WO2014161116A1

WO2014161116A1 - Pa200 and acetylation mediate proteasomal degradation of core histones

Info

Publication number: WO2014161116A1
Application number: PCT/CN2013/001034
Authority: WO
Inventors: Xiaobo QIU; Minxian QIAN; Ye PANG; Cuihua Liu; Guangfei WANG; Qianqian ZHU; Xiaoxu ZHANG; Shan Liu
Original assignee: Beijing Normal University
Priority date: 2013-04-01
Filing date: 2013-09-03
Publication date: 2014-10-09
Also published as: CN103191412A; CN103191412B

Abstract

This invention provides the applications of PA200 in developing products; the functions of these products include at least one of the followings: (1) bind acetylated proteins; (2) promote degradation of acetylated proteins; (3) participate in somatic DNA damage repair; (4) participate in spermatogenesis.

Description

PA200 AND ACETYLATION MEDIATE PROTEASOMAL DEGRADATION OF

CORE HISTONES

Technical Field

The present invention relates to the proteasomal degradation of the core histones mediated by PA200 and acetylation.

Background Art

Proteasomes catalyze ATP- and polyubiquitin-dependent degradation of most cellular proteins and in vertebrates the generation of MHC-Class I antigenic peptides. The 26S proteasome consists primarily of two sub-complexes, the 20S catalytic particle and the regulatory particle at either or both ends of the 20S particle. Two major forms of the 20S "core" particle have been identified in mammals: the constitutive proteasome and the inducible variant, the immunoproteasome. The former has three catalytic subunits, βΐ, β2, and β5, whereas the latter has three closely related inducible subunits, βΐί, β2ί, and β5ί. The primary regulatory particle is the 19S particle, which binds, unfolds, and translocates polyubiquitinated proteins into the 20S. However, additional proteasome activators also exist, such as the 1 IS complex, ΡΑ28αβ, which increases the generation of peptides appropriate for antigen presentation. In addition, the proteasome activator ΡΑ28γ, which is homologous to PA28a and ΡΑ28β, has been reported to promote the ubiquitin- independent degradation of certain nuclear proteins.

The proteasome activator PA200 and its ortholog in yeast, BlmlO, bind to the ends of the 20S particle and stimulate the hydrolysis of small peptides and/or the unstructured tau protein in vitro. PA200 is present in all mammalian tissues, but is highly expressed in the testis. Deletion of PA200 markedly reduces fertility of male mice due to severe defects in spermatogenesis. However, the mechanisms remain unclear.

The core histones, H2A, H2B, H3, and H4, form an octamer to pack DNA into the nucleosome, whereas the linker histone HI protects internucleosomal DNA. Each histone octamer consists of two separate H2A-H2B dimers and a stable tetramer of two H3-H4 dimmers. The nucleosome is the unit of chromatin organization, and is critical in various cellular processes, including epigenetic regulation of gene expression, cell division, differentiation, and DNA damage response.

During spermatogenesis, histones are largely replaced transiently by transition proteins and subsequently by protamines in postmeiotic cells. Histones can also be replaced at promoter regions or active gene bodies in somatic cells. However, the mechanisms underlying the replacement of these histones remain unknown.

Lysine acetylation is extensively involved in various cellular processes, especially chromatin remodeling, DNA repair, and transcription. It influences both proteasomal degradation by either preventing or promoting polyubiquitination and lysosomal degradation of certain substrates. Histone acetyltransferase (HAT) catalyzes the formation of the acetyllysine residue, which can be recognized by the bromodomain (BRD) in proteins, and a histone deacetylase (HDAC) removes the acetyl group.

Histones are highly acetylated prior to their removal from chromatin during

spermatogenesis. Moreover, histone acetylation associates with open and actively transcribed euchromatic domains, and contributes to relaxed chromatin following DNA double-strand breaks. While the acetylation sites in histones and the enzymes that catalyze formation or removal of acetylation are widely studied, how acetylation regulates transcription, spermatogenesis, and DNA repair is still unclear. Summary of the Invention

The purpose of the invention is to provide a new pathway for histone degradation, i.e., PA200- and acetylation-mediated proteasomal degradation of the core histones. The present invention also provides novel tissue-specific proteasomes, spermatoproteasomes.

The invention provides the applications of PA200 protein in product preparation; in a preferred embodiment the protein comprises at a least one of the functions described here from (1) to (4): (1) Binding the acetylated proteins that can be the acetylated histones, specifically the acetylated core histones, more specifically the acetylated histone H2B or histone H4, and the most specifically H2BK5ac or H4K16ac; (2) Promoting the degradation of the acetylated proteins (as described above); (3) Mediating DNA repair in somatic cells (specifically recognizing the acetylated histones in DNA damage loci and promoting their degradation, DNA damage as described above, including induction by radiation and/or chemical reagent. Radiation described here can be ⁶⁰Co γ-radiation, and chemical reagent described here can be MMS (methyl methanesulfonate)); (4) Involved in spermatogenesis.

In particular embodiments, PA200 comprises of the amino acid sequence of SEQ ID No:l in sequence table, including the sequence derived from replacement, deletion, and/or addition of one or a few amino acid residues in SEQ ID No: l to generate proteins with identical functions.

The invention also provides the applications of the BRD-like domains of PA200 and BlmlO in product preparation; the function of the product is described here from (5) to (6): (5) Binding the acetylated proteins, which can be the acetylated histones, specifically the acetylated core histones, more specifically the acetylated histone H2B or histone H4, and the most specifically H2BK5ac or H4K16ac; (6) Promoting the acetylated proteins (as described above) degradation; the BRD-like domains of PA200 is the peptide from the N-terminal region at aal650-1738 of PA200 protein. The BRD-like domain of PA200 as described here can be replaced with PA200-BRDL-GST fusion protein. The invention also protects the applications of promoting histones (specifically core histones, such as H2B, H3 and/or H2A) accumulation or inhibiting histone degradation in sperm cells with PA200 deficiency.

The invention also protects the subunit of a4s, as described from (c) to (d): (c) its protein sequence showed in SEQ ID No:4 in sequence table; (d) the sequence derived from replacement, deletion, and/or addition of one or a few amino acid residues in SEQ ID No:4 to generate proteins with identical functions.

The invention further protects mammalian spermatoproteasomes, which consist of the 20S core complex, the 19S regulatory complex, and PA200; the 20S core complex described here contain a4s mentioned above. The mammals showed here can be bovine, human, mouse, rat, or rabbit. The spermatoproteasomes are the predominant forms of the proteasomes during spermatogenesis. The 20S core complex contains three catalytic β- subunits of immunoproteasomes (βΐί, β2ί and β5ί). The spermatoproteasomes exist in two forms: the large and small testis-specific proteasome. The large form of

spermatoproteasomes consists of 48 subunits from 35 different proteins (al-a7, a4s, β ΐ- β7, Rptl- Rpt6, Rpnl-3, Rpn 5-13, UCH37and PA200) forming. The small form of spermatoproteasomes consists of 29 subunits from 19 different proteins (al-a7, a4s, β ΐ- β7, βΐί, β2ί, β5ί and ΡΑ200).

The invention also protects the application of spermatoproteasomes in product preparation: the function of this product is to degrade acetylated proteins (the proteins showed here can be histones, specifically core histones).

The invention also protects the repressor for PA200 expression or the inhibitor for PA200 activity, the blocker for the binding between spermatoproteasomes and acetylated proteins. The application in product preparation described as follows: ® male contraceptive pills; ® products for promoting cell apoptosis in testis; (3) drugs against testiculoma; @ products for facilitating histones accumulation in spermatid (5) products for inhibiting histones degradation in spermatid.

The invention also protects male contraceptive drugs, their active constituents are to inhibit PA200 expression or PA200 activity, or are to block the association between spermatoproteasomes and acetylated proteins. The acetylated proteins shown here can be the acetylated histones, specifically the acetylated core histones, more specifically the acetylated histone H2B or histone H4, and the most specifically H2BK5ac or H4K16ac.

The invention also protects the application of the inhibitor of histone deacetylase (HDAC) in product preparation for promoting histones degradation. The HDAC inhibitor described here specifically can be TSA (Trichostatin A). Wherein histones can be core histones, specifically H2B and/or H4.

The invention also protects the application of HDAC inhibitor and the relative products inducing DNA double-strain break in product preparation. The HDAC inhibitor can specifically be TSA.

The invention also protects the application of HDAC inhibitor and the drugs inducing DNA double-strain breaks in product preparation. The HDAC inhibitor can specifically be TSA. Wherein the drugs inducing DNA double-strain breaks can be MMS.

The invention also protects a specific type of proteasome, which contains

PA200/BlmlO, can specifically catalyze degradation of the core histones in ubiquitin- independent pathway. During DNA damage responses of somatic cells and

spermatogenesis, PA200/BlmlO recognizes lysine-acetylated core histones through their BRD-like domains and further promotes degradation of their substrates. In mammalian testes, most proteasomes are the specific proteasomes which have never been reported, and are named here spermatoproteasomes. In addition to PA200, spermatoproteasomes also contain a spermatid/sperm-specific a-subunit, referred to as a4s ( Spermatid/sperm specific a4-like subunit) . Meanwhile spermatoproteasomes possess catalytic β-subunits of immunoproteasomes.

The invention finds the co-treatment of HDAC inhibitor and radiation or chemicals inducing DNA double-strain breaks can promote degradation of somatic core histones. The further finding is that deletion of PA200 in mice abolishes the acetylation-dependent degradation of somatic core histones during DNA double-strand breaks, and delays core histone disappearance in elongated spermatids. Purified PA200 greatly promotes the ATP-independent proteasomal degradation of the acetylated core histones, but not polyubiquitinated proteins. Furthermore, acetylation on histones is required for their binding to the bromodomain-like regions in PA200 and its yeast ortholog, BlmlO. These findings suggest that PA200/BlmlO specifically targets the core histones for acetylation- mediated degradation by proteasomes, providing mechanisms by which acetylation regulates histone degradation, DNA repair, and spermatogenesis.

According to one embodiment of the invention, the finding shows that PA200 is essential for the programmed degradation of core histones during spermatogenesis. The pattern of histone modifications has been proposed to constitute a "histone code" for epigenetic regulation of gene expression. This study illuminates the pathways for the degradation of the core histones during spermatogenesis and somatic DNA damage response. In mammals, the large testis-specific proteasome (19S-20S-PA200) contains surprisingly the characteristic immunoproteasome subunits, βΐί, β2ί, and/or β5ί, in its 20S particle, and bears both PA200 and the 19S particle as regulatory particles. Thus, it migrated in native PAGE slower than the singly-capped 26S immunoproteasome and constitutive proteasome, but faster than the doubly-capped 26S particles. Because the catalytic subunits of the immunoproteasome migrated together with PA200, detection of these immunoproteasome subunits in spermatoproteasomes was not simply due to the presence of typical immunoproteasomes in the testis. Although low amounts of PA200- 20S and PA200-20S-19S complexes were also present in muscle, neither a4s nor the "immuno" subunits were found in muscle. Thus, the proteasomes bearing one or two PA200 in the regulatory particles and βΐί, β2ί, β5ί, and/or a4s in the 20S particle appear testis-specific. The functional significance of these alternative 20S subunits in testis is unclear. Unlike the other alternative 20S subunits, a4s is in the outer a-ring and thus lacks catalytic activity, and may preferentially interact with regulatory complexes such as PA200. Possibly, these unique properties might allow the development of drugs against certain testis tumors or even male contraceptives that specifically target sperm

development by blocking the proteasomes essential for spermatogenesis. An excess of histones blocks transcription, leads to enhanced DNA-damage sensitivity, and triggers chromosome aggregation or loss. Delayed disappearance of the core histones in elongated spermatids in PA200-deficient mice also led to accumulation of the core histones and induced apoptosis. Thus, the findings provide a mechanism for the observation that deletion of PA200 leads to malformed spermatids or sperm in mouse testes, and thereby dramatically reduces fertility in male mice.

According to another one embodiment of the invention, the finding shows that acetylation and PA200 mediate polyubiquitin-independent proteasomal degradation of core histones. The core histones are removed from the vicinity of double-strand DNA breaks in yeast, and PA200 accumulates on chromatin during DNA repair. The invention shows that the elevated acetylation (induced by HDAC inhibitors) enhanced core histone degradation upon DNA damage in both yeast and mammalian somatic cells. Moreover, this process was shown to be dependent on PA200/BlmlO. This invention even demonstrates that PA200 specifically bound the acetylated histones at the DNA double- strand break loci through its BRD-like domain, and the purified PA200 directly activated the 20S particle to degrade the acetylated core histones. In contrast, no effect was seen under these conditions on degradation of polyubiquitinated proteins. Numerous HDAC inhibitors are under investigation in clinical trials as anticancer agents, especially in conjunction with other treatments such as chemotherapy and radiation therapy. The invention also provides that HDAC inhibitors promote acetylation-mediated histone degradation induced by the treatment with radiation or DNA damage reagents such as MMS, where this degradation pathway can be blocked by proteasome inhibitor MG132. Meanwhile HDAC inhibitor can enhance cell sensitivity to DNA damage, and trigger cell death. Thus, the invention provides the mechanism that may contribute to their clinical applications.

According to another one embodiment of the invention, the finding demonstrates that acetylation on lysine residue can serve as a signal for proteasomal degradation. Histone acetylation plays critical roles in epigenetic regulation of gene expression. Almost all known BRDs, which recognize the acetyllysine residue, share a moderate sequence homology. Although the BRDL regions of PA200/BlmlO structurally resemble BRD, they share almost no sequence homology with any known BRDs. The invention is important in identifying other new acetyllysine-binding proteins bearing BRD-like regions. Since PA200/BlmlO can recognize acetyllysine residue, some other non-histone proteins may also be targeted for acetylation-mediated degradation.

On the basis of the invention, a model for core histone degradation during

spermatogenesis and somatic DNA repair is summarized. During spermatogenesis, the core histones in postmeiotic spermatids 1) undergo acetylation and probably other uncharacterized posttranslational modifications, 2) are recognized by the BRD-like region in PA200, 3) and are degraded by spermatoproteasomes, 4) leading to their replacement by the transition proteins, which are eventually replaced by protamines. In response to DNA double-strand breaks, the core histones near the damage sites on DNA in somatic cells are, at least partly, also acetylated and degraded by the PA200/BlmlO- containing proteasomes so that DNA repair proteins can reach the damage sites. In addition, it is possible that other co-factors might function together with PA200/BlmlO to fulfill this task and promote histone degradation in vivo.

The invention creates a field of research which examines the acetylation-mediated protein degradation via the PA200/BlmlO-containing proteasomes, which influences the diversified cellular activities, such as DNA repair, gene regulation, and spermatogenesis. The invention is related to the fields about histone acetyaltion, protein degradation, epigenetic regulation of gene expression, and male reproduction. The invention would favor the development of drugs against certain testis tumors or even male contraceptives. The invention obtains the following breakthroughs in the following four aspects: (1) Provide a novel mechanism by which acetylation regulates histone degradation, DNA repair, and spermatogenesis. Histone acetylation is a major type of histone modifications. It is extensively involved in various important cellular processes, especially epigenetic regulation of gene expression, DNA repair, and spermatogenesis. However, how acetylation regulates these essential processes is still unclear. The invention provides that the BRD-like domains of PA200/BlmlO can recognize the acetylated core histones (other posttranslational modifications may assist this

recognization) and promote their degradation, providing the mechanism by which acetylation regulates histone degradation, DNA repair and spermatogenesis.

(2) Discover the proteasomal degradation pathway of histones, whis is mediated by acetylation and PA200/BlmlO, rather than ubiqutination. Proteasomes usually catalyze ATP- and polyubiquitin-dependent proteolysis. Degradation of histones has been approached by searching for ubiquitination enzymes that catalyze their

polyubiquitination, but such enzymes have not yet been identified. The invention finds the PA200/BlmlO-containing proteasomes catalyze the acetylation-dependent, and the ubiquitination-independent degradation of the core histones. Other proteins can also be acetylated. Thus, PA200/BlmlO-containing proteasomes may also catalyze degradation of other acetylated proteins. Velcade, a 26S proteasome inhibitor, is known to be used in the treatment of multiple myeloma, and regulation of PA200/BlmlO-containing proteasomes and acetylation pathway is likely to be a therapy for related diseases.

(3) Discover a novel type of testis-specific proteasome containing PA200

(spermatoproteasomes), and reveal its physiological substrates, core histones. The invention provides that most proteasomes in mammalian testes (spermatoproteasomes) contain a spermatid/sperm-specific a-subunit a4s/PSMA8 and/or the catalytic β-subunits of immunoproteasomes in addition to PA200. PA200/BlmlO as the activator of proteasome plays essential roles in prompt removal of core histones during DNA damage responses and spermatogenesis. The invention demonstrates the BRD-like domains of PA200/BlmlO can associate with the acetyl-lysine residues of core histones. These findings may contribute to the development of drugs against certain tumors or even male contraceptives.

(4) Reveal that HDAC inhibitors promote the acetylation-mediated degradation of the core histones during DNA double-strains breaks, and enhance the cell sensitivity to DNA damage. A large number of HDAC inhibitors serve as drugs against tumors in clinical trials, especially in co-treatment with chemotherapy or radiotherapy. The invention finds HDAC inhibitors promote acetylation-mediated histone degradation during DNA damage induced by radaiation or MMS, providing a mechanism for the clinical application of

HDAC inhibitors.

Brief Description of the Drawings

FIG.1. The co-locolization of PA200 and H2BK5ac.

FIG.2. The co-locolization of PA200 and H4K16ac.

FIG.3. γ-radiation triggers PA200 recruitment to the DNA damage loci.

FIG.4. The domains of PA200/BlmlO recognize acetyl-lysine residues.

FIG.5. The binding assay for fusion proteins and acetylated proteins.

FIG.6. The binding assay for PA200-BRD-GST fission proteins and acetylated proteins.

FIG.7. Identification of two distinct types of proteasomes in mammalian testes. FIG.8. Testis-Specific proteasomes possess distinct subunits and activities.

FIG.9. Deletion of PA200 in mice retards disappearance of core Histones in elongated spermatids.

FIG.10. PA200/BlmlO-containing proteasomes selectively degrade acetylated core Histones.

FIG.11. PA200/BlmlO is required for acetylation-associated degradation of core Histones during somatic DNA damage.

FIG.12. Mode pattern. Detailed Description of the Invention

The following implement embodiments are convenient to comprehend the invention, but are not limited in the invention. If there are no special instructions, the following experiment methods are all conventional, the experiment materials are all purchased from the ordinary biochemical company. In the following quantitative tests, the results are to calculate mean value from the relative three independent experiments.

The amino acid sequence of PA200 is shown in SEQ NO. l, its gene sequence in SEQ NO.2. The amino acid sequence of GST is listed in SEQ NO.3. The amino acid sequence of His tag is "HHHHHH" . The amino acid sequence of a4s is described in SEQ NO.4. The amino acid sequence of a4 is placed in SEQ NO. 5. Gcn5 : GENBANK

ACCESSION NO. NP_011768.1 ( linear PLN 25-FEB-2013 , GL6321691 ) , H4:

GENBANK ACCESSION NO. NP_778224.1 ( linear PRI 24-MAR-2013 ,

GL28173560) ; TIP 60: GENBANK ACCESSION NO. NP_874369 ( linear PRI 10- FEB-2013 , GL36287069) ; RNF5: GENBANK ACCESSION NO. NP_008844.1 ( linear PRI 18-MAR-2013 , GL5902054 ) . Flag tag comprises the amino acid sequence of "DYKDDDDK" . The rat breed used in the experiment materials is Wistar, the mice breed is C57BL/6 or BALB/C. They are both obtained from the Laboratory Animal Center, Chinese

Academy of Medical Sciences (Beijing, China).

In the experimental materials, fresh tissues from bull and rabbit were purchased from Fucheng slaughterhouse (Hebei, China). Following the sacrifice of the animals, the tissues were immediately removed, immersed in liquid nitrogen, and stored at -80°C until use.

Cell lines and Antibodies: The levels of proteins were analyzed by immunoblotting using horseradish peroxidase-conjugated secondary antibodies. The antibodies against βΐ, βΐί, β2, β2ί, β5, β5ί, Rpt2, ΡΑ200, ΡΑ28, Rpn7, and Rpt4 were obtained from BioMol, HI and H2B from Abeam, H2A, H3, γ-Η2ΑΧ (Ser 139), H4K16ac, and H4 from

Millipore, acetyl-Lys from Cell Signalling, β-actin from Sigma, and GAPDH from Santa Cruz Biotechnologies. The rat anti-a4 and anti-a4s polyclonal antibodies were raised against purified His-tagged a4 (aa219-248) and a4s (aa221-250) fragments, respectively. The mouse anti-H2B5ac antiserum was raised against the acetylated H2B peptide

(PEPA ^acSAPAPKKGSKKAVTKA-biotin), which was synthesized by GenScript (Nanjing, China).

Table 1. Proteins or subunits in this invention

Example 1 : PA200 recognizes and binds acetylated histones FIG. 1. Co-localization of PA200 with H2BK5ac. The mouse anti-H2B5ac antiserum was raised against the acetylated H2B peptide (PEPAK^acSAPAPKKGSKKAVTKA-biotin), which was synthesized by GenScript (Nanjing, China).

In the wild-type mouse embryonic fibroblast (MEF) cells, PA200 was visualized with an antiserum against PA200 from rabbit (green), and H2BK5ac was detected by a specific antiserum from mouse (red), while nuclei were stained with DAPI. One of co- localization loci in each cell was indicated by an arrow. At least 20 cells were analyzed, and similar results were obtained for almost all the cells. The PA200-deficient MEF cells (Mut) served as controls for the specificity of the anti-PA200 antiserum.

In the wild-type MEF cells, an antiserum against PA200 recognized punctuate structures in the nuclei, where acetylated H2B (H2BK5ac) was also present. The staining of acetylated H2B in the PA200-deficient cells was much stronger than in the wild-type cells, a further indication that PA200 promotes the acetylation-dependent degradation of the core histones

FIG.2. Co-localization of PA200 with H4K16ac

To express the N-terminally HA-tagged human PA200, the HA tag

(AGCGTAATCTGGAACATCGTATGGGTACATAAGCTTAACTAGCCAGCTTGG GTC ) was engineered into the pcDNA-6B plasmid, and the full-length PA200 was then inserted with a free C-terminus at sites of Kpnl and Notl.

COS-7 cells were transfected with the N-terminally HA-tagged PA200, and immunofluorescence staining was carried out using anti-HA (mouse) and anti-H4K16ac (rabbit). A representative of about 20 cells transfected with HA-PA200 was indicated by an arrow.

The findings suggest HA-PA200 can co-localize with H4K16ac.

FIG. 3. γ-radiation triggers PA200 recruitment to the DNA damage loci

It has been reported that histones undergo acetylation at DNA damage loci in cells. The wild-type MEF cells were pre-treated with 0.3 μΜ of TSA for 2 h, irradiated by a ⁶⁰Co gamma irradiator for 15 min (1 Gy/min), and then incubated for 0, 20, 60, or 120 min. PA200 was visualized with an antiserum against PA200 from rabbit (red), and γ- H2AX was detected by a specific monoclonal antibody from mouse (green). Cells with co-localized PA200 and γ-Η2ΑΧ (yellow) were indicated by arrows. In control, the cells were not irradiated before immunostaining.

In the wild-type MEF cells treated with TSA, γ-Η2ΑΧ was induced by γ-irradiation, and co-localized with PA200 in nuclei at 20 min and 60 min post-irradiation. So the findings suggest PA200 is recruited to DNA damage loci after γ-radiation and acetylation serves as a marker on the core histones and is directly recognized by PA200/BlmlO at loci of DNA double-strand breaks.

FIG. 4. PA200/BlmlO binds acetyllysine residue

The secondary structure of BlmlO/PA200 was predicted by Net SurfP.

The structures of the BRD-like region of yeast BlmlO and human CBP were taken from the crystal structures of BlmlO (PDB code: 3L5Q) and CBP (PDB code:2RNY), respectively. As the crystal structure of PA200 is unavailable, its BRD-like region was modeled after the homologous region in BlmlO.

BRDL regions in PA200/BlmlO. In FIG.4. A, alignment of the regions containing critical hydrophobic residues in the BRD-like (BRDL) regions of PA200/BlmlO with those in known BRDs from yeast Gcn5, human CBP, human T2D1, yeast BDF1, and human TF1A. a-Helices were underlined, the highly conserved residues were shaded in yellow, and the potential acetyllysine- recognizing residues were in red. In FIG.4. B, 3D structure of BRDL regions in yeast BlmlO and human PA200 in comparison with the BRD in human CBP.

The acetyllysine-binding bromodomain (BRD) usually comprises a left-handed bundle of four a helices with two adjacent hydrophobic loops (ZA and BC loops), where acetyl-Lys is anchored to an Asn residue. Based on its known crystal structure, BlmlO contains a BRD-like (BRDL) region at aal 648- 1732, which forms 4 similar a-helices with critical hydrophobic residues (Tyr¹⁶⁶³Asn¹⁶⁶⁴/ Tyr¹⁷¹⁰) in the adjacent loops. Human PA200 is predicted to have a similar region of aal650-1738 with Phe¹⁶⁷⁶/ Asn¹⁷¹⁶ Phe¹⁷¹⁷. Unlike typical BRDs, which share many other conserved residues, the BRDL regions in PA200 and BlmlO do not share any significant sequence homology with known BRDs.

FIG. 5. BRDL regions in PA200/BlmlO bind acetylated histones

1. Preparation of fusion proteins

Express and purify the N-terminally GST fission proteins. BRD-like regions of yeast BlmlO (aal648-1732) and human PA200 (aa 1650-1738) were each inserted at EcoRI and Xhol sites in pGex-4T-2 to generate GST-fusion proteins. Their control regions, BlmlO (aal980-2073) and PA200 (aal296-1377), were subcloned similarly. And their relative mutations of PA200 (N1716T/F1717S) and BlmlO (Y1663H/N1664D) are constructed and subcloned as above. BRD-like regions were fused to GST, expressed in bacteria, and purified using standard protocols.

The N-terminally His-tagged yeast Gcn5 HAT domain (aa98-262) was subcloned at BamHI and Xhol sites in pET28a.

Preparation of Histones: purify from rabbit thymus Preparation of acetylated histones: Histones from thymus were acetylated by His- tagged Gcn5 HAT domain (aa98-262) in the buffer containing 50 mM HEPES, pH 8.0, 10% glycerol, 1 mM dithiothreitol (DTT), 10 mM sodium butyrate, and 0.3 mM of acetyl-CoA, and the reaction was terminated by TCA precipitation.

2. Test the binding of the fusion proteins prepared in Step 1 with acetylated histones. The GSH-beads were incubated for 2 hr at 4^°C with the GST-BRD-like regions and acetylated histones in the buffer containing 10 mM Na-Hepes, pH7.5, 150mM NaCl, 0.005% Tween-20, and 2 mM DTT, and then were washed in the buffers containing 10 mM Na-Hepes, pH7.5, 150 mM KC1, 0.5-1.0 % Tween-20, and 2 mM DTT.

After the incubation, the GSH-beads are washed with the buffer containing 10 mM

Na-Hepes, pH7.5, 150mM NaCl, 0.05% Tween-20, and 2 mM DTT, and then the binding proteins are pulled on SDS-PAGE gels. Following a pull-down assay using GSH-beads, acetylated histones (Ac-H) and H2B were analyzed by western blot with an anti- acetyllysine antibody and an anti-H2B antibody, respectively. GST fusion proteins were stained by Coomassie blue (FIG. 5.).

In FIG. 5, BRD-like regions specifically bind acetyl-lysine on core histones in vitro. GST-fused BRDL regions from PA200/BlmlO (WT) and their mutants (N1716T/F1717S in PA200 and Y1663H/N1664D in BlmlO) (Mut) were expressed and purified from E. coli, and incubated with the histones, which were acetylated by Gcn5 HAT domain. Nonrelevant regions of BlmlO (aal980-2073) and PA200 (aal296-1377) served as negative controls (NC).

The acetyl -histones could be specifically pulled down with the BRDL region aal648- 1732, but not a non-relevant region, of BlmlO. Furthermore, the mutations at this region (Y1663H/N1664D) abolished the association. Similarly, the BRDL region aal650-1738 of human PA200, but not its corresponding mutant form (N 1716T/F 1717S) or a non- relevant region of PA200, bound acetyl-histones directly. Although the nature of the acetylated histones pulled down with the BRDL regions remained to be further characterized, an anti-H2B antibody recognized a band from acetylated histones at ~14- kDa, suggesting that acetylation on H2B was required for binding the BRDL regions.

3. The binding assay for GST-PA200-BRDL and acetylated histones

Acetylated histones purified from cells (Extraction, purification, and analysis of histones. David Shechter et.al, Nature Protocol. 2007).

Express and purify the N-terminally His-tag TIP60 (aal-513) protein, which was constructed in pET-28b at Ndel and Xhol restriction sites. Histone H4 was also subcloned in a pET3a plasmid for bacterial expression, and its mutant H4K16R was constructed similarly. The full-length histone H4 purified from bacteria is acetylated by incubation with His- TIP60 in the buffer containing 10 mM Na-Hepes, pH7.5, 150mM NaCl, 0.05% Tween- 20, and 2 mM DTT.

In FIG. 6A, the four lanes show the different pull-down system. The incubation system of the lanel is mixture of GSH-beads, GST-PA200-BRD and acetylated bacterially-expressed histones. In lane2, GST-PA200-BRD is replaced with GST- PA200-BRD (N1716T/F1717S ) . The mix of lane3 and lane4 is the same to the system of lanl with additional of H4 and H4K16ac respectively. The buffer in these incubation systems is similar to the Step 2.

The H4 peptide (aal-21) with or without acetylation at K16 was included as indicated at ~200-fold of histone molecules. GST pulldown experiments were carried out as in Step 2, and H4K16ac was analyzed with a specific anti-H4K16ac antibody.

After incubating them with GST-BRDL of PA200 or BlmlO, H4K16ac could be specifically pulled down by the WT BRDL region, but not its mutant. However, the H4 peptide with K16ac could not compete with the full-length histone in this assay.

Bacteria lack most posttranslational modifications of proteins in mammalian cells. Therefore, we expressed and purified the full-length histone H4 from bacteria, and acetylated it at K16 in vitro using the HAT, TIP60, but the BRDL region of PA200 could not bind this type of acetylated H4. Accordingly, the BRDL regions of PA200 and BlmlO also could not bind the N-terminal histone peptides (including H4K16ac [aal-21]), which were only modified by acetylation at a single Lys residue (data not shown). Thus, the BRD-like regions of BlmlO and PA200 can bind acetyl-histones in vitro, but additional posttranslational modifications of histones might be required to assist the binding.

Example 2: Identification of two distinct types of proteasomes in mammalian testes To explore the mechanisms underlying histone degradation, the experiments are carried out to test whether spermatogenic cells in mammals possess unusual types of proteasomes, because histones are largely lost during spermatogenesis.

1. Extract the total proteins from tissues of bovine skeletal muscle and of the seminiferous tubules from bovine testes.

2. The proteasomes were visualized in the gels using the specific fluorogenic peptide substrate, succinyl LLVY-7-amino-4-methylcoumarin (amc). Proteasomes in crude tissue extracts were detected by incubating the gel with LLVY-amc in the absence or presence of 0.02% SDS, and visualized under UV light.

The muscle proteasomes were detected in two bands, which corresponded to doubly- capped (19S-20S-19S) and singly-capped (19S-20S) particles. Proteasomes from the testis also migrated as two bands. One corresponded to 19S-20S-19S, but the other was found between the doubly- and singly-capped particles, and thus was probably intermediate in size (referred to as Lg for the large testis-specific proteasome, Peptide hydrolysis by Lg appeared much stronger than that by the 19S-20S-19S, suggesting that Lg represents the predominant activity against this substrate in spermatogenic cells of bovine testes. When 0.02% SDS was added, a faster-migrating band (referred to as Sm for the small testis-specific proteasome) became evident in the testis sample, probably because SDS activated the 20S particle by opening the gated channel for substrate entry.

3. SDS-PAGE for analysis of proteasomes from tissues of bovine skeletal muscle and of the seminiferous tubules from bovine testes. In FIG. 7C, the distribution patterns of proteasomal subunits from the testis were generally similar to those from muscle, but the levels of all 20S subunits appeared greater than those of 19S subunits. In addition, a major band (indicated as X) at approximately 200 kDa was found in the proteasomes purified from the testis.

4. Analysis of proteasomes by negative staining electron microscopy (EM)

Samples were negatively stained by uranyl formate following the established protocol and observed in a Tecnai T20 microscope operated at 120kV at a magnification of 50,000X. Images were recorded on a Gatan 4Kx4K UltraScan CCD camera with a de focus of 1.5 μιη. All images were binned by a factor of 2 to a final pixel size of 5 A /pixel at specimen level. Regulatory particles of proteasomes were manually selected using WEB, and image processing was performed with SPIDER. Proteasomes were windowed into 90 x 90 pixel images and treated by standard multi-reference alignment and classification protocol specifying 25 classes. Classes of the same type of particles were then merged to produce final 5 classes. Only side views of the 20S particles associated with regulatory particles were selected for image processing, and isolated 20S particles without any regulatory particles were not selected for multi-reference alignment and classification. Most proteasomes with any kind of regulatory particles are most likely to be on-side views. Thus, the number of proteasomes within each class represents the relative ratio of this type of proteasome in the sample.

In FIG. 7D, Five different types of proteasomes were found in both the testis and muscle. The first two types were typical 26S proteasomes with one or both ends of the 20S particle capped with the 19S particle. The other three types had at the ends of the 20S one or two smaller structures, which resemble PA200 or its yeast ortholog BlmlO, but differ from PA28-containing complexes. About 90% of proteasomes from the testis contained this small structure resembling PA200. In comparison, only ~8% of the proteasomes from muscle contained such a component. Thus, both Lg and Sm

proteasomes from the testis (i.e., spermatoproteasomes) appear to contain PA200.

5. Purification of proteaomes by glycerol gradient. The fractions from the glycerol gradient into two pools were collected and then run on native PAGE, The individual bands are cut out and subjected to mass spectrometric analysis. Protein samples were analyzed by MALDI-TOF using an Applied Biosystems Voyager-DE-STR.

In table 1, In addition to the typical subunits found in muscle 20S particles (a 1-7 and β 1-7), three immunoproteasomal catalytic subunits (β ΐί, β2ί, and β5ί) were detected in either the testis 20S or the small testis proteasome (Sm). PA200 was detected in all 4 samples from the testis. In contrast, neither immunoproteasome subunits nor PA200 was detectable in the muscle 20S or 26S proteasomes by this approach. Surprisingly, a novel subunit with 82% identity to a4/PSMA7, which is referred to as a4s, was detected in all testis proteasomes, and was expressed specifically in spermatids and sperm. Thus, PA200, a4s, and the catalytic subunits of the immunoproteasome seem to be subunits of the testis-specific proteasomes.

Table2: mass spectrometric analysis

The mammalian 26S proteaome is made up of two subcomplexes: a catalytic core particle (20S) and the 19S regulatory particle. The 19S regulatory particle binds to one of both ends of the latent 20S particle to form two types of proteaome: 19S-20S-19S and 19S-20S. The 19S regulatory particle comprises 6 triple- ATPase (Rpt) subunits and 13 non-ATPase (Rpn and UCH37) subunits. The 20S proteasome appears as a cylinder-like structure consisting of two outer a-rings and two inner β-rings, which are made up of seven structurally similar a (a_1-7) and β (β_1-7) subunits, respectively. In mammal, the testis-specific proteasome comprises by 20S core particle, PA200 and/or 19S regulatory particle to form the two types of proteasome: 19S-20S-PA200 (referred to as Lg) and 20S-PA200 (referred to as Sm). In addition of a4, the outer a- rings of its 20S particle contain the spermatid/sperm-specific a4s subunit. Moreover the inner β-rings of its 20S particle possess the catalytic β-subunits of immunoproteasomes βΐί, β2ί and β5ί in addition to βΐ, β2 and β5.

The subunits of the mammalian proteasome are high conserved.

The Lg spermatoproteasome is made up of 48 subunits formed by 35 proteins (al-a7, a4s, β1-β7, Rptl- Rpt6, Rpnl-3, Rpn 5-13, UCH37 and PA200). Where the Sm spermatoproteasome comprises 29 subunits formed by 19 proteins (al-a7, a4s, β1-β7, βΐί, β2ί, β5i and PA200).

6. The immunohistochemistry assay for the paraffin section of C57BL/6 mouse testis and epididymis. The primary antibodies used here are the rat a4 antiserum and the rat a4s antiserum. Slices (8 μιη) were incubated with antibodies and detected by IHC kits (Zhongshan Golden Bridge Biotechnology, Beijing). The positive cells were then visualized using 3,3-diaminobenzidine tetrahydrochloride (DAB) (brown). Following counterstaining with nuclear haematoxylin (blue), images were captured under a microscope. The filled arrow (spermatocyte), the open arrow (round spermatid), and the open triangle (elongated spermatid) point to the corresponding cells.

In FIG. 7F, a4s protein is specifically expressed in the testis and epididymis.

Example 3: Testis-Specific Proteasomes Possess Distinct Subunits and Activities

1. Extracts of mouse spleen, the testis, sperm, testis cell lines (including

spermatogonium GCl-spg, spermatocyte GC2-spd, leydig cell TM3, and Sertoli cell TM4), and a muscle-related cell line (C2C12) were subjected for SDS-PAGE, and proteasomal subunits were analyzed by immunoblotting.

In FIG. 8 A, a4s and β2ί were detected only in sperm, and β 1 i was in Sertoli cells and spermatocytes, whereas β5ί, PA200, 19S subunits (such as Rpt2, Rpt4, and Rpn7), and PA28a were expressed in all these cell types, β ΐί, β2ί, and β5ί were abundant in the testis and spleen, but not in C2C12 myoblast cells. PA200, β ΐί, and β5ί (like Rpt4, βΐ, β2, and β5) can be detected in GC2-spd spermatocyte or testis extracts.

2. Extracts of BALB/C mouse testis, spleen and muscle tissues are subjected for SDS- PAGE, and analyzed by immunobloting.

In FIG. 8B, a4s, βΐί, β5ί, and PA200, but not β2ί, were detected in the purified testis proteasomes. The 1 IS proteasome activators PA28a and ΡΑ28β were present, but only at low levels. 3. The proteasomes purified from the testis (Te), skeletal muscle (Mu), and spleen (Sp) were separated on native PAGE, and stained with Coomassie blue or analyzed by immunoblotting. Lg and Sm indicate the positions for the large and small testis-specific proteasomes, respectively.

When analyzed by non-denaturing PAGE, the 26S proteasomes from muscle were present mainly as doubly-capped with appreciable singly-capped 26S complexes, and those from spleen (immunoproteasomes) were primarily found as singly-capped with some doubly-capped structures. In contrast, most proteasomes purified from the testis contained PA200, and appeared in a band between the two 26S bands (i.e., the large testis-specific proteasomes) and a small amount migrated with the doubly-capped 26S particles. The presence of the 19S complexes in these structures was confirmed by immunoblotting against Rpt2. β2ί and β5ί were present in the proteasomes from the testis and spleen, but not in those from muscle, which contained instead β2 and β5. Thus, both large (19S-20S-PA200) and small (20S-PA200 or PA200-20S-PA200) testis- specific proteasomes appear distinct in containing PA200, the catalytic subunits of the immunoproteasome, and the novel a-subunit (a4s).

4. Incubate the proteasomes (0.4 μg/ml) purified from tissues of muscle, testis and spleen with The [ 125 I]-labeled calf core histones at 3.75 μΜ in the buffer containing 20mM Heps(PH 7.5 ) , 0.5mM EDTA, 5mM MgCl₂, 2mM ATP, lmM DTT for indicated periods of times. Separate by 15% SDS-PAGE, and analyze with

Phospholmager. Their relative levels were shown under the bands. Similar results were obtained from at least three independent experiments.

All these three types of proteasomes degrade denatured core histones at similar rates.

5. The degradation of polyubiquitinated RNF5 by these three types of proteasomes. Express and purify the N-terminally Flag-tag RNF5 protein, which was constructed in p3 X Flag at Not I and Kpn I restriction sites and transfected to the 293T cells. RNF5, a ubiquitin ligase, can promote formation of the K48-linked ubiquitin chains and

proteasomal degradation of its substrates.

In order to obtain the poly-ubiquitin conjugates of RNF5 [RNF5-(Ub)_n], in vitro auto- ubiquitination reaction was performed in the presence of ubiquitin, El, UbcH5, and

RNF5 for 90min at 30^°C . The buffer for ubiquitination assay is containing 20mM

Tris.HCl, pH 7.5, 20mM KC1, 5mM MgC12, lmM DTT, 4mM ATP, O. lug/ul Ub.

The polyubiquinated species of RNF5 [RNF5-(Ub)_n] prepared in vitro were incubated with proteasomes (0.4 μg/ml) for indicated periods of time. Ubiquitin conjugates were analyzed by immunoblotting with an anti-ubiquitin antibody. Similar results were obtained from at least three independent experiments. The polyubiquitinated species of RNF5 were then incubated with proteasomes. The testis-specific proteasomes were much less efficient in degrading polyubiquitinated RNF5 than those from muscle or spleen.

Similar results were obtained, when polyubiquitinated RNF5 was replaced with polyubiquitinated Nrdp 1 , another ubiquitin ligase, which amino acid sequence refer to ACCESSION NO .NP_001229755.1 ( linear PRI 10-FEB-2013 , GI:338827618 ) .

Example 4: Deletion of PA200 in Mice Retards Disappearance of Core Histones in Elongated Spermatids

1. Deletion of PA200 increases the rate of apoptosis in testis.

Apoptotic cells in testis paraffin sections of the 15-week-old wild-type or PA200- deficient mice were detected by fiuorometric tunnel assay (green). The nucleus was stained by DAPI (4',6-diamidino-2-phenylindole, blue). The results were from 3 independent experiments, and a representative view from a section of a seminiferous tubule was shown.

In FIG. 9 A, only few apoptotic cells (usually <5) were detected in each apoptosis- positive tubule section from wild-type mice, but much more (mostly >5) from the PA200-deficient mice. As reported previously, deletion of PA200 increased markedly apoptosis in testes and reduced male fertility, but did not cause any other apparent phenotypic changes in the mice.

2. Deletion of PA200 leads to accumulation of core histones in elongated spermatids. Histones in testis paraffin sections of the 15-week-old wild-type or PA200-deficient mice were detected by immunohistochemistry (brown), and nuclei were stained with haematoxylin (blue). The steps of spermatogenesis were 11 for both H2B and H3, and 13-14 for HI . The filled arrow (spermatocyte), the open arrow (round spermatid), and the open triangle (elongated spermatid) point to the corresponding cells.

In FIG. 9B, sperm differentiation in mice proceeds through 16 distinct steps (Kotaja et al., 2004). The core histones, H2B and H3, disappeared in the early stage of elongated spermatids (step 9 of spermatogenesis) in wild-type mice. However, in PA200-knockout mice, both H2B and H3 remained detectable at the end of the elongation stage of the spermatids (step 11), though these histones were lost in the elongated spermatids with fully condensed chromatin (e.g., steps 15-16). In contrast, PA200-deficiency did not retard the disappearance of the linker histone HI in elongated spermatids, and reduced its relative levels in most diploid cells in testes.

3. PA200 deficiency increases the levels of the core histones in soluble testis extracts. Histones are usually packed in chromatin, and can be extracted under high-salt or acidic conditions. Testis homogenates from the wild-type or PA200-deficient mice were prepared in the buffer (25 mM Tris, pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl₂, 1 mM PMSF, and 5 mM ATP), and were analyzed by immunoblotting following SDS- PAGE. The asterisk denotes a polypeptide, which did not complex with the 20S particle

In FIG. 9C, deletion of PA200 markedly increased the levels of the core histones H2A, H2B, and H3 in the soluble testis extracts, and dramatically decreased the levels of HI .

4. Deletion of PA200 elevates the levels of H4K16ac in round and elongating spermatids

It is known that H4 is acetylated at K16 (H4K16ac) prior to the removal of the core histones in elongating spermatids. Testis paraffin sections were prepared and stained, and cells were labeled as in FIG. 9B, but the primary antibody was anti-H4K16ac (Millipore #07-329).

In FIG. 9D, deletion of PA200 elevated the levels of H4K16ac in round and

elongating spermatids. Thus, PA200 appears to promote the selective loss of the core histones (and especially the acetylated species) in elongated spermatids.

The results from the above stpel to step 4 indicate that PA200 is required for histone replacement during spermatogenesis.

Example 5: PA200/BlmlO-Containing Proteasomes Selectively Degrade Acetylated Core Histones

Excess histones in a cell can cause genome instability. Delayed disappearance of histones in elongated spermatids or release of histones from DSB sites should resemble ectopic overexpression of histones, which in yeast leads to an accumulation of excess histones. Therefore, the FLAG-tagged core histones were inducibly overexpressed in budding yeast to examine the mechanisms for the BlmlO/PA200-mediated degradation of the core histones.

BlmlO targets the ectopically expressed H3 for degradation via BRD-like regions. Wild-type BY4741 (WT) or mutant yeast carrying the pHHFl-Gal-10/l-FLAG-HHTl plasmids encoding the galactose-inducible FLAG-tagged H3 was used to perform a histone degradation assay, analyzed by immunoblotting, and quantified by densitometry. The relative levels of histones were obtained by normalizing to the loading control (GAPDH).

In FIG. 10A, unlike deletion of the 19S subunits, Rpn4 and Rpnl3, deficiency of BlmlO stabilized the ectopically-expressed histone H3. Overexpression of the HA-tagged BlmlO by itself did not promote FLAG-H3 degradation, suggesting that the endogenous BlmlO was sufficient for the destruction of the excess histones. Furthermore, mutations (Y1663H/N1664D) or deletion (BlmlO AC) of the BRD-like region in BlmlO stabilized FLAG-H3. BlmlO deficiency stabilizes ectopically expressed H2B and H4. Wild-type BY4741 (WT) or mutant yeast carrying the inducible H2B or H4 was constructed and analyzed similarly.

In FIG. 10B, deletion of BlmlO also stabilized the ectopically-expressed FLAG- tagged histones H2B and H4.

BlmlO deficiency does not stabilize ectopically expressed Ub-R-GFP. Wild-type or mutant yeast carrying the galactose-inducible C-terminally His-tagged Ub-R-GFP was used to perform a degradation assay.

In FIG. IOC, unlike Rpn4 or Rpnl3, BlmlO was not required for the ubiquitin- dependent degradation of the N-end rule substrate, ubiquitin-R-GFP (Green fluorescent protein).

Purification of PA200 was adapted from established protocols (Qiu et al., 2006; Ustrell et al, 2005).

20S proteasome is purified with the reference to the protocol: Xiao-Bo Qiu, Song- Ying Ouyang, Chao-Jun Li, Shiying Miao, Linfang Wang and Alfred L Goldberg. hRpnl3/ADRMl/GPl 10 is a novel proteasome subunit that binds the deubiquitinating enzyme, UCH37. Embo J, 2006;25(24):5742-5753.

Purified 20S particle was incubated with the acetylated histones (Ac-H), unmodified histones (monitored by H2B), or poly-ubiquitinated RNF5 (Ub-R5) in the absence or presence of the purified PA200 for the time as indicated. The degradation of acetylated histones was assayed in the buffer containing 20 mM Tris, pH 7.5, 0.5 mM EDTA, 1 mM DTT, and 1 mM MgCl₂ at 37° C and a 70-μ1 reaction mix was supplemented with 280 ng of the 20S proteasome, 3 μg of acetylated or non-acetylated histones, and/or 1 μg PA200. Except for RNF5-(Ub)_n, ATP was not supplemented in the reactions. MG132 was used at 1 μΜ in the indicated reactions. The levels of the substrates were analyzed by immunoblotting and quantified by densitometry (normalized to the proteasome subunit a4).

In FIG. 10D, the purified PA200 greatly promoted degradation of the acetylated core histones by the 20S particles in the absence of ATP. Since the proteasome inhibitor MG132 blocked this degradation, the observed effect should not be caused simply by deacetylation. In contrast, PA200 stimulated degradation of unmodified H2B only slightly, and had almost no effect on degradation of the polyubiquitinated RNF5.

Thus, PA200/BlmlO appears to directly target the acetylated core histones for proteasomal degradation in a process not requiring ATP or polyubiquitination.

Example 6: PA200/BlmlO Is Required for Acetylation- Associated Degradation of Core Histones during Somatic DNA Damage Since histone acetylation happens prior to histone removal in elongated spermatids and at the sites near DNA double-strand breaks (DSBs), the experiment is performed to test whether acetylation promotes histone degradation in response to DSBs.

1. Joint treatment of irradiation with trichostatin A reduces the levels of the core histones. GC-2spd cells were treated with or without TSA (0.3 μΜ), irradiated by a ⁶⁰Co gamma irradiator for 15 min (1 Gy/min), and then incubated for 0, 20, 60, or 120 min.

The levels of the histones and the loading control, β-actin, were analyzed by

immunoblotting following lysis of cells by SDS sample buffer. The levels of H2B and H4 were quantified by densitometry (normalized to the loading control).

In FIG. 11 A, in GC-2spd cells, DSBs induced by γ- irradiation, as marked by phosphorylation of histone H2AX (γ-Η2ΑΧ), had little effect on the levels of the core histones. However, in the presence of the histone deacetylase (HDAC) inhibitor, trichostatin A (TSA), which markedly increased the levels of acetylated H4K16

(H4K16ac), γ- irradiation led to a dramatic decrease in the levels of non-acetylated H2B and H4 at 20 min or 60 min post-irradiation. At 120 min post-irradiation, the levels of H2B and H4 bounced back markedly, probably because the cells had recovered from the damage.

2. Treatment with TSA and MMS decreases the levels of the core histones.

GC-2spd cells were treated with 25 μg/ml cycloheximide and TSA at the

concentrations (0 0.1 0.3 0.5μΜ) as indicated in the absence or the presence of

0.004% (0.472 mM) MMS for 4 h. The levels of histones and the loading control, β-actin, were analyzed as in FIG. 11 A.

In FIG. 1 IB, treatment of GC-2spd cells with TSA in conjunction with the DNA- damaging agent, methyl methanesulfonate (MMS), also led to a dramatic decrease in the levels of H2B and H4

3. Treatment with both irradiation and TSA reduces the levels of the core histones in wild-type, but not in PA200-deficient, MEF cells.

Wild-type (WT) or PA200-deficient (Mut) MEF cells were treated and analyzed as in FIG. 11 A. A probably non-specific 130-kDa band was recognized by the anti-PA200 antiserum.

In FIG. 11C, in wild-type mouse embryonic fibroblast (MEF) cells, the joint treatment of γ-irradiation and TSA led to a marked decrease in the levels of H2B and H4 at 20 min or 60 min post-irradiation. In contrast, in the PA200-deficient MEF cells, this joint treatment had almost no effect on the levels of the core histones. Since the core histones are semi-conservatively replicated during DNA replication, this dramatic loss of the core histones within only 20 min after irradiation (compared to the ~24 h doubling time for the MEF cells) must result from accelerated degradation of these proteins rather than from reduced transcription or translation during DNA replication. Thus, PA200 is apparently required for the acetylation-associated degradation of the core histones in response to DNA double-strand breaks.

4. Acetylation- and BlmlO-dependent degradation of the core histones in diploid yeast treated with MMS.

Wild-type or the BlmlO-deficient diploid budding yeast was treated with MMS and/or VPA in the absence or presence of MG132 (10 μΜ) for the time indicated. The levels of H2B and GAPDH were analyzed by western blot following lysis of yeast by SDS sample buffer.

To further confirm these results, the experiment explores the role of the PA200 ortholog in S. cerevisiae, BlmlO, in the histone degradation in response to DSBs. In diploid yeast, the joint treatment with MMS and the HDAC inhibitor, valproic acid

(VPA), also dramatically reduced the levels of the core histone, H2B. Treatment with the proteasome inhibitor, MG132, or deletion of BlmlO blocked this reduction.

5. BlmlO is required for acetylation-dependent degradation of the core histones in haploid yeast strains during DNA damage.

Wild-type or the BlmlO-deficient haploid budding yeast (SY653) were treated with the medium containing galactose to replace glucose as to induce cells to express HO endonuc leases controlled by Gal promoter. The levels of H2B were analyzed by immunobloting.

In FIG. 1 IE, the HO endonuc lease expressed by inducement would cut chromatin DNA resulting DNA damage. The roles of HO cutting and the HDAC inhibitor, valproic acid (VPA), dramatically reduced the levels of the core histone, H2B. Treatment with the proteasome inhibitor, MG132, or deletion of BlmlO blocked this reduction.

6. BlmlO deficience could partially protect yeast cell viability from DNA damage and inhibition of HDAC.

The haploid yeast cells are diluted as the indicated gradient rates and then are separately cultured in the plates with the medium containing galactose or glucose in addition to VPA. Observe the cell viability after incubation at 30°C for 2 days.

In FIG. 1 IF, the joint treatment of HO endonuclease induction and VPA results in yeast cell death, but BlmlO deletion could partly save the cell survival rate. Thus, DNA double-strand breaks promote the acetylation-associated proteasomal degradation of the core histones, and PA200/BlmlO is required for this process in both yeast and mammalian somatic cells.

Example 7: Models Modes for Acetylation-Mediated Degradation of Core Histones are described in FIG. 12 for summarization of Example 1-6.

(A) Core histone degradation by spermatoproteasomes during spermatogenesis. During elongation of haploid spermatids, the BRD-like (BRDL) region in PA200 recognizes the core histones with acetylation and other uncharacterized posttranslational modifications, dissociates the histones from the nucleosome, and leads to cleavage of the core histones into small peptides. Meanwhile, transition proteins are recruited into the chromatin, and are eventually replaced by protamines.

(B) Coupling of core histone degradation with somatic DNA repair. DNA double- strand breaks trigger acetylation and other uncharacterized posttranslational

modifications on the core histones. Targeting and release of core histones would allow DNA repair proteins to fix the damaged DNA. Meanwhile, the acetylated core histones are, at least partly, degraded by the PA200/BlmlO-containing proteasomes. Following repair of the damaged DNA, the newly synthesized core histones join the DNA to form new nucleosomes.

Claims

Claims What is claimed is:

1. The applications of PA200 include at least one of the followings:

( 1 ) Bind acetylated proteins;

(2) Promote degradation of acetylated proteins;

( 3 ) Participate in somatic DNA repair;

(4) Participate in spermatogenesis.

2. The applications of the BRD-like region of PA200 (aal650-1738) in ( 5 ) and/or ( 6) :

( 5 ) Bind acetylated proteins;

( 6 ) Promote degradation of acetylated proteins.

3. The application of PA200 in promoting histone accumulation or inhibiting histone degradation in spermatids/sperm.

4. a4s subunit is ( c) or ( d) :

( c) the protein shown in SEQ No.4;

( d) the protein derived from SEQ No.4 with replacement, deletion and/or insertion of one or a few amino acid residues.

5. Mammalian spermatoproteasomes consist of the 20S core particle, 19S regulatory particle, and PA200. Their 20S particle contains a4s subunit as described in Claim 4.

6. Application of the spermatoproteasomes (described in Claim 5) in developing products, which catalyze degradation of acetylated proteins.

7. Application in developing the materials that inhibit the expression or activity of PA200, or block the binding of spermatoproteasomes to acetylated proteins , including ®, ©, ©, ©, or ©:

® Male contraceptive;

8. Male contraceptive drugs with components that inhibit expression or activity of PA200, or block the binding of spermatoproteasomes to acetylated proteins.

9. Inhibitors of histone deacetylation enzymes (HDAC) in promoting histone degradation and cell death.

10. HDAC inhibitors and instruments generating radiations to cause DNA double- strand breaks for the treatment of cancer.