WO2014152777A2 - Methods and compositions for the diagnosis and treatment of cancers resistant to ros1 inhibitors - Google Patents

Methods and compositions for the diagnosis and treatment of cancers resistant to ros1 inhibitors Download PDF

Info

Publication number
WO2014152777A2
WO2014152777A2 PCT/US2014/027720 US2014027720W WO2014152777A2 WO 2014152777 A2 WO2014152777 A2 WO 2014152777A2 US 2014027720 W US2014027720 W US 2014027720W WO 2014152777 A2 WO2014152777 A2 WO 2014152777A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
residue
polypeptide
position corresponding
Prior art date
Application number
PCT/US2014/027720
Other languages
French (fr)
Other versions
WO2014152777A3 (en
Inventor
Stephan MORRIS
Liquan Xue
Original Assignee
Insight Genetics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Insight Genetics, Inc. filed Critical Insight Genetics, Inc.
Publication of WO2014152777A2 publication Critical patent/WO2014152777A2/en
Publication of WO2014152777A3 publication Critical patent/WO2014152777A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • ROSl is a receptor tyrosine kinase (RTK).
  • RTK receptor tyrosine kinase
  • ROSl is the orphan (i.e., for which a ligand has yet to be determined) vertebrate counterpart of the Drosophila sevenless receptor tyrosine kinase, which when activated by its ligand BOSS (bride of sevenless) is responsible for the differentiation of the R7 photoreceptors in the developing fly compound eye.
  • BOSS bride of sevenless receptor tyrosine kinase
  • the functions of mammalian ROSl appear to be largely dispensable given that the only abnormality observed in Rosl-null mice involves infertility of the males due to defective sperm function associated with an inability of the epithelium of the epididymis (where ROSl is expressed) to support spermatocyte differentiation.
  • LLK leukocyte tyrosine kinase
  • ROSl is the most highly related receptor tyrosine kinase to ALK.
  • ROSl tyrosine kinase Oncogenic fusions of the ROSl tyrosine kinase have recently been reported to occur in subsets of several human cancers including non-small cell lung carcinoma (NSCLC), glioblastoma multiforme (GBM) brain tumors, and cholangiocarcinomas (biliary tract tumors). Cancer cells that express ROSl fusions are "addicted" to the aberrant signaling associated with the constitutively active chimeric forms of the kinase for their proliferation and survival. In keeping with this dependence upon abnormal ROSl signaling, preclinical studies have demonstrated ROSl -driven cancers can be extremely sensitive to pharmacologic inhibitors of the mutant kinase.
  • NSCLC non-small cell lung carcinoma
  • GBM glioblastoma multiforme
  • cholangiocarcinomas biliary tract tumors
  • ROSl inhibitors analogous to the small-molecule kinase inhibitors
  • GIST gastrointestinal stromal tumors
  • imatinib mesylate Gleevec, Novartis
  • the use of these inhibitors in the clinic has led to the emergence of drug-resistant tumors (O'Hare et al. (2007) Blood 110:2242-2249; Engelman and Settleman (2008) Curr Opin Genet Dev 18:1-7; Bikker et al. (2009) J Med Chem 52:1493-1509).
  • compositions and methods for the identification, prognosis, diagnosis, and treatment of cancers that are resistant to or are genetically predisposed to be resistant to ROS 1 kinase inhibitors are provided.
  • the present disclosure is based on the discovery of novel mutations in ROSl that confer resistance to ROSl kinase inhibitors, such as XALKORI®.
  • Polypeptides comprising the ROSl inhibitor-resistance mutations and polynucleotides encoding the same are provided and find use as biomarkers for use in methods for detecting the resistance mutations and in diagnosing those cancers that are resistant or likely to develop resistance to ROSl kinase inhibitors.
  • Antibodies that specifically bind ROSl polypeptides comprising the disclosed resistance mutations kits comprising the antibodies, and kits comprising polynucleotide(s) capable of specifically detecting or specifically amplifying a polynucleotide encoding an ROS 1 having an ROSl inhibitor resistance mutation are also provided herein for the detection of the resistance mutations in biological samples. Further provided are methods for identifying agents that specifically bind to and/or inhibit the activity of ROSl or ROSl oncogenic fusion proteins comprising the resistance mutations.
  • isolated polynucleotides comprising a nucleotide sequence selected from the group consisting of:
  • nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO : 1 comrpising one or more of the amino acid substitutions listed in Table 1 ;
  • polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • k a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • n a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • w a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • aa a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • bb a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • cc a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • dd a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ee a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • gg a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • hh a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nn a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • qq a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an iso leucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • rr a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ss a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • tt a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • w a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ww a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor;
  • yy a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • aaa a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an iso leucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • bbb a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ccc a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ddd a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • eee a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • fff a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 21 1 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ggg a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • gg a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • kkk a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nnn a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ooo a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; and
  • ppp a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor.
  • polynucleotide further comprises a nucleotide sequence encoding a ROS1 oncogenic fusion protein partner, and wherein said polynucleotide encodes a ROS1 oncogenic fusion protein.
  • ROS1 oncogenic fusion protein partner is selected from the group consisting of fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immunoglobulin- like domains 3 (LRIG3) or others.
  • FOG glioblastoma
  • CD74 cluster of differentiation 74
  • SLC34A2 solute carrier family 34 member 2
  • TPM3 tropomyosin 3
  • SDC4 syndecan 4
  • ezrin ezrin
  • ROS1 small- molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113, X- 396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP-14083, CEP-14513, CEP- 28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126 or others.
  • An expression cassette comprising the isolated polynucleotide of any prededing aspect operably linked to a promoter.
  • a host cell comprising the expression cassette of any preceding aspect.
  • polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS1) small-molecule kinase inhibitor;
  • ROS1 sevenless
  • polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; f) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; 1) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1 wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • aa an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • cc an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; dd) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • gg an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; jj) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nn an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; p) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • aaa an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; bbb) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one OS1 small-molecule kinase inhibitor;
  • ccc an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ddd an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ggg an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; hhh) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • nnn an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; nnn) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
  • ppp an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor.
  • ROS1 oncogenic fusion protein partner is selected from the group consisting of fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immuno globulin-like domains 3 (LRIG3).
  • FOG glioblastoma
  • CD74 cluster of differentiation 74
  • SLC34A2 solute carrier family 34 member 2
  • TPM3 tropomyosin 3
  • SDC4 syndecan 4
  • ezrin ezrin
  • LRIG3 leucine-rich repeats and immuno globulin-like domains 3
  • ROS1 small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113,
  • a non-human transgenic animal that has been altered to express an ROS 1 kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS1 small-molecule kinase inhibitor, wherein said ROS1 kinase inhibitor resistance mutant polypeptide has at least one ROS1 kinase inhibitor resistance mutant residue selected from the group consisting of: a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
  • n a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
  • gg a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
  • nn an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO : 1 ;
  • yy an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ;
  • ccc a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO : 1 ;
  • ggg a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
  • nnn a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1;
  • ooo a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
  • ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS 1 small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
  • n a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
  • gg a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
  • nn an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
  • yy an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1; zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
  • ggg a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
  • nnn a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
  • a kit for detecting a ROSl inhibitor resistance mutation in a biological sample comprising the antibody of an preceding aspect.
  • kit of any preceding aspect further comprising chemicals for the detection of antibody binding to ROSl .
  • a kit for detecting an ROSl inhibitor resistance mutation in a biological sample comprising a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
  • n a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
  • gg a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1 ;
  • nn an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
  • yy an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ;
  • aaa an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
  • bbb a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
  • ggg a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
  • nnn a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1;
  • ooo a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
  • said reagent comprises a pair of primers that amplify an amplicon comprising said ROS1 inhibitor resistance mutation.
  • said reagent comprises at least one probe comprising a polynucleotide sequence that hybridizes under stringent conditions to said ROSl kinase inhibitor resistance mutant polynucleotide and thereby detects the ROSl inhibitor resistance mutation.
  • a method for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting said biological sample with the antibody of any preceding aspectand detecting binding of said antibody to ROSl having the ROSl inhibitor resistance mutation.
  • a method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with the antibody of any presceding aspect, and detecting binding of said antibody to ROSl having said ROSl inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
  • a method for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
  • n a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
  • gg a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1 ; hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
  • nn an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
  • yy an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ;
  • ggg a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
  • nnn a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1;
  • ooo a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
  • a method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS 1 small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
  • n a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
  • gg a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
  • nn an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
  • yy an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1; zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
  • ggg a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
  • nnn a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
  • a method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject comprising assaying a biological sample from said subject for the presence of an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds the polypeptide of any one of any preceding aspect; and detecting binding of said antibody to said ROSl oncogenic fusion protein having an ROSl kinase inhibitor resistance mutation; wherein the presence of said ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
  • a method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject comprising assaying a biological sample from said subject for the presence of a polynucleotide encoding an ROSl oncogenic fusion protein having an ROS 1 inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify the polynucleotide encoding an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, wherein said at least one polynucleotide is capable of specifically detecting or specifically amplifying the polynucleotide according to any preceding aspect; and detecting the presence or absence of said polynucleotide encoding a ROSl oncogenic fusion protein having said ROSl inhibitor resistance mutation in said biological sample; wherein the presence of said polynucleotide encoding said ROSl
  • ROSl small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113 , X-396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP-14083, CEP-14513, CEP-28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126.
  • a method for diagnosing a cancer that is resistant to or likely to develop resistance to XALKORI® in a patient having a cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds a ROSl kinase inhibitor resistance mutant polypeptide that is resistant to XALKORI® , wherein said ROS 1 kinase inhibitor resistance mutant polypeptide has a residue at the position corresponding to amino acid residue position of SEQ ID NO: 1; and detecting binding of said antibody to ROSl having said ROSl kinase inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to XALKORI® .
  • said cancer is selected from the group consisting of a large B-cell lymphoma, anaplastic large cell lymphoma (ALCL), malignant histiocytosis, an inflammatory myofibroblastic tumor sarcoma, an esophageal squamous cell carcinoma, a breast cancer, a colorectal carcinoma, a non-small cell lung carcinoma, a neuroblastoma, a bladder cancer, a renal cancer, cholangiocarcinoma, non-small cell lung cancer (NSCLC), and glioblastoma
  • ACL anaplastic large cell lymphoma
  • NSCLC non-small cell lung cancer
  • a method of specifically reducing the expression of an ROSl kinase inhibitor resistance mutant that is resistant to at least one ROSl small-molecule kinase inhibitor comprising introducing into a cell expressing said ROSl kinase inhibitor resistance mutant a silencing element that targets a gene encoding said ROSl kinase inhibitor resistance mutant, wherein the introduction or expression of said silencing element specifically reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is the polypeptide of any preceding aspect.
  • a method of treating a cancer associated with aberrant ROSl activity that is resistant to at least one ROSl small-molecule kinase inhibitor comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to said at least one ROSl small-molecule kinase inhibitor, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is the polypeptide of any preceiding aspect.
  • a method of treating a cancer associated with aberrant ROSl activity that is resistant to XALKORl® comprising administering an effective amount of a silencing element that targets a gene encoding an ROS 1 kinase inhibitor resistance mutant that is resistant to XALKORl®, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is a polypeptide comprising any mutant amino acid sequence disclosed herein.
  • said cancer is selected from the group consisting of a large B-cell lymphoma, anaplastic large cell lymphoma (ALCL), malignant histiocytosis, an inflammatory myofibroblastic tumor sarcoma, an esophageal squamous cell carcinoma, a breast cancer, a colorectal carcinoma, a non-small cell lung carcinoma, a neuroblastoma, a bladder cancer, a renal cancer, cholangiocarcmoma, non-small cell lung cancer (NSCLC), and glioblastoma.
  • ACL anaplastic large cell lymphoma
  • NSCLC non-small cell lung cancer
  • a method of identifying an agent capable of inhibiting the kinase activity of an ROSl kinase inhibitor resistance mutant or ROSl fusion protein comprising:
  • a method of identifying an agent capable of specifically binding a polypeptide of any preceding aspect comprising the steps of: a) contacting a candidate agent with said polypeptide of any preceding aspect; and,
  • compositions of the immediate disclosure include ROS 1 polypeptides, polynucleotides encoding the same, and variants and fragments thereof that are resistant to ROS1 small-molecule kinase inhibitors.
  • ROS 1 is a member of the insulin receptor superfamily of receptor tyrosine kinases.
  • the ROSl polypeptide is a type I integral membrane protein comprising a single-chain transmembrane protein comprising an extracellular ligand-binding region, a transmembrane- spanning domain, and a cytoplasmic kinase catalytic region.
  • ROSl is encoded by a genomic locus found at the chromosomal band 6q22 in the human, and on the mouse chromosome 10.
  • the ROSl polypeptide is an orphan receptor tyrosine kinase that may function as a growth or differentiation receptor. Additionally, it may be involved in several signaling pathways related to cell differentiation, proliferation, growth, and survival including, but not limited to, PI3 kinase-mTOR signaling, PTPN11 signaling, STAT3 signaling, VAV3 signaling, AKT1 signaling, MAPK1 signaling, MAPK3 signaling, IRS1 signaling, and PLCG2 signaling.
  • ROSl polynucleotides and polypeptides are known in the art for various species.
  • the genomic sequence for human ROSl is set forth in Genbank accession number NC_000006.11.
  • the coding sequence for human ROSl can be found in Genbank accession number NM 002944 (SEQ ID NO: 2) and and the encoded human ROSl polypeptide can be found at accession number NP 002935 and is set forth in SEQ ID NO : 1.
  • ROSl is a distinct receptor tyrosine kinase that is distantly related to the anaplastic lymphoma kinase/leukocyte tyrosine kinase (ALK/LTK) and insulin receptor (INSR) families.
  • ROSl is the orphan (i.e., for which a ligand has yet to be determined) vertebrate counterpart of the Drosophila sevenless receptor tyrosine kinase, which when activated by its ligand BOSS (bride of sevenless) is responsible for the differentiation of the R7 photoreceptors in the developing fly compound eye.
  • ROSl The functions of mammalian ROSl appear to be largely dispensable given that the only abnormality observed in Rosl-null mice involves infertility of the males due to defective sperm function associated with an inability of the epithelium of the epididymis (where Ros 1 is expressed) to support spermatocyte differentiation; thus, therapeutic inhibition of ROS 1 in patients is not likely to be associated with substantive limiting toxicities.
  • FIG fused in glioblastoma, also known as GOPC for Golgi- associated PDZ and Coiled-coil domains-containing protein
  • FIG fused in glioblastoma
  • FIG also known as GOPC for Golgi- associated PDZ and Coiled-coil domains-containing protein
  • FIG-ROS1 fusions are not restricted to glioblastoma only; in 2011 , this chimeric kinase was shown to be expressed in cholangiocarcinomas (biliary tract cancers) as well, being present in nearly 10% (8.7%, 2 of 23) of a small cohort of primary tumor specimens.
  • NSCLC non-small cell lung cancer
  • cholangiocarcinoma - which is the second most common primary hepatic carcinoma - is quite poor, the median survival being less than two years.
  • ROSl inhibitor therapies are still in relatively early stage but the clinical application of such treatments has already begun.
  • Kinase screening assays have demonstrated that due to the close sequence homology between ROS 1 and ALK, certain ALK inhibitors are also effective ROSl -targeted therapies.
  • XALKORI® crizotinib, Pfizer
  • - the small-molecule inhibitor approved in August 2011 by the US FDA for the treatment of patients with ALK-driven NSCLC - exhibits an enzymatic IC50 of 8 nM for MET, 20 nM for ALK, and 62 nM for ROS 1.
  • This ROSl IC50 is within the therapeutic range of the plasma concentration of XALKORI® when administered at the typical dose of 2 0 mg BID determined in clinical trials of the inhibitor, and Pfizer has recently amended a Phase I trial to permit enrollment of ROSl fusion- positive cancer patients and already observed antitumor activity in several such individuals.
  • Other ALK small-molecule inhibitors such as Ariad's AP26113 (which entered Phase I trials in Q3 2011) and Xcovery's X-396 (for which IND filing and Phase I initiation occurred in Q4 2011) are up to 10-fold more potent than XALKORI® against ALK and are also potent ROSl inhibitors.
  • ROSl signaling for instance, high levels of ROSl expression are found in 30-40% of glioblastoma surgical tumors and ROSl mutations have been identified in colorectal and renal carcinoma cell lines.
  • Commercial availability of efficient and reliable diagnostic tests to detect the presence of ROSl fusions in tumors would both greatly facilitate translational research to profile other cancers for these mutations while also providing for a more effective and less costly diagnosis of a particular cancer and enabling more effective and less costly personalized therapy of patients with ROSl fusion-positive tumors using inhibitors of this mutant kinase.
  • ROSl fusions may or may not represent the most common mutation of this tyrosine kinase they remain a significant proportion of tyrosine kinase fusion related cancers the significance of which increases with the identification of additional fusion partners.
  • Such fusions include but are not limited to Fused in glioblastoma (FIG)-ROS 1 , SLC34A2-ROS1, TPM3-ROS1, SDC4-ROS1, EZR-ROS1, LRIG3-ROS1, and CD74-ROS1. These seven fusions have been found in cholangiocarcinoma, non-small cell lung carcinoma (NSCLC), and glioblastomas among other cancers.
  • NSCLC non-small cell lung carcinoma
  • a disease or condition such as ROSl -related cancer
  • assessing the susceptibility or risk for developing a disease or condition such as ROSl -related cancer
  • ROS-1 related cancer refers to any cancer where ROS1 is dysregulated through the presence of a ROS 1 fusion, overexpression, mutation, or other mechanism.
  • ROS-1 fusion a very frequent cause of treatment failure; thus, elucidation of the mechanisms of drug resistance is essential to allow optimal clinical management.
  • ROS1 oncogenic fusion or "ROS1 oncogenic fusion protein” is a polypeptide comprising an amino terminal fusion partner and a fragment of the ROS 1 polypeptide at the carboxy terminus.
  • the fusion of the two proteins results in the constitutive activation of the kinase activity of ROS 1 through oligomerization mediated by an oligomerization domain in the amino terminal fusion partner and subsequent constitutive transmission of growth- promoting/proliferation cellular signals.
  • ROS1 activation causes increased cell growth and proliferation at least partially due to activation of the protein kinase C (PKC), mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) pathways.
  • PKC protein kinase C
  • MAPK mitogen-activated protein kinase
  • PI3K phosphoinositide 3-kinase
  • the amino-terminal partner protein is one that is widely expressed in normal cells and its promoter is responsible for the aberrant expression of the encoded fusion protein.
  • Naturally-occurring ROS1 oncogenic fusions are the result of chromosomal translocations and/or aberrations.
  • ROS1 oncogenic fusion partner or “ROS1 oncogenic fusion protein partner” refers to the amino-terminal fragment of the ROS 1 oncogenic fusion comprising an oligomerization domain.
  • Naturally-occurring oncogenic fusion partners include, but are not limited to, fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immunoglobulin-like domains 3 (LRIG3).
  • FOG glioblastoma
  • CD74 cluster of differentiation 74
  • SLC34A2 solute carrier family 34 member 2
  • TPM3 tropomyosin 3
  • SDC4 syndecan 4
  • ezrin ezrin
  • LRIG3 leucine-rich repeats and immunoglobulin-like domains 3
  • ROSl mutants that are resistant to ROSl kinase inhibitors, which are also referred to herein as ROSl inhibitor resistance mutants or ROSl kinase inhibitor resistance mutants.
  • ROSl kinase inhibitor resistance mutant polypeptides include the amino acid mutations set forth in Table 1 (mutated ROSl kinase domains); including when said mutation is part of a ROSl fusion fragment (a mutated ROSl fusion fragments).
  • ROSl kinase inhibitor resistance mutant polypeptides set forth in Table 1 and variants and fragments thereof.
  • Point mutations sequences are shown as mRNA. It is understood that the cDNA or DNA sequence as shown in SEQ ID NO: 2 will show a Thymidine (T) rather than the mRNA Uracil (U). It is further understood that T and U are considered biological equivalents for purposes of the sequence and this table.
  • ROSl kinase inhibitor resistance mutation or "ROSl inhibitor resistance mutation” is a change in the nucleotide sequence or amino acid sequence of native ROSl that confers resistance of the ROSl polypeptide to at least one ROSl kinase inhibitor.
  • the identified ROSl kinase inhibitor resistance mutations (which are point mutations resulting in a substitution of a single amino acid residue) at both the polynucleotide and polypeptide levels are disclosed in Table 1. It is understood that additional polynucleotide mutations can result in the same amino acid substitution due to codon degeneracy.
  • isolated polynucleotides comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1 comrpising one or more of the amino acid substitutions listed in Table 1 ; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS l) small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at
  • polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%>, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO : 1 , and wherein the polynucleotide encodes
  • polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%,
  • polynucleotide further comprises a nucleotide sequence encoding a ROS 1 oncogenic fusion protein partner, and wherein said polynucleotide encodes a ROS 1 oncogenic fusion protein.
  • isolated polynucleotides comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding the nucleic acid sequence set forth in SEQ ID NO: 2 comprising one or more of the nucleic acid substitutions listed in Table 1; or a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 2 comprising one or more of the nucleotide substitutions listed in Table 1, wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor.
  • polynucleotide is intended to encompass a singular nucleic acid, as well as plural nucleic acids, and refers to a nucleic acid molecule or construct, e.g. , messenger RNA (mRNA), plasmid DNA (pDNA), cDNA, or short interfering RNA (siRNA).
  • mRNA messenger RNA
  • pDNA plasmid DNA
  • cDNA plasmid DNA
  • siRNA short interfering RNA
  • a polynucleotide can be single-stranded or double-stranded, linear or circular and can be comprised of DNA, RNA, or a combination thereof.
  • a polynucleotide can comprise a conventional phosphodiester bond or a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)).
  • PNA peptide nucleic acids
  • nucleic acid refers to any one or more nucleic acid segments, e.g
  • polynucleotide can contain modified nucleic acids, such as phosphorothioate, phosphate, ring atom modified derivatives, and the like.
  • the "polynucleotide” can be a naturally occurring polynucleotide (i.e., one existing in nature without human intervention), a recombinant polynucleotide (i.e., one existing only with human intervention), or a synthetically derived polynucleotide.
  • polynucleotides a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1 or polynucleotides encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1 , wherein the polynucleotide is an isolated cDNA.
  • Polynucleotides can encode a polypeptide or protein.
  • encoding or “encoded,” with respect to a specified nucleic acid, is meant comprising the information for transcription into an RNA and in some embodiments, translation into the specified protein.
  • a nucleic acid encoding a protein can comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or can lack such intervening non-translated sequences (e.g., as in cDNA).
  • the information by which a protein is encoded is specified by the use of codons.
  • the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
  • variants of the universal code such as is present in some plant, animal, and fungal mitochondria, the bacterium Mycoplasma capricolum (Yamao, et al, (1985) Proc. Natl. Acad. Sci. USA 82:2306-9) or the ciliate Macronucleus, can be used when the nucleic acid is expressed using these organisms.
  • the disclosed isolated polynucleotides can be a component of an expression cassette and expressed in a cell. Accordingly, in one aspect disclosed herein are expression cassettes comprising any isolated polynucleotide disclosed herein operably linked to a promoter. It is understood and herein contemplated that the disclosed expression cassettes comprising any of the ROS1 inhibitor resistant polynucleotides disclosed herein can be incorporated into a cell.
  • host cells comprising an expression cassette comprising any of the polynucleotides disclosed herein (for example a polynucleotide having at least 90% sequence identity to SEQ ID NO: 2 or encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 1, said polynucleotide comprising any of the mutations in Table 1 or disclosed herein.
  • an expression cassette comprising any of the polynucleotides disclosed herein (for example a polynucleotide having at least 90% sequence identity to SEQ ID NO: 2 or encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 1, said polynucleotide comprising any of the mutations in Table 1 or disclosed herein.
  • the ROS1 kinase inhibitor resistance mutant polynucleotides can be found in an expression cassette.
  • the expression cassettes can comprise one or more regulatory sequences that are operably linked to the ROS1 kinase inhibitor resistance mutant polynucleotide that facilitate expression of the polynucleotide.
  • regulatory sequences refer to nucleotide sequences located upstream (5 ' non-coding sequences), within, or downstream (3 ' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. See, for example, Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, California).
  • Regulatory sequences can include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
  • Regulatory sequences are operably linked with a coding sequence to allow for expression of the polypeptide encoded by the coding sequence.
  • "Operably linked” is intended to mean that the coding sequence is functionally linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. Operably linked elements can be contiguous or noncontiguous. Polynucleotides can be operably linked to regulatory sequences in sense or antisense orientation.
  • the regulatory regions i.e., promoters, transcriptional regulatory regions, and translational termination regions
  • the coding polynucleotides can be native/analogous to the cell to which the polynucleotide is being introduced or to each other.
  • the regulatory regions and/or the coding polynucleotides can be heterologous to the cell to which the polynucleotide is being introduced or to each other.
  • heterologous in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
  • a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.
  • Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) or at particular stages of development/differentiation (e.g., development-specific regulatory sequences), or those that are chemically-induced. It will be appreciated by those skilled in the art that the design of the expression cassette can depend on such factors as the choice of the host cell to which the polynucleotide is to be introduced, the level of expression of the polypeptide desired, and the like. Such expression cassettes typically include one or more appropriately positioned sites for restriction enzymes, to facilitate introduction of the nucleic acid into a vector.
  • promoter and/or regulatory elements can readily be selected to allow expression of the coding sequence in the cell of interest and at the particular developmental/differentiation state.
  • a promoter that is recognized by RNA polymerase II can be used.
  • the regulatory sequences can also be provided by viral regulatory elements.
  • promoters are derived from polyoma, Adenovirus 2, cytomegalovirus, and Simian Virus 40.
  • suitable expression systems for eukaryotic cells see Chapters 16 and 17 of Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See, Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, California).
  • rat insulin promoter glyceraldehyde-3-phosphate dehydrogenase
  • glyceraldehyde-3-phosphate dehydrogenase glyceraldehyde-3-phosphate dehydrogenase
  • Promoters which can be used include, but are not limited to, the long terminal repeat as described in Squinto et al.
  • inducible promoters and their inducer include MT II/phorbol Ester (TPA) (Palmiter et al. (1982) Nature 300:611) and heavy metals (Haslinger and Karin (1985) Proc. Nat ⁇ Acad. Sci. USA. 82:8572; Searle et al.
  • TPA phorbol Ester
  • MHC class I gene H-2 kB/interferon (Blanar et al. (1989) EMBOJ. 8:1139);
  • HSP70/ela SV40 large T antigen (Taylor and Comments (1990) Mol. Cell. Biol. 10:165; Taylor and Comments (1990) Mol. Cell. Biol. 10:176; Taylor et al. (1989) J. Biol. Chem. 264: 15160); proliferin/phorbol ester-TPA (Mordacq and Linzer (1989) Genes and Dev. 3:760); tumor necrosis factor/PMA (Hensel et al. (1989) Lymphokine Res. 8:347); thyroid stimulating hormone a gene/thyroid hormone (Chatterjee et al. (1989) Proc. Nat'l Acad. Sci. USA. 86:9114); and, insulin E box/glucose.
  • translation control elements are known to those of ordinary skill in the art and can be used in the presently disclosed methods and compositions. These include, but are not limited to, ribosome binding sites, translation initiation and termination codons, and elements derived from picornaviruses (particularly an internal ribosome entry site, or IRES, also referred to as a CITE sequence).
  • IRES internal ribosome entry site
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors).
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, lentiviruses, and adena-associated viruses). See, for example, U.S. Publication 2005214851, herein incorporated by reference.
  • Retroviral vectors, particularly lentiviral vectors are transduced by packaging the vectors into virions prior to contact with a cell.
  • An expression cassette can further comprise a selection marker.
  • selection marker comprises any polynucleotide, which when expressed in a cell allows for the selection of the transformed cell with the vector.
  • a selection marker can confer resistance to a drug, a nutritional requirement, or a cytotoxic drug.
  • a selection marker can also induce a selectable phenotype such as fluorescence or a color deposit.
  • a "positive selection marker” allows a cell expressing the marker to survive against a selective agent and thus confers a positive selection characteristic onto the cell expressing that marker.
  • Positive selection marker/agents include, for example, neo/G418, neo/kanamycin, hyg/hygromycin,
  • positive selection markers include DNA sequences encoding membrane-bound polypeptides.
  • polypeptides are well known to those skilled in the art and can comprise, for example, a secretory sequence, an extracellular domain, a transmembrane domain and an intracellular domain. When expressed as a positive selection marker, such polypeptides associate with the cell membrane.
  • Fluorescently labeled antibodies specific for the extracellular domain can then be used in a fluorescence activated cell sorter (FACS) to select for cells expressing the membrane-bound polypeptide.
  • FACS fluorescence activated cell sorter
  • the expression cassette further comprises a selectable marker, an internal ribosome entry site, or IRES, also referred to as a CITE sequence can be used to separate the coding sequences of the selectable marker and the polypolypeptide of interest, which allows for simultaneous transcription of the two sequences under the control of the same promoter sequences, but separate translation of the transcripts into polypeptides.
  • isolated polypeptides comprising an amino acid sequence selected from the group consisting of: the amino acid sequence set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NOl, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS 1 ) small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%), or 100% sequence identity to SEQ ID NOl, wherein the
  • polypeptide or "protein” is intended to encompass a singular “polypeptide” as well as plural “polypeptides,” and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds).
  • amide bonds also known as peptide bonds
  • polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, "protein,” “amino acid chain,” or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of “polypeptide,” and the term “polypeptide” can be used instead of, or interchangeably with any of these terms.
  • An “isolated” or “puri ied” polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment.
  • an isolated or purified polynucleotide or protein is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived.
  • the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived.
  • a protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%), 5%, or 1% (by dry weight) of contaminating protein.
  • optimally culture medium represents less than about 30%, 20%>, 10%>, 5%, or 1% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.
  • Fragments and variants of the polynucleotides encoding the ROSl kinase inhibitor resistance mutant polypeptides and fragments and variants of the polypeptides themselves can be employed in the various methods and compositions of the invention, including biologically active variants and fragments of the ROSl kinase inhibitor resistance mutant polypeptides. Such active variants and fragments will retain a functional kinase domain that is resistant to at least one ROS 1 kinase inhibitor. Methods to assay for kinase activity are known and are described elsewhere herein.
  • fragment is intended a portion of the polynucleotide and hence the protein encoded thereby or a portion of the polypeptide. Fragments of a polynucleotide can encode protein fragments that retain the biological activity of the ROS 1 kinase inhibitor resistance mutant protein and hence have kinase activity that is resistant to at least one ROSl kinase inhibitor.
  • fragments of a polynucleotide can range from at least about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, , about 25 nucleotides , about 30 nucleotides , about 35 nucleotides , about 40 nucleotides , about 45 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 125 nucleotides, about 150, about 175 nucleotides, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500 contiguous nucleotides, and up to the full-length polynucleotide encoding the ROS1 kinas
  • a fragment of a polynucleotide that encodes a biologically active portion of an ROS1 kinase inhibitor resistance mutant polypeptide will encode at least about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 125, about 150, about 175, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600 contiguous amino acids, or up to the total number of amino acids present in a full-length ROS1 kinase inhibitor resistance mutant polypeptide.
  • a biologically active portion of an ROS1 kinase inhibitor resistance mutant polypeptide can be prepared by isolating a portion of one of the polynucleotides encoding the portion of the ROS1 kinase inhibitor resistance mutant polypeptide and expressing the encoded portion of the polypeptide (e.g., by recombinant expression in vitro), and assessing the activity of the portion of the ROS1 polypeptide.
  • Polynucleotides that encode fragments of an ROS1 kinase inhibitor resistance mutant polypeptide can comprise nucleotide sequences comprising at least 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500 contiguous nucleotides, or up to the number of nucleotides present in a full-length ROS1 kinase inhibitor resistance mutant nucleotide sequence disclosed herein.
  • Variant sequences have a high degree of sequence similarity.
  • conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the ROS 1 kinase inhibitor resistance mutant polypeptides.
  • Variants such as these can be identified with the use of well-known molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques.
  • Variant polynucleotides also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis, but which still encode an ROS1 kinase inhibitor resistance mutant polypeptide.
  • variants of a particular polynucleotide will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein.
  • sequence alignment programs and parameters described elsewhere herein are the isolated
  • polynucleotides disclosed herein having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity to a polynucleotide encoding SEQ ID NO: 1 comprising one or more of the amino acid substitutions of Table 1.
  • variants of a particular polynucleotide can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide.
  • variants include, for example, isolated polynucleotides that encode a polypeptide with a given percent sequence identity to the ROS1 polypeptides set forth herein. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described herein.
  • the percent sequence identity between the two encoded polypeptides is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity.
  • polypeptides disclosed herein having 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a polypeptide as set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions of Table 1.
  • variant polypeptide is intended a polypeptide derived from the ROS 1 kinase inhibitor resistance mutant polypeptide by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the polypeptide; deletion or addition of one or more amino acids at one or more sites in the polypeptide; or substitution of one or more amino acids at one or more sites in the polypeptide.
  • variant ROS1 kinase inhibitor resistance mutant polypeptides are biologically active, that is they continue to have kinase activity that is resistant to at least one ROS 1 kinase inhibitor. Such variants can result from, for example, genetic polymorphism or from human manipulation.
  • Biologically active variants of an ROS1 kinase inhibitor resistance mutant polypeptide will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity to the amino acid sequence for the ROSl kinase inhibitor resistance mutant polypeptide as determined by sequence alignment programs and parameters described elsewhere herein.
  • a biologically active variant of a polypeptide can differ from that polypeptide by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
  • variants and fragments of ROS 1 kinase inhibitor resistance mutant polypeptides retain the point mutation responsible for the resistance to at least one ROSl kinase inhibitor. Therefore, variants and fragments of ROSl kinase inhibitor resistance mutant polypeptides comprise at least one of the following amino acid residues:
  • valine residue at the position corresponding to amino acid residue position 19 1 of SEQ ID NO: 1;
  • SEQ ID NO: 1 a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
  • valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID O: l;
  • ROS 1 kinase inhibitor resistant mutant polypeptides wherein the polypeptide has the sequence as set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions selected from the group consisting of L1945Q, T1946S, L1947M, R1948S, L1951V, E1958V, V1959E, E1961K, G1962E, T1981M, S1986Y, E1990 , E1993K, L2000V, S2002N, F2004L, N2008H, I2009L, L2010M, K201 IN, C2016G, N2019D, N2019Y, Q2022H, L2026M, L2028M, M2029K, E2030K, G2032R, D2033G, L2035I, T2036I, T2036N, R2039G, , R2039H, R2039M, R2039N, R2039S K2040E, K2040Q, T
  • a "conservative substitution" of an amino acid residue comprises other amino acid residues that are similar in size and/or charge to another amino acid residue.
  • the conservative substitution of the amino acid residue does not encompass amino acid residues that are found at that particular position within the native ROSl sequence (disclosed in SEQ ID NO: 1).
  • an amino acid residue of an ROSl mutant polypeptide at the position corresponding to a particular amino acid residue of native ROSl refers to the amino acid residue within the ROS 1 mutant polypeptide that appears opposite the amino acid residue at a particular position in the native ROSl sequence when the ROSl mutant sequence is aligned with the native ROSl sequence (SEQ ID NO: 1) for maximum homology using an alignment program, such as one known in the art (e.g., the GAP program in the GCG software package, using either a BLOSUM62 matrix or a PAM250 matrix).
  • Polypeptides can be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the ROSl kinase inhibitor resistance mutant polypeptides can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds.
  • polynucleotides used in the invention can include naturally occurring sequences as well as those that are synthetically derived or modified.
  • polypeptides used in the methods of the invention encompass naturally occurring polypeptides as well as variations and modified forms thereof.
  • the mutations made in the polynucleotide encoding the variant polypeptide should not place the sequence out of reading frame, and/or create complementary regions that could produce secondary mRNA structure. See, EP Patent
  • deletions, insertions, and substitutions of the polypeptide sequences encompassed herein are not expected to produce radical changes in the characteristics of the polypeptide. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays.
  • Variant polynucleotides and polypeptides also encompass sequences and polypeptides derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different ROS 1 kinase inhibitor resistance mutant coding sequences can be manipulated to create a new ROS1 kinase inhibitor resistance mutant polypeptide possessing the desired properties.
  • libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc.
  • sequence identity or “identity” in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • sequence identity or “identity” in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
  • sequences differ in conservative substitutions the percent sequence identity can be adjusted upwards to correct for the conservative nature of the substitution.
  • Sequences that differ by such conservative substitutions are said to have "sequence similarity” or “similarity”. Means for making this adjustment are well known to those of skill in the art.
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof.
  • equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
  • ROS1 kinase inhibitor is a compound that is capable of inhibiting the kinase activity of ROS1 polypeptides.
  • the ROS1 mutants are resistant to ROS1 small-molecule kinase inhibitors.
  • a small molecule refers to chemical compounds that are not polymers, such as nucleic acids, polypeptides, or
  • polysaccharides although the term can encompass small polymers that are capable of readily crossing the cellular membrane.
  • the kinase activity of ROS1 refers to the ability of ROS1 to phosphorylate tyrosine residues of substrates, either naturally occurring or synthetic, including ROS1 itself and other downstream substrates (e.g., SHC).
  • ROS1 Upon oligomerization, ROS1 autophosphorylates three ROS1 tyrosine residues, which fully activates the enzyme, allowing ROS1 to phosphorylate additional substrates, such as SHC.
  • ROS 1 kinase inhibitors inhibit the kinase activity of ROS1 polypeptides, meaning that the kinase activity is partially or completely reduced in comparison to the kinase in the absence of the inhibitor compound.
  • the ROS 1 kinase activity is reduced by the ROS1 kinase inhibitor by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 100% when compared to the activity of the kinase in the absence of the inhibitor.
  • ROS 1 polypeptides Methods for assaying the kinase activity of an ROS 1 polypeptide are known in the art and include in vitro kinase assays wherein ROS1 polypeptides are isolated via affinity purification or immunoprecipitation and the autophosphorylation of ROS 1 or the
  • ROS1 autophosphorylation or phosphorylation of an ROS1 substrate is determined using immunoblotting or an enzyme-linked immunoassay, for example.
  • Non-limiting examples of methods for analyzing ROS 1 kinase activity can be found in U.S. Application Publication Nos. 2008/0090776, 2009/0099193, and U.S. Provisional Application No. 61/596,720, each which are herein incorporated by reference in its entirety.
  • ROS 1 kinase inhibitors can bind to the inactive form of ROS 1, wherein the three tyrosine residues in the activation loop are unphosphorylated or to the active, autophosphorylated form of ROS1.
  • the ROS1 kinase inhibitors inhibit both the autophosphorylation of the kinase and the phosphorylation of additional substrates.
  • many ROS1 kinase inhibitors are fairly specific for ROS1, however, the term ROS1 kinase inhibitor encompasses inhibitors that are also capable of inhibiting other kinases, such as the MET kinase.
  • ROS 1 kinase inhibitors that are known in the art include XALKORI®, (Zou et al. (2007) Cancer Res 67:4408-4417; Christensen et al. (2007) Mo I Cancer Ther 6:3314-3322; U.S. Application Publication No. 2008/0051419), AP26113, X-396, NVP-TAE684 (Galkin et al.
  • a "host cell” is a fertilized oocyte or an embryonic stem cell into which a sequence encoding an ROSl kinase inhibitor resistance mutant polypeptide has been introduced. Such host cells can then be used to create nonhuman transgenic animals in which an exogenous sequence encoding an ROSl kinase inhibitor resistance mutant polypeptide has been introduced into their genome or homologous
  • the ROSl kinase inhibitor resistance mutant is part of an ROSl oncogenic fusion protein.
  • Such animals are useful for screening candidate agents that inhibit the ROS 1 kinase inhibitor resistance mutants using assays described elsewhere herein to identify agents that are capable of inhibiting the presently disclosed ROSl kinase inhibitor resistance mutants or to further validate the ability of novel inhibitors to inhibit the growth of cancer associated with aberrant ROSl activity that is resistant to at least one ROSl kinase inhibitor, thus, in one aspect, disclosed herein are transgenic animals expressing a ROSl kinase inhibitor resistance mutant polypeptide wherein the ROSl kinase inhibitor resistance mutant polypeptide comprises an amino acid substitution relative to SEQ ID NO: 1 selected from the group consisting of L1945Q, T1946S, L1947M, R1948S, L1951V, E1958V, V1959E, E1961K, G1962E, T1981M, S19
  • E2030 G2032R, D2033G, L2035I, T2036I, T2036N, R2039G, , R2039H, R2039M, R2039N, R2039S K2040E, K2040Q, T2052S, L2059P, H2077P, R2078W, V2087I, D2091N, Y2092N, S2094N, V2098I, K2099N, I2100V, G2101A, A2106P, R2107T, R2116T, V2125G, V2125L, W2127G, E2131D, E2131 , M2134I, T2139I, T2139S, Q2141H, S2142Y, G2148E, I2151N, I2154M, Q2160H, H2165D, E2181D, R2184T, E2201D, R2205I, T2207I, H2209P, Q2212H, and Q22
  • a non-human transgenic animal that has been altered to express an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROS 1 kinase inhibitor resistance mutant residue selected from the group consisting of: a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1; a methionine residue thereof at the position
  • transgenic animal is a nonhuman animal, in specific embodiments a mammal, a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene.
  • Other examples of transgenic animals include nonhuman primates, sheep, dogs, cows, goats, chickens, amphibians, etc.
  • a transgene is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
  • a "homologous recombinant animal” is a nonhuman animal, in specific embodiments a mammal, in other embodiments a mouse, in which an endogenous ROS1 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
  • a transgenic animal can be created by introducing an ROS 1 kinase inhibitor resistance mutant polypeptide encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.
  • sequences can be introduced as a transgene into the genome of a nonhuman animal.
  • Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene.
  • a tissue- specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the sequence particular cells.
  • transgenic founder animal can be identified based upon the presence of the ROSl kinase inhibitor resistance mutant protein or the polynucleotide comprising an ROSl kinase inhibitor resistance mutation in its genome and/or expression of mRNA of such sequences in tissues or cells of the animals.
  • a transgenic founder animal can then be used to breed additional animals carrying the transgene.
  • transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes.
  • the homologous recombination vector the altered portion of the ROS 1 gene is flanked at its 5 ' and 3 ' ends by additional nucleic acids of the ROS 1 gene to allow for homologous recombination to occur between the exogenous ROSl gene carried by the vector and an endogenous ROSl gene in an embryonic stem cell.
  • the additional flanking ROSl nucleic acid is of sufficient length for successful homologous recombination with the
  • flanking DNA typically, several kilobases of flanking DNA (at both the 5' and 3' ends) are included in the vector (see, e.g., Thomas and Capecchi (1987) Cell 51 :503 for a description of homologous recombination vectors).
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation), and cells in which the introduced ROSl gene has homologously recombined with the endogenous ROSl gene are selected (see, e.g., Li et al. (1992) Cell 69:915).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see, e.g., Bradley (1987) in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, ed. Robertson (IRL, Oxford pp. 113-152).
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene.
  • transgenic nonhuman animals containing selected systems that allow for regulated expression of the transgene can be produced.
  • a system is the cre/loxP recombinase system of bacteriophage PI .
  • cre/loxP recombinase system see, e.g., Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236.
  • FLP recombinase system of Saccharomyces cerevisiae (O' Gorman et al. (1991) Science 251 :1351-1355).
  • mice containing transgenes encoding both the Cre recombinase and a selected protein are required.
  • Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
  • Clones of the nonhuman transgenic animals described herein can also be produced according to the methods described in Wilmut et al. (1997) Nature 385:810-813 and PCT Publication Nos. WO 97/07668 and WO 97/07669.
  • antibodies that specifically bind to the OS1 kinase inhibitor resistance mutant polypeptides are referred to as “anti-ROSl kinase inhibitor resistance mutant antibodies”.
  • anti-ROSl kinase inhibitor resistance mutant antibodies antibodies specific for the ROS1 polypeptides and polynucleotides disclosed herein that are resistant to at least one ROS 1 kinase inhibitor.
  • the term also encompasses antibodies that are specific for ROS1 oncogenic fusion proteins comprising an ROS1 polypeptide having an ROS1 inhibitor resistance mutation.
  • the respective antibodies can be used alone or in combination with any of the methods disclosed herein.
  • antibodies that specifically binds an ROS1 kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS1 small-molecule kinase inhibitor, wherein said ROS 1 kinase inhibitor resistance mutant polypeptide has at least one ROS 1 kinase inhibitor resistance mutant residue selected from the group consisting of a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO : 1 ; a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 19 1 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue
  • amino acid residue position 2036 of SEQ ID NO: 1 a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1; a glutamic acid or glutamate residue at the position
  • Antibodies including monoclonal antibodies (mAbs), can be made by standard protocols.
  • a mammal such as a mouse, hamster or rabbit can be immunized with an immunogenic form of a peptide or a peptide complex.
  • immunogenicity on a protein or peptide include conjugation to carriers or other techniques, well known in the art.
  • antibodies that specifically bind is intended that the antibodies will not substantially cross react with another polypeptide.
  • not substantially cross react is intended that the antibody or fragment has a binding affinity for a different polypeptide which is less than 10%, less than 5%, or less than 1%, of the binding affinity for the particular ROS1 kinase inhibitor resistance mutant polypeptide.
  • the anti-ROSl kinase inhibitor resistance mutant antibody binds specifically to a particular ROS1 kinase inhibitor resistance mutant polypeptide and reduces the kinase activity of the kinase.
  • the anti-ROSl kinase inhibitor resistance mutant antibody is a ROS1 kinase inhibitor resistance mutant inhibitor.
  • the anti-ROSl kinase inhibitor resistance mutant antibodies disclosed herein and for use in the methods disclosed herein can be produced using any antibody production method known to those of skill in the art.
  • polyclonal sera can be prepared by conventional methods.
  • a solution containing the ROSl kinase inhibitor resistance mutant polypeptide or a fragment thereof is first used to immunize a suitable animal, preferably a mouse, rat, rabbit, or goat. Rabbits or goats are preferred for the preparation of polyclonal sera due to the volume of serum obtainable, and the availability of labeled anti-rabbit and anti-goat antibodies.
  • Polyclonal sera can be prepared in a transgenic animal, preferably a mouse bearing human immunoglobulin loci.
  • Sf9 ⁇ Spodoptera frugiperda) cells expressing the ROSl kinase inhibitor resistance mutant polypeptide or fragment thereof are used as the immunogen.
  • Immunization can also be performed by mixing or emulsifying the antigen- containing solution in saline, preferably in an adjuvant such as Freund's complete adjuvant, and injecting the mixture or emulsion parenterally (generally subcutaneously or intramuscularly). A dose of 50-200 ⁇ g/injection is typically sufficient.
  • Immunization is generally boosted 2-6 weeks later with one or more injections of the protein in saline, preferably using Freund's incomplete adjuvant.
  • Polyclonal antisera are obtained by bleeding the immunized animal into a glass or plastic container, incubating the blood at 25°C for one hour, followed by incubating at 4°C for 2-18 hours. The serum is recovered by centrifugation ⁇ e.g., 1,000 x g for 10 minutes). About 20-50 ml per bleed can be obtained from rabbits.
  • Sf9 cells Production of the Sf9 cells is disclosed in U.S. Patent No. 6,004,552. Briefly, a sequence encoding the ROSl kinase inhibitor resistance mutant polypeptide is recombined into a baculovirus using transfer vectors. The plasmid is co-transfected with wild-type baculovirus DNA into Sf9 cells. Recombinant baculovirus-infected Sf9 cells are identified and clonally purified.
  • the antibody is monoclonal in nature.
  • monoclonal antibody is intended an antibody obtained from a population of substantially homogeneous antibodies, that is, the individual antibodies comprising the population are identical except for possible naturally occurring mutations that can be present in minor amounts.
  • the term is not limited regarding the species or source of the antibody.
  • the term encompasses whole immunoglobulins as well as fragments such as Fab, F(ab')2, Fv, and others which retain the antigen binding function of the antibody.
  • Monoclonal antibodies are highly specific, being directed against a single antigenic site on the target polypeptide.
  • each monoclonal antibody is directed against a single determinant on the antigen.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milstein (Nature 256:495-97, 1975), or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567).
  • the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in, for example, Clackson et al. (Nature 352:624-28, 1991), Marks et al. (J. Mol. Biol. 222:581-97, 1991) and U.S. Patent No. 5,514,548.
  • epitope is intended the part of an antigenic molecule to which an antibody is produced and to which the antibody will bind.
  • Epitopes can comprise linear amino acid residues (i.e., residues within the epitope are arranged sequentially one after another in a linear fashion), nonlinear amino acid residues (referred to herein as “nonlinear epitopes”- these epitopes are not arranged sequentially), or both linear and nonlinear amino acid residues.
  • the epitope that is recognized by the specific anti-ROSl kinase inhibitor resistance mutant antibodies is one that is found in the particular ROS 1 kinase inhibitor resistance mutant and is not present in the native ROS1 polypeptide.
  • mAbs can be prepared using the method of Kohler and Milstein, or a modification thereof.
  • a mouse is immunized with a solution containing an antigen. Immunization can be performed by mixing or emulsifying the antigen-containing solution in saline, preferably in an adjuvant such as Freund's complete adjuvant, and injecting the mixture or emulsion parenterally. Any method of immunization known in the art may be used to obtain the monoclonal antibodies of the invention.
  • the spleen and optionally, several large lymph nodes
  • the spleen cells may be screened by applying a cell suspension to a plate or well coated with the antigen of interest.
  • the B cells expressing membrane bound immunoglobulin specific for the antigen bind to the plate and are not rinsed away.
  • Resulting B cells, or all dissociated spleen cells are then induced to fuse with myeloma cells to form hybridomas, and are cultured in a selective medium.
  • the resulting cells are plated by serial dilution and are assayed for the production of antibodies that specifically bind the antigen of interest (and that do not bind to unrelated antigens).
  • the selected mAb-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow fiber reactors), or in vivo (as ascites in mice).
  • the DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g. , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • the hybridoma cells described herein can serve as a source of such DNA. Once isolated, the DNA can be placed into expression vectors, which are then trans fected into host cells such as E.
  • the antibody can be produced in a cell line such as a CHO cell line, as disclosed in U.S. Patent Nos. 5,545,403;
  • the cell line is transfected with vectors capable of expressing a light chain and a heavy chain, respectively.
  • vectors capable of expressing a light chain and a heavy chain respectively.
  • transfecting the two proteins on separate vectors chimeric antibodies can be produced.
  • Another advantage is the correct glycosylation of the antibody.
  • anti-ROSl kinase inhibitor resistance mutant antibody encompasses chimeric and humanized anti-ROS 1 kinase inhibitor resistance mutant antibodies.
  • chimeric antibodies is intended antibodies that are most preferably derived using recombinant deoxyribonucleic acid techniques and which comprise both human (including immunologically "related" species, e.g., chimpanzee) and non-human components.
  • the constant region of the chimeric antibody is most preferably substantially identical to the constant region of a natural human antibody; the variable region of the chimeric antibody is most preferably derived from a non-human source and has the desired antigenic specificity to the ROS1 kinase inhibitor resistance mutant antigen.
  • the non-human source can be any vertebrate source that can be used to generate antibodies to a human ROS1 kinase inhibitor resistance mutant antigen or material comprising a human ROS1 kinase inhibitor resistance mutant antigen.
  • Such non-human sources include, but are not limited to, rodents (e.g., rabbit, rat, mouse, etc.; see, e.g., U.S. Patent No. 4,816,567) and non-human primates (e.g., Old World Monkeys, Apes, etc.; see, e.g., U.S. Patent Nos. 5,750,105 and 5,756,096).
  • rodents e.g., rabbit, rat, mouse, etc.
  • non-human primates e.g., Old World Monkeys, Apes, etc.
  • an anti- ROS1 kinase inhibitor resistance mutant antibody binds to an epitope comprising one or more of the ROSl kinase inhibitor resistant amino acid mutations selected from the group consisting of L1945Q, T1946S, L1947M, R1948S, L1951V, E1958V, V1959E, E1961K, G1962E, T1981M, S1986Y, E1990K, E1993 , L2000V, S2002N, F2004L, N2008H, I2009L, L2010M, K2011N, C2016G, N2019D, N2019Y, Q2022H, L2026M, L2028M, M2029 , E2030K, G2032R, D2033
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (also known as complementarity determining region or CDR) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit, or nonhuman primate having the desired specificity, affinity, and capacity.
  • donor antibody also known as complementarity determining region or CDR
  • complementarity determining region refers to amino acid sequences which together define the binding affinity and specificity of the natural Fv region of a native immunoglobulin binding site.
  • constant region refers to the portion of the antibody molecule that confers effector functions.
  • Humanization can be essentially performed following the methods described by Jones et al. (1986) Nature 321 :522-25; Riechmann et al. (1988) Nature 332:323-27; and Verhoeyen et al. (1988) Science 239: 1534-36, by substituting rodent or mutant rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. See also U.S. Patent Nos. 5,225,539; 5,585,089; 5,693,761 ; 5,693,762; and 5,859,205. In some instances, residues within the framework regions of one or more variable regions of the human immunoglobulin are replaced by corresponding non-human residues (see, for example, U.S. Patent Nos.
  • humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance (e.g., to obtain desired affinity).
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are those of a human immunoglobulin sequence.
  • the humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Accordingly, such "humanized" antibodies may include antibodies wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • anti-ROSl kinase inhibitor resistance mutant antibodies are xenogeneic or modified anti-ROSl kinase inhibitor resistance mutant antibodies produced in a non-human mammalian host, more particularly a transgenic mouse, characterized by inactivated endogenous immunoglobulin loci.
  • a transgenic mouse characterized by inactivated endogenous immunoglobulin loci.
  • competent endogenous genes for the expression of light and heavy subunits of host immunoglobulins are rendered non- functional and substituted with the analogous human immunoglobulin loci.
  • These transgenic animals produce human antibodies in the substantial absence of light or heavy host immunoglobulin subunits. See, for example, U.S. Patent Nos. 5,877,397 and 5,939,598.
  • Fully human antibodies to a particular ROS1 kinase inhibitor resistance mutant can be obtained by immunizing transgenic mice.
  • One such mouse is disclosed in U.S. Patent Nos. 6,075,181; 6,091,001 ; and 6,114,598.
  • Fragments of the anti-ROSl kinase inhibitor resistance mutant antibodies are suitable for use in the methods disclosed herein so long as they retain the desired affinity of the full-length antibody.
  • a fragment of an anti-ROS l kinase inhibitor resistance mutant antibody retains the ability to specifically bind to a particular ROS1 kinase inhibitor resistance mutant polypeptide.
  • Such fragments are characterized by properties similar to the corresponding full- length anti-ROSl kinase inhibitor resistance mutant antibody; that is, the fragments specifically bind a particular ROS 1 kinase inhibitor resistance mutant polypeptide.
  • Such fragments are referred to herein as "antigen-binding" fragments.
  • Suitable antigen-binding fragments of an antibody comprise a portion of a full-length antibody, generally the antigen-binding or variable region thereof.
  • antibody fragments include, but are not limited to, Fab, F(ab') 2 , and Fv fragments and single-chain antibody molecules.
  • Fab is intended a monovalent antigen-binding fragment of an immunoglobulin that is composed of the light chain and part of the heavy chain.
  • F(ab') 2 is intended a bivalent antigen-binding fragment of an immunoglobulin that contains both light chains and part of both heavy chains.
  • the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains that enables the sFv to form the desired structure for antigen binding.
  • a polypeptide linker between the V H and V L domains that enables the sFv to form the desired structure for antigen binding.
  • Antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in, for example, McCafferty et al. (1990) Nature 348:552-54; and U.S. Patent No. 5,514,548. Clackson ei a/. (199X) Nature 352:624-28; and Marks et al. (1991) J. Mol. Biol. 222: 81-97 describe the isolation of murine and human antibodies, respectively, using phage libraries. Subsequent publications describe the production of high affinity (nM range) human antibodies by chain shuffling (Marks et al.
  • fragments were derived via proteolytic digestion of intact antibodies (see, e.g., Morimoto et al. (1992) J. Biochem. Biophys. Methods 24:107-17; and Brennan et al. (1985) Science 229:81-3).
  • the antibody fragments can be isolated from the antibody phage libraries discussed above.
  • Fab fragments can be directly recovered from E. coli and chemically coupled to form F(ab') 2 fragments (Carter et al. (1992) Bio/Technology 10:163-67).
  • F(ab')2 fragments can be isolated directly from recombinant host cell culture.
  • Other techniques for the production of antibody fragments will be apparent to the skilled practitioner.
  • the ROS1 kinase inhibitor resistance mutant inhibitor or any of the polynucleotides, polypeptides, or antibodies disclosed herein are administered to a subject along with a pharmaceutically acceptable carrier, which is referred to herein as a pharmaceutical composition.
  • a pharmaceutically acceptable carrier includes solvents, dispersion media, antibacterial and antifungal agents, isotonic agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds also can be incorporated into the compositions.
  • a pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical),
  • transmucosal, and rectal administration it may be desirable to administer a therapeutically effective amount of the pharmaceutical composition locally to an area in need of treatment (e.g., to an area of the body where inhibiting a TR cell function is desired).
  • a therapeutically effective amount of the pharmaceutical composition locally to an area in need of treatment (e.g., to an area of the body where inhibiting a TR cell function is desired).
  • This can be achieved by, for example, local or regional infusion or perfusion during surgery, topical application, injection, catheter, suppository, or implant (for example, implants formed from porous, non-porous, or gelatinous materials, including membranes, such as sialastic membranes or fibers), and the like.
  • administration can be by direct injection at the site (or former site) of a cancer that is to be treated.
  • the therapeutically effective amount of the pharmaceutical composition is delivered in a vesicle, such as liposomes (see, e.g., Langer (1990) Science 249:1527-33; and Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, N.Y., pp. 353-65, 1989).
  • a vesicle such as liposomes
  • the therapeutically effective amount of the pharmaceutical composition can be delivered in a controlled release system.
  • a pump can be used (see, e.g., Langer (1990) Science 249: 1527-33; Sefton (1987) Crit. Rev. Biomed. Eng. 14:201-40; Buchwald et al. (1980) Surgery 88:507-16; Saudek et al. (1989) N. Engl. J. Med. 321 :574-79).
  • polymeric materials can be used (see, e.g., Levy et al. (1985) Science 228:190-92; During et al. (1989) Ann. Neurol. 25:351-56; Howard et al. (1989) J.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.
  • compositions suitable for injectable use include sterile aqueous solutions
  • suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR ® EL (BASF; Parsippany, NJ), or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride, in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
  • the materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to specific receptors) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
  • a polynucleotide can be injected directly as naked DNA or RNA, by infection using defective or attenuated retrovirals or other viral vectors, or can be coated with lipids or cell- surface receptors or transfecting agents, encapsulated in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu (1987) J. Biol. Chem. 262:4429-4432) (which can be used to target cell types specifically expressing the receptors) and so on.
  • polynucleotide-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the polynucleotide to avoid lysosomal degradation.
  • the polynucleotide can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor. Alternatively, the polynucleotide can be introduced
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated with each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
  • compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • administration When administration is for the purpose of treatment, administration may be for either a prophylactic (i.e., preventative) or therapeutic purpose.
  • a prophylactic i.e., preventative
  • the substance When provided prophylactically, the substance is provided in advance of any symptom.
  • the prophylactic administration of the substance serves to prevent or attenuate any subsequent symptom.
  • the substance is provided at (or shortly after) the onset of a symptom.
  • the therapeutic administration of the substance serves to attenuate any actual symptom.
  • treatment modalities described herein can be used alone or in conjunction with other therapeutic modalities (i.e., as adjuvant therapy), including, but not limited to, surgical therapy, radiotherapy, chemotherapy (e.g., with any chemotherapeutic agent well known in the art) or immunotherapy.
  • other therapeutic modalities i.e., as adjuvant therapy
  • treatment of a subject with a therapeutically effective amount of an ROS1 kinase inhibitor resistance mutant inhibitor can include a single treatment or, preferably, can include a series of treatments. It will also be appreciated that the effective dosage of an ROS1 kinase inhibitor resistance mutant inhibitor used for treatment can increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays as described herein.
  • the dose(s) of the active compounds will vary, for example, depending upon the identity, size, and condition of the subject or sample being treated, further depending upon the route by which the composition is to be administered, if applicable, and the effect which the practitioner desires the active compound to have upon the ROSl kinase inhibitor resistance mutant.
  • Exemplary doses include milligram or microgram amounts of the small molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is furthermore understood that appropriate doses of an active agent depend upon the potency of the active agent with respect to the expression or activity to be modulated.
  • Such appropriate doses may be determined using the assays described herein.
  • a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained.
  • the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
  • Therapeutically effective amounts of an ROSl kinase inhibitor resistance mutant inhibitor can be determined by animal studies. When animal assays are used, a dosage is administered to provide a target tissue concentration similar to that which has been shown to be effective in the animal assays. It is recognized that the method of treatment can comprise a single administration of a therapeutically effective amount or multiple administrations of a therapeutically effective amount of the ROS 1 kinase inhibitor resistance mutant inhibitor.
  • formulations comprising an effective amount of a pharmaceutical composition comprising ROS 1 kinase inhibitor resistance mutant inhibitor or ROSl kinase inhibitor resistance mutant specific binding agents can be used for the purpose of treatment, prevention, and diagnosis of a number of clinical indications related to the activity of the ROSl kinase inhibitor resistance mutant.
  • kit refers to a set of reagents for the identification, the detection, and/or the quantification of the polynucleotide encoding an ROS l kinase inhibitor resistance mutant polypeptide or detection and/or quantitation of the ROS l kinase inhibitor resistance mutant polypeptide in biological samples.
  • kit and “system,” as used herein are intended to refer to at least one or more detection reagents which, in specific embodiments, are in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages, such as packaging intended for commercial sale, substrates to which detection reagents are attached, electronic hardware components, instructions of use, and the like).
  • elements or components e.g., other types of biochemical reagents, containers, packages, such as packaging intended for commercial sale, substrates to which detection reagents are attached, electronic hardware components, instructions of use, and the like.
  • ROS l kinase inhibitor resistance mutant detection kits and systems including but not limited to, packaged probe and primer sets (e.g., TaqMan probe/primer sets), antibodies, arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more ROS 1 kinase inhibitor resistance mutant.
  • packaged probe and primer sets e.g., TaqMan probe/primer sets
  • antibodies e.g., antibodies, arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more ROS 1 kinase inhibitor resistance mutant.
  • kits for detecting a ROS l inhibitor resistance mutation in a biological sample comprising any of the antibodies that specifically binds an ROS l kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small- molecule kinase inhibitor disclosed herein.
  • kits for detecting an ROSl inhibitor resistance mutation in a biological sample comprising a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROS l kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROS l kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS l small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROS l kinase inhibitor resistance mutant residue selected from the group consisting of: a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1 ;a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1 ; a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ
  • kits/systems can optionally include various electronic hardware components.
  • arrays e.g., DNA chips
  • micro fluidic systems e.g., lab-on-a-chip systems
  • Other kits/systems e.g., probe/primer sets
  • an ROS1 kinase inhibitor resistance mutant detection kit typically contains one or more detection reagents and other components (e.g., a buffer, enzymes, such as DNA polymerases or ligases, chain extension nucleotides, such as deoxynucleotide
  • kits can further contain means for determining the amount of the target polynucleotide and means for comparing with an appropriate standard, and can include instructions for using the kit to detect the ROS1 kinase inhibitor resistance mutation, such as, for example, the amino acid substitutions disclosed in Table 1.
  • kits are provided which contain the necessary reagents to carry out one or more assays to detect one or more of the ROS1 kinase inhibitor resistance mutations as disclosed herein.
  • the ROS 1 kinase inhibitor resistance mutation detection kits/systems can contain, for example, one or more probes, or pairs of probes, that hybridize to a nucleic acid molecule at or near the ROS 1 kinase inhibitor resistance mutation, such as, for eample, the amino acid substitutions of SEQ ID NO: 1 disclosed in Table 1.
  • the primers and probes can specifically hybridize to any of the polynucleotides disclosed herein.
  • the disclosed primers and probes can specifically hybridize to a polynucleotide comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, or 99.5% or more sequence identity to SEQ ID NO 2, wherein the polynucleotide comprises one or more of the nucleotide substitions disclosed in Table 1 or encodes one of the polynucleotide substitutions disclosed in Table 1.
  • the kit comprises a first and a second primer, wherein the first and second primer amplify an amplicon comprising an ROS 1 inhibitor resistance mutation, such as the mutations listed in Table 1.
  • the kit comprises at least one probe comprising a polynucleotide sequence that hybridizes under stringent conditions to a
  • polynucleotide encoding an ROSl having an inhibitor resistance mutation.
  • Kits can also be used to detect an ROS l inhibitor resistance mutant polypeptide.
  • kits comprise an agent that specifically binds an ROS 1 kinase inhibitor resistance mutant polypeptide, such as an antibody, in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages, such as packaging intended for commercial sale, electronic hardware components, wash reagents, reagents/chemical capable of detecting the presence of bounds specific binding agents, such as antibodies, of the kit).
  • the kit comprises a compartmentalized kit and includes any kit in which reagents are contained in separate containers.
  • Such containers include small glass containers, plastic containers or strips of plastic or paper.
  • Such containers allow one to efficiently transfer reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
  • Such containers can include a container which will accept the test sample, a container which contains the antibodies or probes used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the reagents used to detect the bound antibody or the hybridized probe. Any detection reagents known in the art can be used including, but not limited to those described supra.
  • disclosed herein are methods (also referred to herein as a "screening assay") for identifying specific binding agents and/or inhibitors of a particular presently disclosed ROSl kinase inhibitor resistance mutant.
  • identification of 1 ROS1 kinase inhibitor resistance mutant polypeptide binding agents are of interest, including ROS1 kinase inhibitor resistance mutant specific binding agents and ROS1 kinase inhibitor resistance mutant inhibitors.
  • Screening methods for ROS1 kinase inhibitor resistance mutant binding agents or ROS1 kinase inhibitor resistance mutant inhibitors involve determining if a test compound can bind, specifically or non-specifically, to an ROS1 kinase inhibitor resistance mutant and/or determining if the test compound can reduce the kinase activity of the particular ROS1 kinase inhibitor resistance mutant.
  • methods of identifying an agent capable of inhibiting the kinase activity of an ROS1 kinase inhibitor resistance mutant or ROS1 fusion protein comprising contacting a candidate agent with any polypeptide disclosed herein; and, determining whether said candidate agent inhibits the kinase activity of said polypeptide.
  • methods of identifying an agent capable of specifically binding any of the polypeptides disclosed herein comprising the steps of contacting a candidate agent with said polypeptide; and, determining whether said candidate agent specifically binds said polypeptide.
  • the candidate agents employed in the various screening assays can include any compound including, for example, peptides, peptidomimetics, polynucleotides, small molecules, antibodies, or other drugs.
  • the candidate agents are small molecules.
  • Such candidate agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, nonpeptide oligomer, or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145).
  • candidate agents can be derived from any organism, including bacteria, fungi, plants, or animals.
  • Determining the ability of the candidate agent to bind to the particular ROS 1 kinase inhibitor resistance mutant can be accomplished, for example, by coupling the candidate agent with a radioisotope or enzymatic label such that binding of the candidate agent to the ROSl kinase inhibitor resistance mutant polypeptide can be determined by detecting the labeled agent in a complex.
  • candidate agents can be labeled with 125 1, 3 S, 14 C, or 3 H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • candidate agents can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • an assay to identify specific binding agents for an ROSl kinase inhibitor resistance mutant is a cell-free assay comprising contacting an ROS 1 kinase inhibitor resistance mutant polypeptide with a candidate agent and determining the ability of the candidate agent to bind to the ROSl kinase inhibitor resistance mutant polypeptide. Binding of the candidate agent to the ROSl kinase inhibitor resistance mutant polypeptide can be determined either directly or indirectly.
  • An indirect assay could include assaying for a reduction in ROS 1 kinase activity (e.g., phosphorylation of ROSl substrates).
  • the ROSl kinase inhibitor resistance mutant can be immunoprecipitated from a cellular lysate, wherein the complex is bound to a matrix (e.g., beads).
  • a fusion protein can be provided that adds a domain to the candidate agent or the ROSl kinase inhibitor resistance mutant polypeptide that allows the candidate agent or the ROSl kinase inhibitor resistance mutant to be bound to a matrix.
  • ROS 1 kinase inhibitor resistance mutant polypeptides comprising a glutathione-S-transferase/ROSl kinase inhibitor resistance mutant fusion protein can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
  • ROSl kinase inhibitor resistance mutant polypeptide or the candidate agent can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated ROSl kinase inhibitor resistance mutants or candidate agents can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated plates (Pierce Chemicals).
  • the ROS 1 kinase inhibitor resistance mutant polypeptides can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
  • the ROSl inhibitor resistance mutant can be in either an active or inactive state when contacted with the candidate agent.
  • An active state is one wherein the three tyrosine residues (tyrosines 1278, 1282, and 1283 of full-length ROSl) within the activation domain are phosphorylated.
  • an inactive state is one wherein the activation domain tyrosine residues are not phosphorylated and the activation domain is in its closed conformation.
  • the assay comprises contacting the ROSl kinase inhibitor resistance mutant polypeptide with a candidate agent and determining the ability of the candidate agent to reduce or completely inhibit the kinase activity of the ROSl kinase inhibitor resistance mutant. Determining the ability of the candidate agent to inhibit the activity of an ROSl kinase inhibitor resistance mutant can be accomplished, for example, by determining the ability of the ROSl kinase inhibitor resistance mutant to phosphorylate ROSl substrates or to autophosphorylate in the presence of the test compound.
  • ROSl kinase inhibitor resistance mutant Methods for assaying the kinase activity of an ROSl kinase inhibitor resistance mutant are discussed elsewhere herein, and include in vitro kinase assays wherein ROSl polypeptides are isolated via affinity purification or immunoprecipitation and the autophosphorylation of ROSl or the phosphorylation of a substrate protein or peptide is measured in the presence of ATP.
  • the ROSl kinase inhibitor resistance mutant can be in an active or inactivate state when contacted with the candidate agent in screens for inhibitors of the resistance mutant.
  • Inhibitors that bind to ROSl in the inactive state are particularly desirable because the structure of the kinase domain of receptor tyrosine kinases when inactive is generally more unique than the conformation of the activated kinase.
  • the kinase is activated prior to testing the effect of the candidate agent on the kinase activity.
  • ROSl inhibitor resistance mutants can be activated through the addition of a ligand (e.g., pleiotropin, midkine) in those instances wherein the ROSl mutant polypeptide comprises the ligand binding domain.
  • a ligand e.g., pleiotropin, midkine
  • the ROSl kinase inhibitor resistance mutant polypeptide can comprise the cytoplasmic domain (e.g., amino acids 1058-1620) of the kinase comprising the kinase domain along with domains necessary for interacting with downstream effectors, fused to an inducible dimerization or oligomerization domain.
  • An inducible dimerization domain or inducible oligomerization domain is a polypeptide sequence that can be stimulated to dimerize or oligomerize in the presence of a dimerized or oligomerized ligand.
  • a non-limiting example of an inducible dimerization domain is one comprising at least one FKBP12 polypeptide that can be dimerized through the addition of the cell-permeable synthetic dimerized ligand FK1012 (Spencer et al. (1993) Science 262:989, which is herein incorporated by reference in its entirety).
  • the ROS1 kinase inhibitor resistance mutant-inducible dimerization/oligomerization domain fusion protein becomes activated.
  • Cell-based assays can also be used to measure ROS1 kinase activity wherein ROS1 autophosphorylation or phosphorylation of an ROS1 substrate is determined using
  • the ROS1 kinase inhibitor resistance mutant is expressed in a eukaryotic cell (either endogenously or exogenously wherein the sequence is introduced via transformation, for example). If the full- length ROS1 kinase inhibitor resistance mutant polypeptide is used for such experiments, an activating ligand is added to the culture. In other embodiments, the ROS1 kinase inhibitor resistance mutant is a constitutively active ROS1 kinase inhibitor resistance mutant-oncogenic fusion protein.
  • the ROS1 kinase inhibitor resistance mutant polypeptide comprises the cytoplasmic domain (e.g., amino acids 1058-1620) fused to an inducible dimerization or oligomerization domain and the fusion protein is activated through the addition of a cell-permeable dimerized or oligomerized ligand (Spencer et al. (1993) Science 262:989). Activation of ROS1 leads to the stimulation of cell proliferation, cell survival, promotion of anchorage-independent growth, and cellular migration and invasion.
  • cytoplasmic domain e.g., amino acids 1058-1620
  • candidate agents that inhibit the kinase activity of an ROS 1 kinase inhibitor resistance mutant can be selected based on the ability of the candidate agent to inhibit cell growth, stimulate cell death, inhibit anchorage-independent growth, and/or inhibit cell migration or invasion of cells expressing the activated ROS1 kinase inhibitor resistance mutant.
  • cell growth refers to cell proliferation, cell division, or progression through the cell cycle.
  • Cell death includes both apoptosis and necrosis.
  • Such cell-based assays are known in the art (von Bubnoff et al. (2005) Blood 105:1652-1659; von Bubnoff et al. (2006) Blood 108: 1328-1333; Kancha et al. (2009) Clin Cancer Res 15:460-467; von Bubnoff et al. (2009) Cancer Res 69:3032-3041; von Bubnoff et al. (2005) Cell Cycle 4:400-406; each of which is herein incorporated by reference in its entirety) and described elsewhere herein.
  • any method known in the art can be used to measure the growth rate of a cell or an effect on cell survival, including, but not limited to, optical density (OD 60 o ), CO2 production, O2 consumption, assays that measure mitochondrial function, such as those utilizing tetrazolium salts (e.g., MTT, XTT), or other colorimetric reagents (e.g., the WST-1 reagent available from Roche), assays that measure or estimate DNA content, including, but not limited to fluoremetric assays such as those utilizing the fluorescent dye Hoechst 33258, assays that measure or estimate protein content, including, but not limited to, the sulforhodamine B (SRB) assay, manual or automated cell counts (with or without the Trypan Blue stain to distinguish live cells), and clonogenic assays with manual or automated colony counts.
  • assays that can be used to measure levels of apoptosis include, but are not limited to, measurement of DNA fragmentation,
  • Anchorage-independent growth refers to, in contrast to adherent normal cells that must adhere to the extracellular matrix (anchorage) for their survival and growth, the general essential property of cancer cells capable of growing even without such an anchorage.
  • Methods for measuring the anchorage dependence of cells include growing the cells in a soft agar medium or culturing cells under conditions in which spheroids (cell aggregates) can form. Such assays are described in U.S. Patent Application Publication Nos. 2008/0090776 and 2009/0099193.
  • Cell migration refers to the movement of cells, which in some embodiments can be towards a target (e.g., growth factors), which is also referred to as chemotaxis.
  • Cell invasion refers to cellular movement through a matrix, such as the extracellular matrix. Methods are known in the art to measure cell migration and invasion, including transwell assays, wherein the movement of cells from one chamber to a second chamber is measured through quantitation of the number of cells in the second chamber. In variations of this assay, a chemoattractant is provided in the second chamber and/or the chambers are separated by a matrix comprising various components of the extracellular matrix (e.g., collagen).
  • a chemoattractant is provided in the second chamber and/or the chambers are separated by a matrix comprising various components of the extracellular matrix (e.g., collagen).
  • ROS1 kinase inhibitor resistance mutants include the use of in vivo animal models (e.g., xenografts) for a cancer associated with aberrant ROS 1 activity that express an ROS 1 kinase inhibitor resistance mutant.
  • the non-human animal model can be, for example, a mouse (e.g., nude mouse), rat, or hamster.
  • Cancer cells endogenously expressing an ROS1 kinase inhibitor resistance mutant polypeptide or cells transformed by the expression of the ROS1 kinase inhibitor resistance mutant can be transplanted subcutaneously, intradermally, or intraperitoneally or into each organ.
  • a non- human transgenic animal that has been genetically engineered to express an ROS1 kinase inhibitor resistance mutant-oncogenic fusion protein, such as those described elsewhere herein, can also be used.
  • the ability of a candidate agent to inhibit ROSl kinase activity can be confirmed by administering the candidate agent by a variety of administration methods, such as oral, intravenous, subcutaneous, and intraperitoneal administrations and measuring the volume or weight of the tumor of the animal model or progression of the disease.
  • administration methods such as oral, intravenous, subcutaneous, and intraperitoneal administrations and measuring the volume or weight of the tumor of the animal model or progression of the disease.
  • screening assays for agents that inhibit the kinase activity of an ROSl kinase inhibitor resistance mutant include screening for agents that specifically reduce the expression of a presently disclosed ROSl kinase inhibitor resistance mutant or ROSl kinase inhibitor resistance mutant-oncogenic fusion protein.
  • polynucleotide or polypeptide level of the ROSl kinase inhibitor resistance mutant is statistically lower than the polynucleotide level or polypeptide level of the same target sequence in an appropriate control which is not exposed to the silencing element.
  • reducing the polynucleotide level and/or the polypeptide level of the target sequence according to the presently disclosed subject matter results in less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%), less than 20%, less than 10%, or less than 5% of the polynucleotide level, or the level of the polypeptide encoded thereby, of the same target sequence in an appropriate control.
  • Methods to assay for the level of the R A transcript, the level of the encoded polypeptide, or the activity of the polynucleotide or polypeptide are discussed elsewhere herein.
  • the present disclosure further provides methods and compositions to reduce the level of expression of an ROS 1 kinase inhibitor resistance mutant by introducing into a cell expressing the ROSl kinase inhibitor resistance mutant a silencing element that reduces or eliminates the level of expression of an ROSl kinase inhibitor resistance mutant target polynucleotide or the polypeptide encoded thereby upon introduction or expression of the silencing element.
  • methods for screening candidate agents for those that specifically reduce ROS 1 kinase inhibitor resistance mutant expression include introducing into a cell expressing the ROSl kinase inhibitor resistance mutant the candidate agent (e.g., silencing element) and determining the level of expression of the ROSl kinase inhibitor resistance mutant.
  • the expression of the ROSl kinase inhibitor resistance mutant can be inhibited by any means known in the art, including the introduction of polypeptides that inhibit the expression of the ROSl kinase inhibitor resistance mutant, the introduction of nucleotide sequences comprising silencing elements that encode polynucleotides useful for transposon insertion into the ROSl mutant gene, homologous recombination/genetic knock-out of the ROSl mutant gene, silencing elements that encode zinc finger proteins that bind to an ROSl mutant gene and reduce its expression, silencing elements that encode antisense oligonucleotides or dsRNA molecules (e.g., shRNA, siRNA), or nucleotide sequences that encode antibodies or other polypeptides that inhibit Nrl expression or activity.
  • silencing elements that encode polynucleotides useful for transposon insertion into the ROSl mutant gene
  • homologous recombination/genetic knock-out of the ROSl mutant gene sile
  • a cancer associated with aberrant ROSl activity that is resistant to at least one ROSl small-molecule kinase inhibitor comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to said at least one ROSl small-molecule kinase inhibitor, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is the polypeptide of any preceiding aspect.
  • a cancer associated with aberrant ROS 1 activity that is resistant to XALKORI® comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to XALKORI®, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is a polypeptide comprising any mutant amino acid sequence disclosed herein.
  • ROSl kinase inhibitor resistance mutant inhibitors that are identified through the methods disclosed herein can be used in the treatment of cancers having an ROSl kinase inhibitor resistance mutation. Additionally, agents that reduce the expression of ROSl kinase inhibitor resistance mutants (e.g., silencing elements) can be used to treat cancers having an ROSl kinase inhibitor resistance mutation.
  • agents that reduce the expression of ROSl kinase inhibitor resistance mutants e.g., silencing elements
  • treatment is an approach for obtaining beneficial or desired clinical results.
  • beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, partial or complete restoration of eyesight (e.g., central vision, visual acuity), diminishment of extent of the disorder, stabilized (i.e., not worsening) state of the disorder (e.g., degeneration of cone photoreceptors), delaying or slowing of progression of the disorder, amelioration or palliation of the disorder, and prevention of, inhibition of, or reduction of risk of developing a retinal disorder.
  • Treatment refers to both therapeutic treatment and prophylactic or preventative measures.
  • Those in need of treatment include those already with the disorder (to prevent further degeneration) as well as those in which the disorder is to be prevented. "Palliating" a disorder means that the extent and/or undesirable clinical manifestations of the disorder are lessened and/or the time course of the progression is slowed or lengthened, as compared to a situation without treatment.
  • the silencing element encodes a zinc finger protein that binds to an OS1 kinase inhibitor resistance mutant gene, resulting in reduced expression of the gene.
  • the zinc finger protein binds to a regulatory region of an ROS1 kinase inhibitor resistance mutant gene.
  • the zinc finger protein binds to a messenger RNA (i.e., transcript) encoding an ROS1 kinase inhibitor resistance mutant and prevents its translation.
  • an ROS1 kinase inhibitor resistance mutant is reduced or eliminated by disrupting an ROS1 kinase inhibitor resistance mutant gene.
  • the ROS1 kinase inhibitor resistance mutant gene can be disrupted by any method known in the art. For example, in one embodiment, the gene is disrupted by transposon tagging. In another embodiment, the gene is disrupted by mutagenizing cells using random or targeted mutagenesis, and selecting for cells that have reduced ROS1 activity.
  • transposon tagging is used to reduce or eliminate the expression of an ROS1 kinase inhibitor resistance mutant.
  • Transposon tagging comprises inserting a transposon within an endogenous ROS 1 kinase inhibitor resistance mutant gene to reduce or eliminate expression of the ROS1 kinase inhibitor resistance mutant.
  • the expression of the ROS1 kinase inhibitor resistance mutant gene is reduced or eliminated by inserting a transposon within a regulatory region or coding region of the ROS1 kinase inhibitor resistance mutant gene.
  • a transposon that is within an exon, intron, 5 ' or 3 ' untranslated sequence, a promoter, or any other regulatory sequence of an ROS1 kinase inhibitor resistance mutant gene can be used to reduce or eliminate the expression and/or activity of the encoded ROSl kinase inhibitor resistance mutant.
  • the silencing element comprises or encodes a targeted transposon that can insert within an ROSl kinase inhibitor resistance mutant gene.
  • the silencing element comprises a nucleotide sequence useful for site-directed mutagenesis via homologous recombination with a region of an ROSl kinase inhibitor resistance mutant gene. Insertional mutations in gene exons usually result in null-mutants.
  • the disclosure encompasses additional methods for reducing or eliminating the activity or expression of ROSl kinase inhibitor resistance mutants, such as those that involve promoter-based silencing. See, for example, Mette et al. (2000) EMBO J. 19: 5194-5201; Sijen et al. (2001) Curr. Biol. 11 :436-440; Jones et al. (2001) Curr. Biol. 11 :747-757.
  • the term "silencing element” refers to a polynucleotide, which when expressed or introduced into a cell is capable of reducing or eliminating the level of expression of a target polynucleotide sequence or the polypeptide encoded thereby.
  • the silencing element can comprise or encode an antisense oligonucleotide or an interfering RNA (RNAi).
  • RNAi interfering RNA
  • interfering RNA or "RNAi” refers to any RNA molecule which can enter an RNAi pathway and thereby reduce the expression of a target gene.
  • the RNAi pathway features the Dicer nuclease enzyme and RNA-induced silencing complexes (RISC) that function to degrade or block the translation of a target mRNA.
  • RISC RNA-induced silencing complexes
  • RNAi is distinct from antisense oligonucleotides that function through "antisense” mechanisms that typically involve inhibition of a target transcript by a single-stranded oligonucleotide through an RNase H-mediated pathway. See, Crooke (ed.) (2001) “Antisense Drug Technology: Principles, Strategies, and Applications” (1st ed), Marcel Dekker; ISBN: 0824705661; 1st edition.
  • gene has its meaning as understood in the art.
  • a gene is taken to include gene regulatory sequences (e.g., promoters, enhancers, and the like) and/or intron sequences, in addition to coding sequences (open reading frames).
  • gene regulatory sequences e.g., promoters, enhancers, and the like
  • intron sequences in addition to coding sequences (open reading frames).
  • definitions of "gene” include references to nucleic acids that do not encode proteins but rather encode functional RNA molecules, or precursors thereof, such as microRNA or siRNA precursors, tRNAs, and the like.
  • a target gene comprises any gene that one desires to decrease the level of expression.
  • reduceds or reducing the expression level of a gene is intended to mean, the level of the encoded polynucleotide (i.e., target transcript) or the encoded polypeptide is statistically lower than the encoded polynucleotide level or encoded polypeptide level in an appropriate control which is not exposed to the silencing element.
  • reducing the expression of an ROSl kinase inhibitor resistance mutant gene results in less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%>, or less than 5% of the level of the ROSl kinase inhibitor resistance mutant transcript or the level of the ROSl kinase inhibitor resistance mutant polypeptide in an appropriate control (e.g., the same cell prior to the introduction/expression of the silencing element or a similar cell at a similar stage in differentiation, same phenotype, same genotype, etc.).
  • Methods to assay for the level of the RNA transcript, the level of the encoded polypeptide, or the activity of the polynucleotide or polypeptide are known in the art, and are described elsewhere herein.
  • complementary is used herein in accordance with its art-accepted meaning to refer to the capacity for precise pairing via hydrogen bonds (e.g., Watson-Crick base pairing or Hoogsteen base pairing) between two nucleosides, nucleotides or nucleic acids, and the like.
  • nucleic acids are considered to be complementary at that position (where position may be defined relative to either end of either nucleic acid, generally with respect to a 5' end).
  • a complementary base pair contains two complementary nucleotides, e.g., A and U, A and T, G and C, and the like, whereas a noncomplementary base pair contains two noncomplementary nucleotides (also referred to as a mismatch).
  • Two polynucleotides are said to be complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that hydrogen bond with each other, i.e., a sufficient number of base pairs are complementary.
  • hybridize refers to the interaction between two complementary nucleic acid sequences in which the two sequences remain associated with one another under appropriate conditions.
  • a silencing element can comprise the interfering RNA or antisense oligonucleotide, a precursor to the interfering RNA or antisense oligonucleotide, a template for the transcription of an interfering RNA or antisense oligonucleotide, or a template for the transcription of a precursor interfering RNA or antisense oligonucleotide, wherein the precursor is processed within the cell to produce an interfering RNA or antisense oligonucleotide.
  • a dsRNA silencing element includes a dsRNA molecule, a transcript or polyribonucleotide capable of forming a dsRNA, more than one transcript or polyribonucleotide capable of forming a dsRNA, a DNA encoding a dsRNA molecule, or a DNA encoding one strand of a dsRNA molecule.
  • the silencing element comprises a DNA molecule encoding an interfering RNA, it is recognized that the DNA can be transiently expressed in a cell or stably incorporated into the genome of the cell. Such methods are discussed in further detail elsewhere herein.
  • the silencing element can reduce or eliminate the expression level of a target gene by influencing the level of the target RNA transcript, by influencing translation of the target RNA transcript, or by influencing expression at the pre-transcriptional level (i.e., via the modulation of chromatin structure, methylation pattern, etc., to alter gene expression).
  • a target gene can influence the level of the target RNA transcript, by influencing translation of the target RNA transcript, or by influencing expression at the pre-transcriptional level (i.e., via the modulation of chromatin structure, methylation pattern, etc., to alter gene expression).
  • any region of a transcript from the target gene can be used to design a domain of the silencing element that shares sufficient sequence identity to allow for the silencing element to decrease the level of the polynucleotide or polypeptide encoded by the target gene.
  • the silencing element can be designed to share sequence identity to the 5 ' untranslated region of the target transcript, the 3 ' untranslated region of the target transcript, exonic regions of the target transcript, intronic regions of the target transcript, and any combination thereof.
  • the ability of a silencing element to reduce the level of the target transcript can be assessed directly by measuring the amount of the target transcript using, for example, Northern blots, nuclease protection assays, reverse transcription (RT)-PCR, real-time RT-PCR, microarray analysis, and the like.
  • the ability of the silencing element to reduce the level of the polypeptide encoded by the target gene and target transcript can be measured directly using a variety of affinity-based approaches (e.g., using a ligand or antibody that specifically binds to the target polypeptide) including, but not limited to, Western blots, immunoassays, ELISA, flow cytometry, protein microarrays, and the like.
  • the ability of the silencing element to reduce the level of the target polypeptide encoded by the target gene can be assessed indirectly, e.g., by measuring a functional activity of the polypeptide encoded by the transcript or by measuring a signal produced by the polypeptide encoded by the transcript.
  • silencing element can be prepared according to any available technique including, but not limited to, chemical synthesis, enzymatic or chemical cleavage in vivo or in vitro, template transcription in vivo or in vitro, or combinations of the foregoing.
  • the silencing element comprises or encodes a double stranded RNA molecule.
  • a double stranded RNA or “dsRNA” refers to a polyribonucleotide structure formed either by a single self-complementary RNA molecule or a polyribonucleotide structure formed by the expression of least two distinct RNA strands.
  • dsRNA is meant to encompass other terms used to describe nucleic acid molecules that are capable of mediating RNA interference or gene silencing, including, for example, small RNA (sRNA), short-interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), hairpin RNA, short hairpin RNA (shRNA), and others.
  • small RNA siRNA
  • siRNA short-interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • hairpin RNA short hairpin RNA
  • shRNA short hairpin RNA
  • At least one strand of the duplex or double-stranded region of the dsRNA shares sufficient sequence identity or sequence complementarity to the target gene to allow for the dsRNA to reduce the level of expression of the target gene.
  • the strand that is complementary to the target transcript is the "antisense strand”
  • the strand homologous to the target transcript is the “sense strand.”
  • the dsRNA comprises a hairpin RNA.
  • a hairpin RNA comprises an
  • RNA molecule that is capable of folding back onto itself to form a double stranded structure can comprise multiple structures.
  • the hairpin RNA molecule that hybridizes with itself to form a hairpin structure can comprise a single-stranded loop region and a base-paired stem.
  • the base-paired stem region can comprise a sense sequence corresponding to all or part of the target transcript and further comprises an antisense sequence that is fully or partially complementary to the sense sequence.
  • the base-paired stem region of the silencing element can determine the specificity of the silencing. See, for example, Chuang and Meyerowitz (2000) Proc. Natl Acad. Sci. USA 97:4985-4990, herein incorporated by reference.
  • a transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panslita et al. (2003) Mol. Biol. Rep. 30:135-140, herein incorporated by reference.
  • a "short interfering RNA” or “siRNA” comprises an RNA duplex (double-stranded region) and can further comprise one or two single-stranded overhangs, e.g., 3' or 5' overhangs.
  • the duplex can be approximately 19 base pairs (bp) long, although lengths between 17 and 29 nucleotides, including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29 nucleotides, can be used.
  • An siRNA can be formed from two RNA molecules that hybridize together or can alternatively be generated from a single RNA molecule that includes a self-hybridizing portion.
  • the duplex portion of an siRNA can include one or more bulges containing one or more unpaired and/or mismatched nucleotides in one or both strands of the duplex or can contain one or more noncomplementary nucleotide pairs.
  • One strand of an siRNA (referred to herein as the antisense strand) includes a portion that hybridizes with a target transcript.
  • one strand of the siRNA (the antisense strand) is precisely complementary with a region of the target transcript over at least about 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, or more meaning that the siRNA antisense strand hybridizes to the target transcript without a single mismatch (i.e., without a single noncomplementary base pair) over that length.
  • one or more mismatches between the siRNA antisense strand and the targeted portion of the target transcript can exist.
  • any mismatches between the siRNA antisense strand and the target transcript can be located at or near the 3 ' end of the siRNA antisense strand.
  • nucleotides 1-9, 2-9, 2-10, and/or 1-10 of the antisense strand are perfectly complementary to the target.
  • siRNA molecules design of effective siRNA molecules are discussed in McManus et al. (2002) Nature Reviews Genetics 3:737-747 and in Dykxhoorn et al. (2003) Nature Reviews Molecular Cell Biology 4:457-467. Such considerations include the base composition of the siRNA, the position of the portion of the target transcript that is complementary to the antisense strand of the siRNA relative to the 5 ' and 3 ' ends of the transcript, and the like. A variety of computer programs also are available to assist with selection of siRNA sequences, e.g., from Ambion and Integrated DNA Technologies. Additional design considerations that also can be employed are described in Semizarov et al. Proc. Natl. Acad. Sci. 100:6347-6352.
  • short hairpin RNA refers to an RNA molecule comprising at least two complementary portions hybridized or capable of hybridizing to form a double- stranded (duplex) structure sufficiently long to mediate RNAi (generally between approximately 17 and 29 nucleotides in length, including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29 nucleotides in length, and in some embodiments, typically at least 19 base pairs in length), and at least one single-stranded portion, typically between approximately 1 and 20 or 1 to 10 nucleotides in length that forms a loop connecting the two nucleotides that form the base pair at one end of the duplex portion.
  • RNAi generally between approximately 17 and 29 nucleotides in length, including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29 nucleotides in length, and in some embodiments, typically at least 19 base pairs in length
  • single-stranded portion typically between approximately 1 and 20 or 1 to 10 nucleotides in length that forms a loop connecting the two nucleotides
  • the duplex portion can, but does not require, one or more bulges consisting of one or more unpaired nucleotides.
  • the shRNAs comprise a 3 ' overhang.
  • shRNAs are precursors of siRNAs and are, in general, similarly capable of inhibiting expression of a target transcript.
  • RNA molecules having a hairpin (stem-loop) structure can be processed intracellularly by Dicer to yield an siRNA structure referred to as short hairpin RNAs (shRNAs), which contain two complementary regions that hybridize to one another (self-hybridize) to form a double-stranded (duplex) region referred to as a stem, a single-stranded loop connecting the nucleotides that form the base pair at one end of the duplex, and optionally an overhang, e.g., a 3' overhang.
  • the stem can comprise about 19, 20, or 21 bp long, though shorter and longer stems (e.g., up to about 29 nt) also can be used.
  • the loop can comprise about 1-20, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nt, about 4-10, or about 6-9 nt.
  • the overhang if present, can comprise approximately 1-20 nt or approximately 2-10 nt.
  • the loop can be located at either the 5' or 3' end of the region that is complementary to the target transcript whose inhibition is desired (i.e., the antisense portion of the shRNA).
  • shRNAs contain a single RNA molecule that self-hybridizes
  • the resulting duplex structure can be considered to comprise sense and antisense strands or portions relative to the target mRNA and can thus be considered to be double- stranded.
  • sense and antisense strands, or sense and antisense portions, of an shRNA where the antisense strand or portion is that segment of the molecule that forms or is capable of forming a duplex with and is complementary to the targeted portion of the target polynucleotide, and the sense strand or portion is that segment of the molecule that forms or is capable of forming a duplex with the antisense strand or portion and is substantially identical in sequence to the targeted portion of the target transcript.
  • considerations for selection of the sequence of the antisense strand of an shRNA molecule are similar to those for selection of the sequence of the antisense strand of an siR A molecule that targets the same transcript.
  • the silencing element comprises or encodes an antisense oligonucleotide.
  • An "antisense oligonucleotide” is a single-stranded nucleic acid sequence that is wholly or partially complementary to a target gene, and can be DNA, or its RNA counterpart (i.e., wherein T residues of the DNA are U residues in the RNA counterpart).
  • RNA e.g., mRNA
  • DNA e.g., DNA
  • oligonucleotide that hybridizes to a mRNA molecule can be used to target the mRNA for RnaseH digestion.
  • an oligonucleotide that hybridizes to the translation initiation site of an mRNA molecule can be used to prevent translation of the mRNA.
  • oligonucleotides that bind to double-stranded DNA can be administered. Such oligonucleotides can form a triplex construct and inhibit the transcription of the DNA. Triple helix pairing prevents the double helix from opening sufficiently to allow the binding of polymerases, transcription factors, or regulatory molecules.
  • Such oligonucleotides can be constructed using the base-pairing rules of triple helix formation and the nucleotide sequences of the target genes.
  • antisense oligonucleotides can be targeted to hybridize to the following regions: mRNA cap region, translation initiation site, translational termination site, transcription initiation site, transcription termination site, polyadenylation signal, 3' untranslated region, 5 ' untranslated region, 5 ' coding region, mid coding region, and 3 ' coding region.
  • the complementary oligonucleotide is designed to hybridize to the most unique 5' sequence of a gene, including any of about 15-35 nucleotides spanning the 5' coding sequence.
  • the antisense oligonucleotides in accordance as disclosed herein can comprise from about 10 to about 100 nucleotides, including, but not limited to about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 nucleotides.
  • Antisense nucleic acids can be produced by standard techniques (see, for example, Shewmaker et al, U.S. Pat. No. 5,107,065). Appropriate oligonucleotides can be designed using OLIGO software (Molecular Biology Insights, Inc., Cascade, Colo.).
  • an ROS1 kinase inhibitor resistance mutant gene is targeted by a silencing element.
  • a target gene or target transcript is "targeted" by a silencing element when the introduction or the expression of the silencing element results in the substantially specific reduction or inhibition in the expression of the target gene and target transcript.
  • the specific region of the target gene or target transcript that has substantial sequence identity or similarity or is complementary to the silencing element is the region that has been "targeted" by the silencing element.
  • the region of the ROS 1 kinase inhibitor resistance mutant that is targeted by the silencing element comprises the mutation that confers resistance to at least one ROS1 kinase inhibitor.
  • introduction or expression of the silencing element specifically reduces the level of the ROS1 kinase inhibitor resistance mutant, meaning that the expression level of the native or wild type ROS1 sequence is not affected or minimally affected by the silencing element.
  • the silencing elements employed in any of the methods and compositions disclosed herein can comprise a DNA template for a dsRNA (e.g., shRNA) or antisense RNA or can encode a zinc finger binding protein.
  • a dsRNA e.g., shRNA
  • antisense RNA e.g., can encode a zinc finger binding protein.
  • the DNA molecule encoding the dsRNA, antisense RNA, or zinc finger binding protein is found in an expression cassette.
  • the embodiments disclosed herein further pertain to novel agents identified by the above- described screening assays and uses thereof as described herein.
  • the ROS1 kinase inhibitor resistance mutant specific binding agents can be used in methods for the detection of ROS1 kinase inhibitor resistance mutants and the diagnosis of cancers that are resistant to or are likely to develop resistance to at least one ROS1 kinase inhibitor.
  • the ROS1 kinase inhibitor resistance mutant inhibitors and silencing elements are useful in the treatment of patients having such cancers. It is understood and herein contemplated that diagnosis of the presense of a ROS1 inhibitor resistant cancer can be made before the administration of any treatment regimen.
  • disclosed herein are methods of treating a cancer comprising a ROS1 inhibitor resistant mutation further comprising diagnosisng the subject as having a ROS1 inhibitor resistant cancer prior to the administration of any treatment. It is further understood that the detection or diagnosis can be perfomed using any of the diagnostic or detection methods disclosed herein.
  • a biological sample can comprise any sample in which one desires to detect the polynucleotide encoding a particular ROS1 kinase inhibitor resistance mutant or the mutant polypeptide.
  • biological sample is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject or lysates thereof.
  • the sample may comprise any clinically relevant tissue, such as, but not limited to, bone marrow samples, tumor biopsy, fine needle aspirate, or a sample of bodily fluid, such as, blood, plasma, serum, lymph, ascitic fluid, cystic fluid or urine.
  • tissue such as, but not limited to, bone marrow samples, tumor biopsy, fine needle aspirate, or a sample of bodily fluid, such as, blood, plasma, serum, lymph, ascitic fluid, cystic fluid or urine.
  • the disclosed methods of assaying, detecting, diagnosing, and treating can include a further step of obtaining a tissue sample, including for example DNA, R A, cDNA, proteins, or any tissue that comprises said DNA, RNA, or proteins.
  • Obtaining a tissue sample" or "obtain a tissue sample” means to collect a sample of tissue either from a party having previously harvested the tissue or harvesting directly from a subject. It is understood and herein contemplated that tissue samples obtained directly from the subject can be obtained by any means known in the art including invasive and non-invasive techniques. It is also understood that methods of measurement can be direct or indirect.
  • tissue samples can include but are not limited to tissue biopsy, blood collection, tissue lavage, aspiration, tissue swab, spinal tap, magnetic resonance imaging (MRI), Computed Tomography (CT) scan, Positron Emission Tomography (PET) scan, and X-ray (with and without contrast media).
  • MRI magnetic resonance imaging
  • CT Computed Tomography
  • PET Positron Emission Tomography
  • X-ray X-ray (with and without contrast media).
  • a tissue samples may be any sample containing polynucleotides (polynucleotide targets) of interest and obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
  • the present disclosure further provides methods for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting the biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify a polynucleotide encoding an ROSl inhibitor resistance mutant (e.g., mRNA or genomic DNA), and detecting the polynucleotide that encodes the mutant.
  • the reagent can specifically detect or amplify genomic DNA that encodes the ROSl inhibitor resistance mutant or an RNA transcript that encodes the mutant.
  • a method for detecting a polynucleotide encoding an ROS 1 kinase inhibitor resistance mutant polypeptide or active variants and fragments thereof in a sample comprises contacting the sample with a primer pair capable of specifically amplifying an amplicon of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof, amplifying and then detecting the amplicon.
  • the amplicon is of a sufficient length to specifically detect the polynucleotide encoding the ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof.
  • a method for detecting a polynucleotide encoding an ROSl kinase inhibitor resistance mutant polypeptide or active variants and fragments thereof in a sample comprises contacting the sample with a polynucleotide capable of specifically detecting a polynucleotide encoding an ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof, and detecting the polynucleotide encoding the ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof.
  • the sample is contacted with a polynucleotide probe that hybridizes under stringent hybridization conditions to the target sequences to be detected.
  • the sample and probes are then subjected to stringent hybridization conditions and the hybridization of the probe to the target sequences is detected.
  • a "probe” is an isolated polynucleotide to which is attached a
  • Such a probe is complementary to a strand of a target polynucleotide, which in specific embodiments of the disclosure comprise a polynucleotide encoding an ROSl kinase inhibitor resistance mutant.
  • Deoxyribonucleic acid probes can include those generated by PCR using ROSl kinase inhibitor resistance mutant specific primers, oligonucleotide probes synthesized in vitro, or DNA obtained from bacterial artificial chromosome, fosmid or cosmid libraries.
  • Probes include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that can specifically detect the presence of the target DNA sequence.
  • detection reagents include, but are not limited to radiolabeled probes, enzymatic labeled probes (horse radish peroxidase, alkaline phosphatase), affinity labeled probes (biotin, avidin, or steptavidin), and fluorescent labeled probes (6-FAM, VIC, TAMRA, MGB, fluorescein, rhodamine, texas red [for BAC/fosmids]).
  • enzymatic labeled probes horse radish peroxidase, alkaline phosphatase
  • affinity labeled probes biotin, avidin, or steptavidin
  • fluorescent labeled probes (6-FAM, VIC, TAMRA, MGB, fluorescein, rhodamine,
  • primers are isolated polynucleotides that are annealed to a
  • Primer pairs refer to their use for amplification of a target
  • PCR polymerase chain reaction
  • DNA segments see, U.S. Pat. Nos. 4,683,195 and 4,800,159; herein incorporated by reference).
  • polynucleotide can be used as a probe that hybridizes under stringent conditions to a polynucleotide encoding an ROS 1 kinase inhibitor resistance mutant or the polynucleotide can be used in nucleic acid sequencing techniques to sequence the region comprising the ROSl kinase inhibitor resistance mutant.
  • polynucleotide(s) can be used as a primer to specifically amplify an amplicon of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant.
  • the level or degree of hybridization which allows for the specific detection of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant is sufficient to distinguish the polynucleotide encoding the ROSl kinase inhibitor resistance mutant from a polynucleotide that does not encode the recited polypeptide (e.g., native ROSl; SEQ ID NO:l).
  • Probes and primers are of sufficient nucleotide length to bind to the target DNA sequence and specifically detect and/or amplify a polynucleotide encoding an ROSl kinase inhibitor resistance mutant. It is recognized that the hybridization conditions or reaction conditions can be determined by the operator to achieve this result. This length may be of any length that is of sufficient length to be useful in a detection method of choice.
  • 8, 11, 14, 16, 18, 20, 22, 24, 26, 28, 30, 40, 50, 75, 100, 200, 300, 400, 500, 600, 700 nucleotides or more, or between about 11-20, 20-30, 30-40, 40-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600- 700, 700-800, or more nucleotides in length are used.
  • amplified DNA refers to the product of polynucleotide amplification of a target polynucleotide that is part of a nucleic acid template.
  • the nucleic acid complement of the biological sample may be subjected to a polynucleotide amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to an ROSl kinase inhibitor resistance mutation, and a second primer derived from the 3' flanking sequence adjacent to the ROSl kinase inhibitor resistance mutation to produce an amplicon that is capable of distinguishing the ROSl kinase inhibitor resistance mutant from native or wild-type ROS 1.
  • the amplified polynucleotide can be of any length that allows for the detection of the polynucleotide encoding the ROSl kinase inhibitor resistance mutant.
  • the amplicon can be about 10, 50, 100, 200, 300, 500, 700, 100, 2000, 3000, 4000 nucleotides in length or longer.
  • the length or sequence of the amplified region (amplicon) of the polynucleotide encoding the ROSl kinase inhibitor resistance mutant that allows for the specific detection of the polynucleotide is sufficient to distinguish the polynucleotide encoding the ROSl kinase inhibitor resistance mutant from a polynucleotide that does not encode the recited polypeptide.
  • a member of a primer pair derived from the flanking sequence may be located a distance from the resistance mutation. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs.
  • the use of the term "amplicon" specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
  • PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as the PCR primer analysis tool in
  • the ROS 1 inhibitor resistance mutation can be detected using a variety of nucleic acid techniques known to those of ordinary skill in the art, including but not limited to: nucleic acid sequencing; nucleic acid hybridization; and, nucleic acid amplification.
  • nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing.
  • Chain terminator sequencing uses sequence-specific termination of a DNA synthesis reaction using modified nucleotide substrates. Extension is initiated at a specific site on the template DNA by using a short radioactive, or other labeled, oligonucleotide primer complementary to the template at that region.
  • the oligonucleotide primer is extended using a DNA polymerase, standard four deoxynucleotide bases, and a low concentration of one chain terminating nucleotide, most commonly a di-deoxynucleotide.
  • This reaction is repeated in four separate tubes with each of the bases taking turns as the di-deoxynucleotide.
  • Limited incorporation of the chain terminating nucleotide by the DNA polymerase results in a series of related DNA fragments that are terminated only at positions where that particular di-deoxynucleotide is used.
  • the fragments are size-separated by electrophoresis in a slab polyacrylamide gel or a capillary tube filled with a viscous polymer. The sequence is determined by reading which lane produces a visualized mark from the labeled primer as you scan from the top of the gel to the bottom.
  • Dye terminator sequencing alternatively labels the terminators. Complete sequencing can be performed in a single reaction by labeling each of the di-deoxynucleotide chain- terminators with a separate fluorescent dye, which fluoresces at a different wavelength.
  • the present disclosure further provides methods for assaying a biological sample for an ROSl kinase inhibitor resistance mutation using nucleic acid hybridization techniques.
  • Nucleic acid hybridization includes methods using labeled probes directed against purified DNA, amplified DNA, and fixed cell preparations (fluorescence in situ hybridization).
  • Non-limiting examples of nucleic acid hybridization techniques include the known methods of Southern (DNA:DNA) blot hybridizations, in situ hybridization and FISH of chromosomal material, using appropriate probes.
  • Such nucleic acid probes can be used that comprise nucleotide sequences in proximity to the ROSl kinase inhibitor resistance mutation. By “in proximity to” is intended within about 100 kilobases (kb) of the ROSl kinase inhibitor resistance mutation.
  • ISH In situ hybridization
  • DNA ISH can be used to determine the structure of chromosomes. Sample cells and tissues are usually treated to fix the target transcripts in place and to increase access of the probe. The probe hybridizes to the target sequence at elevated temperature, and then the excess probe is washed away. The probe that was labeled with either radio-, fluorescent- or antigen-labeled bases is localized and quantitated in the tissue using either autoradiography, fluorescence microscopy or immunohistochemistry, respectively.
  • ISH can also use two or more probes, labeled with radioactivity or the other non-radioactive labels, to simultaneously detect two or more transcripts.
  • the ROSl kinase inhibitor resistance mutant is detected using fluorescence in situ hybridization (FISH).
  • Southern blotting can be used to detect specific DNA sequences.
  • DNA that is extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter.
  • the filter bound DNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected.
  • Northern blotting techniques that are known in the art can be used to detect specific RNA sequences that encode an ROS 1 kinase inhibitor resistance mutant.
  • Microarrays can also be used to specifically detect an ROS1 kinase inhibitor resistance polynucleotide.
  • Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA is hybridized to complementary probes on the array and then detected by laser scanning. Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, for example, U.S. Pat. Nos. 6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316, each of which is herein incorporated by reference in its entirety.
  • a polynucleotide that selectively hybridizes to a target polynucleotide encoding an ROS1 kinase inhibitor resistance mutant polypeptide is employed.
  • stringent conditions or “stringent hybridization conditions” when referring to a polynucleotide probe is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing).
  • stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of identity are detected (heterologous probing).
  • a probe is less than about 1000 nucleotides in length or less than 500 nucleotides in length.
  • a substantially identical or complementary sequence is a polynucleotide that specifically hybridizes to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions.
  • stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
  • wash buffers can comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
  • T m 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the
  • T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1°C for each 1% of
  • T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
  • nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), ligase chain reaction (LCR) (Weiss (1991) Science 254: 1292, herein incorporated by reference in its entirety), strand displacement amplification (SDA) (Walker et al. (1992) Proc. Natl. Acad. Sci. USA 89: 392-396; U.S. Pat. Nos. 5,270,184 and 5,455,166, each of which is herein incorporated by reference in its entirety), and nucleic acid sequence based amplification (NASBA).
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription-polymerase chain reaction
  • LCR ligase chain reaction
  • SDA strand displacement amplification
  • NASBA nucleic acid sequence based amplification
  • PCR uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence.
  • One illustrative detection method provides for quantitative evaluation of the amplification process in real-time.
  • Evaluation of an amplification process in "real-time” involves determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initially present in the sample.
  • a variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification are well known in the art. These include methods disclosed in U.S. Pat. Nos. 6,303,305 and 6,541,205, each of which is herein incorporated by reference in its entirety.
  • Amplification products can be detected in real-time through the use of various self- hybridizing probes, most of which have a stem-loop structure.
  • Such self-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence.
  • “molecular torches” are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as “the target binding domain” and “the target closing domain") which are connected by a joining region (e.g., non-nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions.
  • the target binding domain and the target closing domain
  • a joining region e.g., non-nucleotide linker
  • Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS).
  • Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.
  • probe binding pairs having interacting labels such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use in the present invention.
  • Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in the present invention.
  • Additional detection systems include "molecular switches," as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety.
  • Other probes, such as those comprising intercalating dyes and/or fluorochromes are also useful for detection of amplification products in the present invention. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).
  • the methods for detecting an ROSl kinase inhibitor resistance mutant can be used to diagnose a disease associated with aberrant ROSl activity in a subject. Further, agents that inhibit the ROSl kinase inhibitor resistance mutants that have been identified using the screening assays described herein can be used to treat such diseases.
  • Diseases mediated by ROSl activity include, but are not limited to, diseases characterized in part by migration, invasion, proliferation and other biological activities associated with invasive cell growth. Such diseases include cancers.
  • methods for diagnosing the presence of a cancer that is resistant to or likely to develop resistance to at least one ROSl kinase inhibitor in a subject are provided.
  • Such methods can comprise assaying a biological sample from a subject for the presence of an ROSl inhibitor resistance mutation using any of the aforementioned methods, such as detecting the ROS 1 kinase inhibitor resistance mutant polypeptide with a specific binding agent (e.g., antibody) or detecting the ROSl kinase inhibitor resistant mutation using a polynucleotide capable of detecting the same.
  • a specific binding agent e.g., antibody
  • cancer refers to the condition in a subject that is characterized by unregulated cell growth, wherein the cancerous cells are capable of local invasion and/or metastasis to noncontiguous sites.
  • cancer cells cancer cells
  • cancer cells cancer cells
  • cancer cells cancer cells
  • tumor cells cancer cells
  • tumor cells cancer cells that are characterized by this unregulated cell growth and invasive property.
  • cancer encompasses all types of cancers, including, but not limited to, all forms of carcinomas, melanomas, sarcomas, lymphomas and leukemias, including without limitation, cancers of the cardiac system: sarcoma (angiosarcoma, fibrosarcoma,
  • cancers of the lung bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hanlartoma, mesothelioma; cancers of the gastrointestinal system: esophagus (squamous cell carcinoma, adenocarcinoma,

Abstract

Compositions and methods for the diagnosis and treatment of a cancer that is resistant to at least one ROSl kinase inhibitor are provided herein. The disclosures herein are based on the discovery of mutations within ROSl that confer resistance to at least one ROSl kinase inhibitor. Polynucleotides and polypeptides having at least one ROSl inhibitor resistance mutation are provided and find use in methods and compositions useful in the diagnosis, prognosis, and/or treatment of diseases associated with aberrant ROSl activity, more particularly, those that are resistant to at least one ROSl kinase inhibitor. Methods and compositions are also provided for the identification of agents that can inhibit the kinase activity and/or reduce the expression level of the ROSl kinase inhibitor resistance mutants.

Description

METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CANCERS RESISTANT TO ROSl INHIBITORS This Application claims the benefit of U.S. Provisional Application No. 61/800,230, filed on March, 15, 2013, which is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
ROSl (aka ROS) is a receptor tyrosine kinase (RTK). Phylogenic relationship analysis of the kinase domains of all 58 known human RTKs demonstrates that ROSl is a distinct receptor which is distantly related to the Anaplastic Lymphoma Kinase/Leukocyte Tyrosine Kinase
(ALK/LTK) and Insulin Receptor (INSR) families. ROSl is the orphan (i.e., for which a ligand has yet to be determined) vertebrate counterpart of the Drosophila sevenless receptor tyrosine kinase, which when activated by its ligand BOSS (bride of sevenless) is responsible for the differentiation of the R7 photoreceptors in the developing fly compound eye. The functions of mammalian ROSl appear to be largely dispensable given that the only abnormality observed in Rosl-null mice involves infertility of the males due to defective sperm function associated with an inability of the epithelium of the epididymis (where ROSl is expressed) to support spermatocyte differentiation. Other than leukocyte tyrosine kinase (LTK), ROSl is the most highly related receptor tyrosine kinase to ALK.
Oncogenic fusions of the ROSl tyrosine kinase have recently been reported to occur in subsets of several human cancers including non-small cell lung carcinoma (NSCLC), glioblastoma multiforme (GBM) brain tumors, and cholangiocarcinomas (biliary tract tumors). Cancer cells that express ROSl fusions are "addicted" to the aberrant signaling associated with the constitutively active chimeric forms of the kinase for their proliferation and survival. In keeping with this dependence upon abnormal ROSl signaling, preclinical studies have demonstrated ROSl -driven cancers can be exquisitely sensitive to pharmacologic inhibitors of the mutant kinase.
The involvement of mutant, constitutively activated forms of ROSl fusions in this broad spectrum of cancers has engendered considerable interest among pharmaceutical and biotech firms in the development of ROSl inhibitors, analogous to the small-molecule kinase inhibitors
Atlanta #1434408 v1 imatinib (Gleevec, Novartis) and erlotinib (Tarceva, Genentech/OSI) that target the Abelson (ABL) kinase and the epidermal growth factor receptor (EGFR) kinase, respectively. Since 2001, a number of ATP-competitive small-molecule kinase inhibitors (including imatinib and erlotinib among others) have been approved for various cancer indications in the United States (reviewed in Webb et al. (2009) Expert Rev Anticancer Ther 9:331-356). Although these drugs have proven extremely valuable as anticancer agents ~ perhaps best exemplified by the therapeutic benefit realized in patients with chronic myeloid leukemia (CML) and
gastrointestinal stromal tumors (GIST) following administration of imatinib mesylate (Gleevec, Novartis), the use of these inhibitors in the clinic has led to the emergence of drug-resistant tumors (O'Hare et al. (2007) Blood 110:2242-2249; Engelman and Settleman (2008) Curr Opin Genet Dev 18:1-7; Bikker et al. (2009) J Med Chem 52:1493-1509). This resistance has been attributed to a number of mechanisms including the amplification of the gene encoding the oncogenic kinase as well as the activation of alternative signaling pathways; however, one of the more common mechanisms mediating ATP-competitive kinase inhibitor resistance is the development of individual or groups of mutations within or near the kinase catalytic domains of the kinase targets (O'Hare et al. (2007) Blood 110:2242-2249; Engelman and Settleman (2008) Curr Opin Genet Dev 18:1-7; Bikker et al. (2009) J Med Chem 52: 1493-1509). These mutations preclude high-affinity interactions of the inhibitors with their kinase targets while leaving ATP binding by their catalytic domains intact. The emergence of clinical resistance to kinase inhibitors and identification of the kinase domain mutations that confer such resistance have engendered the design and development of follow-on drugs to treat patients whose tumors no longer respond to therapy with first-generation agents
Robust diagnostic assays to detect the presence of resistance mutations in the ROS 1 kinase domain are needed for clinical application to confirm the mechanism of resistance in cancer patients who become resistant to therapy with ROS1 kinase inhibitors, and to permit the informed selection by physicians of second-generation inhibitors for the management of patients with first-generation inhibitor-resistant tumors. No assays for the detection of ROS1 inhibitor resistance currently exist. The identification of these mutations will also serve to guide the informed design and synthesis of second- and later-generation inhibitors of ROS 1 developed to inhibit these mutant forms of ROS 1 that are resistant to first-generation inhibitors.
BRIEF SUMMARY OF THE INVENTION Compositions and methods for the identification, prognosis, diagnosis, and treatment of cancers that are resistant to or are genetically predisposed to be resistant to ROS 1 kinase inhibitors are provided. The present disclosure is based on the discovery of novel mutations in ROSl that confer resistance to ROSl kinase inhibitors, such as XALKORI®. Polypeptides comprising the ROSl inhibitor-resistance mutations and polynucleotides encoding the same are provided and find use as biomarkers for use in methods for detecting the resistance mutations and in diagnosing those cancers that are resistant or likely to develop resistance to ROSl kinase inhibitors. Antibodies that specifically bind ROSl polypeptides comprising the disclosed resistance mutations, kits comprising the antibodies, and kits comprising polynucleotide(s) capable of specifically detecting or specifically amplifying a polynucleotide encoding an ROS 1 having an ROSl inhibitor resistance mutation are also provided herein for the detection of the resistance mutations in biological samples. Further provided are methods for identifying agents that specifically bind to and/or inhibit the activity of ROSl or ROSl oncogenic fusion proteins comprising the resistance mutations.
The following embodiments are disclosed herein:
1. In one aspect, disclosed herein are isolated polynucleotides comprising a nucleotide sequence selected from the group consisting of:
a) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO : 1 comrpising one or more of the amino acid substitutions listed in Table 1 ;
b) a nucleotide sequence encoding an amino acid sequence having at least
90% sequence identity to SEQ ID NOl, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
c) a nucleotide sequence encoding an amino acid sequence having at least
90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
d) a nucleotide sequence encoding an amino acid sequence having at least
90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor;
e) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
f) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
g) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
h) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
i) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
j) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
k) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
1) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
m) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
n) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
o) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
p) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
q) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
r) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
s) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
t) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
u) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
v) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
x) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
y) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
z) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aa) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bb) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
cc) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
dd) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ee) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ff) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
gg) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hh) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ii) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jj) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kk) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
11) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mm) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nn) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
oo) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
pp) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
qq) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an iso leucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
rr) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ss) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
tt) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
uu) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ww) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
xx) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor;
yy) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
zz) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aaa) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an iso leucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bbb) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ccc) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ddd) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
eee) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
fff) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 21 1 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ggg) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hhh) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
iii) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jjj) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kkk) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
111) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mmm) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nnn) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ooo) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; and
ppp) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor.
2. The isolated polynucleotide of any preceding aspect, wherein said polynucleotide further comprises a nucleotide sequence encoding a ROS1 oncogenic fusion protein partner, and wherein said polynucleotide encodes a ROS1 oncogenic fusion protein.
3. The isolated polynucleotide of any preceeding aspect, wherein said ROS1 oncogenic fusion protein partner is selected from the group consisting of fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immunoglobulin- like domains 3 (LRIG3) or others. 4. The isolated polynucleotide of any preceding aspect, wherein said ROS1 small- molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113, X- 396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP-14083, CEP-14513, CEP- 28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126 or others.
5. An expression cassette comprising the isolated polynucleotide of any prededing aspect operably linked to a promoter.
6. A host cell comprising the expression cassette of any preceding aspect.
7. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:
a) the amino acid sequence set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1 ;
b) an amino acid sequence having at least 90% sequence identity to SEQ ID NOl, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS1) small-molecule kinase inhibitor;
c) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
d) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
e) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; f) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
g) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
h) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
i) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
j) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
k) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; 1) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
m) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
n) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
o) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
p) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor;
q) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; r) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
s) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
t) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
u) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
v) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; x) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
y) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
z) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aa) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bb) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
cc) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; dd) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ee) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ff) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
gg) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hh) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ii) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; jj) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kk) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
11) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mm) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nn) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
oo) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; p) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
qq) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
rr) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ss) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
tt) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
uu) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; w) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ww) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
xx) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
yy) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
zz) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aaa) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; bbb) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one OS1 small-molecule kinase inhibitor;
ccc) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ddd) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
eee) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
fff) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ggg) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; hhh) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
iii) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jjj) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kkk) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
111) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mmm) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; nnn) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ooo) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; and
ppp) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor.
8. The isolated polypeptide of any preceding aspect, wherein said polypeptide further comprises an ROS1 oncogenic fusion protein partner, thus forming an ROS1 oncogene fusion protein.
9. The isolated polypeptide of any preceding aspect, wherein said ROS1 oncogenic fusion protein partner is selected from the group consisting of fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immuno globulin-like domains 3 (LRIG3).
10. The isolated polypeptide of any one of preceding aspect, wherein said ROS1 small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113,
X-396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP-14083, CEP-14513, CEP- 28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126.
11. A non-human transgenic animal that has been altered to express an ROS 1 kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS1 small-molecule kinase inhibitor, wherein said ROS1 kinase inhibitor resistance mutant polypeptide has at least one ROS1 kinase inhibitor resistance mutant residue selected from the group consisting of: a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO : 1 ;
f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1;
g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1; p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 ;
u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1;
v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO : 1 ;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1; ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 ;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO : 1 ;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1; tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO : 1 ;
yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ;
zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO : 1 ;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1; iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO : 1 ;
nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and
ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
12. An antibody that specifically binds an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS 1 small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO : 1 ;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1;
f) a valine residue at the position corresponding to amino acid residue position 19 8 of SEQ ID NO: 1; g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO : 1 ;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1;
u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1; v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO : 1 ;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 ;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1; kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO : 1 ;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO : 1 ;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1;
yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1; zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO : 1 ;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1;
nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
13. A kit for detecting a ROSl inhibitor resistance mutation in a biological sample comprising the antibody of an preceding aspect.
14. The kit of any preceding aspect, further comprising chemicals for the detection of antibody binding to ROSl .
15. A kit for detecting an ROSl inhibitor resistance mutation in a biological sample comprising a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO : 1 ;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1;
f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1;
g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1; i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO : 1 ;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO : 1 ;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1;
u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1;
v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1; x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 ;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1 ;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1; mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO : 1 ;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1;
yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ;
zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1; bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO : 1 ;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1;
nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and
ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
16. The kit of embodiment of any preceding aspect, wherein said reagent comprises a pair of primers that amplify an amplicon comprising said ROS1 inhibitor resistance mutation. 17. The kit of any preceding aspect, wherein said reagent comprises at least one probe comprising a polynucleotide sequence that hybridizes under stringent conditions to said ROSl kinase inhibitor resistance mutant polynucleotide and thereby detects the ROSl inhibitor resistance mutation.
18. A method for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting said biological sample with the antibody of any preceding aspectand detecting binding of said antibody to ROSl having the ROSl inhibitor resistance mutation.
19. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with the antibody of any presceding aspect, and detecting binding of said antibody to ROSl having said ROSl inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
20. A method for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1; d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1;
f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1;
g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO : 1 ;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO : 1 ;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1; s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1;
u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1;
v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO : 1 ;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO : 1 ;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 ;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1 ; hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO : 1 ;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1; ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1;
yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ;
zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO : 1 ;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1; 111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1;
nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and
ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
21. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS 1 small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO : 1 ;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1;
f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1; g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO : 1 ;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1;
u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1; v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO : 1 ;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 ;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1; kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO : 1 ;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO : 1 ;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1;
yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1; zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO : 1 ;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1;
nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
and detecting the presence or absence of said ROS 1 inhibitor resistance mutation in said biological sample, wherein the presence of said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor.
22. The method of any preceding aspect, wherein said at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide is capable of specifically detecting or specifically amplifying the polynucleotide of any preceding aspect.
23. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject comprising assaying a biological sample from said subject for the presence of an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds the polypeptide of any one of any preceding aspect; and detecting binding of said antibody to said ROSl oncogenic fusion protein having an ROSl kinase inhibitor resistance mutation; wherein the presence of said ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
24. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject comprising assaying a biological sample from said subject for the presence of a polynucleotide encoding an ROSl oncogenic fusion protein having an ROS 1 inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify the polynucleotide encoding an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, wherein said at least one polynucleotide is capable of specifically detecting or specifically amplifying the polynucleotide according to any preceding aspect; and detecting the presence or absence of said polynucleotide encoding a ROSl oncogenic fusion protein having said ROSl inhibitor resistance mutation in said biological sample; wherein the presence of said polynucleotide encoding said ROSl oncogenic fusion protein having said ROSl inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
25. The method of any preceding aspect, wherein said ROSl small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113 , X-396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP-14083, CEP-14513, CEP-28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126.
26. A method for diagnosing a cancer that is resistant to or likely to develop resistance to XALKORI® in a patient having a cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds a ROSl kinase inhibitor resistance mutant polypeptide that is resistant to XALKORI® , wherein said ROS 1 kinase inhibitor resistance mutant polypeptide has a residue at the position corresponding to amino acid residue position of SEQ ID NO: 1; and detecting binding of said antibody to ROSl having said ROSl kinase inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to XALKORI® .
27. The method of any preceding aspect, wherein said cancer is selected from the group consisting of a large B-cell lymphoma, anaplastic large cell lymphoma (ALCL), malignant histiocytosis, an inflammatory myofibroblastic tumor sarcoma, an esophageal squamous cell carcinoma, a breast cancer, a colorectal carcinoma, a non-small cell lung carcinoma, a neuroblastoma, a bladder cancer, a renal cancer, cholangiocarcinoma, non-small cell lung cancer (NSCLC), and glioblastoma
28. The method of any preceding aspect, further comprising selecting and administering a therapy for said patient.
29. A method of specifically reducing the expression of an ROSl kinase inhibitor resistance mutant that is resistant to at least one ROSl small-molecule kinase inhibitor, said method comprising introducing into a cell expressing said ROSl kinase inhibitor resistance mutant a silencing element that targets a gene encoding said ROSl kinase inhibitor resistance mutant, wherein the introduction or expression of said silencing element specifically reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is the polypeptide of any preceding aspect.
30. A method of treating a cancer associated with aberrant ROSl activity that is resistant to at least one ROSl small-molecule kinase inhibitor, said method comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to said at least one ROSl small-molecule kinase inhibitor, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is the polypeptide of any preceiding aspect.
31. A method of treating a cancer associated with aberrant ROSl activity that is resistant to XALKORl®, said method comprising administering an effective amount of a silencing element that targets a gene encoding an ROS 1 kinase inhibitor resistance mutant that is resistant to XALKORl®, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is a polypeptide comprising any mutant amino acid sequence disclosed herein.
32. The method of any preceding aspect, wherein said cancer is selected from the group consisting of a large B-cell lymphoma, anaplastic large cell lymphoma (ALCL), malignant histiocytosis, an inflammatory myofibroblastic tumor sarcoma, an esophageal squamous cell carcinoma, a breast cancer, a colorectal carcinoma, a non-small cell lung carcinoma, a neuroblastoma, a bladder cancer, a renal cancer, cholangiocarcmoma, non-small cell lung cancer (NSCLC), and glioblastoma.
33. A method of identifying an agent capable of inhibiting the kinase activity of an ROSl kinase inhibitor resistance mutant or ROSl fusion protein comprising:
a) contacting a candidate agent with the polypeptide of any preceding aspect; and,
b) determining whether said candidate agent inhibits the kinase activity of said polypeptide.
34. A method of identifying an agent capable of specifically binding a polypeptide of any preceding aspectcomprising the steps of: a) contacting a candidate agent with said polypeptide of any preceding aspect; and,
b) determining whether said candidate agent specifically binds said polypeptide.
These and other aspects of the invention are disclosed in more detail in the description of the invention given below.
DETAILED DESCRIPTION OF THE INVENTION
COMPOSITIONS
Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular ROS1 inhibitor resistance mutant is disclosed and discussed and a number of modifications that can be made to a number of molecules including the ROS1 are discussed, specifically contemplated is each and every combination and permutation of ROS1 inhibitor resistance mutant and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
Compositions of the immediate disclosure include ROS 1 polypeptides, polynucleotides encoding the same, and variants and fragments thereof that are resistant to ROS1 small-molecule kinase inhibitors. ROS 1 is a member of the insulin receptor superfamily of receptor tyrosine kinases. The ROSl polypeptide is a type I integral membrane protein comprising a single-chain transmembrane protein comprising an extracellular ligand-binding region, a transmembrane- spanning domain, and a cytoplasmic kinase catalytic region. ROSl is encoded by a genomic locus found at the chromosomal band 6q22 in the human, and on the mouse chromosome 10. The ROSl polypeptide is an orphan receptor tyrosine kinase that may function as a growth or differentiation receptor. Additionally, it may be involved in several signaling pathways related to cell differentiation, proliferation, growth, and survival including, but not limited to, PI3 kinase-mTOR signaling, PTPN11 signaling, STAT3 signaling, VAV3 signaling, AKT1 signaling, MAPK1 signaling, MAPK3 signaling, IRS1 signaling, and PLCG2 signaling.
ROSl polynucleotides and polypeptides are known in the art for various species. The genomic sequence for human ROSl is set forth in Genbank accession number NC_000006.11. The coding sequence for human ROSl can be found in Genbank accession number NM 002944 (SEQ ID NO: 2) and and the encoded human ROSl polypeptide can be found at accession number NP 002935 and is set forth in SEQ ID NO : 1.
ROSl is a distinct receptor tyrosine kinase that is distantly related to the anaplastic lymphoma kinase/leukocyte tyrosine kinase (ALK/LTK) and insulin receptor (INSR) families. ROSl is the orphan (i.e., for which a ligand has yet to be determined) vertebrate counterpart of the Drosophila sevenless receptor tyrosine kinase, which when activated by its ligand BOSS (bride of sevenless) is responsible for the differentiation of the R7 photoreceptors in the developing fly compound eye. The functions of mammalian ROSl appear to be largely dispensable given that the only abnormality observed in Rosl-null mice involves infertility of the males due to defective sperm function associated with an inability of the epithelium of the epididymis (where Ros 1 is expressed) to support spermatocyte differentiation; thus, therapeutic inhibition of ROS 1 in patients is not likely to be associated with substantive limiting toxicities.
Recently, an interstitial micro-deletion on chromosome 6q21 that results in a fusion event between a novel gene called FIG (fused in glioblastoma, also known as GOPC for Golgi- associated PDZ and Coiled-coil domains-containing protein) and sequences coding for the intracellular portion of ROSl was discovered in human glioblastoma cell lines. The
experimentally enforced expression of FIG-ROS1 in the central nervous system of genetically engineered adult mice results in the formation of glioblastoma multiforme tumors, confirming the oncogenic activity of this fused kinase. FIG-ROS1 fusions are not restricted to glioblastoma only; in 2011 , this chimeric kinase was shown to be expressed in cholangiocarcinomas (biliary tract cancers) as well, being present in nearly 10% (8.7%, 2 of 23) of a small cohort of primary tumor specimens. Like glioblastoma and non-small cell lung cancer (NSCLC, another malignancy caused by ROSl fusions - vide infra), the prognosis of patients with
cholangiocarcinoma - which is the second most common primary hepatic carcinoma - is quite poor, the median survival being less than two years.
In 2007, two novel ROS 1 fusions were first reported in NSCLC; inter-chromosomal translocations were shown to result in the fusion of the SLC34A2 and CD74 genes to the extracellular juxtamembrane-encoding region of ROSl in both NSCLC cell lines and patient tumors. The fusion of the N-terminal portions of FIG, CD74 and SLC34A2 to the ROSl kinase domain in glioblastoma, cholangiocarcinoma and NSCLC results in constitutive kinase activity that drives tumor growth. Consistent with the role of these ROSl fusions as oncogenic driver mutations, siRNA-mediated downregulation of SLC34A2-ROS1 induces the apoptotic death of human NSCLC cells; similarly, the treatment using a tool ROSl small-molecule inhibitor of cells experimentally rendered tumorigenic by FIG-ROS1 expression is associated with robust tumor cell killing. Recently, several additional oncogenic ROSl fusions have been identified in NSCLC as well; thus, ROSl fusions are clearly recurrent driver mutations and targets for therapy in lung cancers (comprising ~2% of all lung malignancies) as well as other cancers.
ROSl inhibitor therapies are still in relatively early stage but the clinical application of such treatments has already begun. Kinase screening assays have demonstrated that due to the close sequence homology between ROS 1 and ALK, certain ALK inhibitors are also effective ROSl -targeted therapies. For example, XALKORI® (crizotinib, Pfizer) - the small-molecule inhibitor approved in August 2011 by the US FDA for the treatment of patients with ALK-driven NSCLC - exhibits an enzymatic IC50 of 8 nM for MET, 20 nM for ALK, and 62 nM for ROS 1. This ROSl IC50 is within the therapeutic range of the plasma concentration of XALKORI® when administered at the typical dose of 2 0 mg BID determined in clinical trials of the inhibitor, and Pfizer has recently amended a Phase I trial to permit enrollment of ROSl fusion- positive cancer patients and already observed antitumor activity in several such individuals. Other ALK small-molecule inhibitors such as Ariad's AP26113 (which entered Phase I trials in Q3 2011) and Xcovery's X-396 (for which IND filing and Phase I initiation occurred in Q4 2011) are up to 10-fold more potent than XALKORI® against ALK and are also potent ROSl inhibitors. In addition, South Korean investigators have recently reported a highly selective and potent ROSl inhibitor in preclinical development. Furthermore, companies developing Hsp90 small-molecule inhibitors (e.g., Synta Pharmaceuticals and others) are likewise interested in ROSl fusions given that - like ALK fusions - these fused kinases are Hsp90 client proteins, and ROSl fusion-positive malignancies respond in preclinical models to Hsp90 inhibitor therapy similar to the robust responses recently shown to occur in patients with ALK fusion-positive NSCLCs treated with these agents.
Although not quite as common as EGFR or ALK RTK mutations in NSCLC, ROS fusions are clearly recurrent - in a recent study, 2.6% (17/656) of NSCLC specimens were shown to be ROSl fusion-positive by immunohistochemistry and FISH, and ALK and ROSl fusions were never observed in the same tumor. In addition, several independent analyses of tumor specimens have revealed significantly elevated expression of ROSl in 20-30% of NSCLCs, supporting an even broader role for the kinase in lung cancer pathogenesis. Yet additional malignancies may be driven by aberrant ROSl signaling; for instance, high levels of ROSl expression are found in 30-40% of glioblastoma surgical tumors and ROSl mutations have been identified in colorectal and renal carcinoma cell lines. Commercial availability of efficient and reliable diagnostic tests to detect the presence of ROSl fusions in tumors would both greatly facilitate translational research to profile other cancers for these mutations while also providing for a more effective and less costly diagnosis of a particular cancer and enabling more effective and less costly personalized therapy of patients with ROSl fusion-positive tumors using inhibitors of this mutant kinase.
Accordingly, although known ROSl fusions may or may not represent the most common mutation of this tyrosine kinase they remain a significant proportion of tyrosine kinase fusion related cancers the significance of which increases with the identification of additional fusion partners. Such fusions include but are not limited to Fused in glioblastoma (FIG)-ROS 1 , SLC34A2-ROS1, TPM3-ROS1, SDC4-ROS1, EZR-ROS1, LRIG3-ROS1, and CD74-ROS1. These seven fusions have been found in cholangiocarcinoma, non-small cell lung carcinoma (NSCLC), and glioblastomas among other cancers. Therefore, in one aspect, disclosed herein are methods of detection or diagnosis of a disease or condition such as ROSl -related cancer; assessing the susceptibility or risk for developing a disease or condition such as ROSl -related cancer; the monitoring disease progression of a ROS 1 -related cancer; and the determination of susceptibility or resistance to therapeutic treatment ROSl-related cancer in a subject with a cancer comprising detecting the presence of or measuring the amount of ROS 1 am licon in a tissue sample from a subject, wherein the presence of a nucleic acid or an increase in a nucleic acid relative to a control indicated the presence of a ROS 1 related cancer such as a cancer with a ROS1 fusion. As used herein, a "ROS-1 related cancer" refers to any cancer where ROS1 is dysregulated through the presence of a ROS 1 fusion, overexpression, mutation, or other mechanism. Unfortunately, resistance to kinase inhibitors is a very frequent cause of treatment failure; thus, elucidation of the mechanisms of drug resistance is essential to allow optimal clinical management.
A "ROS1 oncogenic fusion" or "ROS1 oncogenic fusion protein" is a polypeptide comprising an amino terminal fusion partner and a fragment of the ROS 1 polypeptide at the carboxy terminus. The fusion of the two proteins results in the constitutive activation of the kinase activity of ROS 1 through oligomerization mediated by an oligomerization domain in the amino terminal fusion partner and subsequent constitutive transmission of growth- promoting/proliferation cellular signals. ROS1 activation causes increased cell growth and proliferation at least partially due to activation of the protein kinase C (PKC), mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) pathways. In addition, activation of ROS 1 enhances cell migration and invasion and promotes anchorage independent growth of cells. In some embodiments, the amino-terminal partner protein is one that is widely expressed in normal cells and its promoter is responsible for the aberrant expression of the encoded fusion protein. Naturally-occurring ROS1 oncogenic fusions are the result of chromosomal translocations and/or aberrations.
As used herein, "ROS1 oncogenic fusion partner" or "ROS1 oncogenic fusion protein partner" refers to the amino-terminal fragment of the ROS 1 oncogenic fusion comprising an oligomerization domain.
Naturally-occurring oncogenic fusion partners are known in the art and include, but are not limited to, fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immunoglobulin-like domains 3 (LRIG3). Table 2 provides accession numbers for the genomic and coding sequences of each ROSl oncogenic fusion partner, along with reference to the coding sequence of the fragment that fuses with ROSl
Figure imgf000060_0001
Approximately two percent of lung tumors, 15-20% of cholangiocarcinomas, and a yet- to-be determined percentage of glioblastomas, have a ROSl oncogenic fusion protein.
Described herein are ROSl mutants that are resistant to ROSl kinase inhibitors, which are also referred to herein as ROSl inhibitor resistance mutants or ROSl kinase inhibitor resistance mutants. ROSl kinase inhibitor resistance mutant polypeptides include the amino acid mutations set forth in Table 1 (mutated ROSl kinase domains); including when said mutation is part of a ROSl fusion fragment (a mutated ROSl fusion fragments). Likewise, ROSl kinase inhibitor resistance mutant polypeptides set forth in Table 1 and variants and fragments thereof.
Table 1. List of substitutions in ROSl inhibitor resistance mutants
Figure imgf000060_0002
1951 Valine 6050 CUG→GUG
1958 Valine 6072 GAA→GUA
1959 Glutamic Acid 6075 GUG→GAG
1961 Lysine 6080 GAA→AAA
1962 Glutamic Acid 6084 GGA→GAA
1981 Methionine 6141 and 6142 ACU→ AUG
1986 Tyrosine 6156 UCC→UAC
1990 Lysine 6167 GAG→AAG
1993 Lysine 6176 GAA→AAA
2000 Valine 6197 CUG→GUG
2002 Asparagine 6204 AGC→AAC
2004 Leucine 6209 or 6211 UUU→UUG/A or
CUU
2008 Histidine 6221 AAC→CAC
2009 Leucine 6224 AUU→CUU
2010 Methionine 6227 CUG→AUG
2011 Asparagine 6232 AAG→AAC/U
2016 Glycine 6245 UGU→GGU
2019 Aspartic Acid or Tyrosine 6254 AAU→G/UAU
2022 Histidine 6265 CAA→CAC/U
2026 Methionine 6275 CUG→AUG
2028 Methionine 6281 CUG→AUG
2029 Lysine 6285 AUG— >AAG
2030 Lysine 6287 GAG→AAG
2032 Arginine 6293 GGA→A/CGA
2033 Glycine 6297 GAC→GGC
2035 Isoleucine 6302 CUU→AUU
2036 Isoleucine or Asparagine 6306 ACA→AA/UU
2039 Glycine, Histidine, Methionine, 6314, 6315, or 6316
Asparagrine, or Serine CGU→G/AGU or C/AAU or AUG
2040 Glutamic Acid or Glutamine 6317 AAA→G/CAA
2052 Serine 6353 or 6354 ACC→AGC or UCC
2059 Proline 6375 CUG→CCG
2077 Proline 6429 CAC→CCC
2078 Tryptophan 6431 AGG→UGG
2087 Isoleucine 6458 GUU→AUU
2091 Asparagine 6470 GAC→AAC
2092 Asparagine 6473 UAU→AAU
2094 Asparagine 6480 AGU→AAU
2098 Isoleucine 6491 and 6493 GUG→AUA/C U
2099 Asparagine 6496 A AG→A AC
2100 Valine 6497 AUU→GUU
2101 Alanine 6501 GGA→GCA
2106 Proline 6515 GCC→CCC
2107 Threonine 6519 AGA→ACA 2116 Threonine 6546 AGA→ACA
2125 Glycine or Leucine 6572 or 6573 GUU→CUU or
GGU
2127 Glycine 6578 UGG→GGG
2131 Aspartic Acid or Lysine 6590 or 6592 GAA→GAC/U or
AAA
2134 Isoleucine 6601 AUG→AUA/C/U
2139 Isoleucine or Serine 6614, 6615, and/or 6616
ACT→AUA/C/U or UCU
2141 Histidine 6622 CAA→CAC/U
2142 Tyrosine 6624 UCU→UAU
2148 Glutamic Acid 6642 GGA→GAA
2151 Asparagine 6651 AUU→AAU
2154 Methionine 6661 AUU→AUG
2160 Histidine 6679 CAG→CAC/U
2165 Aspartic Acid 6692 CAU→GAU
2181 Aspartic Acid 6742 GAG→GAC/U
2184 Threonine 6750 AGA→ACA
2201 Aspartic Acid 6802 GAA→GAC/U
2205 Isoleucine 6813 AGA→AUA
2207 Isoleucine 6819 ACU→AUU
2209 Proline 6825 CAU→CCU
2212 Histidine or Proline 6832 or 6833 CAG→CAC/U or
CCG
Point mutations sequences are shown as mRNA. It is understood that the cDNA or DNA sequence as shown in SEQ ID NO: 2 will show a Thymidine (T) rather than the mRNA Uracil (U). It is further understood that T and U are considered biological equivalents for purposes of the sequence and this table.
A "ROSl kinase inhibitor resistance mutation" or "ROSl inhibitor resistance mutation" is a change in the nucleotide sequence or amino acid sequence of native ROSl that confers resistance of the ROSl polypeptide to at least one ROSl kinase inhibitor. The identified ROSl kinase inhibitor resistance mutations (which are point mutations resulting in a substitution of a single amino acid residue) at both the polynucleotide and polypeptide levels are disclosed in Table 1. It is understood that additional polynucleotide mutations can result in the same amino acid substitution due to codon degeneracy.
Polynucleotides
In one aspect disclosed herein are isolated polynucleotides comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1 comrpising one or more of the amino acid substitutions listed in Table 1 ; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS l) small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS l small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%), 92%,93%, 94%, 95%>, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 >, 92%>,93%, 94%>, 95%>, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%>, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%>,93%, 94%>, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%>, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 201 1 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%), or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%>,93%, 94%>, 95%>, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%), or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%>,93%, 94%>, 95%>,
96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%>, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: I , wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%>, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 ), 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 >, 92%>,93%, 94%>, 95%>, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%>, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%>, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 21 16 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 >, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%), or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91 %, 92%>,93%, 94%>, 95%>, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position
corresponding to amino acid residue position 2201 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%), or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; and a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor. Also disclosed herein are isolated polynucleotides, wherein said polynucleotide further comprises a nucleotide sequence encoding a ROS 1 oncogenic fusion protein partner, and wherein said polynucleotide encodes a ROS 1 oncogenic fusion protein.
Also disclosed herein are isolated polynucleotides comprising a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding the nucleic acid sequence set forth in SEQ ID NO: 2 comprising one or more of the nucleic acid substitutions listed in Table 1; or a nucleotide sequence encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 2 comprising one or more of the nucleotide substitutions listed in Table 1, wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor.
As used herein, the term "polynucleotide" is intended to encompass a singular nucleic acid, as well as plural nucleic acids, and refers to a nucleic acid molecule or construct, e.g. , messenger RNA (mRNA), plasmid DNA (pDNA), cDNA, or short interfering RNA (siRNA). A polynucleotide can be single-stranded or double-stranded, linear or circular and can be comprised of DNA, RNA, or a combination thereof. A polynucleotide can comprise a conventional phosphodiester bond or a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)). The term "nucleic acid" refers to any one or more nucleic acid segments, e.g., UNA or RNA fragments, present in a polynucleotide. The
"polynucleotide" can contain modified nucleic acids, such as phosphorothioate, phosphate, ring atom modified derivatives, and the like. The "polynucleotide" can be a naturally occurring polynucleotide (i.e., one existing in nature without human intervention), a recombinant polynucleotide (i.e., one existing only with human intervention), or a synthetically derived polynucleotide. Specifically contemplated herein are polynucleotides a nucleotide sequence selected from the group consisting of: a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1 or polynucleotides encoding an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1 , wherein the polynucleotide is an isolated cDNA.
Polynucleotides can encode a polypeptide or protein. By "encoding" or "encoded," with respect to a specified nucleic acid, is meant comprising the information for transcription into an RNA and in some embodiments, translation into the specified protein. A nucleic acid encoding a protein can comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or can lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
However, variants of the universal code, such as is present in some plant, animal, and fungal mitochondria, the bacterium Mycoplasma capricolum (Yamao, et al, (1985) Proc. Natl. Acad. Sci. USA 82:2306-9) or the ciliate Macronucleus, can be used when the nucleic acid is expressed using these organisms.
In one aspect, the disclosed isolated polynucleotides can be a component of an expression cassette and expressed in a cell. Accordingly, in one aspect disclosed herein are expression cassettes comprising any isolated polynucleotide disclosed herein operably linked to a promoter. It is understood and herein contemplated that the disclosed expression cassettes comprising any of the ROS1 inhibitor resistant polynucleotides disclosed herein can be incorporated into a cell. Thus, in one aspect, disclosed herein are host cells comprising an expression cassette comprising any of the polynucleotides disclosed herein (for example a polynucleotide having at least 90% sequence identity to SEQ ID NO: 2 or encoding a polypeptide with at least 90% sequence identity to SEQ ID NO: 1, said polynucleotide comprising any of the mutations in Table 1 or disclosed herein.
The ROS1 kinase inhibitor resistance mutant polynucleotides can be found in an expression cassette. The expression cassettes can comprise one or more regulatory sequences that are operably linked to the ROS1 kinase inhibitor resistance mutant polynucleotide that facilitate expression of the polynucleotide. "Regulatory sequences" refer to nucleotide sequences located upstream (5 ' non-coding sequences), within, or downstream (3 ' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. See, for example, Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, California). Regulatory sequences can include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
Regulatory sequences are operably linked with a coding sequence to allow for expression of the polypeptide encoded by the coding sequence. "Operably linked" is intended to mean that the coding sequence is functionally linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. Operably linked elements can be contiguous or noncontiguous. Polynucleotides can be operably linked to regulatory sequences in sense or antisense orientation.
The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the coding polynucleotides can be native/analogous to the cell to which the polynucleotide is being introduced or to each other. Alternatively, the regulatory regions and/or the coding polynucleotides can be heterologous to the cell to which the polynucleotide is being introduced or to each other.
As used herein, "heterologous" in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) or at particular stages of development/differentiation (e.g., development-specific regulatory sequences), or those that are chemically-induced. It will be appreciated by those skilled in the art that the design of the expression cassette can depend on such factors as the choice of the host cell to which the polynucleotide is to be introduced, the level of expression of the polypeptide desired, and the like. Such expression cassettes typically include one or more appropriately positioned sites for restriction enzymes, to facilitate introduction of the nucleic acid into a vector.
It will further be appreciated that appropriate promoter and/or regulatory elements can readily be selected to allow expression of the coding sequence in the cell of interest and at the particular developmental/differentiation state. In some embodiments, a promoter that is recognized by RNA polymerase II can be used.
The regulatory sequences can also be provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus, and Simian Virus 40. For other suitable expression systems for eukaryotic cells, see Chapters 16 and 17 of Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See, Goeddel (1990) in Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, California).
Various constitutive promoters are known. For example, in various embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, rat insulin promoter and glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high-level expression of the coding sequence of interest. The use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art can be used to achieve expression of a coding sequence of interest. Promoters which can be used include, but are not limited to, the long terminal repeat as described in Squinto et al. (1991) Cell 65: 1 20); the SV40 early promoter region (Bemoist and Chambon (1981) Nature 290:304 310), the CMV promoter, the M-MuLV 5' terminal repeat the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al. (1980) Cell 22:187 797), and the herpes thymidine kinase promoter (Wagner et al. (1981) Proc. Natl. Acad. Sci. U.S.A. 78: 144 1445). Inducible promoters are also known. Non-limiting examples of inducible promoters and their inducer include MT II/phorbol Ester (TPA) (Palmiter et al. (1982) Nature 300:611) and heavy metals (Haslinger and Karin (1985) Proc. Nat Ί Acad. Sci. USA. 82:8572; Searle et al.
(1985) Mol. Cell. Biol. 5: 1480; Stuart ef al. (1985) Nature 317:828; Imagawa et al. (1987) Cell 51 :251; Karin et al. (1987) Mo/. Cell Biol. 7:606; Angel et al. (1987) Cell 49:729; McNeall et al.
(1989) Gene 76:8); MMTV (mouse mammary tumor virus)/glucocorticoids (Huang et al. (1981)
Cell 27:245; Lee et al. (1981) Nature 294:228; Majors and Varmus (1983) Proc. Natl Acad. Sci.
USA. 80:5866; Chandler et al. (1983) Cell 33:489; Ponta et al. (1985) Proc. Natl Acad. Sci.
USA. 82: 1020; Sakai et al. (1988) Genes and Dev. 2:1144); p-interferon/poly(rI)X and poly(rc) (Tavernier et al. (1983) Nature 301 :634); adenovirus 5 E2/E1A (Imperiale and Nevins (1984)
Mol. Cell. Biol. 4:875); c-jun/phorbol ester (TPA), H202; collagenase/phorbol ester (TPA)
(Angel et al. (1987) Mol. Cell. Biol. 7:2256); stromelysin/phorbol ester (TPA), IL-1 (Angel et al.
(1987) Cell 49:729); SV40/phorbol ester (TPA) (Angel et al. (1987) Cell 49:729); murine MX gene/interferon, Newcastle disease virus; GRP78 gene/A23187 (Resendez Jr. et al. (1988) Mol. Cell. Biol. 8:4579); a-2-macroglobulin/IL-6; vimentin/serum (Kunz et al. (1989) Nucl. Acids
Res. 17: 1121); MHC class I gene H-2 kB/interferon (Blanar et al. (1989) EMBOJ. 8:1139);
HSP70/ela, SV40 large T antigen (Taylor and Kingston (1990) Mol. Cell. Biol. 10:165; Taylor and Kingston (1990) Mol. Cell. Biol. 10:176; Taylor et al. (1989) J. Biol. Chem. 264: 15160); proliferin/phorbol ester-TPA (Mordacq and Linzer (1989) Genes and Dev. 3:760); tumor necrosis factor/PMA (Hensel et al. (1989) Lymphokine Res. 8:347); thyroid stimulating hormone a gene/thyroid hormone (Chatterjee et al. (1989) Proc. Nat'l Acad. Sci. USA. 86:9114); and, insulin E box/glucose.
A variety of translation control elements are known to those of ordinary skill in the art and can be used in the presently disclosed methods and compositions. These include, but are not limited to, ribosome binding sites, translation initiation and termination codons, and elements derived from picornaviruses (particularly an internal ribosome entry site, or IRES, also referred to as a CITE sequence).
In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors). However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, lentiviruses, and adena-associated viruses). See, for example, U.S. Publication 2005214851, herein incorporated by reference. Retroviral vectors, particularly lentiviral vectors, are transduced by packaging the vectors into virions prior to contact with a cell.
An expression cassette can further comprise a selection marker. As used herein, the term "selection marker" comprises any polynucleotide, which when expressed in a cell allows for the selection of the transformed cell with the vector. For example, a selection marker can confer resistance to a drug, a nutritional requirement, or a cytotoxic drug. A selection marker can also induce a selectable phenotype such as fluorescence or a color deposit. A "positive selection marker" allows a cell expressing the marker to survive against a selective agent and thus confers a positive selection characteristic onto the cell expressing that marker. Positive selection marker/agents include, for example, neo/G418, neo/kanamycin, hyg/hygromycin,
hisD/histidinol, gpt/xanthine, ble leomycin, HPRT/hypoxanthine. Other positive selection markers include DNA sequences encoding membrane-bound polypeptides. Such polypeptides are well known to those skilled in the art and can comprise, for example, a secretory sequence, an extracellular domain, a transmembrane domain and an intracellular domain. When expressed as a positive selection marker, such polypeptides associate with the cell membrane.
Fluorescently labeled antibodies specific for the extracellular domain can then be used in a fluorescence activated cell sorter (FACS) to select for cells expressing the membrane-bound polypeptide. In some of the embodiments wherein the expression cassette further comprises a selectable marker, an internal ribosome entry site, or IRES, also referred to as a CITE sequence can be used to separate the coding sequences of the selectable marker and the polypolypeptide of interest, which allows for simultaneous transcription of the two sequences under the control of the same promoter sequences, but separate translation of the transcripts into polypeptides.
Polypeptides
In another aspect, disclosed herein are isolated polypeptides comprising an amino acid sequence selected from the group consisting of: the amino acid sequence set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NOl, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS 1 ) small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%), or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%), 99.5%o, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%), or 100%) sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1 , wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: I, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO : 1 , and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor; and an amino acid sequence having at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, or 100% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor.
As used herein, the term "polypeptide" or "protein" is intended to encompass a singular "polypeptide" as well as plural "polypeptides," and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term
"polypeptide" refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, "protein," "amino acid chain," or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of "polypeptide," and the term "polypeptide" can be used instead of, or interchangeably with any of these terms. An "isolated" or "puri ied" polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide or protein is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%), 5%, or 1% (by dry weight) of contaminating protein. When the protein of the invention or biologically active portion thereof is recombinantly produced, optimally culture medium represents less than about 30%, 20%>, 10%>, 5%, or 1% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.
Fragments and variants of the polynucleotides encoding the ROSl kinase inhibitor resistance mutant polypeptides and fragments and variants of the polypeptides themselves can be employed in the various methods and compositions of the invention, including biologically active variants and fragments of the ROSl kinase inhibitor resistance mutant polypeptides. Such active variants and fragments will retain a functional kinase domain that is resistant to at least one ROS 1 kinase inhibitor. Methods to assay for kinase activity are known and are described elsewhere herein.
By "fragment" is intended a portion of the polynucleotide and hence the protein encoded thereby or a portion of the polypeptide. Fragments of a polynucleotide can encode protein fragments that retain the biological activity of the ROS 1 kinase inhibitor resistance mutant protein and hence have kinase activity that is resistant to at least one ROSl kinase inhibitor. Thus, fragments of a polynucleotide can range from at least about 10 nucleotides, about 15 nucleotides, about 20 nucleotides, , about 25 nucleotides , about 30 nucleotides , about 35 nucleotides , about 40 nucleotides , about 45 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 125 nucleotides, about 150, about 175 nucleotides, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500 contiguous nucleotides, and up to the full-length polynucleotide encoding the ROS1 kinase inhibitor resistance mutant polypeptide.
A fragment of a polynucleotide that encodes a biologically active portion of an ROS1 kinase inhibitor resistance mutant polypeptide will encode at least about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 125, about 150, about 175, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1600 contiguous amino acids, or up to the total number of amino acids present in a full-length ROS1 kinase inhibitor resistance mutant polypeptide.
A biologically active portion of an ROS1 kinase inhibitor resistance mutant polypeptide can be prepared by isolating a portion of one of the polynucleotides encoding the portion of the ROS1 kinase inhibitor resistance mutant polypeptide and expressing the encoded portion of the polypeptide (e.g., by recombinant expression in vitro), and assessing the activity of the portion of the ROS1 polypeptide. Polynucleotides that encode fragments of an ROS1 kinase inhibitor resistance mutant polypeptide can comprise nucleotide sequences comprising at least 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500 contiguous nucleotides, or up to the number of nucleotides present in a full-length ROS1 kinase inhibitor resistance mutant nucleotide sequence disclosed herein.
"Variant" sequences have a high degree of sequence similarity. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the ROS 1 kinase inhibitor resistance mutant polypeptides. Variants such as these can be identified with the use of well-known molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques. Variant polynucleotides also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis, but which still encode an ROS1 kinase inhibitor resistance mutant polypeptide. Generally, variants of a particular polynucleotide will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein. Thus, specifically disclosed are the isolated
polynucleotides disclosed herein having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity to a polynucleotide encoding SEQ ID NO: 1 comprising one or more of the amino acid substitutions of Table 1.
Variants of a particular polynucleotide can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, variants include, for example, isolated polynucleotides that encode a polypeptide with a given percent sequence identity to the ROS1 polypeptides set forth herein. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described herein. Where any given pair of polynucleotides is evaluated by comparison of the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity. Thus, specifically disclosed are the isolated polypeptides disclosed herein having 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a polypeptide as set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions of Table 1.
By "variant" polypeptide is intended a polypeptide derived from the ROS 1 kinase inhibitor resistance mutant polypeptide by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the polypeptide; deletion or addition of one or more amino acids at one or more sites in the polypeptide; or substitution of one or more amino acids at one or more sites in the polypeptide. Variant ROS1 kinase inhibitor resistance mutant polypeptides are biologically active, that is they continue to have kinase activity that is resistant to at least one ROS 1 kinase inhibitor. Such variants can result from, for example, genetic polymorphism or from human manipulation. Biologically active variants of an ROS1 kinase inhibitor resistance mutant polypeptide will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5% or more sequence identity to the amino acid sequence for the ROSl kinase inhibitor resistance mutant polypeptide as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a polypeptide can differ from that polypeptide by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, 3, 2, or even 1 amino acid residue.
Biologically active variants and fragments of ROS 1 kinase inhibitor resistance mutant polypeptides retain the point mutation responsible for the resistance to at least one ROSl kinase inhibitor. Therefore, variants and fragments of ROSl kinase inhibitor resistance mutant polypeptides comprise at least one of the following amino acid residues:
a glutamine residue at the position corresponding to amino acid residue position 1945 of
SEQ ID NO: 1;
a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1;
a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
a valine residue at the position corresponding to amino acid residue position 19 1 of SEQ ID NO: 1;
a valine residue at the position corresponding to amino acid residue position 1958 of SEQ
ID NO: 1;
a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: l;
a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
a tyrosine residue at the position corresponding to amino acid residue position 1986 of
SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
a valine residue at the position corresponding to amino acid residue position 2000 of SEQ
ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
a methionine residue at the position corresponding to amino acid residue position 2010 of
SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1;
a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1;
an aspartic acid residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
a tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
a histidine residue at the position corresponding to amino acid residue position 2022 of
SEQ ID NO: 1;
a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
an arginine residue at the position corresponding to amino acid residue position 2032 of
SEQ ID NO: 1;
a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1;
a glycine residue at the position corresponding to amino acid residue position 2039 of
SEQ ID NO: 1;
a histidine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
a methionine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
a serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
a glutamic acid residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
a glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: l; a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
a tryptophan residue at the position corresponding to amino acid residue position 2078 of
SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2098 of
SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID O: l;
an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1;
a threonine residue at the position corresponding to amino acid residue position 2107 of
SEQ ID NO: 1;
a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1;
a glycine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1; a leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1;
an aspartic acid residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1;
a lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
a serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
a histidine residue at the position corresponding to amino acid residue position 2141 of
SEQ ID NO: 1;
a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1;
a histidine residue at the position corresponding to amino acid residue position 2160 of
SEQ ID NO: 1;
an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1;
an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2205 of
SEQ ID NO: 1;
an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1;
a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1;
a histidine residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1; and
a proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
Accordingly, in one aspect, disclosed herein are ROS 1 kinase inhibitor resistant mutant polypeptides wherein the polypeptide has the sequence as set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions selected from the group consisting of L1945Q, T1946S, L1947M, R1948S, L1951V, E1958V, V1959E, E1961K, G1962E, T1981M, S1986Y, E1990 , E1993K, L2000V, S2002N, F2004L, N2008H, I2009L, L2010M, K201 IN, C2016G, N2019D, N2019Y, Q2022H, L2026M, L2028M, M2029K, E2030K, G2032R, D2033G, L2035I, T2036I, T2036N, R2039G, , R2039H, R2039M, R2039N, R2039S K2040E, K2040Q, T2052S, L2059P, H2077P, R2078W, V2087I, D2091N, Y2092N, S2094N, V2098I, K2099N, I2100V, G2101A, A2106P, R2107T, R2116T, V2125G, V2125L, W2127G, E2131D, E2131K, M2134I, T2139I, T2139S, Q2141H, S2142Y, G2148E, I2151N, I2154M, Q2160H, H2165D, E2181D, R2184T, E2201D, R2205I, T2207I, H2209P, Q2212H, and Q2212P. Likewise, variant ROS1 kinase inhibitor resistance mutant polynucleotides can be one that encodes such a variant ROS1 kinase inhibitor resistance mutant polypeptide.
As used herein, a "conservative substitution" of an amino acid residue comprises other amino acid residues that are similar in size and/or charge to another amino acid residue. The conservative substitution of the amino acid residue does not encompass amino acid residues that are found at that particular position within the native ROSl sequence (disclosed in SEQ ID NO: 1).
As used herein, an amino acid residue of an ROSl mutant polypeptide at the position corresponding to a particular amino acid residue of native ROSl (SEQ ID NO: 1) refers to the amino acid residue within the ROS 1 mutant polypeptide that appears opposite the amino acid residue at a particular position in the native ROSl sequence when the ROSl mutant sequence is aligned with the native ROSl sequence (SEQ ID NO: 1) for maximum homology using an alignment program, such as one known in the art (e.g., the GAP program in the GCG software package, using either a BLOSUM62 matrix or a PAM250 matrix).
Polypeptides can be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the ROSl kinase inhibitor resistance mutant polypeptides can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the polypeptide of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative substitutions, such as exchanging one amino acid with another having similar properties, can be preferable.
The polynucleotides used in the invention can include naturally occurring sequences as well as those that are synthetically derived or modified. Likewise, the polypeptides used in the methods of the invention encompass naturally occurring polypeptides as well as variations and modified forms thereof. Generally, the mutations made in the polynucleotide encoding the variant polypeptide should not place the sequence out of reading frame, and/or create complementary regions that could produce secondary mRNA structure. See, EP Patent
Application Publication No. 75,444.
The deletions, insertions, and substitutions of the polypeptide sequences encompassed herein are not expected to produce radical changes in the characteristics of the polypeptide. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays.
Variant polynucleotides and polypeptides also encompass sequences and polypeptides derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different ROS 1 kinase inhibitor resistance mutant coding sequences can be manipulated to create a new ROS1 kinase inhibitor resistance mutant polypeptide possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91 : 10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391 :288-291; and U.S. Patent Nos. 5,605,793 and 5,837,458.
As used herein, "sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity can be adjusted upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE
(Intelligenetics, Mountain View, California).
As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
Disclosed herein are novel mutations within ROS1 that confer resistance to ROS1 kinase inhibitors. As used herein, an "ROS1 kinase inhibitor" is a compound that is capable of inhibiting the kinase activity of ROS1 polypeptides. In some embodiments, the ROS1 mutants are resistant to ROS1 small-molecule kinase inhibitors. In general, a small molecule refers to chemical compounds that are not polymers, such as nucleic acids, polypeptides, or
polysaccharides, although the term can encompass small polymers that are capable of readily crossing the cellular membrane.
The kinase activity of ROS1 refers to the ability of ROS1 to phosphorylate tyrosine residues of substrates, either naturally occurring or synthetic, including ROS1 itself and other downstream substrates (e.g., SHC). Upon oligomerization, ROS1 autophosphorylates three ROS1 tyrosine residues, which fully activates the enzyme, allowing ROS1 to phosphorylate additional substrates, such as SHC. ROS 1 kinase inhibitors inhibit the kinase activity of ROS1 polypeptides, meaning that the kinase activity is partially or completely reduced in comparison to the kinase in the absence of the inhibitor compound. In some embodiments, the ROS 1 kinase activity is reduced by the ROS1 kinase inhibitor by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 100% when compared to the activity of the kinase in the absence of the inhibitor.
Methods for assaying the kinase activity of an ROS 1 polypeptide are known in the art and include in vitro kinase assays wherein ROS1 polypeptides are isolated via affinity purification or immunoprecipitation and the autophosphorylation of ROS 1 or the
phosphorylation of a substrate protein or peptide is measured in the presence of ATP. Cell-based assays can also be used wherein ROS1 autophosphorylation or phosphorylation of an ROS1 substrate is determined using immunoblotting or an enzyme-linked immunoassay, for example. Non-limiting examples of methods for analyzing ROS 1 kinase activity can be found in U.S. Application Publication Nos. 2008/0090776, 2009/0099193, and U.S. Provisional Application No. 61/596,720, each which are herein incorporated by reference in its entirety.
ROS 1 kinase inhibitors can bind to the inactive form of ROS 1, wherein the three tyrosine residues in the activation loop are unphosphorylated or to the active, autophosphorylated form of ROS1. The ROS1 kinase inhibitors inhibit both the autophosphorylation of the kinase and the phosphorylation of additional substrates. In order to be clinically useful, many ROS1 kinase inhibitors are fairly specific for ROS1, however, the term ROS1 kinase inhibitor encompasses inhibitors that are also capable of inhibiting other kinases, such as the MET kinase.
Non-limiting examples of ROS 1 kinase inhibitors that are known in the art include XALKORI®, (Zou et al. (2007) Cancer Res 67:4408-4417; Christensen et al. (2007) Mo I Cancer Ther 6:3314-3322; U.S. Application Publication No. 2008/0051419), AP26113, X-396, NVP-TAE684 (Galkin et al. (2007) Proc Natl Acad Sci USA 104 :270-275), staurosporine, 7- hydroxystaurosporine, CEP-14083, CEP-14513, CEP-28122 (Wan et al (2006) Blood 107: 1617- 1623; Piva ei a/. (2006) J C/ζκ Invest 116:3171-31821), pyridone 14 (Li et al. (2006) JMed Chem 49: 1006-1015), pyridone 15, CRL151104A (U.S. Application Publication
No. 2008/0171769), and WZ-5-126 (McDermott et al. (2008) Cancer Res 68:3389-3395), each of which are herein incorporated by reference in its entirety. In specific embodiments, the presently disclosed ROSl kinase inhibitor resistance mutations confer resistance to XALKORI®.
The host cells disclosed herein can also be used to produce nonhuman transgenic animals. For example, in one embodiment, as used herein, a "host cell" is a fertilized oocyte or an embryonic stem cell into which a sequence encoding an ROSl kinase inhibitor resistance mutant polypeptide has been introduced. Such host cells can then be used to create nonhuman transgenic animals in which an exogenous sequence encoding an ROSl kinase inhibitor resistance mutant polypeptide has been introduced into their genome or homologous
recombinant animals. In some embodiments, the ROSl kinase inhibitor resistance mutant is part of an ROSl oncogenic fusion protein. Such animals are useful for screening candidate agents that inhibit the ROS 1 kinase inhibitor resistance mutants using assays described elsewhere herein to identify agents that are capable of inhibiting the presently disclosed ROSl kinase inhibitor resistance mutants or to further validate the ability of novel inhibitors to inhibit the growth of cancer associated with aberrant ROSl activity that is resistant to at least one ROSl kinase inhibitor, thus, in one aspect, disclosed herein are transgenic animals expressing a ROSl kinase inhibitor resistance mutant polypeptide wherein the ROSl kinase inhibitor resistance mutant polypeptide comprises an amino acid substitution relative to SEQ ID NO: 1 selected from the group consisting of L1945Q, T1946S, L1947M, R1948S, L1951V, E1958V, V1959E, E1961K, G1962E, T1981M, S1986Y, E1990 , E1993K, L2000V, S2002N, F2004L, N2008H, I2009L, L2010M, K201 IN, C2016G, N2019D, N2019Y, Q2022H, L2026M, L2028M, M2029K,
E2030 , G2032R, D2033G, L2035I, T2036I, T2036N, R2039G, , R2039H, R2039M, R2039N, R2039S K2040E, K2040Q, T2052S, L2059P, H2077P, R2078W, V2087I, D2091N, Y2092N, S2094N, V2098I, K2099N, I2100V, G2101A, A2106P, R2107T, R2116T, V2125G, V2125L, W2127G, E2131D, E2131 , M2134I, T2139I, T2139S, Q2141H, S2142Y, G2148E, I2151N, I2154M, Q2160H, H2165D, E2181D, R2184T, E2201D, R2205I, T2207I, H2209P, Q2212H, and Q2212P.
Thus, disclosed herein are A non-human transgenic animal that has been altered to express an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROS 1 kinase inhibitor resistance mutant residue selected from the group consisting of: a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1; a methionine residue thereof at the position
corresponding to amino acid residue position 1947 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO : 1 ; a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO : 1 ; a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1; a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1; a lysine residue at the position
corresponding to amino acid residue position 1990 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO : 1 ; a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1 ; an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1; a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1 ; a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1; a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1; an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO : 1 ; a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1; an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1; an iso leucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1; an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1; a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1; a glutamic acid or glutamate residue at the position
corresponding to amino acid residue position 2040 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1; a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1; a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1; an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1; a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1 ; an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1 ; an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1 ; a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1 ; a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO : 1 ; an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1 ; an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
As used herein, a "transgenic animal" is a nonhuman animal, in specific embodiments a mammal, a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include nonhuman primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a "homologous recombinant animal" is a nonhuman animal, in specific embodiments a mammal, in other embodiments a mouse, in which an endogenous ROS1 gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
In one aspect, a transgenic animal can be created by introducing an ROS 1 kinase inhibitor resistance mutant polypeptide encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Such sequences can be introduced as a transgene into the genome of a nonhuman animal. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue- specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the sequence particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866, 4,870,009, and 4,873,191 and in Hogan (1986) Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the ROSl kinase inhibitor resistance mutant protein or the polynucleotide comprising an ROSl kinase inhibitor resistance mutation in its genome and/or expression of mRNA of such sequences in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes.
To create a homologous recombinant animal, one prepares a vector containing at least a portion of a sequence encoding an ROSl kinase inhibitor resistance mutant polypeptide to thereby allow for the expression of an ROSl kinase inhibitor resistance mutant polypeptide. In one embodiment, the homologous recombination vector, the altered portion of the ROS 1 gene is flanked at its 5 ' and 3 ' ends by additional nucleic acids of the ROS 1 gene to allow for homologous recombination to occur between the exogenous ROSl gene carried by the vector and an endogenous ROSl gene in an embryonic stem cell. The additional flanking ROSl nucleic acid is of sufficient length for successful homologous recombination with the
endogenous gene. Typically, several kilobases of flanking DNA (at both the 5' and 3' ends) are included in the vector (see, e.g., Thomas and Capecchi (1987) Cell 51 :503 for a description of homologous recombination vectors). The vector is introduced into an embryonic stem cell line (e.g., by electroporation), and cells in which the introduced ROSl gene has homologously recombined with the endogenous ROSl gene are selected (see, e.g., Li et al. (1992) Cell 69:915). The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see, e.g., Bradley (1987) in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, ed. Robertson (IRL, Oxford pp. 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley (1991) Current Opinion in Bio/Technology 2:823-829 and in PCT Publication Nos. WO 90/11354, WO 91/01140, WO 92/0968, and WO 93/04169.
In another embodiment, transgenic nonhuman animals containing selected systems that allow for regulated expression of the transgene can be produced. One example of such a system is the cre/loxP recombinase system of bacteriophage PI . For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O' Gorman et al. (1991) Science 251 :1351-1355). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.
Clones of the nonhuman transgenic animals described herein can also be produced according to the methods described in Wilmut et al. (1997) Nature 385:810-813 and PCT Publication Nos. WO 97/07668 and WO 97/07669.
Antibodies
In one embodiment, disclosed herein are antibodies that specifically bind to the OS1 kinase inhibitor resistance mutant polypeptides. As discussed herein, these antibodies are referred to as "anti-ROSl kinase inhibitor resistance mutant antibodies". Thus, by "anti-ROSl kinase inhibitor resistance mutant antibodies" is intended antibodies specific for the ROS1 polypeptides and polynucleotides disclosed herein that are resistant to at least one ROS 1 kinase inhibitor. The term also encompasses antibodies that are specific for ROS1 oncogenic fusion proteins comprising an ROS1 polypeptide having an ROS1 inhibitor resistance mutation. The respective antibodies can be used alone or in combination with any of the methods disclosed herein.
In one aspect, disclosed herein are antibodies that specifically binds an ROS1 kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS1 small-molecule kinase inhibitor, wherein said ROS 1 kinase inhibitor resistance mutant polypeptide has at least one ROS 1 kinase inhibitor resistance mutant residue selected from the group consisting of a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO : 1 ; a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 19 1 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1; a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1; a leucine residue at the position
corresponding to amino acid residue position 2004 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1 ; a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 ; a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1; an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1 ; a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO : 1 ; a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1 ; a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1; an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1; an isoleucine or asparagine residue at the position
corresponding to amino acid residue position 2036 of SEQ ID NO: 1; a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1; a glutamic acid or glutamate residue at the position
corresponding to amino acid residue position 2040 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1; a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1 ; a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1 ; an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1; an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1; a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1; an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO : 1 ; an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1 ; an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1; a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 21 1 of SEQ ID NO: 1 ; a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO : 1 ; an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
Antibodies, including monoclonal antibodies (mAbs), can be made by standard protocols.
See, for example, Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999. Briefly, a mammal such as a mouse, hamster or rabbit can be immunized with an immunogenic form of a peptide or a peptide complex. Techniques for conferring
immunogenicity on a protein or peptide include conjugation to carriers or other techniques, well known in the art.
By "antibodies that specifically bind" is intended that the antibodies will not substantially cross react with another polypeptide. By "not substantially cross react" is intended that the antibody or fragment has a binding affinity for a different polypeptide which is less than 10%, less than 5%, or less than 1%, of the binding affinity for the particular ROS1 kinase inhibitor resistance mutant polypeptide.
In specific embodiments, the anti-ROSl kinase inhibitor resistance mutant antibody binds specifically to a particular ROS1 kinase inhibitor resistance mutant polypeptide and reduces the kinase activity of the kinase. Thus, in specific embodiments, the anti-ROSl kinase inhibitor resistance mutant antibody is a ROS1 kinase inhibitor resistance mutant inhibitor.
The anti-ROSl kinase inhibitor resistance mutant antibodies disclosed herein and for use in the methods disclosed herein can be produced using any antibody production method known to those of skill in the art. Thus, polyclonal sera can be prepared by conventional methods. In general, a solution containing the ROSl kinase inhibitor resistance mutant polypeptide or a fragment thereof is first used to immunize a suitable animal, preferably a mouse, rat, rabbit, or goat. Rabbits or goats are preferred for the preparation of polyclonal sera due to the volume of serum obtainable, and the availability of labeled anti-rabbit and anti-goat antibodies.
Polyclonal sera can be prepared in a transgenic animal, preferably a mouse bearing human immunoglobulin loci. In a preferred embodiment, Sf9 {Spodoptera frugiperda) cells expressing the ROSl kinase inhibitor resistance mutant polypeptide or fragment thereof are used as the immunogen. Immunization can also be performed by mixing or emulsifying the antigen- containing solution in saline, preferably in an adjuvant such as Freund's complete adjuvant, and injecting the mixture or emulsion parenterally (generally subcutaneously or intramuscularly). A dose of 50-200 μg/injection is typically sufficient. Immunization is generally boosted 2-6 weeks later with one or more injections of the protein in saline, preferably using Freund's incomplete adjuvant. One may alternatively generate antibodies by in vitro immunization using methods known in the art, which for the purposes of this invention is considered equivalent to in vivo immunization. Polyclonal antisera are obtained by bleeding the immunized animal into a glass or plastic container, incubating the blood at 25°C for one hour, followed by incubating at 4°C for 2-18 hours. The serum is recovered by centrifugation {e.g., 1,000 x g for 10 minutes). About 20-50 ml per bleed can be obtained from rabbits.
Production of the Sf9 cells is disclosed in U.S. Patent No. 6,004,552. Briefly, a sequence encoding the ROSl kinase inhibitor resistance mutant polypeptide is recombined into a baculovirus using transfer vectors. The plasmid is co-transfected with wild-type baculovirus DNA into Sf9 cells. Recombinant baculovirus-infected Sf9 cells are identified and clonally purified.
In some embodiments, the antibody is monoclonal in nature. By "monoclonal antibody" is intended an antibody obtained from a population of substantially homogeneous antibodies, that is, the individual antibodies comprising the population are identical except for possible naturally occurring mutations that can be present in minor amounts. The term is not limited regarding the species or source of the antibody. The term encompasses whole immunoglobulins as well as fragments such as Fab, F(ab')2, Fv, and others which retain the antigen binding function of the antibody. Monoclonal antibodies are highly specific, being directed against a single antigenic site on the target polypeptide. Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milstein (Nature 256:495-97, 1975), or may be made by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567). The "monoclonal antibodies" may also be isolated from phage antibody libraries using the techniques described in, for example, Clackson et al. (Nature 352:624-28, 1991), Marks et al. (J. Mol. Biol. 222:581-97, 1991) and U.S. Patent No. 5,514,548.
By "epitope" is intended the part of an antigenic molecule to which an antibody is produced and to which the antibody will bind. Epitopes can comprise linear amino acid residues (i.e., residues within the epitope are arranged sequentially one after another in a linear fashion), nonlinear amino acid residues (referred to herein as "nonlinear epitopes"- these epitopes are not arranged sequentially), or both linear and nonlinear amino acid residues. For purposes of the presently disclosed subject matter, the epitope that is recognized by the specific anti-ROSl kinase inhibitor resistance mutant antibodies is one that is found in the particular ROS 1 kinase inhibitor resistance mutant and is not present in the native ROS1 polypeptide.
As discussed herein, mAbs can be prepared using the method of Kohler and Milstein, or a modification thereof. Typically, a mouse is immunized with a solution containing an antigen. Immunization can be performed by mixing or emulsifying the antigen-containing solution in saline, preferably in an adjuvant such as Freund's complete adjuvant, and injecting the mixture or emulsion parenterally. Any method of immunization known in the art may be used to obtain the monoclonal antibodies of the invention. After immunization of the animal, the spleen (and optionally, several large lymph nodes) are removed and dissociated into single cells. The spleen cells may be screened by applying a cell suspension to a plate or well coated with the antigen of interest. The B cells expressing membrane bound immunoglobulin specific for the antigen bind to the plate and are not rinsed away. Resulting B cells, or all dissociated spleen cells, are then induced to fuse with myeloma cells to form hybridomas, and are cultured in a selective medium. The resulting cells are plated by serial dilution and are assayed for the production of antibodies that specifically bind the antigen of interest (and that do not bind to unrelated antigens). The selected mAb-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow fiber reactors), or in vivo (as ascites in mice).
Where the anti-ROSl kinase inhibitor resistance mutant antibodies are to be prepared using recombinant DNA methods, the DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g. , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells described herein can serve as a source of such DNA. Once isolated, the DNA can be placed into expression vectors, which are then trans fected into host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. Review articles on recombinant expression in bacteria of DNA encoding an antibody include Skerra (1993) Curr. Opinion in Immunol. 5:256-62; and Phickthun (1992) Immunol. Revs. 130: 151-88. Alternatively, the antibody can be produced in a cell line such as a CHO cell line, as disclosed in U.S. Patent Nos. 5,545,403;
5,545,405 and 5,998,144. Briefly the cell line is transfected with vectors capable of expressing a light chain and a heavy chain, respectively. By transfecting the two proteins on separate vectors, chimeric antibodies can be produced. Another advantage is the correct glycosylation of the antibody.
Additionally, the term "anti-ROSl kinase inhibitor resistance mutant antibody" as used herein encompasses chimeric and humanized anti-ROS 1 kinase inhibitor resistance mutant antibodies. By "chimeric" antibodies is intended antibodies that are most preferably derived using recombinant deoxyribonucleic acid techniques and which comprise both human (including immunologically "related" species, e.g., chimpanzee) and non-human components. Thus, the constant region of the chimeric antibody is most preferably substantially identical to the constant region of a natural human antibody; the variable region of the chimeric antibody is most preferably derived from a non-human source and has the desired antigenic specificity to the ROS1 kinase inhibitor resistance mutant antigen. The non-human source can be any vertebrate source that can be used to generate antibodies to a human ROS1 kinase inhibitor resistance mutant antigen or material comprising a human ROS1 kinase inhibitor resistance mutant antigen. Such non-human sources include, but are not limited to, rodents (e.g., rabbit, rat, mouse, etc.; see, e.g., U.S. Patent No. 4,816,567) and non-human primates (e.g., Old World Monkeys, Apes, etc.; see, e.g., U.S. Patent Nos. 5,750,105 and 5,756,096). As used herein, the phrase
"immunologically active" when used in reference to chimeric/humanized anti-ROSl kinase inhibitor resistance mutant antibodies means chimeric/humanized antibodies that bind a particular ROS 1 kinase inhibitor resistance mutant. In one aspect it is understood that an anti- ROS1 kinase inhibitor resistance mutant antibody binds to an epitope comprising one or more of the ROSl kinase inhibitor resistant amino acid mutations selected from the group consisting of L1945Q, T1946S, L1947M, R1948S, L1951V, E1958V, V1959E, E1961K, G1962E, T1981M, S1986Y, E1990K, E1993 , L2000V, S2002N, F2004L, N2008H, I2009L, L2010M, K2011N, C2016G, N2019D, N2019Y, Q2022H, L2026M, L2028M, M2029 , E2030K, G2032R, D2033G, L2035I, T2036I, T2036N, R2039G, , R2039H, R2039M, R2039N, R2039S K2040E, K2040Q, T2052S, L2059P, H2077P, R2078W, V2087I, D2091N, Y2092N, S2094N, V2098I, K2099N, I2100V, G2101A, A2106P, R2107T, R2116T, V2125G, V2125L, W2127G, E2131D, E2131 , M2134I, T2139I, T2139S, Q2141H, S2142Y, G2148E, I2151N, I2154M, Q2160H, H2165D, E2181D, R2184T, E2201D, R2205I, T2207I, H2209P, Q2212H, and Q2212P.
By "humanized" is intended forms of anti-ROS 1 kinase inhibitor resistance mutant antibodies that contain minimal sequence derived from non-human immunoglobulin sequences. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (also known as complementarity determining region or CDR) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit, or nonhuman primate having the desired specificity, affinity, and capacity. The phrase "complementarity determining region" refers to amino acid sequences which together define the binding affinity and specificity of the natural Fv region of a native immunoglobulin binding site. See, for example, Chothia et al. (1987) J. Mol. Biol. 196:901-17; and abat et al. (U.S. Dept. of Health and Human Services, NIH Publication No. 91-3242, 1991). The phrase "constant region" refers to the portion of the antibody molecule that confers effector functions.
Humanization can be essentially performed following the methods described by Jones et al. (1986) Nature 321 :522-25; Riechmann et al. (1988) Nature 332:323-27; and Verhoeyen et al. (1988) Science 239: 1534-36, by substituting rodent or mutant rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. See also U.S. Patent Nos. 5,225,539; 5,585,089; 5,693,761 ; 5,693,762; and 5,859,205. In some instances, residues within the framework regions of one or more variable regions of the human immunoglobulin are replaced by corresponding non-human residues (see, for example, U.S. Patent Nos. 5,585,089; 5,693,761; 5,693,762; and 6,180,370). Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance (e.g., to obtain desired affinity). In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Accordingly, such "humanized" antibodies may include antibodies wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
Also encompassed by the term "anti-ROSl kinase inhibitor resistance mutant antibodies" are xenogeneic or modified anti-ROSl kinase inhibitor resistance mutant antibodies produced in a non-human mammalian host, more particularly a transgenic mouse, characterized by inactivated endogenous immunoglobulin loci. In such transgenic animals, competent endogenous genes for the expression of light and heavy subunits of host immunoglobulins are rendered non- functional and substituted with the analogous human immunoglobulin loci. These transgenic animals produce human antibodies in the substantial absence of light or heavy host immunoglobulin subunits. See, for example, U.S. Patent Nos. 5,877,397 and 5,939,598.
Preferably, fully human antibodies to a particular ROS1 kinase inhibitor resistance mutant can be obtained by immunizing transgenic mice. One such mouse is disclosed in U.S. Patent Nos. 6,075,181; 6,091,001 ; and 6,114,598.
Fragments of the anti-ROSl kinase inhibitor resistance mutant antibodies are suitable for use in the methods disclosed herein so long as they retain the desired affinity of the full-length antibody. Thus, a fragment of an anti-ROS l kinase inhibitor resistance mutant antibody retains the ability to specifically bind to a particular ROS1 kinase inhibitor resistance mutant polypeptide. Such fragments are characterized by properties similar to the corresponding full- length anti-ROSl kinase inhibitor resistance mutant antibody; that is, the fragments specifically bind a particular ROS 1 kinase inhibitor resistance mutant polypeptide. Such fragments are referred to herein as "antigen-binding" fragments.
Suitable antigen-binding fragments of an antibody comprise a portion of a full-length antibody, generally the antigen-binding or variable region thereof. Examples of antibody fragments include, but are not limited to, Fab, F(ab')2, and Fv fragments and single-chain antibody molecules. By "Fab" is intended a monovalent antigen-binding fragment of an immunoglobulin that is composed of the light chain and part of the heavy chain. By F(ab')2 is intended a bivalent antigen-binding fragment of an immunoglobulin that contains both light chains and part of both heavy chains. By "single-chain Fv" or "sFv" antibody fragments is intended fragments comprising the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. See, for example, U.S. Patent Nos. 4,946,778;
5,260,203; 5,455,030; and 5,856,456. Generally, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains that enables the sFv to form the desired structure for antigen binding. For a review of sFv see Pluckthun (1994) in The Pharmacology of Monoclonal Antibodies, Vol. 113, ed. Rosenburg and Moore (Springer-Verlag, New York), pp. 269-315.
Antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in, for example, McCafferty et al. (1990) Nature 348:552-54; and U.S. Patent No. 5,514,548. Clackson ei a/. (199X) Nature 352:624-28; and Marks et al. (1991) J. Mol. Biol. 222: 81-97 describe the isolation of murine and human antibodies, respectively, using phage libraries. Subsequent publications describe the production of high affinity (nM range) human antibodies by chain shuffling (Marks et al. (1992) Bio/Technology 10:779-83), as well as combinatorial infection and in vivo recombination as a strategy for constructing very large phage libraries (Waterhouse et al. (1993) Nucleic. Acids Res. 21 :2265-66). Thus, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolation of monoclonal antibodies.
Various techniques have been developed for the production of antibody fragments.
Traditionally, these fragments were derived via proteolytic digestion of intact antibodies (see, e.g., Morimoto et al. (1992) J. Biochem. Biophys. Methods 24:107-17; and Brennan et al. (1985) Science 229:81-3). However, these fragments can now be produced directly by recombinant host cells. For example, the antibody fragments can be isolated from the antibody phage libraries discussed above. Alternatively, Fab fragments can be directly recovered from E. coli and chemically coupled to form F(ab')2 fragments (Carter et al. (1992) Bio/Technology 10:163-67). According to another approach, F(ab')2 fragments can be isolated directly from recombinant host cell culture. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner.
Pharmaceutical Compositions
In some embodiments, the ROS1 kinase inhibitor resistance mutant inhibitor or any of the polynucleotides, polypeptides, or antibodies disclosed herein are administered to a subject along with a pharmaceutically acceptable carrier, which is referred to herein as a pharmaceutical composition. As used herein the term "pharmaceutically acceptable carrier" includes solvents, dispersion media, antibacterial and antifungal agents, isotonic agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds also can be incorporated into the compositions.
A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical),
transmucosal, and rectal administration. In addition, it may be desirable to administer a therapeutically effective amount of the pharmaceutical composition locally to an area in need of treatment (e.g., to an area of the body where inhibiting a TR cell function is desired). This can be achieved by, for example, local or regional infusion or perfusion during surgery, topical application, injection, catheter, suppository, or implant (for example, implants formed from porous, non-porous, or gelatinous materials, including membranes, such as sialastic membranes or fibers), and the like. In one embodiment, administration can be by direct injection at the site (or former site) of a cancer that is to be treated. In another embodiment, the therapeutically effective amount of the pharmaceutical composition is delivered in a vesicle, such as liposomes (see, e.g., Langer (1990) Science 249:1527-33; and Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, N.Y., pp. 353-65, 1989).
In yet another embodiment, the therapeutically effective amount of the pharmaceutical composition can be delivered in a controlled release system. In one example, a pump can be used (see, e.g., Langer (1990) Science 249: 1527-33; Sefton (1987) Crit. Rev. Biomed. Eng. 14:201-40; Buchwald et al. (1980) Surgery 88:507-16; Saudek et al. (1989) N. Engl. J. Med. 321 :574-79). In another example, polymeric materials can be used (see, e.g., Levy et al. (1985) Science 228:190-92; During et al. (1989) Ann. Neurol. 25:351-56; Howard et al. (1989) J.
Neurosurg. 71 : 105-12). Other controlled release systems, such as those discussed by Langer (1990) Science 249: 1527-33, can also be used.
Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions
(where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, CREMOPHOR® EL (BASF; Parsippany, NJ), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of
microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride, in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or com starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from a pressurized container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to specific receptors) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
A polynucleotide can be injected directly as naked DNA or RNA, by infection using defective or attenuated retrovirals or other viral vectors, or can be coated with lipids or cell- surface receptors or transfecting agents, encapsulated in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu (1987) J. Biol. Chem. 262:4429-4432) (which can be used to target cell types specifically expressing the receptors) and so on. In another embodiment, polynucleotide-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the polynucleotide to avoid lysosomal degradation. In yet another embodiment, the polynucleotide can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor. Alternatively, the polynucleotide can be introduced
intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies (1989) Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijistra et al. (1989) Nature 342:435-438).
It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated with each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
When administration is for the purpose of treatment, administration may be for either a prophylactic (i.e., preventative) or therapeutic purpose. When provided prophylactically, the substance is provided in advance of any symptom. The prophylactic administration of the substance serves to prevent or attenuate any subsequent symptom. When provided
therapeutically, the substance is provided at (or shortly after) the onset of a symptom. The therapeutic administration of the substance serves to attenuate any actual symptom.
It will be understood by one of skill in the art that the treatment modalities described herein can be used alone or in conjunction with other therapeutic modalities (i.e., as adjuvant therapy), including, but not limited to, surgical therapy, radiotherapy, chemotherapy (e.g., with any chemotherapeutic agent well known in the art) or immunotherapy.
The skilled artisan will appreciate that certain factors can influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
Moreover, treatment of a subject with a therapeutically effective amount of an ROS1 kinase inhibitor resistance mutant inhibitor can include a single treatment or, preferably, can include a series of treatments. It will also be appreciated that the effective dosage of an ROS1 kinase inhibitor resistance mutant inhibitor used for treatment can increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays as described herein.
It is understood that appropriate doses of such active compounds depends upon a number of factors within the knowledge of the ordinarily skilled physician, veterinarian, or researcher.
The dose(s) of the active compounds will vary, for example, depending upon the identity, size, and condition of the subject or sample being treated, further depending upon the route by which the composition is to be administered, if applicable, and the effect which the practitioner desires the active compound to have upon the ROSl kinase inhibitor resistance mutant. Exemplary doses include milligram or microgram amounts of the small molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is furthermore understood that appropriate doses of an active agent depend upon the potency of the active agent with respect to the expression or activity to be modulated. Such appropriate doses may be determined using the assays described herein. When one or more of these small molecules is to be administered to an animal (e.g., a human) in order to reduce the expression level or activity of an ROSl kinase inhibitor resistance mutant, a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained. In addition, it is understood that the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
Therapeutically effective amounts of an ROSl kinase inhibitor resistance mutant inhibitor can be determined by animal studies. When animal assays are used, a dosage is administered to provide a target tissue concentration similar to that which has been shown to be effective in the animal assays. It is recognized that the method of treatment can comprise a single administration of a therapeutically effective amount or multiple administrations of a therapeutically effective amount of the ROS 1 kinase inhibitor resistance mutant inhibitor.
Any delivery system or treatment regimen that effectively achieves the desired effect of inhibiting cell growth can be used. Thus, for example, formulations comprising an effective amount of a pharmaceutical composition comprising ROS 1 kinase inhibitor resistance mutant inhibitor or ROSl kinase inhibitor resistance mutant specific binding agents can be used for the purpose of treatment, prevention, and diagnosis of a number of clinical indications related to the activity of the ROSl kinase inhibitor resistance mutant.
Kits
Agents that can be used to specifically detect a presently disclosed ROSl kinase inhibitor resistance mutant can be provided in a kit. As used herein, "kit" refers to a set of reagents for the identification, the detection, and/or the quantification of the polynucleotide encoding an ROS l kinase inhibitor resistance mutant polypeptide or detection and/or quantitation of the ROS l kinase inhibitor resistance mutant polypeptide in biological samples. The terms "kit" and "system," as used herein are intended to refer to at least one or more detection reagents which, in specific embodiments, are in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages, such as packaging intended for commercial sale, substrates to which detection reagents are attached, electronic hardware components, instructions of use, and the like). Accordingly, in one aspect, disclosed herein are ROS l kinase inhibitor resistance mutant detection kits and systems, including but not limited to, packaged probe and primer sets (e.g., TaqMan probe/primer sets), antibodies, arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more ROS 1 kinase inhibitor resistance mutant. For example, disclosed herein are kits for detecting a ROS l inhibitor resistance mutation in a biological sample comprising any of the antibodies that specifically binds an ROS l kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small- molecule kinase inhibitor disclosed herein.
In one aspect, disclosed herein are kits for detecting an ROSl inhibitor resistance mutation in a biological sample comprising a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROS l kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROS l kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROS l small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROS l kinase inhibitor resistance mutant residue selected from the group consisting of: a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1 ;a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1 ; a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1 ; a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1 ; a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1 ; a valine residue at the position corresponding to amino acid residue position 19 8 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1; a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO : 1 ; a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1 ; an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1; a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1; a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO : 1 ; an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1 ; a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1 ; an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1; a glycine residue at the position
corresponding to amino acid residue position 2033 of SEQ ID NO: 1; an iso leucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1 ; an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1; a glycine, histidine, methionine, asparagrine, or serine residue at the position
corresponding to amino acid residue position 2039 of SEQ ID NO: 1; a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1; a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1; a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1; a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1; an iso leucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1 ; an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1 ; a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1; an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1; a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1; a glycine or leucine residue at the position
corresponding to amino acid residue position 2125 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO : 1 ; an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1 ; an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1; an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1; a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1 ; a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1 ; an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1; an iso leucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1 ; an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1 ; and a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
The kits/systems can optionally include various electronic hardware components. For example, arrays (e.g., DNA chips) and micro fluidic systems (e.g., lab-on-a-chip systems) provided by various manufacturers typically include hardware components. Other kits/systems (e.g., probe/primer sets) may not include electronic hardware components, but can include, for example, one or more ROS1 kinase inhibitor resistance mutant detection reagents along with other biochemical reagents packaged in one or more containers.
In some embodiments, an ROS1 kinase inhibitor resistance mutant detection kit typically contains one or more detection reagents and other components (e.g., a buffer, enzymes, such as DNA polymerases or ligases, chain extension nucleotides, such as deoxynucleotide
triphosphates, positive control sequences, negative control sequences, and the like) necessary to carry out an assay or reaction, such as amplification and/or detection of a polynucleotide comprising an ROS1 kinase inhibitor resistance mutation. A kit can further contain means for determining the amount of the target polynucleotide and means for comparing with an appropriate standard, and can include instructions for using the kit to detect the ROS1 kinase inhibitor resistance mutation, such as, for example, the amino acid substitutions disclosed in Table 1. In one embodiment, kits are provided which contain the necessary reagents to carry out one or more assays to detect one or more of the ROS1 kinase inhibitor resistance mutations as disclosed herein. The ROS 1 kinase inhibitor resistance mutation detection kits/systems can contain, for example, one or more probes, or pairs of probes, that hybridize to a nucleic acid molecule at or near the ROS 1 kinase inhibitor resistance mutation, such as, for eample, the amino acid substitutions of SEQ ID NO: 1 disclosed in Table 1. In one aspect, the primers and probes can specifically hybridize to any of the polynucleotides disclosed herein. For example, the disclosed primers and probes can specifically hybridize to a polynucleotide comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, or 99.5% or more sequence identity to SEQ ID NO 2, wherein the polynucleotide comprises one or more of the nucleotide substitions disclosed in Table 1 or encodes one of the polynucleotide substitutions disclosed in Table 1.
In specific embodiments, the kit comprises a first and a second primer, wherein the first and second primer amplify an amplicon comprising an ROS 1 inhibitor resistance mutation, such as the mutations listed in Table 1. In other embodiments, the kit comprises at least one probe comprising a polynucleotide sequence that hybridizes under stringent conditions to a
polynucleotide encoding an ROSl having an inhibitor resistance mutation.
Kits can also be used to detect an ROS l inhibitor resistance mutant polypeptide. In these embodiments, kits comprise an agent that specifically binds an ROS 1 kinase inhibitor resistance mutant polypeptide, such as an antibody, in combination with one or more other types of elements or components (e.g., other types of biochemical reagents, containers, packages, such as packaging intended for commercial sale, electronic hardware components, wash reagents, reagents/chemical capable of detecting the presence of bounds specific binding agents, such as antibodies, of the kit).
In specific embodiments, the kit comprises a compartmentalized kit and includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow one to efficiently transfer reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers can include a container which will accept the test sample, a container which contains the antibodies or probes used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the reagents used to detect the bound antibody or the hybridized probe. Any detection reagents known in the art can be used including, but not limited to those described supra.
METHODS OF SCREENING
In one aspect, disclosed herein are methods (also referred to herein as a "screening assay") for identifying specific binding agents and/or inhibitors of a particular presently disclosed ROSl kinase inhibitor resistance mutant. As discussed herein, identification of1 ROS1 kinase inhibitor resistance mutant polypeptide binding agents are of interest, including ROS1 kinase inhibitor resistance mutant specific binding agents and ROS1 kinase inhibitor resistance mutant inhibitors.
Screening methods for ROS1 kinase inhibitor resistance mutant binding agents or ROS1 kinase inhibitor resistance mutant inhibitors involve determining if a test compound can bind, specifically or non-specifically, to an ROS1 kinase inhibitor resistance mutant and/or determining if the test compound can reduce the kinase activity of the particular ROS1 kinase inhibitor resistance mutant. In one aspect, disclosed herein are methods of identifying an agent capable of inhibiting the kinase activity of an ROS1 kinase inhibitor resistance mutant or ROS1 fusion protein comprising contacting a candidate agent with any polypeptide disclosed herein; and, determining whether said candidate agent inhibits the kinase activity of said polypeptide. Also disclosed are methods of identifying an agent capable of specifically binding any of the polypeptides disclosed herein comprising the steps of contacting a candidate agent with said polypeptide; and, determining whether said candidate agent specifically binds said polypeptide.
The candidate agents employed in the various screening assays can include any compound including, for example, peptides, peptidomimetics, polynucleotides, small molecules, antibodies, or other drugs. In certain embodiments, the candidate agents are small molecules. Such candidate agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, nonpeptide oligomer, or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91 :11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678; Cho et al. {1993) Science 261 : 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem. 37:1233.
Known pharmacological agents and even known ROS1 inhibitors can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification to produce structural analogs that can be tested for the ability to inhibit the kinase activity of at least one of the ROSl kinase inhibitor resistance mutants. Alternatively, candidate agents can be derived from any organism, including bacteria, fungi, plants, or animals.
Libraries of compounds can be presented in solution (e.g., Houghten (1992)
Bio/Techniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (U.S. Patent No. 5,223,409), spores (U.S. Patent Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89:1865- 1869), or phage (Scott and Smith (1990) Science 249:386-390; Devlin (1990) Science 249:404- 406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici (1991) J. Mol. Biol. 222:301-310).
Determining the ability of the candidate agent to bind to the particular ROS 1 kinase inhibitor resistance mutant can be accomplished, for example, by coupling the candidate agent with a radioisotope or enzymatic label such that binding of the candidate agent to the ROSl kinase inhibitor resistance mutant polypeptide can be determined by detecting the labeled agent in a complex. For example, candidate agents can be labeled with 1251, 3 S, 14C, or 3H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, candidate agents can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
In one embodiment, an assay to identify specific binding agents for an ROSl kinase inhibitor resistance mutant is a cell-free assay comprising contacting an ROS 1 kinase inhibitor resistance mutant polypeptide with a candidate agent and determining the ability of the candidate agent to bind to the ROSl kinase inhibitor resistance mutant polypeptide. Binding of the candidate agent to the ROSl kinase inhibitor resistance mutant polypeptide can be determined either directly or indirectly. An indirect assay could include assaying for a reduction in ROS 1 kinase activity (e.g., phosphorylation of ROSl substrates).
In some assays, it may be desirable to immobilize either the ROSl kinase inhibitor resistance mutant or the candidate agent to facilitate automation of the assay. In one
embodiment, the ROSl kinase inhibitor resistance mutant can be immunoprecipitated from a cellular lysate, wherein the complex is bound to a matrix (e.g., beads). In another embodiment, a fusion protein can be provided that adds a domain to the candidate agent or the ROSl kinase inhibitor resistance mutant polypeptide that allows the candidate agent or the ROSl kinase inhibitor resistance mutant to be bound to a matrix. For example, ROS 1 kinase inhibitor resistance mutant polypeptides comprising a glutathione-S-transferase/ROSl kinase inhibitor resistance mutant fusion protein can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione-derivatized microtitre plates, which are then combined with the candidate agent, and the mixture incubated under conditions conducive to complex formation between the candidate agent and the ROSl kinase inhibitor resistance mutant (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components and complex formation of the candidate agent and ROSl kinase inhibitor resistance mutant polypeptide is measured either directly or indirectly, for example, as described above.
Other techniques for immobilizing proteins on matrices can also be used in the screening assays. For example, either the ROSl kinase inhibitor resistance mutant polypeptide or the candidate agent can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated ROSl kinase inhibitor resistance mutants or candidate agents can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated plates (Pierce Chemicals).
In yet another aspect, the ROS 1 kinase inhibitor resistance mutant polypeptides can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Barrel et al. (1993) Bio/Techniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and PCT Publication No. WO 94/10300), to identify other proteins, which bind to or interact with the ROSl kinase inhibitor resistance mutant polypeptide and, in some embodiments, inhibit ROSl kinase inhibitor resistance mutant kinase activity.
In embodiments wherein candidate agents that specifically bind ROSl inhibitor resistance mutants are desired, the ROSl inhibitor resistance mutant can be in either an active or inactive state when contacted with the candidate agent. An active state is one wherein the three tyrosine residues (tyrosines 1278, 1282, and 1283 of full-length ROSl) within the activation domain are phosphorylated. Conversely, an inactive state is one wherein the activation domain tyrosine residues are not phosphorylated and the activation domain is in its closed conformation. In those embodiments wherein an ROSl kinase inhibitor resistance mutant inhibitor is desired, the assay comprises contacting the ROSl kinase inhibitor resistance mutant polypeptide with a candidate agent and determining the ability of the candidate agent to reduce or completely inhibit the kinase activity of the ROSl kinase inhibitor resistance mutant. Determining the ability of the candidate agent to inhibit the activity of an ROSl kinase inhibitor resistance mutant can be accomplished, for example, by determining the ability of the ROSl kinase inhibitor resistance mutant to phosphorylate ROSl substrates or to autophosphorylate in the presence of the test compound. Methods for assaying the kinase activity of an ROSl kinase inhibitor resistance mutant are discussed elsewhere herein, and include in vitro kinase assays wherein ROSl polypeptides are isolated via affinity purification or immunoprecipitation and the autophosphorylation of ROSl or the phosphorylation of a substrate protein or peptide is measured in the presence of ATP.
Similar to screening assays for specific binders, the ROSl kinase inhibitor resistance mutant can be in an active or inactivate state when contacted with the candidate agent in screens for inhibitors of the resistance mutant. Inhibitors that bind to ROSl in the inactive state are particularly desirable because the structure of the kinase domain of receptor tyrosine kinases when inactive is generally more unique than the conformation of the activated kinase. In those embodiments wherein the ROSl kinase inhibitor resistance mutant is contacted with the candidate agent in the inactive state, the kinase is activated prior to testing the effect of the candidate agent on the kinase activity. ROSl inhibitor resistance mutants can be activated through the addition of a ligand (e.g., pleiotropin, midkine) in those instances wherein the ROSl mutant polypeptide comprises the ligand binding domain. Alternatively, the ROSl kinase inhibitor resistance mutant polypeptide can comprise the cytoplasmic domain (e.g., amino acids 1058-1620) of the kinase comprising the kinase domain along with domains necessary for interacting with downstream effectors, fused to an inducible dimerization or oligomerization domain. An inducible dimerization domain or inducible oligomerization domain is a polypeptide sequence that can be stimulated to dimerize or oligomerize in the presence of a dimerized or oligomerized ligand. A non-limiting example of an inducible dimerization domain is one comprising at least one FKBP12 polypeptide that can be dimerized through the addition of the cell-permeable synthetic dimerized ligand FK1012 (Spencer et al. (1993) Science 262:989, which is herein incorporated by reference in its entirety). Upon dimerization or oligomerization, the ROS1 kinase inhibitor resistance mutant-inducible dimerization/oligomerization domain fusion protein becomes activated.
Cell-based assays can also be used to measure ROS1 kinase activity wherein ROS1 autophosphorylation or phosphorylation of an ROS1 substrate is determined using
immunoblotting or an enzyme-linked immunoassay, for example. The inhibition of ROS1 kinase activity can also be assessed indirectly with cell-based assays. In such embodiments, the ROS1 kinase inhibitor resistance mutant is expressed in a eukaryotic cell (either endogenously or exogenously wherein the sequence is introduced via transformation, for example). If the full- length ROS1 kinase inhibitor resistance mutant polypeptide is used for such experiments, an activating ligand is added to the culture. In other embodiments, the ROS1 kinase inhibitor resistance mutant is a constitutively active ROS1 kinase inhibitor resistance mutant-oncogenic fusion protein. In yet other embodiments, the ROS1 kinase inhibitor resistance mutant polypeptide comprises the cytoplasmic domain (e.g., amino acids 1058-1620) fused to an inducible dimerization or oligomerization domain and the fusion protein is activated through the addition of a cell-permeable dimerized or oligomerized ligand (Spencer et al. (1993) Science 262:989). Activation of ROS1 leads to the stimulation of cell proliferation, cell survival, promotion of anchorage-independent growth, and cellular migration and invasion. Therefore, candidate agents that inhibit the kinase activity of an ROS 1 kinase inhibitor resistance mutant can be selected based on the ability of the candidate agent to inhibit cell growth, stimulate cell death, inhibit anchorage-independent growth, and/or inhibit cell migration or invasion of cells expressing the activated ROS1 kinase inhibitor resistance mutant.
As used herein, "cell growth" refers to cell proliferation, cell division, or progression through the cell cycle. "Cell death" includes both apoptosis and necrosis. Such cell-based assays are known in the art (von Bubnoff et al. (2005) Blood 105:1652-1659; von Bubnoff et al. (2006) Blood 108: 1328-1333; Kancha et al. (2009) Clin Cancer Res 15:460-467; von Bubnoff et al. (2009) Cancer Res 69:3032-3041; von Bubnoff et al. (2005) Cell Cycle 4:400-406; each of which is herein incorporated by reference in its entirety) and described elsewhere herein.
Any method known in the art can be used to measure the growth rate of a cell or an effect on cell survival, including, but not limited to, optical density (OD60o ), CO2 production, O2 consumption, assays that measure mitochondrial function, such as those utilizing tetrazolium salts (e.g., MTT, XTT), or other colorimetric reagents (e.g., the WST-1 reagent available from Roche), assays that measure or estimate DNA content, including, but not limited to fluoremetric assays such as those utilizing the fluorescent dye Hoechst 33258, assays that measure or estimate protein content, including, but not limited to, the sulforhodamine B (SRB) assay, manual or automated cell counts (with or without the Trypan Blue stain to distinguish live cells), and clonogenic assays with manual or automated colony counts. Non-limiting examples of assays that can be used to measure levels of apoptosis include, but are not limited to, measurement of DNA fragmentation, caspase activation assays, TUNEL staining, annexin V staining.
"Anchorage-independent growth" refers to, in contrast to adherent normal cells that must adhere to the extracellular matrix (anchorage) for their survival and growth, the general essential property of cancer cells capable of growing even without such an anchorage. Methods for measuring the anchorage dependence of cells are known in the art and include growing the cells in a soft agar medium or culturing cells under conditions in which spheroids (cell aggregates) can form. Such assays are described in U.S. Patent Application Publication Nos. 2008/0090776 and 2009/0099193.
"Cell migration" refers to the movement of cells, which in some embodiments can be towards a target (e.g., growth factors), which is also referred to as chemotaxis. "Cell invasion" refers to cellular movement through a matrix, such as the extracellular matrix. Methods are known in the art to measure cell migration and invasion, including transwell assays, wherein the movement of cells from one chamber to a second chamber is measured through quantitation of the number of cells in the second chamber. In variations of this assay, a chemoattractant is provided in the second chamber and/or the chambers are separated by a matrix comprising various components of the extracellular matrix (e.g., collagen).
Other assays that can be used to screen for an inhibitor of an ROS1 kinase inhibitor resistance mutant include the use of in vivo animal models (e.g., xenografts) for a cancer associated with aberrant ROS 1 activity that express an ROS 1 kinase inhibitor resistance mutant. The non-human animal model can be, for example, a mouse (e.g., nude mouse), rat, or hamster. Cancer cells endogenously expressing an ROS1 kinase inhibitor resistance mutant polypeptide or cells transformed by the expression of the ROS1 kinase inhibitor resistance mutant can be transplanted subcutaneously, intradermally, or intraperitoneally or into each organ. A non- human transgenic animal that has been genetically engineered to express an ROS1 kinase inhibitor resistance mutant-oncogenic fusion protein, such as those described elsewhere herein, can also be used. The ability of a candidate agent to inhibit ROSl kinase activity can be confirmed by administering the candidate agent by a variety of administration methods, such as oral, intravenous, subcutaneous, and intraperitoneal administrations and measuring the volume or weight of the tumor of the animal model or progression of the disease. Such methods are known in the art and are described in U.S. Patent Application Publication Nos. 2008/0090776 and 2009/0099193.
In some embodiments, screening assays for agents that inhibit the kinase activity of an ROSl kinase inhibitor resistance mutant include screening for agents that specifically reduce the expression of a presently disclosed ROSl kinase inhibitor resistance mutant or ROSl kinase inhibitor resistance mutant-oncogenic fusion protein. By "reduces" or "reducing" the expression level of a polynucleotide or a polypeptide encoded thereby is intended to mean, the
polynucleotide or polypeptide level of the ROSl kinase inhibitor resistance mutant is statistically lower than the polynucleotide level or polypeptide level of the same target sequence in an appropriate control which is not exposed to the silencing element. In particular embodiments, reducing the polynucleotide level and/or the polypeptide level of the target sequence according to the presently disclosed subject matter results in less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%), less than 20%, less than 10%, or less than 5% of the polynucleotide level, or the level of the polypeptide encoded thereby, of the same target sequence in an appropriate control. Methods to assay for the level of the R A transcript, the level of the encoded polypeptide, or the activity of the polynucleotide or polypeptide are discussed elsewhere herein.
METHODS OF TREATING
Thus, the present disclosure further provides methods and compositions to reduce the level of expression of an ROS 1 kinase inhibitor resistance mutant by introducing into a cell expressing the ROSl kinase inhibitor resistance mutant a silencing element that reduces or eliminates the level of expression of an ROSl kinase inhibitor resistance mutant target polynucleotide or the polypeptide encoded thereby upon introduction or expression of the silencing element. Further, methods for screening candidate agents for those that specifically reduce ROS 1 kinase inhibitor resistance mutant expression include introducing into a cell expressing the ROSl kinase inhibitor resistance mutant the candidate agent (e.g., silencing element) and determining the level of expression of the ROSl kinase inhibitor resistance mutant. The expression of the ROSl kinase inhibitor resistance mutant can be inhibited by any means known in the art, including the introduction of polypeptides that inhibit the expression of the ROSl kinase inhibitor resistance mutant, the introduction of nucleotide sequences comprising silencing elements that encode polynucleotides useful for transposon insertion into the ROSl mutant gene, homologous recombination/genetic knock-out of the ROSl mutant gene, silencing elements that encode zinc finger proteins that bind to an ROSl mutant gene and reduce its expression, silencing elements that encode antisense oligonucleotides or dsRNA molecules (e.g., shRNA, siRNA), or nucleotide sequences that encode antibodies or other polypeptides that inhibit Nrl expression or activity.
Accordingly, in one aspect, disclosed are methods of treating a cancer associated with aberrant ROSl activity that is resistant to at least one ROSl small-molecule kinase inhibitor, said method comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to said at least one ROSl small-molecule kinase inhibitor, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is the polypeptide of any preceiding aspect. For example, disclosed herein are methods of treating a cancer associated with aberrant ROS 1 activity that is resistant to XALKORI®, said method comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to XALKORI®, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is a polypeptide comprising any mutant amino acid sequence disclosed herein.
The ROSl kinase inhibitor resistance mutant inhibitors that are identified through the methods disclosed herein can be used in the treatment of cancers having an ROSl kinase inhibitor resistance mutation. Additionally, agents that reduce the expression of ROSl kinase inhibitor resistance mutants (e.g., silencing elements) can be used to treat cancers having an ROSl kinase inhibitor resistance mutation.
As used herein, "treatment" is an approach for obtaining beneficial or desired clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, partial or complete restoration of eyesight (e.g., central vision, visual acuity), diminishment of extent of the disorder, stabilized (i.e., not worsening) state of the disorder (e.g., degeneration of cone photoreceptors), delaying or slowing of progression of the disorder, amelioration or palliation of the disorder, and prevention of, inhibition of, or reduction of risk of developing a retinal disorder. "Treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder (to prevent further degeneration) as well as those in which the disorder is to be prevented. "Palliating" a disorder means that the extent and/or undesirable clinical manifestations of the disorder are lessened and/or the time course of the progression is slowed or lengthened, as compared to a situation without treatment.
In one embodiment, the silencing element encodes a zinc finger protein that binds to an OS1 kinase inhibitor resistance mutant gene, resulting in reduced expression of the gene. In particular embodiments, the zinc finger protein binds to a regulatory region of an ROS1 kinase inhibitor resistance mutant gene. In other embodiments, the zinc finger protein binds to a messenger RNA (i.e., transcript) encoding an ROS1 kinase inhibitor resistance mutant and prevents its translation. Methods of selecting sites for targeting by zinc finger proteins have been described, for example, in U.S. Patent No. 6,453,242, which is herein incorporated by reference.
In some embodiments, the expression of an ROS1 kinase inhibitor resistance mutant is reduced or eliminated by disrupting an ROS1 kinase inhibitor resistance mutant gene. The ROS1 kinase inhibitor resistance mutant gene can be disrupted by any method known in the art. For example, in one embodiment, the gene is disrupted by transposon tagging. In another embodiment, the gene is disrupted by mutagenizing cells using random or targeted mutagenesis, and selecting for cells that have reduced ROS1 activity.
In one embodiment, transposon tagging is used to reduce or eliminate the expression of an ROS1 kinase inhibitor resistance mutant. Transposon tagging comprises inserting a transposon within an endogenous ROS 1 kinase inhibitor resistance mutant gene to reduce or eliminate expression of the ROS1 kinase inhibitor resistance mutant. In this embodiment, the expression of the ROS1 kinase inhibitor resistance mutant gene is reduced or eliminated by inserting a transposon within a regulatory region or coding region of the ROS1 kinase inhibitor resistance mutant gene. A transposon that is within an exon, intron, 5 ' or 3 ' untranslated sequence, a promoter, or any other regulatory sequence of an ROS1 kinase inhibitor resistance mutant gene can be used to reduce or eliminate the expression and/or activity of the encoded ROSl kinase inhibitor resistance mutant. In these embodiments, the silencing element comprises or encodes a targeted transposon that can insert within an ROSl kinase inhibitor resistance mutant gene.
In other embodiments, the silencing element comprises a nucleotide sequence useful for site-directed mutagenesis via homologous recombination with a region of an ROSl kinase inhibitor resistance mutant gene. Insertional mutations in gene exons usually result in null-mutants. The disclosure encompasses additional methods for reducing or eliminating the activity or expression of ROSl kinase inhibitor resistance mutants, such as those that involve promoter-based silencing. See, for example, Mette et al. (2000) EMBO J. 19: 5194-5201; Sijen et al. (2001) Curr. Biol. 11 :436-440; Jones et al. (2001) Curr. Biol. 11 :747-757.
As used herein, the term "silencing element" refers to a polynucleotide, which when expressed or introduced into a cell is capable of reducing or eliminating the level of expression of a target polynucleotide sequence or the polypeptide encoded thereby. The silencing element can comprise or encode an antisense oligonucleotide or an interfering RNA (RNAi). The term "interfering RNA" or "RNAi" refers to any RNA molecule which can enter an RNAi pathway and thereby reduce the expression of a target gene. The RNAi pathway features the Dicer nuclease enzyme and RNA-induced silencing complexes (RISC) that function to degrade or block the translation of a target mRNA. RNAi is distinct from antisense oligonucleotides that function through "antisense" mechanisms that typically involve inhibition of a target transcript by a single-stranded oligonucleotide through an RNase H-mediated pathway. See, Crooke (ed.) (2001) "Antisense Drug Technology: Principles, Strategies, and Applications" (1st ed), Marcel Dekker; ISBN: 0824705661; 1st edition.
As used herein, the term "gene" has its meaning as understood in the art. In general, a gene is taken to include gene regulatory sequences (e.g., promoters, enhancers, and the like) and/or intron sequences, in addition to coding sequences (open reading frames). It will further be appreciated that definitions of "gene" include references to nucleic acids that do not encode proteins but rather encode functional RNA molecules, or precursors thereof, such as microRNA or siRNA precursors, tRNAs, and the like.
As used herein, a "target gene" comprises any gene that one desires to decrease the level of expression. By "reduces" or "reducing" the expression level of a gene is intended to mean, the level of the encoded polynucleotide (i.e., target transcript) or the encoded polypeptide is statistically lower than the encoded polynucleotide level or encoded polypeptide level in an appropriate control which is not exposed to the silencing element. In particular embodiments, reducing the expression of an ROSl kinase inhibitor resistance mutant gene results in less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%>, or less than 5% of the level of the ROSl kinase inhibitor resistance mutant transcript or the level of the ROSl kinase inhibitor resistance mutant polypeptide in an appropriate control (e.g., the same cell prior to the introduction/expression of the silencing element or a similar cell at a similar stage in differentiation, same phenotype, same genotype, etc.). Methods to assay for the level of the RNA transcript, the level of the encoded polypeptide, or the activity of the polynucleotide or polypeptide are known in the art, and are described elsewhere herein.
The term "complementary" is used herein in accordance with its art-accepted meaning to refer to the capacity for precise pairing via hydrogen bonds (e.g., Watson-Crick base pairing or Hoogsteen base pairing) between two nucleosides, nucleotides or nucleic acids, and the like. For example, if a nucleotide at a certain position of a first nucleic acid is capable of stably hydrogen bonding with a nucleotide located opposite to that nucleotide in a second nucleic acid, when the nucleic acids are aligned in opposite 5' to 3' orientation (i.e., in anti-parallel orientation), then the nucleic acids are considered to be complementary at that position (where position may be defined relative to either end of either nucleic acid, generally with respect to a 5' end). The nucleotides located opposite one another can be referred to as a "base pair." A complementary base pair contains two complementary nucleotides, e.g., A and U, A and T, G and C, and the like, whereas a noncomplementary base pair contains two noncomplementary nucleotides (also referred to as a mismatch). Two polynucleotides are said to be complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that hydrogen bond with each other, i.e., a sufficient number of base pairs are complementary.
The term "hybridize" as used herein refers to the interaction between two complementary nucleic acid sequences in which the two sequences remain associated with one another under appropriate conditions.
A silencing element can comprise the interfering RNA or antisense oligonucleotide, a precursor to the interfering RNA or antisense oligonucleotide, a template for the transcription of an interfering RNA or antisense oligonucleotide, or a template for the transcription of a precursor interfering RNA or antisense oligonucleotide, wherein the precursor is processed within the cell to produce an interfering RNA or antisense oligonucleotide. Thus, for example, a dsRNA silencing element includes a dsRNA molecule, a transcript or polyribonucleotide capable of forming a dsRNA, more than one transcript or polyribonucleotide capable of forming a dsRNA, a DNA encoding a dsRNA molecule, or a DNA encoding one strand of a dsRNA molecule. When the silencing element comprises a DNA molecule encoding an interfering RNA, it is recognized that the DNA can be transiently expressed in a cell or stably incorporated into the genome of the cell. Such methods are discussed in further detail elsewhere herein.
The silencing element can reduce or eliminate the expression level of a target gene by influencing the level of the target RNA transcript, by influencing translation of the target RNA transcript, or by influencing expression at the pre-transcriptional level (i.e., via the modulation of chromatin structure, methylation pattern, etc., to alter gene expression). See, for example, Verdel et al. (2004) Science 303:672-676; Pal-Bhadra et al. (2004) Science 303:669-672;
Allshire (2002) Science 297:1818-1819; Volpe et al. (2002) Science 297: 1833-1837; Jenuwein (2002) Science 297:2215-2218; and Hall et al (2002) Science 297:2232-2237. Methods to assay for functional interfering RNA that are capable of reducing or eliminating the expression of a target gene are known in the art and disclosed elsewhere herein.
Any region of a transcript from the target gene (i.e., target transcript) can be used to design a domain of the silencing element that shares sufficient sequence identity to allow for the silencing element to decrease the level of the polynucleotide or polypeptide encoded by the target gene. For instance, the silencing element can be designed to share sequence identity to the 5 ' untranslated region of the target transcript, the 3 ' untranslated region of the target transcript, exonic regions of the target transcript, intronic regions of the target transcript, and any combination thereof.
The ability of a silencing element to reduce the level of the target transcript can be assessed directly by measuring the amount of the target transcript using, for example, Northern blots, nuclease protection assays, reverse transcription (RT)-PCR, real-time RT-PCR, microarray analysis, and the like. Alternatively, the ability of the silencing element to reduce the level of the polypeptide encoded by the target gene and target transcript can be measured directly using a variety of affinity-based approaches (e.g., using a ligand or antibody that specifically binds to the target polypeptide) including, but not limited to, Western blots, immunoassays, ELISA, flow cytometry, protein microarrays, and the like. In still other methods, the ability of the silencing element to reduce the level of the target polypeptide encoded by the target gene can be assessed indirectly, e.g., by measuring a functional activity of the polypeptide encoded by the transcript or by measuring a signal produced by the polypeptide encoded by the transcript.
Those of ordinary skill in the art will readily appreciate that a silencing element can be prepared according to any available technique including, but not limited to, chemical synthesis, enzymatic or chemical cleavage in vivo or in vitro, template transcription in vivo or in vitro, or combinations of the foregoing.
In one embodiment, the silencing element comprises or encodes a double stranded RNA molecule. As used herein, a "double stranded RNA" or "dsRNA" refers to a polyribonucleotide structure formed either by a single self-complementary RNA molecule or a polyribonucleotide structure formed by the expression of least two distinct RNA strands. Accordingly, as used herein, the term "dsRNA" is meant to encompass other terms used to describe nucleic acid molecules that are capable of mediating RNA interference or gene silencing, including, for example, small RNA (sRNA), short-interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), hairpin RNA, short hairpin RNA (shRNA), and others. See, for example, Meister and Tuschl (2004) Nature 431 :343-349 and Bonetta et al. (2004) Nature Methods 1 :79- 86.
In specific embodiments, at least one strand of the duplex or double-stranded region of the dsRNA shares sufficient sequence identity or sequence complementarity to the target gene to allow for the dsRNA to reduce the level of expression of the target gene. As used herein, the strand that is complementary to the target transcript is the "antisense strand," and the strand homologous to the target transcript is the "sense strand."
In one embodiment, the dsRNA comprises a hairpin RNA. A hairpin RNA comprises an
RNA molecule that is capable of folding back onto itself to form a double stranded structure. Multiple structures can be employed as hairpin elements. For example, the hairpin RNA molecule that hybridizes with itself to form a hairpin structure can comprise a single-stranded loop region and a base-paired stem. The base-paired stem region can comprise a sense sequence corresponding to all or part of the target transcript and further comprises an antisense sequence that is fully or partially complementary to the sense sequence. Thus, the base-paired stem region of the silencing element can determine the specificity of the silencing. See, for example, Chuang and Meyerowitz (2000) Proc. Natl Acad. Sci. USA 97:4985-4990, herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga et al. (2003) Mol. Biol. Rep. 30:135-140, herein incorporated by reference.
A "short interfering RNA" or "siRNA" comprises an RNA duplex (double-stranded region) and can further comprise one or two single-stranded overhangs, e.g., 3' or 5' overhangs. The duplex can be approximately 19 base pairs (bp) long, although lengths between 17 and 29 nucleotides, including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29 nucleotides, can be used. An siRNA can be formed from two RNA molecules that hybridize together or can alternatively be generated from a single RNA molecule that includes a self-hybridizing portion. The duplex portion of an siRNA can include one or more bulges containing one or more unpaired and/or mismatched nucleotides in one or both strands of the duplex or can contain one or more noncomplementary nucleotide pairs. One strand of an siRNA (referred to herein as the antisense strand) includes a portion that hybridizes with a target transcript. In certain
embodiments, one strand of the siRNA (the antisense strand) is precisely complementary with a region of the target transcript over at least about 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, or more meaning that the siRNA antisense strand hybridizes to the target transcript without a single mismatch (i.e., without a single noncomplementary base pair) over that length. In other embodiments, one or more mismatches between the siRNA antisense strand and the targeted portion of the target transcript can exist. In embodiments in which perfect complementarity is not achieved, any mismatches between the siRNA antisense strand and the target transcript can be located at or near the 3 ' end of the siRNA antisense strand. For example, in certain embodiments, nucleotides 1-9, 2-9, 2-10, and/or 1-10 of the antisense strand are perfectly complementary to the target.
Considerations for the design of effective siRNA molecules are discussed in McManus et al. (2002) Nature Reviews Genetics 3:737-747 and in Dykxhoorn et al. (2003) Nature Reviews Molecular Cell Biology 4:457-467. Such considerations include the base composition of the siRNA, the position of the portion of the target transcript that is complementary to the antisense strand of the siRNA relative to the 5 ' and 3 ' ends of the transcript, and the like. A variety of computer programs also are available to assist with selection of siRNA sequences, e.g., from Ambion and Integrated DNA Technologies. Additional design considerations that also can be employed are described in Semizarov et al. Proc. Natl. Acad. Sci. 100:6347-6352.
The term "short hairpin RNA" or "shRNA" refers to an RNA molecule comprising at least two complementary portions hybridized or capable of hybridizing to form a double- stranded (duplex) structure sufficiently long to mediate RNAi (generally between approximately 17 and 29 nucleotides in length, including 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, and 29 nucleotides in length, and in some embodiments, typically at least 19 base pairs in length), and at least one single-stranded portion, typically between approximately 1 and 20 or 1 to 10 nucleotides in length that forms a loop connecting the two nucleotides that form the base pair at one end of the duplex portion. The duplex portion can, but does not require, one or more bulges consisting of one or more unpaired nucleotides. In specific embodiments, the shRNAs comprise a 3 ' overhang. Thus, shRNAs are precursors of siRNAs and are, in general, similarly capable of inhibiting expression of a target transcript.
In particular, RNA molecules having a hairpin (stem-loop) structure can be processed intracellularly by Dicer to yield an siRNA structure referred to as short hairpin RNAs (shRNAs), which contain two complementary regions that hybridize to one another (self-hybridize) to form a double-stranded (duplex) region referred to as a stem, a single-stranded loop connecting the nucleotides that form the base pair at one end of the duplex, and optionally an overhang, e.g., a 3' overhang. The stem can comprise about 19, 20, or 21 bp long, though shorter and longer stems (e.g., up to about 29 nt) also can be used. The loop can comprise about 1-20, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nt, about 4-10, or about 6-9 nt. The overhang, if present, can comprise approximately 1-20 nt or approximately 2-10 nt. The loop can be located at either the 5' or 3' end of the region that is complementary to the target transcript whose inhibition is desired (i.e., the antisense portion of the shRNA).
Although shRNAs contain a single RNA molecule that self-hybridizes, it will be appreciated that the resulting duplex structure can be considered to comprise sense and antisense strands or portions relative to the target mRNA and can thus be considered to be double- stranded. It will therefore be convenient herein to refer to sense and antisense strands, or sense and antisense portions, of an shRNA, where the antisense strand or portion is that segment of the molecule that forms or is capable of forming a duplex with and is complementary to the targeted portion of the target polynucleotide, and the sense strand or portion is that segment of the molecule that forms or is capable of forming a duplex with the antisense strand or portion and is substantially identical in sequence to the targeted portion of the target transcript. In general, considerations for selection of the sequence of the antisense strand of an shRNA molecule are similar to those for selection of the sequence of the antisense strand of an siR A molecule that targets the same transcript.
In some embodiments, the silencing element comprises or encodes an antisense oligonucleotide. An "antisense oligonucleotide" is a single-stranded nucleic acid sequence that is wholly or partially complementary to a target gene, and can be DNA, or its RNA counterpart (i.e., wherein T residues of the DNA are U residues in the RNA counterpart).
The antisense oligonucleotides disclosued herein are designed to be hybridizable with target RNA (e.g., mRNA) or DNA. For example, an oligonucleotide (e.g., DNA
oligonucleotide) that hybridizes to a mRNA molecule can be used to target the mRNA for RnaseH digestion. Alternatively, an oligonucleotide that hybridizes to the translation initiation site of an mRNA molecule can be used to prevent translation of the mRNA. In another approach, oligonucleotides that bind to double-stranded DNA can be administered. Such oligonucleotides can form a triplex construct and inhibit the transcription of the DNA. Triple helix pairing prevents the double helix from opening sufficiently to allow the binding of polymerases, transcription factors, or regulatory molecules. Such oligonucleotides can be constructed using the base-pairing rules of triple helix formation and the nucleotide sequences of the target genes.
As non-limiting examples, antisense oligonucleotides can be targeted to hybridize to the following regions: mRNA cap region, translation initiation site, translational termination site, transcription initiation site, transcription termination site, polyadenylation signal, 3' untranslated region, 5 ' untranslated region, 5 ' coding region, mid coding region, and 3 ' coding region. In some embodiments, the complementary oligonucleotide is designed to hybridize to the most unique 5' sequence of a gene, including any of about 15-35 nucleotides spanning the 5' coding sequence.
Accordingly, the antisense oligonucleotides in accordance as disclosed herein can comprise from about 10 to about 100 nucleotides, including, but not limited to about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 nucleotides.
Antisense nucleic acids can be produced by standard techniques (see, for example, Shewmaker et al, U.S. Pat. No. 5,107,065). Appropriate oligonucleotides can be designed using OLIGO software (Molecular Biology Insights, Inc., Cascade, Colo.).
According to the methods disclosed herein, an ROS1 kinase inhibitor resistance mutant gene is targeted by a silencing element. As used herein, a target gene or target transcript is "targeted" by a silencing element when the introduction or the expression of the silencing element results in the substantially specific reduction or inhibition in the expression of the target gene and target transcript. The specific region of the target gene or target transcript that has substantial sequence identity or similarity or is complementary to the silencing element is the region that has been "targeted" by the silencing element.
The region of the ROS 1 kinase inhibitor resistance mutant that is targeted by the silencing element comprises the mutation that confers resistance to at least one ROS1 kinase inhibitor. In specific embodiments, introduction or expression of the silencing element specifically reduces the level of the ROS1 kinase inhibitor resistance mutant, meaning that the expression level of the native or wild type ROS1 sequence is not affected or minimally affected by the silencing element.
As discussed above, the silencing elements employed in any of the methods and compositions disclosed herein can comprise a DNA template for a dsRNA (e.g., shRNA) or antisense RNA or can encode a zinc finger binding protein. In such embodiments, the DNA molecule encoding the dsRNA, antisense RNA, or zinc finger binding protein is found in an expression cassette.
The embodiments disclosed herein further pertain to novel agents identified by the above- described screening assays and uses thereof as described herein. Briefly, the ROS1 kinase inhibitor resistance mutant specific binding agents can be used in methods for the detection of ROS1 kinase inhibitor resistance mutants and the diagnosis of cancers that are resistant to or are likely to develop resistance to at least one ROS1 kinase inhibitor. The ROS1 kinase inhibitor resistance mutant inhibitors and silencing elements are useful in the treatment of patients having such cancers. It is understood and herein contemplated that diagnosis of the presense of a ROS1 inhibitor resistant cancer can be made before the administration of any treatment regimen.
Accordingly, in one aspect, disclosed herein are methods of treating a cancer comprising a ROS1 inhibitor resistant mutation further comprising diagnosisng the subject as having a ROS1 inhibitor resistant cancer prior to the administration of any treatment. It is further understood that the detection or diagnosis can be perfomed using any of the diagnostic or detection methods disclosed herein.
METHODS OF DETECTION AND DIAGNOSIS
Various methods and compositions for detecting a polynucleotide encoding ROS1 kinase inhibitor resistance mutants or for detecting the ROS1 kinase inhibitor resistance mutant polypeptide in a sample (e.g., biological sample) are provided. A biological sample can comprise any sample in which one desires to detect the polynucleotide encoding a particular ROS1 kinase inhibitor resistance mutant or the mutant polypeptide. The term "biological sample" is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject or lysates thereof. The sample may comprise any clinically relevant tissue, such as, but not limited to, bone marrow samples, tumor biopsy, fine needle aspirate, or a sample of bodily fluid, such as, blood, plasma, serum, lymph, ascitic fluid, cystic fluid or urine.
In one aspect, it is understood and herein contemplated that the disclosed methods of assaying, detecting, diagnosing, and treating can include a further step of obtaining a tissue sample, including for example DNA, R A, cDNA, proteins, or any tissue that comprises said DNA, RNA, or proteins. Obtaining a tissue sample" or "obtain a tissue sample" means to collect a sample of tissue either from a party having previously harvested the tissue or harvesting directly from a subject. It is understood and herein contemplated that tissue samples obtained directly from the subject can be obtained by any means known in the art including invasive and non-invasive techniques. It is also understood that methods of measurement can be direct or indirect. Examples of methods of obtaining or measuring a tissue sample can include but are not limited to tissue biopsy, blood collection, tissue lavage, aspiration, tissue swab, spinal tap, magnetic resonance imaging (MRI), Computed Tomography (CT) scan, Positron Emission Tomography (PET) scan, and X-ray (with and without contrast media). It is understood and herein contemplated that a tissue samples may be any sample containing polynucleotides (polynucleotide targets) of interest and obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations.
The present disclosure further provides methods for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting the biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify a polynucleotide encoding an ROSl inhibitor resistance mutant (e.g., mRNA or genomic DNA), and detecting the polynucleotide that encodes the mutant. The reagent can specifically detect or amplify genomic DNA that encodes the ROSl inhibitor resistance mutant or an RNA transcript that encodes the mutant.
In one embodiment, a method for detecting a polynucleotide encoding an ROS 1 kinase inhibitor resistance mutant polypeptide or active variants and fragments thereof in a sample comprises contacting the sample with a primer pair capable of specifically amplifying an amplicon of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof, amplifying and then detecting the amplicon. In certain embodiments, the amplicon is of a sufficient length to specifically detect the polynucleotide encoding the ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof.
In other embodiments, a method for detecting a polynucleotide encoding an ROSl kinase inhibitor resistance mutant polypeptide or active variants and fragments thereof in a sample comprises contacting the sample with a polynucleotide capable of specifically detecting a polynucleotide encoding an ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof, and detecting the polynucleotide encoding the ROSl kinase inhibitor resistance mutant polypeptide or an active variant or fragment thereof.
In specific embodiments, the sample is contacted with a polynucleotide probe that hybridizes under stringent hybridization conditions to the target sequences to be detected. The sample and probes are then subjected to stringent hybridization conditions and the hybridization of the probe to the target sequences is detected.
As used herein, a "probe" is an isolated polynucleotide to which is attached a
conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, chemiluminescent agent, enzyme, etc. Such a probe is complementary to a strand of a target polynucleotide, which in specific embodiments of the disclosure comprise a polynucleotide encoding an ROSl kinase inhibitor resistance mutant. Deoxyribonucleic acid probes can include those generated by PCR using ROSl kinase inhibitor resistance mutant specific primers, oligonucleotide probes synthesized in vitro, or DNA obtained from bacterial artificial chromosome, fosmid or cosmid libraries. Probes include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that can specifically detect the presence of the target DNA sequence. For nucleic acid probes, examples of detection reagents include, but are not limited to radiolabeled probes, enzymatic labeled probes (horse radish peroxidase, alkaline phosphatase), affinity labeled probes (biotin, avidin, or steptavidin), and fluorescent labeled probes (6-FAM, VIC, TAMRA, MGB, fluorescein, rhodamine, texas red [for BAC/fosmids]). One skilled in the art will readily recognize that the nucleic acid probes described herein can readily be incorporated into one of the established kit formats which are well known in the art.
As used herein, "primers" are isolated polynucleotides that are annealed to a
complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand., then extended along the target DNA strand by a polymerase, e.g., a DNA polymerase. Primer pairs refer to their use for amplification of a target
polynucleotide, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods. "PCR" or "polymerase chain reaction" is a technique used for the amplification of specific DNA segments (see, U.S. Pat. Nos. 4,683,195 and 4,800,159; herein incorporated by reference).
By "specifically detect" is intended that the polynucleotide can be used as a probe that hybridizes under stringent conditions to a polynucleotide encoding an ROS 1 kinase inhibitor resistance mutant or the polynucleotide can be used in nucleic acid sequencing techniques to sequence the region comprising the ROSl kinase inhibitor resistance mutant. By "specifically amplify" is intended that the polynucleotide(s) can be used as a primer to specifically amplify an amplicon of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant. The level or degree of hybridization which allows for the specific detection of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant is sufficient to distinguish the polynucleotide encoding the ROSl kinase inhibitor resistance mutant from a polynucleotide that does not encode the recited polypeptide (e.g., native ROSl; SEQ ID NO:l). By "shares sufficient sequence identity or complementarity to allow for the amplification of a polynucleotide encoding an ROSl kinase inhibitor resistance mutant" is intended the sequence shares at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity or complementarity to a fragment or across the full length of the polynucleotide encoding the ROSl kinase inhibitor resistance mutant.
Probes and primers are of sufficient nucleotide length to bind to the target DNA sequence and specifically detect and/or amplify a polynucleotide encoding an ROSl kinase inhibitor resistance mutant. It is recognized that the hybridization conditions or reaction conditions can be determined by the operator to achieve this result. This length may be of any length that is of sufficient length to be useful in a detection method of choice. Generally, 8, 11, 14, 16, 18, 20, 22, 24, 26, 28, 30, 40, 50, 75, 100, 200, 300, 400, 500, 600, 700 nucleotides or more, or between about 11-20, 20-30, 30-40, 40-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600- 700, 700-800, or more nucleotides in length are used.
As used herein, "amplified DNA" or "amplicon" refers to the product of polynucleotide amplification of a target polynucleotide that is part of a nucleic acid template. For example, to determine whether the biological sample comprises an ROS 1 kinase inhibitor resistance mutation, the nucleic acid complement of the biological sample may be subjected to a polynucleotide amplification method using a primer pair that includes a first primer derived from the 5' flanking sequence adjacent to an ROSl kinase inhibitor resistance mutation, and a second primer derived from the 3' flanking sequence adjacent to the ROSl kinase inhibitor resistance mutation to produce an amplicon that is capable of distinguishing the ROSl kinase inhibitor resistance mutant from native or wild-type ROS 1. The amplified polynucleotide (amplicon) can be of any length that allows for the detection of the polynucleotide encoding the ROSl kinase inhibitor resistance mutant. For example, the amplicon can be about 10, 50, 100, 200, 300, 500, 700, 100, 2000, 3000, 4000 nucleotides in length or longer. Further, in some embodiments, the length or sequence of the amplified region (amplicon) of the polynucleotide encoding the ROSl kinase inhibitor resistance mutant that allows for the specific detection of the polynucleotide is sufficient to distinguish the polynucleotide encoding the ROSl kinase inhibitor resistance mutant from a polynucleotide that does not encode the recited polypeptide. A member of a primer pair derived from the flanking sequence may be located a distance from the resistance mutation. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2.sup.nd ed, vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989 (hereinafter, "Sambrook et al, 1989"); Current Protocols in Molecular Biology, ed. Ausubel et al, Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates) (hereinafter, "Ausubel et al, 1992"); and Innis et al, PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as the PCR primer analysis tool in
Vector NTI version 10 (Informax Inc., Bethesda Md.); PrimerSelect (DNASTAR Inc., Madison, Wis.); and Primer3 (Version 0.4.0.COPYRGT., 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Additionally, the sequence can be visually scanned and primers manually identified using guidelines known to one of skill in the art.
The ROS 1 inhibitor resistance mutation can be detected using a variety of nucleic acid techniques known to those of ordinary skill in the art, including but not limited to: nucleic acid sequencing; nucleic acid hybridization; and, nucleic acid amplification.
Illustrative non-limiting examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Chain terminator sequencing uses sequence-specific termination of a DNA synthesis reaction using modified nucleotide substrates. Extension is initiated at a specific site on the template DNA by using a short radioactive, or other labeled, oligonucleotide primer complementary to the template at that region. The oligonucleotide primer is extended using a DNA polymerase, standard four deoxynucleotide bases, and a low concentration of one chain terminating nucleotide, most commonly a di-deoxynucleotide. This reaction is repeated in four separate tubes with each of the bases taking turns as the di-deoxynucleotide. Limited incorporation of the chain terminating nucleotide by the DNA polymerase results in a series of related DNA fragments that are terminated only at positions where that particular di-deoxynucleotide is used. For each reaction tube, the fragments are size-separated by electrophoresis in a slab polyacrylamide gel or a capillary tube filled with a viscous polymer. The sequence is determined by reading which lane produces a visualized mark from the labeled primer as you scan from the top of the gel to the bottom. Dye terminator sequencing alternatively labels the terminators. Complete sequencing can be performed in a single reaction by labeling each of the di-deoxynucleotide chain- terminators with a separate fluorescent dye, which fluoresces at a different wavelength.
The present disclosure further provides methods for assaying a biological sample for an ROSl kinase inhibitor resistance mutation using nucleic acid hybridization techniques. Nucleic acid hybridization includes methods using labeled probes directed against purified DNA, amplified DNA, and fixed cell preparations (fluorescence in situ hybridization). Non-limiting examples of nucleic acid hybridization techniques include the known methods of Southern (DNA:DNA) blot hybridizations, in situ hybridization and FISH of chromosomal material, using appropriate probes. Such nucleic acid probes can be used that comprise nucleotide sequences in proximity to the ROSl kinase inhibitor resistance mutation. By "in proximity to" is intended within about 100 kilobases (kb) of the ROSl kinase inhibitor resistance mutation.
In situ hybridization (ISH) is a type of hybridization that uses a labeled complementary DNA or RNA strand as a probe to localize a specific DNA or RNA sequence in a portion or section of tissue (in situ), or, if the tissue is small enough, the entire tissue (whole mount ISH). DNA ISH can be used to determine the structure of chromosomes. Sample cells and tissues are usually treated to fix the target transcripts in place and to increase access of the probe. The probe hybridizes to the target sequence at elevated temperature, and then the excess probe is washed away. The probe that was labeled with either radio-, fluorescent- or antigen-labeled bases is localized and quantitated in the tissue using either autoradiography, fluorescence microscopy or immunohistochemistry, respectively. ISH can also use two or more probes, labeled with radioactivity or the other non-radioactive labels, to simultaneously detect two or more transcripts. In some embodiments, the ROSl kinase inhibitor resistance mutant is detected using fluorescence in situ hybridization (FISH).
Specific protocols for nucleic acid hybridization are well known in the art and can be readily adapted for the present invention. Guidance regarding methodology may be obtained from many references including: In situ Hybridization: Medical Applications (eds. G. R.
Coulton and J. de Belleroche), Kluwer Academic Publishers, Boston (1992); In situ
Hybridization: hi Neurobiology; Advances in Methodology (eds. J. H. Eberwine, K. L.
Valentino, and J.D. Barchas), Oxford University Press Inc., England (1994); In situ
Hybridization: A Practical Approach (ed. D. G. Wilkinson), Oxford University Press Inc., England (1992)); Kuo et al. (1991) Am. J. Hum. Genet. 42: 112-119; Klinger et al. (1992) Am. J. Hum. Genet. 51 :55-65; and Ward et al. (1993) Am. J. Hum. Genet. 52:854-865). There are also kits that are commercially available and that provide protocols for performing FISH assays (available from e.g., Oncor, Inc., Gaithersburg, MD). Patents providing guidance on methodology include U.S. 5,225,326; 5,545,524; 6,121,489 and 6,573,043. All of these references are hereby incorporated by reference in their entirety and may be used along with similar references in the art.
Southern blotting can be used to detect specific DNA sequences. In such methods, DNA that is extracted from a sample is fragmented, electrophoretically separated on a matrix gel, and transferred to a membrane filter. The filter bound DNA is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected. Further, Northern blotting techniques that are known in the art can be used to detect specific RNA sequences that encode an ROS 1 kinase inhibitor resistance mutant.
Microarrays can also be used to specifically detect an ROS1 kinase inhibitor resistance polynucleotide. Each array consists of a reproducible pattern of capture probes attached to a solid support. Labeled RNA is hybridized to complementary probes on the array and then detected by laser scanning. Hybridization intensities for each probe on the array are determined and converted to a quantitative value representing relative gene expression levels. See, for example, U.S. Pat. Nos. 6,040,138, 5,800,992 and 6,020,135, 6,033,860, and 6,344,316, each of which is herein incorporated by reference in its entirety.
In hybridization techniques, all or part of a polynucleotide that selectively hybridizes to a target polynucleotide encoding an ROS1 kinase inhibitor resistance mutant polypeptide is employed. By "stringent conditions" or "stringent hybridization conditions" when referring to a polynucleotide probe is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of identity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length or less than 500 nucleotides in length. As used herein, a substantially identical or complementary sequence is a polynucleotide that specifically hybridizes to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions. Appropriate stringency conditions which promote DNA hybridization, for example, 6Xsodium chloride/sodium citrate (SSC) at about 45° C, followed by a wash of 2XSSC at 50° C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. Optionally, wash buffers can comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
In hybridization reactions, specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the
hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1°C for each 1% of
mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45°C (aqueous solution) or 32°C (formamide solution), it is optimal to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al, eds. (1995) Current
Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York) and Haymes et al. (1985) In: Nucleic Acid Hybridization, a Practical Approach, IRL Press, Washington, D.C.
Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), ligase chain reaction (LCR) (Weiss (1991) Science 254: 1292, herein incorporated by reference in its entirety), strand displacement amplification (SDA) (Walker et al. (1992) Proc. Natl. Acad. Sci. USA 89: 392-396; U.S. Pat. Nos. 5,270,184 and 5,455,166, each of which is herein incorporated by reference in its entirety), and nucleic acid sequence based amplification (NASBA). The polymerase chain reaction (U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159 and 4,965,188, each of which is herein incorporated by reference in its entirety), commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence. For other various permutations of PCR see, e.g., U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159; Mullis et al., (1987) Meth. Enzymol. 155: 335; and, Murakawa et al, (1988) DNA 7: 287, each of which is herein incorporated by reference in its entirety. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See also Innis et al, eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Methods of amplification are further described in US Patent Nos. 4,683,195, 4,683,202 and Chen et al. (1994) PNAS 91 :5695- 5699. These methods as well as other methods known in the art of DNA amplification can be used in the practice of the embodiments of the present invention. It is understood that a number of parameters in a specific PCR protocol may need to be adjusted to specific laboratory conditions and may be slightly modified and yet allow for the collection of similar results. These adjustments will be apparent to a person skilled in the art. Thermal cyclers are often employed for the specific amplification of polynucleotides. The cycles of denaturation, annealing and polymerization for PCR may be performed using an automated device, typically known as a thermal cycler. Thermal cyclers that may be employed are described in U.S. Pat. Nos.
5,612,473; 5,602,756; 5,538,871; and 5,475,610, the disclosures of which are herein incorporated by reference.
One illustrative detection method provides for quantitative evaluation of the amplification process in real-time. Evaluation of an amplification process in "real-time" involves determining the amount of amplicon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initially present in the sample. A variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification are well known in the art. These include methods disclosed in U.S. Pat. Nos. 6,303,305 and 6,541,205, each of which is herein incorporated by reference in its entirety. Another method for determining the quantity of target sequence initially present in a sample, but which is not based on a real-time
amplification, is disclosed in U.S. Pat. No. 5,710,029, herein incorporated by reference in its entirety.
Amplification products can be detected in real-time through the use of various self- hybridizing probes, most of which have a stem-loop structure. Such self-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a target sequence. By way of non-limiting example, "molecular torches" are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as "the target binding domain" and "the target closing domain") which are connected by a joining region (e.g., non-nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions. Molecular torches and a variety of types of interacting label pairs are disclosed in U.S. Pat. No. 6,534,274, herein incorporated by reference in its entirety.
Another example of a detection probe having self-complementarity is a "molecular beacon." Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.
Other self-hybridizing probes are well known to those of ordinary skill in the art. By way of non-limiting example, probe binding pairs having interacting labels, such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use in the present invention. Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in the present invention. Additional detection systems include "molecular switches," as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety. Other probes, such as those comprising intercalating dyes and/or fluorochromes, are also useful for detection of amplification products in the present invention. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).
The methods for detecting an ROSl kinase inhibitor resistance mutant can be used to diagnose a disease associated with aberrant ROSl activity in a subject. Further, agents that inhibit the ROSl kinase inhibitor resistance mutants that have been identified using the screening assays described herein can be used to treat such diseases. Diseases mediated by ROSl activity include, but are not limited to, diseases characterized in part by migration, invasion, proliferation and other biological activities associated with invasive cell growth. Such diseases include cancers. Thus, methods for diagnosing the presence of a cancer that is resistant to or likely to develop resistance to at least one ROSl kinase inhibitor in a subject are provided. Such methods can comprise assaying a biological sample from a subject for the presence of an ROSl inhibitor resistance mutation using any of the aforementioned methods, such as detecting the ROS 1 kinase inhibitor resistance mutant polypeptide with a specific binding agent (e.g., antibody) or detecting the ROSl kinase inhibitor resistant mutation using a polynucleotide capable of detecting the same.
As used throughout this specification, the term "cancer" refers to the condition in a subject that is characterized by unregulated cell growth, wherein the cancerous cells are capable of local invasion and/or metastasis to noncontiguous sites. As used herein, "cancer cells," "cancerous cells," or "tumor cells" refer to the cells that are characterized by this unregulated cell growth and invasive property.
The term "cancer" encompasses all types of cancers, including, but not limited to, all forms of carcinomas, melanomas, sarcomas, lymphomas and leukemias, including without limitation, cancers of the cardiac system: sarcoma (angiosarcoma, fibrosarcoma,
rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; cancers of the lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hanlartoma, mesothelioma; cancers of the gastrointestinal system: esophagus (squamous cell carcinoma, adenocarcinoma,
leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma); cancers of the genitourinary tract: kidney
(adenocarcinoma, Wilm's tumor [nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate
(adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); cancers of the liver: hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma; cancers of the bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors; cancers of the nervous system: skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformians), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, meduUoblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma); gynecological cancers: uterus (endometrial carcinoma), cervix (cervical carcinoma, pre -tumor cervical dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma], granulosa-thecal cell tumors, Sertoli Leydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma
(embryonal rhabdomyosarcoma), fallopian tubes (carcinoma); hematologic cancers: blood (myeloid leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, a non-small cell lung carcinoma, glioblastoma multiforme (GBM) brain tumors, cholangiocarcinomas (biliary tract tumors), multiple myeloma, myelodysplasia syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma], anaplastic large cell lymphoma (ALCL); skin cancers: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis; and cancers of the adrenal glands: neuroblastoma.
In certain embodiments, the cancer is a large B-celllymphoma, malignant histiocytosis, an inflammatory myoftbroblastic tumor sarcoma, an esophageal squamous cell carcinoma, a breast cancer, a colorectal carcinoma, a non-small cell lung carcinoma, a neuroblastoma, a bladder cancer, a renal cancer, a cholangiocarcinoma, and a glioblastoma.
As used herein, a "subject" can refer to any individual on whom the methods disclosed herein are being performed. In one aspect, the subject can be a patient already having been diagnosed with a cancer and the methodology herein being performed to further elucidate the nature of the cancer or the subject could be previously undiagnosed with any cancer. For example, the subject can already be diagnosed with non-small cell lung carcinoma; papillary thyroid carcinoma; neuroblastoma; medulloblastoma; colon carcinoma; acute myeloid leukemia; or prostatic carcinoma plasmacytomas. Methods for assaying a biological sample for an ROSl inhibitor resistance mutation comprise contacting the biological sample with an anti-ROSl kinase inhibitor resistance mutant antibody or other agent that specifically binds to the particular ROSl kinase inhibitor resistance mutant polypeptide, followed by the detection of the binding of the antibody or binding agent to the ROSl kinase inhibitor resistance mutant. The binding of the antibody or the binding agent to the ROS 1 kinase inhibitor resistance mutant can be detected through the presence of a detectable label (e.g., radioisotope, fluorescent tag, enzymatic tag, chemiluminescent tag) conjugated to the antibody or binding agent or through the use of a labeled secondary antibody or secondary binding agent that specifically binds the ROSl -specific binding agent. Non-limiting examples of assays that can be used to detect an ROSl kinase inhibitor resistance mutant polypeptide using a specific binding agent include
immunoprecipitation, Western blot, ELISA, immunohistochemistry, immunocytochemistry, and flow cytometry.
As used throughout the specification and in any of the methods disclosed herein, "subject" is intended mammals, e.g., primates, humans, agricultural and domesticated animals such as, but not limited to, dogs, cats, cattle, horses, pigs, sheep, and the like. In some embodiments, the subject that is being diagnosed or treated is a human. It is understood and herein contemplated that the subject may have never been diagnosed or may have been previously diagnosed with a cancer or more specifically a diagnosed with a cancer comprising a ROSl oncogenic fusion. Accordingly, the methods can be used to diagnose a cancer in a subject not previously known to have a cancer through the detection of an ROSl oncogenic fusion protein having an ROS 1 inhibitor resistance mutation or a polynucleotide encoding the same using the detection methods disclosed herein.
The methods can also be used to diagnose a cancer that is resistant to or likely to develop resistance to at least one ROSl kinase inhibitor in a subject that was previously known to have a cancer that is associated with aberrant ROSl activity through the detection of an ROSl inhibitor resistance mutant polypeptide or polynucleotide encoding the same using the detection methods disclosed herein. In these embodiments, the ROSl inhibitor resistance mutant does not necessarily have to be part of an ROSl oncogenic fusion protein, as genomic amplifications or protein overexpression can lead to aberrant ROSl activity and cancer development. Therefore, "aberrant ROSl activity" refers to an increased ROSl activity (that can be due to genomic amplification, protein overexpression or overactivation, or the presence of a constitutively active ROSl oncogenic fusion protein) that is sufficient to contribute to the development and/or maintenance of a cancerous state. Accordingly, a cancer that is associated with aberrant ROSl activity is one wherein the aberrant ROSl activity contributes to the development and/or growth of the cancer.
Thus, in one aspect, disclosed herein are methods for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROS 1 activity or methods of assaying a biological sample for an ROSl inhibitor resistance mutation, the methods comprising assaying a biological sample from said patient for the presence of an ROS 1 inhibitor resistance mutation, said method comprising contacting said biological sample with any of the antibodies disclosed herein (for example and antibody that specifically binds any of the polypeptides disclosed herein), and detecting binding of said antibody to ROSl having said ROSl inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
Also disclosed herein are methods for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROS 1 small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity or methods of assaying a biological sample for an ROSl inhibitor resistance mutation, the methods comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one
polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROS 1 kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of: a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO : 1 ; a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO : 1 ; a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1; a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1; a leucine residue at the position
corresponding to amino acid residue position 2004 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1 ; a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 ; a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1; an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1; a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO : 1 ; a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1; a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1; an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1; an isoleucine or asparagine residue at the position
corresponding to amino acid residue position 2036 of SEQ ID NO: 1; a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1; a glutamic acid or glutamate residue at the position
corresponding to amino acid residue position 2040 of SEQ ID NO: 1; a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1; a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1; a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1; a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1; an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1; a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1; a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1 ; an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1 ; an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1 ; a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1; a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1; an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1 ; a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1; a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1; a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1; an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1; an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1 ; a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO : 1 ; and detecting the presence or absence of said ROSl inhibitor resistance mutation in said biological sample, wherein the presence of said ROS 1 inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small- molecule kinase inhibitor.
In another aspect, disclosed herein are diagnostic methods wherein said at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide is capable of specifically detecting or specifically amplifying any of the polynucleotides disclosed herein.
In one aspect disclosed herein are methods for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject or methods of assaying a biological sample for an ROSl inhibitor resistance mutation, the methods comprising assaying a biological sample from said subject for the presence of an ROS 1 oncogenic fusion protein having an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds of the polypeptides disclosed herein; and detecting binding of said antibody to said ROSl oncogenic fusion protein having an ROSl kinase inhibitor resistance mutation; wherein the presence of said ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
In one aspect, disclosed herein are methods for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject or methods of assaying a biological sample for an ROSl inhibitor resistance mutation, the methods comprising assaying a biological sample from said subject for the presence of a polynucleotide encoding an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify the polynucleotide encoding an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, wherein said at least one polynucleotide is capable of specifically detecting or specifically amplifying the polynucleotide disclosed herein; and detecting the presence or absence of said polynucleotide encoding a ROSl oncogenic fusion protein having said ROSl inhibitor resistance mutation in said biological sample; wherein the presence of said polynucleotide encoding said ROSl oncogenic fusion protein having said ROS 1 inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
Also disclosed in one aspect are diagnostic methods wherein said ROSl small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113, X-396, NVP- TAE684, staurosponne, 7-hydroxystaurosporine, CEP-14083, CEP-14513, CEP-28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126 or others. For example disclosed herein are methods for diagnosing a cancer that is resistant to or likely to develop resistance to
XALKORI® in a patient having a cancer that is associated with aberrant ROS 1 activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds a ROS 1 kinase inhibitor resistance mutant polypeptide that is resistant to XALKORI® , wherein said ROS 1 kinase inhibitor resistance mutant polypeptide has a residue at the position corresponding to amino acid residue position of SEQ ID NO: 1; and detecting binding of said antibody to ROSl having said ROSl kinase inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to XALKORI® . Also disclosed are diagnostic methods, wherein said cancer is selected from the group consisting of a large B-cell lymphoma, anaplastic large cell lymphoma (ALCL), malignant histiocytosis, an inflammatory myofibroblastic tumor sarcoma, an esophageal squamous cell carcinoma, a breast cancer, a colorectal carcinoma, a non-small cell lung carcinoma, a neuroblastoma, a bladder cancer, a renal cancer, cholangiocarcinoma, non-small cell lung cancer (NSCLC), and glioblastoma. It is understood and herein contemplated that any of the diagnositic methods disclosed herein can further comprise selecting and administering a therapy for said patient.
It is understood that once a diagnosis of a ROS1 kinase inhibitor resistant cancer is made it reamins desirable to reduce the expression of the mutant ROS1. Thus, disclosed herein are methods of detecting or diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROS1 small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROS1 activity, further comprising treating the patient using any of the methods of treatment disclosed herein. For example, the disclosed methods of detection and diagnosisng can comprise treating the subject through the use of a method of specifically reducing the expression of an ROS1 kinase inhibitor resistance mutant that is resistant to at least one ROS1 small- molecule kinase inhibitor, said method comprising introducing into a cell expressing said ROS1 kinase inhibitor resistance mutant a silencing element that targets a gene encoding said ROS1 kinase inhibitor resistance mutant, wherein the introduction or expression of said silencing element specifically reduces the expression of said ROS 1 kinase inhibitor resistance mutant, wherein said ROS 1 kinase inhibitor resistance mutant is any of the polypeptides disclosed herein. In one aspect, it is understood and herein contemplated that the disclosed treatments would comprising electing not to administer a ROA1 kinase inhibitor. It is further contemplated herein that other chemotherapeutics or anti-oxidants known in the art or irradiation can be administered to the subject to treat the cancer. Examples of agents that can be administered to the subject when a cancer is found to be ROS 1 kinase inhibitor resistant include but are not limited to Actinomycin, All-trans retinoic acid, Azacitidine, Azathioprine, Bleomycin, Bortezomib, Carboplatin, Capecitabine, Cetuximab, Cisplatin, Chlorambucil, Crizotinib, Cyclophosphamide, Cytarabine, Daunorubicin, Docetaxel, Doxifluridine, Doxorubicin, Epirubicin, Epothilone, Etoposide, Fluorouracil, Gemcitabine, Herceptin, Hydroxyurea, Idarubicin, Imatinib, Irinotecan, Lipoplatin, Mechlorethamine, Mercaptopurine, Methotrexate, Mitoxantrone, Nedaplatin, Oxaliplatin, Paclitaxel, Pemetrexed, Picoplatin, Rituximab, Satraplatin, Teniposide, Tioguanine, Trastuzumab, Triplatin, Topotecan, Valrubicin, Vinblastine, Vincristine, Vindesine, and
Vinorelbine
It is further understood and herein contemplated that where a subject is found to not have a ROS1 kinase inhibitor resistant cancer, the methods of diagnosing, detecting, or assaying described herein can include treating the subject by administering a ROS1 kinase inhibitor such as, for example, XALKORI®, AP26113, X-396, NVP-TAE684, staurosporine, 7- hydroxystaurosporine, CEP-14083, CEP-14513, CEP-28122, pyridone 14, pyridone 15,
CRL151104A, and WZ-5-126.
It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a polypeptide" is understood to represent one or more polypeptides. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.
Throughout this specification and the embodiments, the words "comprise," "comprises," and "comprising" are used in a non-exclusive sense, except where the context requires otherwise.
As used herein, the term "about," when referring to a value is meant to encompass variations of, in some embodiments ± 50%, in some embodiments ± 20%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ± 1%, in some embodiments ± 0.5%, and in some embodiments ± 0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions.
Further, when an amount, concentration, or other value or parameter is given as either a range, preferred range, or a list of upper preferable values and lower preferable values, this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed. Where a range of numerical values is recited herein, unless otherwise stated, the range is intended to include the endpoints thereof, and all integers and fractions within the range. It is not intended that the scope of the presently disclosed subject matter be limited to the specific values recited when defining a range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art to which the invention pertains. Although any methods and materials similar herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein. The following examples are offered by way of illustration and not by way of limitation.
EXAMPLES
Example 1 Identification of ROS 1 inhibitor resistance mutations
To experimentally identify a wide spectrum of mutations that confer ROS1 inhibitor resistance, a high complexity library of mutagenized FIG-ROS 1 cDNA subcloned into an MSCV retroviral vector was generated, then introduced into cells by viral transduction. ROS 1 inhibitor- resistant FIG-ROSl -expressing cells were selected by incubation with the ALK/MET/ROS1 inhibitor crizotinib (XALKORI®, Pfizer) and the mutational status of the ROS1 kinase domain expressed in the surviving drug-resistant clones was analyzed by sequencing of PCR amplicons. To verify that the observed mutations are the basis for drug resistance, each mutation is regenerated separately by site-directed mutagenesis of native FIG-ROSl and reintroduced into cells, followed by testing for inhibitor-mediated cytotoxicity.
Additional specifics of note regarding the aforementioned protocol include the following. The murine pro-B cell line BaF3, which is dependent on interleukin-3 (IL3) for its growth but is rendered IL3 -independent by ectopic expression of a constitutive ly active kinase such as FIG- ROSl, was used for the resistance selection studies described herein. Random mutations were introduced into the MSCV-FIG-ROS 1 cDNA by propagating it in XL-1 Red competent E. coli bacteria (Agilent Technologies), which are deficient in DNA repair mechanisms; infectious viral supernatant was prepared by bulk transfection of the high complexity mutagenized FIG-ROS 1 retrovirus library into HEK 293T packaging cells. Retrovirally-transduced BaF3 cells were selected in either soft agar or liquid cultures containing high concentrations (either 250 or 500 nM) of crizotinib (the IC50 for BaF3 cells expressing native FIG-ROSl being -100 nM crizotinib, as calculated using XTT assay [Roche]). PCR amplicons encompassing the ROS1 kinase domain from FIG-ROSl BaF3 cell clones resistant to crizotinib were generated using the following primers and their mutational status assessed by Sanger sequencing.
ROS1KDP01 5' catactcttccaacccaagaggag 3' (SEQ ID NO: 10)
ROSlKDP02a 5' gactccactgttgtttgcttcatc 3' (SEQ ID NO: 11)
Example 2: Selection of ROS1 inhibitor resistance mutations
Multiple crizotinib-resistant FIG-ROS l/BaF3 clones were selected at both the 250 and 500 nM concentrations; more than 350 clones were characterized by DNA sequence analysis to identify resistance mutations. Both singleton mutations as well as specific mutations repeated in many resistant clones were identified; the Table illustrates the complete spectrum of ROSl amino acid substitutions associated with ROSl kinase inhibitor resistance. As the case for BCR- ABL, AL fusions and other oncogenic kinases, the resistance mutations were scattered throughout the extent of the ROS 1 kinase domain. Further, as the case with other kinases and their inhibitors, it is predicted that the mutations shown in the Table below will confer varying degrees of resistance to other ROSl inhibitors in addition to crizotinib despite the use of crizotinib to identify them.
Table No. 1 : ROSl Inhibitor Resistance Mutations
Figure imgf000169_0001
All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the foregoing list of embodiments and appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
REFERENCES Aquaviva J, Wong R, Charest A. The multifaceted roles of the receptor tyrosine kinase ROS in development and cancer. Biochimica et Biophysica Acta 1795: 37-52, 2009.
Azam M, Latek RR, Daley GQ. Mechanisms of autoinhibition and STI-571/imatinib resistance revealed by mutagenesis of BCR-ABL. Cell 2003 Mar 21; 112(6):831-43.
Azam M, Raz T, Nardi V, Opitz SL, Daley GQ. A screen to identify drug resistant variants to target-directed anti-cancer agents. .Biol Proceed Online 2003; 5(1): 204-210.
Bergethon K, Shaw AT, Ou SH, Katayama R, Lovly CM, McDonald NT, Massion PP, Siwak- Tapp C, Gonzalez A, Fang R, Mark EJ, Batten JM, Chen H, Wilner KD, Kwak EL, Clark JW, Carbone DP, Ji H, Engelman JA, Mino-Kenudson M, Pao W, Iafrate AJ. ROS1 rearrangements define a unique molecular class of lung cancers. J Clin Oncol. 2012 Mar 10;30(8):863-70. Camidge DR, Doebele RC. Treating ALK-positive lung cancer—early successes and future challenges. Nat Rev Clin Oncol. 2012 Apr 3;9(5):268-77.
Sasaki T, Koivunen J, Ogino A, Yanagita M, Nikiforow S, Zheng W, Lathan C, Marcoux JP, Du J, Okuda K, Capelletti M, Shimamura T, Ercan D, Stumpfova M, Xiao Y, Weremowicz S, Butaney M, Heon S, Wilner K, Christensen JG, Eck MJ, Wong KK, Lindeman N, Gray NS, Rodig SJ, Janne PA. A novel ALK secondary mutation and EGFR signaling cause resistance to ALK kinase inhibitors.Cancer Res. 2011 Sep 15;71(18):6051-60.
Charest A, Kheifets V, Park J, Lane K, McMahon K, Nutt CL, Housman D. Oncogenic targeting of an activated tyrosine kinase to the Golgi apparatus in a glioblastoma. Proc Natl Acad Sci USA 100: 916-921, 2003.
Charest A, Lane K, McMahon K, Park J, Preisinger E, Conroy H, Housman D. Fusion of FIG to the receptor tyrosine kinase ROS in a glioblastoma with an interstitial del(6)(q21q21). Genes Chromosomes Cancer 37: 58-61, 2003.
Charest A, Wilker EW, McLaughlin ME, Lane K, Gowda R, Coven S, McMahon K, Kovach S, Feng Y, Yaffe MB, Jacks T, Housman D. ROS fusion tyrosine kinase activates a SH2 domain- containing phosphatase-2/phosphatidylinositol 3-kinase/mammalian target of rapamycin signaling axis to form glioblastoma in mice. Cancer Res 66: 7473-7481, 2006.
Chin LP, Soo RA, Soong R, Ou SH. Targeting ROS1 with anaplastic lymphoma kinase inhibitors: a promising therapeutic strategy for a newly defined molecular subset of non-small- cell lung cancer. J Thorac Oncol. 2012 Nov;7(l l):1625-30.
Davies KD, Le AT, Theodora MF, Skokan MC, Aisner DL, Berge EM, Terracciano LM,
Cappuzzo F, Incarbone M, Roncalli M, Alloisio M, Santoro A, Camidge DR, Varella-Garcia M, Doebele RC. Identifying and targeting ROS1 gene fusions in non-small cell lung cancer. Clin Cancer Res. 2012 Sep l;18(17):4570-9. Doebele RC, Pilling AB, Aisner DL, Kutateladze TG, Le AT, Weickhardt AJ, Kondo KL, Linderman DJ, Heasley LE, Franklin WA, Varella-Garcia M, Camidge DR. Mechanisms of resistance to crizotinib in patients with ALK gene rearranged non-small cell lung cancer. Clin Cancer Res. 2012 Mar l;18(5): 1472-82.
El-Deeb IM, Park BS, Jung SJ, Yoo KH, Oh CH, Cho SJ, Han DK, Lee JY, Lee SH. Design, synthesis, screening and molecular modeling study of a new series of ROS1 receptor tyrosine kinase inhibitors. Bioorg Med Chem Lett 19: 5622-5626, 2009.
El-Deeb IM, Yoo KH, Lee SH. ROS receptor tyrosine kinase: a new potential target for anticancer drugs. Med Res Rev 31 (5): 794-818, 2011.
Govindan R, Ding L, Griffith M, Subramanian J, Dees ND, Kanchi KL, Maher CA, Fulton R, Fulton L, Wallis J, Chen K, Walker J, McDonald S, Bose R, Ornitz D, Xiong D, You M, Dooling DJ, Watson M, Mardis ER, Wilson RK. Genomic landscape of non-small cell lung cancer in smokers and never-smokers. Cell. 2012 Sep 14;150(6):1121-34.
Gu T-L, Deng X, Huang F, Tucker M, Crosby K, Rimkunas V, Wang Y, Deng G, Zhu L, Tan Z, Hu Y, Wu C, Nardone J, MacNeill J, Ren J, Reeves C, Innocenti G, Norris B, Yuan J, Yu J, Haack H, Shen B, Peng C, Li H, Zhou X, Liu X, Rush J, Comb MJ. Survey of tyrosine kinase signaling reveals ROS kinase fusions in human cholangiocarcinoma. PLoS ONE 6(1): el5640, 2011.
Heuckmann JM, Holzel M, Sos ML, Heynck S, Balke-Want H, Koker M, Peifer M, Weiss J, Lovly CM, Griitter C, Rauh D, Pao W, Thomas RK. ALK mutations conferring differential resistance to structurally diverse ALK inhibitors. Clin Cancer Res. 2011 Dec 1 ; 17(23):7394-401.
Karvela M, Helgason GV, Holyoake TL. Mechanisms and novel approaches in overriding tyrosine kinase inhibitor resistance in chronic myeloid leukemia. Expert Rev Anticancer Ther. 2012 Mar;12(3):381-92.
Katayama R, Shaw AT, Khan TM, Mino-Kenudson M, Solomon BJ, Halmos B, Jessop NA,
Wain JC, Yeo AT, Benes C, Drew L, Saeh JC, Crosby K, Sequist LV, Iafrate AJ, Engelman JA. Mechanisms of acquired crizotinib resistance in ALK-rearranged lung cancers. Sci Transl Med. 2012 Feb 8;4(120): 120ral7.
Kim S, Kim TM, Kim DW, Go H, Keam B, Lee SH, Ku JL, Chung DH, Heo DS. J
Heterogeneity of Genetic Changes Associated with Acquired Crizotinib Resistance in ALK- Rearranged Lung Cancer. Thorac Oncol. 2013 Jan 22. [Epub ahead of print].
Komiya T, Thomas A, Khozin S, Rajan A, Wang Y, Giaccone G. Response to crizotinib in ROS 1 -rearranged non-small-cell lung cancer. J Clin Oncol. 2012 Sep 20;30(27):3425-6.
Lee J, Lee SE, Kang SY, Do IG, Lee S, Ha SY, Cho J, Kang WK, Jang J, Ou SH, Kim KM. Identification of ROS1 rearrangement in gastric adenocarcinoma. Cancer. 2013 Feb 7. [Epub ahead of print].
Lovly CM, Heuckmann JM, de Stanchina E, Chen H, Thomas RK, Liang C, Pao W. Insights into ALK-driven cancers revealed through development of novel ALK tyrosine kinase inhibitors. Cancer Res 71(14): 4920-4931, 2011. Marit MR, Chohan M, Matthew N, Huang K, Kuntz DA, Rose DR, Barber DL. Random mutagenesis reveals residues of JAK2 critical in evading inhibition by a tyrosine kinase inhibitor. PLoS One. 2012;7(8):e43437.
Ohashi K, Maruvka YE, Michor F, Pao W. Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor-Resistant Disease. J Clin Oncol. 2013 Feb 11. [Epub ahead of print].
Oxnard GR, Binder A, Janne PA. New Targetable Oncogenes in Non- Small-Cell Lung Cancer. J Clin Oncol. 2013 Feb 11. [Epub ahead of print].
Pao W, Hutchinson KE. Chipping away at the lung cancer genome. Nat Med. 2012 Mar
6;18(3):349-51.
Qi J, McTigue MA, Rogers A, Lifshits E, Christensen JG, Janne PA, Engelman JA. Multiple mutations and bypass mechanisms can contribute to development of acquired resistance to MET inhibitors. Cancer Res. 2011 Feb 1;71(3):1081-91.
Rikova K, Guo A, Zeng Q, Possemato A, Yu J, Haack H, Nardone J, Lee K, Reeves C, Li Y, Hu Y, Tan Z, Stokes M, Sullivan L, Mitchell J, Wetzel R, Macneill J, Ren JM, Yuan J, Bakalarski CE, Villen J, Kornhauser JM, Smith B, Li D, Zhou X, Gygi SP, Gu TL, Polakiewicz RD, Rush J, Comb MJ. Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer. Cell 131 : 1190-1203, 2007.
Rimkunas VM, Crosby KE, Li D, Hu Y, Kelly ME, Gu TL, Mack JS, Silver MR, Zhou X, Haack H. Analysis of receptor tyrosine kinase ROS1 -positive tumors in non-small cell lung cancer: identification of a FIG-ROS1 fusion. Clin Cancer Res. 2012 Aug 15;18(16):4449-57.
Sang J, Acquaviva J, Friedland JC, Smith DL, Sequeira M, Zhang C, Jiang Q, Xue L, Lovly CM, Jimenez J-P, Shaw AT, Doebele RC, He S, Bates RC, Camidge DR. Morris SW, El-Hairy I, Proia DA. Targeted Inhibition of the Molecular Chaperone Hsp90 Overcomes ALK Inhibitor Resistance in Non-Small Cell Lung Cancer. Cancer Discovery 2013 [epub ahead of print].
Sasaki T, Koivunen J, Ogino A, Yanagita M, Nikiforow S, Zheng W, Lathan C, Marcoux JP, Du J, Okuda K, Capelletti M, Shimamura T, Ercan D, Stumpfova M, Xiao Y, Weremowicz S, Butaney M, Heon S, Wilner K, Christensen JG, Eck MJ, Wong KK, Lindeman N, Gray NS, Rodig SJ, Janne PA. A novel ALK secondary mutation and EGFR signaling cause resistance to ALK kinase inhibitors.
Sasaki T, Okuda K, Zheng W, Butrynski J, Capelletti M, Wang L, Gray NS, Wilner K,
Christensen JG, Demetri G, Shapiro GI, Rodig SJ, Eck MJ, Janne PA. The neuroblastoma- associated Fl 174L ALK mutation causes resistance to an ALK kinase inhibitor in ALK- translocated cancers. Cancer Res. 2010 Dec 1 ;70(24): 10038-43.
Seo JS, Ju YS, Lee WC, Shin JY, Lee JK, Bleazard T, Lee J, Jung YJ, Kim JO, Shin JY, Yu SB, Kim J, Lee ER, Kang CH, Park IK, Rhee H, Lee SH, Kim JI, Kang JH, Kim YT. The
transcriptional landscape and mutational profile of lung adenocarcinoma. Genome Res. 2012 Nov;22(l l):2109-19.
Sequist LV, Gettinger S, Senzer NN, Martins RG, Janne PA, Lilenbaum R, Gray JE, Iafrate AJ, Katayama R, Hafeez N, Sweeney J, Walker JR, Fritz C, Ross RW, Grayzel D, Engelman JA, Borger DR, Paez G, Natale R. Activity of IPI-504, a novel heat-shock protein 90 inhibitor, in patients with molecularly defined non-small-cell lung cancer. J Clin Oncol 28: 4953-4960, 2010. Sonnenberg-Riethmacher E, Walter B, Riethmacher D, Godecke S, Birchmeier C. The c-ros tyrosine kinase receptor controls regionalization and differentiation of epithelial cells in the epididymis. Genes Dev 10: 1184-1193, 1996.
Suehara Y, Arcila M, Wang L, Hasanovic A, Ang D, Ito T, Kimura Y, Drilon A, Guha U, Rusch V, Kris MG, Zakowski MF, Rizvi N, Khanin R, Ladanyi M. Identification of KIF5B-RET and GOPC-ROS1 fusions in lung adenocarcinomas through a comprehensive mRNA-based screen for tyrosine kinase fusions. Clin Cancer Res. 2012 Dec 15;18(24):6599-608.
Takeuchi K, Soda M, Togashi Y, Suzuki R, Sakata S, Hatano S, Asaka R, Hamanaka W, Ninomiya H, Uehara H, Lim Choi Y, Satoh Y, Okumura S, Nakagawa K, Mano H, Ishikawa Y. RET, ROS1 and ALK fusions in lung cancer. Nat Med. 2012 Feb 12; 18(3):378-81.
Voena C, Chiarle R. The battle against ALK resistance: successes and setbacks. Expert Opin Investig Drugs. 2012 Dec;21(12):1751-4.
Webb TR, Slavish J, George RE, Look AT, Xue L, Jiang Q, Cui X, Rentrop WB, Morris SW. Anaplastic lymphoma kinase: role in cancer pathogenesis and small-molecule inhibitor development for therapy. Expert Rev Anticancer Ther 9: 331-356, 2009.
Yoshida A, Kohno T, Tsuta K, Wakai S, Arai Y, Shimada Y, Asamura H, Furuta K, Shibata T, Tsuda H. ROS1 -Rearranged Lung Cancer: A Clinicopathologic and Molecular Study of 15 Surgical Cases. Am J Surg Pathol. 2013 Feb 15. [Epub ahead of print].

Claims

CLAIMS What is Claimed is:
1. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:
a) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1 comrpising one or more of the amino acid substitutions listed in Table 1;
b) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NOl, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS1) small-molecule kinase inhibitor;
c) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
d) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor;
e) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
f) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: I, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
g) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
h) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor;
i) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
j) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS 1 small-molecule kinase inhibitor;
k) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
1) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
m) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
n) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
o) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
p) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
q) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
r) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
s) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
t) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
u) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
v) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
x) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
y) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
z) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aa) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bb) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
cc) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
dd) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ee) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ff) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
gg) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hh) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ii) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jj) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kk) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
11) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mm) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nn) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
oo) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
pp) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
qq) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
rr) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ss) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
tt) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
uu) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ww) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
xx) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
yy) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
zz) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aaa) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an iso leucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bbb) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ccc) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ddd) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
eee) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
fff) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ggg) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hhh) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
iii) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jjj) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kkk) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
111) a nucleotide sequence encoding an amino acid sequence having at least 90%o sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mmm) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nnn) a nucleotide sequence encoding an amino acid sequence having at least 90%) sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ooo) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; and
ppp) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor.
2. The isolated polynucleotide of claim 1, wherein said polynucleotide further comprises a nucleotide sequence encoding a ROS1 oncogenic fusion protein partner, and wherein said polynucleotide encodes a ROS1 oncogenic fusion protein.
3. The isolated polynucleotide of claim 2, wherein said ROS1 oncogenic fusion protein partner is selected from the group consisting of fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immunoglobulin-like domains 3 (LRIG3).
4. The isolated polynucleotide of claim 1, wherein said ROS1 small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113, X-396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP- 14083, CEP-14513, CEP-28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126.
5. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:
a) the amino acid sequence set forth in SEQ ID NO: 1 comprising one or more of the amino acid substitutions listed in Table 1 ;
b) an amino acid sequence having at least 90%> sequence identity to SEQ ID NOl, wherein the polynucleotide encodes a polypeptide having a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one receptor of sevenless (ROS1) small-molecule kinase inhibitor;
c) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
d) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
e) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
f) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
g) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
h) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
i) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
j) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
k) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
1) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
m) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
n) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
o) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
p) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
q) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
r) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
s) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
t) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
u) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
v) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
x) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
y) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
z) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aa) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bb) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
cc) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
dd) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ee) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ff) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
gg) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hh) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid or glutamine residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ii) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jj) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kk) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
11) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mm) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nn) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
oo) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
pp) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
qq) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
rr) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ss) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
tt) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
uu) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
w) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ww) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
xx) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
yy) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
zz) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
aaa) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
bbb) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ccc) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ddd) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
eee) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
fff) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ggg) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
hhh) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
iii) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
jjj) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
kkk) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
111) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
mmm) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
nnn) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor;
ooo) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROS1 small-molecule kinase inhibitor; and
ppp) an amino acid sequence having at least 90%> sequence identity to SEQ ID NO: 1, wherein the polynucleotide encodes a polypeptide having a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1, and wherein the polynucleotide encodes a polypeptide having kinase activity that is resistant to at least one ROSl small-molecule kinase inhibitor.
6. The isolated polypeptide of claim 5, wherein said polypeptide further comprises an ROSl oncogenic fusion protein partner, thus forming an ROSl oncogene fusion protein.
7. The isolated polypeptide of claim 6, wherein said ROSl oncogenic fusion protein partner is selected from the group consisting of fused in glioblastoma (FIG), cluster of differentiation 74 (CD74), solute carrier family 34 member 2 (SLC34A2), tropomyosin 3 (TPM3), syndecan 4 (SDC4), ezrin (EZR), and leucine-rich repeats and immunoglobulin-like domains 3 (LRIG3) or others.
8. The isolated polypeptide of claim 5, wherein said ROSl small-molecule kinase inhibitor is selected from the group consisting of XALKORI®, AP26113, X-396, NVP-TAE684, staurosporine, 7-hydroxystaurosporine, CEP- 14083, CEP-14513, CEP-28122, pyridone 14, pyridone 15, CRL151104A, and WZ-5-126 or others.
9. A kit for detecting an ROSl inhibitor resistance mutation in a biological sample comprising a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1; f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1;
g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO : 1 ;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 ; u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO : 1 ;
v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1; jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO : 1 ;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO : 1 ;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO : 1 ;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO : 1 ; yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1;
zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO : 1 ;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO : 1 ;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO : 1 ;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO : 1 ;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1; nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and
ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
10. The kit of claim 9, wherein said reagent comprises a pair of primers that amplify an amplicon comprising said ROSl inhibitor resistance mutation.
11. The kit of claim 9, wherein said reagent comprises at least one probe comprising a polynucleotide sequence that hybridizes under stringent conditions to said ROSl kinase inhibitor resistance mutant polynucleotide and thereby detects the ROSl inhibitor resistance mutation.
12. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with the antibody specific for a ROSl inhibitor resistance mutation, and detecting binding of said antibody to ROSl having said ROSl inhibitor resistance mutation, wherein the presence of said ROSl having said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
13. A method for assaying a biological sample for an ROSl inhibitor resistance mutation comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes an ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1; c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1;
f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1;
g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1; r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO : 1 ;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 ;
u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO : 1 ;
v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1; gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1;
jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO : 1 ;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO : 1 ;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO : 1 ; w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO : 1 ;
yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1;
zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO : 1 ;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO : 1 ;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO : 1 ;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO : 1 ; kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1;
nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and
ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
14. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a patient having cancer that is associated with aberrant ROSl activity comprising assaying a biological sample from said patient for the presence of an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify an ROSl kinase inhibitor resistance mutant polynucleotide having an ROSl inhibitor resistance mutation, wherein said ROSl kinase inhibitor resistance mutant polynucleotide encodes a ROSl kinase inhibitor resistance mutant polypeptide that is resistant to at least one ROSl small-molecule kinase inhibitor, wherein said ROSl kinase inhibitor resistance mutant polypeptide has at least one ROSl kinase inhibitor resistance mutant residue selected from the group consisting of:
a) a glutamine residue at the position corresponding to amino acid residue position 1945 of SEQ ID NO: 1;
b) a serine residue at the position corresponding to amino acid residue position 1946 of SEQ ID NO: 1;
c) a methionine residue thereof at the position corresponding to amino acid residue position 1947 of SEQ ID NO: 1;
d) a serine residue at the position corresponding to amino acid residue position 1948 of SEQ ID NO: 1;
e) a valine residue at the position corresponding to amino acid residue position 1951 of SEQ ID NO: 1; f) a valine residue at the position corresponding to amino acid residue position 1958 of SEQ ID NO: 1;
g) a glutamic acid residue at the position corresponding to amino acid residue position 1959 of SEQ ID NO: 1;
h) a lysine residue at the position corresponding to amino acid residue position 1961 of SEQ ID NO: 1;
i) a glutamic acid residue at the position corresponding to amino acid residue position 1962 of SEQ ID NO: 1;
j) a methionine residue at the position corresponding to amino acid residue position 1981 of SEQ ID NO: 1;
k) a tyrosine residue at the position corresponding to amino acid residue position 1986 of SEQ ID NO: 1;
1) a lysine residue at the position corresponding to amino acid residue position 1990 of SEQ ID NO: 1;
m) a lysine residue at the position corresponding to amino acid residue position 1993 of SEQ ID NO: 1;
n) a valine residue at the position corresponding to amino acid residue position 2000 of SEQ ID NO: 1;
o) an asparagine residue at the position corresponding to amino acid residue position 2002 of SEQ ID NO: 1;
p) a leucine residue at the position corresponding to amino acid residue position 2004 of SEQ ID NO: 1;
q) a histidine residue at the position corresponding to amino acid residue position 2008 of SEQ ID NO: 1;
r) a leucine residue at the position corresponding to amino acid residue position 2009 of SEQ ID NO: 1;
s) a methionine residue at the position corresponding to amino acid residue position 2010 of SEQ ID NO : 1 ;
t) an asparagine residue at the position corresponding to amino acid residue position 2011 of SEQ ID NO : 1 ; u) a glycine residue at the position corresponding to amino acid residue position 2016 of SEQ ID NO : 1 ;
v) an aspartic acid or tyrosine residue at the position corresponding to amino acid residue position 2019 of SEQ ID NO: 1;
w) a histidine residue at the position corresponding to amino acid residue position 2022 of SEQ ID NO: 1;
x) a methionine residue at the position corresponding to amino acid residue position 2026 of SEQ ID NO: 1;
y) a methionine residue at the position corresponding to amino acid residue position 2028 of SEQ ID NO: 1;
z) a lysine residue at the position corresponding to amino acid residue position 2029 of SEQ ID NO: 1;
aa) a lysine residue at the position corresponding to amino acid residue position 2030 of SEQ ID NO: 1;
bb) an arginine residue at the position corresponding to amino acid residue position 2032 of SEQ ID NO: 1;
cc) a glycine residue at the position corresponding to amino acid residue position 2033 of SEQ ID NO: 1;
dd) an isoleucine residue at the position corresponding to amino acid residue position 2035 of SEQ ID NO: 1;
ee) an isoleucine or asparagine residue at the position corresponding to amino acid residue position 2036 of SEQ ID NO: 1;
ff) a glycine, histidine, methionine, asparagrine, or serine residue at the position corresponding to amino acid residue position 2039 of SEQ ID NO: 1;
gg) a glutamic acid or glutamate residue at the position corresponding to amino acid residue position 2040 of SEQ ID NO: 1;
hh) a serine residue at the position corresponding to amino acid residue position 2052 of SEQ ID NO: 1;
ii) a proline residue at the position corresponding to amino acid residue position 2059 of SEQ ID NO: 1; jj) a proline residue at the position corresponding to amino acid residue position 2077 of SEQ ID NO: 1;
kk) a tryptophan residue at the position corresponding to amino acid residue position 2078 of SEQ ID NO: 1;
11) an isoleucine residue at the position corresponding to amino acid residue position 2087 of SEQ ID NO: 1;
mm) an asparagine residue at the position corresponding to amino acid residue position 2091 of SEQ ID NO: 1;
nn) an asparagine residue at the position corresponding to amino acid residue position 2092 of SEQ ID NO: 1;
oo) an asparagine residue at the position corresponding to amino acid residue position 2094 of SEQ ID NO: 1;
pp) an isoleucine residue at the position corresponding to amino acid residue position 2098 of SEQ ID NO: 1;
qq) an asparagine residue at the position corresponding to amino acid residue position 2099 of SEQ ID NO: 1;
rr) a valine residue at the position corresponding to amino acid residue position 2100 of SEQ ID NO : 1 ;
ss) an alanine residue at the position corresponding to amino acid residue position 2101 of SEQ ID NO: 1;
tt) a proline residue at the position corresponding to amino acid residue position 2106 of SEQ ID NO : 1 ;
uu) a threonine residue at the position corresponding to amino acid residue position 2107 of SEQ ID NO : 1 ;
w) a threonine residue at the position corresponding to amino acid residue position 2116 of SEQ ID NO : 1 ;
ww) a glycine or leucine residue at the position corresponding to amino acid residue position 2125 of SEQ ID NO: 1;
xx) a glycine residue at the position corresponding to amino acid residue position 2127 of SEQ ID NO : 1 ; yy) an aspartic acid or lysine residue at the position corresponding to amino acid residue position 2131 of SEQ ID NO: 1;
zz) an isoleucine residue at the position corresponding to amino acid residue position 2134 of SEQ ID NO : 1 ;
aaa) an isoleucine or serine residue at the position corresponding to amino acid residue position 2139 of SEQ ID NO: 1;
bbb) a histidine residue at the position corresponding to amino acid residue position 2141 of SEQ ID NO: 1;
ccc) a tyrosine residue at the position corresponding to amino acid residue position 2142 of SEQ ID NO: 1;
ddd) a glutamic acid residue at the position corresponding to amino acid residue position 2148 of SEQ ID NO: 1;
eee) an asparagine residue at the position corresponding to amino acid residue position 2151 of SEQ ID NO: 1;
fff) a methionine residue at the position corresponding to amino acid residue position 2154 of SEQ ID NO : 1 ;
ggg) a histidine residue at the position corresponding to amino acid residue position 2160 of SEQ ID NO : 1 ;
hhh) an aspartic acid residue at the position corresponding to amino acid residue position 2165 of SEQ ID NO: 1;
iii) an aspartic acid residue at the position corresponding to amino acid residue position 2181 of SEQ ID NO: 1;
jjj) a threonine residue at the position corresponding to amino acid residue position 2184 of SEQ ID NO : 1 ;
kkk) an aspartic acid residue at the position corresponding to amino acid residue position 2201 of SEQ ID NO: 1;
111) an isoleucine residue at the position corresponding to amino acid residue position 2205 of SEQ ID NO: 1;
mmm) an isoleucine residue at the position corresponding to amino acid residue position 2207 of SEQ ID NO: 1; nnn) a proline residue at the position corresponding to amino acid residue position 2209 of SEQ ID NO: 1; and
ooo) a histidine or proline residue at the position corresponding to amino acid residue position 2212 of SEQ ID NO: 1.
and detecting the presence or absence of said ROSl inhibitor resistance mutation in said biological sample, wherein the presence of said ROSl inhibitor resistance mutation is indicative of said patient having a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor.
15. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject comprising assaying a biological sample from said subject for the presence of an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with an antibody that specifically binds the polypeptide of any one of any preceding aspect; and detecting binding of said antibody to said ROSl oncogenic fusion protein having an ROSl kinase inhibitor resistance mutation; wherein the presence of said ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
16. A method for diagnosing a cancer that is resistant to or likely to develop resistance to at least one ROSl small-molecule kinase inhibitor in a subject comprising assaying a biological sample from said subject for the presence of a polynucleotide encoding an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, said method comprising contacting said biological sample with a reagent comprising at least one polynucleotide that can specifically detect or specifically amplify the polynucleotide encoding an ROSl oncogenic fusion protein having an ROSl inhibitor resistance mutation, wherein said at least one polynucleotide is capable of specifically detecting or specifically amplifying the polynucleotide according to any preceding aspect; and detecting the presence or absence of said polynucleotide encoding a ROSl oncogenic fusion protein having said ROSl inhibitor resistance mutation in said biological sample; wherein the presence of said polynucleotide encoding said ROSl oncogenic fusion protein having said ROSl inhibitor resistance mutation is indicative of said subject having a cancer that is resistant to or likely to develop resistance to at least one ROSl small molecule kinase inhibitor.
17. A method of specifically reducing the expression of an ROSl kinase inhibitor resistance mutant that is resistant to at least one ROSl small-molecule kinase inhibitor, said method comprising introducing into a cell expressing said ROSl kinase inhibitor resistance mutant a silencing element that targets a gene encoding said ROSl kinase inhibitor resistance mutant, wherein the introduction or expression of said silencing element specifically reduces the expression of said ROSl kinase inhibitor resistance mutant.
18. A method of treating a cancer associated with aberrant ROSl activity that is resistant to at least one ROSl small-molecule kinase inhibitor, said method comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to said at least one ROSl small-molecule kinase inhibitor, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant.
19. A method of treating a cancer associated with aberrant ROSl activity that is resistant to XALKORI®, said method comprising administering an effective amount of a silencing element that targets a gene encoding an ROSl kinase inhibitor resistance mutant that is resistant to XALKORI®, wherein the introduction or expression of said silencing element reduces the expression of said ROSl kinase inhibitor resistance mutant, wherein said ROSl kinase inhibitor resistance mutant is a polypeptide comprising any mutant amino acid sequence disclosed herein.
20. A method of identifying an agent capable of inhibiting the kinase activity of an ROSl kinase inhibitor resistance mutant or ROSl fusion protein comprising:
a) contacting a candidate agent with the polypeptide of any preceding aspect; and,
b) determining whether said candidate agent inhibits the kinase activity of said polypeptide.
21. A method of identifying an agent capable of specifically binding a polypeptide of any preceding aspectcomprising the steps of:
a) contacting a candidate agent with said polypeptide of any preceding aspect; and, b) determining whether said candidate agent specifically binds said polypeptide.
PCT/US2014/027720 2013-03-15 2014-03-14 Methods and compositions for the diagnosis and treatment of cancers resistant to ros1 inhibitors WO2014152777A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361800230P 2013-03-15 2013-03-15
US61/800,230 2013-03-15

Publications (2)

Publication Number Publication Date
WO2014152777A2 true WO2014152777A2 (en) 2014-09-25
WO2014152777A3 WO2014152777A3 (en) 2014-11-13

Family

ID=51581746

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/027720 WO2014152777A2 (en) 2013-03-15 2014-03-14 Methods and compositions for the diagnosis and treatment of cancers resistant to ros1 inhibitors

Country Status (1)

Country Link
WO (1) WO2014152777A2 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140243332A1 (en) * 2013-02-27 2014-08-28 Oregon Health & Science University Methods of treating cancers characterized by aberrent ros1 activity
US20170145517A1 (en) * 2015-11-20 2017-05-25 Oregon Health & Science University Methods of detecting cancers sensitive to cabozantinib
CN108531598A (en) * 2018-05-07 2018-09-14 广州迈景基因医学科技有限公司 ROS1 Gene Fusions detection primer, method and kit
US10588908B2 (en) 2016-04-04 2020-03-17 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10590139B2 (en) 2008-09-22 2020-03-17 Array Biopharma Inc. Method of treatment using substituted imidazo[1,2b]pyridazine compounds
US10647730B2 (en) 2010-05-20 2020-05-12 Array Biopharma Inc. Macrocyclic compounds as TRK kinase inhibitors
US10655186B2 (en) 2015-10-26 2020-05-19 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10668072B2 (en) 2016-04-04 2020-06-02 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US10688100B2 (en) 2017-03-16 2020-06-23 Array Biopharma Inc. Macrocylic compounds as ROS1 kinase inhibitors
US10758542B2 (en) 2009-07-09 2020-09-01 Array Biopharma Inc. Substituted pyrazolo[l,5-a]pyrimidine compounds as Trk kinase inhibitors
US10774085B2 (en) 2008-10-22 2020-09-15 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-A] pyrimidine compounds
US10799505B2 (en) 2014-11-16 2020-10-13 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US11091486B2 (en) 2016-10-26 2021-08-17 Array Biopharma, Inc Process for the preparation of pyrazolo[1,5-a]pyrimidines and salts thereof
US11214571B2 (en) 2016-05-18 2022-01-04 Array Biopharma Inc. Process for the preparation of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide and salts thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011070148A1 (en) * 2009-12-11 2011-06-16 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Differential diagnosis and therapy for kinase inhibitors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011070148A1 (en) * 2009-12-11 2011-06-16 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Differential diagnosis and therapy for kinase inhibitors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
THEODORAKI ET AL.: 'ROS1 Asp2213Asn polymorphism is not associated with coronary artery disease in a Greek case-control study.' CLIN CHEM LAB MED. vol. 47, no. 12, 2009, pages 1471 - 3 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10590139B2 (en) 2008-09-22 2020-03-17 Array Biopharma Inc. Method of treatment using substituted imidazo[1,2b]pyridazine compounds
US11267818B2 (en) 2008-10-22 2022-03-08 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-a] pyrimidine compounds
US10774085B2 (en) 2008-10-22 2020-09-15 Array Biopharma Inc. Method of treatment using substituted pyrazolo[1,5-A] pyrimidine compounds
US10758542B2 (en) 2009-07-09 2020-09-01 Array Biopharma Inc. Substituted pyrazolo[l,5-a]pyrimidine compounds as Trk kinase inhibitors
US10647730B2 (en) 2010-05-20 2020-05-12 Array Biopharma Inc. Macrocyclic compounds as TRK kinase inhibitors
US20140243332A1 (en) * 2013-02-27 2014-08-28 Oregon Health & Science University Methods of treating cancers characterized by aberrent ros1 activity
US10813936B2 (en) 2014-11-16 2020-10-27 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-YL)-pyrazolo[1,5-A]pyrimidin-3-YL)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US10799505B2 (en) 2014-11-16 2020-10-13 Array Biopharma, Inc. Crystalline form of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-A]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide hydrogen sulfate
US10724102B2 (en) 2015-10-26 2020-07-28 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10655186B2 (en) 2015-10-26 2020-05-19 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10907215B2 (en) 2015-10-26 2021-02-02 Loxo Oncology, Inc. Point mutations in TRK inhibitor-resistant cancer and methods relating to the same
US10100366B2 (en) * 2015-11-20 2018-10-16 Oregon Health & Science University Methods of detecting cancers sensitive to cabozantinib
US20170145517A1 (en) * 2015-11-20 2017-05-25 Oregon Health & Science University Methods of detecting cancers sensitive to cabozantinib
US10588908B2 (en) 2016-04-04 2020-03-17 Loxo Oncology, Inc. Methods of treating pediatric cancers
US11191766B2 (en) 2016-04-04 2021-12-07 Loxo Oncology, Inc. Methods of treating pediatric cancers
US10668072B2 (en) 2016-04-04 2020-06-02 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US11484535B2 (en) 2016-04-04 2022-11-01 Loxo Oncology, Inc. Liquid formulations of (S)-N-(5-((R)-2-(2,5-difluorophenyl)-pyrrolidin-1-yl)-pyrazolo[1,5-a] pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide
US11214571B2 (en) 2016-05-18 2022-01-04 Array Biopharma Inc. Process for the preparation of (S)-N-(5-((R)-2-(2,5-difluorophenyl)pyrrolidin-1-yl)-pyrazolo[1,5-a]pyrimidin-3-yl)-3-hydroxypyrrolidine-1-carboxamide and salts thereof
US11091486B2 (en) 2016-10-26 2021-08-17 Array Biopharma, Inc Process for the preparation of pyrazolo[1,5-a]pyrimidines and salts thereof
US10688100B2 (en) 2017-03-16 2020-06-23 Array Biopharma Inc. Macrocylic compounds as ROS1 kinase inhibitors
US10966985B2 (en) 2017-03-16 2021-04-06 Array Biopharma Inc. Macrocyclic compounds as ROS1 kinase inhibitors
CN108531598A (en) * 2018-05-07 2018-09-14 广州迈景基因医学科技有限公司 ROS1 Gene Fusions detection primer, method and kit

Also Published As

Publication number Publication date
WO2014152777A3 (en) 2014-11-13

Similar Documents

Publication Publication Date Title
EP2558490B1 (en) Methods and compositions for the diagnosis and treatment of cancer resistant to anaplastic lymphoma kinase (alk) kinase inhibitors
WO2014152777A2 (en) Methods and compositions for the diagnosis and treatment of cancers resistant to ros1 inhibitors
EP3296407B1 (en) Mutations of the pik3ca gene in human cancers
KR101203003B1 (en) Identification of a jak2 mutation in polycythemia vera
JP5512125B2 (en) Recurrent gene fusion in prostate cancer
JP2018019720A (en) Recurrent gene fusions in prostate cancer
US10175244B2 (en) Dominant negative HSP110 mutant and its use in prognosing and treating cancers
WO2013089882A2 (en) Recurrent gene fusions in breast cancer
WO2006078911A2 (en) Gitr antibodies for the diagnosis of nsclc
US20170334966A1 (en) Anti-tumor antibody-tumor suppressor fusion protein compositions and methods of use for the treatment of cancer
US20110047634A1 (en) Methods and compositions for the diagnosis and treatment of acute lymphoblastic leukemia
MX2007008691A (en) Gitr antibodies for the diagnosis of nsclc

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14767706

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 14767706

Country of ref document: EP

Kind code of ref document: A2