 구체적으로, B16F10 세포주의 경우 24시간 및 48시간 배양하였고, HT1080 세포주의 경우 40시간 배양하였다. 상기와 같은 시간 동안 배양 후, 손상 부위에서 세포 이동 능력을 위상차 현미경을 통해 관찰하였다. 손상(wound)을 형성한 시점(0 시간)의 간격을 100%로 정하고 시간이 경과하면서 세포이동에 의해 간격이 좁아지는 정도를 계산하였다.
실험 결과, 미처리 대조군의 B16F10 세포의 경우, 24시간 경과 후 손상 부위의 약 25%, 48시간 경과 후 약 70% 정도가 치유된 반면, 상기의 혼합 약재 추출물(KIOM-C)을 처리한 군에서는 농도에 따라 치유능(healing)이 억제되는 결과를 보였다. 특히, 상기의 혼합 약재 추출물(KIOM-C)을 100 ㎍/㎖ 및 250 ㎍/㎖의 농도로 처리한 경우에는 48시간 경과 후, 대조군 세포와 비교하여 손상 부위로의 세포 이동이 농도 의존적으로 약 55% 내지 60% 정도로 유의미하게 억제되는 것으로 확인되었다(도 9a).
또한, 미처리 대조군의 HT1080 세포의 경우에도, 40시간 경과 후 약 70% 정도가 치유된 반면, 상기의 혼합 약재 추출물(KIOM-C)을 처리한 군에서는 농도에 따라 치유능(healing)이 억제되는 결과를 보였다. 특히, 상기의 혼합 약재 추출물(KIOM-C)을 250 ㎍/㎖의 농도로 처리한 경우에는 40시간 경과 후 약 25% 정도 치유(healing) 하는데 그쳐, 대조군에 비해 약 3배 정도 세포이동을 억제한 것을 확인하였다(도 9b).
따라서, 본 발명의 상기 혼합 약재 추출물(KIOM-C)이 세포이동을 효과적으로 억제하였음을 의미한다.
실시예 5: 시험관 내 세포 이동(cell migration) 및 세포 침윤능(cell invasion) 분석
암세포(B16F10 및 HT1080)에 혼합 약재 추출물(KIOM-C)을 처리하는 경우, 세포 이동 능력 및 침윤 능력이 억제되는지 여부를 확인하기 위하여, 하기와 같이 트랜스웰 이동/침윤 분석(Transwell migration/invasion assay)을 수행하였다.
이동능 분석은 8 ㎛의 기공 크기의 폴리카보네이트 막(Corning costar, Cambridge, MA)을 가진 10 ㎜ 직경의 트랜스웰 챔버(transwell chamber)의 아래쪽 챔버에 600 ㎕의 10% FBS/DMEM 배지를 채우고, 위쪽 챔버는 혼합 약재 추출물(KIOM-C) 및 암세포(B16F10 및 HT1080)(1×105 개/100 ㎕)가 포함된, 혈청이 없는 DMEM 배지 100 ㎕를 채워 넣은 후, 37℃에서 24시간 내지 36시간 동안 인큐베이션하였다. 그 다음, 필터로 이동 혹은 침윤된 세포를 확인하기 위해, 이동하지 않은 필터의 위쪽 표면에 남아있는 세포를 제거하고, 필터를 0.2% 크리스탈 바이올렛(crystal violet)/20% 메탄올(w/v) 용액으로 염색한 후 현미경으로 관찰하였다. 이때, HT1080 세포주의 경우에는 PMA 자극 조건에서 상기 혼합 약재 추출물(KIOM-C)의 효능을 확인하였다.
침윤능 분석은 20 ㎕의 마트리젤(Matrigel):DMEM의 1:2 혼합물(마트리젤, BD Biosciences, Bedford, MA, 미국)로 트랜스웰 챔버를 코팅하여 중간 침윤 장벽(intervening invasive barrier)을 형성한 후 수행하였다.
실험 결과, 혼합 약재 추출물(KIOM-C)은 이의 미처리 대조군과 비교하여 세포의 이동능을 농도에 의존적으로 유의미하게 감소시키는 것으로 확인되었으며, 세포의 침윤능(마트리젤 경계를 침투하는 능력) 역시 혼합 약재 추출물(KIOM-C)이 처리된 세포에서 유의미하게 감소되는 것으로 확인되었다. 구체적으로, 상기 혼합 약재 추출물(KIOM-C) 처리된 B16F10 세포주의 경우, 미처리 대조군 세포와 비교하여 세포 이동능 및 세포 침윤능이 대략 55% 정도로 억제되었다(도 10a). 또한, HT1080 세포주의 경우에도, 미처리 대조군 세포와 비교하여 상기 혼합 약재 추출물(KIOM-C) 처리에 의하여 세포 이동능 및 세포 침윤능이 대략 50% 정도 억제되었다(도 10b).
따라서, 본 발명의 혼합 약재 추출물(KIOM-C)이 고전이 암세포주의 세포이동(cell migration) 및 세포침윤(cell invasion)을 효과적으로 억제하는 것을 확인하였다.
실시예 6: MMP-9의 발현 및 활성 감소 분석
MMP-9은 주위 세포외 기질(ECM)을 분해함으로써 암 전이에서 필수적인 역할을 하는 것으로 알려져 있다. 이에 암세포(B16F10 및 HT1080)에 혼합 약재 추출물(KIOM-C)을 처리하는 경우, MMP-9의 발현 및 활성이 감소되는지 여부를 확인하기 위하여, 하기와 같이 RT-PCR(Reverse Transcriptase Polymerase Chain Reaction), 웨스턴 블롯팅(western blotting) 및 젤라틴 자이모그래피(Gelatin zymography)를 수행하였다.
본 실험에서 포볼 미리스테이트 아세테이트(phorbol myristate acetate; PMA)를 MMP-9의 발현 및 활성을 증가시키는 유도 물질로서 사용하였다. 즉, 암세포(B16F10 및 HT1080)를 혼합 약재 추출물(KIOM-C)(100 ㎍/㎖ 및 250 ㎍/㎖)이 포함된, 혈청이 없는 DMEM에서 12시간 동안 인큐베이션 한 다음, 이에 5 nM의 PMA를 처리하고 HT1080 세포주의 경우, 추가적으로 24시간 그리고 B16F10 세포주의 경우, 추가적으로 48시간 동안 배양하여 세포를 자극한 다음, 하기 실험을 진행하였다.
실시예 6-1: 역전사중합효소 연쇄 반응(RT-PCR)
상기에서 혼합 약재 추출물(KIOM-C)이 포함된 배지에서 배양한 다음, PMA로 자극한 세포의 RNA를 PureHelix RNA 추출 키트(NanoHelix, 대전)를 사용하여 분리한 후, Helixcript 1'st strand cDNA 합성 키트(NanoHelix, 대전)를 사용하여 cDNA를 합성한 후 PCR을 수행하였다. 사용한 hMMP-9 및 GAPDH 프라이머 서열 정보는 하기 표 3과 같다.
표 3
타겟 프라이머 서열번호
방향 서열(5'-3')
hMMP-9 Forward TCTTCCCTGGAGACTGAGAA 7
hMMP-9 Reverse GGCAAGTCTTCCGAGTAGTTT 8
실시예 6-2: 웨스턴 블롯 분석(western blot analysis)
상기에서 혼합 약재 추출물(KIOM-C)이 포함된 배지에서 배양한 다음, PMA로 자극한 세포의 전체 세포 용해물(lysate)과 핵(nuclear)/시토졸(cytosolic) 추출물을 제조업자의 지시에 따라, M-PER 포유동물 단백질 추출 시약(M-PER Mammalian Protein Extraction Reagent)과 NE-PER 핵 및 시토졸 추출 시약(NE-PER Nuclear & Cytosolic Extraction Reagent)(Pierce Biotechnology, Inc., Rockford, IL, USA)을 사용하여 각각 준비하였다. 세포 용해질(cell lysate)은 BCA 단백질 분석(BCA(Bicinchoninic Acid) protein assay)으로 단백질 농도를 정량하였고, 면역학적 블로팅(immunoblotting) 후에, 단백질은 파워-옵티-화학발광 웨스톤 블롯팅 검출 시약(Power Opti-ECL Western blotting detection reagent)(Animal Genetics, Inc., Korea)과 ImageQuant LAS 4000 mini(GE Healthcare, Piscataway, NJ, USA)를 사용하여 가시화하였다. MMP-9의 발현 정도는, 가시화된 단백질 밴드(band)를 소프트웨어 ImageJ(National Institutes of Health, USA)를 이용하여 정량화함에 의해 도출하였다.
실시예 6-3: 젤라틴 자이모그래피(Gelatin zymography)
상기에서 PMA로 자극한 세포의 배양 배지를 0.1% 젤라틴이 포함된 8% SDS-PAGE(sodium dodecyl sulfate-polyacrylamide gel)에서 전기 영동 하고, 젤을 세척 버퍼(50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 2.5% Triton X-100)로 꼼꼼히 세척한 후, 활성 버퍼(50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM CaCl2, 0.02% NaN3, 1 μM ZnCl2)에 담근 다음, 37℃에서 인큐베이션하였다. 그 다음, 젤을 쿠마시 브릴리언트 블루(Coomassie Brilliant Blue) R-250 염색 용액(Bio-Rad Laboratories, Hercules, CA, 미국)으로 염색하고, 10% 이소프로판올(isopropanol)/10% 아세트산(v/v) 용액으로 탈염색하였다. MMP-9의 젤라틴 분해 능력은 어두운 푸른색 배경에서 투명한 밴드로 92 kDa 크기에서 탐지되었다.
실험 결과, 혼합 약재 추출물(KIOM-C)을 처리한 경우, 이를 미처리한 대조군과 비교하여 PMA 자극에 의한 MMP-9의 발현 및 활성을 농도에 의존적으로 유의미하게 감소시키는 것으로 확인되었다(도 11).
따라서, 본 발명의 상기 혼합약재 추출물(KIOM-C)에 의해 종양 이동 및 침윤에 주요하게 관여하는 MMP-9의 발현 및 활성이 현저히 감소되는 것을 확인하였다.
실시예 7: PMA 자극에 의한 NF-κB 활성에 대한 혼합 약재 추출물(KIOM-C)의 효능 분석
NF-κB는 MMP-9 유전자 발현 조절과 암세포의 이동 및 침투능을 증진시키는 것으로 알려져 있는 전사인자로, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)이 NF-κB의 활성을 저해하는지 확인하기 위하여, pIκB 및 IκB 발현 정도와 NF-κB p65 서브유닛(subunit)의 핵내 이동 정도를, 상기 실시예 6-2에 기재한 바와 같이, 웨스턴 블롯 분석을 하였다. 이때, NF-κB p65 서브유닛(subunit)의 핵내 이동 정도를 웨스턴 블롯으로 확인하기 위하여, 세포 용해물은 시토졸과 핵 부분으로 나누어 실시하였다. pIκB, IκB 및 핵내 이동한 NF-κB p65 서브유닛(subunit)의 발현 정도는, 인터널 컨트롤(internal control)인 α-tublin 또는 TBP로 표준화하여 정량하였다.
구체적으로, 혼합 약재 추출물(KIOM-C) 250 ㎍/㎖을 12시간 전처리한 HT1080 세포주에 PMA 5 nM을 처리하여, 상기 세포주에 자극을 주어 NF-κB를 활성화시킨다. PMA를 처리하고 15분, 30분, 60분 후, 각 단백질을 수획한 후, pIκB, IκB 및 핵내 이동한 NF-κB p65 서브유닛(subunit)의 발현 정도를 확인해 본 결과, 혼합 약재 추출물(KIOM-C)을 처리한 경우, 처리하지 않은 대조군에서는 PMA 자극 후 pIκB이 증가되고 IκB 발현이 감소되었으나, 상기 혼합 약재 추출물(KIOM-C)을 처리한 군에서는 PMA 자극에 의한 pIκB 증가가 보이지 않았으며 IκB 발현이 감소하지 않았다. NF-κB p65 서브유닛의 핵내 이동 역시 혼합 약재 추출물(KIOM-C)을 처리한 군에서 대조군에 비해 현저히 감소되어 있음을 확인하였다. 이와 같은 결과는 상기 실시예의 혼합 약재 추출물(KIOM-C)이 NF-κB 활성을 억제하는 효과가 있음을 뒷받침한다(도 12).
따라서, 혼합 약재 추출물(KIOM-C)은 NF-κB의 활성을 저해시킴으로써 MMP-9의 발현 및 활성을 억제하여, 결과적으로 암 세포의 이동 및 침윤을 억제시키는 효과가 있음을 확인할 수 있었다.
실시예 8: 생체 내( in vivo ) 실험
혼합 약재 추출물(KIOM-C)의 생체 내 암 전이 억제 효능 및 항암 활성을 평가하기 위하여 하기와 같은 실험을 수행하였다.
실시예 8-1: 자연 전이 마우스 종양 모델(spontaneous lung metastasis model)을 이용한 혼합 약재 추출물(KIOM-C)의 암 전이 억제 활성 평가
혼합 약재 추출물(KIOM-C)의 생체 내 암 전이 억제 효능을 확인하기 위하여 하기와 같은 실험을 수행하였다.
15 마리의 C57BL/6J 마우스의 꼬리 정맥에 각각 고전이 암세포주인 B16F10 세포주(3×105개의 세포/0.2 ㎖ PBS)를 주입한 다음(0일), 상기 마우스들을 임의적으로 3개의 군으로 나누고(각 군마다 n = 5), 제1군(실험군)에는 혼합 약재 추출물(KIOM-C) 170 ㎎/㎏/day을, 제2군(실험군)에는 혼합 약재 추출물(KIOM-C) 510 ㎎/㎏/day을, 제3군(대조군)에는 생리 식염수를 17일 동안 매일 경구 투여하였다. 17일 후, 마우스를 희생시켜 각 마우스의 폐를 보우인 용액(Bouin's solution)(Sigma)으로 고정하고, 폐의 표면에 있는 B16F10 세포의 검은 색 콜로니의 숫자를 육안으로 검사하였다. 상기 검사 결과는 각 군의 평균 콜로니 갯수로 계산하였다.
실험 결과, 대조군 마우스의 경우에는 폐로 전이된 평균 콜로니 갯수가 542.3±93.56개로 관찰된 반면, 상기 혼합 약재 추출물(KIOM-C) 170 mg/kg을 투여한 군에서는 227.5±20.10개를 그리고 510 mg/kg의 혼합 약재 추출물(KIOM-C)을 투여한 군은 154.7±52.81개의 종양 콜로니가 전이된 것으로 관찰되었다(도 13a 및 도 13b). 이는 생리 식염수를 투여한 대조군에 비하여 각각 58% 및 71% 이상 전이가 억제된 것으로, 상기 혼합 약재 추출물(KIOM-C) 투여에 의해 고전이 암세포의 전이능이 현저히 감소되었음을 나타낸다.
따라서, 본 발명의 혼합 약재 추출물(KIOM-C)이 생체 내에서 암세포 전이를 억제하는 효능이 매우 우수함을 뒷받침하는 결과이다.
실시예 8-2: 암 이식 모델(Tumor xenograft model)을 이용한 혼합 약재 추출물(KIOM-C)의 항암 활성 평가
인간 섬유육종 세포주(HT1080) 2×106 개/200 ㎕ 생리식염수를 약 6주령의 암컷 Balb/c 누드 마우스(Balb/c athymic nude mice)의 대퇴부 피하에 접종한 후 혼합 약재 추출물(KIOM-C)을 매일 경구 투여하면서 약 15일간 종양 성장을 확인하였다. 상기 혼합 약재 추출물(KIOM-C)의 투여량은 60 kg 성인이 복용하는 양 및 탕제의 수율을 고려하여 85 mg/kg, 170 mg/kg 및 340 mg/kg의 세 가지 투여군으로 분리하여 투여하였으며, 음성대조군으로 생리식염수 투여군을 포함하였다. 종양을 피하에 접종한 후 상기 혼합 약재 추출물(KIOM-C)을 약 15일간 매일 경구 투여 하면서 종양 부피를 측정하여 하기 산출 공식을 통하여 계산하였다.
[tumor volume(mm3)=길이(length(long, mm)×width2(short2, mm2)×0.52]
또한, 암을 사멸하는 중요한 사이토카인인 인터페론-감마(interferon-; INF-γ)의 분비 수준을 상기 실험 그룹군의 각 마우스의 혈액을 채취하여 혈청(serum)에서 INF-γ의 레벨을, 제조업자의 지시에 따라 LEGEND MAXTM ELISA kit(BioLegent Inc. San Diego, CA)를 사용하여 측정하였다.
실험 결과, 음성대조군은 종양 접종 5일 후부터 종양괴가 관찰되기 시작하여 약 10일 후부터 급격한 성장을 보이는 데 반해 상기 혼합 약재 추출물(KIOM-C)을 투여한 군에서는 종양 성장의 정도가 현저히 감소되는 것을 확인하였다(도 14a). 또한, 15일 경과 후 적출한 종양괴의 크기 역시 상기 혼합 약재 추출물(KIOM-C)을 투여한 군이 현저히 작은 것을 확인할 수 있었다(도 14b). 15일 경과 후 누드 마우스로부터 종양을 적출하여 종양의 무게를 측정한 결과, 음성대조군의 종양 무게 평균은 0.62±0.18g이었으며, 상기 혼합약재 추출물 85 mg/kg 투여군은 0.16±0.06g, 170 mg/kg 투여군은 0.16±0.09g 그리고 340 mg/kg 투여군은 0.19±0.11g으로 나타났다(도 14c). 아울러, 혼합 약재 추출물(KIOM-C)을 투여한 군의 경우, 이를 미처리한 대조군과 비교하여, INF-γ 농도가 두드러지게 증가함을 확인할 수 있었다(도 14d).
따라서, 본 발명의 혼합 약재 추출물(KIOM-C)이 in-vivo 실험에서도 종양의 성장을 현저히 억제시키며, 장기간 반복 투여에 의한 특이적인 독성도 없음을 확인하였다.
실시예 9: 혼합약재 추출물 및 각 단미재의 효능 비교 분석
혼합 약재 추출물(KIOM-C)과 이를 구성하고 있는 단미재의 종양세포사멸 효과 및 종양 전이 억제 효과를 비교 분석하기 위하여, 하기와 같은 실험을 수행하였다.
실시예 9-1: 혼합약재 추출물 및 각 단미재의 종양세포사멸 효과 분석
상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)과 이를 구성하고 있는 단미재(천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향)의 종양세포사멸 효과에 대하여 비교 분석을 실시하였다. 고전이암 세포주 HT1080(인체 섬유육종)에 각각 상기 실시예의 혼합 약재 추출물(KIOM-C) 500 ㎍/㎖와 상기 비교예 1 내지 비교예 22의 각 단미재 추출물(천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향)을 처리하고 48시간 배양한 후 세포 생존율을 MTT assay를 통하여 분석하였다. 이때, 각 단미재 추출물은 상기 혼합 약재 추출물(KIOM-C) 500 ㎍/㎖에 포함되어 있는 각 단미재 성분의 농도로 처리하였다.
실험 결과, 상기 실시예 1에서 제조한 혼합 약재 추출물(KIOM-C)을 처리한 군은 처리하지 않은 군과 비교하여 22.3%의 암 세포 생존율(77.7%의 암 세포사멸)을 나타내었으나, 각 단미재 추출물(천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향)을 처리한 군에서는 암 세포 생존 억제(암 세포사멸) 효능이 확인되지 않았다(도 15).
따라서, 본 발명의 혼합 약재 추출물(KIOM-C)은 암 세포사멸 효과를 보이지 않는 저농도의 각 단미재들을 혼합하여 사용함으로써 각각의 단미재들이 단독으로 제공하지 못하는 효과적인 항암 활성(세포사멸)을 나타내는 것을 확인하였다.
실시예 9-2: 혼합약재 추출물 및 각 단미재의 종양 전이 억제 효과 분석
상기 비교예 1 내지 22에서 제조한 각 단미재 추출물 중 마황(비교예 7) 추출물 및 대황 추출물(비교예 9) 각각의 MMP-2/MMP-9 활성에 대한 영향을 젤라틴 자이모그래피(gelatin zymography)를 통해 조사하였다. 이 때, 상기 마황 및 대황의 처리 농도는 상기 실시예 9-1의 암 세포사멸 효과 실험시 사용하였던 상기 실시예의 혼합 약재 추출물(KIOM-C) 500 ㎍/㎖ 농도에 포함되어 있는 마황 및 대황의 각 농도(암 세포사멸 효과를 나타내지 않은 농도)를 사용하였다.
실험 결과, 대황의 경우(도 16, lane 1), 기존 문헌에 보고된 바와 같이 300 ㎍/㎖ 농도로 처리한 경우 MMP-9의 활성이 현저히 감소되는 결과를 얻었으나, 그와 동시에 80% 이상의 세포독성이 관찰되었다. 한편, 독성이 관찰되지 않으면서 효능을 보인 혼합 약재 추출물(KIOM-C) 500 ㎍/㎖에 포함된 대황 농도(2 ㎍/㎖ 내지 15 ㎍/㎖)로 처리한 경우에는 암 세포사멸 효과(세포독성, 도 15)가 관찰되지 않았으며, MMP-9 활성에도 영향을 주지 못하였다(도 16, lane 2). 마황의 경우에도 혼합 약재 추출물(KIOM-C) 500 ㎍/㎖에 포함된 마황 농도(2 ㎍/㎖ 내지 15 ㎍/㎖)에서도 암 세포사멸 효과(세포 독성, 도 15)가 관찰되지 않았으며, MMP-9 활성에 아무런 영향을 주지 못하였다(도 16, lane 3).
따라서, 상기 실시예의 혼합 약재 추출물(KIOM-C)은 암 세포 사멸 효과(세포독성)를 나타내지 않는 저농도의 안전한 각 단미재들을 혼합하여 사용함으로써 항전이 활성을 현저히 향상시키는 효과가 있음을 확인하였다.

Claims (13)

  1. 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합 약재의 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 조성물은 음양곽 1 중량부에 대하여, 천궁 1 중량부 내지 3 중량부, 방풍 1 중량부 내지 3 중량부, 당귀 1 중량부 내지 3 중량부, 작약 1 중량부 내지 3 중량부, 연교 1 중량부 내지 3 중량부, 박하엽 1 중량부 내지 3 중량부, 마황 1 중량부 내지 3 중량부, 망초 1 중량부 내지 3 중량부, 대황 1 중량부 내지 3 중량부, 석고 0.5 중량부 내지 3 중량부, 길경 0.5 중량부 내지 3 중량부, 황금 0.5 중량부 내지 3 중량부, 백출 0.5 중량부 내지 2 중량부, 산치자 0.5 중량부 내지 2 중량부, 형개 0.5 중량부 내지 2 중량부, 생강 1 중량부 내지 3 중량부, 활석 1 중량부 내지 5 중량부, 감초 1 중량부 내지 3 중량부, 금은화 1 중량부 내지 3 중량부, 원지 1 중량부 내지 3 중량부, 및 목향 1 중량부 내지 3 중량부를 포함하는 혼합 약재의 추출물을 포함하는 것을 특징으로 하는 약학적 조성물.
  3. 제1항에 있어서, 상기 추출물은 상기 혼합 약재를 물, C1-4 알코올 또는 이들의 혼합 용매로 추출하여 제조되는 것을 특징으로 하는 약학적 조성물.
  4. 제3항에 있어서, 상기 추출은 열수 추출, 초음파 추출, 상온추출, 냉침 추출, 환류 냉각 추출 또는 증기 추출인 것을 특징으로 하는 약학적 조성물.
  5. 제1항에 있어서, 상기 조성물은 암세포 전이 억제, 암세포사멸 또는 암세포 성장 억제 활성을 갖는 것을 특징으로 하는 약학적 조성물.
  6. 제1항에 있어서, 상기 암은 섬유육종, 피부암, 폐암, 유방암 또는 위암으로 구성된 군으로부터 선택되는 어느 하나인 것인 약학적 조성물.
  7. 천궁, 방풍, 당귀, 작약, 연교, 박하엽, 마황, 망초, 대황, 석고, 길경, 황금, 백출, 산치자, 형개, 생강, 활석, 감초, 금은화, 음양곽, 원지 및 목향으로 구성된 혼합 약재의 추출물을 유효성분으로 포함하는 암의 예방 또는 개선용 건강기능식품.
  8. 제7항에 있어서, 상기 조성물은 음양곽 1 중량부에 대하여, 천궁 1 중량부 내지 3 중량부, 방풍 1 중량부 내지 3 중량부, 당귀 1 중량부 내지 3 중량부, 작약 1 중량부 내지 3 중량부, 연교 1 중량부 내지 3 중량부, 박하엽 1 중량부 내지 3 중량부, 마황 1 중량부 내지 3 중량부, 망초 1 중량부 내지 3 중량부, 대황 1 중량부 내지 3 중량부, 석고 0.5 중량부 내지 3 중량부, 길경 0.5 중량부 내지 3 중량부, 황금 0.5 중량부 내지 3 중량부, 백출 0.5 중량부 내지 2 중량부, 산치자 0.5 중량부 내지 2 중량부, 형개 0.5 중량부 내지 2 중량부, 생강 1 중량부 내지 3 중량부, 활석 1 중량부 내지 5 중량부, 감초 1 중량부 내지 3 중량부, 금은화 1 중량부 내지 3 중량부, 원지 1 중량부 내지 3 중량부, 및 목향 1 중량부 내지 3 중량부를 포함하는 혼합 약재의 추출물을 포함하는 것을 특징으로 하는 건강기능식품.
  9. 제7항에 있어서, 상기 추출물은 상기 혼합 약재를 물, C1-4 알코올 또는 이들의 혼합 용매로 추출하여 제조되는 것을 특징으로 하는 건강기능식품.
  10. 제9항에 있어서, 상기 추출은 열수 추출, 초음파 추출, 상온추출, 냉침 추출, 환류 냉각 추출 또는 증기 추출인 것을 특징으로 하는 건강기능식품.
  11. 제7항에 있어서, 상기 조성물은 암세포 전이 억제, 암세포 사멸 유도 또는 암세포 성장 억제 활성을 갖는 것을 특징으로 하는 건강기능식품.
  12. 제7항에 있어서, 섬유육종, 피부암, 폐암, 유방암 또는 위암으로 구성된 군으로부터 선택되는 어느 하나인 것인 건강기능식품.
  13. 제 1항 내지 제 6항 중 어느 한 항의 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 암의 치료 방법.
PCT/KR2014/003138 2013-04-11 2014-04-11 천연물 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품 Ceased WO2014168447A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2013-0040136 2013-04-11
KR20130040136 2013-04-11

Publications (1)

Publication Number Publication Date
WO2014168447A1 true WO2014168447A1 (ko) 2014-10-16

Family

ID=51689782

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/003138 Ceased WO2014168447A1 (ko) 2013-04-11 2014-04-11 천연물 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품

Country Status (2)

Country Link
KR (1) KR101544470B1 (ko)
WO (1) WO2014168447A1 (ko)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104366622A (zh) * 2014-11-24 2015-02-25 郴州大诚中药饮片有限责任公司 保健饮料及其制备方法
CN104383340A (zh) * 2014-12-05 2015-03-04 苗艳秋 用于新生儿肺热咳嗽症状的中成药及其制备方法
CN105168944A (zh) * 2015-10-20 2015-12-23 青岛云天生物技术有限公司 一种治疗乳腺癌的中药组合物及其用途
CN115088833A (zh) * 2022-05-20 2022-09-23 唛迪森营养科技(江苏)有限公司 一种用于预防和/或治疗肿瘤患者肠道损伤的功能性食品

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101652730B1 (ko) * 2015-10-08 2016-09-01 한국원자력연구원 지용성 폴리페놀 성분이 증가된 생약 조성물 제조방법, 상기 방법으로 제조된 생약 조성물, 및 이의 용도
KR102294477B1 (ko) * 2019-10-17 2021-08-25 경희대학교 산학협력단 삼지구엽초 추출물의 신규용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060104408A (ko) * 2005-03-30 2006-10-09 정두수 암치료용 한약조성물
KR20070041925A (ko) * 2005-10-17 2007-04-20 안봉전 항산화, 항암 및 항균효과를 나타내는 nh 생약 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060104408A (ko) * 2005-03-30 2006-10-09 정두수 암치료용 한약조성물
KR20070041925A (ko) * 2005-10-17 2007-04-20 안봉전 항산화, 항암 및 항균효과를 나타내는 nh 생약 조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LEE, MIN WOO ET AL.: "Induction of Cdk inhibitor p27 and Inhibition of pRB Phosphorylation by Insamsapye-tang Treatment in Human Lung Cancer A549 Cells", KOREAN JOURNAL OF ORIENTAL PHYSIOLOGY & PATHOLOGY, vol. 17, no. 1, 2003, pages 213 - 219, XP053004071 *
LEE, SEOK WOO ET AL.: "Study on The Antitumor and Antimetastatic Effects of Hangambaekchulsan", KOREAN JOURNAL OF ORIENTAL MEDICAL PATHOLOGY, vol. 10, no. 2, 1996, pages 153 - 170, XP053003499 *
PARK, SE WON: "Anticancer Activity Research on Animal Ascites Carcinoma related to Three Kinds of Cancer Treatment", THE KOREAN JOURNAL OF ORIENTAL MEDICAL PRESCRIPTION, vol. 4, no. 2, 1996, pages 27 - 52 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104366622A (zh) * 2014-11-24 2015-02-25 郴州大诚中药饮片有限责任公司 保健饮料及其制备方法
CN104383340A (zh) * 2014-12-05 2015-03-04 苗艳秋 用于新生儿肺热咳嗽症状的中成药及其制备方法
CN105168944A (zh) * 2015-10-20 2015-12-23 青岛云天生物技术有限公司 一种治疗乳腺癌的中药组合物及其用途
CN115088833A (zh) * 2022-05-20 2022-09-23 唛迪森营养科技(江苏)有限公司 一种用于预防和/或治疗肿瘤患者肠道损伤的功能性食品

Also Published As

Publication number Publication date
KR20140123444A (ko) 2014-10-22
KR101544470B1 (ko) 2015-08-17

Similar Documents

Publication Publication Date Title
WO2014168447A1 (ko) 천연물 추출물을 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품
Singh et al. European Viscum album: a potent phytotherapeutic agent with multifarious phytochemicals, pharmacological properties and clinical evidence
WO2013062266A2 (ko) 약용 꽃을 활용한 쌈 발효법 및 이를 활용한 피부 외용제 조성물
WO2011126295A2 (ko) 약용 잎을 활용한 쌈 발효법 및 이를 활용한 피부 외용제 조성물
WO2012050396A2 (ko) 생약 추출물을 포함하는 간암 예방 또는 치료용 약학적 조성물
WO2012033378A2 (ko) 비만억제 활성과 혈당강하 효능이 있는 꾸지뽕 및 의이인을 포함하는 조성물 및 이의 용도
KR102640794B1 (ko) 천연물 혼합 추출물을 포함하는 코로나바이러스 감염 예방 또는 치료용 조성물
Liu et al. The invasive species Reynoutria japonica Houtt. as a promising natural agent for cardiovascular and digestive system illness
WO2016175379A1 (ko) 생약 성분을 포함하는 소화기암 예방 또는 치료용 조성물
WO2012050398A2 (ko) 생약 추출물을 포함하는 폐암 예방 또는 치료용 약학적 조성물
WO2023090881A1 (ko) 혼합 생약 추출물을 포함하는 암의 예방 또는 치료용 약학적 조성물 및 건강기능식품
Sun et al. Immunomodulatory activity of polysaccharide from Helicteres angustifolia L. on 4T1 tumor-bearing mice
WO2016167577A1 (en) Composition for preventing or treating inflammatory diseases or pain
WO2024005561A1 (ko) 노각나무 추출물을 유효성분으로 포함하는 치매의 예방 또는 치료용 조성물
WO2018143639A1 (ko) 천연식물 추출물의 잔류농약 제거방법
WO2012050397A2 (ko) 생약 추출물을 포함하는 신장암 예방 또는 치료용 약학적 조성물
WO2022250313A1 (ko) 알로에 베라 꽃 추출물, 또는 알로에 베라 꽃 추출물 및 알로에 베라 다당체를 유효성분으로 함유하는 피부 보습, 재생 촉진 및 상처 치료용 조성물
KR100706131B1 (ko) 미선나무 추출물을 포함하는 항암제
WO2020106084A1 (en) Composition comprising combination of red clover extract and hops extract for improvement of menopausal disorder
WO2015072734A1 (ko) 사철쑥 유래 스코파론 함유 추출물을 유효성분으로 포함하는 골다공증 예방 또는 치료용 조성물
WO2018221922A1 (ko) 황련 추출물을 함유하는 근육관련 질환의 예방 및 치료용 조성물 및 이의 용도
WO2010143825A2 (en) Anti-arthritic agent using cyathula officinalis
WO2019245207A1 (ko) 식물 추출물 또는 분획물을 유효성분으로 함유하는, 뇌신경 보호용 조성물
WO2012115469A2 (ko) 항염증성의 경구 투여용 기능성 식품 조성물 및 상기 기능성 식품 조성물의 제조방법
WO2017099327A1 (ko) 쇠무릅, 두충, 석류 추출물의 복합물(p-joint 100)의 cox2, peg2 억제를 통한 항염효과, mmp-2, 9 억제를 통한 연골보호효과 및 type ii collagen 합성 증가를 통한 연골재생효과에 의한 골관절염 개선 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14782389

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14782389

Country of ref document: EP

Kind code of ref document: A1