WO2014160211A1 - Modulation of inflammatory responses by c-reactive protein - Google Patents

Modulation of inflammatory responses by c-reactive protein Download PDF

Info

Publication number
WO2014160211A1
WO2014160211A1 PCT/US2014/026058 US2014026058W WO2014160211A1 WO 2014160211 A1 WO2014160211 A1 WO 2014160211A1 US 2014026058 W US2014026058 W US 2014026058W WO 2014160211 A1 WO2014160211 A1 WO 2014160211A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
oligonucleotide
crp
certain embodiments
modified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/026058
Other languages
French (fr)
Inventor
Marshelle WARREN
JoAnn D. FLAIM
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Publication of WO2014160211A1 publication Critical patent/WO2014160211A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Definitions

  • the present invention provides methods, compounds, and compositions for reducing inflammation without immunosuppression in an animal by administering a CRP inhibitor to the animal.
  • C-reactive protein also known as CRP and PTX1
  • CRP and PTX1 are essential human acute-phase reactant produced in the liver in response to a variety of inflammatory cytokines.
  • the protein first identified in 1930, is highly conserved and considered to be an early indicator of infectious or inflammatory conditions.
  • Plasma CRP levels increase 1,000-fold in response to infection, ischemia, trauma, burns, and inflammatory conditions.
  • CRP cardiovascular disease
  • CRP is a member of the pentraxin family of proteins, which are characterized by a cyclic pentameric structure and radial symmetry.
  • the five identical 24-kDa protomers consist of 206 amino acids, and are noncovalently linked (Lei et al., J. Biol. Chem., 1985, 260, 13377- 13383; Szalai et al., 1997, cited above).
  • the genomic DNA sequence for human CRP has been reported by Lei et al. 1985, cited above, as have mutant forms of the protein (International Patent Publication No. WO 1996/06624) and methods to deliver materials into cells using the mutant protein as a carrier (International Patent Publication No. WO 2000/11207).
  • CRP binds to a broad range of cellular substances such as phosphocholine, fibronectin, chromatin, histones, and ribonucleoprotein in a calcium-dependent manner (Szalai et al., 1997, cited above). It is a ligand for specific receptors on phagocytic leukocytes, mediates activation reactions on monocytes and macrophages, and activates complement (Szalai et al., 1997, cited above).
  • CRP The function of CRP is related to its role in the innate immune system. Similar to immunoglobulin(Ig) G, it activates complement, binds to Fc receptors and acts as an opsonin for various pathogens. Interaction of CRP with Fc receptors leads to the generation of proinflammatory cytokines that enhance the inflammatory response. Unlike IgG, which specifically recognizes distinct antigenic epitopes, CRP recognizes altered self and foreign molecules based on pattern recognition. CRP is therefore thought to act as a surveillance molecule for altered self and certain pathogens. This recognition provides early defense innate immunity and leads to a proinflammatory signal and activation of the humoral, adaptive immune system. Thus, the CRP molecule has both a recognition function and an effector function. Therefore, the pharmacological modulation of CRP activity and/or its expression is an appropriate point of therapeutic intervention in pathological conditions.
  • Antisense oligonucleotides inhibiting CRP have previously been designed and disclosed in various applications and patents, including, WO 2005/005599, WO 2007/143317, WO 03/010284, U.S. 7,425,545, U.S. 7,863,252, U.S. 6,964,950, U.S. 7,491,815, U.S. 7,915,231, U.S. 8,093,224 and U.S. 7,326,693, all incorporated-by-reference herein.
  • Inflammation is a complex biological process of the body in response to an injury or abnormal stimulation caused by a physical, chemical or biological stimulus. Inflammation is a protective process by which the body attempts to remove the injury or stimulus and begins to heal affected tissue in the body.
  • Inflammatory responses although generally helpful to the body to clear an injury or stimulus, can sometimes cause injury to the body.
  • a body's immune response inappropriately triggers an inflammatory response where there is no known injury or stimulus to the body.
  • autoimmune diseases the body attacks its own tissues causing injury to its own tissues.
  • Treatment to decrease inflammation includes non-steroidal anti-inflammatory drugs
  • NSAIDS as well as disease modifying drugs. Many of these drugs have unwanted side effects. For example, with NSAIDS, the most common side effects are nausea, vomiting, diarrhea, constipation, decreased appetite, rash, dizziness, headache, and drowsiness. NSAIDs may also cause fluid retention, leading to edema. The most serious side effects are kidney failure, liver failure, ulcers and prolonged bleeding after an injury or surgery.
  • DMARDs Disease Modifying Anti-Rheumatic Drugs
  • Many of these DMARDs are nonspecific cytotoxic immunosuppressive drugs that suppress a large part of, or the entire, immune system of the subject. Prolonged therapy with these immunosuppressive drugs potentially produces toxic side effects, including opportunistic infections, malignancies, kidney failure, bone marrow suppression, pulmonary fibrosis, diabetes, and liver function disorders.
  • Many DMARDs e.g., etanercept and abatacept
  • the new therapeutic should decrease the inflammation and treat the inflammatory condition without suppressing the immune system in part or whole.
  • Antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of CRP.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in an immunocompromised subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP thereby reducing inflammation in the immunocompromised subject.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject wherein the autoimmune disease is incompletely responsive to, or fails, DMARD therapy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the
  • the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject with elevated levels of CRP, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject concurrently suffering from an infection or malignancy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering to the subject (a) a DMARD, and (b) a therapeutically effective amount of an oligonucleotide targeting CRP, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
  • Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 20 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consists of the sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
  • NCBI National Center for Biotechnology Information
  • 2'-0-methoxyethyl refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring.
  • a 2'-0-methoxyethyl modified sugar is a modified sugar.
  • 2'-0-methoxyethyl nucleotide means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 ' position.
  • a 5-methylcytosine is a modified nucleobase.
  • “About” means within ⁇ 10% of a value. For example, if it is stated “the compounds inhibited CRP by at least about 70%", it is implied that the CRP levels are inhibited within a range of 63% to 77%.
  • Active pharmaceutical agent means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to CRP is an active pharmaceutical agent.
  • Active target region or “target region” means a region to which one or more active antisense compounds is targeted.
  • Active antisense compounds means antisense compounds that reduce target nucleic acid levels or protein levels.
  • administering refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
  • administering means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
  • “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition.
  • amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease.
  • the severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
  • amelioration of arthritis can be measured by various assessments: ACR score (Felson et al, 1995, Arthritis Rheum., 38(6):727-35), RASS scale (Bardwell et al, 2002, Rheumatology, 41 (1 ): 38-45) or the 2010 ACR/EULAR Rheumatoid Arthritis Classification Criteria (Aletaha et al, 2010, Arthritis Rheum., 62(9) 2569-2581).
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Antibody refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense compound means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • Antisense inhibition means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • autoimmune diseases refers to disease/disorders or conditions where a body attacks its own tissues causing injury to its own tissues.
  • a body's improper immune response inappropriately triggers an inflammatory response leading tissue injury even though there may be no known injury or stimulus causing the immune response.
  • autoimmune diseases include, but are not limited to, arthritis, lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g.
  • insulin dependent diabetes mellitus type I diabetes mellitus, type II diabetes mellitus
  • good pasture's syndrome myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (e.g., rheumatoid arthritis), polymyositis, scleroderma, psoriasis, and mixed connective tissue disease.
  • rheumatic diseases e.g., rheumatoid arthritis
  • polymyositis scleroderma
  • psoriasis and mixed connective tissue disease.
  • Bicyclic sugar means a furosyl ring modified by the bridging of two non-geminal ring atoms.
  • a bicyclic sugar is a modified sugar.
  • BNA Bicyclic nucleic acid
  • BNA a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
  • Cap structure or "terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0-methoxyethyl modifications. "Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions.
  • Co-administration means administration of two or more pharmaceutical agents to an individual.
  • the two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions.
  • Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration.
  • Co-administration encompasses concomitant, parallel or sequential administration.
  • “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
  • Consstrained ethyl or “cEt” refers to a bicyclic nucleoside having a furanosyl sugar that comprises a methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') bridge between the 4' and the 2' carbon atoms.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • C-reactive protein and “CRP” is used interchangeably herein.
  • CRP nucleic acid or “CRP nucleic acid” means any nucleic acid encoding CRP.
  • a CRP nucleic acid includes a DNA sequence encoding CRP, an RNA sequence transcribed from DNA encoding CRP (including genomic DNA comprising introns and exons), and an mRNA sequence encoding CRP.
  • CRP mRNA means an mRNA encoding a CRP protein.
  • CRP specific inhibitor refers to any agent capable of specifically inhibiting the expression of CRP mRNA and/or CRP protein at the molecular level.
  • CRP specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CRP mRNA and/or CRP protein.
  • CRP specific inhibitors may affect components of the inflammatory pathway.
  • CRP specific inhibitors may affect other molecular processes in an animal.
  • “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable.
  • the diluent in an injected composition may be a liquid, e.g. saline solution.
  • Disease modifying drug refers to any agent that modifies the symptoms and/or progression associated with an inflammatory disease, disorder or condition, including autoimmune diseases (e.g. arthritis, colitis or diabetes), trauma or surgery-related disorders, sepsis, allergic inflammation and asthma.
  • DMARDs modify one or more of the symptoms and/or disease progression associated with these diseases, disorders or conditions.
  • DMARDs include TNF-a blockers, IL-6 blockers, JAK blockers, T cell modulators and B cell modulators.
  • DMARDs include, but are not limited to, methotrexate, abatacept, infliximab, adalimumab, rituximab, tofacitinib citrate, toci!izumab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP), and other cytokine (e.g., TNF-a, IL-6) blockers or antagonists.
  • the compound of the invention and one or more disease modifying drug can be administered concomitantly or sequentially.
  • Dose means a specified quantity of a pharmaceutical agent provided in a single
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
  • Effective amount means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
  • “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as a "gap segment” and the external regions may be referred to as "wing segments.”
  • “Hybridization” means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
  • Identifying an animal at risk for an inflammatory disease, disorder or condition means identifying an animal having been diagnosed with an inflammatory disease, disorder or condition or identifying an animal predisposed to develop an inflammatory disease, disorder or condition.
  • Individuals predisposed to develop an inflammatory disease, disorder or condition for example in individuals with a familial history of an autoimmune disease such as rheumatoid arthritis. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.
  • Immunosuppression or “immune suppression” refers to a reduction in the effectiveness of the immune system.
  • the level of immunosuppression may be partial or complete.
  • immunosuppression is measured by the biological parameters assessed in Example 1 : IL-6, TNF-a, IL- ⁇ ⁇ , MCP-1 , LPS binding protein, fibrinogen, soluble e-selectin, serum amyloid A (SAA). Additionally, immunosuppression may be measured by other biological factors such as an increase in the number of infections or magnitude of infection in a subject.
  • Incomplete responder refers to a subject that does not respond completely to a specific therapy i.e. the subject does not achieve complete remission of the disease.
  • the therapy can have some effect on a disease, but there is some residual disease in the subject.
  • a subject can be "incompletely responsive to DMARD” or “incomplete TNF-a responder” wherein the therapy does not completely ameliorate rheumatoid arthritis in the subject.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • Inflammation or an “Inflammatory response” is a complex biological process of the body in response to an injury or abnormal stimulation caused by a physical, chemical or biological stimulus. Inflammation is a protective process by which the body attempts to remove the injury or stimulus and begins to heal affected tissue in the body. Examples of inflammatory responses include an immune response by the body to clear the injury or stimulus responsible for initiating the inflammatory response. Alternatively, an inflammatory response can be initiated in the body even when no known injury or stimulus is found such as in autoimmune diseases. Inflammation can be mediated by a Thl or a Th2 response. Thl and Th2 responses include production of selective cytokines and cellular migration or recruitment to the inflammatory site.
  • Thl cytokines include, but are not limited to IL-1, IL-6, TNF-a, INF-a and keratinocyte chemoattractanct (KC).
  • Th2 cytokines include, but are not limited to, IL-4 and IL-5.
  • a decrease in cytokine(s) level or cellular migration can be an indication of decreased inflammation. Accordingly, cytokine level or cellular migration can be a marker for certain types of inflammation such as Thl or Th2 mediated inflammation.
  • Inflammatory disease means a disease, disorder or condition related to an inflammatory response to injury or stimulus
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • Linked nucleosides means adjacent nucleosides which are bonded together.
  • mismatch or “non-complementary nucleobase” or “MM” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
  • Modified nucleobase refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An "unmodified nucleobase” means the purine bases adenine (A) and guanine
  • G thymine
  • C cytosine
  • U uracil
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
  • a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, or a modified nucleobase.
  • Modified sugar refers to a substitution or change from a natural sugar.
  • Modulating refers to changing or adjusting a feature in a cell, tissue, organ or organism.
  • modulating CRP mRNA can mean to increase or decrease the level of CRP mRNA and/or CRP protein in a cell, tissue, organ or organism.
  • Modulating CRP mRNA and/or protein can lead to an increase or decrease in an inflammatory response in a cell, tissue, organ or organism.
  • a “modulator” effects the change in the cell, tissue, organ or organism.
  • a CRP antisense oligonucleotide can be a modulator that decreases the amount of CRP mRNA and/or CRP protein in a cell, tissue, organ or organism.
  • Microtif means the pattern of chemically distinct regions in an antisense compound.
  • Natural sugar moiety means a sugar found in DNA (2'-H) or RNA (2' -OH).
  • NSAID refers to a Non-Steroidal Anti-Inflammatory Drug. NSAIDs reduce inflammatory reactions in a subject but in general do not ameliorate or prevent a disease from occurring or progressing. Many NSAIDS have unwanted side effects. For example, the most common side effects are nausea, vomiting, diarrhea, constipation, decreased appetite, rash, dizziness, headache, and drowsiness. NSAIDs may also cause fluid retention, leading to edema. The most serious side effects are kidney failure, liver failure, ulcers and prolonged bleeding after an injury or surgery.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • miRNA microRNAs
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • Oligomer means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • “Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
  • Peptide means a molecule formed by linking at least two amino acids by amide bonds.
  • Peptide refers to polypeptides and proteins.
  • “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual.
  • a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
  • “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxico logical effects thereto.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified internucleoside linkage.
  • Portion means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
  • Prevent refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
  • Side effects means physiological responses attributable to a treatment other than the desired effects.
  • side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • Single-stranded oligonucleotide means an oligonucleotide which is not hybridized to a complementary strand.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • Targeting or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid “Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5' target site refers to the 5 '-most nucleotide of a target segment.
  • 3' target site refers to the 3 '-most nucleotide of a target segment.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • Treat refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
  • one or more pharmaceutical compositions can be administered to the animal.
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleotide) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleotide).
  • Certain embodiments provide compounds for use in targeting CRP.
  • the compounds targeting CRP are CRP specific inhibitors.
  • the CRP specific inhibitors are anti-inflammatory but not immunosuppressive.
  • the compounds targeting CRP are CRP specific inhibitors, for use in treating, preventing, or
  • CRP specific inhibitors are nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CRP mRNA and/or CRP protein.
  • the CRP specific inhibitors are oligonucleotides.
  • the oligonucleotides are modified oligonucleotides.
  • the CRP specific inhibitors decrease CRP expression.
  • the CRP nucleic acid is any of the human sequences set forth in GENBANK
  • provided for use in the methods are compounds comprising a modified oligonucleotide.
  • the compounds comprise a modified
  • the compounds comprise a modified oligonucleotide consisting of 20 linked nucleosides.
  • the compounds for use in the methods may comprise a modified oligonucleotide comprising a nucleobase sequence at least 80%, at least 85%>, at least 90%>, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NOs: 1-4.
  • the compound may comprise a modified oligonucleotide comprising a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NOs: 1-4.
  • oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases of a nucleobase sequence complementary to any of the sequences recited in SEQ ID NOs: 1-4.
  • the modified oligonucleotide for use in the methods consists of 12 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 12, 13,
  • the compound for use in the methods consists of a single-stranded oligonucleotide.
  • the oligonucleotide is a modified oligonucleotide.
  • the compound for use in the methods has at least one modified internucleoside linkage.
  • the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
  • the compound for use in the methods has at least one nucleoside comprising a modified sugar.
  • at least one modified sugar is a bicyclic sugar.
  • at least one modified sugar comprises a 2'-0-methoxyethyl
  • the compound for use in the methods has at least one nucleoside comprising a modified nucleobase.
  • the modified nucleobase is a 5- methylcytosine.
  • the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of linked deoxynucleosides; (ii) a 5' wing segment consisting of linked nucleosides; (iii) a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of ten linked deoxynucleosides; (ii) a 5' wing segment consisting of five linked nucleosides; (iii) a 3 ' wing segment consisting of five linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3 ' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising: (a) selecting a subject with inflammation; and (b)
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in an immunocompromised subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP thereby reducing inflammation in the immunocompromised subject.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in an immunocompromised subject comprising: (a) selecting an immunocompromised subject; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the immunocompromised subject thereby reducing inflammation in the subject.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject wherein the autoimmune disease is incompletely responsive to, or fails, DMARD therapy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the
  • the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject comprising: (a) selecting a subject with an autoimmune disease incompletely responsive to, or fails, DMARD therapy; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject with elevated levels of CRP, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject comprising: (a) selecting a subject with elevated CRP levels; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject concurrently suffering from an infection or malignancy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject comprising: (a) selecting a subject with the autoimmune disease concurrent with an infection or malignancy; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering to the subject (a) a DMARD, and (b) a therapeutically effective amount of an oligonucleotide targeting CRP, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject.
  • the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
  • the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
  • Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
  • Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 20 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consists of the sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
  • administration of a CRP inhibitor to an animal does not cause immunosuppression in the animal.
  • administration of a CRP inhibitor to an animal is an anti-inflammatory agent but not an immunosuppressive agent in the animal.
  • the animal is pre-treated with one or more CRP inhibitor.
  • the animal is a human.
  • the symptom or therapeutic endpoint can be selected from one or more of inflammation, pain, redness and/or swelling.
  • the immune response marker can be selected from one or more of cytokine levels, chemokine levels, acute phase protein levels or other marker.
  • cytokine levels include, but are not limited to, IL-6, TNF-a, IL-l , MCP-1, LPS binding protein, fibrinogen, soluble e-selectin and serum amyloid A (SAA).
  • the inflammatory response, disease, disorder, or condition is an autoimmune disease.
  • the inflammation is the result of an autoimmune disease.
  • the inflammation causes an autoimmune disease.
  • autoimmune diseases include, but are not limited to, arthritis, lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g.
  • insulin dependent diabetes mellitus type I diabetes mellitus, type II diabetes mellitus
  • good pasture's syndrome myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (e.g., rheumatoid arthritis), polymyositis, scleroderma, psoriasis, and mixed connective tissue disease.
  • rheumatic diseases e.g., rheumatoid arthritis
  • polymyositis scleroderma
  • psoriasis and mixed connective tissue disease.
  • arthritis examples include, but are not limited to, rheumatoid arthritis, juvenile
  • rheumatoid arthritis arthritis uratica, gout, chronic polyarthritis, periarthritis humeroscapularis, cervical arthritis, lumbosacral arthritis, osteoarthritis, psoriatic arthritis, enteropaihic arthritis and ankylosing spondylitis.
  • the compounds and compositions disclosed herein are administered to an animal.
  • administration to an animal is by a parenteral route.
  • parenteral administration is any of subcutaneous or intravenous administration.
  • the compound is co-administered with one or more second agent(s).
  • the second agent is a NSAID or a Disease Modifying Anti-Rheumatic Drug (DMARD).
  • NSAIDS include, but are not limited to, acetyl salicylic acid, celecoxib, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, meloxicam and tramadol.
  • the compound of the invention and one or more NSAIDS can be administered concomitantly or sequentially.
  • DMARDs include, but are not limited to, methotrexate, abatacept, infliximab, adalirnurnab, rituximab, tofacitmib citrate, tocilizuraab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP), and tumor necrosis factor-alpha (TNF-a) or other cytokine blockers or antagonists.
  • the compound of the invention and one or more disease modifying drug can be administered concomitantly or sequentially.
  • a compound or oligonucleotide is in salt form.
  • the compounds or compositions are formulated with a
  • the methods and compounds disclosed herein are useful in the manufacture of a medicament for reducing inflammation without causing immunosuppression.
  • kits for treating, preventing, or ameliorating an inflammatory response, disease, disorder or condition as described herein comprising: (i) a CRP specific inhibitor as described herein; and optionally (ii) an additional agent or therapy as described herein.
  • kits of the present invention may further include instructions for using the kit to treat, prevent, or ameliorate an inflammatory disease, disorder or condition as described herein by combination therapy as described herein.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense
  • oligonucleotides and siRNAs.
  • An oligomeric compound can be "antisense" to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound targeted to CRP nucleic acid is 10 to 30 nucleotides in length.
  • antisense compounds are from 10 to 30 linked nucleobases.
  • the antisense compound comprises a modified oligonucleotide consisting of 8 to
  • the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense oligonucleotide.
  • the antisense compound comprises a shortened or truncated modified oligonucleotide.
  • the shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5' end (5' truncation), the central portion or alternatively from the 3' end (3' truncation).
  • a shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5 ' end, two or more nucleosides deleted from the central portion or alternatively can have two or more nucleosides deleted from the 3 ' end.
  • the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one or more nucleoside deleted from the 5 ' end, one or more nucleoside deleted from the central portion and/or one or more nucleoside deleted from the 3' end.
  • the antisense compound comprises a lengthened or long modified oligonucleotide.
  • the additional nucleoside can be located at the 5' end, 3' end or central portion of the oligonucleotide.
  • the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5 ' end (5 ' addition), to the 3' end (3' addition) or the central portion, of the oligonucleotide.
  • the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one or more nucleoside added to the 5 ' end, one or more nucleoside added to the 3 ' end, and/or one or more nucleoside added to the central portion.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches. Gautschi et al (J. Natl. Cancer Inst.
  • antisense compounds targeted to a CRP nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • each distinct region comprises uniform sugar moieties.
  • wing-gap-wing motif is frequently described as "X-Y-Z", where "X” represents the length of the 5 ' wing region, "Y” represents the length of the gap region, and "Z” represents the length of the 3' wing region.
  • a gapmer described as "X-Y-Z” has a configuration such that the gap segment is positioned immediately adjacent each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5 ' wing segment and gap segment, or the gap segment and the 3 ' wing segment.
  • Any of the antisense compounds described herein can have a gapmer motif.
  • X and Z are the same, in other embodiments they are different.
  • Y is between 8 and 15 nucleotides.
  • X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides.
  • gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 1-8-1, 2-6-2, 6-8- 6, 5-8-5, 1-8-1, 2-6-2, 2-13-2, 1-8-2, 2-8-3, 3-10-2, 1-18-2, or 2-18-2.
  • the antisense compound as a "wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration.
  • wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.
  • antisense compounds targeted to a CRP nucleic acid possess a 5- 10-5 gapmer motif.
  • antisense compounds targeted to a CRP nucleic acid possess a 3-
  • antisense compounds targeted to a CRP nucleic acid possess a 2- 13-5 gapmer motif.
  • an antisense compound targeted to a CRP nucleic acid has a gap- widened motif.
  • a gap-widened antisense oligonucleotide targeted to a CRP nucleic acid has a gap segment of fourteen 2'-deoxyribonucleosides positioned immediately adjacent to and between wing segments of three chemically modified nucleosides.
  • the chemical modification comprises a 2 '-sugar modification.
  • the chemical modification comprises a 2'-MOE sugar modification.
  • a gap-widened antisense oligonucleotide targeted to a CRP nucleic acid has a gap segment of thirteen 2'-deoxyribonucleosides positioned immediately adjacent to and between a 5 ' wing segment of two chemically modified nucleosides and a 3 ' wing segment of five chemically modified nucleosides.
  • the chemical modification comprises a 2 '-sugar modification.
  • the chemical modification comprises a 2'-MOE sugar modification.
  • Nucleotide sequences that encode CRP include, without limitation, the following:
  • BC020766.1 (incorporated herein as SEQ ID NO: 3), and nucleotides 6134081 6137180 of
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
  • a target region is a structurally defined region of the target nucleic acid.
  • a target region may encompass a 3 ' UTR, a 5 ' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region.
  • the structurally defined regions for CRP can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference.
  • a target region may encompass the sequence from a 5 ' target site of one target segment within the target region to a 3 ' target site of another target segment within the target region.
  • a target segment is a smaller, sub-portion of a target region within a nucleic acid.
  • a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compound is targeted.
  • 5 ' target site refers to the 5 '-most nucleotide of a target segment.
  • 3 ' target site refers to the 3 '-most nucleotide of a target segment.
  • Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs.
  • the desired effect is a reduction in mRNA target nucleic acid levels.
  • the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
  • a target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values.
  • target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5 ' target sites or 3 ' target sites listed herein.
  • Suitable target segments may be found within a 5 ' UTR, a coding region, a 3 ' UTR, an intron, an exon, or an exon/intron junction.
  • Target segments containing a start codon or a stop codon are also suitable target segments.
  • a suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
  • the determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome.
  • the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
  • hybridization occurs between an antisense compound disclosed herein and a CRP nucleic acid.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with a CRP nucleic acid.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a CRP nucleic acid).
  • Non-complementary nucleobases between an antisense compound and a CRP nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of a CRP nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a CRP nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al, J. Mol. Biol, 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981 , 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • antisense compound may be fully complementary to a CRP nucleic acid, or a target region, or a target segment or target sequence thereof.
  • "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5 ' end or 3 ' end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18,
  • nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CRP nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CRP nucleic acid, or specified portion thereof.
  • the antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment.
  • antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3 ' or 5' hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to a CRP nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non- geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R 2 ) (R, Ri and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof.
  • substitutent groups including 5' and 2' substituent groups, bridging of non- geminal ring atoms to form bicyclic nucleic acids (BNA)
  • BNA bicyclic nucleic acids
  • R, Ri and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group
  • Examples of chemically modified sugars include 2'-F- 5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5 * -vinyl, 5 * -methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'- OCH 2 CH 2 F and 2'-0(CH 2 ) 2 OCH substituent groups.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • BNAs bicyclic nucleic acids
  • examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH 2 )-0-2' (LNA); 4'-(CH 2 )-S-2'; 4 , -(CH 2 ) 2 -0-2' (ENA); 4'-CH(CH 3 )-0-2' and 4 * -CH(CH 2 OCH 3 )-0-2 * (and analogs thereof see U.S.
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 4 '-2' bicyclic nucleoside or “4' to 2' bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
  • the bridge of a bicyclic sugar moiety is , -[C(R a )(Rb)] n - , -[C(R a )(R b )]n-0-, -C(R a R b )-N(R)-0- or -C(R a R b )-0-N(R)-.
  • the bridge is 4'-CH 2 -2', 4 , -(CH 2 ) 2 -2', 4 , -(CH 2 ) 3 -2', 4'-CH 2 -0-2', 4 , -(CH 2 ) 2 -0-2', 4'-CH 2 -0-N(R)-2' and 4'-CH 2 - N(R)-0-2'- wherein each Ris, independently, H, a protecting group or Ci-Ci 2 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4'-(CH 2 )-0-2' bridge may be in the a-L configuration or in the ⁇ -D configuration.
  • a-L-methyleneoxy (4'-CH 2 -0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids
  • bicyclic nucleosides include those having a 4' to 2' bridge wherein such bridges include without limitation, a-L-4'-(CH 2 )-0-2', P-D-4'-CH 2 -0-2', 4 , -(CH 2 ) 2 -0-2', 4'- CH 2 -0-N(R)-2', 4'-CH 2 -N(R)-0-2', 4'-CH(CH 3 )-0-2', 4'-CH 2 -S-2', 4'-CH 2 -N(R)-2', 4'-CH 2 - CH(CH 3 )-2', and 4'-(CH 2 ) 3 -2', wherein R is H, a protecting group or C1-C12 alkyl.
  • bicyclic nucleosides have the formula:
  • Rc is Ci-Ci 2 alkyl or an amino protecting group
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted Ci-C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • R d is Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and qa is, independently, H, halogen, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -
  • Ci-C 6 alkenyl substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl, Ci-C 6 alkoxyl, substituted Ci-C 6 alkoxyl, acyl, substituted acyl, Ci-C 6 aminoalkyl or substituted Ci-C 6 aminoalkyl;
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q g and q h are each, independently, H, halogen, C 1 -C 12 alkyl or substituted C 1 -C 12 alkyl.
  • adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4'-CH 2 -0-2' bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al, Tetrahedron, 1998, 54, 3607-3630).
  • the synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.
  • bicyclic nucleosides have the formula:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each 3 ⁇ 4, c , q k and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C 2 -
  • bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D-methyleneoxy (4'-CH 2 -0-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -0-2') BNA, (D) aminooxy (4'-CH 2 -0-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-0- 2') BNA, (F) methyl(methyleneoxy) (4'-CH(CH 3 )-0-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene-amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'--
  • Bx is the base moiety and R is, independently, H, a protecting group, Ci-C 6 alkyl or Ci-C 6 alkoxy.
  • modified tetrahydropyran nucleoside or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran "sugar” substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate.
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med.
  • sugar surrogates are selected having the formula:
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, inde endently, an internucleoside linking group linking the
  • internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
  • qi > q 2 , q3, 1 4 , q 5 , q6 and q 7 are each independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and
  • q l s q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl.
  • THP nucleosides are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is fluoro and R 2 is H; Ri is methoxy and R 2 is H, and Ri is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506).
  • morpholino means a sugar surrogate having the following formula:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as "modifed morpholinos.”
  • Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH 2 - 0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • PCT International Application WO 2007/134181 published on 11/22/07 wherein a 4'-CH 2 - 0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group.
  • carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
  • antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J. Am. Chem. Soc, 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides,
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T 3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and
  • qi, q 2 , q 3 , q 4 , q 5 , q 6 , q7, qs and q are each, independently, H, Ci-C 6 alkyl, substituted Ci-C 6 alkyl, C 2 -C6 alkenyl, substituted C 2 -C6 alkenyl, C 2 -C6 alkynyl, substituted C 2 -C6 alkynyl or other sugar substituent group.
  • 2 '-modified sugar means a furanosyl sugar modified at the 2' position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2'- substituent groups can also be selected from: Ci-Ci 2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2'- MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000).
  • 2 * -MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486- 504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
  • 2 '-modified or “2 '-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH.
  • 2'-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
  • MOE or "2'-MOE” or “2'-OCH 2 CH 2 OCH 3 " or “2'-0-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleo sides (R A) and/or deoxyribonucleosides (DNA).
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2'-MOE.
  • the 2'-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-0-2') bridging group.
  • the (4'-CH(CH 3 )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276- 278).
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl (-C ⁇ C-CH 3 ) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substi
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • antisense compounds targeted to a CRP nucleic acid comprise one or more modified nucleobases.
  • gap-widened antisense oligonucleotides targeted to a CRP nucleic acid comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to a CRP nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • the "pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
  • the excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.
  • Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • binding agents e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxyprop
  • compositions of the present invention can also be used to formulate the compositions of the present invention.
  • suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a CRP nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the antisense compound is an antisense oligonucleotide.
  • compositions comprising antisense compounds encompass any one of
  • compositions are also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bio equivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • one or more modified oligonucleotides of the present invention can be formulated as a prodrug.
  • a prodrug can be produced by modifying a pharmaceutically active compound such that the active compound will be regenerated upon in vivo administration.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • a pharmaceutical composition comprises a sterile lyophilized modified oligonucleotide that is reconstituted with a suitable diluent, e.g., sterile water for injection or sterile saline for injection.
  • a suitable diluent e.g., sterile water for injection or sterile saline for injection.
  • the reconstituted product is administered as a subcutaneous injection or as an intravenous infusion after dilution into saline.
  • the lyophilized drug product consists of a modified oligonucleotide which has been prepared in water for injection, or in saline for injection, adjusted to pH 7.0-9.0 with acid or base during preparation, and then lyophilized.
  • the lyophilized modified oligonucleotide may be 25-800 mg, or any dose between 25-800 mg as described above, of a modified oligonucleotide.
  • the lyophilized drug product may be packaged in a 2 mL Type I, clear glass vial (ammonium sulfate-treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum flip-off overseal.
  • compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art- established usage levels.
  • the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • additional materials useful in physically formulating various dosage forms of the compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
  • compositions of the present invention can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
  • auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
  • compositions of the present invention comprise one or more modified oligonucleotides and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • a pharmaceutical composition of the present invention is prepared using known techniques, including, but not limited to mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or tabletting processes.
  • the compounds of the invention targeted to a CRP nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent includes, but is not limited to, water, oils, alcohols, or phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered parenterally.
  • employed in the methods described herein is a pharmaceutical composition comprising an compound targeted to a CRP nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is PBS.
  • the compound is an antisense oligonucleotide.
  • a pharmaceutical composition of the present invention is a liquid
  • a liquid pharmaceutical composition is prepared using ingredients known in the art, including, but not limited to, water, buffered saline, glycols, oils, alcohols, flavoring agents, preservatives, and coloring agents.
  • a pharmaceutical composition of the present invention is a solid (e.g., a powder, tablet, and/or capsule).
  • a solid pharmaceutical composition comprising one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders, and disintegrating agents.
  • a pharmaceutical composition of the present invention is formulated as a depot preparation. Certain such depot preparations are typically longer acting than non-depot preparations. In certain embodiments, such preparations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. In certain embodiments, depot preparations are prepared using suitable polymeric or hydrophobic materials (for example an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • a pharmaceutical composition of the present invention comprises a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • a pharmaceutical composition of the present invention comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • compositions include liposomes coated with a tissue-specific antibody.
  • a pharmaceutical composition of the present invention comprises a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • VPD co-solvent system is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • a pharmaceutical composition of the present invention comprises a sustained-release system.
  • a sustained-release system is a semipermeable matrix of solid hydrophobic polymers.
  • sustained-release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks or months.
  • a pharmaceutical composition of the present invention is prepared for oral administration.
  • a pharmaceutical composition is formulated by combining one or more compounds comprising a modified oligonucleotide with one or more pharmaceutically acceptable carriers.
  • pharmaceutically acceptable carriers enable pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject.
  • pharmaceutical compositions for oral use are obtained by mixing oligonucleotide and one or more solid excipient.
  • Suitable excipients include, but are not limited to, fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • PVP polyvinylpyrrolidone
  • such a mixture is optionally ground and auxiliaries are optionally added.
  • pharmaceutical compositions are formed to obtain tablets or dragee cores.
  • disintegrating agents e.g., cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate are added.
  • dragee cores are provided with coatings. In certain such embodiments,
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to tablets or dragee coatings.
  • compositions for oral administration are push-fit capsules made of gelatin.
  • Certain of such push-fit capsules comprise one or more pharmaceutical agents of the present invention in admixture with one or more filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • pharmaceutical compositions for oral administration are soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • one or more pharmaceutical agents of the present invention are be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added.
  • compositions are prepared for buccal
  • compositions are tablets or lozenges formulated in conventional manner.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer (e.g., PBS).
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
  • a pharmaceutical composition of the present invention comprises a modified oligonucleotide in a therapeutically effective amount.
  • the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated.
  • compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect.
  • a dosing regimen e.g., dose, dose frequency, and duration
  • the desired effect can be, for example, reduction of CRP or the prevention, reduction, amelioration or slowing the progression of a disease or condition associated with CRP.
  • the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject.
  • concentration of pharmaceutical composition can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition.
  • dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.
  • Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from O.O ⁇ g to lOOmg per kg of body weight, or within a range of 0.00 lmg to lOOOmg dosing, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years.
  • oligonucleotide is administered in maintenance doses, ranging from O.O ⁇ g to lOOmg per kg of body weight, once or more daily, to once every 20 years or ranging from O.OOlmg to lOOOmg dosing.
  • the compounds or pharmaceutical compositions of the present invention can be any organic or pharmaceutical compositions of the present invention.
  • Parenteral administration includes intravenous, intra-arterial,
  • parenteral administration is by infusion.
  • Infusion can be chronic or continuous or short or intermittent.
  • infused pharmaceutical agents are delivered with a pump.
  • parenteral administration is by injection.
  • the injection can be delivered with a syringe or a pump.
  • the injection is a bolus injection.
  • the injection is administered directly to a tissue or organ.
  • formulations for parenteral, intrathecal or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • the compounds of the invention can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability.
  • stabilizing groups include cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini.
  • Cap structures are well known in the art and include, for example, inverted deoxy abasic caps.
  • 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003. Cell culture and antisense compounds treatment
  • CRP nucleic acids The effects of antisense compounds on the level, activity or expression of CRP nucleic acids can be tested in vitro in a variety of cell types.
  • Cell types used for such analyses are available from commerical vendors ⁇ e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA).
  • Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes. In vitro testing of antisense oligonucleotides
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • cells are treated with antisense oligonucleotides when the cells reach
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA).
  • Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen,
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with
  • LIPOFECT AMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes OligofectamineTM (Invitrogen Life Technologies, Carlsbad, CA). Antisense oligonucleotide is mixed with OligofectamineTM in Opti-MEMTM-l reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide with an OligofectamineTM to oligonucleotide ratio of approximately 0.2 to 0.8 per 100 nM.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum- free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 ⁇ of FuGENE 6 per 100 nM.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001).
  • Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line.
  • Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001). RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols. Analysis of inhibition of target levels or expression
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT reverse transcriptase
  • cDNA complementary DNA
  • the RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A or GAPDH, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A or
  • GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately.
  • Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Carlsbad, CA). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
  • a CYTOFLUOR® 4000 instrument PE Applied Biosystems
  • Probes and primers are designed to hybridize to a CRP nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA).
  • the PCR probes can have JOE or FAM covalently linked to the 5 ' end and TAMRA or MGB covalently linked to the 3 ' end, where JOE or FAM is the fluorescent reporter dye and
  • TAMRA or MGB is the quencher dye.
  • primers and probe designed to a sequence from a different species are used to measure expression.
  • a human GAPDH primer and probe set can be used to measure GAPDH expression in monkey-derived cells and cell lines.
  • Gene target quantities obtained by RT, real-time PCR can be normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes, Inc. Eugene, OR).
  • GAPDH expression can be quantified by RT, real-time PCR, by being run simultaneously with the target, multiplexing, or separately.
  • Total RNA can be quantified using RiboGreenTM RNA quantification reagent (Molecular Probes, Inc. Eugene, OR).
  • Antisense inhibition of CRP nucleic acids can be assessed by measuring CRP protein levels. Protein levels of CRP can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked
  • ELISA immunosorbent assay
  • quantitative protein assays protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd Ed., 2001).
  • FACS fluorescence-activated cell sorting
  • Antibodies useful for the detection of human and rat CRP are commercially available.
  • Antisense compounds for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of CRP and produce phenotypic changesas measeured by art known methods such as the ACR score, RASS scale or the 2010 ACR/EULAR Rheumatoid
  • Changes in CRP protein levels can also be measured. Changes in CRP expression can be measured by determing the level of inflammation, inflammatory conditions (e.g., asthma, arthritis, colitis) or inflammatory markers (e.g., cytokines, chemokines, acute phase proteins) present in the animal.
  • inflammatory conditions e.g., asthma, arthritis, colitis
  • inflammatory markers e.g., cytokines, chemokines, acute phase proteins
  • Inflammation is now recognized as a type of non-specific immune response to an injury or stimulus.
  • the inflammatory response has a cellular component and an exudative component.
  • resident macrophages at the site of injury or stimulus initiate the inflammatory response by releasing inflammatory mediators such as TNF-a, IFN-a, IL-1 , IL-6, IL-12, IL-18, and others.
  • Leukocytes are then recruited to move into the inflamed tissue area and perform various functions such as release of additional cellular mediators, phagocytosis, release of enzymatic granules and other functions.
  • the exudative component involves the passage of plasma fluid containing proteins from blood vessels to the inflamed tissue site.
  • Inflammatory mediators such as bradykinin, nitric oxide, and histamine cause blood vessels to become dilated, slow the blood flow in the vessels and increase the blood vessel permeability, allowing the movement of fluid and protein into the tissue.
  • Biochemical cascades are activated in order to propagate the inflammatory response (e.g., complement system in response to infection, fibrinolysis and coagulation systems in response to necrosis due to a burn or trauma, kinin system to sustain inflammation) (Robbins Pathologic Basis of Disease, Elsevier Health Sciences).
  • Inflammation can be acute or chronic. Acute inflammation has a fairly rapid onset, quickly becomes severe and quickly and distinctly clears after a few days to a few weeks. Chronic inflammation can begin rapidly or slowly and tends to persist for weeks, months or years with a vague and indefinite termination. Chronic inflammation can result when an injury or stimulus, or products resulting from its presence, persists at the site of injury or stimulation and the body's immune response is not sufficient to overcome its effects.
  • the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention.
  • the individual has or is at risk for inflammation.
  • the individual has or is at risk for an inflammatory disease, disorder or condition.
  • the individual is at risk for an inflammatory disease, disorder or condition.
  • the individual is immunocompromised.
  • the individual has a malignancy.
  • the individual has an infection (active or latent).
  • the invention provides methods for prophylactically reducing CRP expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a CRP nucleic acid.
  • administration of a therapeutically effective amount of an antisense compound targeted to a CRP nucleic acid is accompanied by monitoring of CRP levels in the serum of an individual, to determine an individual's response to administration of the antisense compound.
  • An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • administration of an antisense compound targeted to a CRP nucleic acid results in reduction of CRP expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • administration of an antisense compound targeted to a CRP nucleic acid results in a change in inflammatory disease, condition, symptom or marker (e.g., ACR score, cytokine levels, chemokine levels).
  • administration of a CRP antisense compound decreases the inflammatory disease, condition, symptom or marker by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • compositions comprising an antisense compound targeted to CRP are used for the preparation of a medicament for treating subject described herein.
  • a first agent comprising a modified oligonucleotide provided herein is co-administered with one or more secondary agents.
  • such second agents are designed to treat the same inflammatory disease, disorder or condition as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein.
  • such first agent are designed to treat an undesired side effect of a second agent.
  • second agents are co-administered with the first agent to treat an undesired effect of the first agent.
  • second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
  • a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.
  • second agents include, but are not limited to, NSAIDS and/or DMARDs as described herein.
  • the disease modifying drug is administered prior to administration of the first agent.
  • the disease modifying drug is administered following administration of the first agent.
  • the disease modifying drugs is administered at the same time as the first agent.
  • the dose of a co-administered disease modifying drug is the same as the dose that would be administered if the disease modifying drug was administered alone.
  • the dose of a co- administered disease modifying drug is lower than the dose that would be administered if the disease modifying drugs was administered alone.
  • the dose of a co -administered disease modifying drug is greater than the dose that would be administered if the disease modifying drugs was administered alone.
  • CRP oligonucleotides oligonucleotides targeting a nucleic acid encoding CRP protein
  • CRP oligonucleotides to reduce inflammation and treat, prevent and/or ameliorate an inflammatory disease or condition such as an autoimmune disease or symptoms related to the disease without suppressing the immune system.
  • DMARDs Disease Modifying Anti-Rheumatic Drugs
  • Many of these DMARDs are nonspecific
  • immunosuppressive drugs that suppress a large part of, or the entire, immune system of the subject. Prolonged therapy with these immunosuppressive drugs potentially produces toxic side effects, including opportunistic infections, malignancies, kidney failure, bone marrow suppression, pulmonary fibrosis, diabetes, and liver function disorders.
  • DMARDs e.g., etanercept and abatacept
  • DMARDs are contra-indicated in the presence of malignancies or infections (active or latent).
  • compositions described herein provide an advantage over the commercially available DMARDs by decreasing inflammation or an inflammatory disease but not suppressing the immune system. Accordingly, the compositions described herein can be used in subjects in need of inflammation alleviation but immunosuppressive therapy is contra-indicated. For example, immunocompromised subjects can be treated with the compositions described herein while commercially available DMARDs are contra-indicated. Other populations that can benefit from the compositions described herein include subjects with malignancies or subjects with infections (active or latent).
  • compositions described herein are not used in combination with each other for fear of enhancing immune suppression in a subject.
  • an advantage of the compositions described herein is that they can be used in combination with commercially available DMARDs to reduce inflammation and treat inflammatory diseases.
  • Example 1 Assessment of the effects of pre-treatment with an antisense oligonucleotide targeting C-reactive protein (CRP) on acute inflammatory response
  • CRP C-reactive protein
  • Eligible subjects were male volunteers, 18 to 40 years in age, 55-95 kg in body weight, and who were in good health, with no clinically significant abnormalities in their medical history, physical examination and laboratory evaluations.
  • the study excluded subjects who had a CRP level of greater than 10 mg/dL, and had a history of any clinically important allergy or a known allergy to lactose or polyethylene glycol (which were the excipients in the endotoxin formulation), were currently using any kind of medication of health supplement, received a vaccination within 6 months of screening, participated in a clinical trial of an immunosuppressive drug or one using endotoxin within 6 months of screening, had received another investigational drug, medical device or medical procedure within 90 days or 5 half-lives of screening, or participated in an investigational study involving systemic administration of an oligonucleotide within 9 months of screening.
  • ISIS 329993 (AGCATAGTTAACGAGCTCCC, designated herein as SEQ ID NO: 5) is a 5- 10-5 MOE gapmer, 20 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked by wing segments on the 5 ' direction and the 3 ' direction comprising five nucleosides each. Each nucleoside in the 5 ' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification.
  • ISIS 329993 targets GENBANK Accession No. NM_000567.2 (SEQ ID NO: 1) from positions 977 to 996.
  • a Phase 1 study involving 35 healthy subjects the subjects were divided into three groups. Study subjects were enrolled into two sequential dose cohorts, where each cohort was randomized in a -2: 1 ratio to a placebo group. In a cohort of 12 subjects, ISIS 329993 at a dose of 400 mg was administered intravenously on days 1, 3, 5, 8, 15 and 22 (6 doses total) prior to administration of endotoxin. In a second cohort of 11 subjects, ISIS 329993 at a dose of 600 mg was administered intravenously on days 1, 3, 5, 8, 15 and 22 (6 doses total) prior to administration of endotoxin.
  • the placebo was administered intravenously on days 1, 3, 5, 8, 15 and 22 (6 doses total) prior to administration of endotoxin. Endotoxin challenge was given on day 26 and assessment of inflammatory biomarkers and immune cell counts was done at various time points after.
  • the subjects received an intravenous bolus of purified lipopolysaccharide (LPS) from E. Coli: l 13 (CCRE, Lot #3; NIH Clinical Center, Bethesda, MD) in the amount of 2 ng/kg body weight.
  • LPS lipopolysaccharide
  • the protocol was approved by an independent institutional review board (Copernicus Group, Durham, NC) and the study was performed in compliance with the standards of Good Clinical Practice and the Declaration of Helsinki in its revised edition (Washington DC, 2002).
  • Inflammation biomarkers CRP, IL-6, TNF-a, IL- ⁇ , MCP-1, LPS binding protein, fibrinogen, soluble E-selection, and SAA were measured to monitor adverse events.
  • One measure used was maximum change (Max. Change), which is the maximum amount of change in biomarker compared to baseline levels seen any time from just after the endotoxin challenge to 72 hrs after.
  • Another measure used was area under the curve, where the change in levels of the biomarker compared to baseline was plotted over time on a graph and the total area under the curve (AUC) was measured. The results are presented in Table 1.
  • Tables 2 to 10 The measurements over time for immune cell counts for WBC, neutrophils, lymphocytes, monocytes, and platelets, are presented in Tables 11 to 15.
  • the numbers with asterisks in Table 1 were found to be statistically significant (p ⁇ 0.05 versus the placebo) as per the Wilcoxon Rank Sum Test.
  • the numbers with asterisks in Tables 2-15 were found to be statistically significant (p ⁇ 0.05 versus the placebo) as per the Kolmogorov-Smimov test of residuals.
  • the hours in brackets in Tables 2-15 are the number of hours post-endotoxin challenge.
  • ISIS 329993 selectively inhibits CRP in a statistically significant, dose-dependent manner, without affecting the immune response to endotoxin as assessed by the parameters listed in tables 3-15.
  • Pre-treatment of subjects with ISIS 329993 produced a dose- dependent, statistically significant reduction in endotoxin-induced CRP levels, as well as the AUC, over time.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed herein are compositions and methods for inhibiting CRP and reducing inflammation without causing immunosuppression in a subject. Inflammatory diseases in a subject such as arthritis can be treated, ameliorated or prevented with the administration of antisense compounds targeted to CRP. The present invention provides methods, compounds, and compositions for reducing inflammation without immunosuppression in an animal by administering a CRP inhibitor to the animal.

Description

MODULATION OF INFLAMMATORY RESPONSES BY C-REACTIVE PROTEIN
SEQUENCE LISTING
The present application is being filed along with a Sequence Listing in electronic format.
The Sequence Listing is provided as a file entitled BIOL0222WOSEQ_ST25.txt created January 28, 2014, which is 24 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. FIELD OF THE INVENTION
The present invention provides methods, compounds, and compositions for reducing inflammation without immunosuppression in an animal by administering a CRP inhibitor to the animal. BACKGROUND OF THE INVENTION
C-reactive protein
C-reactive protein (also known as CRP and PTX1) is an essential human acute-phase reactant produced in the liver in response to a variety of inflammatory cytokines. The protein, first identified in 1930, is highly conserved and considered to be an early indicator of infectious or inflammatory conditions. Plasma CRP levels increase 1,000-fold in response to infection, ischemia, trauma, burns, and inflammatory conditions. Since the biological half-life of CRP is not influenced by age, liver or kidney function or pharmacotherapy, it is a reliable biochemical marker for tissue destruction, necrosis and inflammation and its measurement is widely used to monitor various inflammatory states, angina pectoris, vascular insults, end-stage renal disease, rheumatoid arthritis, obesity and atherosclerosis (Arici and Walls, Kidney Int., 2001, 59, 407-414; Gabay and Kushner, N.
Engl. J. Med, 1999, 340, 448-454; Highton et al., J. Rheumatol, 1985, 12, 871-875; Hulthe et al, Clin Sci (Colch), 2001, 100, 371-378; Lagrand et al, Circulation, 1999, 100, 6+96-102; Morrow and Ridker, Med. Clin. North Am., 2000, 84, 149-161, ix; Szalai et al, Immunol Res, 1997, 16, 127- 136; Westhuyzen and Healy, Ann. Clin. Lab. Sci., 2000, 30, 133-143; Yudkin et al., Atherosclerosis, 2000, 148, 209-214, Ruuskanen et al., J. Pediatr., 1985, 107, 97-100, Barany, Nephrol. Dial.
Transplant., 2001, 16, 224-227).
Structurally, CRP is a member of the pentraxin family of proteins, which are characterized by a cyclic pentameric structure and radial symmetry. The five identical 24-kDa protomers consist of 206 amino acids, and are noncovalently linked (Lei et al., J. Biol. Chem., 1985, 260, 13377- 13383; Szalai et al., 1997, cited above). The genomic DNA sequence for human CRP has been reported by Lei et al. 1985, cited above, as have mutant forms of the protein (International Patent Publication No. WO 1996/06624) and methods to deliver materials into cells using the mutant protein as a carrier (International Patent Publication No. WO 2000/11207).
CRP binds to a broad range of cellular substances such as phosphocholine, fibronectin, chromatin, histones, and ribonucleoprotein in a calcium-dependent manner (Szalai et al., 1997, cited above). It is a ligand for specific receptors on phagocytic leukocytes, mediates activation reactions on monocytes and macrophages, and activates complement (Szalai et al., 1997, cited above).
The function of CRP is related to its role in the innate immune system. Similar to immunoglobulin(Ig) G, it activates complement, binds to Fc receptors and acts as an opsonin for various pathogens. Interaction of CRP with Fc receptors leads to the generation of proinflammatory cytokines that enhance the inflammatory response. Unlike IgG, which specifically recognizes distinct antigenic epitopes, CRP recognizes altered self and foreign molecules based on pattern recognition. CRP is therefore thought to act as a surveillance molecule for altered self and certain pathogens. This recognition provides early defense innate immunity and leads to a proinflammatory signal and activation of the humoral, adaptive immune system. Thus, the CRP molecule has both a recognition function and an effector function. Therefore, the pharmacological modulation of CRP activity and/or its expression is an appropriate point of therapeutic intervention in pathological conditions.
Antisense oligonucleotides inhibiting CRP have previously been designed and disclosed in various applications and patents, including, WO 2005/005599, WO 2007/143317, WO 03/010284, U.S. 7,425,545, U.S. 7,863,252, U.S. 6,964,950, U.S. 7,491,815, U.S. 7,915,231, U.S. 8,093,224 and U.S. 7,326,693, all incorporated-by-reference herein. An antisense oligonucleotide targeting CRP has been shown in a phase I clinical trial to be safe and effective in inhibiting CRP expression (February 23, 2011, Press Release, entitled "Isis Pharmaceuticals Reports That Its Selective CRP Inhibitor Demonstrated Activity in a Phase 1 Study") and is currently in clinical trials to assess its affects on two indications (February 26, 2013, Press Release entitled "Isis Pharmaceuticals Initiates Phase 2 Study of ISIS-CRPRx in Patients With Atrial Fibrillation"; Clinicaltrials.gov website,
"Safety, Tolerability, and Pharmacodynamic Study of ISIS CRP Rx in Rheumatoid Arthritis"). Inflammation
Inflammation is a complex biological process of the body in response to an injury or abnormal stimulation caused by a physical, chemical or biological stimulus. Inflammation is a protective process by which the body attempts to remove the injury or stimulus and begins to heal affected tissue in the body.
Inflammatory responses, although generally helpful to the body to clear an injury or stimulus, can sometimes cause injury to the body. In some cases, a body's immune response inappropriately triggers an inflammatory response where there is no known injury or stimulus to the body. In these cases, categorized as autoimmune diseases, the body attacks its own tissues causing injury to its own tissues.
Treatment to decrease inflammation includes non-steroidal anti-inflammatory drugs
(NSAIDS) as well as disease modifying drugs. Many of these drugs have unwanted side effects. For example, with NSAIDS, the most common side effects are nausea, vomiting, diarrhea, constipation, decreased appetite, rash, dizziness, headache, and drowsiness. NSAIDs may also cause fluid retention, leading to edema. The most serious side effects are kidney failure, liver failure, ulcers and prolonged bleeding after an injury or surgery.
Additionally, Disease Modifying Anti-Rheumatic Drugs (DMARDs) are used to treat inflammatory conditions such as autoimmune diseases. Many of these DMARDs are nonspecific cytotoxic immunosuppressive drugs that suppress a large part of, or the entire, immune system of the subject. Prolonged therapy with these immunosuppressive drugs potentially produces toxic side effects, including opportunistic infections, malignancies, kidney failure, bone marrow suppression, pulmonary fibrosis, diabetes, and liver function disorders. Many DMARDs (e.g., etanercept and abatacept) are contra-indicated in the presence of sepsis or other infections (active or latent).
Accordingly, there is a need to find alternative therapeutics with a more attractive clinical profile to treat inflammation. Ideally the new therapeutic should decrease the inflammation and treat the inflammatory condition without suppressing the immune system in part or whole.
Antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of CRP. SUMMARY OF THE INVENTION
Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for reducing inflammation in an immunocompromised subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP thereby reducing inflammation in the immunocompromised subject. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the
oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject wherein the autoimmune disease is incompletely responsive to, or fails, DMARD therapy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the
oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject with elevated levels of CRP, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject concurrently suffering from an infection or malignancy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering to the subject (a) a DMARD, and (b) a therapeutically effective amount of an oligonucleotide targeting CRP, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 20 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consists of the sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
DETAILED DESCRIPTION OF THE INVENTION
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety. Definitions
Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession
Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
"2'-0-methoxyethyl" (also 2'-MOE and 2'-0(CH2)2-OCH3) refers to an O-methoxy-ethyl modification of the 2' position of a furosyl ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.
"2'-0-methoxyethyl nucleotide" means a nucleotide comprising a 2'-0-methoxyethyl modified sugar moiety.
"5 -methyl cytosine" means a cytosine modified with a methyl group attached to the 5 ' position. A 5-methylcytosine is a modified nucleobase.
"About" means within ±10% of a value. For example, if it is stated "the compounds inhibited CRP by at least about 70%", it is implied that the CRP levels are inhibited within a range of 63% to 77%. "Active pharmaceutical agent" means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments an antisense oligonucleotide targeted to CRP is an active pharmaceutical agent.
"Active target region" or "target region" means a region to which one or more active antisense compounds is targeted. "Active antisense compounds" means antisense compounds that reduce target nucleic acid levels or protein levels.
"Administered concomitantly" refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
"Administering" means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
"Amelioration" refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art. For example, amelioration of arthritis can be measured by various assessments: ACR score (Felson et al, 1995, Arthritis Rheum., 38(6):727-35), RASS scale (Bardwell et al, 2002, Rheumatology, 41 (1 ): 38-45) or the 2010 ACR/EULAR Rheumatoid Arthritis Classification Criteria (Aletaha et al, 2010, Arthritis Rheum., 62(9) 2569-2581).
"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
"Antibody" refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.
"Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
"Antisense compound" means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
"Antisense inhibition" means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
"Autoimmune Disease" refers to disease/disorders or conditions where a body attacks its own tissues causing injury to its own tissues. In autoimmune diseases, a body's improper immune response inappropriately triggers an inflammatory response leading tissue injury even though there may be no known injury or stimulus causing the immune response. Examples of autoimmune diseases include, but are not limited to, arthritis, lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g. insulin dependent diabetes mellitus, type I diabetes mellitus, type II diabetes mellitus), good pasture's syndrome, myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (e.g., rheumatoid arthritis), polymyositis, scleroderma, psoriasis, and mixed connective tissue disease.
"Bicyclic sugar" means a furosyl ring modified by the bridging of two non-geminal ring atoms. A bicyclic sugar is a modified sugar.
"Bicyclic nucleic acid" or "BNA" refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.
"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.
"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0-methoxyethyl modifications. "Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions.
"Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses concomitant, parallel or sequential administration.
"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
"Constrained ethyl" or "cEt" refers to a bicyclic nucleoside having a furanosyl sugar that comprises a methyl(methyleneoxy) (4'-CH(CH3)-0-2') bridge between the 4' and the 2' carbon atoms.
"Contiguous nucleobases" means nucleobases immediately adjacent to each other.
"C-reactive protein" and "CRP" is used interchangeably herein.
"CRP nucleic acid" or "CRP nucleic acid" means any nucleic acid encoding CRP. For example, in certain embodiments, a CRP nucleic acid includes a DNA sequence encoding CRP, an RNA sequence transcribed from DNA encoding CRP (including genomic DNA comprising introns and exons), and an mRNA sequence encoding CRP. "CRP mRNA" means an mRNA encoding a CRP protein.
"CRP specific inhibitor" refers to any agent capable of specifically inhibiting the expression of CRP mRNA and/or CRP protein at the molecular level. For example, CRP specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CRP mRNA and/or CRP protein. In certain embodiments, by specifically modulating CRP mRNA level and/or CRP protein expression, CRP specific inhibitors may affect components of the inflammatory pathway. Similarly, in certain embodiments, CRP specific inhibitors may affect other molecular processes in an animal.
"Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition may be a liquid, e.g. saline solution.
"Disease modifying drug", "Disease modifying anti-inflammatory drug" or "DMARD" refers to any agent that modifies the symptoms and/or progression associated with an inflammatory disease, disorder or condition, including autoimmune diseases (e.g. arthritis, colitis or diabetes), trauma or surgery-related disorders, sepsis, allergic inflammation and asthma. DMARDs modify one or more of the symptoms and/or disease progression associated with these diseases, disorders or conditions. DMARDs include TNF-a blockers, IL-6 blockers, JAK blockers, T cell modulators and B cell modulators. Examples of DMARDs include, but are not limited to, methotrexate, abatacept, infliximab, adalimumab, rituximab, tofacitinib citrate, toci!izumab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP), and other cytokine (e.g., TNF-a, IL-6) blockers or antagonists. The compound of the invention and one or more disease modifying drug can be administered concomitantly or sequentially.
"Dose" means a specified quantity of a pharmaceutical agent provided in a single
administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
"Effective amount" means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a "gap segment" and the external regions may be referred to as "wing segments." "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.
"Identifying an animal at risk for an inflammatory disease, disorder or condition" means identifying an animal having been diagnosed with an inflammatory disease, disorder or condition or identifying an animal predisposed to develop an inflammatory disease, disorder or condition.
Individuals predisposed to develop an inflammatory disease, disorder or condition, for example in individuals with a familial history of an autoimmune disease such as rheumatoid arthritis. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.
"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.
"Immunosuppression" or "immune suppression" refers to a reduction in the effectiveness of the immune system. The level of immunosuppression may be partial or complete. In certain embodiments, immunosuppression is measured by the biological parameters assessed in Example 1 : IL-6, TNF-a, IL-Ι β, MCP-1 , LPS binding protein, fibrinogen, soluble e-selectin, serum amyloid A (SAA). Additionally, immunosuppression may be measured by other biological factors such as an increase in the number of infections or magnitude of infection in a subject.
"Incomplete responder", "incompletely responsive" or "partial responder" refers to a subject that does not respond completely to a specific therapy i.e. the subject does not achieve complete remission of the disease. The therapy can have some effect on a disease, but there is some residual disease in the subject. For example, a subject can be "incompletely responsive to DMARD" or "incomplete TNF-a responder" wherein the therapy does not completely ameliorate rheumatoid arthritis in the subject.
"Individual" means a human or non-human animal selected for treatment or therapy.
"Inflammation" or an "Inflammatory response" is a complex biological process of the body in response to an injury or abnormal stimulation caused by a physical, chemical or biological stimulus. Inflammation is a protective process by which the body attempts to remove the injury or stimulus and begins to heal affected tissue in the body. Examples of inflammatory responses include an immune response by the body to clear the injury or stimulus responsible for initiating the inflammatory response. Alternatively, an inflammatory response can be initiated in the body even when no known injury or stimulus is found such as in autoimmune diseases. Inflammation can be mediated by a Thl or a Th2 response. Thl and Th2 responses include production of selective cytokines and cellular migration or recruitment to the inflammatory site. Cell types that can migrate to an inflammatory site include, but are not limited to, eosinophils and macrophages. Thl cytokines include, but are not limited to IL-1, IL-6, TNF-a, INF-a and keratinocyte chemoattractanct (KC). Th2 cytokines include, but are not limited to, IL-4 and IL-5. A decrease in cytokine(s) level or cellular migration can be an indication of decreased inflammation. Accordingly, cytokine level or cellular migration can be a marker for certain types of inflammation such as Thl or Th2 mediated inflammation.
"Inflammatory disease", "inflammatory disorder" or "inflammatory condition" means a disease, disorder or condition related to an inflammatory response to injury or stimulus
characterized by clinical signs of increased redness {rubor), temperature (calor), swelling (tumor), pain (dolor) and/or loss of function (functio laesa) in a tissue. Increased redness and temperature is caused by vasodilation leading to increased blood supply at core body temperature to the inflamed tissue site. Swelling is caused by vascular permeability and accumulation of protein and fluid at the inflamed tissue site. Pain is due to the release of chemicals (e.g. bradykinin) at the inflamed tissue site that stimulate nerve endings. Loss of function may be due to several causes.
"Internucleoside linkage" refers to the chemical bond between nucleosides.
"Linked nucleosides" means adjacent nucleosides which are bonded together.
"Mismatch" or "non-complementary nucleobase" or "MM" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
"Modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine
(G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A "modified nucleoside" means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.
"Modified oligonucleotide" means an oligonucleotide comprising a modified internucleoside linkage, a modified sugar, or a modified nucleobase.
"Modified sugar" refers to a substitution or change from a natural sugar. "Modulating" refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating CRP mRNA can mean to increase or decrease the level of CRP mRNA and/or CRP protein in a cell, tissue, organ or organism. Modulating CRP mRNA and/or protein can lead to an increase or decrease in an inflammatory response in a cell, tissue, organ or organism. A "modulator" effects the change in the cell, tissue, organ or organism. For example, a CRP antisense oligonucleotide can be a modulator that decreases the amount of CRP mRNA and/or CRP protein in a cell, tissue, organ or organism.
"Motif means the pattern of chemically distinct regions in an antisense compound.
"Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. "Natural sugar moiety" means a sugar found in DNA (2'-H) or RNA (2' -OH).
"NSAID" refers to a Non-Steroidal Anti-Inflammatory Drug. NSAIDs reduce inflammatory reactions in a subject but in general do not ameliorate or prevent a disease from occurring or progressing. Many NSAIDS have unwanted side effects. For example, the most common side effects are nausea, vomiting, diarrhea, constipation, decreased appetite, rash, dizziness, headache, and drowsiness. NSAIDs may also cause fluid retention, leading to edema. The most serious side effects are kidney failure, liver failure, ulcers and prolonged bleeding after an injury or surgery.
"Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.
"Nucleoside" means a nucleobase linked to a sugar.
"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
"Oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. "Parenteral administration" means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
"Peptide" means a molecule formed by linking at least two amino acids by amide bonds.
Peptide refers to polypeptides and proteins.
"Pharmaceutical composition" means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.
"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxico logical effects thereto.
"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.
"Portion" means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
"Prevent" refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.
"Side effects" means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality. "Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a complementary strand.
"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.
"Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
"Target nucleic acid," "target RNA," and "target RNA transcript" all refer to a nucleic acid capable of being targeted by antisense compounds.
"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.
"Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
"Treat" refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. In certain
embodiments, one or more pharmaceutical compositions can be administered to the animal.
"Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleotide) or a DNA nucleotide (i.e. β-D-deoxyribonucleotide).
Certain Embodiments
Certain embodiments provide compounds for use in targeting CRP. In certain embodiments, the compounds targeting CRP are CRP specific inhibitors. In certain embodiments, the CRP specific inhibitors are anti-inflammatory but not immunosuppressive. In certain embodiments, the compounds targeting CRP are CRP specific inhibitors, for use in treating, preventing, or
ameliorating an inflammatory response, disease, disorder or condition. In certain embodiments, CRP specific inhibitors are nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CRP mRNA and/or CRP protein. In certain embodiments, the CRP specific inhibitors are oligonucleotides. In certain embodiments, the oligonucleotides are modified oligonucleotides. In certain embodiments, the CRP specific inhibitors decrease CRP expression.
In certain embodiments, provided are compounds targeted to a CRP nucleic acid. In certain embodiments, the CRP nucleic acid is any of the human sequences set forth in GENBANK
Accession No. NM_000567.2 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. M1 1725.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. BC020766.1 (incorporated herein as SEQ ID NO: 3), and nucleotides 6134081 6137180 of GENBANK
Accession No. NT 004668.15 (incorporated herein as SEQ ID NO: 4).
In certain embodiments, provided for use in the methods are compounds comprising a modified oligonucleotide. In certain embodiments, the compounds comprise a modified
oligonucleotide consisting of 12 to 30 linked nucleosides. In certain embodiments, the compounds comprise a modified oligonucleotide consisting of 20 linked nucleosides.
In certain embodiments, the compounds for use in the methods may comprise a modified oligonucleotide comprising a nucleobase sequence at least 80%, at least 85%>, at least 90%>, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of SEQ ID NOs: 1-4. In certain embodiments, the compound may comprise a modified oligonucleotide comprising a nucleobase sequence 100% complementary to an equal length portion of SEQ ID NOs: 1-4.
In certain embodiments, provided are compounds for use in the methods comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 contiguous nucleobases of a nucleobase sequence complementary to any of the sequences recited in SEQ ID NOs: 1-4.
In certain embodiments, the modified oligonucleotide for use in the methods consists of 12 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 12, 13,
14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked nucleosides.
In certain embodiments, the compound for use in the methods consists of a single-stranded oligonucleotide.
In certain embodiments, the oligonucleotide is a modified oligonucleotide.
In certain embodiments, the compound for use in the methods has at least one modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
In certain embodiments, the compound for use in the methods has at least one nucleoside comprising a modified sugar. In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2'-0-methoxyethyl
(2'MOE) or cEt.
In certain embodiments, the compound for use in the methods has at least one nucleoside comprising a modified nucleobase. In certain embodiments, the modified nucleobase is a 5- methylcytosine.
In certain embodiments, the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of linked deoxynucleosides; (ii) a 5' wing segment consisting of linked nucleosides; (iii) a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5 ' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
In certain embodiments, the modified oligonucleotide of the compound for use in the methods comprises: (i) a gap segment consisting of ten linked deoxynucleosides; (ii) a 5' wing segment consisting of five linked nucleosides; (iii) a 3 ' wing segment consisting of five linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3 ' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising: (a) selecting a subject with inflammation; and (b)
administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject while not causing immune suppression. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for reducing inflammation in an immunocompromised subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP thereby reducing inflammation in the immunocompromised subject. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the
oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for reducing inflammation in an immunocompromised subject comprising: (a) selecting an immunocompromised subject; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the immunocompromised subject thereby reducing inflammation in the subject. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject wherein the autoimmune disease is incompletely responsive to, or fails, DMARD therapy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the
oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject comprising: (a) selecting a subject with an autoimmune disease incompletely responsive to, or fails, DMARD therapy; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the
oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject with elevated levels of CRP, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject comprising: (a) selecting a subject with elevated CRP levels; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject concurrently suffering from an infection or malignancy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide methods, compounds and compositions for ameliorating an autoimmune disease in a subject comprising: (a) selecting a subject with the autoimmune disease concurrent with an infection or malignancy; and (b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5. Certain embodiments provide methods, compounds and compositions for reducing inflammation in a subject comprising administering to the subject (a) a DMARD, and (b) a therapeutically effective amount of an oligonucleotide targeting CRP, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject. In certain embodiments, the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5. In certain embodiments, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 5.
Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
Certain embodiments provide a method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 20 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consists of the sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
In certain embodiments, administration of a CRP inhibitor to an animal does not cause immunosuppression in the animal. In certain embodiments, administration of a CRP inhibitor to an animal is an anti-inflammatory agent but not an immunosuppressive agent in the animal.
In certain embodiments, the animal is pre-treated with one or more CRP inhibitor.
In certain embodiments, the animal is a human.
In certain embodiments, provided are methods, compounds, and compositions for ameliorating a symptom or therapeutic endpoint of an inflammatory disease or condition. The symptom or therapeutic endpoint can be selected from one or more of inflammation, pain, redness and/or swelling.
In certain embodiments, provided are methods, compounds and compositions for reducing inflammation but not reducing an immune response or marker thereof. The immune response marker can be selected from one or more of cytokine levels, chemokine levels, acute phase protein levels or other marker. Examples of such markers include, but are not limited to, IL-6, TNF-a, IL-l , MCP-1, LPS binding protein, fibrinogen, soluble e-selectin and serum amyloid A (SAA).
In certain embodiments, the inflammatory response, disease, disorder, or condition is an autoimmune disease. In certain embodiments, the inflammation is the result of an autoimmune disease. In certain embodiments, the inflammation causes an autoimmune disease. Examples of autoimmune diseases include, but are not limited to, arthritis, lupus (e.g., lupus erythematosus, lupus nephritis), Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes (e.g. insulin dependent diabetes mellitus, type I diabetes mellitus, type II diabetes mellitus), good pasture's syndrome, myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulcerative colitis, Sjogren's syndrome, rheumatic diseases (e.g., rheumatoid arthritis), polymyositis, scleroderma, psoriasis, and mixed connective tissue disease.
Examples of arthritis include, but are not limited to, rheumatoid arthritis, juvenile
rheumatoid arthritis, arthritis uratica, gout, chronic polyarthritis, periarthritis humeroscapularis, cervical arthritis, lumbosacral arthritis, osteoarthritis, psoriatic arthritis, enteropaihic arthritis and ankylosing spondylitis.
In certain embodiments, the compounds and compositions disclosed herein are administered to an animal. In certain embodiments, administration to an animal is by a parenteral route. In certain embodiments, the parenteral administration is any of subcutaneous or intravenous administration.
In certain embodiments, the compound is co-administered with one or more second agent(s). In certain embodiments the second agent is a NSAID or a Disease Modifying Anti-Rheumatic Drug (DMARD).
NSAIDS include, but are not limited to, acetyl salicylic acid, celecoxib, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, meloxicam and tramadol. The compound of the invention and one or more NSAIDS can be administered concomitantly or sequentially.
Examples of DMARDs include, but are not limited to, methotrexate, abatacept, infliximab, adalirnurnab, rituximab, tofacitmib citrate, tocilizuraab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine, leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP), and tumor necrosis factor-alpha (TNF-a) or other cytokine blockers or antagonists. The compound of the invention and one or more disease modifying drug can be administered concomitantly or sequentially.
In certain embodiments, a compound or oligonucleotide is in salt form.
In certain embodiments, the compounds or compositions are formulated with a
pharmaceutically acceptable carrier or diluent.
In certain embodiments, the methods and compounds disclosed herein are useful in the manufacture of a medicament for reducing inflammation without causing immunosuppression.
In certain embodiments, provided is a kit for treating, preventing, or ameliorating an inflammatory response, disease, disorder or condition as described herein wherein the kit comprises: (i) a CRP specific inhibitor as described herein; and optionally (ii) an additional agent or therapy as described herein.
A kit of the present invention may further include instructions for using the kit to treat, prevent, or ameliorate an inflammatory disease, disorder or condition as described herein by combination therapy as described herein.
Antisense Compounds
Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense
oligonucleotides, and siRNAs. An oligomeric compound can be "antisense" to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
In certain embodiments, an antisense compound targeted to CRP nucleic acid is 10 to 30 nucleotides in length. In other words, antisense compounds are from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to
80, 10 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values. In some embodiments, the antisense compound is an antisense oligonucleotide.
In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5' end (5' truncation), the central portion or alternatively from the 3' end (3' truncation). A shortened or truncated oligonucleotide can have two or more nucleosides deleted from the 5 ' end, two or more nucleosides deleted from the central portion or alternatively can have two or more nucleosides deleted from the 3 ' end. Alternatively, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one or more nucleoside deleted from the 5 ' end, one or more nucleoside deleted from the central portion and/or one or more nucleoside deleted from the 3' end.
In certain embodiments, the antisense compound comprises a lengthened or long modified oligonucleotide. When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside can be located at the 5' end, 3' end or central portion of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5 ' end (5 ' addition), to the 3' end (3' addition) or the central portion, of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one or more nucleoside added to the 5 ' end, one or more nucleoside added to the 3 ' end, and/or one or more nucleoside added to the central portion.
It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches. Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
Antisense Compound Motifs
In certain embodiments, antisense compounds targeted to a CRP nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can in some embodiments include β- D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2 '-modified nucleosides can include 2'-MOE, and 2'-0-CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides can include those having a 4'-(CH2)n-0-2' bridge, where n=l or n=2). Preferably, each distinct region comprises uniform sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5 ' wing region, "Y" represents the length of the gap region, and "Z" represents the length of the 3' wing region. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap segment is positioned immediately adjacent each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5 ' wing segment and gap segment, or the gap segment and the 3 ' wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. Thus, gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 1-8-1, 2-6-2, 6-8- 6, 5-8-5, 1-8-1, 2-6-2, 2-13-2, 1-8-2, 2-8-3, 3-10-2, 1-18-2, or 2-18-2.
In certain embodiments, the antisense compound as a "wingmer" motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.
In certain embodiments, antisense compounds targeted to a CRP nucleic acid possess a 5- 10-5 gapmer motif.
In certain embodiments, antisense compounds targeted to a CRP nucleic acid possess a 3-
14-3 gapmer motif.
In certain embodiments, antisense compounds targeted to a CRP nucleic acid possess a 2- 13-5 gapmer motif.
In certain embodiments, an antisense compound targeted to a CRP nucleic acid has a gap- widened motif.
In certain embodiments, a gap-widened antisense oligonucleotide targeted to a CRP nucleic acid has a gap segment of fourteen 2'-deoxyribonucleosides positioned immediately adjacent to and between wing segments of three chemically modified nucleosides. In certain embodiments, the chemical modification comprises a 2 '-sugar modification. In another embodiment, the chemical modification comprises a 2'-MOE sugar modification.
In certain embodiments, a gap-widened antisense oligonucleotide targeted to a CRP nucleic acid has a gap segment of thirteen 2'-deoxyribonucleosides positioned immediately adjacent to and between a 5 ' wing segment of two chemically modified nucleosides and a 3 ' wing segment of five chemically modified nucleosides. In certain embodiments, the chemical modification comprises a 2 '-sugar modification. In another embodiment, the chemical modification comprises a 2'-MOE sugar modification.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
Nucleotide sequences that encode CRP include, without limitation, the following:
GENBANK Accession No. NM 000567.2 (incorporated herein as SEQ ID NO: 1), GENBANK
Accession No. Ml 1725.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No.
BC020766.1 (incorporated herein as SEQ ID NO: 3), and nucleotides 6134081 6137180 of
GENBANK Accession No. NT 004668.15 (incorporated herein as SEQ ID NO: 4.
It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3 ' UTR, a 5 ' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for CRP can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5 ' target site of one target segment within the target region to a 3 ' target site of another target segment within the target region.
In certain embodiments, a "target segment" is a smaller, sub-portion of a target region within a nucleic acid. For example, a target segment can be the sequence of nucleotides of a target nucleic acid to which one or more antisense compound is targeted. "5 ' target site" refers to the 5 '-most nucleotide of a target segment. "3 ' target site" refers to the 3 '-most nucleotide of a target segment.
Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5 ' target sites or 3 ' target sites listed herein.
Suitable target segments may be found within a 5 ' UTR, a coding region, a 3 ' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
Hybridization
In some embodiments, hybridization occurs between an antisense compound disclosed herein and a CRP nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
Hybridization can occur under varying conditions. Stringent conditions are sequence- dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 Ed., 2001). In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a CRP nucleic acid.
Complementarity
An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a CRP nucleic acid).
Non-complementary nucleobases between an antisense compound and a CRP nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a CRP nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a CRP nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al, J. Mol. Biol, 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981 , 2, 482 489).
In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, antisense compound may be fully complementary to a CRP nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
The location of a non-complementary nucleobase may be at the 5 ' end or 3 ' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non- complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18,
19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CRP nucleic acid, or specified portion thereof.
In certain embodiments, antisense compounds that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CRP nucleic acid, or specified portion thereof.
The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
Identity
The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
Modifications
A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3 ' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
Modified Internucleoside Linkages
The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
In certain embodiments, antisense compounds targeted to a CRP nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
Modified Sugar Moieties
Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non- geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R2) (R, Ri and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F- 5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent
Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5*-vinyl, 5*-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'- OCH2CH2F and 2'-0(CH2)2OCH substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, OCF3, OCH2F, 0(CH2)2SCH3, 0(CH2)2-0-N(Rm)(Rn), 0-CH2-C(=0)-N(Rm)(Rn), and 0-CH2-C(=0)-N(Ri)-(CH2)2-N(Rm)(Rn), where each Rls Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.
As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH2)-0-2' (LNA); 4'-(CH2)-S-2'; 4,-(CH2)2-0-2' (ENA); 4'-CH(CH3)-0-2' and 4*-CH(CH2OCH3)-0-2* (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH3)(CH3)-0-2' (and analogs thereof see PCT/US2008/068922 published as WO/2009/006478, published January 8, 2009); 4,-CH2-N(OCH3)-2' (and analogs thereof see
PCT/US2008/064591 published as WO/2008/150729, published December 11, 2008); 4'-CH2-0-
N(CH3)-2* (see published U.S. Patent Application US2004-0171570, published September 2, 2004 );
4'-CH2-N(R)-0-2', wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al, J. Org. Chem.,
2009, 74, 118-134); and 4,-CH2-C(=CH2)-2' (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on December 8, 2008).
Further bicyclic nucleosides have been reported in published literature (see for example:
Srivastava et al, J. Am. Chem. Soc, 2007, 129(26) 8362-8379; Frieden et al, Nucleic Acids
Research, 2003, 21, 6365-6372; Elayadi et al, Curr. Opinion Invens. Drugs, 2001, 2, 558-561;
Braasch et al, Chem. Biol, 2001, 8, 1-7; Oram et al, Curr. Opinion Mol Ther., 2001, 3, 239-243;
Wahlestedt et al, Proc. Natl Acad. Sci. U. S. A., 2000, 97, 5633-5638; Singh et al, Chem.
Commun., 1998, 4, 455-456; Koshkin et al, Tetrahedron, 1998, 54, 3607-3630; Kumar et al,
Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al, J. Org. Chem., 1998, 63, 10035-10039; U.S. Patents Nos.: 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191;
6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570;
U.S. Patent Applications, Serial Nos.: 12/129,154; 61/099,844; 61/097,787; 61/086,231;
61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO
2005/021570; WO 2004/106356; WO 94/14226; and PCT International Applications Nos.:
PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and β-D-ribofuranose (see PCT international application
PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).
As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
As used herein, "4 '-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, - C(=0)-, -C(=S)-, -0-, -Si(Ra)2-, -S(=0)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C2o aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJiJ2, SJi, N3, COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=0)-Ji); and each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-Ci2 alkenyl, C2-Ci2 alkynyl, substituted C2-Ci2 alkynyl, C5-C2o aryl, substituted C5- C2o aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.
In certain embodiments, the bridge of a bicyclic sugar moiety is , -[C(Ra)(Rb)]n- , -[C(Ra)(Rb)]n-0-, -C(RaRb)-N(R)-0- or -C(RaRb)-0-N(R)-. In certain embodiments, the bridge is 4'-CH2-2', 4,-(CH2)2-2', 4,-(CH2)3-2', 4'-CH2-0-2', 4,-(CH2)2-0-2', 4'-CH2-0-N(R)-2' and 4'-CH2- N(R)-0-2'- wherein each Ris, independently, H, a protecting group or Ci-Ci2 alkyl.
In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-(CH2)-0-2' bridge, may be in the a-L configuration or in the β-D configuration. Previously, a-L-methyleneoxy (4'-CH2-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids
Research, 2003, 21, 6365-6372).
In certain embodiments, bicyclic nucleosides include those having a 4' to 2' bridge wherein such bridges include without limitation, a-L-4'-(CH2)-0-2', P-D-4'-CH2-0-2', 4,-(CH2)2-0-2', 4'- CH2-0-N(R)-2', 4'-CH2-N(R)-0-2', 4'-CH(CH3)-0-2', 4'-CH2-S-2', 4'-CH2-N(R)-2', 4'-CH2- CH(CH3)-2', and 4'-(CH2)3-2', wherein R is H, a protecting group or C1-C12 alkyl.
In certain embodiment, bicyclic nucleosides have the formula:
Figure imgf000035_0001
Bx is a heterocyclic base moiety; -Qa-Qb-Qc- is -CH2-N(RC)-CH2-, -C(=0)-N(Rc)-CH2-, -CH2-0-N(Rc)-, -CH2-N(Rc)-0- or - N(Rc)-0-CH2;
Rc is Ci-Ci2 alkyl or an amino protecting group; and
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
In certain embodiments, bicyclic nucleosides have the formula:
Figure imgf000036_0001
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Za is Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted Ci-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.
In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJJd, SJc, N3, OC(=X)Jc, and NJeC(=X)NJcJd, wherein each Jc, Jd and Je is, independently, H, Ci-C6 alkyl, or substituted Ci-C6 alkyl and X is O or NJC.
In certain embodiments, bicyclic nucleosides have the formula:
Figure imgf000036_0002
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Zb is Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted Ci-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(=0)-).
In certain embodiments, bicyclic nucleosides have the formula:
Figure imgf000037_0001
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Rd is Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
each qa, qb, qc and qa is, independently, H, halogen, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-
C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, Ci-C6 alkoxyl, substituted Ci-C6 alkoxyl, acyl, substituted acyl, Ci-C6 aminoalkyl or substituted Ci-C6 aminoalkyl;
In certain embodiments, bicyclic nucleosides have the formula:
Figure imgf000037_0002
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; qa, qb, qe and qf are each, independently, hydrogen, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJj, SJj, SOJj, S02Jj, NJjJk, N3, CN, C(=0)OJj, C(=0)NJjJk, C(=0)Jj, 0-C(=0)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJk orN(H)C(=S)NJjJk;
or qe and qf together are =C(qg)(qh);
qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl. The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4'-CH2-0-2' bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al, Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.
Analogs of various bicyclic nucleosides that have 4' to 2' bridging groups such as 4'-CH2-0- 2' and 4'-CH2-S-2', have also been prepared (Kumar et al, Bioorg. Med. Chem. Lett. , 1998, 8, 2219- 2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al, WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al, J. Org. Chem., 1998, 63, 10035- 10039). In addition, 2'-amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.
In certain embodiments, bicyclic nucleosides have the formula:
Figure imgf000038_0001
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each ¾, c , qk and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-
C12 alkenyl, substituted C2-Ci2 alkenyl, C2-Ci2 alkynyl, substituted C2-Ci2 alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJj, SJj, SOJj, S02Jj, NJjJk, N3, CN, C(=0)OJj, C(=0)NJjJk, C(=0)Jj, O- C(=0)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJk orN(H)C(=S)NJjJk; and
qi and qj or qi and qk together are =C(qg)(qh), wherein qg and qh are each, independently, H, halogen, Ci-C12 alkyl or substituted Ci-C12 alkyl.
One carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and the alkenyl analog bridge 4'-CH=CH-CH2-2' have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et ah, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH2-0-2') BNA , (B) β-D-methyleneoxy (4'-CH2-0-2') BNA , (C) ethyleneoxy (4'-(CH2)2-0-2') BNA, (D) aminooxy (4'-CH2-0-N(R)-2') BNA, (E) oxyamino (4'-CH2-N(R)-0- 2') BNA, (F) methyl(methyleneoxy) (4'-CH(CH3)-0-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH2-S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA, (J) propylene carbocyclic (4'-(CH2)3-2') BNA, and (K) vinyl BNA as depicted below.
Figure imgf000039_0001
wherein Bx is the base moiety and R is, independently, H, a protecting group, Ci-C6 alkyl or Ci-C6 alkoxy.
As used herein, the term "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate. Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med.
Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyranyl ring system as illustrated below.
Figure imgf000040_0001
In certain embodiment, sugar surrogates are selected having the formula:
Figure imgf000040_0002
wherein:
Bx is a heterocyclic base moiety;
T3 and T4 are each, inde endently, an internucleoside linking group linking the
tetrahydropyran nucleoside analog to the oligomeric compound or one of T3 and T4 is an
internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;
qi> q2, q3, 14, q5, q6 and q7 are each independently, H, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and
one of Ri and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJi, N3, OC(=X)Ji, OC(=X)NJiJ2, NJ3C(=X)NJiJ2 and CN, wherein X is O, S or NJi and each Jl s J2 and J3 is, independently, H or Ci-C6 alkyl.
In certain embodiments, ql s q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is fluoro and R2 is H; Ri is methoxy and R2 is H, and Ri is methoxyethoxy and R2 is H.
In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term "morpholino" means a sugar surrogate having the following formula:
Figure imgf000041_0001
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modifed morpholinos."
Combinations of modifications are also provided without limitation, such as 2 -F-5 '-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH2- 0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the
pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J. Am. Chem. Soc, 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides,
Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al, Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al, Tetrahedron, 2004, 60(9), 2111- 4123; Gu et al, Oligonucleotides, 2003, 13(6), 479-489; Wang et al, J. Org. Chem., 2003, 68,
4499-4505; Verbeure et al, Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al, J. Org. Chem., 2001, 66, 8478-82; Wang et al, Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al, J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have Formula X.
Figure imgf000042_0001
X
wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X:
Bx is a heterocyclic base moiety;
T3 and T4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and
qi, q2, q3, q4, q5, q6, q7, qs and q are each, independently, H, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or other sugar substituent group.
Many other monocyclic, bicyclic and tricyclic ring systems are known in the art and are suitable as sugar surrogates that can be used to modify nucleosides for incorporation into oligomeric compounds as provided herein (see for example review article: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to further enhance their activity.
As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH2)nO]mCH3, 0(CH2)nNH2, 0(CH2)nCH3, 0(CH2)nF, 0(CH2)nONH2, OCH2C(=0)N(H)CH3, and
0(CH2)nON[(CH2)nCH ]2, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: Ci-Ci2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, F, CF3, OCF3, SOCH3, S02CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'- MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000). Such 2*-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.
Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486- 504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
As used herein, "2 '-modified" or "2 '-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non- bridging 2 'substituents, such as allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, -OCF3, 0-(C¾)2- O-CH3, 2'-0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn), or 0-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.
As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
As used herein, "2'-OMe" or "2'-OCH3", "2'-0-methyl" or "2'-methoxy" each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2' position of the sugar ring.
As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-0-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH2CH2OCH3 group at the 2' position of the sugar ring.
Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed June 2, 2005 and published as WO 2005/121371 on December 22, 2005, and each of which is herein incorporated by reference in its entirety.
As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleo sides (R A) and/or deoxyribonucleosides (DNA).
In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-0-2') bridging group. In certain embodiments, the (4'-CH(CH3)-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.
Modified Nucleobases
Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276- 278).
Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5- halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7- methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
In certain embodiments, antisense compounds targeted to a CRP nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to a CRP nucleic acid comprise one or more modified nucleobases. In certain
embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
Compositions and Methods for Formulating Pharmaceutical Compositions
Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
An antisense compound targeted to a CRP nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
In certain embodiments, the "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
Pharmaceutically acceptable organic or inorganic excipients, which do not deleteriously react with nucleic acids, suitable for parenteral or non-parenteral administration can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a CRP nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.
Pharmaceutical compositions comprising antisense compounds encompass any
pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bio equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
In certain embodiments, one or more modified oligonucleotides of the present invention can be formulated as a prodrug. A prodrug can be produced by modifying a pharmaceutically active compound such that the active compound will be regenerated upon in vivo administration. For example, a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
In certain embodiments, a pharmaceutical composition comprises a sterile lyophilized modified oligonucleotide that is reconstituted with a suitable diluent, e.g., sterile water for injection or sterile saline for injection. The reconstituted product is administered as a subcutaneous injection or as an intravenous infusion after dilution into saline. The lyophilized drug product consists of a modified oligonucleotide which has been prepared in water for injection, or in saline for injection, adjusted to pH 7.0-9.0 with acid or base during preparation, and then lyophilized. The lyophilized modified oligonucleotide may be 25-800 mg, or any dose between 25-800 mg as described above, of a modified oligonucleotide. The lyophilized drug product may be packaged in a 2 mL Type I, clear glass vial (ammonium sulfate-treated), stoppered with a bromobutyl rubber closure and sealed with an aluminum flip-off overseal.
In certain embodiments, the compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art- established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. Such materials, when added, should not unduly interfere with the biological activities of the components of the
compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the oligonucleotide(s) of the formulation.
In certain embodiments, pharmaceutical compositions of the present invention comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
In certain embodiments, a pharmaceutical composition of the present invention is prepared using known techniques, including, but not limited to mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping or tabletting processes.
In certain embodiments, the compounds of the invention targeted to a CRP nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes, but is not limited to, water, oils, alcohols, or phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an compound targeted to a CRP nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the compound is an antisense oligonucleotide.
In certain embodiments, a pharmaceutical composition of the present invention is a liquid
(e.g., a suspension, elixir and/or solution). In certain of such embodiments, a liquid pharmaceutical composition is prepared using ingredients known in the art, including, but not limited to, water, buffered saline, glycols, oils, alcohols, flavoring agents, preservatives, and coloring agents.
In certain embodiments, a pharmaceutical composition of the present invention is a solid (e.g., a powder, tablet, and/or capsule). In certain of such embodiments, a solid pharmaceutical composition comprising one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders, and disintegrating agents.
In certain embodiments, a pharmaceutical composition of the present invention is formulated as a depot preparation. Certain such depot preparations are typically longer acting than non-depot preparations. In certain embodiments, such preparations are administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. In certain embodiments, depot preparations are prepared using suitable polymeric or hydrophobic materials (for example an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
In certain embodiments, a pharmaceutical composition of the present invention comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
In certain embodiments, a pharmaceutical composition of the present invention comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain
embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
In certain embodiments, a pharmaceutical composition of the present invention comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In certain embodiments, a pharmaceutical composition of the present invention comprises a sustained-release system. A non-limiting example of such a sustained-release system is a semipermeable matrix of solid hydrophobic polymers. In certain embodiments, sustained-release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks or months.
In certain embodiments, a pharmaceutical composition of the present invention is prepared for oral administration. In certain of such embodiments, a pharmaceutical composition is formulated by combining one or more compounds comprising a modified oligonucleotide with one or more pharmaceutically acceptable carriers. Certain of such carriers enable pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject. In certain embodiments, pharmaceutical compositions for oral use are obtained by mixing oligonucleotide and one or more solid excipient. Suitable excipients include, but are not limited to, fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). In certain embodiments, such a mixture is optionally ground and auxiliaries are optionally added. In certain embodiments, pharmaceutical compositions are formed to obtain tablets or dragee cores. In certain embodiments, disintegrating agents (e.g., cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate) are added.
In certain embodiments, dragee cores are provided with coatings. In certain such
embodiments, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to tablets or dragee coatings.
In certain embodiments, pharmaceutical compositions for oral administration are push-fit capsules made of gelatin. Certain of such push-fit capsules comprise one or more pharmaceutical agents of the present invention in admixture with one or more filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In certain embodiments, pharmaceutical compositions for oral administration are soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. In certain soft capsules, one or more pharmaceutical agents of the present invention are be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.
In certain embodiments, pharmaceutical compositions are prepared for buccal
administration. Certain of such pharmaceutical compositions are tablets or lozenges formulated in conventional manner.
In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer (e.g., PBS). In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical
compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions. In certain embodiments, a pharmaceutical composition of the present invention comprises a modified oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated.
Dosing
In certain embodiments, pharmaceutical compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect. The desired effect can be, for example, reduction of CRP or the prevention, reduction, amelioration or slowing the progression of a disease or condition associated with CRP.
In certain embodiments, the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject. "Concentration of pharmaceutical composition" as used with regard to dose regimen can refer to the compound, oligonucleotide, or active ingredient of the pharmaceutical composition. For example, in certain embodiments, dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.
Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism. In certain embodiments, dosage is from O.O^g to lOOmg per kg of body weight, or within a range of 0.00 lmg to lOOOmg dosing, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from O.O^g to lOOmg per kg of body weight, once or more daily, to once every 20 years or ranging from O.OOlmg to lOOOmg dosing.
Administration
The compounds or pharmaceutical compositions of the present invention can be
administered in a number of ways depending upon whether local or systemic treatment is and upon the area to be treated. Administration can be oral, inhaled or parenteral. In certain embodiments, the compounds and compositions as described herein are administered parenterally. Parenteral administration includes intravenous, intra-arterial,
subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump.
In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or a pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.
In certain embodiments, formulations for parenteral, intrathecal or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
Conjugated Antisense Compounds
In certain embodiments, the compounds of the invention can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
In certain embodiments, antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003. Cell culture and antisense compounds treatment
The effects of antisense compounds on the level, activity or expression of CRP nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors {e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary hepatocytes. In vitro testing of antisense oligonucleotides
Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
In general, cells are treated with antisense oligonucleotides when the cells reach
approximately 60-80% confluency in culture.
One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA).
Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen,
Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a
LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense
oligonucleotide.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with
LIPOFECT AMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes Oligofectamine™ (Invitrogen Life Technologies, Carlsbad, CA). Antisense oligonucleotide is mixed with Oligofectamine™ in Opti-MEM™-l reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired concentration of oligonucleotide with an Oligofectamine™ to oligonucleotide ratio of approximately 0.2 to 0.8 per 100 nM.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6 (Roche Diagnostics Corp., Indianapolis, IN). Antisense oligomeric compound was mixed with FuGENE 6 in 1 mL of serum- free RPMI to achieve the desired concentration of oligonucleotide with a FuGENE 6 to oligomeric compound ratio of 1 to 4 μΕ of FuGENE 6 per 100 nM.
Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001).
Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001). In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
The concentration of antisense oligonucleotide used varies from cell line to cell line.
Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art (Sambrook and Russell in Molecular Cloning. A Laboratory Manual. Third Edition. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 2001).
Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
RNA Isolation
RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols. Analysis of inhibition of target levels or expression
Inhibition of levels or expression of a CRP nucleic acid can be assayed in a variety of ways known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.
Quantitative Real-Time PCR Analysis of Target RNA Levels
Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, CA). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.
Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A or GAPDH, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A or
GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Carlsbad, CA). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence. Probes and primers are designed to hybridize to a CRP nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, CA).
The PCR probes can have JOE or FAM covalently linked to the 5 ' end and TAMRA or MGB covalently linked to the 3 ' end, where JOE or FAM is the fluorescent reporter dye and
TAMRA or MGB is the quencher dye. In some cell types, primers and probe designed to a sequence from a different species are used to measure expression. For example, a human GAPDH primer and probe set can be used to measure GAPDH expression in monkey-derived cells and cell lines.
Gene target quantities obtained by RT, real-time PCR can be normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, OR). GAPDH expression can be quantified by RT, real-time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA can be quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, OR).
Analysis of Protein Levels
Antisense inhibition of CRP nucleic acids can be assessed by measuring CRP protein levels. Protein levels of CRP can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked
immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS) (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., 2001). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
Antibodies useful for the detection of human and rat CRP are commercially available.
In Vivo Testing of Antisense Compounds
Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of CRP and produce phenotypic changesas measeured by art known methods such as the ACR score, RASS scale or the 2010 ACR/EULAR Rheumatoid
Arthritis Classification Criteria. Testing can be performed in normal animals, or in experimental disease models. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency depends upon factors such as route of administration and animal body weight. In one embodiment, following a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue and changes in CRP nucleic acid expression are measured. Changes in CRP protein levels can also be measured. Changes in CRP expression can be measured by determing the level of inflammation, inflammatory conditions (e.g., asthma, arthritis, colitis) or inflammatory markers (e.g., cytokines, chemokines, acute phase proteins) present in the animal.
Certain Indications
Inflammation is now recognized as a type of non-specific immune response to an injury or stimulus. The inflammatory response has a cellular component and an exudative component. In the cellular component, resident macrophages at the site of injury or stimulus initiate the inflammatory response by releasing inflammatory mediators such as TNF-a, IFN-a, IL-1 , IL-6, IL-12, IL-18, and others. Leukocytes are then recruited to move into the inflamed tissue area and perform various functions such as release of additional cellular mediators, phagocytosis, release of enzymatic granules and other functions. The exudative component involves the passage of plasma fluid containing proteins from blood vessels to the inflamed tissue site. Inflammatory mediators such as bradykinin, nitric oxide, and histamine cause blood vessels to become dilated, slow the blood flow in the vessels and increase the blood vessel permeability, allowing the movement of fluid and protein into the tissue. Biochemical cascades are activated in order to propagate the inflammatory response (e.g., complement system in response to infection, fibrinolysis and coagulation systems in response to necrosis due to a burn or trauma, kinin system to sustain inflammation) (Robbins Pathologic Basis of Disease, Elsevier Health Sciences).
Inflammation can be acute or chronic. Acute inflammation has a fairly rapid onset, quickly becomes severe and quickly and distinctly clears after a few days to a few weeks. Chronic inflammation can begin rapidly or slowly and tends to persist for weeks, months or years with a vague and indefinite termination. Chronic inflammation can result when an injury or stimulus, or products resulting from its presence, persists at the site of injury or stimulation and the body's immune response is not sufficient to overcome its effects.
In certain embodiments, the invention provides methods of treating an individual comprising administering one or more pharmaceutical compositions of the present invention. In certain embodiments, the individual has or is at risk for inflammation. In certain embodiments, the individual has or is at risk for an inflammatory disease, disorder or condition. In certain
embodiments, the individual is at risk for an inflammatory disease, disorder or condition. In certain embodiments, the individual is immunocompromised. In certain embodiments, the individual has a malignancy. In certain embodiments, the individual has an infection (active or latent). In certain embodiments the invention provides methods for prophylactically reducing CRP expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a CRP nucleic acid.
In certain embodiments, administration of a therapeutically effective amount of an antisense compound targeted to a CRP nucleic acid is accompanied by monitoring of CRP levels in the serum of an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
In certain embodiments, administration of an antisense compound targeted to a CRP nucleic acid results in reduction of CRP expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a CRP nucleic acid results in a change in inflammatory disease, condition, symptom or marker (e.g., ACR score, cytokine levels, chemokine levels). In certain embodiments, administration of a CRP antisense compound decreases the inflammatory disease, condition, symptom or marker by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to CRP are used for the preparation of a medicament for treating subject described herein.
Certain Combination Therapies
In certain embodiments, a first agent comprising a modified oligonucleotide provided herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same inflammatory disease, disorder or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, such first agent are designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.
In certain embodiments, second agents include, but are not limited to, NSAIDS and/or DMARDs as described herein. In certain embodiments, the disease modifying drug is administered prior to administration of the first agent. In certain embodiments, the disease modifying drug is administered following administration of the first agent. In certain embodiments the disease modifying drugs is administered at the same time as the first agent. In certain embodiments the dose of a co-administered disease modifying drug is the same as the dose that would be administered if the disease modifying drug was administered alone. In certain embodiments the dose of a co- administered disease modifying drug is lower than the dose that would be administered if the disease modifying drugs was administered alone. In certain embodiments the dose of a co -administered disease modifying drug is greater than the dose that would be administered if the disease modifying drugs was administered alone. ADVANTAGES OF THE INVENTION
Provided herein, for the first time, are methods and compositions targeting CRP for reducing inflammation without causing immunosuppression. In a particular embodiment, provided are CRP oligonucleotides (oligonucleotides targeting a nucleic acid encoding CRP protein) to reduce inflammation and treat, prevent and/or ameliorate an inflammatory disease or condition such as an autoimmune disease or symptoms related to the disease without suppressing the immune system.
Disease Modifying Anti-Rheumatic Drugs (DMARDs) are used to treat inflammatory conditions such as autoimmune diseases. Many of these DMARDs are nonspecific
immunosuppressive drugs that suppress a large part of, or the entire, immune system of the subject. Prolonged therapy with these immunosuppressive drugs potentially produces toxic side effects, including opportunistic infections, malignancies, kidney failure, bone marrow suppression, pulmonary fibrosis, diabetes, and liver function disorders. Several DMARDs (e.g., etanercept and abatacept) are contra-indicated in the presence of malignancies or infections (active or latent).
The compositions described herein provide an advantage over the commercially available DMARDs by decreasing inflammation or an inflammatory disease but not suppressing the immune system. Accordingly, the compositions described herein can be used in subjects in need of inflammation alleviation but immunosuppressive therapy is contra-indicated. For example, immunocompromised subjects can be treated with the compositions described herein while commercially available DMARDs are contra-indicated. Other populations that can benefit from the compositions described herein include subjects with malignancies or subjects with infections (active or latent).
Additionally, commercially available DMARDs are not used in combination with each other for fear of enhancing immune suppression in a subject. As the compositions described herein are not immunosuppressive, an advantage of the compositions described herein is that they can be used in combination with commercially available DMARDs to reduce inflammation and treat inflammatory diseases.. EXAMPLES
Non-limiting disclosure and incorporation by reference
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety. Example 1: Assessment of the effects of pre-treatment with an antisense oligonucleotide targeting C-reactive protein (CRP) on acute inflammatory response
A single center, randomized, double-blind, placebo-controlled, adaptive, dose-response, Phase 1 study was performed to assess the effects of pre-treatment with ISIS 329993 on the acute inflammatory response after endotoxin (LPS) challenge in healthy subjects. The study consisted of a 28-day screening period, a 22-day treatment period, a 5-day endotoxin challenge period, and a 63- day follow-up period.
Eligible subjects were male volunteers, 18 to 40 years in age, 55-95 kg in body weight, and who were in good health, with no clinically significant abnormalities in their medical history, physical examination and laboratory evaluations. The study excluded subjects who had a CRP level of greater than 10 mg/dL, and had a history of any clinically important allergy or a known allergy to lactose or polyethylene glycol (which were the excipients in the endotoxin formulation), were currently using any kind of medication of health supplement, received a vaccination within 6 months of screening, participated in a clinical trial of an immunosuppressive drug or one using endotoxin within 6 months of screening, had received another investigational drug, medical device or medical procedure within 90 days or 5 half-lives of screening, or participated in an investigational study involving systemic administration of an oligonucleotide within 9 months of screening.
ISIS 329993 (AGCATAGTTAACGAGCTCCC, designated herein as SEQ ID NO: 5) is a 5- 10-5 MOE gapmer, 20 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked by wing segments on the 5 ' direction and the 3 ' direction comprising five nucleosides each. Each nucleoside in the 5 ' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5- methylcytosines. ISIS 329993 targets GENBANK Accession No. NM_000567.2 (SEQ ID NO: 1) from positions 977 to 996.
In a Phase 1 study involving 35 healthy subjects, the subjects were divided into three groups. Study subjects were enrolled into two sequential dose cohorts, where each cohort was randomized in a -2: 1 ratio to a placebo group. In a cohort of 12 subjects, ISIS 329993 at a dose of 400 mg was administered intravenously on days 1, 3, 5, 8, 15 and 22 (6 doses total) prior to administration of endotoxin. In a second cohort of 11 subjects, ISIS 329993 at a dose of 600 mg was administered intravenously on days 1, 3, 5, 8, 15 and 22 (6 doses total) prior to administration of endotoxin. In a third cohort of 12 subjects, the placebo (PBS) was administered intravenously on days 1, 3, 5, 8, 15 and 22 (6 doses total) prior to administration of endotoxin. Endotoxin challenge was given on day 26 and assessment of inflammatory biomarkers and immune cell counts was done at various time points after. The subjects received an intravenous bolus of purified lipopolysaccharide (LPS) from E. Coli: l 13 (CCRE, Lot #3; NIH Clinical Center, Bethesda, MD) in the amount of 2 ng/kg body weight. The protocol was approved by an independent institutional review board (Copernicus Group, Durham, NC) and the study was performed in compliance with the standards of Good Clinical Practice and the Declaration of Helsinki in its revised edition (Washington DC, 2002).
Inflammation biomarkers CRP, IL-6, TNF-a, IL-Ιβ, MCP-1, LPS binding protein, fibrinogen, soluble E-selection, and SAA were measured to monitor adverse events. One measure used was maximum change (Max. Change), which is the maximum amount of change in biomarker compared to baseline levels seen any time from just after the endotoxin challenge to 72 hrs after. Another measure used was area under the curve, where the change in levels of the biomarker compared to baseline was plotted over time on a graph and the total area under the curve (AUC) was measured. The results are presented in Table 1.
The measurements for the individual inflammatory biomarkers over time are presented in
Tables 2 to 10. The measurements over time for immune cell counts for WBC, neutrophils, lymphocytes, monocytes, and platelets, are presented in Tables 11 to 15. The numbers with asterisks in Table 1 were found to be statistically significant (p< 0.05 versus the placebo) as per the Wilcoxon Rank Sum Test. The numbers with asterisks in Tables 2-15 were found to be statistically significant (p< 0.05 versus the placebo) as per the Kolmogorov-Smimov test of residuals. The hours in brackets in Tables 2-15 are the number of hours post-endotoxin challenge.
The results indicate that ISIS 329993 selectively inhibits CRP in a statistically significant, dose-dependent manner, without affecting the immune response to endotoxin as assessed by the parameters listed in tables 3-15. Pre-treatment of subjects with ISIS 329993 produced a dose- dependent, statistically significant reduction in endotoxin-induced CRP levels, as well as the AUC, over time. There was no consistent effect on induction of pro-inflammatory cytokines and chemokines, the coagulation cascade, fibrinolytic pathway, complement factors, or blood cell counts.
Treatment with ISIS 329993 had no effect on endotoxin-induced changes in vital signs, including changes in body temperature, heart rate, systolic blood pressure, and diastolic blood pressure. Table 1
Inflammation biomarkers
Figure imgf000063_0001
Table 2
Figure imgf000063_0002
Table 4
Figure imgf000064_0001
Table 6
LPS binding protein levels (mg/L)
Figure imgf000064_0002
Figure imgf000065_0001
Table 11
Figure imgf000066_0001
Table 15
Figure imgf000067_0001

Claims

1. A method for reducing inflammation in a subject comprising administering a
therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression
2. A method for reducing inflammation in a subject comprising
(a) selecting a subject with inflammation; and
(b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject,
wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject while not causing immune suppression.
3. A method for reducing inflammation in an immunocompromised subject comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject, wherein the oligonucleotide inhibits CRP thereby reducing inflammation in the immunocompromised subject.
4. A method for reducing inflammation in an immunocompromised subject comprising
(a) selecting an immunocompromised subject; and
(b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject,
wherein the oligonucleotide inhibits CRP in the immunocompromised subject thereby reducing inflammation in the subject.
5. A method for ameliorating an autoimmune disease in a subject wherein the autoimmune disease is incompletely responsive to, or fails, DMARD therapy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
6. A method for ameliorating an autoimmune disease in a subject comprising
(a) selecting a subject with an autoimmune disease incompletely responsive to, or fails, DMARD therapy; and
(b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease,
wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
7. A method for ameliorating an autoimmune disease in a subject with elevated levels of CRP, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
8. A method for ameliorating an autoimmune disease in a subject comprising
(a) selecting a subject with elevated CRP levels; and
(b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with elevated CRP,
wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease.
9. A method for ameliorating an autoimmune disease in a subject concurrently suffering from an infection or malignancy, comprising administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy.
10. A method for ameliorating an autoimmune disease in a subject comprising
(a) selecting a subject with the autoimmune disease concurrent with an infection or malignancy; and
(b) administering a therapeutically effective amount of an oligonucleotide targeting CRP to the subject with the autoimmune disease, wherein the oligonucleotide inhibits CRP thereby ameliorating the autoimmune disease while not exacerbating the infection or malignancy.
11. A method for reducing inflammation in a subject comprising administering to the subject
(a) a DMARD, and
(b) a therapeutically effective amount of an oligonucleotide targeting CRP
wherein the oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject.
12. The method of claim 11, wherein the DMARD is methotrexate, abatacept, infliximab, adalimumab, rituximab, tofacitinib citrate, tocilizumab, cyclophosphamide, azathioprine, corticosteroids, cyclosporin A, aminosalicylates, sulfasalazine, hydroxychloroquine,
leflunomide, etanercept, efalizumab, 6-mercapto-purine (6-MP), and tumor necrosis factor-alpha (TNF-a) or other cytokine blockers or antagonists.
13. The method of claim any preceding claim, wherein the subject has an autoimmune disease.
14. The method of claim 13, wherein the autoimmune disease is arthritis, lupus, Hashimoto's thyroiditis, primary myxedema, Graves' disease, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, diabetes, good pasture's syndrome, myasthenia gravis, pemphigus, Crohn's disease, sympathetic ophthalmia, autoimmune uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic action hepatitis, ulcerative colitis, Sjogren's syndrome, a rheumatic disease, polymyositis, scleroderma, psoriasis, and mixed connective tissue disease
15. The method of claim 14, wherein the arthritis is rheumatoid arthritis.
16. The method of claim any preceding claim, wherein CRP has a sequence as shown in SEQ ID NOs: 1-4.
17. The method of claim any preceding claim, wherein the nucleobase sequence of the oligonucleotide is at least 90%, at least 95% or 100% complementary to a nucleobase sequence of SEQ ID NOs: 1-4.
18. The method of any preceding claim, wherein the oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5.
19. The method of any preceding claim, wherein the oligonucleotide consists of a single- stranded oligonucleotide.
20. The method of any preceding claim, wherein the oligonucleotide consists of 12 to 30 linked nucleosides.
21. The method of any preceding claim, wherein the oligonucleotide consists of 20 linked nucleosides.
22. The method of any preceding claim, wherein the oligonucleotide is a modified oligonucleotide.
23. The method of claim 22, wherein at least one internucleoside linkage is a modified internucleoside linkage.
24. The method of claim 23, wherein each modified internucleoside linkage is a
phosphorothioate internucleoside linkage.
25. The method of claim 22, wherein at least one nucleoside comprises a modified sugar.
26. The method of claim 25, wherein at least one modified sugar is a bicyclic sugar.
27. The method of claim 25, wherein at least one modified sugar comprises a 2'-0- methoxyethyl or cEt.
28. The method of claim 22, wherein at least one nucleoside comprises a modified nucleobase.
29. The method of claim 28, wherein the modified nucleobase is a 5-methylcytosine.
30. The method of claim 22, wherein the modified oligonucleotide comprises:
(a) a gap segment consisting of linked deoxynucleosides;
(b) a 5 ' wing segment consisting of linked nucleosides;
(c) a 3 ' wing segment consisting of linked nucleosides;
wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3 ' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
31. The method of claim 22, wherein the modified oligonucleotide comprises:
(a) a gap segment consisting of ten linked deoxynucleosides;
(b) a 5' wing segment consisting of five linked nucleosides;
(c) a 3' wing segment consisting of five linked nucleosides;
wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0- methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
32. A method for reducing inflammation in a subject comprising administering to the subject a therapeutically effective amount of a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence of SEQ ID NO: 5, and wherein the modified oligonucleotide inhibits CRP in the subject thereby reducing inflammation in the subject without causing immune suppression.
PCT/US2014/026058 2013-03-13 2014-03-13 Modulation of inflammatory responses by c-reactive protein Ceased WO2014160211A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361780916P 2013-03-13 2013-03-13
US61/780,916 2013-03-13

Publications (1)

Publication Number Publication Date
WO2014160211A1 true WO2014160211A1 (en) 2014-10-02

Family

ID=51625361

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/026058 Ceased WO2014160211A1 (en) 2013-03-13 2014-03-13 Modulation of inflammatory responses by c-reactive protein

Country Status (1)

Country Link
WO (1) WO2014160211A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030157030A1 (en) * 2001-11-02 2003-08-21 Insert Therapeutics, Inc. Methods and compositions for therapeutic use of rna interference
US20090170799A1 (en) * 2003-06-02 2009-07-02 Crooke Rosanne M Modulation of c-reactive protein expression
US20090176706A1 (en) * 2004-02-17 2009-07-09 Mohapatra Shyam S Materials and methods for treatment of inflammatory and cell proliferation disorders
US20100107263A1 (en) * 2007-01-20 2010-04-29 Boehringer Ingelheim International Gmbh & Co., Kg C-reactive protein (crp) knockout mouse

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030157030A1 (en) * 2001-11-02 2003-08-21 Insert Therapeutics, Inc. Methods and compositions for therapeutic use of rna interference
US20090170799A1 (en) * 2003-06-02 2009-07-02 Crooke Rosanne M Modulation of c-reactive protein expression
US20090176706A1 (en) * 2004-02-17 2009-07-09 Mohapatra Shyam S Materials and methods for treatment of inflammatory and cell proliferation disorders
US20100107263A1 (en) * 2007-01-20 2010-04-29 Boehringer Ingelheim International Gmbh & Co., Kg C-reactive protein (crp) knockout mouse

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
FUJII ET AL.: "C-Reactive Protein Alters Antioxidant Defenses and Promotes Apoptosis in Endothelial Progenitor Cells", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY, 24 August 2006 (2006-08-24), pages 1 - 11 *

Similar Documents

Publication Publication Date Title
EP3087183B1 (en) Modulation of angiopoietin-like 3 expression
AU2017235886B2 (en) Antisense modulation of gcgr expression
EP2877579B1 (en) Modulation of renin-angiotensin system (ras) related diseases by angiotensinogen
WO2013063313A1 (en) Antisense modulation of gccr expression
EP3277817A1 (en) Compounds and methods for modulating tmprss6 expression
WO2017062816A2 (en) Compounds and methods for modulating angiotensinogen expression
EP2855500A2 (en) Methods and compositions for modulating apolipoprotein(a) expression
WO2010121074A1 (en) Modulation of inflammatory responses by factor xi
WO2012170947A2 (en) Methods for modulating factor 12 expression
CA2795750A1 (en) Modulation of cetp expression
WO2011127175A1 (en) Modulation of cd130 (gp130) expression
EP2776564A1 (en) Modulation of tmprss6 expression
EP2721156A2 (en) Antisense modulation of fibroblast growth factor receptor 4 expression
EP3011026A2 (en) Compounds and methods for modulating apolipoprotein c-iii expression for improving a diabetic profile
WO2012174154A1 (en) Modulation of inflammatory responses by factor vii
WO2014036301A1 (en) Modulation of copper related diseases by ctr1
WO2013130868A1 (en) Methods for modulating fibrinogen expression
WO2014160211A1 (en) Modulation of inflammatory responses by c-reactive protein
WO2012161806A1 (en) Modulation of stat3 expression
WO2013023172A1 (en) Modulation of inflammatory responses by saa1 and saa2
WO2012149465A2 (en) Modulation of cd36 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14775390

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14775390

Country of ref document: EP

Kind code of ref document: A1