WO2014165714A1 - Composants spécifiques de jus de grenade et inhibition de l'évolution/métastase du cancer de la prostate - Google Patents

Composants spécifiques de jus de grenade et inhibition de l'évolution/métastase du cancer de la prostate Download PDF

Info

Publication number
WO2014165714A1
WO2014165714A1 PCT/US2014/032894 US2014032894W WO2014165714A1 WO 2014165714 A1 WO2014165714 A1 WO 2014165714A1 US 2014032894 W US2014032894 W US 2014032894W WO 2014165714 A1 WO2014165714 A1 WO 2014165714A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cells
luteolin
acid
tumor
Prior art date
Application number
PCT/US2014/032894
Other languages
English (en)
Inventor
Manuela Martins-Green
Lei Wang
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2014165714A1 publication Critical patent/WO2014165714A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A61K31/202—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having three or more double bonds, e.g. linolenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A61K31/366—Lactones having six-membered rings, e.g. delta-lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to cancer treatment.
  • Prostate cancer is the second leading cause of cancer deaths in men in the United States. To date there is no real cure for the disease beyond surgery and/or radiation. Early stages can be controlled with hormone ablation therapy that suppresses the rate of prostate cancer growth. However, over time, the cancer overcomes its hormone dependence, becomes highly aggressive and metastasizes to the bone marrow and lymph nodes. Chemotherapy is available but the drugs are not very effective because prostate cancer cells do not divide rapidly. Also, chemotherapeutic treatments are aggressive and have many side effects. As a result, researchers have turned to attempting development of novel strategies to fight prostate cancer such as vaccines against PSA (prostate specific antigen), a protein specifically produced by prostate cells, and therapies related to the development of novel anti-androgen agents. However, recently, there has been a renewed push to identify natural remedies to fight prostate cancer
  • a method of treating cancer in a subject in need of such treatment includes administering to the subject luteolin (L), ellagic acid (E) and punicic acid (P), in an effective amount to treat the cancer.
  • a biocompatible carrier can be administered with at least one of the luteolin, ellagic acid or punicic acid; b) the luteolin, ellagic acid and punicic acid are administered non-orally, for example, by intraperitoneal administration; c) the cancer can be prostate cancer, breast cancer, or another cancer that metastasizes such as lung cancer or liver cancer; d) the luteolin, ellagic acid and punicic acid can be administered to the subject as separate substances, or as any combination of the separate substances; e) the treating can include reducing tumor metastasis, reducing tumor growth, or reducing tumor angiogenesis, or any combination thereof; f) the method can further include administering an effective amount of an EZH2 inhibitor or an miR-200c mimic, or a combination thereof; or g) the method can include any combination of a) - f).
  • luteolin, ellagic acid and punicic acid together can be administered with a biocompatible carrier, and the administering can be performed non-orally by intraperitoneal administration.
  • ellagic acid with a biocompatible carrier can be administered non-orally, such as by intraperitoneal administration, and luteolin and punicic acid can be administered together in a biocompatible carrier by oral administration.
  • a method of inhibiting cancer cell migration includes exposing a cancer cell to: a) luteolin, ellagic acid, or punicic acid, or any combination thereof; and b) an EZH2 inhibitor or an miR-200c mimic, or a combination thereof.
  • the cell is exposed to these substances in an effective amount to inhibit migration of the cell.
  • the cancer cell can be from a prostate cancer, a breast cancer or another cancer that metastasizes such as lung cancer or liver cancer; b) the cell can be treated in vivo or in vitro; c) the cell can be in culture or in a subject; d) the cancer cell can be in or a part of a tumor; e) in particular embodiments, the cell can be exposed to L, E, P, L + E, L + P, E + P, or L + E + P; f) when the cell is in a subject, the exposing can occur by administering the particular substances to the subject; or g) the method can include any combination of a) - f).
  • a composition for treating cancer includes: a) an effective amount of L, E, and P; and b) a biocompatible carrier.
  • the composition can further include an effective amount of an EZH2 inhibitor or an miR-200c mimic, or a combination thereof.
  • a composition for inhibiting cancer cell migration includes: a) an effective amount of L, E, or P, or a combination thereof; and b) an effective amount of an EZH2 inhibitor or an miR-200c mimic, or a combination thereof.
  • the composition can further include a biocompatible carrier.
  • the composition can include L, E, P, L + E, L + P, E + P, or L + E + P.
  • the EZH2 inhibitor can be an siRNA directed against EZH2, including siRNA directed against the sequence CGGTGGGACTCAGAAGGCA (SEQ ID NO.l), and the miR-200c mimic can be UAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO.2).
  • Fig. 1 are results showing that L+E+P inhibits growth and metastasis of PC-3M- luc xenograft tumors in SCID mice.
  • (1A, IB) 2 l0 6 PC-3M-luc cells were injected into SCID mice subcutaneously; one day after injection of the tumor cells, mice in the treated group received 64 ⁇ g each of L+E+P via IP once a day, 5 days/week for 8 weeks and the control mice received only vehicle (DPBS).
  • DPBS DPBS
  • ID The weekly BLI intensities of mice in Vehicle and L+E+P group were quantified and the mean intensities were plotted.
  • IF Tumors from mice in the Vehicle group metastasized by week 8 as shown by the BLI when the bioluminescence signals from primary tumors were blocked. Arrow indicates a metastasis.
  • Fig 2. are results showing that L+E+P inhibits angiogenesis of PC-3M-luc xenograft tumors in SCID mice.
  • Tumors collected from the Vehicle and L+E+P treated groups were fixed and sectioned.
  • (2B) The numbers of Ki67 positively-stained cells were averaged in 10 high- power (40X) fields (HPF).
  • HPF high- power
  • 2C Quantification of blood vessels in each section. The total number of blood vessels were counted/mm 2 of tumor tissue.
  • Fig 3. are results showing that L+E+P inhibits metastasis of Pten ⁇ ;K-ras mouse cancer cell allograft tumors.
  • 1 x 10 6 Pten ' ⁇ ;K-ras G12D mouse cancer cells were injected into SCID mice subcutaneously near the prostate region.
  • DPBS vehicle
  • Fig 4. are results showing that the effects of L+E+P involve inhibiting
  • mice in SC79 and SC79/L+E+P group were quantified and the mean intensities were plotted.
  • (4E) Tumors from SC79 and SC79/L+E+P groups of mice were collected and total protein was extracted and analyzed by immunoblotting for p-AKT (S473). Bars represent Standard Error of the Mean. **p ⁇ 0.01.
  • Fig 5. are results showing that L+E+P changes angiogenesis-related properties of HMVEC cells.
  • 5 A HMVEC cells were plated onto gelatin-coated plates and were treated with L+E+P at 2 ⁇ g/ml or 4 ⁇ g/ml for 12h or 24h. Time required to completely trypsinize all cells from the plate was recorded.
  • 5B Confluent HMVEC- 1 cultures were scratch wounded and were treated with L+E+P at 2 ⁇ g/ml or 4 ⁇ g/ml for 24h or 48h. The distance migrated from the wounded edge was recorded at indicated time points.
  • HMVECs were seeded onto the collagen-coated upper side of 8 ⁇ pore size membranes of inserts inside transwell units and were treated with L+E+P at 4 ⁇ g/ml for 12h.
  • Conditioned medium collected from PC3 culture was introduced into the lower chamber to induce chemotaxis for 4h.
  • L+E+P inhibited chemotaxis of the ECs towards the conditioned media of the cancer cells.
  • the number of cells that migrated through the pores was counted and averaged in 10 high-power (40X) fields (HPF).
  • HMVECs were treated with L+E+P at 4 ⁇ g/ml for 24h or 48h and protein extracts were analyzed by immunoblotting for VE-cadherin and CD31.
  • Fig 6. are results showing that L+E+P inhibits production of pro-angiogenic factors in tumors and inhibits signaling in HMVEC cells.
  • (6A-6B) Levels of IL-8 and VEGF in normal human prostate tissue and in three different human prostate tumors.
  • Protein extracts were analyzed by immunoblotting for p-AKT (S473) and VEGFR2 phosphorylation (Y1054).
  • (6F) HMVEC cells were pre-treated with 4 ⁇ g/ml L+E+P for 12 h and then treated with VEGF at 200ng/ml for 60 min in the presence or absence of L+E+P.
  • Protein extracts were analyzed by immunoblotting for p-AKT (S473) and p-ERK (T202/Y204).
  • Fig. 7 are results of the effects of L, E or P individually on PC3M-luc tumor growth.
  • 7 A Tumor growth and progression in L, E and P groups of mice were monitored by BLI weekly. Representative images at week 2, 4, 6, and 8 are shown.
  • 7B The weekly BLI intensities of mice in Vehicle and L+E+P group were quantified and the mean intensities were plotted.
  • (7C) Mice were euthanized at the end of the 8 th week and tumor volume was determined using the formula: Volume (width) 2 x length/2.
  • Fig. 8 are results showing L+E+P stimulates adhesion, and inhibits migration
  • Fig. 9 are results showing L+E+P inhibits angiogenesis of Pten ⁇ ;K-ras
  • mice subcutaneously in the region of the prostate.
  • One group of mice received 64 ⁇ g each L+E+P treatment once a day, five days/week for 4 weeks and the other group received only the vehicle (DPBS)
  • DPBS vehicle
  • 9 A Quantification of blood vessels in each section. The total numbers of blood vessel counted/mm 2 of tumor tissue.
  • (9B) The numbers of Ki67 positively stained cell were counted and averaged in 10 high-power (40X) fields (HPF). Bars represent Standard Error of the Mean. *p ⁇ 0.05, **p ⁇ 0.01.
  • Fig. 10 are results showing L+E+P prevents tube formation in HMVEC cells.
  • (10A-10B) HMVEC cells were plated onto Matrixgel-coated plates and allowed to adhere for lh. The cells were then treated with L+E+P at 2 ⁇ g/ml or 4 ⁇ g/ml for 4h and tube number counted. Bars represent Standard Error of the Mean.; **p ⁇ 0.01, ***p ⁇ 0.001.
  • FIG. 11 are results showing L+E+P inhibits IL-8 or VEGF induced angiogenesis.
  • C57BL mice were treated with 64 ⁇ g each of L+E+P for 2 weeks and injected with IL-8 (1003 ⁇ 4/20 ⁇ 1 saline) or VEGF (2003 ⁇ 4/20 ⁇ 1 saline) at symmetric sites (see text) on the back every 24 hrs for 4 days, and skin samples from the injected areas were collected at day 5 and photographed (11 A) under direct light and (1 IB) vessels were highlighted using Photoshop.
  • Fig. 12 is a graph showing the combinatory effect of L+E+P plus EZH2 siRNA and/or miR-200c mimics.
  • Luteolin is 2-(3,4-Dihydroxyphenyl)- 5,7-dihydroxy-4-chromenone, with the following chemical structure:
  • Ellagic acid is 2,3,7,8-Tetrahydroxy-chromeno[5,4,3-cde]chromene-5,10-dione, with the following chemical structure:
  • Punicic acid is 9Z,1 lE,13Z-octadeca-9,l 1,13-trienoic acid, with the following chemical structure:
  • Biocompatible carriers include any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, sterile water, carrier solutions, suspensions, colloids, and the like, that are acceptable for use with humans or other animals.
  • the use of such media and agents for pharmaceutically active substances is well known in the art (see, Remington's Pharmaceutical Sciences, Gennaro, Ed., Mack Publishing Co., Easton, Pa. 1990, for example).
  • biocompatible carrier can be used with at least one of the substances luteolin, ellagic acid and punicic acid.
  • one, two or all three of the substances can be used with biocompatible carriers, and the substances can be used with the same or different biocompatible carriers.
  • a biocompatible carrier can be used with luteolin, or with ellagic acid, or with punicic acid, or with luteolin and ellagic acid, or with luteolin, ellagic acid and punicic acid.
  • the same or different biocompatible carrier can be used with each substance or combination of the substances.
  • treating means reducing the severity and/or the effects of disease, reducing metastasis, reducing tumor growth, reducing tumor angiogenesis, reducing cancer progression, or reducing cancer cell migration, or any combination thereof.
  • an active substance used or administered to inhibit cancer cell migration or to treat a cancer will depend, among other things, on the cell, tumor or cancer being targeted, the subject being treated, the route of administration, and the particular substances utilized. Determination of the dose, formulation and route of administration are well within the skill of those in the clinical arts.
  • an effective amount of luteolin, an effective amount of ellagic acid, and an effective amount of punicic acid can be administered to treat a cancer or a tumor in a subject, or to inhibit cancer cell migration in vitro.
  • an effective amount of each can be administered.
  • a composition can include an effective amount of luteolin, or an effective amount of ellagic acid, or an effective amount of punicic acid, or any combination thereof, and a biocompatible carrier can be included with at least one of the luteolin, ellagic acid, or punicic acid.
  • a composition can include an effective amount of luteolin, an effective amount of ellagic acid, and an effective amount of punicic acid, along with a biocompatible carrier.
  • a composition can include an effective amount of luteolin, or an effective amount of ellagic acid, or an effective amount of punicic acid, or any combination thereof, and an effective amount of an EZH2 inhibitor and/or an miR-200c mimic.
  • a composition can include an effective amount of luteolin, an effective amount of ellagic acid, and an effective amount of punicic acid, along with an effective amount of an EZH2 inhibitor and an effective amount of an miR-200c mimic.
  • the EZH2 inhibitor can be an siRNA directed against EZH2, including siRNA directed against the sequence CGGTGGGACTCAGAAGGCA (SEQ ID NO.l), and the miR-200c mimic can be UAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO.2).
  • the route of administration of an active substance will vary, naturally, with the location and nature of the lesion, and can include, e.g., oral administration, non-oral administration, intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, or any combination thereof.
  • the luteolin, ellagic acid and punicic acid can be administered by the same or different routes of administration.
  • the luteolin, ellagic acid and punicic acid can be administered non-orally.
  • Non-oral administration can include perenteral administration or intraperitoneal administration.
  • the ellagic acid can be administered non-orally while the luteolin and/or the punicic acid can be administered orally or non-orally.
  • an effective amount of luteolin, an effective amount of ellagic acid, an effective amount of punicic acid and a biocompatible carrier can be non- orally administered to treat a cancer or a tumor in a subject.
  • the amount of L, E and P administered per dose can be in the range of about 0.01 ⁇ g/g - 100 ⁇ g/g body weight. In some embodiments, especially for humans, L, E and P can each be in the range of about 1 ⁇ g/kg - 20 mg/kg body weight per dose.
  • the ratio of L to E to P in weight can include a ratio such as, but not limited to, 1 : 16:2; 1 :8:2; 1 :4:2; 1 :25; 2.5, 1 :50:5; 1 :20: 10; 1 : 10:5;
  • these amounts and ratios can be for oral administration.
  • EZH2 is a histone methyltransferase.
  • EZH2 inhibitors include, but are not limited to, siRNA directed against EZH2, or small molecule inhibitors such as GSK343 and GSK126, which are potent selective chemicals developed by Glaxo SmithKline.
  • siRNAs Small interfering RNAs
  • the siRNA can be produce in cells, for example, by the action of the Dicer ribonuclease, or by transfection of synthetic siRNA.
  • Micro-RNAs are naturally-occurring small non-coding RNAs that function as negative regulators of gene expression. They regulate important cellular functions such as cell proliferation, apoptosis, differentiation and development. Mature miRNAs bind to target mRNAs which subsequently results in either direct cleavage of the targeted mRNAs or inhibition of translation.
  • the micro-RNA miR-200c negatively targets the repressor of E-cadherin.
  • the subject can be a human or animal. In any of the methods, the subject can be a patient in need of such treatment.
  • the substances L, E, P, EZH2 inhibitor and/or miR-200c mimic can be provided to the cell, tumor or subject as separate substances, or as any combination of the separate substances.
  • L can be administered to a subject separately while E and P are administered to the subject together, and the EZH2 inhibitor and the miR-200c mimic, if present, are administered to the subject together.
  • the substances L, E, P, EZH2 inhibitor and/or miR-200c mimic can be provided to the cell, tumor or subject as a pharmaceutical, nutraceutical, or food additive, or a combination thereof.
  • the various substances are administered at the same time.
  • the various substances L, E, P, EZH2 inhibitor and/or miR-200c mimic can be administered to a cell, tumor or subject at the same time or at different times so long as the particular combination of substances in a particular embodiment is formed and presented to the cell, tumor, or subject.
  • the cancer can be prostate cancer, breast cancer, or any cancer that metastasizes, including cancers such as lung cancer and liver cancer.
  • Prostate cancer is the second cause of cancer deaths in men in the United States.
  • early stages can be controlled with hormone ablation therapy to delay the rate of cancer progression but, over time, the cancer overcomes its hormone dependence, becomes highly aggressive and metastasizes.
  • Clinical trials have shown that pomegranate juice (PJ) inhibits prostate cancer progression.
  • PJ pomegranate juice
  • L luteolin
  • E ellagic acid
  • P punicic acid
  • L+E+P significantly inhibits growth and metastasis of highly invasive Pten ⁇ ;K-ras prostate tumors. Furthermore, L+E+P inhibits angiogenesis in vivo, prevents human endothelial cell (EC) tube formation in culture and disrupts pre-formed EC tubes, indicating inhibition of EC adhesion to each other. L+E+P also inhibits the angiogenic factors IL-8 and VEGF as well as their induced signaling pathways in ECs. In conclusion, these results show that L+E+P inhibits prostate cancer progression and metastasis.
  • PCa Prostate cancer
  • the American Cancer Society has estimated that a total of 238,590 new cases will be diagnosed and 29,720 men will die of PCa in 2013 (1). To date there is no real cure for the disease beyond surgery and/or radiation. Early stages can be controlled with hormone ablation therapy that suppresses the rate of PCa growth. However, over time, the cancer overcomes its hormone dependence, becomes castration resistant prostate cancer (CRPC) and metastasizes to the lung, liver and bone (2).
  • CRPC castration resistant prostate cancer
  • Cabozantinib is a potent dual inhibitor of the tyrosine kinases MET and VEGFR2, that has been shown to reduce or stabilize metastatic bone lesions in CRPC patients (9,10). However, all of these treatments have adverse side effects.
  • pomegranate juice has been identified as a natural agent to fight PCa.
  • Mounting evidence shows that PJ has great potential to inhibit the growth and reduce the invasiveness of PCa cells both in vitro and in vivo (11-14).
  • PSADT PSA doubling time
  • P ⁇ 0.001 PSA doubling time
  • PSADT lengthened more than 6 months from 11.9 to 18.5 months (P ⁇ 0.001) with no significant difference between dose groups (16).
  • PJ contains many components and as a whole it is difficult to determine how to best maximize its use in treating PCa.
  • a way to overcome this challenge is to identify components of PJ that are responsible for the anti-metastatic effect of the whole juice.
  • the juice contains a rich complement of polyphenolic compounds such as delphinidin, punicalin, punicalagin, quercetin and luteolin (12).
  • Pomegranate pericarp is very rich in tannates of gallic acid and ellagic acid, which are strongly antioxidant (18).
  • Pomegranate seed oil is rich in steroids and sterols (19) .
  • the oil is comprised of 80% punicic acid, which is a rare C18 octadecatrienoic fatty acid. Many of these compounds have been shown to have anticancer properties (20-23). Nevertheless, the specific
  • L+E+P is additively more potent than L, E or P individually (24). They stimulate cell adhesion, inhibit cell migration and inhibit chemotaxis of the PCa cells via CXCL12/CXCR4, a chemokine axis that is very important in metastasis of PCa cells (24).
  • L+E+P inhibits PCa metastasis in vivo. Therefore, in the present study, we tested the effect of L+E+P on metastasis of PCa in a mouse tumor model.
  • L+E+P administration inhibits growth and metastasis of luciferase expressing human PCa (PC-3M-luc) xenograft tumors in severe combined immunodeficiency (SCID) mice.
  • L+E+P treatment also inhibits growth and metastasis of allograft tumors of the highly invasive mouse PCa cells with PTEN deletion and K-Ras activation.
  • L+E+P treatment inhibits tumor angiogenesis and angiogenesis-related molecular properties of endothelial cells.
  • mice Male SCID mice (5-6 weeks old) were anesthetized and were injected ventrally under the skin near the region of the prostate with 2 l0 6 PC-3M-luc2 cells or ⁇ ⁇ Pten ' ⁇ K-ras G12D cells suspended in ⁇ Dulbecco's Phosphate Buffered Saline (DPBS). One day after the injection of the tumor cells, treatment with vehicle or L+E+P was started. For the weekly imaging, mice were anesthetized and were given the substrate D-luciferin by intraperitoneal injection at 150mg/kg in DPBS 5-10 min before imaging.
  • IACUC Institutional Animal Care and Use Committee
  • Bioluminescent imaging was performed with a bioluminescent imaging system (ONYX, Stanford Photonics) comprised of a highly sensitive cooled CCD camera mounted in a light-tight specimen box. Images and measurements of BLI were acquired and analyzed using Win View software. To quantify the BLI intensity, the tumor of each mouse was manually outlined using Matlab's built-in function "roipoly". The mean value of the gray scale intensities inside the tumor were then calculated for quantitative analysis. The tumor diameters were measured and the volumes were calculated by the formula:
  • Human prostate tumor samples were obtained through an IRB-approved protocol. Matched normal and tumor tissues from a single patient were obtained at the time of prostatectomy. The fragments used were shown by frozen section to contain or not contain tumor. Two patient-derived xenograft tumors were also utilized. Tissue was removed from subcutaneous xenografts in SCID mice, at 6 th passage level.
  • HMVEC or Pten ⁇ ;K-ras cells were plated on gelatin- coated 6-well plates (BD Biosciences, San Jose, CA), cultured for 24hrs and then treated with PJ components for 12 hrs or 24 hrs. Cells were then trypsinized and the time required to detach all cells was recorded as an indicator of cell adhesiveness as previously described (17,24,25).
  • Confluent HMVEC or Pten ' ' ;K-ras UJ ⁇ cell cultures were wounded using a rubber scraper to create a scratch, washed and treated with PJ components at various concentrations. Cell migration was determined by measuring the distance migrated by the cells from the wounded edge to the leading edge of migration at 24h and 48h after treatment was initiated. Scraped cell cultures without treatment were used as controls.
  • Chemotaxis assay was done as previously described (17,24,25). HMVEC or Pten ' ⁇ 'K-ras G12D cells (lxlO 5 ) were plated on the upper side of transwell membranes and were treated with L+E+P for 12 hours. CXCL12 (lOOng/ml) or PC3 cells conditioned medium was added to the lower chamber and the cells migrated to the other side of the membrane were counted in 8 high power (40X) fields (HPF)/filter to obtain the average number of cells per field.
  • mice were purchased from the Jackson Laboratory (Bar Harbor, ME). All experimental protocols were approved by the UCR IACUC. The mice were treated with L+E+P (64 ⁇ g of each) by intraperitoneal injection (IP) daily for 2 weeks. The hair was then removed from the back of the mice using Nair hair remover (Madera, CA) and they were injected with IL-8 (1003 ⁇ 4/20 ⁇ 1 saline) or VEGF (2003 ⁇ 4/20 ⁇ 1 saline) using an insulin syringe. IL-8 and VEGF were each injected in two sites symmetrically located on the back of each mouse every 24 hrs for 4 days.
  • IL-8 1003 ⁇ 4/20 ⁇ 1 saline
  • VEGF vascular endothelial growth factor
  • Injection sites were labeled using a permanent marker to ensure that repeated injections for the same site all took place in the same spot; on each animal, the pair of injection sites for IL-8 and the pair for VEGF were on opposite sides of the backbone and at least 2 cm apart to avoid possible cross-over effects. Skin samples from the injected areas were collected and observed at day 5.
  • Frozen tissue sections were immuno labeled with Ki67 or aSMA antibodies, mounted with Vectashield, and viewed using Nikon Microphot-FXA fluorescence
  • L+E+P inhibits tumor growth, metastasis and angiogenesis of prostate xenograft and allograft tumors
  • mice were injected ventrally under the skin with luciferase-expressing human PCa cells (PC-3M- luc).
  • PC-3M- luc luciferase-expressing human PCa cells
  • mice were randomly divided into two groups.
  • One group of mice received L+E+P treatment once a day, five days/week for 8 weeks and the other received only vehicle (DPBS) for the same period of time, via intraperitoneal (IP) injection.
  • DPBS luciferase-expressing human PCa cells
  • IP intraperitoneal
  • Tumor growth and progression to metastasis of both treated and vehicle groups were monitored weekly by bioluminescence imaging (BLI) (Fig. 1 A,B). Without treatment the tumors grew to the maximum size allowed by the IACUC in 8 weeks
  • mice were injected with Pten ⁇ ;K-ras cells subcutaneously in the region of the prostate, and then divided into two groups.
  • One group of mice received L+E+P treatment (64 ⁇ g/component/day five days a week) and the other group received only the vehicle. Because of the tumor aggressiveness, all mice were treated for only 4 weeks and euthanized at the end of the 4 th week.
  • L+E+P significantly decreased the size of the tumors compared to the vehicle-treated group (Fig. 3A). By the end of week 4, all tumors in the vehicle-treated group had metastasized and the major sites of metastasis were the lung and liver. The number of metastatic lesions was counted
  • L+E+P involve inhibiting the CXCL12/CXCR4 and AKT signaling axis
  • L+E+P alters the angiogenic properties of HMVECs
  • HMVEC human microvascular endothelial cells
  • IL-8 and VEGF are potent angiogenesis inducers and that tumor cells in general produce high levels of both.
  • Fig. 6C, D To determine the effect of L+E+P on IL-8 and VEGF production, we treated PC3 cells with L+E+P and found that these PJ components significantly reduce the IL-8 and VEGF production.
  • L+E+P inhibits IL-8 or VEGF induced angiogenesis in vivo
  • C57BL mice were injected for 2 weeks with 64 ⁇ g each of L+E+P once/day.
  • IL-8 or VEGF was injected under the skin once/day for 4 consecutive days to examine whether the angiogenic effects were inhibited by systemically pre-treating the animals with L+E+P.
  • the skin samples were collected, imaged and the blood vessels were manually highlighted.
  • angiogenesis induced by IL-8 or VEGF was inhibited by L+E+P as shown by reduced number of blood vessels in L+E+P treated skin samples (Fig. 6G and Fig. 11 A-B).
  • Prostate cancer that has become metastasized has a poor prognosis and remains a significant therapeutic challenge.
  • L+E+P has anti- metastatic effects in vivo and have found that these PJ components (i) Inhibit growth of primary tumors; (ii) inhibit cellular and molecular processes critical for metastasis; (iii) inhibit tumor angiogenesis and change angiogenesis-related properties of human endothelial cells; (iv) inhibit the CXCL12/CXCR4 chemotactic signaling axis which is known to be important in cancer metastasis.
  • ellagic acid and metabolites can be identified briefly and in low quantity in plasma and urine within an hour of both oral and IP administration.
  • most ellagic acid appears to be converted by intestinal microorganisms to urolithins and their glucuronides (31-33). These urolithin glucuronides are then absorbed and concentrated in prostate tissue, where they may exert anti-proliferative and anti-oxidant effects.
  • ellagic acid itself does not appear to be a major, biologically-effective component of orally-administered PJ.
  • ellagic acid itself ends up in the plasma and in the prostate of mice (31).
  • parenteral dosing of PJ components may have novel biologic effects by bypassing intestinal metabolism. Comparative studies of the biologic activities of L, E, and P by both routes will be necessary to define the optimum methods to use these compounds in clinical cancer care.
  • angiogenesis plays a crucial role in the survival, proliferation and metastatic potential of PCa tumors through providing nutrients and oxygen (35). Therefore, angiogenesis is an attractive treatment target in many types of solid tumors, including PCa tumors.
  • the most successful anti-angiogenic agent is bevacizumab, a monoclonal antibody against VEGF (36).
  • Natural agents such as pomegranate extract have been shown to inhibit angiogenesis in prostate cancer (37) but the active components responsible for the anti-angiogenic effects are largely unknown.
  • L+E+P inhibits angiogenesis by reducing the number of blood vessels in the tumors.
  • New blood vessels are formed in response to interaction between tumor cells and endothelial cells, growth factors, and extracellular matrix components (38).
  • endothelial cells we show that L+E+P significantly, and in a dose-dependent manner, decreases endothelial cell adhesion, migration and tube formation, all of which are important processes in angiogenesis.
  • VE-cadherin and CD31 two of the important endothelial-specific adhesion proteins that maintain the integrity of blood vessels at adherens junctions (39) are completely (Ve-Cadherin) or significantly (CD31) inhibited by L+E+P treatment.
  • tumor-secreted factors can chemoattract local stromal cells, such as fibroblasts and macrophages, and distant cells such as endothelial cells (40).
  • L+E+P inhibits chemotaxis of endothelial cells towards PC3 conditioned medium, suggesting that these components inhibit angiogenesis also through perturbing the communication between tumor and endothelial cells.
  • tumor cells secrete growth factors such as IL-8 and VEGF to stimulate the migration and proliferation of endothelial cells (41).
  • IL-8 and VEGF are known as potent promoters of angiogenesis and the level of IL-8 and VEGF are in general elevated in various tumors (42).
  • IL-8 has been shown to stimulate cell migration via the PI3K/AKT signaling pathway (43) and VEGF is known to promote endothelial cell proliferation through activation of the PI3K/AKT and MEK/ER signaling pathways (30).
  • L+E+P treatment significantly reduces the production of IL-8 and VEGF in PC3 cells and inhibits the endothelial cell response to IL-8 and VEGF.
  • L+E+P reduces the level of CXCR4 in prostate tumors and inhibits the CXCR4 downstream signaling G l 3 which is the G protein a subunit involved in CXCL12-induced chemotaxis (47). Together with the finding that the effect of L+E+P on tumor growth was partially reversed by AKT activation, these results strongly suggest that L+E+P inhibits prostate cancer metastasis also through targeting the
  • L+E+P inhibits cell proliferation as detected with staining for Ki67, a protein active during the cell cycle but absent when cells are in GO. Because we find virtually no staining for Ki67 in tumors of animals treated with L+E+P this suggests that the cells are arrested in GO.
  • L+E+P can be used in combination to prevent prostate cancer growth and metastasis. Furthermore, it may be possible to develop them into novel drugs that can be made more effective than the natural products in preventing cancer progression.
  • EZH2 siRNA and/or miR-200c further enhanced the effect of L+E+P on prostate cancer cell migration.
  • EZH2 is a histone methyltransferase and its overexpression has been shown to promote metastasis; miR-200c negatively targets the repressor of E-cadherin.
  • L+E+P significantly down-regulate the level of EZH2 while up-regulate the level of miR-200c. Therefore, the combinatory effect indicates that EZH2 siRNA and miR-200c mimics can potentially be combined with L+E+P treatment.
  • Confluent prostate cancer cells PC3 were wounded using a rubber scraper to create a scratch, washed and treated with PJ components plus siRNA (25nM) targeting the 5'UTR region of EZH2 with the sequence 5 '-CGGTGGGACTC AGAAGGC A-3 ' (SEQ ID NO. l), and an miR200c mimic (UAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO.2)).
  • siRNA 25nM
  • siRNA 25nM
  • l the sequence 5 '-CGGTGGGACTC AGAAGGC A-3 '
  • miR200c mimic UAUACUGCCGGGUAAUGAUGGA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Oncology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Cette invention concerne des méthodes et des compositions pour le traitement du cancer. Selon un aspect, l'invention concerne une méthode de traitement du cancer chez un sujet ayant besoin de ce traitement, la méthode comprenant l'administration au sujet de lutéoline, acide ellagique et acide punicique, en une quantité efficace pour traiter le cancer. Selon un autre aspect, l'invention concerne une méthode d'inhibition de la migration des cellules cancéreuses, la méthode comprenant l'exposition d'une cellule cancéreuse à a) une lutéoline, un acide ellagique ou acide punicique, ou à une combinaison de ces substances ; et à b) un inhibiteur EZH2 ou un mimétique de miR-200c, ou à une combinaison de ces substances. Des compositions contenant de la lutéoline, de l'acide ellagique, ou de l'acide punicique, ou une combinaison de ces substances sont en outre décrites.
PCT/US2014/032894 2013-04-03 2014-04-03 Composants spécifiques de jus de grenade et inhibition de l'évolution/métastase du cancer de la prostate WO2014165714A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361808168P 2013-04-03 2013-04-03
US61/808,168 2013-04-03

Publications (1)

Publication Number Publication Date
WO2014165714A1 true WO2014165714A1 (fr) 2014-10-09

Family

ID=51659217

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/032894 WO2014165714A1 (fr) 2013-04-03 2014-04-03 Composants spécifiques de jus de grenade et inhibition de l'évolution/métastase du cancer de la prostate

Country Status (1)

Country Link
WO (1) WO2014165714A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080234361A1 (en) * 2004-03-23 2008-09-25 Rimonest Ltd. Pharmaceutical Compositions, Methods of Formulation Thereof and Methods of Use Thereof
WO2012071492A1 (fr) * 2010-11-23 2012-05-31 Georgia Tech Research Corporation Membres de la famille mir-200 induisant la transition mésenchyme-épithélium dans le cancer des ovaires
WO2012144220A1 (fr) * 2011-04-22 2012-10-26 Oncotherapy Science, Inc. Ezh2 en tant que gène cible pour une thérapie anticancéreuse et le diagnostic du cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080234361A1 (en) * 2004-03-23 2008-09-25 Rimonest Ltd. Pharmaceutical Compositions, Methods of Formulation Thereof and Methods of Use Thereof
WO2012071492A1 (fr) * 2010-11-23 2012-05-31 Georgia Tech Research Corporation Membres de la famille mir-200 induisant la transition mésenchyme-épithélium dans le cancer des ovaires
WO2012144220A1 (fr) * 2011-04-22 2012-10-26 Oncotherapy Science, Inc. Ezh2 en tant que gène cible pour une thérapie anticancéreuse et le diagnostic du cancer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LANSKY ET AL.: "Pomegranate (Punica granatum) pure chemicals show possible synergistic inhibition of human PC-3 prostate cancer cell invasion across MatrigelTM", INVESTIGATIONAL NEW DRUGS, vol. 23, 1 March 2005 (2005-03-01), pages 21 - 22 *
WANG ET AL.: "Specific Pomegranate Juice Components as Potential Inhibitors of Prostate Cancer Metastasis", TRANSLATIONAL ONCOLOGY, vol. 5, no. 5, 1 October 2012 (2012-10-01), pages 344 - 355 *

Similar Documents

Publication Publication Date Title
Wang et al. Luteolin, ellagic acid and punicic acid are natural products that inhibit prostate cancer metastasis
Kong et al. The natural flavonoid galangin elicits apoptosis, pyroptosis, and autophagy in glioblastoma
Kovacovicova et al. Senolytic cocktail dasatinib+ quercetin (D+ Q) does not enhance the efficacy of senescence-inducing chemotherapy in liver cancer
Dou et al. Aloe-emodin ameliorates renal fibrosis via inhibiting PI3K/Akt/mTOR signaling pathway in vivo and in vitro
JP2024051080A (ja) 抗癌療法としての正常細胞および腫瘍細胞の小分子ｔｒａｉｌ遺伝子誘導
He et al. Zinc oxide nanoparticles inhibit osteosarcoma metastasis by downregulating β-catenin via HIF-1α/BNIP3/LC3B-mediated mitophagy pathway
McCarthy et al. In vivo anticancer synergy mechanism of doxorubicin and verapamil combination treatment is impaired in BALB/c mice with metastatic breast cancer
He et al. Curcumin reverses 5-fluorouracil resistance by promoting human colon cancer HCT-8/5-FU cell apoptosis and down-regulating heat shock protein 27 and P-glycoprotein
Qian et al. Pharmacological manipulation of Ezh2 with salvianolic acid B results in tumor vascular normalization and synergizes with cisplatin and T cell-mediated immunotherapy
Welten et al. Inhibition of 14q32 microRNA miR-495 reduces lesion formation, intimal hyperplasia and plasma cholesterol levels in experimental restenosis
Wang et al. Artesunate suppresses the growth of prostatic cancer cells through inhibiting androgen receptor
Wang et al. Isorhapontigenin protects against doxorubicin-induced cardiotoxicity via increasing YAP1 expression
Bian et al. A pectin-like polysaccharide from Polygala tenuifolia inhibits pancreatic cancer cell growth in vitro and in vivo by inducing apoptosis and suppressing autophagy
Fu et al. Apigenin suppresses tumor angiogenesis and growth via inhibiting HIF-1α expression in non-small cell lung carcinoma
US20240108628A1 (en) Combination therapy with mek inhibitor and cdk4/6 inhibitor to treat pancreatic cancer
Chen et al. Exosomal miR-500 derived from lipopolysaccharide-treated macrophage accelerates liver fibrosis by suppressing MFN2
He et al. Apigenin nanoparticle attenuates renal ischemia/reperfusion inflammatory injury by regulation of miR-140-5p/CXCL12/NF-κB signaling pathway
Liao et al. Advanced oxidation protein products impair autophagic flux in macrophage by inducing lysosomal dysfunction via activation of PI3K-Akt-mTOR pathway in Crohn's disease
Yang et al. The role of non-apoptotic cell death in the treatment and drug-resistance of digestive tumors
Wu et al. GSK621 activates AMPK signaling to inhibit LPS-induced TNFα production
Ali et al. Microvesicles mediate sorafenib resistance in liver cancer cells through attenuating p53 and enhancing FOXM1 expression
Zhang et al. Influence of 6-shogaol potentiated on 5-fluorouracil treatment of liver cancer by promoting apoptosis and cell cycle arrest by regulating AKT/mTOR/MRP1 signalling
Chu et al. Synergistic effects of sodium butyrate and cisplatin against cervical carcinoma in vitro and in vivo
WO2014066122A1 (fr) Traitement de tumeurs à l'aide de cellules souches mésenchymateuses activées
Zhang et al. Cell membrane-camouflaged bufalin targets NOD2 and overcomes multidrug resistance in pancreatic cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14778926

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14778926

Country of ref document: EP

Kind code of ref document: A1