WO2014159312A2 - A novel single chain antibody reduced mutant alpha-1 antitrypsin aggregation and toxicity - Google Patents

Abstract

The current invention is directed to a gene therapy comprising, introducing genes to a subject, wherein the genes encode fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathways and antibodies or fragments of the antibodies against mutant or abnormal proteins that misfold and accumulate in the ER causing the disease. The current invention is also directed to gene therapy, comprising introducing genes to a subject, wherein the genes encode fusion proteins comprising FKBP12 and antibodies or a fragment of the antibodies against mutant or abnormal proteins that misfold and accumulate in the ER causing the disease. The current invention is further directed to a gene therapy for alpha- 1 antitrypsin deficiency, comprising introducing genes to a human in need of the gene therapy, wherein the genes encode fusion proteins comprising FKBP12 and scFv portion of a monoclonal antibody against alpha- 1 antitrypsin.

Description

A NOVEL SINGLE CHAIN ANTIBODY REDUCED MUTANT ALPHA- 1

ANTITRYPSIN AGGREGATION AND TOXICITY

CROSS-REFERENCE TO A RELATED APPLICATION This application claims the benefit of U.S. Provisional Application Serial No. 61/784,692, filed March 14, 2013, the disclosure of which is hereby incorporated by reference in its entirety, including all figures, tables and amino acid or nucleic acid sequences.

BRIEF SUMMARY OF THE INVENTION

The current invention provides a method of treating alpha- 1 antitrypsin (ATT) deficiency via gene therapy, wherein the gene therapy comprises introducing genes to a subject in need of a treatment for AAT deficiency, wherein the genes encode fusion proteins comprising FK506-binding protein fragment 12 (FKBP12) and scFv portion of antibody against AAT. The current invention also provides a method of treating a disease via gene therapy, wherein the gene therapy comprises introducing genes to a subject in need of a treatment of the disease, wherein the genes encode fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathway and antibodies or fragment of the antibodies against a target proteins that misfold and accumulate in the endoplasmic reticulum (ER), wherein misfolding and accumulation of the target protein in the ER causes the disease.

The current invention further provides genes encoding fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathways and antibodies or fragments of the antibodies against mutant or abnormal target proteins that misfold and accumulate in the ER, wherein the misfolding and accumulation of the mutant or abnormal target protein in the ER causes a disease. Furthermore, the current invention provides genes encoding fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathways and antibodies or fragments of the antibodies against mutant or abnormal target proteins that misfold and accumulate in the ER, wherein the misfolding and accumulation of the mutant or abnormal target proteins causes a disease, and the fusion proteins target the mutant or abnormal target proteins without interfering with the wild type or normal counterpart of the mutant protein. BRIEF DESCRIPTION OF DRAWINGS

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication, with color drawing(s), will be provided by the Office upon request and payment of the necessary fee.

Figures 1A-1F. Expression and binding properties of anti- AAT scFv.

A. Amino-acid sequence alignment of anti-AAT scFv (SEQ ID NO: 1). Non-AAT specific scFv sequence was used for comparison (SEQ ID NO: 2). Underlined sequence is the linker sequence between VH and VL.

B. HEK 293 cells were transiently transfected with anti-AAT scFv. Conditioned media was subjected to western blot analysis. Primary antibody used was anti-His (1 : 1000) and detecting antibody was anti-rabbit-HRP (1 :2500).

Lane 1. Uncultured DMEM with 10% FBS.

Lane 2. Conditioned media from HEK 293 cells transfected with scFv.

Lane 3. Purified scFv.

Lane 4. Cell lysate from HEK 293 cells transfected with pSecTag2-scFv.

C. 20 μΐ of cell culture media from anti-AAT scFv transfected cells or original 3H12- 2C2 hybridoma clone was tested by ELISA using an M or Z-AAT coated plate. Culture medium from non-transfected HEK 293 cells was used as a control. *** p<0.0001 versus control.

D. Coomassie staining showing scFv purification.

Lane 1. Uncultured medium with 10% FBS.

Lane 2. Culture medium from pSec-scFv transfected HEK 293 cells.

Lane 3. Elution after 6X His tag purification. Black arrow shows the purified scFv band.

E. 0.1 ng of M or Z-AAT was subjected to SDS-PAGE, blotted with purified anti-

AAT scFv (1 : 100) and detected with anti-His-HRP antibody. 0.1 ng of BSA was used as a negative control.

F. CHO-mRFP-Z-AAT cells were fixed and stained with anti-AAT scFv and anti- His-Alexa Fluor-488. Representative images show anti-AAT scFv can recognize mRFP-Z- AAT. Control group is CHO cells transfected with mRFP plasmid and stained with scFv and anti-His- Alexa Fluor 488. Bar = 20 μιη.

Figures 2A-2B. ScFv inhibits the polymerization of Z-AAT in vitro. A. Co-incubation of Z-AAT with anti-AAT scFv prevents Z-AAT polymerization. Representative image shows purified scFv and 0.1 mM Z-AAT (final concentration) were incubated at 37°C for 48 hours, subjected to non-denaturing PAGE, and detected with the anti-AAT polyclonal antibody (n = 3 independent experiments).

B. Anti-AAT scFv does not have an effect on Z-AAT in cell culture. Anti-AAT scFv expressing plasmid was transfected into protease inhibitor type ZZ (PI-ZZ) hepatocytes or mRFP-Z-AAT stable expression CHO cells for 48 hours. ScFv expression was detected with western blot using rabbit anti 6XHis primary antibody. "+" indicates cells transfected with scFv plasmid; "-" indicates cells transfected with EGFP plasmid as control, β-actin was used as loading control.

Figures 3A-3F. ScFv-FKBP12 increases degradation of Z-AAT.

A. Three vectors expressing scFv fusion protein were constructed: one is fused with Hsc70 binding motif (Hsc70bm), the second is fused with wild-type FKBP12, and the third is fused with KDEL sequence. All vectors have a myc tag at the C-terminus.

B. Western blot of NP40 lysate, detected with anti-myc primary antibody and anti- rabbit-HRP secondary antibody, showing expression of scFv fused with KDEL, Hsc70bm and FKBP12. β-actin was used as loading control.

C. Non-denaturing gel of transfected CHO-mRFP-Z-AAT cell lysate, detected with anti-AAT primary antibody and anti-rabbit-HRP secondary antibody showing the intracellular monomer and polymers of AAT. β-actin was used as loading control. The gel represents 3 independent experiments.

D. CHO-mRFP-Z-AAT cells were transfected with scFv-FKBP12 or EGFP control plasmid. 48 hours after transfection, images were taken at 40X. Bar = 20μιη.

E. Ten cells were chosen in random view from each group and Image J was used to measure the total mRFP-Z-AAT intensity of each cell. The graph shows mean ± SEM of 3 independent experiments. p<0.0001.

F. Cells transfected with scFv-FKBP12, FKBP12-myc, or EGFP for 24 hours were lysed and subjected to SDS-PAGE. Representative gel image shows the level of AAT after treatment, β-actin was used as loading control.

Figures 4A-4E. ScFv-FKBP12 directs Z-AAT into proteasome degradation.

A. Western blot of an immunoprecipitation of cell lysate with c-myc antibody, detected with anti-AAT primary antibody and anti-rabbit-HRP secondary antibody, showing that anti-AAT scFv fusion protein with FKBP12 (anti-AAT scFv-FKBP12) can bind to mPvFP-Z-AAT.

B. CHO-mRFP-Z-AAT cells were transfected with anti-AAT scFv-FKBP12, FKBP12-myc or EGFP expression plasmid for 48 hours, fixed on slides and then stained with anti-myc as primary antibody and Alexa 488 conjugated donkey anti-rabbit secondary antibody. Images from red and green channels were taken at 40X, and then merged and deconvoluted to show the co-localization of the expressed proteins to Z-AAT. Bar = 20 μιη.

C. Forty-eight hours post-transfection, CHO-mRFP cells were treated with 10 μΜ MG132 or DMSO for 2 hours, and images were taken from random fields at 40X. White arrows in the representative images indicate increased aggregated protein. Bar = 20 μιη.

D. Quantification of fluorescent density (C). The graph shows mean ± SEM of 3 independent experiments.

E. 1 μΕ of baculovirus expressing GFP-N-acetylgalactosaminyl transferase 2 (Golgi marker) was added to the cell culture media following transfection with anti-AAT scFv- FKBP12. 24 hours later, live cell images were taken at 20X. Bar = 20 μιη.

Figures 5A-5C. Anti-AAT scFv-FKBP12 reduces ER stress caused by Z-AAT accumulation.

A. Anti-AAT scFv-FKBP12, FKBP-myc, or EGFP plasmid was transfected into CHO-mRFP-Z-AAT cells. 4000 cells from the three transfected groups and normal CHO cells were seeded into 96-well plates. MTT assays were performed every 24 hours for 4 days. The graph shows average ± SEM of 8 replicates. The value is expressed in absorption OD. **, p<0.01, ***, p<0.0001.

B. After 48 hours, cells from the three transfected groups in (A) were fixed and processed for transmission electron microscopy. Images were taken at 8000X. Arrows point to the Z-AAT accumulation globules. Bar = 1 μιη.

C. Plasmid pMet-NF-KB-Luc was co-transfected with anti-AAT scFv-FKBP12, FKBP12-myc, or EGFP to CHO-mRFP-Z-AAT cells. Normal CHO cells were also transfected with pMet-NFKB-Luc as baseline control. Cell culture medium was taken 24 hours after transfection and monitored by employing the Ready-To-Glow Secreted NF-KB Luciferase Reporter Assay. The results were normalized to total protein measured by BCA assay. The histogram shows relative NF-κΒ activity to normal CHO cells. RLU stands for relative light unit. *, p<0.05 under two tail student-t test. Figures 6A-6D. Anti-AAT scFv-FKBP12 does not interfere with the secretion and activity of M- AAT.

A. Huh7 cells were transfected with anti-AAT scFv-FKBP12 or GFP for 48 hours. Cell culture medium from both groups was subjected to M-AAT ELISA.

B. Cell culture medium from (A) was subjected to neutrophil elastase inhibition assay to determine the activity of secreted M-AAT.

C. 600 nM of purified scFv or PBS was incubated with 250 nM, 200 nM, 160 nM, 128 nM, 102.4 nM and 81.92 nM of M-AAT (final concentration in 50 μί) for 1 hour. Residual AAT activities were determined by neutrophil elastase inhibition assay. "-" indicates expected values of residual AAT at each concentration.

D. 600, 450, 300, 150 nM of purified anti-AAT scFv was incubated with 125 nM (final concentration) M-AAT for 1 hour, and residual AAT activity was measured as in (C). Broken line shows expected value of residual AAT at 125 nM.

Figures 7A-7C. Characterization of CHO-mRFP-Z-AAT stable expression cell line.

A. Schematic of mRFP-Z-AAT expression construct. Monomer red fluorescent protein (mRFP) was inserted between the signal peptide and the rest of the Z-AAT.

B. Overexpressed mRFP-Z-AAT can polymerize.

Lane 1. Cell lysate from mRFP-Z-AAT stable expression CHO cells.

Lane 2. Cell lysate from mRFP-M-AAT transient transfected CHO cells.

Lane 3. Cell lysate from CHO cells before stable transfection were subjected to non- denaturing or SDS PAGE and immunoblot with anti-AAT antibody.

C. ER marker co-localized with mRFP-Z-AAT within the stable CHO cell line. ER resident protein, Protein Disulfide Isomerase (PDI) was used as an ER marker. CHO cells transiently transfected with mRFP-M-AAT were used as the control. Bar = 2 μιη.

Figure 8. Mutated FKBP12 tag did not significantly increase degradation of Z-

AAT polymers in cell culture. CHO-mRFP-Z-AAT was transfected with anti-AAT scFv-

FKBP12- wt (wild type FBKP12) or anti-AAT scFv-FKBP12-2mu (FKBP12 double mutant).

FKBP-myc and EGFP were used as negative controls. 48 hours after transfection, cells were fixed, stained with DAPI, and subjected to fluorescent microscopy. Images were taken at

20X. Bar = 20 μm. Figure 9. Transfection efficiency in Huh7 cells was determined by positive EGFP expression. Huh7 cells were transfected with GFP for 48 hours, images were taken at 20X and transfection efficiency determined by GFP positive cells/total cells (n=5). Bar= 20 μιη.

DETAILED DESCRIPTION OF THE INVENTION

The current invention provides a method of treating a disease involving misfolding and accumulation of proteins in the ER via gene therapy. The gene therapy of the current invention comprises introducing genes to a subject in need of a treatment of the disease, wherein the genes encode fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathway and antibodies or fragment of the antibodies against target proteins that misfold and accumulate in the ER, wherein misfolding and accumulation of the target proteins in the ER causes the disease.

The gene therapy of the current invention provides several advantages. Firstly, the fusion proteins of the current invention are more stable within the ER than small molecules or peptides. The fusion proteins are expressed in the target cell via gene delivery, and therefore, the delivery of the expressed proteins to the ER is more efficient. Also, as the antibody is synthesized within the cell and the translation and assembly takes place within the ER, a natural environment is provided for the antibody to recognize and bind to target proteins. Also, compared to RNA regulation, antibodies directly target mutant target proteins, which should provide for fewer off-target effects and higher efficiency of reducing the accumulation of misfolded mutant or abnormal proteins.

In an embodiment of the current invention, the subject receiving the gene therapy is a mammal. In another embodiment of the current invention, the subject receiving the gene therapy is a human. In a further embodiment of the invention, the gene therapy is targeted to a specific tissue of the subject. Non- limiting examples of the target tissues which may be used for the current invention include brain, heart, muscle, bone, liver, kidney, pancreas, stomach, intestines, skin, lungs, thymus, adrenal gland, spleen, prostate, testis, ovaries, pituitary gland, thyroid gland, parathyroid gland, pineal gland, other endocrine glands, other exocrine glands, blood, lymphatic tissue, and eyes. In an embodiment of the current invention, the gene therapy is directed to liver. In a further embodiment of the invention virus, for example, adenovirus, is used to deliver the gene encoding for the fusion proteins of the current invention to the target tissue. Vectors and delivery of the disclosed genes to a subject can be accomplished by various methods known the art, see, for example, U.S. Patent Nos: 8,137,962; 7,094,604; 6,461,606; 6,165,781; and 5,658,776, each of which is hereby incorporated by reference in its entirety.

The current invention provides genes encoding fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathways and antibodies or fragment of the antibodies against target proteins that misfold and accumulate in the ER. In an aspect of the invention, the genes encode fusion proteins comprising of proteins or polypeptides that target the fusion proteins to ubiquitin mediated or chaperone mediated proteasomal degradation pathways. The proteins or polypeptides that target the fusion proteins to chaperon mediated proteasomal pathways include, but are not limited to, Hsc70, a fragment of Hsc70, or peptide sequence Lys-Phe-Glu-Arg-Gln (KFERQ motif) (Dice, 1990). The proteins or polypeptides that target the fusion proteins to ubiquitin mediated degradation pathways, include, but are not limited to, FKBP12 or fragments of FKBP12. Further, based on the teachings of Gilon et al. (1998) and Bachmair et al. (1989), a person of ordinary skill in the art can design additional polypeptide sequences that would target the fusion protein containing those sequences to ubiquitin mediated proteasomal degradation pathways.

The current invention further provides genes encoding fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathways and antibodies or fragments of the antibodies against mutant or abnormal proteins that misfold and accumulate in the ER, wherein misfolding and accumulation of the mutant or abnormal proteins in the ER causes a disease. The current invention also provides genes encoding fusion proteins comprising proteins or polypeptides that target the fusion proteins to proteasomal degradation pathways and antibodies or fragments of the antibodies against mutant or abnormal proteins that can misfold and accumulate in the ER, wherein the fusion proteins target the mutant or abnormal proteins without interfering with the wild type or normal counterpart of the mutant protein.

In an embodiment of the invention the genes encode fusion proteins comprising FKBP12 or a fragment, derivative, or mutant thereof and antibodies or a fragment of the antibodies against proteins that misfold and accumulate in the ER, wherein the misfolding and accumulation of the proteins in the ER causes a disease. The fragment, derivative, or mutant of FKBP12 suitable for use in the current invention has the ability to target the fusion proteins to proteasomal degradation without having the full length FKBP12 protein sequence. The derivatives or mutants of FKBP12 suitable for use in the current invention include, but are not limited to, amino acid substitutions, deletions, or insertions.

Non-limiting examples of conditions where mutant or abnormal proteins misfold and accumulate in the ER leading to a disease are provided by alpha- 1 antitrypsin deficiency, alpha- 1 antichymotrypsin deficiency, cystic fibrosis, familial neurohypophyseal diabetes insipidus, Prion-related diseases, Creutzfeldt-Jacob's disease, and Robinow Syndrome. Numerous diseases involving misfolding and accumulation of mutant or abnormal proteins in ER, as discussed by Chen et al. (2005) and otherwise known to a person of ordinary skill in the art, are within the purview of the current invention.

An embodiment of the invention provides the genes that encode fusion proteins comprising FKBP12 and antibodies or fragment of the antibodies against AAT. Another embodiment of the current invention provides the genes encoding fusion proteins comprising FKBP12 and antibodies or a fragment of the antibodies against mutant or abnormal AAT, wherein misfolding and accumulation of mutant AAT in ER causes a disease. Another embodiment of the current invention provides genes encoding fusion proteins comprising FKBP12 and antibodies or fragments of the antibodies against mutant or abnormal AAT protein, wherein the mutant or abnormal AAT misfolds and accumulates in ER and the fusion protein targets the mutant or abnormal AAT without interfering with the wild type or normal AAT. A further embodiment of the invention provides the genes encoding fusion proteins comprising FKBP12 with scFv portion of an antibody against AAT. In an even further embodiment, the current invention provides the genes encoding fusion proteins comprising FKBP12 with scFv portion of the antibody against mutant or abnormal AAT.

The current invention also provides a single chain variable fragment (scFv) derived from a monoclonal antibody against Z-AAT (anti-AAT scFv). Further, the current invention provides fusion proteins comprising anti-AAT scFv and a protein or polypeptide tag recognized by proteasome machinery, wherein the fusion protein can cause proteasomal degradation of anti-AAT scFv complexed with Z-AAT protein (scFv-Z-AAT complex) by directing it to proteasomal machinery. The current invention further provides fusion proteins comprising FKBP12 and anti-AAT scFv, wherein the fusion proteins cause proteasomal degradation of scFv-Z-AAT complex by directing it to proteasomal machinery. Antibodies disclosed herein may be formulated as compositions in carriers or diluents according to methods known in the art. In certain embodiments, the compositions are in the form of pharmaceutical compositions suitable for administration to a mammalian subject or human (e.g., the antibodies are formulated in pharmaceutically acceptable diluents or excipients).

A pharmaceutical composition according to the invention comprises an antibody as disclosed herein, for example the scFv-AAT of SEQ ID NO: 1). The pharmaceutical compositions according to the invention may be formulated with pharmaceutical acceptable carriers or diluents as well as any other known adjuvants and excipients in accordance with conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed. Mack Publishing Co., Easton, Pa., 1995. The pharmaceutical compositions may be specifically formulated for administration by any suitable route such as the oral, rectal, nasal, pulmonal, topical (including buccal and sublingual), transdermal, itracisternal, intraperitoneal, vaginal and parenteral (including subcutaneous, intramuscular, intrathecal, intravenous and intradermal) route.

Another aspect of the inventions provides vectors for the expression of antibodies ad disclosed herein (e.g., the scFv of SEQ ID NO: 1). As it is well known in the art, a vector is a tool that allows or facilitates the transfer of an entity from one environment to another. In accordance with the present invention, and by way of example, some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment or a heterologous cDNA segment), to be transferred into a host and/or a target cell for the purpose of replicating the vectors comprising the nucleotide sequences of the present invention and/or expressing the proteins of the invention encoded by the nucleotide sequences of the present invention. Examples of vectors used in recombinant DNA techniques include but are not limited to plasmids, chromosomes, artificial chromosomes or viruses. Thus, the term "vector" includes expression vectors and/or transformation vectors. The term "expression vector" means a construct capable of in vivo or in vitro/ex vivo expression. The term "transformation vector" means a construct capable of being transferred from one species to another.

All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

Following are examples which illustrate procedures for practicing the invention.

These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. EXAMPLE 1: DISEASE RESULTING FROM MISFOLDING AND

ACCUMULATION OF MUTANT PROTEIN IN THE ER: AAT DEFICIENCY

AAT is an acute phase glycoprotein synthesized and secreted by liver. Its major function is to protect the lungs against proteolytic damage of neutrophil elastase (NE) by irreversibly docking its inhibition site to NE's proteolytic active site (Beatty et al., 1980). In hepatocytes, AAT is transcribed into a 1.6 kb mRNA which encodes a 394 amino acid peptide. Later the peptide is glycosylated and folded into a 52 kDa glycoprotein with three asparagine-linked carbohydrate side chains (Carrell et al., 1982; Mega et al., 1980). Over 100 variants have been described in various populations, the most common deficient variant being the Z mutation, a single nucleotide exchange (G>A) which causes an amino acid substitution of positively charged lysine for negatively charged glutamic acid at position 342 (Jeppsson 1976). This mutation causes abnormal folding of AAT, leading to polymerization and accumulation within the ER and later, major clinical manifestations, including loss-of- function for lung disease and gain-of- function toxicity for liver disease (Ekeowa et al., 2009; Kopito and Ron 2000).

In cases of lung disease, lack of AAT exposes the lungs to proteolytic attack by NE and patients have a consequent risk of early on-set emphysema (Lieberman et al., 1986). In cases of liver disease, patients with homozygous Z alleles have higher chances of developing fibrosis, cirrhosis, or liver carcinogenesis, believed to be through the mechanism of ER stress induced apoptosis (Perlmutter 2011 ; Rudnick et al. , 2004). It is indicated that there must be a "second hit" such as environmental or genetic factors that lead to liver disease (Kumar et al., 2004; Stolk et al., 2006). Literature has shown mechanisms such as ER associated degradation (ERAD) (Sifers 2010), ER overloading response (Davies et al., 2009; Hidvegi et al., 2005; Lawless et al., 2004), and autophagy pathways (Hidvegi et al., 2005) are involved in dealing with Z-AAT aggregation.

Several potential treatments to reduce accumulation of unfolded Z-AAT, such as inducing autophagy (Hidvegi et al., 2005), inducing the ubiquitin-proteasome pathway (Wang et al., 2011), using small ligands to seal the surface cavity to terminate the polymerization reaction (Mahadeva et al., 2002; Mallya et al., 2007), using small peptides (Mahadeva et al., 2002), gene delivery of shRNA (Cruz et al., 2007), and gene delivery of miRNA (Mueller et al., 2012) have been assessed. Researchers successfully demonstrated that using small ligands to treat AAT deficiency is feasible in vitro, but this approach has limited success because the small peptide or molecule is either not stable or hard to deliver to the ER (Mahadeva et al, 2002; Mallya et al.,2007).

AAT deficiency has been well recognized as a conformational disorder caused by aberrant β-strand inter-linkage (Zhou et al., 2004). The mutant Z-AAT protein forms polymers and is retained within the ER of hepatocytes, which may lead to ER dysfunction and liver disease. However, clinical studies indicate that not all PI-ZZ patients will develop severe liver diseases (Ellgaard and Helenius 2001). It has been proposed that the equilibrium between polymer formation and degradation is the key reason for these PI-ZZ individuals' healthy status (Zhou et al., 2004). The well accepted "second hit" theory proposed that an insufficient degradation system would break this equilibrium and lead to significant disease (Lawless et al. , 2008).

The current invention provides gene therapy involving an anti-AAT single chain variable fragment (anti-AAT scFv) derived from a monoclonal hybridoma as a tool to facilitate the degradation of accumulated Z-AAT. This approach has several advantages. Anti-AAT scFv is more stable than small molecules or peptides within the ER (Rajpal and Turi 2001). The anti-AAT scFv or a fusion protein thereof is expressed in the target cell via gene delivery, and therefore, the delivery of the expressed protein to the ER is more efficient as the antibody is synthesized within the cell and the translation and assembly takes place within the ER thereby providing a natural environment for the antibody to recognize and bind to Z-AAT. Also, compared to RNA regulation, anti-AAT scFv directly targets mutant Z- AAT proteins, which may have less off-target effects and higher efficiency of reducing the accumulation of Z-AAT.

EXAMPLE 2: CLONING OF ANTI-AAT SCFV

The hybridoma secreting anti-human AAT antibody was generated in the Hybridoma

Core Facility at the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida. The process was handled under the established method (Brown et al., 1980) and approved by the University of Florida Institutional Animal Care and Use Committee (UF IACUC protocol #201202356). Positive colonies were screened by ELISA using plates coated with M or Z-AAT. Total RNA from clone 3H12-2C2 was isolated with the RNeasy kit (Qiagen, Valencia, CA). The RNA was reverse transcribed into cDNA using the Universal Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA) with random hexamers as primers to synthesize first strand cDNA. The first strand was then poly-G tailed by incubation with 1 unit of terminal transferase and 100 μΜ dGTP (both from New England Biolabs, Ipswich, MA) for 30 minutes. The tailed cDNA was amplified by PCR using an anchor poly-C primer and another primer to anneal to the constant region of either the heavy chain (V_H) or light chain (V_L) (Gilliland et al., 1996). The first round PCR reaction was carried out with 35 cycles at 96°C for 30s, 52°C for 30s, and 72°C for 45s. The amplicons of V_H and V_L were digested by Xba I and Hind III, respectively, and inserted into pEGM-Easy vector, (Promega, Madison, WI) for sequencing. To create a single chain construct, V_H and V_L were amplified with nest primers, which contain an intervening (G₄S)₃ peptide DNA linker, and assembled in V_H-V_L fashion. The final PCR product was inserted into the Hind III and Not I site of the pSecTag2-His plasmid (Invitrogen, Carlsbad, CA) to create pSecTag2-ScFv plasmid for protein expression and purification.

To generate a high affinity scFv against AAT, the hybridoma colonies which produce AAT antibodies were screened. As Table 1 shows, multiple single colonies had strong affinity for both M and Z-AAT. Clone 3H12-2C2 was chosen from various monoclonal hybridomas (Table 1) to generate the anti-AAT scFv because the antibody it produced has higher affinity for Z-AAT than for M-AAT. Both V_H and V_L fragments are 560bp and were amplified from the cDNA of the hybridoma; the deduced size for the anti-AAT scFv protein is 28 kDa. The amino-acid sequence of anti-AAT scFv without a leader sequence is shown in Figure 1A. To verify the affinity of the scFv to AAT, we characterized the anti-AAT scFv- His expressed in the HEK 293 cell. The 28 kDa band from both the cell culture media and cell lysate was detected on an SDS-PAGE gel with anti-His antibody (Figure IB). Media from anti-AAT scFv-His plasmid transfected cells shows significantly higher signal compared to the negative control in ELISA with M or Z-AAT coated plates (Figure 1C).

Table 1. Hybridomas screening for positive affinity to AAT

Assay Plate

3H12 clone ZZ OD MM OD Clone type well

C8 2E8 2.481 3.249 Single colony

C9 2F2 2.576 3.339 Single colony

E10 3F4 2.605 3.370 Single colony

El l 3F7 2.691 3.394 Single colony

E12 3F9 2.780 3.448 Single colony F7 4B8 2.497 3.189 Single colony

F9 4B12 2.594 3.342 Single colony

Fl l 4C4 2.467 3.331 Single colony

Gl 4C7 2.558 3.370 Single colony

G6 4E7 2.584 3.279 Single colony

H12 4D4 2.420 3.245 Multiple colony

B4 1C12 2.363 4.000 Single colony

B5 1D1 2.099 4.000 Single colony

B12 2C2 3.362 2.267 Single colony

CIO 2F3 2.404 3.319 Single colony

C12 2F8 2.479 3.383 Single colony

E9 3E3 2.300 3.341 Single colony

F8 4B10 2.140 3.420 Single colony

B9 2A12 2.189 3.341 Single colony

Bl l 2B10 2.156 3.340 Single colony

Purified Anti-AAT scFv inhibits the Z-AAT polymer formation in vitro

We purified the anti-AAT scFv from culture media with a His purification system and detected a 28 kDa band with Coomassie staining (Figure ID). The purified anti-AAT-scFv- His detected AAT by western blot (Figure IE) and immunofiuorescent staining when used as the primary antibody (Figure IF). Collectively, these data demonstrate that the anti-AAT scFv retains, but with a reduced binding affinity to AAT as compared to the parental monoclonal antibody (mAb).

After determining that the anti-AAT scFv has affinity to AAT, we tested whether it can function as an inhibitor of Z-AAT polymer formation. Since Z-AAT can form polymers at 37°C (Lomas 2006), we incubated O. lmM Z-AAT with different amounts of purified anti- AAT scFv at 37°C overnight and subjected it to non-denaturing PAGE followed by immunoblot with anti-AAT polyclonal antibody. Polymerized Z-AAT diminishes with increasing amounts of anti-AAT scFv, as shown in Figure 2A. In addition, the portion of Z- AAT monomer or dimer significantly increases as anti-AAT scFv concentration increases. This data demonstrates that anti-AAT scFv inhibits Z-AAT polymer formation in vitro. ScFv-FKBP12 increases degradation of Z-AAT in cell culture

Next, we questioned whether anti-AAT scFv performs the same inhibition of polymer formation in a Z-AAT expressing cell line. We first established a stable CHO cell line expressing mRFP-Z-AAT (Figure 7A). Polymerized mRFP-Z-AAT has been identified by non-denaturing PAGE (Figure 7B). Immuno fluorescent microscopy revealed mRFP-Z-AAT co-localized with ER markers (Figure 7C). Then scFv-His or pEGFP-C3 control plasmids were transiently transfected into CHO-mRFP-Z-AAT and PI-ZZ hepatocytes with 78% and 40%) efficiency, respectively, which was determined by positive EGFP cell counting (data not shown). However, no significant reduction of polymerization was observed (Figure 2B). To increase the chance of scFv binding to Z-AAT, we replaced the scFv Ig-κΐ leader sequence (METDTLLLWVLLLWVPGSTG, SEQ ID NO: 3) with the native AAT signal peptide sequence (MPSSVSWGILLLAGLCCLVPV, SEQ ID NO: 4) at the N-terminus of anti-AAT scFv. To increase the degradation efficiency, we directed the anti-AAT scFv complex to three specific degradation pathways. Three vectors were constructed based on the scFv with native AAT signal peptide (Figure 3 A). At the C-terminus of the anti-AAT scFv, one was fused with Hsc70bm to direct it to the chaperone mediated autophagy pathway (Bauer et ah, 2010); a second was fused with wild-type FKBP12 to direct to the ubiquitin pathway (Schneekloth et ah, 2004); the third was fused with KDEL sequence (Munro and Pelham 1987) to retain the anti-AAT scFv in the ER to increase the chance of anti-AAT scFv binding to Z-AAT protein.

Three anti-AAT scFv constructs were transfected into CHO-mRFP-Z-AAT cells and the fusion protein bands were detected in cell lysates with correct size: anti-AAT scFv-KDEL and anti-AAT scFv-Hsc70bm both showed 28 kDa bands and anti-AAT scFv-FKBP12 showed a 35 kDa band (Figure 3B). In addition, the cell lysate in PBS was subjected to non- denaturing PAGE and detected with anti AAT primary antibody and anti-rabbit-HRP secondary antibody. As shown in Figure 3C, the anti-AAT scFv-FKBP12 transfected group has the most significant reduction of intracellular polymer and monomer AAT. To further confirm this, cells were transfected with anti-AAT scFv-FKBP12 and subjected to fluorescent microscopy. The cells from anti-AAT scFv-FKBP12 treated group have reduced Z-AAT accumulation represented by total RFP fluorescent intensity (Figure 3D). The total intensity of mRFP-Z-AAT of the treatment group decreased 2-fold compared to the control group (Figure 3E). To verify that the reduction of Z-AAT aggregation is not caused by FKBP12 alone, we used FKBP12-myc transfected cells as an additional control. The AAT levels in the western blot show that only the anti-AAT scFv-FKBP12 group reduces the total intracellular accumulation of Z-AAT (Figure 3F). Since Banaszynski et. al. demonstrated that FKBP12 with F36V and L106P mutations will significantly increase the degradation efficiency in NIH3T3 cells (Banaszynski et al, 2006), we compared the degradation efficiency between wild-type and double-mutated anti-AAT scFv-FKBP12.

As shown in Figure 8, although both transfected constructs reduce Z-AAT accumulation levels, the mRFP-Z-AAT accumulation levels between anti-AAT scFv- FKBP12-wt and anti-AAT scFv-FKBP12-2mu transfected groups shows no significant difference (t-test, p=0.28, n=6). These results demonstrate that scFv-FKBP12 with native AAT signal peptide significantly reduces the Z-AAT accumulation level within the ER.

ScFv-FKBP12 reduces Z-AAT polymerization through the proteasome degradation pathway

Since FKBP12 has been reported as a chaperone for amyloid precursor protein (Cao and Konsolaki 2011), we introduced FKBP12-myc construct as a negative control to eliminate the possibility that FKBP12 alone can facilitate degradation of Z-AAT. To prove anti-AAT scFv-FKBP12 can bind to Z-AAT, anti-myc antibody was used to pull down scFv- FKBP12-Z-AAT complex from the cell lysate and the result shows only scFv-FKBP12 can bind to Z-AAT (Figure 4A). In addition, co-localization of mRFP-Z-AAT with anti-AAT scFv-FKBP12 but not FKBP12 was detected (Figure 4B). To further confirm that the proteasome pathway degrades the binding complexes, we used MG132, a proteasome inhibitor, to block the degradation chain of the complex. After treatment with MG132 for 2 hours, the anti-AAT scFv-FKBP12 transfected group shows the highest increasing of Z-AAT accumulation (Figure 4C). Further quantification of the fluorescent images (Figure 4D) shows the fluorescent density in the anti-AAT scFv-FKBP12 transfected group increased 2.1- fold after MG132 treatment (p=0.02, n=4). However, in FKBP12-myc control groups, the AAT accumulation level has no significant change after MG132 treatment (p=0.7183, n=4) and only a 1.3-fold increase was observed in the EGFP control group (p=0.03, n=4). To further confirm the previous report that inhibition of polymerization will not interfere with the secretion pathway (Mallya et al, 2007), co-localization of a Golgi apparatus marker and Z-AAT was performed. No co-localization was observed (Figure 4E). These data demonstrate that anti-AAT scFv-FKBP12 binds and directs the aggregated complex to proteasome pathway for degradation. ScFv-FKBP12 reduces ER stress caused by Z-AAT accumulation

The direct effect of Z-AAT accumulation is ER stress, which may lead to mitochondria damage and ER dilation (Gooptu et al, 2009). To assess whether anti-AAT scFv-FKBP12 can restore the growth status of the cell, an MTT assay was performed. CHO- mRFP-Z-AAT cells transfected with anti-AAT scFv-FKBP12 grow significantly faster than both EGFP and FKBP12-myc control groups after 48 hours (p<0.01, FKBP12-myc and EGFP vs. scFv-FKBP12, two-way ANOVA with Bonferroni post-test) (Figure 5 A). The characteristic ER globules formed by Z-AAT accumulation were reduced (Figure 5B). To assess changes in the ER overloading pathway, NF-κΒ was used as a marker (Davies et al, 2009; Hidvegi et al, 2005; Lawless et al, 2004). CHO-mRFP-Z-AAT cells were co- transfected with pNF-KB-MetLuc and pCR3.1-scFv-FKBP12 as treatments. The control group was co-transfected with pNF-KB-MetLuc and pEGFP or pCR3.1-FKBP12-myc. As shown in Figure 5C, the reporter activity, an indicator of transcription level of NF-κΒ, in normal CHO cells is only 59.3% ± 1.2% of that in CHO-mRFPZ-AAT (p=.004, n=4). After transfection with scFv-FKBP12, the NF-κΒ transcription level significantly decreased by 33.8% ± 9.1% compared to the EGFP control group in CHO-mRFPZ-AAT cells (p=0.01, n=4). This data demonstrates that clearance of Z-AAT accumulation by anti-AAT scFv- FKBP12 reduces activation of the NF-κΒ pathway, or ER stress within the cell.

Anti-AAT ScFv-FKBP12 does not interfere with the secretion and the activity of M-AAT

Initial studies showed that anti-AAT scFv can bind to both M and Z-AAT in ELISA. To assess whether anti-AAT scFv can interfere with normal M-AAT in the cells, anti-AAT scFv-FKBP12 or pEGFP-C3 plasmids were transfected into Huh7 cells with normal M-AAT expression. 48 hours after transfection, 82% ± 3% of the cells have positive EGFP expression (Figure 9). Cell culture media was subjected to ELISA to measure the amount of M-AAT. As shown in Figure 6 A, no significant difference in M-AAT production between anti-AAT scFv-FKBP12 and EGFP transfected groups was observed (p=0.18, n=3). To monitor the activity of secreted M-AAT, a neutrophil elastase inhibition assay was performed on cell culture media from the two groups, and showed no significant difference between them (p=0.17, n=4) (Figure 6B). To further confirm, we incubated either 600nM of purified anti-AAT scFv or IX PBS with different amounts of M-AAT for 30 minutes and performed a neutrophil elastase inhibition assay. The result from this experiment showed scFv did not affect M-AAT activity (Figure 6C) (two-way ANOVA with Bonferroni post-test, p=0.06, n=3). In addition, we incubated 125 nM M-AAT with different amounts of purified scFv. Similarly, no significant effect of scFv on M-AAT activity was observed (Figure 6D) (One- way ANOVA, p=0.6023, n=3).

There are two rather curious aspects to the findings discussed above. First is that scFv can inhibit the formation of Z-AAT polymers in vitro, but failed to decrease intracellular accumulation by itself. This suggests that inhibition of polymerization is not enough to increase Z-AAT degradation. Since we know that most unfolded Z-AAT will be recognized and degraded by the ERAD pathway (Sifers 2010), the fast turnover of FKBP12 may provide a good means of enhancing the degradation of whole complex in the ERAD pathway.

The other aspect is regarding the lack of effect of anti-AAT scFv on either the secretion or the activity of M-AAT. Since anti-AAT scFv can bind both M and Z-AAT, theoretically it would have had the same effect on both. However, it has been reported that PI-MM cells secrete most of the M-AAT in a very fast manner and very few proteins remain within the ER (Novoradovskaya et al., 1998). This may give fewer chances for anti-AAT scFv to bind M-AAT, and thus have a limited effect on the degradation level of M-AAT. On the issues of M-AAT activity, our explanation is that the binding epitope on AAT is not close to the reactive site, so the docking of neutrophil elastase will not be interrupted.

These findings also support an aspect of the current invention where the fusion protein comprising anti-AAT scFv and FKBP12 can eliminate accumulated Z-AAT and at the same time allow sufficient M-AAT to enter into circulation.

Therefore, compared to inducing a non-target-specific degradation system like macroautophagy or ERAD, the scFv therapy has several advantages. First, the target of the scFv is very specific, so collateral damage to other functional proteins is minimized. Second, the artificial construct is upgradable. Since the functional groups of either scFv or FKBP12 are distinct, current scFv can be switched with a Z-AAT specific scFV, which may further increase the efficiency and specificity of the treatment.

Since the scFv-FKBP12 is expressed constitutively within the ER, further kinetic studies will be necessary to determine the optimal expression level to achieve the best efficiency without overwhelming the proteasome (Cardinale et al., 2003). Given that adeno- associated virus type 8 (AAV8) can achieve more than 80% gene delivery efficiency as well as more in the liver through portal vein injection (Jiang et al., 2006), an aspect of the invention involves gene delivery method using AAV8.

EXAMPLE 3: CELL LINES AND TRANSFECTIONS

The CHO cell line (Invitrogen, Carlsbad, CA) with stable mRFP-Z-AAT expression were generated by standard protocols. CHO stable-expression cells were cultured in DMEM F-12 media supplemented with 10% fetal bovine serum, 100 units/mL penicillin, and 100 μg/mL Streptomycin. Cells were incubated at 37°C with 5% C0₂ and maintained with 500 μg/mL Geneticin (all cell culture reagents from Invitrogen). HEK 293 cells were maintained in the same medium but without Geneticin. 24 hours before transfection, 1 X 10⁵ CHO- mRFP-Z-AAT or HEK 293 cells were seeded in each well of a 6-well plate without Geneticin. The PI-ZZ hepatocyte line was created from a liver biopsy from a four month old PI-ZZ infant according to the established protocol (Gomez-Lechon et al., 1990). Lentivirus containing human telomerase catalytic domain TERT was used to immortalize the cell. The plasmids were premixed in 500 Opti-MEM and trans fected with Lipofectamin LTX (Invitrogen, Carlsbad, CA) according to manufacturer's instructions. Transfection in the PI- ZZ and Huh-7 cell line was done in a similar fashion with GenJet™ In Vitro DNA Transfection Reagent (SignaGen Lab Gaithersburg, MD) and culture media was changed 6 hours after transfection.

EXAMPLE 4: CONSTRUCTION OF SCFV FUSION VECTORS

To express in the mammalian cell lines, the anti-AAT scFv fragment was digested with Hind III and Not I and inserted into pCR3.1 (Invitrogen, Carlsbad, CA). The AAT signal peptide was inserted at the 5 ' end of the scFv. KDEL ER-targeting sequence, Hsc70 binding motif VKKDQ/KFERQ (SEQ ID NOs: 5 and 6, respectively), and FKBP12 (107 amino acid) were inserted at the 3' end of the scFv between the Not I and Apa I site. Myc sequence was added at the 3' end of each tag.

FKBP12 was digested from pCR3.1-FKBP-myc (plasmid 20211, Addgene, Cambridge MA). KDEL-ER targeting sequence and heat shock cognate protein (Hsc70) binding motif were synthesized by annealing two oligonucleotides. The list of oligonucleotide primers is shown in Table 2. Table 2. Primers for ScFv Construction.

Primers Sequence (5'-3')

CGTCGATGAGCTCTAGAATTCGCATGTGCAAGTCCG

Poly-C primer Forward

ATGGTCCCCCCCCCCCCCC (SEQ ID NO: 7)

Constant Region Heavy

CAGGTCACTGTCACTGGCTCAG (SEQ ID NO: 8) Chain

Constant Region Light

CTTCCACTTGACATTGATGTCTTTG (SEQ ID NO: 9) Chain

GGTTGGTACCGTCGACATGGATGTGCAGCTTCAGGA

VH nest primers F

GTCG (SEQ ID NO: 10)

AATTGGTCTCCCTCCTCCGCTTCCTCCTCCTCCAGGC

VH nest primers R

TGCAGAGACAGTGAC (SEQ ID NO: 11)

AATTGGTCTCAGGAGGAGGAAGCGGAGGAGGAGGA

VL nest primers F

AGCGACATTGTGCTGACACAG (SEQ ID NO: 12)

TTAAGCGGCCGCTTTCCAGCTTGGTCCCCC (SEQ ID

VL nest primers R

NO: 13)

CTAGCATGCCGTCTTCTGTCTCGTGGGGCATCCTCCT

AAT signal peptide F GCTGGCAGGCCTGTGCTGCCTGGTCCCTGTCTCCCTG

GCTGAGGATCCGA (SEQ ID NO: 14)

AGCTTCGGATCCTCAGCCAGGGAGACAGGGACCAG

AAT signal peptide R GCAGCACAGGCCTGCCAGCAGGAGGATGCCCCACG

AGACAGAAGACGGCATG (SEQ ID NO: 15)

KDEL ER-targeting GGCCGCTAAGGACGAGCTGCATCATCATCATCATCA sequence F TTGAGGGCC (SEQ ID NO: 16)

KDEL ER-targeting CTCAATGATGATGATGATGATGCAGCTCGTCCTTAG sequence R C (SEQ ID NO: 17)

GGCCGCTGTTAAGAAGGATCAAGCTGGAGCCGCTGC

Hsp 70 binding motif F ACCGAAGTTCGAACGTCAACATCATCATCATCATCA

TTGAG (SEQ ID NO: 18)

AAAGGGCCCTCAATGATGATGATGATGATGTTGACG

Hsp 70 binding motif R TTCGAACTTCGGTGCAGCGGCTCCAGCTTGATCCTTC

TTAACAGCGGCCGCCCGTTTGATTTC (SEQ ID NO: 19)

EXAMPLE 5: IMMUNOBLOTTING FOR NON-DENATURING GELS

48 hours after transfection, cells were scraped from the surface of 6-well plates in DPBS (Invitrogen, Carlsbad, CA) with protease inhibitor (Roche, Pleasanton, CA). The lysate was vortexed for 5 minutes and centrifuged at 14,000 g for 10 minutes. Total protein in the supernatant was normalized by BCA assay (Thermo Scientific, Rockford, IL) and subjected to non-denaturing gel electrophoresis. Then the gel was transferred to a PVDF membrane with iBlot (Invitrogen) and blotted with polyclonal anti-AAT antibody (1 :5000) (Dako, Carpinteria, CA) or monoclonal anti-His antibody (1 :3000) (Abeam, Cambridge, MA).

EXAMPLE 6: IMMUNOFLUORESCENT MICROSCOPY

Cells were transferred from 6-well plates (Nunc, Rochester, NY) to culture slides (Millipore, Billerica, MA) 6 hours post transfection. After 48 hours, cells were washed twice with DPBS (Invitrogen), fixed with 4% paraformaldehyde for 30 minutes and permeabilized with 0.5% Triton X-100 for 10 minutes. After blocking in 10% donkey serum for 10 minutes, cells were incubated with rabbit anti-myc (1 : 1000) (# ab9160, Abeam, Cambridge, MA) in 3%) donkey serum, followed by 5 minutes in a DPBS wash 3 times. Secondary donkey anti-rabbit antibody labeled with Alexa 488 (Jackson Immunolab, West Grove, PA) was used at 1 :250 in 1.5% donkey serum and incubated with samples for 1 hour. Golgi apparatus was labeled with GFP-Nacetylgalactosaminyl transferase 2 and ER was labeled with GFP-KDEL, which were both delivered by Cell Light baculovirus (Invitrogen). 36 hours after transfection, 10 of cell light reagent was added to 500 of cell culture medium and incubated with CHO cells overnight before taking live cell images. Image J (vl .46r) was used to quantify the fluorescent intensity within each cell.

EXAMPLE 7: IMMUNOPRECIPITATION

CHO cells were lysed in NP40 buffer 48 hours after transfection. Samples were centrifuged at 14,000g for 10 minutes. The supernatants were incubated with Dynabeads (Invitrogen) conjugated with a mouse monoclonal anti-myc antibody. Followed by 3 washes, the samples were eluted and ran on a 4-12% Bis-Tris gel (Invitrogen) for western blotting and detected by polyclonal anti-AAT antibody (1 :3000, Dako) and HRP-conjugated secondary goat anti-rabbit antibody (Chemicon International, Billerica, MA). EXAMPLE 8: SCFV ANTI-AAT BINDING ACTIVITY ASSAY

Plasmid pSecTag2-scFv was transfected into HEK 293 cells and incubated for 48 hours at 37°C. Supernatant was collected, purified with MagneHis purification system (Promega, Madison, WI) and subjected to an ELISA-based assay. Microtiter plates (Corning Life Science, Tewksbury MA) were coated overnight with ^g of M or Z-AAT per well. Plates were washed, followed by the addition of a dilution series of purified scFv or positive control polyclonal anti-AAT antibody (1 :5000, Dako). Rabbit anti-His antibody labeled with horseradish peroxidase (HRP) (1 : 1000, Roche) was used as secondary antibody for the supernatant and goat anti-rabbit (1 : 1500, Jackson Laboratories, Bar Harbor, ME) antibody was used as secondary antibody for positive control. Plates were developed using 3,3',5,5'- Tetramethyl benzidine and phosphate citrate buffer (Sigma-Aldrich, St. Louis, MO) and analyzed at an absorbance of 450nm using Molecular Devices model M3 microplate reader (Molecular Device, Sunnyvale, CA).

EXAMPLE 9: CELL PROLIFERATION ESTIMATED BY MTT ASSAY

Six hours after transfection, 3000 cells were seeded into each well of a 96-well-plate. The MTT assay was done at 0, 24, 48, 72, and 96 hours after seeding the cells by using Cell Titer 96 MTT assay kit (Promega) according to the manual.

EXAMPLE 10: ELECTRON MICROSCOPY

Cells were trypsinized and resuspended in Tyrode's buffer (Sigma-Aldrich). Then the cells were fixed with 2% glutaraldehyde, dehydrated, and embedded in Epon in preparation for electron microscopy. Ultrathin sections were counter stained with uranyl acetate followed by lead citrate and examined by Hitachi 7100 Transmission electron microscope. Images were captured at 8000X magnification.

EXAMPLE 11: AAT ACTIVITY ASSAY

Pure AAT at 125 nM was diluted with varying amounts of antibody to test for neutralizing effects and then AAT activity was measured by anti-neutrophil elastase capacity assay. Samples were incubated with neutrophil elastase (Athens Research and Technology, Athens, GA) for 5 minutes at 37°C and then combined with n-methoxysuccinyl-Ala-Ala-Pro- Val-p-nitroanilide chromogenic substrate (Sigma, St Louis, MO) for a kinetic reading at 405 nm. The resulting OD values were compared for all samples and no difference was found for any antibody addition.

EXAMPLE 12: NF-κΒ ACTIVITY ASSAY Cells in each well of a 6-well plate were transfected with 2 μ of p NF-KB-MetLuc plasmid (Clontech, Mountain View, CA), 8 Lipofectamin LTX reagent (Invitrogen, Carlsbad, CA), and 2 μΐ, of Plus reagent. 24 hours after transfection, 50 μΐ, of cell culture medium from each well was tested with the Ready-to-Glow secreted luciferase assay according to manufacturer's instructions.

STATISTICAL ANALYSES

Quantitative PCR and western blot data were analyzed with GraphPad Prism 5.03 software (GraphPad Software, San Diego, CA). Results were compiled as mean ± SEM and compared by Student's t test. Significance was considered for p values < 0.05.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.

REFERENCES BACHMAIR A, VARSHAVSKIY A (1989). The degradation signal in a short-lived protein. Cell, Volume 56, Issue 6, 1019-1032. BANASZINSKI LA, CHEN LC, MAYNARD-SMITH LA, OOI AGL, et al. (2006). A rapid, reversible, and tunable method to regulate protein function in living cells using synthetic small molecules. Cell 126, 995-1004. BAUER PO, GOSWAMI A, WONG HK, OKUNO M, et al. (2010). Harnessing haperonemediated autophagy for the selective degradation of mutant huntingtin protein. Nature Biotechnology 28, 256-63. BEATTY K, BIETH J, TRAVIS J. (1980). Kinetics of association of serine proteinases with native and oxidized alpha- 1 -proteinase inhibitor and alpha- 1- antichymotrypsin. J Biol Chem 255, 3931-4. BROWN S, DILLEY J, LEVY R. (1980). Immunoglobulin secretion by mouse X human hybridomas: an approach for the production of anti-idiotype reagents useful in monitoring patients with B cell lymphoma. J Immunol 125, 1037-43. CAO W, KONSOLAKI M. (2011). FKBP immunophilins and Alzheimer's disease: a chaperoned affair. J Biosci 36, 493-8. CARDINALE A, FILESI I, MATTEI S, BIOCCA S. (2003). Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies. Eur J Biochem 270, 3389-97. CARRELL RW, JEPPSSON JO, LAURELL CB, BRENNAN SO, et al. (1982). Structure and variation of human alpha 1 -antitrypsin. Nature 298, 329-34. CHEN Y, BELLMY PW, SEABRA MC, FIELD MC, ALI BR (2005). ER-associated protein degradation is a common mechanism underpinning numerous monogenic diseases including Robinow syndrome. Human Molecular Genetics, Vol. 14, No. 17, pp. 2559-2569. CRUZ PE, MUELLER C, COSSETTE TL, GOLANT A, et al. (2007). In vivo posttranscriptional gene silencing of alpha- 1 antitrypsin by adeno-associated virus vectors expressing siRNA. Lab Invest 87, 893-902. DAVIES MJ, MIRANDA E, ROUSSEL BD, KAUFMAN RJ, et al. (2009).

Neuroserpin polymers activate NF-kappaB by a calcium signaling pathway that is independent of the unfolded protein response. J Biol Chem 284, 18202-9. DICE JF (1990). Peptide sequences that target cytosolic proteins for lysosomal proteolysis. Trends in Biochemical Sciences, Volume 15, Issue 8, 305-309. 13. EKEOWA UI, GOOPTU B, BELORGEY D, HAGGLOF P, et al. (2009). alphal- Antitrypsin deficiency, chronic obstructive pulmonary disease and the serpinopathies. Clin Sci (Lond) 116, 837-50. 14. ELLGAARD L, HELENIUS A. (2001). ER quality control: towards an understanding at the molecular level. Current Opinion in Cell Biology 13, 431-437.

15. GILLILAND LK, NORRIS NA, MARQUARDT H, TSU TT, et al. (1996). Rapid and reliable cloning of antibody variable regions and generation of recombinant single chain antibody fragments. Tissue Antigens 47, 1-20.

16. GILON T, CHOMSKY O, Kulka RG (1998). Degradation signals for ubiquitin

system proteolysis in Saccharomyces cerevisiae. The EMBO Journal, Vol.17, No.10, pp.2759-2766.

17. GOMEZ-LECHON MJ, LOPEZ P, DONATO T, MONTOYA A, et al. (1990).

Culture of human hepatocytes from small surgical liver biopsies. Biochemical characterization and

comparison with in vivo. In Vitro Cell Dev Biol 26, 67-74.

18. GOOPTU B, EKEOWA UI, LOMAS DA. (2009). Mechanisms of emphysema in alpha 1 -antitrypsin deficiency: molecular and cellular insights. Eur Respir J 34, 475- 88. 19. HIDVEGI T, SCHMIDT BZ, HALE P, PERLMUTTER DH. (2005). Accumulation of mutant alpha 1 -antitrypsin Z in the endoplasmic reticulum activates caspases-4 and -12, NFkappaB, and BAP31 but not the unfolded protein response. J Biol Chem 280, 39002-15. 20. JEPPSSON JO. (1976). Amino-Acid Substitution Glu→Lys in Alpha- 1 -Antitrypsin

Piz. FEBS Lett 65, 195-197.

21. JIANG H, LILLICRAP D, PATARROYO-WHITE S, LIU T, et al. (2006). Multiyear therapeutic benefit of AAV serotypes 2, 6, and 8 delivering factor VIII to hemophilia A mice and dogs. Blood 108, 107-15.

22. KOPITO RR, RON D. (2000). Conformational disease. Nat Cell Biol 2, E207-9.

23. KUMAR MB, POTTER DW, HORMANN RE, EDWARDS A, et al. (2004). Highly flexible ligand binding pocket of ecdysone receptor - Nonsteroidal ecdysone agonists.

Journal of Biological Chemistry 279, 27211-27218.

24. LAWLESS MW, GREENE CM, MULGREW A, TAGGART CC, et al. (2004).

Activation of endoplasmic reticulum-specific stress responses associated with the conformational disease Z alpha 1 -antitrypsin deficiency. J Immunol 172, 5722-6.

25. LAWLESS MW, MANKAN AK, GRAY SG, NORRIS S. (2008). Endoplasmic

reticulum stress—a double edged sword for Z alpha- 1 antitrypsin deficiency hepatoxicity. Int J Biochem Cell Biol 40, 1403-14. 26. LEVITES Y, JANSEN K, SMITHSON LA, DAKIN R, et al. (2006). Intracranial adenoassociated virus-mediated delivery of anti-pan amyloid beta, amyloid beta40, and amyloid beta42 single-chain variable fragments attenuates plaque pathology in amyloid precursor protein mice. J Neurosci 26, 11923-8.

27. LIEBERMAN J, WINTER B, SASTRE A. (1986). Alpha 1-antitrypsin Pi-types in 965 COPD patients. Chest 89, 370-3. 28. LOMAS DA. (2006). Parker B. Francis lectureship. Antitrypsin deficiency, the

serpinopathies, and chronic obstructive pulmonary disease. Proc Am Thorac Soc 3, 499-501.

29. MAHADEVA R, DAFFORN TR, CARRELL RW, LOMAS DA. (2002). 6-mer

peptide selectively anneals to a pathogenic serpin conformation and blocks polymerization. Implications for the prevention of Z alpha(l)-antitrypsin-related cirrhosis. J Biol Chem 277, 6771-4.

30. MALLYA M, PHILLIPS RL, SALDANHA SA, GOOPTU B, et al. (2007). Small molecules block the polymerization of Z alphal -antitrypsin and increase the clearance of intracellular aggregates. J Med Chem 50, 5357-63.

31. MEGA T, LUJAN E, YOSHIDA A. (1980). Studies on the oligosaccharide chains of human alpha 1-protease inhibitor. II. Structure of oligosaccharides. J Biol Chem 255, 4057-61.

32. MESSER A, MCLEAR J. (2006). The therapeutic potential of intrabodies in

neurologic disorders: focus on Huntington and Parkinson diseases. BioDrugs 20, 327- 33.

33. MIRANDA E, PEREZ J, EKEOWA UI, HADZIC N, et al. (2010). A novel

monoclonal antibody to characterize pathogenic polymers in liver disease associated with alphal -antitrypsin deficiency. Hepatology 52, 1078-88. 34. MUELLER C, TANG Q, GRUNTMAN A, BLOMENKAMP K, et al. (2012).

Sustained miRNA-mediated knockdown of mutant AAT with simultaneous augmentation of wildtype AAT has minimal effect on global liver miRNA profiles. Mol Ther 20, 590-600. 35. MUNRO S, PELHAM HR. (1987). A C-terminal signal prevents secretion of luminal

ER proteins. Cell 48, 899-907.

36. NOVORADOVSKAYA N, LEE J, YU ZX, FERRANS VJ, et al. (1998). Inhibition of intracellular degradation increases secretion of a mutant form of alphal -antitrypsin associated with profound deficiency. J Clin Invest 101, 2693 -701.

37. PERLMUTTER DH. (2011). Alpha- 1-antitrypsin deficiency: importance of

proteasomal and autophagic degradative pathways in disposal of liver disease- associated protein aggregates. Annu Rev Med 62, 333-45. RAJPAL A, TURI TG. (2001). Intracellular stability of anti-caspase-3 intrabodies determines efficacy in retargeting the antigen. J Biol Chem 276, 33139-46. RUDNICK DA, LIAO Y, AN JK, MUGLIA LJ, et al. (2004). Analyses of

hepatocellular proliferation in a mouse model of alpha- 1 -antitrypsin deficiency.

Hepatology 39, 1048-55. SCHNEEKLOTH JS, JR., FONSECA FN, KOLDOBSKIY M, MANDAL A, et al. (2004). Chemical genetic control of protein levels: selective in vivo targeted degradation. J Am Chem Soc 126, 3748-54. SIFERS RN. (2010). Intracellular processing of alpha 1 -antitrypsin. Proc Am Thorac Soc 7, 376-80. SONG S, MORGAN M, ELLIS T, POIRIER A, et al. (1998). Sustained secretion of human alpha- 1 -antitrypsin from murine muscle transduced with adeno-associated virus vectors. Proc Natl Acad Sci U S A 95, 14384-8. STOLK J, SEERSHOLM N, KALSHEKER N. (2006). Alpha 1 -antitrypsin deficiency: current perspective on research, diagnosis, and management. Int J Chron Obstruct Pulmon Dis 1, 151-60. WANG H, LI Q, SHEN Y, SUN A, et al. (2011). The ubiquitin ligase Hrdl promotes degradation of the Z variant alpha 1 -antitrypsin and increases its solubility. Mol Cell Biochem 346, 137-45. XIAO K, WANG L, MCANDREW E, ROUHANI F, et al. (2010). Unfolded Protein Response and Autophagy Behave as Complement Pathways to Dispose ZAAT in Hepatocytes. In Molecular Biology of the Cell, pp 3056. ZHOU A, STEIN PE, HUNTINGTON JA, SIVASOTHY P, et al. (2004). How small peptides block and reverse serpin polymerisation. J Mol Biol 342, 931-41.

Claims

CLAIMS We claim:

1. A method of treating a disease comprising introducing one or more genes to a subject in need of a treatment of a disease, wherein the genes encode fusion proteins comprising:

a) proteins or polypeptides that target the fusion proteins to proteasomal degradation pathway, and

b) antibodies or fragments of antibodies against target proteins that misfold and accumulate in endoplasmic reticulum,

wherein misfolding and accumulation of the target proteins in the endoplasmic reticulum causes the disease.

2. The method of claim 1 , wherein the subject is a mammal.

3. The method of claim 2, where in the subject is a human.

4. The method of claim 3, wherein the disease is selected from the group consisting of alpha- 1 antitrypsin deficiency, alpha- 1 antichymotrypsin deficiency, cystic fibrosis, familial neurohypophyseal diabetes insipidus, Prion-related diseases, Creutzfeldt- Jacob's disease, and Robinow Syndrome.

5. The method of claim 3, wherein the disease is alpha- 1 antitrypsin deficiency

6. The method of claim 3, wherein the genes encode fusion proteins comprising proteins or polypeptides that target the fusion proteins to ubiquitin mediated degradation.

7. The method of claim 3, wherein the proteins or polypeptides that target the fusion proteins to ubiquitin mediated degradation are FBKP12 or fragments thereof.

8. The method of claim 3, wherein the genes encode fusion proteins comprising an antibody or a fragment of an antibody against alpha- 1 antitrypsin.

9. The method of claim 8, wherein the fragment of the antibody against alpha- 1 antitrypsin comprises an scFv, such as the scFv of SEQ ID NO: 1.

10. The method of claim 3, wherein the genes encode for proteins comprising FKBP12 and scFv portion of an antibody against alpha- 1 antitrypsin, such as the scFv of SEQ ID NO: 1.

11. The method of claim 3, wherein the gene therapy is targeted to the subject's tissue.

12. The method of claim 11, wherein the tissue is selected from the group consisting of brain, heart, muscle, bone, liver, kidney, pancreas, stomach, intestines, skin, lungs, thymus, adrenal gland, spleen, prostate, testis, ovaries, pituitary gland, thyroid gland, parathyroid gland, pineal gland, blood, lymphatic tissue, and eyes.

13. The method of claim 11 , wherein the tissue is liver.

14. The method of claim 13, wherein adeno-associated virus type 8 is used for introducing the genes to the liver.

15. The method of claim 3, wherein the proteins or polypeptides target the fusion proteins to chaperon mediated degradation.

16. The method of claim 15, wherein the proteins or polypeptides that target the fusion proteins to chaperon mediated degradation are selected from Hsc70, fragment of Hsc70, Hsc70 binding motif, and Lys-Phe-Glu-Arg-Gln motif.

17. An isolated antibody having the binding specificity of the scFv fragment of SEQ ID NO: 1.

18. The isolated antibody of claim 17, wherein said antibody comprises SEQ ID NO: 1 (scFv-AAT).

19. The isolated antibody of claim 17 or claim 18, wherein said antibody further comprises at least one linked moiety selected from the group consisting of a polypeptide, a radiolabel, a fluorescent label.

20. The isolated antibody of claim 19, wherein said polypeptide is an enzyme.

21. The isolated antibody of claim 19, wherein said polypeptide is Hsc70, Lys- Phe-Glu-Arg-Gln (KFERQ motif), FKBP12 or fragments of FKBP12.

22. A composition comprising an antibody of any of claims 17-21 and a carrier or excipient.

23. The composition according to claim 22, wherein said composition comprises a pharmaceutically acceptable carrier or excipient.

24. A nucleic acid encoding an antibody according to claim 17.

25. The nucleic acid according to claim 24, wherein said nucleic acid encodes a scFv antibody comprising SEQ ID NO: 1.

26. A vector comprising a nucleic acid of claim 24 or claim 25.