WO2014165650A1 - Novel ppetac1 gene and method to manipulate tree architecture - Google Patents

Abstract

Disclosed is a novel gene that controls the branching angle of a tree wherein either silencing or overexpressing PpeTAC1 controls the architecture of transformed to the tree.

Description

NOVEL PPETAC1 GENE AND METHOD TO MANIPULATE TREE ARCHITECTURE

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This present application claims priority under 35 U.S.C. §119(e) to U.S.

Provisional Serial No.: 61/808,269, which was filed on April 4, 2013, and is hereby incorporated by reference.

FIELD OF THE INVENTION

[0002] This invention relates to a novel gene that controls the branching angle of a tree. Disclosed is the gene, PpeTACl, and a method to control tree architecture via either silencing PpeTACl or overexpressing PpeTACL

BACKGROUND OF INVENTION

[0003] The spatial patterning or architecture of any given tree is ultimately a consequence of numerous developmeiiiaL genetic, and environmental factors (Baithelemy D. and Caraglio Y., 2007, Ann Bot. 99, 375-407). Over the last 40 years, the study of tree architecture has intensified as it is a critical parameter for both the management and aesthetics of our agriculture, forests, and residential landscapes. Two features that prominently contribute to tr ee architectural differences include the pattern of branching and the angle of branch growth (Tomlinson, P.B., 1978, London: Cambridge University Press, 197-202). Combined, these factors control the number of branches produced, their spacing, and their directional orientations.

[0004] Branch growth angle is not uniform and subject to substantial variation within any given tree. Yet in a broad sense, branch angle has been used to classify trees into

architectural types that are influenced by various tropisms. These include pillar or columnar' forms that have narrow branch angles, spreadin types with wide branch angles, and weeping in which shoots grow downwards. Unlike the apical shoot, axillary shoots are not subject to strict gravitropic or phototropic control, allowing thein to grow in a variety of directions irrespective of the gravity and light vectors. Most familiar tree canopy shapes display a phenomenon whereby shoots closer to the apical meristem grow more vertical while those lower in the canopy tend to grow more horizontally.

[0005] Optimizing tree architecture to maximize productivity and simplify management is a chief goal of numerous tree crop industries. Thus tree architecture has been long studied with regard to horticultural practices associated with orchard and plantation forestry management. Tree growth responses to various types of pruning, hormone treatments, fertilizer applications, and effects of rootstock-scion interactions are well established.

Architectural tree types suited for high density production systems and/or improved

mechanization offer great promise for improving tree-based agricultural systems. In this regard, vertical or columnar tree forms are being investigated due to their erect axillary branch angles and reduced canopy diameter (Kelsey, D.F. and Brown, S.K., 1992, Fruit Var. J. 46, 83-87; Scorza et ai., 1989, J. Am. Soc. Hortic. Sci. 114, 98-100). Considering the importance of canopy spatial patterning to the evolution and niche exploitation of land plants, little is known of the genes underlying the genetic basis of these traits.

[0006] Peach trees with extreme- vertical brandling resulting in a fastigiated tree shape have been developed for use in high density production systems (Miller and Scorza, 2010, J. Amer. Pomological Soc. 64, 199-217). This trait was initially referred to as "broomy" Ox) (Yamazaki et al., 1987, New broomy flowering peach eu!tivars Teratebem, Temtemomo. and Terateshiro. Bulletin of the Kanagawa Horticultural Experiment Station, No. 34) and was later designated "pillar" inasmuch as it was shown to be incompletely dominan as

heterozygous individuals have intermediate branch angles referred to as "upright" (Scorza et al., 1989, J Am, Soc. Hortic. Sci, 114, 98-100; Tworkoski and Scorza, 2001, J. Amer. Hart. Sci. 126, 785-790: and Scorza et al., 2002, J. Amer. Soc. Ho . Sci. 127(2), 254-261). Axillary shoots in vertical trees tend to grow vertically regardless of their canopy position. Given the growing need to control canopy special patterns in trees, especially trees planted in nursery and orchards settings, there is a need to develop breeding and identification

techniques to identify the genes responsible for different growth habits in tr ee varieties, BRIEF SUMMARY OF THE INVENTION

[0007] Disclosed herein is an isolated polynucleotide sequence comprising

polynucleotide sequence SEQ. ID. NO.: 1, wherein the polynucleotide sequence expression results in a plant having a horizontal phenotype characterized by axillary shoots having an increased horizontal orientation. In another embodiment of the invention, disclosed is a kit. for the detection of a horizontal phenotype for a plant or gerniplasm, the kit comprising a reagent for the detection for the presence of SEQ. ID. NO. : 1.

[0008] Disclosed herein is an isolated polynucleotide sequence comprising

polynucleotide sequence having 99% homology with SEQ. ID. NO.: 1, wherein the polynucleotide sequence expression results in a plant having a horizontal phenotype characterized by axillary shoots having an increased horizontal orientation.

[0009] Also disclosed is method for controlling plant horizontal orientation, the method comprising overexpressmg SEQ. ID. NO.: 1 in germpiasm or plant wherein the

overexpression of SEQ. ID. NO. : 1 result in a horizontal phenotype characterized by axillary shoots having an increased horizontal orientation. In one embodiment of the invention, the germpiasm or plant being controlled is a Prun cultivar. In another" embodiment of the invention, the germpiasm or plant being controlled is Primus persica. In yet another embodiment of the invention, the gennplasm or plant being controlled is Prunm domes ica. In another" embodiment of the invention is a transgenic Primus cell or tissue prepared according to the disclosed method for controlling plant horizontal orientation, hi another embodiment of the invention is &Prtmtis plant generated from the disclosed transgenic Primus cell or tissue prepared according to the disclosed method for controlling plant horizontal orientation. In yet another embodiment of the invention is transgenic seed produced by the Prumis plant prepared according to the disclosed method for controlling plant horizontal orientation.

[0010] Also disclosed is a method for controlling plant horizontal orientation, the metliod comprising overexpressing a sequence having 99% homology with SEQ. ID. NO. : 1 in germp!asm or plant wherein the overexpression of the sequence results in a horizontal phenotype characterized by axillary shoots having an increased horizontal orientation, hi one embodiment of the invention, the germplasm or plant being controlled is a Primus culfivar. hi another embodiment of th invention is a transgenic Pnmus eel! or tissue prepared according to the disclosed method for controlling plant horizontal orientation, hi another embodiment of the invention is a Prun plant generated from the disclosed transgenic

Pnmus cell or tissue prepared according to the disclosed method for controlling plant horizontal orientation. In yet another embodiment of the invention is transgenic seed produced by the Pnmus plant prepared according to the disclosed method for controlling plant horizontal orientation.

[0011] Also disclosed is a method for controlling plant branch vertical orientation, the method comprising silencing the expression of SEQ. ID. NO.: 1 in germplasm or plant, wherein the silencing of SEQ. ID. NO.: 1 result in a vertical phenotype characterized by axillary shoots having an increased vertical orientation. In one embodiment of the invention, the germplasm or plant being controlled is a Pnmus cultivar. In another embodiment of the invention, the germplasm or plant being controlled is Prunm persica. In yet another embodiment of the invention, the germplasm or plant being controlled is Prunm domes ica. hi another embodiment of the invention is a transgenic Pnmus eel! or tissue prepared according to the disclosed method for controlling plant vertical orientation, hi another embodiment of the invention is a Primus plant generated from the disclosed transgenic

Pmnus cell or tissue prepared according to the disclosed method for controlling plant vertical orientation. In yet another embodiment of the invention is transgenic seed produced by the Primus plant prepared according to the disclosed method for controlling plant vertical orientation.

[0012] Also disclosed is a method for controlling plant branch vertical orientation, the method comprising silencing the expression of a sequence having 99% homology with SEQ. ID. NO. I 1 in germplasm or plant, wherein the silencing of the sequence results in a vertical phenotype characterized by axillary shoots having an increased ver tical orientation. In one embodiment of the invention, the germplasm or plant being controlled is a Prmms cultivar. In another embodiment of the invention is a transgenic Pmnus cell or tissue prepared according to the disclosed method for controlling plant vertical orientation. In another embodiment of the invention is a Prun plant generated from the disclosed transgenic

Pmnus eel! or tissue prepared according to the disclosed method for controlling plant vertical orientation. In yet another embodiment of the invention is transgenic seed produced by the Pmnus plant prepared according to the disclosed method for controlling plant vertical orientation.

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The present invention together with the disclosed embodiments may best be understood from the following detailed description of the drawings, wherein:

[00i4j FIG. 1A, IB, and 1C depict two year- old Pmnus persfca trees from an F2 segregating population standard, upright, and vertical phenotypes, respectively.

[0015] FIG. 2 is a general schematic to identify the polymorphism responsible for the vertical trait from peach tree populations. [0016] FIG. 3 depicts the SNP DIP pnorne frequency map tor the peach vertical trait. SNPs/DIPs unique to pillar (ie. not present in the peach reference genome of the cultivar ονεΙΓ or the standard pnonie of 'True Gold') are s own in green while those unique to standard (ie. not found in peach reference genome 'Lovell' or the 'Italian pillar' pnome) are in red. Dashed line represents a trendline. A 2Mb region (blue bar) was identified with the highest SNP frequencies. Genetic linkage map showing the HRM marker positions (blue) on scaffold 2 and the resulting calculated cM distances (red). Region delineated from the frequency map is mdicated by shaded bar-, SNPs within the mapped region are mdicated by circles while DIPs are mdicated with triangles.

[0017] FIG. 4A depicts the expression of PpeTACl in anatomical tissues collected from the standard growth habit peach cultivar 'Tine Gold'. Tissues types are labeled. Y-axis represents relative expression values derived from qPCR results after normalization and standardization. Expression was highest in axillary flower and vegetative buds as well as axillary branch attachment sites.

[0018] FIG. 4B depicts flower pedicel angles from standard (top left) and vertical (bottom left) trees. Quantitative differences in axillary floral bud emergence angles from vertical, upright and standard trees are shown on right. Enor bars represent standard deviation of three biological replicates derived from thre independent trees.

[0019] FIG. 4C is a graph depicting qPCR results for PpeTAC l expression hi branch attachment sites from verticle, upright, and standard trees. No transcript was detected in either "Italian Pillar" or "NJ Piiiar" samples. En or bar s represent standard deviation of three biological replicates.

[0020] FIG. 4D is depiction of mutations in PpTACl are associated with the vertical phenotype. [0021 FIG. 5 is a phylogenetic tree of various IGT family members identified in diverse plant species. Tree was constructed using the UPGMA algorithm from an amino acid multiple alignment generated using CLC Genomics Workbench (CLC Bio, Netherlands). TAC1 and L·4ZT1 clades are indicated on right. Plant classifications are color coded according to the legend.

[0022] FIG. 6 is a depiction of the expression of TACl and LAZY! in dissected 4 week old wild-type Ambidopsis (Col-0) plants and 4 month old peach saplings (cv. True Gold). Short black lines indicate cut points where sections of each individual plant were dissected and flash frozen. Ambidopsis image is a redr awn representation of an individual plant whereas the peach image is derived from an actual picture of the plant that was dissected. Expression values obtained for each segment via qPCR are color coded according to an expression scale (bottom.). RNA could not. be recovered from a small number of samples which are highlighted with dashed lines.

[0023] FIG. 7 is a depiction of four transgenic plum lines having PpeTACl silenced. The wild type depicted is a Biuebyrd plum line.

[0024] FIG. 8 is a measurement of the average branch angle for tour transgenic plum lines. The wild type depicted is a Biuebyrd plum line.

[0025] FIG. 9 is graph depicting RT-quantitative PGR on four transgenic plum line.

BRIEF DESCRIPTION OF THE SEQUENCES

[0026] SEQ. ID. NO. 1 :

atgaagatcttcaactgggttcataagaggcttcatcaaag^tcgtcaag^tgg^t¾c¾^atgtgaaaaagag¾aactgga aaccaatgaeaaggacacacaagcatttctcaaacaagttggrc

ataggcacctitggtttegaeccccte^

tgtttacaacatttgaacacagctttgaggatattgggicaaa

gtgtecctcttactccatttgaggggtccagtg^

agagaa†tac.actggctgacftgitceaggetgaigtte

agaaaaaaatgaatgccagaacaaggagiggcctegcatiigccaagaaactcatcccicgcgtcaaagaigaiicaagtccaaicaa aaatargeaaegaeigaigaggaggargttgaagaggaagate^

aagcagcccagtgcggtagagctcaietccaai^

gcactga is the cDNA sequence of PpeTACl.

[6021] SEQ. ID. NO. 2: TGAACCACTTGTGCTTCTGCGA is a 5 '→ 3 ' primer used in expression analysis of PpeTACl.

[0028] SEQ. ID. NO. 3: ATTCAAACAGCAGCCACAACGG is a 5'→ T primer used in expression analysis of PpeTACl.

[0029] SEQ. ID. NO. 4: GGAAATGCAAATAGGAATTGG is a 5 '→ 3' primer used in expression analysis of PpeTACl .

[0030] SEQ. ID. NO. 5: CTCTCTCTCTGTGGATTAAA is a 5'→ 3' primer used in expression analysis of PpeTACl .

[0031] SEQ. ID. NO. 6: CTCACATGGCCATAGGGATAGT is a 5'→3' primer used in expression analysis of PpeTA Cl ,

[0032] SEQ. ID. NO. 7 : TGAAAGACGTACGCCAAGCCAA is a 5 '→ 3 ' primer used in expression analysis of PpeTACl . [0033] SEQ. ID. NO. 8: AGAGCGAAGAAGACGATCAGGA is a 5⁵→ 3' primer used in expression analysis of PpeTACl .

[0034] SEQ. ID. NO. 9: CAGCTGGTTTCTGAACAATGGC is a 5'— 3^T primer used in expression analysis of PpeTACl.

[0035] SEQ. ID. NO. 10: AAGCACACGTTCCACTCTGT is a 5'→ 3' primer vised in expression analysis of PpeTACl.

[0036] SEQ. ID. NO. 1 i : GGCAATAGTTGTGTGAGGTGAGGT is a 5⁵→ 3 ' primer used in expression analysis of PpeTACl,

[0037] SEQ. ID. NO. 12; ACAGCTAAGCTCCTACTTCAACCC is a 5'→ 3' primer used in expression analysis of PpeTACl.

[0038] SEQ. ID. NO. 13 : AGAGAGTGGCTTTGGTTGGTCT is a 5 '→ 3 ' primer used in expression analysis of PpeTACl.

[0039] SEQ. ID. NO. 14: TCTTCCATCTAAGCTGCCACAT is a 5 '→ 3 ' primer used in expression analysis of PpeTACl .

[0040] SEQ. ID. NO. 15: GCAGTGAATTGAAGAAATAATCGTCG is a 5'→ 3 ' primer vised in expression analysis of PpeTACl.

[0041] SEQ. ID. NO. 16: GAATTCAATTGCTCACAAAATATGAAG is a 5'→ 3' primer used in expression analysis of full length PpeTACl.

[0042] SEQ. ID. NO. 17: GGATCCTTAATTCAGTGCACACAA is a 5'→ 3' primer used in expression analysis of PpeTACl.

[0043] SEQ. ID. NO. 18: TTTGCCAAGAAACTCATCCCTCGC is a 5 '→ 3 ' primer used in expression analysis of PpeTACl .

[0044] SEQ. ID. NO. 19: GCTGCTTCTGGCCATCTGATTTGT is a 5'→ 3 ' primer used in expression analysis of PpeTACl. [0045] SEQ. ID. NO. 20: AATTGCTCACAAAATATGAAG is a forward primer used to detect SEQ. ID. NO. 1.

[0046] SEQ. ID. NO. 21 iTTAATTCAGTGCACACAA is a reverse primer used to detect SEQ. ID. NO. 1.

[0047] SEQ. ID . NO. 22: TGGGTTTGCTGGGAATGTGA is a forward primer used to assemble a PpeTACl silencing construct in a plum species.

[0048] SEQ. ID. NO. 23: CAGCTGGTTTCTGAACAATGGC is a reverse primer used to assemble a PpeTACl silencing construct in a plum species.

[0049] SEQ. ID. NO. 24:

TGGGTI GCTGGGAATGTGAAAAAGAGTGAACTGGAAACCAATGACAAGGACAC ACAAGCATTTCTCAAACAAGTTGGCCTTGTTA_^^^{^}

AGC :÷ATGC :ATTTTAACTATAG( ACCTTTGGTTTCGACCCCCTA,4AACCCTCTA CCCACCAAAACGAATATTTCGTTCTGGAGAGCGAAGAAGACGATCAGGAAAGCC

ATGGATTTTCACACAGTGGTAATGATGATGATGATGATGATGATGAAC:ATTATGA TCATAGTGTTGAAGATGAAGAACTGAACCCTTTAATGTTTACAACATTTGAACAC AGGTTTGAGGATATTGGGTCAAATTTTGATGCCATTGTTCAGAAACCAG G is PpeTACl silencing construct.

[0050] SEQ. ID, NO: 25: GAATTCAATTCGCTCACAAAATATGAAG is a primer used to amplify full length PpeTACl .

[0051] SEQ. ID. NO; 26: CCTTGTGTGCACTGAATTAAGGATCC is a reverse primer used to amplify full length PpeTACl.

DETAILED DESCRIPTION OF THE INVENTION

[0052] Disclosed here is an isolated polynucleotide sequence comprising polynucleotide sequence SEQ. ID. NO. : 1, and referred to as PpeTACl, wherein the polynucleotide sequence expression results in a tree having a spreading phenotype characterized by axillary shoots having an increased horizontal orientation.

Definitions

[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill i the art to which the presently disclosed subject matter pertains. For clarity of the present specification, certain definitions are presented herein below.

[0054J As used herein, the term '".shoo;^" refers to the aerial portion of a plant that includes the stem, leaves, axillary nieristems, and apical meristems.

[0055] As used herein, the term "axillary shoot" refers to either a shoot originating from the axil of leaf or from an axillary bud.

[0056] The term "gene^"" refers to a DNA sequence involved in producing a polypeptide or precursor thereof. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence, such as exon sequences.

[0057] The term "oligonucleotide" refers to a molecule comprising a plurality of deoxyriborracleotides or ribonucleotides. Oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, polymerase chain reaction, or a combination thereof. The present invention embodies utilizing the

oligonucleotide in the form of dsRNA as means of interfering with a critical developmental or reproductive process that leads to control. Inasmuch as mononucleotides are synthesized to construct oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end" if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentos ting. As used herein, a l i nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends.

[0058] When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3' end of one

oligonucleotide points towards the 5' end of the other, the former may be called the

''upstream" oligonucleotide and the latter the "downstream" oligonucleotide.

[0059] The term "primer" refers to an oligonucleotide,, which is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide "primer" may occur naturally, as in a purified restriction digest or may be produced synthetically.

[0060] A primer is selected to be "substantially complementary" to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5^* end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence is sufficiently

complementaiy with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.

[0061] The term "double stranded RNA" or "dsRNA" refers to two substantially complementary strands of ribonucleic acid. "Identity," as used herein, is the rela tionshi between two or more polynucleotide sequences, as determined by comparing the sequences. Identity also means the degree of sequence relatedness between polynucleotide sequences, as determined by the match between strings of such sequences. Identity can be readily

calculated (see, .e.g. Computation Molecular Biology, Lesk, A. M., eds., Oxford University Press, New York (1998), and Biocomputing: Informatics and Genome Projects, Smith, D. W., eel. Academic Press, Ne York (1993), both of which are incorporated by reference herein). While there exist a number of methods to measure identity between two

polynucleotide sequences, the term is well known to skilled artisans (see, e.g.. Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press (1987); and Sequence Analysis Primer, Gribskov., M. and Devereux, J., eds., M Stockton Press, New York (1991)). Methods commonly employed to detemiine identity between sequences include, for example, those disclosed in CariUo, H., and Lipman, D., SIAMJ. Applied Math. (19S8) 48:1073.

"Substantially identical" as used herein, means there is a very high degree of homology

(preferably 100% sequence identity) between the inhibitory dsRNA and the corresponding part of the target gene. However, dsRNA having greater than 90% or 95% sequence identity may be used in the present invention, and thus sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence can be tolerated. Although 100% identity is preferred, the dsRNA may contain single or multiple base pair random mismatches between the K A and th target gene, provided that the mismatches occur at a distance of at least three nucleotides from the fusion site.

[0062] As used herein, "target gene" refers to a section of a DNA strand of a double- stranded DNA that is complementary to a section of a DNA strand, including all transcribed regions, that serves as a matrix for transcription. The target gene is therefore usually the sense strand.

[0063] The term "complementary RNA strand" refers to the strand of the dsRNA, which is complementary to an inRNA transcript that is formed during expression of the target gene, or its processing products. "dsRNA" refers to a ribonucleic acid molecule having a duplex structure comprising two complementary and anti-parallel nucleic acid strands. Not all nucleotides of a dsR A must exhibit Watson-Crick base pairs. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA.

[0064] As used herein, the term "recombinant DNA construct" refer to any agent such as a plasffiicl cosrnid, virus, BAC (bacterial artificial chromosome), autonomously replicating sequence, phage, or linear or circular single-stranded or double-stranded DN A or S A nucleotide sequence, derived from any source, capable of genomic integration or autonomous replication, comprising a DNA molecule in which one or more DNA sequences have been linked in a functionally operative manner using well-known recombinant DNA techniques.

[0065] A nucleic acid sequence can be inserted into a vector by a variety of procedures. In general, the sequence is gated to the desired position in a vector following digestion of the insert and the vector with appropriate restriction endonucleases. Alternatively, blunt ends in both the insert and the vector may be ligated. A variety of cloning techniques are known in the art, e.g., as described in Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, Cold Sprin Harbor Press, Plainview. N.Y, (1989) and Ausubel, F. M. et al,. Current

Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y. (19S9). Such procedures and others are deemed to be within the scope of those skilled in the art .

[0066] The vector can be in the form of a plasmid, a viral particle, or a phage.

Preferably, as disclosed herein the vector is a bacterial vector. Other vectors include chromosomal, non-chromosomal and synthetic DNA sequences, pET-30a and derivatives of pET-30: bacterial plasmids, phage DNA, baculoviras, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A variety of cloning and expression vectors for use with prokaryotic and eukaryoric hosts are described by, e.g., Sambrook, T. et al., Molecular Cloning; A

Laboratory Manual, Cold Spring Harbor Press, Plain view, N.Y, (1989), [0067] "Small interfering RNA" or "siRNA" refers to a snort double-strand of

ribonucleic acid, approximately 18 to 30 micleotides in length. The term '^'RNA interference" or "RNAi" refers to a cellular mechanism for the destruction of targeted ribonucleic acid molecules. Under endogenous conditions,. RNAi mechanism operates when dsRNA is cleaved to siRNA via an enzyme, DICER. The siRNA is processed to a single strand of anti- sense ribonucleic acid and coupled with a protein complex named RISC. The antisense RNA then targets a complementary gene construct, such as messenger RNA that is cleaved by ribonuclease. While the examples infra discloses constructing dsRNA constructs via enzymatic techniques with the enzyme RNA polymerase, it is contemplated that siRNA can be constructed via RNA oligonucleotide synthesis such as those disclosed in Scaringe, S., Methods EnzymoL, 2000, Vol, 317:3 and incorporated herein by reference.

[0068] As used herein, "knock-down" is defined as the act of binding an oligonucleotide with a complementary nucleotide sequence of a gene as such that the expression of the gene or niRNA transcript decreases. In an embodiment, knock-down of a PpeTACl gene in a transgenic plant confers control of branching for said transgenic plant.

[0069] dsRNA containing nucleotide sequence complementary to PpeTACl gene. As disclosed herein, 100% sequence identity between the RNA and the target gene is not required to prac tice the present invention. Thus, the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for plant resistance to RNA viruses. Thus, sequence identity may be optimized by sequence comparison and alignment algorithms known in the art . Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988. CABIOS 4: 11-17), the local homology algorithm of Smith et al. (1981. Adv. Appl. Math. 2: 482); the homology alignment algorithm of Neediemim and Wunsc!i (1970. J. Mol. Biol. 48: 443-453); the search-for-similaiity-metfaod of Pearson and Lspman (1988. Proc. Natl. Acad. Sci. 85: 2444-2448; the aigoriilim of Kailin and Altschul (1990. Proc, Natl. Acad. Sci. USA 87: 2264). modified as in Karlin and Altschul (1993. Proc. Natl. Acad. Sci. USA 90: 5873-5877).

[0070J Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from lutelligenefics.

Mountain View, Calif); the ALIGN program. (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wis., USA); Multiple Alignment took. CLC Genomics Workbench, Version 6.1 (available from CLC Bio. 10

Rogers Street #101, Cambridge, MA). Alignments usin these programs can be performed using the default parameters.

[0071] Greater than 90% sequence identity, or even 100% sequence identity, between the inhibitory RNA and the portion of the eukaryotic translation initiation factor target gene is preferred. Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with portion of the target gene transcript under stringent conditions (e.g., 400 mM NaCi, 40 mM PIPES pH 6.4, 1 mM EDTA, 0° C hybridization for 12-16 horn s; followed by washing). The length of the substantially identical double-stranded nucleotide sequences may be at least about 18, 19, 21 , 22. 23, or 24 bases. In preferred embodiment, the length of the double- stranded nucleotide sequence is approximately from about 21 to about 24 nucleotides in length for plants. [0072] The dsRNA construct disclosed herein may optionally comprise a single stranded overhang at either or both ends. The double-stranded structure may be formed by a single self-complementary RNA strand (i.e. forming a hairpin loop) or two complementary RNA strands. RNA duplex formation may be initiated either inside or outside the cell. When the dsRNA of the invention forms a hairpin loop, it may optionally comprise an mtroii, as set forth in U.S. 2003/01 S0945A1 or a nucleotide spacer, which is a stretch of sequence between the complementary RNA strands to stabilize the hairpin transgene in cells. Methods for making various dsRNA molecules are set forth,, for example, in WO 99/53050 and in U.S. Pat. No.6,506,559. The RNA may be introduced in an amount that allows delivery of at least one copy per cell.

[0073] ^"While the examples provided wherein describe dsRNA constructs that target the branching angle of a plum and peach free, it is contempla ted that, when read in conjunction with the teaching disclosed herein, the construction of other dsRNA constructs targeting PpeTACl in a plurality of trees and cultivars such as Prunus domesitac (European plum), Prunus persica (peach), Prunus armeniaca (apricot), Prunus salicina (Japanese phun), Prunus mume (Chinese plum), Prunus amygdalus, (almond), Prunus avium (sweet cherry), and Prunus cerasus (sour cherry).

Agrobacterium-mediated Transformation

[0074] Agrobacterium-mediated gene transfer exploits the natural ability of

Agrobacterium to transfer DNA into plant chromosomes. As is well known in the art, Agrobacteri m is a plant pathogen that can transfer a set of genes into plant cells. In some embodiments of the presently disclosed subject matter, immature Prunus cells can be transformed using Agrobacteri n tumefaciem.

[0075] Those skilled in the ait will appreciate that the disclosed methods apply equally well to Agrobacterium rhisagenes. Transformation using Agrobacterium rhisogenes has developed analogously to that of Agrobacterium t mefaciens and as been successfully utilized to transform plants, including but not limited to, alfalfa, Solatium nigrum L., and poplar. See, for example. Hooykaas, Plant Mo!. Biol, (1989) 13: 327: Smith et ai. Crop Science (1995) 35: 301 (1995); Chilton, Proc. Nad. Acad. Sci. USA (1993) 90: 3119;

Mollony et al. Monograph Theor. Appl. Genet .¥7(1993) 19: 148; Ishida et al. Nature

Biotec nol. (1996) 14: 745 (1996); and Komari et al. The Plant Journal (1996) 10:165

(1996), the disclosures of which are incorporated herein by reference,

[0076] For Agrobacterium-mediat d gene transfer, wounding of the explant tissue can be used to facilitate gene transfer. Accordingly, in some embodiments, a wound can be created in the explant tissue. The Agrobactetium-m&dia.ted transformation process of the presently disclosed subject matter can comprise several steps. The basic steps can include, but are not limited to. an infection step and a co-cultivation step. In some embodiments, these steps are followed by a selection step, and in some embodiments, by a selection and a regeneration step, as discussed in detail herein below.

[0077] In the infection step, plant ceils to be transformed are exposed to Agrobacterium. In some embodiments, the cells are brought into contact with die Agrobacterium in a liquid medium. Alternatively, in some embodiments, the ceils are brought into contact with the Agrobacterium in a solid medium. In some embodiments, the Agrobacterium can be modified to contain a gene or nucleic acid of interest, wherein the nucleic acid can be inserted into genetic construct, which can comprise a piasmid or other suitable vector.

[007SJ A number of vectors suitable for stable transfectlon of plant cells or for the establishment, of transgenic plants have been described in, e.g.. Pouwels et ai 1985. Supp. 1987. Cloning Vectors: A Laboratory Manual; Weissbach and Weissbach. 19S9. Methods for Plant Molecular Biology, Academic Press, New York: and Flevin et al. 1990. Plant

Molecular Biology Manual, Kluwer Academic Publishers, Boston. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, enviioimientaliy- or developmentaiiy regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription temimation site, and/or a polyadenyiation signal,

[0079] The term "prornoter" refers to a nucleotide sequence capable of controlling the expression of a coiling sequence or functional RNA . In gener al a coding sequence is located 3' to a promoter sequence. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an

"enhancer" is nucleotide sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at differ ent stages of development, or in response to different environmental conditions. The tissue specificity of a promoter, for example, is exemplified by the promoter sequence which specifically induces gene expression in plant tissues including vegetative buds, stems, vascular' tissues, apical nieristems, lateral meristems, roots, root meristenis, fruit and flower buds. Promoters that cause a nucleic acid fragment to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg, 1 89, Biochemistry of Plants 15: 1-82. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, nucleic acid fragments of different lengths may have identical promoter activity.

[0080] As used herein, the term "horizontal orientation" refers to the overall branch orientation of a plant.

[0081] As used herein, the term 'Vertical orientation" in reference to a plant refers to the branch orientation of a plant. To the extent that a plant or tree is re ferenced to ha ve a "pillar" orientation in the a t, as used herein, said plant or tree is referred to having a "'vertical orientation^"".

[0082] In an embodiment of the invention, targeted cleavage events can be used, for example, to induce targeted mutagenesis , induce tar geted deletions of cellular DNA sequences, and facilitate targeted recombination and integration at a predetermined

chromosomal ppTAC or ppeTAC locus. Techniques of nucleotide editing can be found for example, Urnov et al. (2010) Nature 435{7042):646-51; United States Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060188987; 20090263900; 20090117617; 20100047805; 20110207221: 20110301073: 2011089775; 20110239315: 20110145940: and International Publication WO 2007/014275, the disclosures of which are incorporated by reference in their entireties for all purposes. Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription- activator like effector nucleases (TALENs), or using the CRISPR/Cas system with an engineered crRNA/tracr RNA (^"single guide RNA ) to guide specific cleavage. U.S. Patent Publication No. 20080182332 describes the use of non-canonical zinc finger nucleases (ZFNs) for targeted modification of plant genomes; U.S. Patent Publication No.

20090205083 describes Z N-mediated targeted modification of a plant EPSPS locus; U.S. Patent Publication No. 20100199389 describes targeted modification of a plant ZplS locus and U.S. Patent Publication No. 20110167521 describes targeted modification of plant genes involved in fatty acid biosynthesis. In addition, Moehle et ai. (2007) Proc. Natl. Acad, Sci. USA 104(9)3055-3060 describes using designed ZF s for targeted gene addition at a specified locus. U.S. Patent Publication 20110041195 describes methods of making homozygous diploid organisms.

[0083] For example, a ppTAC or ppeTAC-specific DNA recognition and cleavage protein may be, for example and without limitation, a ZFN; a TALEN: RNA-guided CRISPR-

Cas9, a recoinbinase (e.g., Cre, Hin, RecA, Tre, and FLP recombinases); a meganuclease, and an engineered protein derived from any of the foregoing or their equivalents. Cleavage may also be eiiected using the CRISPR/Cas system with an engineered crRNA racr RNA (single guide RNA) to guide specific cleavage.

[0084] The following Examples have been included to illustrate representative and exemplary modes of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the ait, those of skill will appreciate that the following

Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the spirit and scope of the presently disclosed subject matter.

EXAMPLE 1: SEQUENCE-BASED MAPPING OF Br using pnomes

[0085] To identify the polymorphism responsible for the vertical trait from peach tree populations. A strategy for simultaneous genetic mapping and candidate gene identification using next-generation sequencing of pooled genomes, dubbed "pnoines" was utilized. The puomes stra tegy is based on sequencing a populations) of segregating individuals pooled by a specific trait(s). In theory, the linkage of individual polymorphisms to a trait of interest should be measurable by calculating the abundance of each polymorphism within a given pnome assembled against a reference genome. Tightly linked polymorphisms should occur at high frequency in the pnonie containing the trait while those same polymorphisms should be rare or absent in the pnome lacking the trait, and vice versa. Consequently, whe graphed by nucleotide position, the data should produce a beli-shaped curve delineating the location of the trait. A schematic describing the pnome strategy is depicted in FIG. 2. To test the efficacy of the puomes strategy, DNA was extracted from 27 standard stature trees and 56 vertical individuals derived from an F2 segregating population.

Peach Tree Populations

[0086] Two sources of br were used in this study. 'Italian Pillar" was obtained as pollen from the Institute Sperimentale per la Fnitticohura, Forli, Italy. "New Jersey Pillar" represented a different source of the br gene and was obtained from Japan through Rutgers University (Scorza, R., Bassi, D. and Liverani, A._t 2002, J. Amer. Soc. Hort. Sci. 127(2), 254- 261. While both sources of br expressed the vertical growth habit they differed in flower and fruit characteristics (Id). For pnome mapping, an F2 peach (Primus persic ) population of over 200 individuals segregating for the vertical trait was used. This was derived from selling an Fl individual which was a progeny of an F0 cross between the vertical cultivar "Crimson Rocket' and the doubled haploid variety "True Gold¹ that has a standard

architecture. 'Crimson Rocket' was derived from "Italian Pillar" germplasni

(http://ddr.nal.usda.gow The trees were phenofyped and leaf tissue was collected from select 4 year old trees in which the vertical and standard phenotypes were most apparent. Fine mapping was performed using trees from several different segregating populations in which the vertical trait was derived from 'Italian Pillar' . From these, 157 vertical trees were chosen based on their having a clear vertical phenotype. Standard and upright individuals were not used for fine mapping due to the inability to accurately phenotype them. [0087] These DNAs were subsequently combined into two pools (standard and vertical) for pnome sequencing. Genomic DNA was extracted from liquid nitrogen treated ground leaf samples with the E.Z.N.A.™ High Performance (HP) DNA Kit (Omega Bio-Tek Inc.

http://www.omegabiotek.com). Modifications to the Frozen Specimens protocol were the additio of 2% PVP-40 (w/v) to Buffer CPL and the optional addition of 2-mercaptoethanol. The fluorescent dye, PicoGreen was used to obtain a more specific double stranded DNA measurement utilizing the Quant-iT PicoGreen kit (Molecular Probes, Inc., Eugene, OR), The reactions were set up according to the manufacturer's directions with each 100 ul reaction containing 40-400 ng of leaf DNA as determined by Nanodrop spectrophotometer readings. A second set of reactions was set up with 0.1X leaf DNA. Standard curves were ran simultaneously that ranged from 0 to 250 ng of lambda DNA included in the kit. All reactions were run in duplicate in a 96 well microliter plate. The reactions were allowed to proceed for 5 m n in the dark and were then read utilizing a Cytofluor 000 TR (Applied Biosystems, Inc., Foster City, CA). Standard curves were constructed from the lambda DNA readings and the leaf DNA concentra tions were obtained from the curves. The readings ranged from 18% to 72% of the Nanodrop readings. Those Resulting DNA samples were combined in equal molar ratios to generate the vertical and standard pools for pnome sequencing.

[0088] The two DNA pools were sequenced via Illumina 100 bp paired-end reads to an estimated coverage of 2X and 1.6X (relative to the number of genomes in each pnome), respectively. Next, the vertical and standard reads were separately assembled against the peach genome [Sosmski et al, in preparation; sequence available at

http: /\vww Josaceae.org peach genorne] using CLC Genomics Workbench Software (CLC Bio, Aarhus, Denmark), Default parameters were used and non-specific reads were excluded from mapping. SNPs and DIPs were identified from each pnome assembly using the respective CLC tools. Default parameters for S P DIP significance were changed as follows: minimum coverage and paired coverage set to 20, maximum coverage set to 500. minimum variant count required set to 20, maximum expected variations set to 2. SNP/DIP frequency is automatically calculated by the software based on the number of high qualify reads in which each polymorphism occurs relative to the total number of high quality reads that span that nucleotide position. To compare the vertical vs. standard SNP DIP datasets, t ey were each filtered to remove invariant SNPs/DIPs, unlinked SNPs/DIPs, and artifacts arising from assembly errors. Filtering was performed as follows: 1 ) SNPs/DIPs with the same variant allele (relative to the reference) occurring at a frequency >75% in both the vertical and standard pnomes were removed. These largely represent non-segregating polymorphisms that only occur relativ to Loveil genome. 2) SNP DIPs with a valiant frequency below 75% were removed from each dataset to eliminate unlinked polymorphisms. 3) The remaining SNPs and DIPs were manually verified by inspection of the corresponding sequence assemblies to eliminate artifacts arising from assembly differences.

[0089] To create an allele frequency map, the frequency of all SNPs/DIPs in the piiome from which they were absent or at low abundance was calculated. Next, the inverse

frequencies from the opposing piiome were calculated. The datasets were filtered again based on the frequency scores of the inverse pnome (removed if less than 75%) , The two frequencies were then averaged to get a single frequency value. This additional step captures segregation data for all SNPs/DIPs in both pnomes providing a more robust frequency estimate. The resulting average SNP/DIP frequencies were graphed by reference nucleotide position to gener ate the allele frequency map. After mapping, a low threshold SNP/DIP search was done within the mapped region to identify those that may have been missed during the initial, more stringent searches. The low stringency sear ch parameters used were : m iimum coverage and paired coverage set to 10, maximum coverage set to 500, minimum variant count required set to i 0, maximum expected variations set to 2. This additional step only captured 3 polymorphisms which had been excluded by the initial more stringent searches in Tabie 1.

TA.BLE 1

77.8% 73.4% 7S.1%

83.3% 7S.5% 79.9%

76.6% 80.0% 7S.3%

77.3% 75.9% 7S.9%

77.4% 77.5% 77.5%

75.4% 753* 75.4%

75.0% .0¾ 76.0%

7S.6% 75.0% 75.8%

79.5% 77.6% 7S.S%

S1,0% 79.4% SO .2%

76,9% 75.0% 76.0%

87.8% 80.6% 84.2%

87.5%. 81.8% 84.7%

75.0% 75.7% 75.4% <·..;>¾ 75.5% 75.8%

75,3% 76.0% 75.7%

75,7% 84.2% 80.0%

73.3% 75.0% 77.2%

80.4% 77.1% 73.8%

78.4%. 77.1% 77.8%

75.0% 77.3% 76.2%

75.0% 7S.0% 75.5%

76,3% 75.0% 75.7%

76,2% 78.4% 77.3%

76.7% 75.7% 7S.2%

80.7% 76.0% 73.4%

78.7%. 76.9% 77.8%

82.1% 75.3% 78.7%

78.3% .80.0% 79.2%

75,4% 75.0% 75.2%

75,0% 76.3% 75.7%

75.3% 82.4% 79.1%

77.1% 82.0% 79.6%

76.0%. 7S.4% 77.2%

77.4%. .8% 77.6%

77.4% 73.2% 77.8%

81.8% 7S.0% 7S.9%

77,5% 77.0% 77.3%

80.0% 76.8% 73.4%

80.0% 75.9% 73.0%

78.0%. 7s.a% 78.4%

77.8%. 7S.7% 78.3%

77.8% 73.3% 7S.1%

77.8% 79.6% 7S.7%

82.9% 81.8% 82.4%

82,1% 81.8% 82.0%

75.0% 77.3% 7S.2%

71 79.3% .85,7% 82.5%

75.4% 79,5% 77.5%

S4,4% 77.5% Sl.0%

85.2% 78.1% .81,7%

78.3% 80.4% 79,7%

77.6% so.o% 78.8%

76.5% 75.0¾ 75.8%

78.1% 77,1% 77.6%

77.3% 75,3% 76.6%

75,0% 75.6% 75.3%

76.7% 7S.2% 76.5%

77.2% 7S.3% 76.8%

75,4% 76.5% 76.0%

S3, % 81.8% 82.8%

83.7% 81.4% .82,6%

75.4% 76.6% 7S,0%

77.6% 5.9% 76.8%

77.5%. 77.4% 77.5%

78.4% 7S.7% 77.6%

76,9% 86.7% 81.8%

78,6% 76.5% 77.6%

75.0% 75.0% 75,0%

76.8% 76.5% 7S,7%

79.6% 76.9% 78.3%

75.5%. 75.4% 75.5%

77.1% 77,1% 77.1%

76,3% 80.4% 7S.4%

S1,0% 83.7% 82.4%

86.7% 80.0% .83,4%

80.0% 81.5% 80,8%

78.9%. 81.5% 80.2%

83.8%. .8% 80.8%

80.0% .80,0% 80.0%

79.0% 73,7% 78.9%

75,0% 78.0% 76.5%

75.4% 75.0% 75,2%

78.6% 76.2% 77,4%

82.5%. 80.4% 81.5%

75.7%. 7S.1% 77.4%

75.S% .82,8% 79.3%

77.0% 79,6% 78.3%

77,0% 77.6% 77.3%

77,4% 75.6% 76.5%

73.0% 76.1% 77,6%

75.5%. 75.0% 75.3%

77.6% 7S.0% 77.8%

77.2% 77,4% 77.3%

77.3% 7S,7% 77.0% 79.4% 75.5% 77.5%

80.3% 80.8% 80.5% 78.6% 78.3% 7S.5% 77.2% 78.3% 77.8% 77.1% 84.0% 80.6% 75.6% 7S.7% 77.2% 75.7% 7.9% 76.8% 7S.3% 75.0% 75.7% 75.7% 80.8% 78.3% 75,0% 75.0% 75.0% 78,1% 77.8% 7S.0% 73.7% 75.4% 77.6% 78.4% 77.3% 77.3% 76.6%. 76.9% 76.8% 75.4% 73.6% 77.0% 75.0% 75.8% 75.4% 76,0% 77.1% 76.6%

77.8%. 80.0% 78.3%

77.4% 77.5% 77.5% 77.8%. 76.7% 77.3% 85.7%. 34.0% 84.3% 75.0% 79.8% 77.4% 76,3% 78.1% 77.2% 75,7% 78.1% 76.9% 76.4% 83.3% 79.3% 75.0% 80.0% 77.5% 75.0% 80.0% 77.5% 80.0%. 86.5% 83.3% 78.7% .83.2% 83.5% 75,0% 76.5% 5.8% 75,0% 82.6% 7S.8% 75.0% 75.0% 75.0% 75.3% 75.0% 75.5% 80.5%. 80.0% 80.3% 75.9%. 76.9% 76.4% 75.0% 76.3% 76.0% 75.0% 76.5% 75.8% 81.8% 85.2% 83.5% 73.1% 75.4% 77.3% 75.8% 78.3% 77.1% 81.2%. 75.0% 78.1% 80.0%. 75.0% 77.5% 75.9% .83.3% 79.S% <·.. !¾ 79.7% 77.9%

S1,0% 80.0% 80.5% 75,8% 77.3% 76.6%

75.0% 79.4% 77.2% 81.1% 75,0% 7S.1%

7S.B% 73,8% 7S.8%

75.0% 78.3% 76.7%

83.7% 77 .80,4%

77.4% 80.4% 73,9%

77.6% 7S 78.5%

76.3% 77.0¾ 76.7%

76.3% 80,6% 7S.S% S% 77,9% 77.9%

78.2% 78.6% 7S.4%

75,0% 77.1% 76.1%

77.6% 76.9% 77,3%

75.5% 75.0% 75.3%

81.2%. 30.8% 81

78.8% 79,6% 79.2%

73,8% 7S.0%

75.4% 30.0% 77.7%

S4.6% 31.0% 82.8%

80.4% 80,5% 80.S%

76.4% 76.3% 76.4%

75.0% 82.3% 79.0%

80.0% 92.7% .86.4%

77.4% 76.6% 77,0%

83.5%. 7S 84.3%

78.6%. 31.4% 80

77.8% 75,3% 76.6%

S2.9% 78.3% 30.9% ao.6% 79.2% 7S.9%

78.9% 76.8% 77.9%

76,9% 87.0% 82.0%

75.5% 39.8% 82.7%

76.3% 77.6% 77

80.0% 77,2% 7S.S%

77.8% 77,8% 77.8%

78,9% 77.0% 7S.0%

75.0% .8% 76.9%

77.1% 81.6% 79.4%

76.6% 7.9% 77.3%

S2.1 30.6% 81.4%

82.4% 75,6% 79.0%

76.0% 79 77.7%

76.7% 7.8% 77.3%

79.5% .82,4% 81.0%

75.0% .86.7% 80.9%

75,0% 86.7% 30.9%

75,7% 92.1% 33.9% 76.7% 96.7% .86.7% SNP 77 83.2%

SNP 79.1% 81.2%

DfP 80.1%

J A .81.6%

76.3%

SNP T c 76.7» 77.1%

SNP & 73.5%

SNP e 81.0%

SNP 83.9% c 86.5%

84.4% 79.5%

SNP A 78.0%

SNP 73.0%

SNP c 76.9%

SNP 80.7%

A 81.4%

7S.3%

A 75.8%

SNP 73.8%

SNP c 77.8%

SNP c 80.2%

SNP c 73.S%

T c 84.6%

85.5% c 79.4%

Vai 32i

10833636 SNP C T 59 74 e 79,7% 77.0% 7S.4%

11111 ^10833343 SNP C G 62 81 76,5% 76.0% 76.3%

10834900 SNP G T 53 69 76.8% 7S.9% 77.3%

Wj&i 1194552S SNP C T 62 .82 75.6% 77.1% 76.4% 12666240 SNP c A 34 45 75.6% 87.9% 81.8% iSBsf 12776159 SNP G A 30 35 85.7%. 76.5% 81.1%

¾B¾T 13141873 SNP G T 51 60 85.0% .81.8% 83.4%

¾B¾T 13367722 SNP G T 101 126 80.2% LVALUE ! 80.2%

!Ksifca- 13 (67727 SNP A c 101 132 76,5% 84.0% 80.3%

WjSSi 13763233 SNP A c 58 72 80.6% 73.5% 80.1%

Wj&i 1377219S SNP G A 64 .82 78.0% 83.3% 80.7% iSBsf 137S0242 SNP T c 44 53 83.0%. 77.6% 80.3% iSBsf 137S6412 SNP A c 29 37 78.4%. 75.0% 76.7%

¾B¾T 13797328 SNP T A 26 32 81.2% .86.4% 83.8%

¾B¾T 13815018 SNP A T 41 51 80.4% 75.0% 77.7%

!Ksifca- 1 S815439 SNP T c 44 56 78,6% 77.6% 7S.1%

3¾!Sar 1 S817350 SNP T c 46 54 85.2% 77.8% 81.5%

WjSSi 138281 SS SNP G A 40 49 81.6% 80.0% 80.8% iSBsf 13831534 SNP G A 61 77 73.2%. 75.4% 77.3% iSBsf 13840465 SNP G T 54 66 81.8%. 86.2% 84.0%

¾B¾T 13858848 SNP C e SI 63 88.4% 73.6% 83.5%

¾B¾T 13863336 SNP A e 37 46 80.4% 76.2% 7S.3%

32 37 86.5% 90.6% 88.S%

33 3S 86.8% 90,6% 88.7% 34 as S7.2 90.6% SS.9% 32 39 82.1% 90.S .86,4% 27 34 73.4% 90.5% .85,0% 28 34 82.4% SO .6% 86.5% 53 64 82.8% 34.0% 88.4% 3S 41 32.7% .89,6% 91.2% 46 50 92.0% 95,0% 93.5% 36 44 81.8% 97.0% 89.4% 30 35 85.7% 92.5% 89.1% 37 41 30.2% 93.0% 91,6% 34 38 83.5%. 87.9% 88.7% 31 36 86.1%. 87.3% 86.7% 2S 33 84. S% 91,4% 88.1% 35 39 89.7% .89,1% 89.4% 29 33 S7,9% 86.0% 87.0% 31 35 ss,e% 85.4% 87.0% 23 34 85.3% 85.4% .85,4% 33 38 86.8%. si. as 89.3% 35 39 83.7%. 36.7% 93.2% 37 89.2% 96,8% 93.0%

63 90,5% 86.6% 8S .6%

26 32 81.2% 96.8% .89. .0% 21 26 80.8% 88.7% 84. .8% 21 26 80.8%. 8S.7% 84. .8% 38 42 30.5%. 36.6% 93. .6% 41 47 87.2% .88,3% 87 .8% 41 47 S7,2% 88.7% 8S .0% 27 92,6% 82.3% 87 .8% 45 84.4% 89.8% .87. .1%

53 66 80.3% 96.1% .88. .2% 29 33 87.9%. 31.7% 89. .8% 32 36 88.9%. SS.7% 88. .8% 2S 32 87.5% 93,0% 90 .3% 32 37 8S.5% 92,3% 89 .4%

S3, 3% 92.3% 8S .1%

44 84.6% 91.7% .88. .2% 43 51 36.1% 91.0% 93. .6% 29 37 78.4%. SS.9% 83. .7% 43 49 87.8%. 34.2% 91. .0% 41 51 80.4% 90,4% 85 .4% 51 56 91.1% 93,7% 92 .4% 50 65 S7,0% 83.1% 85 .1% 60 64 93,8% 91.0% 32 .4%

41 46 89.1% 92.8% 91. .0% 88.7% 82.7%

84.8% 92.5% 88.7% S6.0 90.5% 85.3% 87.3% 91.8% 89.6% 86.0% 90.5% .88.3% 84.7% 87.4% 86.1% 85.2% 87.4% 86.3%

88. S% 85.7%

91.4% 87.2% 89.3% 81.7% 86.2% .84.0% 89.8% 94.8% 92.3% 75.9%. S2.6% 84.3% 84.7% 91.5% 88.1% 88.4'S 93.5% 91.0%

82.0% Sl.3% 86.7% 75.0% S3.6% 84.3% 87.5% .85.5% 86.5% S7,7% 85.5% 86.6% S6.7% 86.5% 86.6% 82.2% 90.5% .86.4% 36.3% 90.3% 93.6% 86.0%. 95.OS 90.5% 36.0%. 85.4% 92.2% 84.6% 100.0% 92.3% 8S.2% 93.3% 89.8%

32.3%. SS.5% 95.4% 9S.O% 92.5% 95.3%

31.6% 100.0% 95.8% 38.5% 95.IS 96.8% 93.8% 91.3% 92.6% 100.0% 79.6% 89.8% 93,8% 94.2% 94.0% 91,5% 100.0% as. as

100.0% 95.2%

87.7% 95.2%

36.3% 90.9% 93.6% 35.9%. 91.5% 93.7% 35.3%. 95.4% 95.4% 94.6% 95.7% 95.2%

33.6% 9S.7% 95.2% 36.9%. 36.4% 91.7% 97.1% .86.0% 91.6%

84.7% 91.5% 88.1%

[0090] Structural variation analysis was performed using the CLC Genomics Workbench tool. A 5Mb region (17Mb-22Mb) from both the vertical and standard pnome assemblies was extracted and used for the input. Default parameters were used and mterckroinosoinal variation was excluded. The results were compared and filtered as described above.

[0091] Next, the pnomes were separately assembled against the peach genome (Verde et al._s 2013, Nat Genet., doi: 10.1O38/ng.25S6) and subjected to pnome-wide Single Nucleotide Polymorphism (SNP) and Deletion Insertion Polymorphism (DIP) sear ches using CLC

Genomics Workbench software (CLC Bio. Aarhus, Denmark). Approximately 300,000 SNPs and 36,000 DIPs were identified from both pnomes and filtered to identity linked

polymorphisms. After filtering, a total of 487 SNPs and 23 DIPs remained and all were located on scaffold 2 (Table I). The resulting average SNP/DIP frequencies were graphed by reference nucleotide position to reveal the physical location of the br gene responsible for the vertical trait (FIG. 3) , The apparent unequal distribution of polymorphisms across scaffold 2 resulted in tight clusters of SNPs DIPs unique to either the standard or the vertical pnomes. Still, the collective results showed a bell-shaped curve with a peak near the distal end of scaffold 2„ position 20.0 Mb. A linkage cluster was also identified on the proximal end of scaffold 2, however; tins region was excluded from further analysis as it showed a relatively lower level of linkage. Poiyinorphisms in fee mapped region were rare with only i 5

SNPs/DIPs identified within a 2Mb interval. The defined position was consistent with previovis vertical mapping studies which had positioned fee trait on the distal half of scaffold 2 (Chaparro, J.X., et al„ 1994, Theor. Appl Genet. 87, 805-815; Sosinski B., et al., 2000, Theor. Appl. Genet. 10L 421-428: Sajer, O.. et al., 20 Ϊ .1 , Plant Breeding, 131 : 186-192).

[0092] To confirm and further narrow the interval, seven HRM (High Resolution

Melting) SNP markers spanning the region from 17.4 Mb to 23.1 Mb were designed from the pnonie polymorphism data and tested on all 83 F2 individuals (56 vertical, 27 standard). Primers were designed from the pnonie sequence to have an annealing temperature of 60°C. These are presented in Table 2. The HRM technique was performed in a single run on a LightCycIer 480® (Roche Applied Science, wwwj.Oche-applied-science.com) in a reaction mix containing 2.5 ng of genomic DN A, 2 nM of each primer, and IniM MgCl₂ in the

LightCycIer 480 High Resolutio Melting Master Mix with PCR-grade water adjusted to a total volume of lOuL. The reaction conditions included an activation step at 95°C for 10 min followed by 50 cycles of 95°C for 15s, 60°C for 15s, and 72°C for 15 s. Before the HRM step, the products were heated to 95oC for 1 min and cooled to 40°C for 1 min. HRM was carried out over the range from 65°C to 95°C, rising at 1°C per second with 25 acquisitions per degree. All reactions were performed in 384- well microtiier plates. Individuals were scored based on their melting curve profiles relative to parental homozygous and heterozygous controls .

[0093] The results confirmed fee accuracy of the allele frequency graph as the identification of recombinant individuals narrowed the causative polymorphism between positions 19.349 and 20.128 Mb (FIG. 3). Within fee mapped internal, only two vertical SNPs remained, located at positions 19.526 Mb and 19.566 Mb, neither of which fell within or near annotated genes or predicted open reading fr ames. Based on fee results, we hypothesized that the causative polymorphism could be a larger structural anomaly not revealed by the SNP or DIP searches. To assess this, we utilized the CLC Genomics Workbench- Structural Variation Detection tool to identify potential insertions, deletions, or rearrangements within a 5 Mb segment spanning the mapped interval (17.000 Mb and 22.0G0 Mb). A total of 95 putative structural polymorphisms were identified and filtered using the same method described for S Ps DIPs. Ninety of the identified structural variations were found to be assembly artifacts arising from hornopolymer or short repetitive regions. After filtering, 5 putative insertion events remained; 3 enriched in the standard pnome and 2 within the vertical pnome. Only one of the events specific to the vertical pnome fell within the mapped interval. It consisted of a putative insertion element that could be ascertained by the presence of unaligned flanking sequences on both ends of stacked reads. This insertion event had the highest vertical pnome frequency of all identified polymorphisms.

[0094] The putative insertion was located at position 19,659,067 bp and fell within the 3rd exon of the predicted gene Ppa010QS2, annotated as encoding an unknown protein. The insertion sit Pp 0100S2 was marked by a short nucleotide repeat (GAT x 7) within exon 3 that encodes a contiguous stretch of aspartic acid residues. Marker PI 9.659. that was designed to flank the insertion, confirmed mat the element was present in all 56 vertical individuals and in none of the 27 standards. This marker along with HRM markers at positions PI 9.652 and P20.128 were tested on an additional 157 vertical individuals derived from several segregating populations with similar pedigrees to confirm the location. No recombinant, wer found for either the P19.652 or PI 9,659 markers. In contrast,. 3 recombinants were identified for the P20.128 marker. Collectively, the pnome and marker mapping data excluded all but two SNP polymorphisms neither of which fell within or near gene sequences, indicating that the insertion event within PpaO 10082 was highly likely to be the causative polymorphism for the vertical trait. [0095] Ppa010082 was found to encode a predicted protein of 302 amino acids which was confirmed by the amplification of an approximately 900 bp band using RT-PCR and subsequent sequencing of the PCR product. Translation of the gene in vertical containing the insertion element in vertical results in a premature stop codon at amino acid position 102. Translation initiation from the 3' end of the insertion element leads to stop codons in all three reading frames prior to the resumption of the Pp OlOOSl coding sequence. BLAST analysis of PpaOlOQS '2 indicated that it is present in diverse plant species and occurs most often as a single or low copy gene. Due to the similarities between TAC1 and Ppa010Q82 the peach orthologue was named PpeTACI and indentified as SEQ. ID. NO: 1.

EXAMPLE 2: PpeTACI gene expression

[0096] To determine the expression pattern of PpeTACI . qPCR studies were performed using a set of tissue samples collected from both vegetative and reproductive tissues of the standard growt habit doubled haploid ctiltivar 'True Gold' at various stages of growth and development (FIGS. 4A-C).

[0097] R A extraction and qPCR was performed as previously described by Dardick et al. 2010, . BMC Biol. 9, 8-13 and incorporated herein by reference. Briefly; each reaction was run in triplicate using 50 ng of RNA in a 15 ί reaction volume using the Superscript III Platinum SYBR Green qRT-PCR Kit (Invitrogen, http:/ www.mvitrogen.com). The reactions were performed on a 7900DNA Sequence detector (Applied Biosystems,

www.appliedbiosystems.com). Quantification was performed using a relative curve derived from a standard RNA ran in parallel, A primer set designed to amplify 26S ribosomal RNA was ran on all samples and used to normalize the data. A dissociation curve was ran to verify that a single desired amplified product was obtained from each reaction. Primers used for PpeTACI qPCR and for amplification of full length transcript are presented in Table 2. [0098] Significant expression was observed in axillary tissues including vegetative beds, branch nodes, apical meristems, yoimg fruit and flower buds. The high expression level of PpeTACI in flower buds is consistent with the nearly plagiotropic growth of the flower pedicels in standard trees compared to the narrow growth angles in the vertical mutants where the flower pedicels grew nearly parallel with stems (FIG. 4B). Interestingly, PpeTACI shows a relative high level of expression in attachment sites of actively growing branches where its role in the control of vertical branching orientation versus horizontal branching orientation may be required, to contrast very low relative expression levels of PpeTACI were observed in mature or dormant tissues suggesting it is specific to actively growing tissues (FIG. 4A). Collectively, these data indicate that PpeTACI is specifically expressed within or near actively growing axillary vegetative and reproductive tissues.

[0099] To assess the spatial expression patterns of TAC1, the primary shoot and all lateral shoots of five week old mature Arabidopsis plants and 12 week old peach seedlings were dissected into terminal,, central, and basal sections and subject to qPCR analyses (FIG. 6). Results showed that TAC i expression patterns are similar in both peach and Arabidopsis as expression was predominately in the apical shoots and the upper sections of the main stem and as well as in the upper laterals, hi contrast lower lateral shoots and the basal sections of the main trunk showed little or no expression. TAC I expression was most prevalent in and near the apical meristems

[00100] To test whether PpeTACI gene expression is altered in vertical cuitivars, transcript levels were measur ed via qPCR. RNAs were extracted from branch attachment sites collected from one year old field grown shoots of vertical, tipright, and standard stature trees. PpeTACI transcript could not be detected in either 'New Jersey Pillar' or 'Italian Pillar'. Similarly, transcript levels in the heterozygous upright trees were reduced relative to standard controls (FIG. 4C). [ΟΟίΟΙ] The lack of expression in 'NJ Pillar' prompted us to assess whether this cultivar possessed the same insertion element found in "Italian Pillar' . Pieviovis mapping studies had positioned the 'NJ Pillar trait to the same region (Sosinski B., et ai, 2000, Theor.

AppI.Ge.net. 101, 421-428). The results of mapping studies were confirmed through hybridization tests for allelism which indicated that the same locus was responsible for the vertical trait in 'NJ Pillar' and 'Italian Pillar¹ (Sosirtski B., et at, 2000, Theor. Appl.Genei. 101, 421-428).

[00102] A 3kb genomic fragment of PpeTACl was PGR amplified and sequenced from 'NJ Pillar'. Surprisingly, the insertion element present in 'Italian Pillar¹ was not found. Instead, PpeTACl in ^''NJ Pillar' contained four novel SNPs within the 3^rd and 4^th introns (FIG. 4D). While none of the SNPs showed obvious deleterious impacts, one SNP was located at a position near the predicted intron 3 donor splice site and could potentially lead to transcript instability.

Example 3: Transformation of Plum species

Silencing of PpeTACl in plum.

[00103] PpeTAC 1 specific primer sequences [ 5'- TGGGTTTGCTGGGAATGTGA -3' (SEQ. ID. NO. 22)1 ^mA [Rev 5^*- CAGCTGGTTTCTGAACAATGGC -3' (SEQ. ID. NO. 23)] were used to PCR amplify a 300 base pair cDNA fragment from peach genomic DNA. The resulting fiagnient was cloned into the pENTR-D TOPO (mvitrogen) vector per manufacturer s specifications and sequenced for verification. An RNAi silencing vector was created using Gateway recombination technology (Mvitrogen). PpeTAC 1_300 pENTR-D TOPO was recombined with pHellsgate 8 (Commonwealth Scientific and Industrial Research Organisation (CSIRO), Australia) to create PpeTAC 1-HG. This construct contains an inverted repeat of the 300bp PpTAC 1 fragment separated by an Arabidopsis t alkm pyruvate dehydrogenase kinase (PDK) intron. This arrangement is driven by a 35S promoter and is transcriptionally terminated by an octopme synthase (OCS) terminator. Expression of the resulting hairpin induces R Ai silencing and results in suppression of the native Primus TACl gene.

[00104] Plum transformation was performed as previously reported in Petri et al., 2008, Mol Breeding 22: 581-591 2008 and incorporated herein by reference. Using Agrobacterium mediated transformation of plviiii hypocoryl slices, four independent transgenic plum lines were obtained, two of which exhibited phenotypes identical to the peach pillar phenotype (FIG. 7). Such vertical growth habit is not known to occur in Primus domestica germplasm. Over-expression of PpeTACl iit plum.

[00105] PpeTACl specific primer sequences [For 5' -

GAATTCAATTCGCTCACAAAATATGAAG -3' (SEQ. ID, NO. 25)] and (Rev 5' - CCTTGTGTGCACTGAATTAAGGATCC -3' (SEQ. ID. NO. 26)] were used to PGR amplify the full length PpeTACl coding sequence from peach RNA purified from apical shoots. The resulting fragment was cloned into a modified pBIN-ARS vector behind the Cauliflower Mosaic Virus 35S promoter. The resulting construct (called PpeTACl-OE) was transformed into Agrobacterium tumefaciens for subsequent plum transformation.

[00106] Plum transformation was performed as previously reported (Petri et al., 2008) using Agrobacterium mediated transformation of plum hypocotyl slices. Two independent transgenic plum lines were obtained, both of which exhibited wide angle lateral shoot growth (FIG. 7).

Branch angle measurements.

[00107] To confirm that PpTACl silencing and over-expression alters lateral branch angles in plum, measurements of vegetatively propagated transgenic lines were taken on 1 year old greenhouse grown trees. Branch angles were quantified using a compass with 90° representing branches growing at right angles and 0° representing absolute vertical growth. Mean branch growth angles in 2 PpeTAC-HG lines, 2 PpeTAC-OX lines, and 2 control lines are shown in FIG. 8. Lower case letters designate statistically significant groups (P- value <Q.G5) derived from pairwise T-tests and ANOVA. Collectively the results confirm that, silencing of PpeTACl produces a more upright tree form (branch angle <22°) while over- expression of PpeTACl leads to wider branch angles (branch angle >50°).

Gene Expression

[00108] To confirm silencing or overexpression of PpeTACl in transgenic plums, realtime quantitative polymerase chain reaction (qPCR) was performed on plum transgenic and control lines (FIG. 9). Total RNA was extracted from apical shoots of 1 year old, greenhouse grown plants using the SQ Total RNA Extraction Kit (Omega Biotech, Norcross GA) per manufacturer's instructions. qPCR from total RNA was performed using the CYBR Green One -Step qPCR Kit (Invitrogen, Carlsbad CA) and ran in an ABI 7900HT Sequence Detection System. Each reaction was ran in triplicate using 50ng of RNA. Three

independent vegetatively propagated plants from each line (PpeTACl HG2, PpeTACl HG6, PpeTACl OE1, and PpeTACl OE2) were tested. Quantification was performed using a relative curve derived from a serially diluted standard RNA ran in parallel. A dissociation curve was run to verify that a single desir ed amplified product was obtained from each reaction. The PpeTACl primers used (For 5'— TTTGC^'CAAGAAACTCATCCCTCGC: (SEQ. ID. NO. 18) and Rev 5' -GCTGCTTCTGGCCATCTGATTTGT (SEQ. ID. NO. 19)) were designed to amplify both the PpeTACl transgene and the native plum TAC1 gene. FIG. 9 shows the normalized relative gene expression value for each transgenic line. The results confirm that TAC 1 gene expression is repressed in the transgenic lines containing the RNAi hairpin (PpeTACl HG2 and PpeTACl HG6) and that PpeTACl is over expressed in transgenic plum lines containing PpeTAC l under the control of a 35S promoter (PpeTACl OE1 and PpeTACl OE2). [00109] While the mvention has been desciibed with reference to details of the illustrated embodiment, these details are not intended to limit the scope of the invention as defined m the appended claims. The embodiment of the mvention in which exclusive property or privilege is claimed is defined as follows:

Claims

CLAIMS:

1. A method for controlling plant horizontal orientation, the method comprising: overexpressing SEQ. ID. NO.: 1 or a sequence having 99% homology with SEQ. ID. NO.: 1 in germplasni or plan t wherein the overexpression of the sequence results in a horizontal phenotype characterized by axillary shoots having an increased horizontal orientation.

2. The method of claim 1 wherein the gennplasm or plant is a Primus cultivar.

3. The method of claim 2 wherein the germplasm or plant is Primus persic .

4. The method of claim 2 wherein the gennplasm or plant is Promts domestics,

5. A method for controlling plant branch vertical orientation, the method comprising silencing the expression of SEQ. ID. NO.: 1 or a sequence having 99% homology with SEQ. ID. NO.: 1 in gennplasm or plant, wherein the silencing of nucleotide sequence results in a vertical phenotype characterized by axillary shoots having an increased vertical orientation.

6. The method of claim 5 wherein the gennplasm or plant is a Primus cultivar.

7. The method of claim 6 wherein the germplasm or plant is Primus persica.

8. The method of claim 6 wherein the gennplasm or plant is Primus domestica.

9. A transgenic Primus cell or tissue prepared according to the method of claim 2.

10. A Prunm plant generated from the transgenic Primus cell or tissue of claim 8.

11. A transgenic seed produced by the Prim us plant of claim 10.

12. A transgenic Prunm cell or tissue prepared according to the method of claim 6.

13. A Primus plant generated from the transgenic Primus cell or tissue of claim 12,

15. A transgeni seed produced by the Prim us plant of claim 13.

16. A kit for the detection of horizontal phenotype for a plant or germplasm, the kit comprising a reagent for the detection the presence of the SEQ. ID. NO.: 1.