WO2014152747A1 - Engineering rubber production in plants - Google Patents
Engineering rubber production in plants Download PDFInfo
- Publication number
- WO2014152747A1 WO2014152747A1 PCT/US2014/027689 US2014027689W WO2014152747A1 WO 2014152747 A1 WO2014152747 A1 WO 2014152747A1 US 2014027689 W US2014027689 W US 2014027689W WO 2014152747 A1 WO2014152747 A1 WO 2014152747A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- guayuie
- guayule
- plants
- transplastomic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
- C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Definitions
- the invention in exemplary embodiments the invention relates to transformation of
- Parthenhmi arge.ntatu Gray (guayule) chloroplasts and to transformed Parthenhmi argen latum capable of producing increased amounts of natural rubber.
- P rthenwm argeriiatum Gray commonly know as guayule, is a shrub in the family Asteraeeae, native to the southwestern United States and northern Mexico. P.
- argen latum produces high quality rubber in bark tissue and finds particular value as an alternative source of natural rubber latex.
- Natural rubber, cis-1, 4-polyisoprene, is essential and irreplaceable in many industrial applicaiicais. Because of its desirable properties, the demand for natural rubber is rising, making natural rubber increasingly more precious as an industrial material. To meet demand at sustainable costs, it is desirable to increase the quantity and/or quality of natural latex rubber produced from guayule. Indeed, increasing the quantity of available natural rubber latex wiil benefit agricultural workers and many industries and thus, humankind in general.
- the present disclosure provides a method for transforming guayule chloroplasts to provide a transplasioniic guayule plant, the method comprising: (i) growing guayule plants on hormone free media supplemented with activated charcoal to provide cultured guayule plants; (ii) collecting leaves from the cultured guayule plants to provide leaves from the cultured guayule plants; (iii) placing the leaves from the cultured guayule plants in medium comprising trans-zeotin-iiboside for bombarding and recovery; (iv) bombarding the leaves from the cultured guayule plants with gold particles, wherein the gold particles are coated with chloropiajst transformation vector DNA, and wherein the ehloropiast transformation vector DNA comprises guayule specific flanking sequences that target insertion of the ehloropiast transformation DNA to ehloropiast DNA, thereby providing bombarded
- the disclosure provides a transplastomic guayule plant made according to the method for transforming guayule chloroplasts to provide a transplastomic guayule plant.
- the transplastomic guayule plant comprises recombinant cMoroplasts transformed with the 6-gene cluster comprising the complete cytosolic nievalonate pathway.
- the transplastomic guayule plant is capable of producing increased amounts of isopenry .pyrophosphate and increased amounts of natural latex.
- the disclosure provides a transplastomic seed of the transplastomic guayule plant.
- the disclosure provides a transplastomic guayule plant, or a part thereof, produced by growing the seed, hi another exemplary embodiment, the disclosure provides a tissue culture of regenerable transplastomic cells produced from the traiisplastomic guayule plant. In another exemplary embodiment, the disclosure provides a transplastomic protoplast produced from the tissue culture. In another exemplary embodiment, the disclosure provides a transplastomic guayule plant, regenerated from the tissue culture. In another exemplary embodiment, the disclosure provides a hybrid transplastomic guayule plant, wherein the lineage of at least one parent plant comprises the transplastomic guayule plant.
- the disclosure provides a transplastomic guayule plant or part thereof.
- the transplastomic guayule plant comprises recombinant cMoropiasts transformed with the 6-gene cluster comprising the complete cytosolic nievalonate pathway.
- the transplastomic guayule plant is capable of producing increased amounts of isopentylpyrophosphate and increased amounts of natural latex.
- the disclosure provides a transplastomic seed of the transplastomic guayule plant, hi another exemplary embodiment, the disclosure provides a transplastomic guayule plant, or a part thereof, produced by growing the seed, hi another exemplary embodiment, the disclosure provides a tissue culture of regenerable traiisplastomic cells produced from the transplastomic guayule plant, In another exemplary embodiment, the disclosure provides a transplastomic protoplast produced from the tissue culture, In another exemplary embodiment, the disclosure provides a transplastomic guayule plant, regenerated from the tissue culture, hi still another
- the disclosure provides a hybrid transplastomic guayule plant, wherein the lineage of at least one parent plant comprises the transplastomic guayule plant.
- FIG. 1 iliiistiaies SEQ ID NO: 1, the nucleic acid sequence of a piastid transformation vector pUY-MEV6 comprising full length synthetic operon encoding the complete cytosoiic mevalonate pathway.
- FIG. 2. Provides a diagrammatic representation of pUY-MEV6 shown as SEQ ID NO: 1 in FIG. 1.
- the 6-gene cluster comprising the complete mevalonate pathway from pUY-MEV6 (see e.g. Kumar ei ai. 2012 Metab Eng. 2012 Jan: 14(1): 19-28) was used to replace the Tips 16 and the PpsbA-5' TJTR in plasmid pUY- Gua-aadANPTITGFP, resulted a the final plasmid containing 9 genes and 16075 bp.
- FIG. 3 iliiistiaies Guayule Specific Chloroplast transformation vector (pUY- Gua-aadA/NFrn GFP).
- FIG. 4 The vector pUY-Gua-aadA/npfll GFP (aka pUY-Gna-spec/kan/GFP) was tested with Ndel-Xbal digestion. The small bands in the middle lane and the right lane showed different sizes, representing ⁇ gene plus GFP gene or NPTII gene analog. A GFP fluorescence was observed in the E.coli cells under a fluorescent microscope as shown below the gel image, illustrating the functionality of the GFP gene in this construct.
- FIG. 5 Greenhouse guayule plants
- A non-transgenic control plant
- B pUY- Giia-aadA NPTn/GFP transgenic plant
- C pUY-Giia-MEV6 transgenic plant. The figure illustrates that there were no significant differences among 9-week-okl transgenic and non- transgenic plants in plant height and shape of plants.
- FIG. 6 A: PC amplification with HMGS gene primers (forward 5'- TTGGACTTCCCGGACATTAG -3 ', SEQ ID NO: 2 primers and reverse 5 '- TTTCTCGGTGACCAACACAC -3 ', SEQ ID O:3).
- Lane 1 1 Kb marker
- lane 2 plasmid DNA
- lane 3 non-transgenic control plant
- lanes 4 and 5 pUY-Gua-MEV6 transgenic plants 0.7 bp).
- FIG 6 B PCR amplification with aadA-GFP gene primers (forward 5'- TGAATGAACTGCAGGACGAG -3', SEQ ID NO: 4 primers and reverse 5'- GGGTGTTCTGCTGGTAGTGG -3', SEQ ID NGi5).
- Lane 1 1 Kb marker
- lane 2 plasmid DNA
- lane 3 non- transgenic control plant
- lanes 4 and 5 pUY-Gua-aadA/NPTII GFP transgenic plants (1.2 kb).
- isopenfylpyropliosphate'' refers to the ability of a transplastoniic guayuie plant as disclosed herein, to biosynthesize at least about 25% or more
- IPP isopenfylpyropliosphate
- complete cytosolic mevaionate pathway refers to an isoprenoid synthetic pathway located hi the cytosoi of animals, plants and fungi e.g., yeast, which produces isopentenyi diphosphate (IPP) condensation of three molecules of acetyl coenzyme A (CoA).
- IPP isopentenyi diphosphate
- the six genes that comprise the complete cytosolic mevaionate pathway are: acetoacetyl-CoA syntha.se, 3-hydiOxy-3-iiiethyiglutoyl-CoA (HMG-CoA) synthase, HMG-CoA reductase, mevaionate kinase, phosphonievalonate kinase, and pyrophosphomevaloiiate decarboxylase,
- isopentylpyrophosphate and increased amounts of natural latex refers to the ability of plants to biosynthesize a t least about 25% or more natural rubber than is produced from an otherwise isogenic non-transplastomic guayuie plant.
- An operon is "synthetic" by virtue of the fact that it is constructed in vitro, rather than being naturally occurring.
- the six yeast genes that comprise the complete cytosolic mevaionate pathway are cloned into an expression vector to create a "synthetic operon" that encodes the complete cytosolic mevaionate pathway.
- plant refers to whole plants, plant bodies, plant organs (e.g., leaves, stems, flowers, roots, etc.), seeds, plant tissues, plant cells and progeny of same, hi an exemplary embodiment, a plant cell includes callus. In another exemplary embodiment, a plant organ includes a root, a leaf, a flower and/or the like.
- plant refers to the broad class of higher plants amenable to transformation techniques.
- plant also includes plants of any variety of ploidy levels, including polyploid, diploid, haploid and hemizygous. Exemplary plants include e.g., dicotyledonous plants of the family Asteraeeae e.g., Parthemum argeniatum.
- transplastoinic plant refers to a plant comprising at least one heterologous nucleic acid sequence that was introduced into the plant chloroplasts. a t some point in its lineage, by genetic engineering techniques.
- a transplastomic plant is a plant whose plastids are transformed with an expression vector comprising a synthetic operon thai encodes the six enzymes thai comprise the complete cytosolic mevalonate pathway.
- a transplastomic plant is a plant whose plastids are transformed with an expression vector comprising a synthetic operon that encodes the HMG-CoA reductase (HMGR).
- HMGR HMG-CoA reductase
- a traiisplasioime plant is a plant that is the progeny or decendant of a transplastomic plant transformed with an expression vector comprising a synthetic operon thai encodes the six enzymes thai comprise the complete cytosolic mevalonate pathway, wherein the progeny or decendani is a iransplastomic plant whose plastids contain the synthetic operon that encodes the six enzymes that comprise the complete cytosolic mevalonate pathway.
- the term "transplastomic plant” refers to plants which are the direct result of transformation with a heterologous nucleic acid or transgene. and the progeny and decendants of transfornied plants which themselves comprise the introduced heterologous nucleic acid or transgene.
- isolated refers to material that is substantially or essentially free from components that normally accompany it as found in its native state.
- purity and homogeneity are determined using analytical chemistry techniques such as polyacrylamide gel
- a nucleic acid that is the predominant species present in a preparation is substantially pur ified.
- an isolated nucleic acid or a fragment thereof is separated from open reading frames and/or other nucleic acid sequences that flank the nucleic acid or a fragment thereof in its native state.
- the term "purified” denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
- isolated nucleic acids or proteins have a level of purity expressed as a range. The lower end of the range of purity for the component is about 60%, about 70% or about 80% and the upper end of the range of purity is about 70%, about 80%, about 90% or more than about 90%.
- nucleic acid refers to a polymer of ribonucleotides or deoxyribonucleotides. Typically, “nucleic acid” polymers occur in either single- or double- stranded form, but are also known to form structures comprising three or more strands.
- nucleic acid includes naturally occurring nucleic acid polymers as well as nucleic acids comprising known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- Exemplary analogs include, without limitation, phosphorothioates, phosphoranrklates, methyl phosphonaies, chiral-merhyl phosphonates, 2- O-methyi ribonucleotides, peptide-nueleie acids (PNAs).
- PNAs peptide-nueleie acids
- nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (see e.g., Batzer et oL, Nucleic Acid Res. 19:5081 (1 91); Ohtsuka e.f at, J. Biol. Chem. 260:2605-2608 (1985); and Rossolim et at. Mol. Cell. Probes 8:91-98 (1994)).
- polypeptide refers to a polymer of amino acid residues. The terms apply to natur ally occurring amino acid polymers and non-naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a corresponding naturally occurring amino acid.
- amino acid refers to naturally occurring and synthetic amino acids, as well as annuo acid analogs and annuo acid ininietics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those annuo acids that are later modified, e.g. , hydroxyproline.
- Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoseiine, noileucine, methionine sulfoxide, methionine methyl siilfonium. Such analogs have modified R groups (e.g. , noileucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
- Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an annuo acid, but that functions in a manner similar to a naturally occurring amino acid.
- Amino acids are referred to herein by either then commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
- Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not e code an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon is altered to any of the corresponding codons described without altering the encoded polypeptide.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino a cid.
- Macromolecular structures such as polypeptide structures are described in terms of various levels of organization. For a general discussion of this organization, see, e.g. , Alberts ei at.. Molecular Biology of the Cell (3 rd ed., 1994) and Cantor and Schiinmel, Biophysical Chemistry Part I: The Conformation of Biological Macromolecuies (1 80).
- Primary structure refers to the amino acid sequence of a particular peptide.
- “Secondary structure” refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains. Domains ar e portions of a polypeptide that form a compact unit of the polypeptide and are typically 50 to 350 amino acids long.
- Typical domains are made up of sections of lesser organization such as stretches of ⁇ -sheet and a-helices.
- Tetiary structure refers to the complete three dimensional structure of a polypeptide monomer.
- Quaternary structure refers to the three dimensional structure formed by the noncovalent association of independent tertiary units. Anisotropic terms are also known as energy terms.
- label refers to a composition detectable by
- Exemplary labels include J ⁇ P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available.
- nucleic acid probe or oligonucleotide refers to a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation.
- a probe may include natural f..e.. A, G, C, or T) or modified bases (e.g. , 7-deazaguanosine, mosme, etc.).
- the bases in a probe may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization.
- probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. It will be understood by one of skill in the ait that probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the
- probes are directly labeled as with isotopes, chromophores. lumiphores, chromogens etc. hi other exemplar ⁇ ' embodiments probes are indirectly labeled e.g., with biotin to which a srreptavidm complex may later bind. By assaying for the presence or absence of the probe, one can detect the presence or absence of the select sequence or subsequence.
- labeled nucleic acid probe or oligonucleotide refers to a probe that is bound, either covalently, through a linker or a chemical bond, or iioneovaieiitly, through ionic, van der Waals, electrostatic, or hydrogen bonds to a label such that the presence of the probe may be detected by detecting the presence of the label bound to the probe .
- primer refers to short nucleic acids, typically DNA oligonucleotides of at least about 15 nucleotides in length.
- primers are annealed to a complementary target DNA stand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand. Annealed primers are then extended along the target DNA strand by a DNA polymerase enzyme.
- Primer pairs can be vised for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
- PCR polymerase chain reaction
- PCR primer pairs are typically derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5 ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
- Primer Very 0.5 ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.
- a primer comprising 20 consecutive nucleotides of a guayule chloroplast genome sequence nucleic acid or a cytosolic mevalonaie pathway nucleic acid will anneal to a related target sequence with a higher specificity than a corresponding primer of only 15 nucleotides.
- .gr eater specificity of a nucleic acid primer or probe is attained with probes and primers selected to comprise 20, 25, 30, 35. 40, 50 or more consecutive nucleotides of a selected sequence.
- nucleic acid probes and primers are readily prepared based on the nucleic acid sequences disclosed herein. Methods for prepar ing and using probes and primers and for labeling and guidance in the choice of labels appropriate for various piuposes are discussed. e.g., in Sambrook et ah, Molecular Cloning, A Laboratory Manual 2nd ed. 1989, Cold Spring Harbor Laboratory; and Current Protocols in Molecular Biology, Ausubel et al. , eds., 1994, John Wiley & Sons).
- recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the ceil, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
- recombinant cells comprise and or express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, over expressed, under expressed or not expressed at all.
- promoter or “promoter complex” or "promoter sequence” as used herein refers to an array of nucleic acid expression control sequences that direct
- a “promoter” or “promoter complex” or “promoter sequence” comprises necessary nucleic acid sequences near the start site of transcription, such as, e.g., a polymerase II type promoter, a TATA element etc to "control" tr anscription of an operably linked nucleic acid, in some exemplary embodiments, a
- promoter complex or "promoter sequence” also includes distal enhancer or repressor elements, which can be, but are not necessarily located as much as several thousand base pairs from the start site of transcription.
- promoter or “promoter complex” or “promoter sequence” includes sequences that facilitate transcription of an operably linked heterologous nucleic acid and/or expression of the final protein product of the heterologous nucleic acid e.g., intron sequence and/or nitron and ubiquitin monomer sequences as disclosed herein.
- a "constitutive" promoter is a promoter that is active under most environmental and developmental conditions.
- An “inducible” promoter is a promoter that is active under environmental or developmental regulation, e.g., ⁇ regulation in response to wounding of plant tissues. Promoters may be derived in their entirety from a native gene, may comprise a segment or fragment of a native gene, or may be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. It is further miderstood that the same promoter may be differentially expressed in different tissues and/or differentially expressed under different conditions.
- the first nucleic acid is a test sample
- the second nucleic acid is the sense or aiitisense strand of a guayule chloroplast genome sequence nucleic acid e.g., a guayuie DNA barcode sequence.
- Hybridization of the first and second nucleic acids is conducted under standard stringent conditions, e.g., high temperature and/or low salt content, winch tend to disfavor
- operably linked refers to a functional linkage between a nucleic acid expression control sequence (such as e.g., a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence (such as e.g., a nucleic acid encoding in a single operon the six enzymes comprising the complete cytosolic mevalonate pathway) wherein the expression control sequence directs expression e.g. , tr anscription, of the nucleic acid corresponding to the second sequence.
- a promoter thai is "operably linked" to a heterologous nucleic acid is located upstr eam of and in-frame with the heterologous nucleic acid.
- nucleic acid when used with reference to portions of a nucleic ac id indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically
- a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g.. a fusion protein).
- an "expression cassette” as used herein refers to a nucleic acid construct, typically generated recombinantly or synthetically, which comprises a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell.
- an expression cassette comprises a heterologous nucleic acid to be transcribed e.g., a synthetic operon encoding the six genes encoding enzymes comprising the complete cytosolic the mevalonate pathwayoperably linked to a promoter.
- an "expression cassette” is part of an "expression vector".
- vector refers to nucleic acid capable of replica ting in a selected host cell or organism.
- a vector can replicate as an autonomous structure, or alternatively can integrate into the host cell chromosomes and thus replicate along with the host cell genome.
- an expression vector is integrated mto the host cell chromosomes in its entirety.
- a f agment of the expression vector e.g., the expression cassette and flanking sequences, is integrated into the host DCi chromosome.
- an "expression vector” is a nucleic acid capable of replicating in a selected host cell or organism e.g., a plasniid, virus, artificial chromosome, nucleic acid fragment, or any suitable construct known in the art, which comprises an "expression cassette".
- transformation encompasses any and all techniques by which a nucleic acid molecule might be introduced into a ceil, including but not limited to, transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, Agrobacterium infection, and particle gun acceleration, etc.
- transcription as used herein applies to plants or plant parts e.g, leaf tissue, callous, chloroplasts. such tha t one obtains a transgenic plant e.g., a transplastomic plant.
- transformation as used herein also refers to the
- reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length guayule chloroplast genome sequence, a segment of guayule DNA barcode sequence or gene sequence, or gene sequence given in a sequence listing, or may comprise a complete guayule chloroplast genome sequence, guayule DNA barcode sequence, or gene sequence.
- nucleic acids or polypeptide sequence refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 85% identity, 90% identity, 99%, or 100% identity), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection.
- the substantial identity exists over a region of the sequences that is at least about 50 residues in length.
- the substantial identity exists over a region of the sequences that is at least about 100 residues in length. In still another exemplary embodiment, the substantial identity exists over a region of the sequences that is at least about 1 0 residues or more, in length, in one exemplary embodiment, the sequences are substantially identical over the entire length of nucleic acid or protein sequence.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default progr am par ameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a "comparison window' * includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well-known in the art.
- Optimal alignment of sequences for comparison can be conducted, e.g.. by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunseh, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nail. Acad. Sci. USA 85:2444 (1988), by computerized impleineniations of these
- PILEUP creates a multiple sequence alignment from a group of related sequences using progr essive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Moi. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5: 151-153 (1989). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids.
- the multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple exiensicai of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments.
- the program is run by designating specific sequences and t eir amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters.
- PILEUP a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00). default gap length weight (0.10). and weighted end gaps.
- PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395 (1984).
- thai Another example of algorithm thai is suitable for deiemiining percent sequence identity and sequence similarity are the BL AST and BLAST 2.0 algorithms . , which are described in Altschul el al, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al, J. Mol. Biol. 215:403-410 (1990), respectively.
- Software for performing BLAST analyses is publicly a vailable through the National Center for Biotechnology Information (NCBI).
- NCBI National Center for Biotechnology Information
- This algorithm mvolves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence.
- HSPs high scoring sequence pairs
- T is referred to as the neighborhood word score threshold (Altschul et al., supra).
- These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (re war d score for a pan of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score.
- Extension of the word hits hi each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Kailin & Altschul, Proc. Nat . Acad. Sci. USA 90:5873- 5787 (1993)).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)). which provides an indica tion of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01. and most preferably less than about 0.001.
- nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the aQtibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
- a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
- Another indication tha t two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
- Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
- the phrase “selectively (or specifically) hybridizes to” refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g.. total cellular or library DNA or ENA).
- a complex mixture e.g. total cellular or library DNA or ENA.
- two nucleic acid sequences are said to be “substantially identical" when the two molecules or their complements selectively or specifically hybridize to each other under stringent conditions.
- stringent hybridization conditions refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
- stringent conditions are selected to be about 5-10 °C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength pH.
- T m is the temperature (under defined ionic strength. pH, and nucleic ccaiceniration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% of the probes are occupied at equilibrium).
- Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to LO M sodium ion concentration (or oilier salts) at pH 7.0 to 8.3 and the temperatur is at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For high stringency hybridization, a positive signal is at least two times background, preferably 10 times background hybridization.
- Exemplar ⁇ ' high stringency or stringent hybridization conditions include; 50% formamide, 5xSSC and 1% SDS incubated at 42°C or 5xSSC and 1% SDS incubated at 65 °C, with a wash in 0.2xSSC and 0.1% SDS at 65°C.
- other high stringency hybridization conditions known in the art can be used.
- nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they enc ode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.
- Exemplar ' “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M aCL 1% SDS at 37 0 C Pain and a wash in IxSSC at 45 °C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize thai alternative hybridization and wash conditions can be utilized to provide conditions of similar
- Natural rubber is a raw material vital to industry., transportation, medicine and defense. Parikenium argentatum Gray (guayuie) produces high quality, rubber in its bark parenchyma and thus, there is considerable interest in developing guayuie as a source of natural mbber latex.
- the invention provides a transplastoinie guayuie plant comprising chloroplasts engineered to express the complete cytosoiic nievalonate (MEV) pathway.
- These transplastomic plants are capable of producing increased amounts of isopeniylpyrophosphate (IPP) and other isoprenoid pathway products e.g. , terpenoids, sterols, carotenoids, phytoliomiones such as abscisic acid, squalene, and dolichols.
- IPP isopeniylpyrophosphate
- other isoprenoid pathway products e.g. , terpenoids, sterols, carotenoids, phytoliomiones such as abscisic acid, squalene, and dolichols.
- a transplastomic guayuie plant comprising chloroplasts engineered to express the complete cytosoiic mevalonate (MEV) pathway capable of producing increased amounts of isopentylpyrophosphate (IPP) produces increased amounts of natural mbber as compared to a noii-traiisplastomic guayuie plant.
- MMV complete cytosoiic mevalonate
- IPP isopentylpyrophosphate
- Isoprenoid biosyiithetic pathways are responsible for the formation of the most chemically diverse family of metabolites found in nature, including sterols (C30), caiotenoids (C40), dolichols (C40-50), ubiquinones (C30-50), and natural mbber (C ' 2,000- 300,000).
- IPP isopentenyl diphosphate
- DMAPP dimethylaliyl diphosphate
- IPP and DMAPP are assembled from three molecules of acetyl Co- A by the mevalonate (MEV) pathway.
- MEV mevalonate
- 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway makes IPP and DMAPP from pyruvate and glyeeraldehyde 3-phosphate.
- a transplastomic guayule plant comprising chloroplasts engineered to express the complete cytosolic mevalonate (MEV) pathway capable of producing increased amounts of isoperitylpyrophospliate (IPP) produces increased amoimis of natural rubber as compared to a non-traasplastomic guayule plant.
- MMV complete cytosolic mevalonate
- IPP isoperitylpyrophospliate
- This invention utilizes routine techniques in the field of recombinant genetics.
- Basic texts disclosing the general methods of use in this invention include Sanibrook et !., Molecular Cloning— A Laboratory Manual (2nd Ed.), Vol. 1-3. Cold Spring Harbor Laboratory, Coid Spring Harbor. N.Y., 1989; Kriegler, Gene Transfer arid Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et l., eds., 1 94)). Unless otherwise noted, technical terms are used according to conventional usage.
- nucleic acids sizes are given in either kilobases (kb) or base pairs (bp). Estimates are typically derived from agarose or aciylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences.
- proteins sizes are given in kiiodaltoiis (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
- Oligonucleotides that are not commercially available can be chemically
- oligonucleotides are synthesized e.g., according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et a!., Nucleic Acids Res. 12:6159- 6168 (1984). Purification of oligonucleotides is by either native acrylamide gel
- Porthmium argeniatum Gray commonly known as guayule is a shrub in the family Asteraceae, native to the southeastern United States and northern Mexico. P.
- argeniatum produces high quality rubber in bark tissue and finds particular value as a source of na tural mbber latex .
- guayule is an important source of natural rubber la tex that is safe for people with Type I latex allergy.
- Guayule chioroplast genome sequence nucleic acids, and cytosolic mevalonate pathway genes can be isolated using any of a variety of methods known to those of skill in the art which may be used for isolation of chioroplast genome sequence nucleic acids.
- guayule chioroplast genome sequence nucleic acids can be isolated from a guayule genomic library and' or from a guayule chioroplast genomic library,
- cytosolic mevalonate pathway genes can be isolated using any of a variety of methods known to those of skill in the art which may be used for isolation of genome sequence nucleic acids.
- Genomic fragments can be prepared as disclosed below.
- DNA is extracted from plant tissue and either mechanically sheared or enzyrnatically digested to yield fr agments of about 15-20 kb.
- the fragments are then separated by gradient eentrifugation from undesired sizes and are constructed in bacteriophage lambda vectors.
- These vectors and phage are packaged in vitro, as described e.g., in Sambrook, et al. supra.
- Recombinant phage are analyzed by plaque hybridization as described in Benton and Davis, Science, 196:180-182 (1977). Colony hybridization is carried out as generally described in M. Granstein et al. Proc. Natl. Acad. Sci.
- DNA sequences encoding the complete cytosolic mevaionate pathway and/ r fragments thereof are identified in genomic libraries by the ability of the sequences to hybridize with labeled nucleic acid probes that comprise sequences which encode one or more individual genes (or fragments thereof) that comprise the cytosolic mevaionate pathway, e.g., on Southern blots.
- the hybridizing DNA regions are isolated by standard methods familiar to those of skill in the art. See e.g., Sambrook, et al. supra.
- the genes encoding enzymes comprising the complete cytosolic mevaionate pathway from yeast and a synthetic operon comprising all si cytosolic mevaionate pathway genes are known in the ait (see e.g., U.S. Patent 7,129,392).
- the sequence of a plastid transformation vector comprising full length synthetic operon encoding the complete cytosolic mevaionate pathway is also shown in FIG. I , as SEQ ID NO: I.
- the transformation vector includes guayme-specifie flanking sequences to allow site-specific insertion of the cassette.
- the order of the six cytosolic mevaionate pathway genes on the transformation vector is: Phosphonievalonate kinase; Mevaionate kinase, mevaionate diphosphate decarboxylase, acetoacetyl co-A thiolase, HMGco-A synthase, HMGco-A reductase.
- Expression cassettes comprising sequences encoding the complete cytosolic mevalonate pathway can be constructed in a variety of ways. The skilled artisan is well aware of the genetic elements that must be present on an expression construct/Vector in order to successfully transform, select and propagate the expressicai construct in host cells e.g., in chloropiasts, see e.g., Wu. S. et al (2006) Nat. Bioteclmol.24: 1441-1447; Maliga, P. (2004) Anna. Rev. Plant Biol. 2004. 55:289-313) Techniques for manipulation of nucleic acids encoding enzymes comprising the complete cytosolic mevalonate pathway such as subcloning nucleic acid sequences into expression vectors, labeling probes, DNA
- cytosolic mevalonate pathway genes can be individually cloned and expressed, in an exemplary embodiment, the six genes encoding cytosolic mevalonate enzymes acetoacetyl-CoA synthase, 3-hydroxy-3-methylglutaryi-C A ⁇ HMG-CoA) synthase, HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, and pyrophosphomevalonate decarboxylase, are cloned and expressed from a single synthetic operon (see e.g., U.S. Patent 7,129,392; FIG. I and FIG. 2.).
- DNA constructs comprising sequences encoding the complete cytosolic mevalonate pathway can be inserted into a variety of vectors.
- the vector chosen is a vector suitable for expressing the complete cytosolic mevalonate pathway in chloropiasts.
- An exemplary vector comprising a synthetic operon encoding the complete cytosolic mevalonate pathway is shown in FIG. 2.
- Such vectors can be constructed by the use of recombinant DNA techniques well known to those of skill in the art. See e.g., Sambrook et al. supra.
- An expression vector comprising e.g. .
- a sequence encoding all six enzymes that comprise the complete cytosolic mevalonate pathway may then be transfected/fraiisfomied into the target cMoroplasi/plastid. Successfully transformed plastids are then selected based on the presenc e of a suitable marker gene as disclosed below.
- recombinant vectors are available to those of skill in the art for use in the stable transaction of chloropiasts for the establishment of transplastomic plants (see e.g., FIG. 3.
- recombinant vectors are available to those of skill in the art for use in the stable transfection of chloropiasts typically comprise homologous flanking sequences on either side of the transgene cassette to facilitate double recombination.
- the flanking sequences are generally about Ikb in size.
- Chloroplast vectors may also cany an origin of replication that facilitates replication of the plasmkl insidethe chloroplast, thereby increasing the template copynumber for homologous recombination arid consequently enhancing the probability of transgene integration.
- expression constructs prepared as disclosed may comprise additional elements.
- plastid transformation vectors typically include a selectable and/or screeiiable marker gene to allow for the ready identification of transformants.
- Exemplary selectable marker genes include, but are not limited to those encoding antibiotic resistance (e.g. resistance to hygromycin, kananiycin, bleomycin, G418, streptomycin or spectinomycin) and herbicide resistance genes (e.g., phosphmotkricin aeetyltransfera.se).
- Exemplary screeiiable markers include e.g., green fiorescent protein.
- a selectable or screeiiable marker gene is employed in addition to sequences encoding the complete cytosoiic mevalonate pathway, to provide or enhance the ability to identify transformants.
- marker genes are genes that impart a distinct phenotype to cells expressing the marker gene, such that transformed cells can be distinguished from cells that do not have the marker.
- marker genes encode a selectable marker which one can "select” for by chemical means, e.g., through the use of a selective agent (e.g. , a herbicide, antibiotic, or the like).
- marker genes encode a screeiiable marker, which is identified through observation or testing, e.g., by "screening" (e.g., the green fluorescent protein).
- Some exemplary screenable markers include, but are not limited to a ⁇ - glucuronidase (GUS) or iiidA gene, see e.g. , U.S. Patent 5,268,463, U.S. Patent 5,432,081 and U.S. Patent 5,599,670; a ⁇ -gene, see e.g., Suteliffe, (1978) Proc. Natl. Acad. Sci. USA, 75:3737-3741 ); ⁇ -galactosidase: and lueiferase (lux) gene (see e.g. , Ow et at., (1986) Science, 234:856-859; Sheen et al., (1995) Plant J., 8(5): 777-784; and WO 97/41228).
- GUS ⁇ - glucuronidase
- iiidA gene see e.g. , U.S. Patent 5,268,463, U.S. Patent
- Exemplaiy selectable or screenable marker genes also include genes which encode a "secretable marker" whose secretion c an be detected as a means of identifying or selecting for transformed cells.
- exemplary secretable markers include but are not limited to secretable antigens that can be identified by antibody interaction, e.g., small, diffusible proteins detectable, e.g., by ELISA; and/or secretable enzymes which can be detected by their catalytic activity.
- small active enzymes detectable in extracellular solution e.g., a-amylase, ⁇ -lactainase, phosphmothricin acetyltiansferase
- proteins that are inserted or trapped in the cell wall e.g., proteins that include a leader sequence such as that found e.g., in the expression unit of extensin or tobacco PR-S.
- an expression vector further comprises sequences that are joined to the sequences encoding the complete cytosolic mevalonate pathway, which are removed p st-translationally from the initial translation product.
- post-translationally removed sequences facilitate the transport of the protein into or through intracellular- or extracellular membranes, thereby facilitating the transport of the protein into compartments inside and/or outside the cell.
- post-translationally removed sequences protect a nascent protein from intracellular proteolytic degradation.
- a nucleic acid segment encoding a leader peptide sequence upstream and in reading frame with a selected coding sequence is used i recombinant expression of the coding sequence i a host cell
- an expression construct comprises a bacterial origin of replication, e.g., a colE i origin.
- an expression construct/vector comprises a bacterial selectable marker e.g., an ampieillin, tetracyclic hygromycin, neomycin or chloramphenicol resistance gene,
- expression constructs typically comprise restriction endonuelease sites to facilitate vector construction.
- exemplary restriction endonuelease recognition sites include, but are not limited to recognition site for the restriction endonueleases Noil, Aatll, SacII, Pmei Hindlll, Pstl, EcoRI, and BamHL
- DNA constructs comprising a gene or a synthetic operon encoding all six genes comprising the complete cytosolic nievaionate pathway can be transformed into plastids to provide trarispiastoimc plants with desired phenotypic characteristics e.g., having the ability to produce increased amounts of natural rubber as c ompared to non-ti ansplastonnc plants.
- Exemplary plants for transformation with expression constructs comprising the complete cytosolic nievaionate pathway include, but are not limited to; dicotyledonous species, such as e.g., guayule (Parthenium argentatum); tobacco (Nicotiana spp.), Lactuca spp. and sunflower (Heliaathus spp.).
- guayule Parthenium argentatiim
- a DNA construct that comprises a synthetic operon which encodes the six genes comprising the complete cytosolic mevalonate pathway.
- transplastomic guayule plant comprising chloroplasts engineered to express the complete cytosolic mevalonic acid (MEV) pathway wherein the transplastomic guayule plants are capable of producing increased amounts of isopentylpyrophosphate (IPP), and ultimately increased amounts of rubber (see e.g., Liu et al.. Plant Cell Rep 2007; Sikdar et al. (1998) Journal of Physiology 511, 851-859; Bogorad (2000) TTBTech 18:257-263; Verma and Danielle (2007): Plant Physiology 145: 1129-1143.
- IPP isopentylpyrophosphate
- concentration of activated charcoal is typically a t least about .2% w/v (or 2g/L). However, in some exemplary embodiments, activated charcoal is present in concentration that is in a range that is between about lg L to about 10 g/L. In other exemplary embodiments, activated charcoal is present in a concentration that is a range that is between about lg L to about 5 g/L.
- activated charcoal is present in a concentration that is about lg/L, about 2 g/L, about 3 g/L, about 4g/L, about 5g/L, about 6g/L, about 7 g/L, about 8 /L, about 9g/L, or about lOg L.
- the concentration of calcium nitrate is typically at least about 100 mg/L.
- calcium nitrate is present in a concentration that is in a range that is between about lOGnig/L to about 1500 mg/L.
- calcium nitrate is present in a concentration that is about 150 mg/L, about 200 mg L, about 250 mg/L. about 300 mg/L, about 350 mg/L, about 400 mg/L, about 450 mg/L, about 500 mg/L, about 550 mg L, about 600 mg/L.
- trans zeatin shock before and immediately after introducing the transgene, plants are exposed to high concentration of trans zeatin riboside (or similar chemicals as listed in table) Typical concentration of trans zeotin-riboside is at least about 5 rng/L. However, concentrations in a range t at is between about I mg/L to about 160 mg/L are used effectively.
- trans-zeotin-riboside is present in a concentration of about 1 mg/L , about 3 mg/L , about 5mg/L, about 10 mg L, about 15 mg L, about 20 mg/L, about 30mg/L, about 40 mg/L, about 50 mg L, about 60 mg/L, about 70 mg/L, about 80 mg/L, about 90 mg L, about 100 mg/L, about 110 mg/L, about 120 mg L, about 130 mg L, about 140 mg/L, about 150 mg L, or about 160 mg/L.
- Dipping method for rooting optimized exposure (cone and time) to plant hormone (IBA specifically) for rooting.
- transplastoniic plants can be used to introduce the metabolically engineerered chloroplasts into new plants by sexual crossing, thereby developing new transplastoniic lines. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
- exemplary method for screening transformation events may be accomplished e.g., by PGR as disclosed hereinbelow; by Southern analysis of DNA blots (Southern, (1975) J. Mo! Biol. 98: 503), Northern analysis of inRNA expression (Kroczek, J., (1993) Chrornatogr. Biomed. AppL, 618(1 2): 133 145), Western analysis of protein expression, and/or phenotypic analysis e.g.. resistance to an herbicide can be detected by treatment with the herbicide. Expression of the heterologous DNA can also be detected by measurement of the specific RNA transcription product.
- protein expression is quantitated and/or detected in different plant tissues using a reporter gene, e.g., GUS.
- transplastornic plants may be grown to produce plant tissues or parts having the desired phenotvpe.
- the plant tissue or plant parts may be harvested, and/or the seed collected.
- the seed may serve as a source for growing additional plants with tissues or par ts having the desired characteristics.
- a transplastomic guayule plant is detected by means which include but are not limited to;
- Spectinomycin is an antibiotic that is fatal to guayule plants at about 12 mg/L.
- the aadA gene, included in the operon, confers resistance to spectinomycin. Plants that survive under spectinomycin selection pressur e (12-20 mg L-) are putative
- transplastomic guayule b) Regeneration on kanamycin.
- Kanamycin is an antibiotic that is also fatal to guayule.
- Genomic PCR analysis To test integration of gene cassettes into the chloroplast genome, PCR is performed with primers that are targeted to one of the introduced genes (e.g.. GFP, aadA, ⁇ or other genes) and compared to the native chloroplast genomic DNA.
- the introduced genes e.g.. GFP, aadA, ⁇ or other genes
- Green Fluorescent Protein detection Transplastomic plant tissues with the GFP gene exhibit fluorescence when exposed to visible light. The emission peak is at 509 mn. which is in the lower green portion of the visible spectrum.
- leaf painting techniques can be used. This technique are used to detect and eliminate chimeric plants, hi practice, various leaves from different sections of the plant are brushed spotted with antibiotic solution, then inspected for browning over a period of time. This is preferably done on plants that have been transferred to soil. Plants exhibiting no browning on any leaf sections may be homoplasmic.
- Genomic southern blot analysis Southern blots are performed to analyze gene integration into the plant DNA. Total genomic DNA (2 mg) of transgenics and wildtype, are digested with appropriate restriction enzymes and hybridized with a P32-labeled DNAprobe amplified by the PCR using primers to internal regions of flanking native DNA. f 00115] Gene expression analysis: Performed by isolation of total RNA followed by addition of specific reverse-traiiscriptase primers targeted to specific genes or junctions of genes within the insert, followed by amplification by PCR and sequencing of the PCR products.
- transplastomic and wildtvpe plants are grown on medium containing fosmidomvcm at 100 mM.
- Fosmidomycin is a specific inhibitor of dxr in the plastidial MEP pathway (Zeidier etai..(1998) Z
- natural rubber content is quantified by extraction of rubber in latex form, latex quantification, by methods known in the art (see e.g., Cornish et al. Industrial Crops and Products 10 (1999) 121-136)
- natural rubber content is quantified by using solvent (e.g., toluene, eyeiohexane, or THF) extraction of harvested, gr ound plant tissues by methods known in the ait (Pearson et al. Industrial Crops and Products 31 (2010) 469-475).
- the quality of natural rubber is usually indicated by molecular weight and molecular weight distribution, as determined by gel permeation chromatography, well known to those skilled in the art (see e.g., Wyatt, P.J. 1993 Light scattering and the absolute characterization of macromolecnles. Analytica
- the cultures were maintained in a growth chamber at 25 °C under a i 6-h photoperiod provided by cool- white fluorescent lamps.
- the lamps provided a phorosynthetie photon flux of 125 ⁇ 2 ⁇ 8 _ ⁇ , held at the top of the culture vessels. All of the stock cultures in the following experiment were maintained under these conditions.
- the piasmid transformation vectors used in this work were pUY-Gua- aadA/NPTH/GFP.
- the piasmid pITi'-Giia-aadA/ PTII/GFP vector (FIG. 3) contains the aadA (aminoglycoside 3-adenyl transferase) arid NPTII gene as a selectable, and the multiple cloning site flanked guayule plastid DNA homologous sequences to target the insertion of the linked transgenes into the plastid genome by homologous recombination.
- piasmid contained the green fluorescent protein (GFP).
- the aadA and NPTII gene encodes resistance to spectinomycin and kanainycin, respectively.
- DKW medium were used. Recovered expiants were transferred onto DKW-CN-SP12 (DKW medium
- the regenerated green shoots were transferred onto the new D W-CN-SP 15 (DKW medium supplemented with 0.75 mg-L "1 N6 benzylanunopurine (BA), 0.25 mg-L “1 a-naphtha eneacetic acid (NAA), 250 mg'L “1 calcium nitr ate and 15 mg-L “1 spectinomycin) to remove chimerical shoots and for selection of resistant and elongation shoots for 6 weeks.
- the callus and explants were transferred to the new fresh plates of the same media types.
- Regenerated shoot transferred to rooting medium (WP medium supplement with 0.2 nig-L "1 IB A and 12 mg'L "1 spectiaoinycm) when it grow up over 2 cm.
- the method disclosed herein differs from known methods in: 1) media composition (transformation and propagation, 2) the use of cytokinin shock, 3) Dipping method for rooting.
- the bombardment conditions used were pretty standard.
- Cytokimns e.g., zeatin
- CK Cytokimns
- zeatin are naturally-occurring secondary metabolites that function in plant growth, development, and signaling (see e.g.. Hitoshi Sakakibara (2006) Cytokimns: Activity, Biosynthesis, and Translocation Annu. Rev. Plant Biol. 57:431-449).
- Hitoshi Sakakibara (2006) Cytokimns: Activity, Biosynthesis, and Translocation Annu. Rev. Plant Biol. 57:431-449.
- Zeatin hi the media before and after bombardment cleaily contributes to the success of the method.
- the fransformation methods disclosed herein in Example 1, 2 and 6 utilize the following elements for successful guayule chloroplast transformation: 1) Media composition: (a) Transformation media: MS (Mumshige and Skoog, Murashige T and Skoog F (1 62) Physiol Plant 15:473-497 ) media or DKW (Driver and Kuniyuki Walnut; Driver and Kuniyuki 1 84) media supplemented with calcium nitrate, (b) Propagation media: WPM (Woody Plant Medium Lloyd and McCown 1981) supplemented with activated charcoal.
- Transformation media MS (Mumshige and Skoog, Murashige T and Skoog F (1 62) Physiol Plant 15:473-497 ) media or DKW (Driver and Kuniyuki Walnut; Driver and Kuniyuki 1 84) media supplemented with calcium nitrate
- DKW Driver and Kuniyuki Walnut; Driver and Kuniyuki 1 84
- C tokinin (Zeatin) shock before and immediately after introducing the transgene, plants are exposed to high concentration of trans zeatm riboside (or similar chemicals a.s listed in table).
- Template DNA was denatured at 94 for 2 in and 35 cycles of amplification was carried out as follows: 94°C for 30 s, primer annealing at 52°C for 30s and extension at 72°C for 1 min; The samples are followed by 7 min final extension at 72 '3 G.
- PCR products were examined by electrophoresis through 1.0% agarose gels containing 1 pg mg*L _I ethidium bromide under UV illumination.
- the transformation frequency is about 5%. While this may seem a low frequency on its face, every other method yields 0%. (This finding is discussed further in Example 5 herein below)
- Example 2 f00142] The following example illustrates an improved, highly efficient propagation and regeneration protocol for guayuie transformation.
- the cultures were maintained in a growth chamber at 25 °C under a 16-h pliotoperiod provided by cool-white iluorescent lamps.
- the lamps provided a photosynthetic photon flux of 125 held at the top of the culture vessels. All of the stock cultures in the following experiment were maintained under these conditions.
- guayuie shoots were cultured asepiically on either MS, woody plant medium (WPM) (Lloyd and McCown (1981) International Plant Propagator's Society, 30: 421-427 or Driver and Kuniyuki walnut (DKW) medium (Driver and Kuiriyuki (1984) Hort. Sci 19:507). Vigorously growing 3-cm shoot tips were excised for guayuie propagation (Table I ). All medium were supplemented with 0.1% MS vitamins, 3% (w/v) sucrose and 0.3% (w/v) phatagel (Sigma).
- guayule explants were cultured on MS basal medium with plant growth regulators (PGRs) (1.0 mg-L "1 BA and 0.1 mg-L "5 NAA) and calcium nitrate.
- PGRs plant growth regulators
- Calcium nitrate was added to the culture medium before adjusting the pH to 5.7, prior to autoclaving, DKW basal medium (0.75 mg-L "1 BA and 0.25 mg-L "1 NAA) was used as a control.
- Explants were grown on MS basal medium with 1,0 mg-L 1 BA and 0.1 mg-L "1 NAA or DKW basal medium wife 0.75 mg-L "5 BA and 0.25 mg- L "1 NAA, and supplemented with either 0, 100, 250, 500, 750, 1000 or 1500 mg-L "3 calcium nitrate tetrahydrate
- Total number of elongated true shoot from regenerated callus total number of explants
- Spectinoniycin present in the media had a significant effect car callus iomiation and shoot regeneration of guayule. Callus formation and shoot emergence was not affected by specfinomycin at 8 mg-L ' ', but was significantly reduced at 10 mg-L "1 and completely inhibited by 12 mg-L 1 or higher.
- Example illustrates cMoroplast transformation of guayule (Parihenium argenkttum) using an optimized protocol.
- the pUY-Gua-MEV6 plasmid contained the 6-gene cluster comprising the complete yeast mevaionate pathway.
- pUY-Q .-aadA NPTII/GFP chloroplast plasmid contained aadA, NPT11 and gfp genes.
- the aadA gene, included in the operon confers resistance to spectinomycin
- the NPTII gene, included in the operon confers resistance to kanamycin
- plant tissues with the GFP gene exhibit fluorescence from Green Fluorescent Protein when exposed to visible light at 509 mn.
- the guayule chloroplast transformation vector was constructed following that previously described (Kumar and DanielL 2004 Methods Mot Biol 267. 365-383). Flanking sequences for homologous recombination were amplified using the Guayule Chloroplast Genome Sequences (Kumar et al., 2009, supra) with the forward primer GuaFL F:
- GGCCGACACTGACACTGAGAGACGA (SEQ ID NO: 8) and the reverse primer GuaFL R: GCCATCCTAAGGTGCTGCTAAATGGA (SEQ ID NO:9).
- the 3.0 kb PCR product was amplified using PFU-Ultra Fidelity Polymerase (Stratagene) following vendor's instructions. The PCR product was purified and sequenced. The complete DNA sequence of flanking region, which is 100% specific, for chloroplast transformation of Parihenium argentatum (Guayule) line AZ-2, is given as below: Guayide Flanking Cp-D A sequence (SEQ ID NO: 10)
- GAACTTAGC CGATACAAAGCTATATGATAGCACCCAATTTTTCCGATTCGGCGG
- the psbA (light regulated) promoter along with 5' UTR was obtained as synthetic DNA from Bio Basic Inc. (Canada).
- the empty vector control pUY-Gua- aadA/npill/GFP was made for optimization of Guayule's chioroplasis transformation.
- the physical map of pUY-Gtia-aadA nptll/GFP is given below and the vector was tested with Ndel-Xbal digestion and GFP fluorescence was observed in the E.coli cells under
- pUY-Gua-MEV6 and pUY-Gua-aadA/NPTII/GF plasmid DNAs (12.5 ug each) were transformed in guayule using standard micro-projectile bombardment procedures as described by Biechl and Anderson (1996) Nat. Bioieehnol. 14:875-879. Guayule leaves harvested from in viiro-grown guayule plants were cut into 0.5 cm 2 segments. The explants were placed in MS supplemented with 5 mg-L "1 /ra? «'-zeatin-riboside for bombardment and recovery.
- Plant genomic D A isolation and PCR analysis
- guayule genomic DNA was isolated from 0.5 g transgenic and non-transgenic plant leaf tissues using a GeiieEluteTM Plant Genomic DNA Miniprep Kit (Sigma, USA) according to the manufacturer's protocol. 50ng genomic DNA was used for PCR amplification by using the spectinomycm-gfp gene primers (forward 5 '- TGA ATG AAC TGC AGG ACG AG -3' (SEQ ID NO:l 1) primers and reverse 5'- GGG TGT TCT GCT GGT AGT GG -3 '(SEQ ID NO: 12)). The expected size for the gene was 1200 bp.
- Amplified fragments were separated on 1% agarose gels using a DNA 1 KB ladder (Fisher Scientific inc., Pittsburgh, PA).
- the efficiency of chioropiasi transformation using this method was calculated using two criteria. First was based on plants confirmed positive by PCR after surviving selection media [DKW with 15 to 20 mg-L "1 speciionrnycin] . In that case, the 6.9% of guayule plants (8 total) transformed by the pUY-Gua-MEV6 and 13.0% of guayule plants (9 total) transformed by the pUY-Gna- dA/NPTII/GFV gene were confirmed transplastomie. The second basis used was that of the number of PCR-coniimied transplasiomic plants out of all attempted bombardment experiments.
- Chlorophyll meter were taken at the center of the leaves throughout the experiments.
- Plants were grown oa plant growth regulator free WPM basal medium, solidified with gtirke, and supplemented with 2 g-L ⁇ activated charcoal (AC).
- the reenhouse lants were grown cm potting mix soil with AC.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to transplastomic guayule plants comprising chloroplasts engineered to express the complete cytosolic mevalonic acid (MEV) pathway.
Description
ENGINEERING RUBBER PRODUCTION IN PLANTS
REFERENCE TO RELATED APPLICATIONS
[0061] This application claims priority to U.S. Provisional Patent Application USSN 61/789,228, filed March 15, 2013, which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
|0002] in exemplary embodiments the invention relates to transformation of
Parthenhmi arge.ntatu Gray (guayule) chloroplasts and to transformed Parthenhmi argen latum capable of producing increased amounts of natural rubber.
BACKGROUN OF THE INVENTION
[00Θ3] P rthenwm argeriiatum Gray commonly know as guayule, is a shrub in the family Asteraeeae, native to the southwestern United States and northern Mexico. P.
argen latum produces high quality rubber in bark tissue and finds particular value as an alternative source of natural rubber latex.
[00Θ4] Natural rubber, cis-1, 4-polyisoprene, is essential and irreplaceable in many industrial applicaiicais. Because of its desirable properties, the demand for natural rubber is rising, making natural rubber increasingly more precious as an industrial material. To meet demand at sustainable costs, it is desirable to increase the quantity and/or quality of natural latex rubber produced from guayule. Indeed, increasing the quantity of available natural rubber latex wiil benefit agricultural workers and many industries and thus, humankind in general.
[0005] Acc ordingly, discovering and developing guayule cuitivars capable of producing high yields of natur al rubber latex would be invaluable for increasing a vailable quantities of natural rubber. Therefore, what is needed in the art, are methods for improving the quantity and/or quality of natur al latex rubber from guayule, and new guayule cuitivars capable of producing high yields of natural mbber latex.
- i -
[0066] Fortunately., as will be clear from the following disclosure, the present invention provides for these and other needs.
SUMMARY OF THE INVENTION
£0007] in one aspect, the present disclosure provides a method for transforming guayule chloroplasts to provide a transplasioniic guayule plant, the method comprising: (i) growing guayule plants on hormone free media supplemented with activated charcoal to provide cultured guayule plants; (ii) collecting leaves from the cultured guayule plants to provide leaves from the cultured guayule plants; (iii) placing the leaves from the cultured guayule plants in medium comprising trans-zeotin-iiboside for bombarding and recovery; (iv) bombarding the leaves from the cultured guayule plants with gold particles, wherein the gold particles are coated with chloropiajst transformation vector DNA, and wherein the ehloropiast transformation vector DNA comprises guayule specific flanking sequences that target insertion of the ehloropiast transformation DNA to ehloropiast DNA, thereby providing bombarded guayule leaves; (v) incubating the bombarded guayule leaves in the medium comprising trans-zeotin-riboside, to provide recovered bombarded guayule leaves: (vi) transferring the recovered bombarded guayule leaves to Callus and Shoot Induction medium comprising a selection agent and calcium nitrate: (vii) growing the recovered bombarded guayule leaves in Callus and Shoot Induction medium to provide calli and small shoots; (viii) transferring the calli and small shoots to Shoot Induction Medium wherein the Shoot Induction Medium comprises calcium nitrate ; (ix) growing the calli and small shoots i the Shoot Induction Medium until shoots are elongated, to provide elongated shoots; (x) transferring the elongated shoots to Rooting Medium comprising a selection agent; (xi) growing the elongated shoots on the Rooting Medium until roots are formed, to provide rooted shoots; (xii) transplanting the rooted shoot to soil, and (xiii) growing the rooted shoots i the soil; thereby providing a transplastomic guayule plantln one exemplary embodiment, the ehloropiast transformation vector DNA further comprises the 6-geiie cluster comprising the complete cytosolic mevalonate pathway.
[0008] In another aspect, the disclosure provides a transplastomic guayule plant made according to the method for transforming guayule chloroplasts to provide a transplastomic guayule plant. In one exemplary embodiment, the transplastomic guayule plant comprises
recombinant cMoroplasts transformed with the 6-gene cluster comprising the complete cytosolic nievalonate pathway. In another exemplary embodiment, the transplastomic guayule plant is capable of producing increased amounts of isopenry .pyrophosphate and increased amounts of natural latex. In another exemplary embodiment, the disclosure provides a transplastomic seed of the transplastomic guayule plant. In another exemplar y embodiment, the disclosure provides a transplastomic guayule plant, or a part thereof, produced by growing the seed, hi another exemplary embodiment, the disclosure provides a tissue culture of regenerable transplastomic cells produced from the traiisplastomic guayule plant. In another exemplary embodiment, the disclosure provides a transplastomic protoplast produced from the tissue culture. In another exemplary embodiment, the disclosure provides a transplastomic guayule plant, regenerated from the tissue culture. In another exemplary embodiment, the disclosure provides a hybrid transplastomic guayule plant, wherein the lineage of at least one parent plant comprises the transplastomic guayule plant.
[0009] In another aspect the disclosure provides a transplastomic guayule plant or part thereof. In one exemplary embodiment, the the transplastomic guayule plant comprises recombinant cMoropiasts transformed with the 6-gene cluster comprising the complete cytosolic nievalonate pathway. In another exemplary embodiment, the transplastomic guayule plant is capable of producing increased amounts of isopentylpyrophosphate and increased amounts of natural latex. In another exemplary embodiment, the disclosure provides a transplastomic seed of the transplastomic guayule plant, hi another exemplary embodiment, the disclosure provides a transplastomic guayule plant, or a part thereof, produced by growing the seed, hi another exemplary embodiment, the disclosure provides a tissue culture of regenerable traiisplastomic cells produced from the transplastomic guayule plant, In another exemplary embodiment, the disclosure provides a transplastomic protoplast produced from the tissue culture, In another exemplary embodiment, the disclosure provides a transplastomic guayule plant, regenerated from the tissue culture, hi still another
exemplary embodiment, the disclosure provides a hybrid transplastomic guayule plant, wherein the lineage of at least one parent plant comprises the transplastomic guayule plant.
[0010] Other features, objects and advantages of the invention will be apparent from the detailed description which follows.
BRIEF DESCRIPTION OF THE DRAWINGS
fOOii]
[0012] FIG. 1. iliiistiaies SEQ ID NO: 1, the nucleic acid sequence of a piastid transformation vector pUY-MEV6 comprising full length synthetic operon encoding the complete cytosoiic mevalonate pathway.
[0013] FIG. 2. Provides a diagrammatic representation of pUY-MEV6 shown as SEQ ID NO: 1 in FIG. 1. To make pUY-Gua-MEV6, the 6-gene cluster comprising the complete mevalonate pathway from pUY-MEV6 (see e.g. Kumar ei ai. 2012 Metab Eng. 2012 Jan: 14(1): 19-28) was used to replace the Tips 16 and the PpsbA-5' TJTR in plasmid pUY- Gua-aadANPTITGFP, resulted a the final plasmid containing 9 genes and 16075 bp.
[0014] FIG. 3. iliiistiaies Guayule Specific Chloroplast transformation vector (pUY- Gua-aadA/NFrn GFP).
[0015] FIG. 4. The vector pUY-Gua-aadA/npfll GFP (aka pUY-Gna-spec/kan/GFP) was tested with Ndel-Xbal digestion. The small bands in the middle lane and the right lane showed different sizes, representing ΝΡΤΊΙ gene plus GFP gene or NPTII gene analog. A GFP fluorescence was observed in the E.coli cells under a fluorescent microscope as shown below the gel image, illustrating the functionality of the GFP gene in this construct.
[00Ϊ6] FIG. 5. Greenhouse guayule plants (A) non-transgenic control plant (B) pUY- Giia-aadA NPTn/GFP transgenic plant (C) pUY-Giia-MEV6 transgenic plant. The figure illustrates that there were no significant differences among 9-week-okl transgenic and non- transgenic plants in plant height and shape of plants.
[0017] FIG. 6. A: PC amplification with HMGS gene primers (forward 5'- TTGGACTTCCCGGACATTAG -3 ', SEQ ID NO: 2 primers and reverse 5 '- TTTCTCGGTGACCAACACAC -3 ', SEQ ID O:3). Lane 1 : 1 Kb marker, lane 2: plasmid DNA, lane 3: non-transgenic control plant, lanes 4 and 5 pUY-Gua-MEV6 transgenic plants (0.7 bp).
|00I8] FIG 6 B: PCR amplification with aadA-GFP gene primers (forward 5'- TGAATGAACTGCAGGACGAG -3', SEQ ID NO: 4 primers and reverse 5'- GGGTGTTCTGCTGGTAGTGG -3', SEQ ID NGi5). Lane 1: 1 Kb marker, lane 2: plasmid DNA, lane 3: non- transgenic control plant, lanes 4 and 5; pUY-Gua-aadA/NPTII GFP transgenic plants (1.2 kb).
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0019] The expression "capable of producing increased amounts of
isopenfylpyropliosphate'' as used herein, refers to the ability of a transplastoniic guayuie plant as disclosed herein, to biosynthesize at least about 25% or more
isopenfylpyropliosphate (IPP) than is produced from an otherwise isogenic non- transplastoniie guayuie plant.
[0026] The expression "complete cytosolic mevaionate pathway" as used herein refers to an isoprenoid synthetic pathway located hi the cytosoi of animals, plants and fungi e.g., yeast, which produces isopentenyi diphosphate (IPP) condensation of three molecules of acetyl coenzyme A (CoA). The six genes that comprise the complete cytosolic mevaionate pathway are: acetoacetyl-CoA syntha.se, 3-hydiOxy-3-iiiethyiglutoyl-CoA (HMG-CoA) synthase, HMG-CoA reductase, mevaionate kinase, phosphonievalonate kinase, and pyrophosphomevaloiiate decarboxylase,
f0021] The expressio "capable of producing increased amounts of
isopentylpyrophosphate and increased amounts of natural latex" as used herein, refers to the ability of plants to biosynthesize a t least about 25% or more natural rubber than is produced from an otherwise isogenic non-transplastomic guayuie plant.
[ΘΘ22] The term "synthetic operon'' as used herein, refers to a DNA sequence that comprises multiple individual genes which are expressed under the control of a single regula tory signal or promoter. An operon is "synthetic" by virtue of the fact that it is constructed in vitro, rather than being naturally occurring. Thus, in an exemplar}' embodiment, the six yeast genes that comprise the complete cytosolic mevaionate pathway are cloned into an expression vector to create a "synthetic operon" that encodes the complete cytosolic mevaionate pathway.
|0023] The term "plant" as used herein refers to whole plants, plant bodies, plant organs (e.g., leaves, stems, flowers, roots, etc.), seeds, plant tissues, plant cells and progeny of same, hi an exemplary embodiment, a plant cell includes callus. In another exemplary embodiment, a plant organ includes a root, a leaf, a flower and/or the like. The term "plant" refers to the broad class of higher plants amenable to transformation techniques. The term "plant" also includes plants of any variety of ploidy levels, including polyploid, diploid, haploid and hemizygous. Exemplary plants include e.g., dicotyledonous plants of the family Asteraeeae e.g., Parthemum argeniatum.
f 0024] The term "transplastoinic plant" as used herein refers to a plant comprising at least one heterologous nucleic acid sequence that was introduced into the plant chloroplasts. a t some point in its lineage, by genetic engineering techniques. In an exemplary
embodiment, a transplastomic plant is a plant whose plastids are transformed with an expression vector comprising a synthetic operon thai encodes the six enzymes thai comprise the complete cytosolic mevalonate pathway. In another exemplary embodiment, a transplastomic plant is a plant whose plastids are transformed with an expression vector comprising a synthetic operon that encodes the HMG-CoA reductase (HMGR). In another exemplary embodiment, a traiisplasioime plant is a plant that is the progeny or decendant of a transplastomic plant transformed with an expression vector comprising a synthetic operon thai encodes the six enzymes thai comprise the complete cytosolic mevalonate pathway, wherein the progeny or decendani is a iransplastomic plant whose plastids contain the synthetic operon that encodes the six enzymes that comprise the complete cytosolic mevalonate pathway. Thus, the term "transplastomic plant" refers to plants which are the direct result of transformation with a heterologous nucleic acid or transgene. and the progeny and decendants of transfornied plants which themselves comprise the introduced heterologous nucleic acid or transgene.
[002S] The terms "isolated," "purified," or "biologically pure" as used herein, refer to material that is substantially or essentially free from components that normally accompany it as found in its native state. In an exemplary embodiment, purity and homogeneity are determined using analytical chemistry techniques such as polyacrylamide gel
electrophoresis or high performance liquid chromatography. A nucleic acid that is the predominant species present in a preparation is substantially pur ified. In one exemplary
embodiment, an isolated nucleic acid or a fragment thereof is separated from open reading frames and/or other nucleic acid sequences that flank the nucleic acid or a fragment thereof in its native state. In an exemplary embodiment, the term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Typically, isolated nucleic acids or proteins have a level of purity expressed as a range. The lower end of the range of purity for the component is about 60%, about 70% or about 80% and the upper end of the range of purity is about 70%, about 80%, about 90% or more than about 90%.
[0026] The term "nucleic acid" as used herein, refers to a polymer of ribonucleotides or deoxyribonucleotides. Typically, "nucleic acid" polymers occur in either single- or double- stranded form, but are also known to form structures comprising three or more strands. The term "nucleic acid" includes naturally occurring nucleic acid polymers as well as nucleic acids comprising known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Exemplary analogs include, without limitation, phosphorothioates, phosphoranrklates, methyl phosphonaies, chiral-merhyl phosphonates, 2- O-methyi ribonucleotides, peptide-nueleie acids (PNAs).
f 0027] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (see e.g., Batzer et oL, Nucleic Acid Res. 19:5081 (1 91); Ohtsuka e.f at, J. Biol. Chem. 260:2605-2608 (1985); and Rossolim et at. Mol. Cell. Probes 8:91-98 (1994)).
[0028] The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to natur ally occurring amino acid polymers and non-naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a corresponding naturally occurring amino acid.
[0029] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as annuo acid analogs and annuo acid ininietics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those annuo acids that are later modified, e.g. , hydroxyproline. y- earboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoseiine, noileucine, methionine sulfoxide, methionine methyl siilfonium. Such analogs have modified R groups (e.g. , noileucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an annuo acid, but that functions in a manner similar to a naturally occurring amino acid.
[0030] Amino acids are referred to herein by either then commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
f 0031] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not e code an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon is altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a
functionally ideniical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence,
f 0032] As to amino acid sequences, one of skill will recognize that individual
substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino a cid.
Conservative substitution tables providing functionally similar annuo acids are well known in the art (see, e.g., Creighton, Proteins (1984)). Such conservatively modified variants are in addition to and do not exclude polymorphic valiants, interspecies homologs. and alleles, f 0033] The following eight groups illustrate some exemplary amino acids that are conservative substitutions for one another:
1 ) Alanine (A). Glycine (G);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutaiiime (Q);
4) Argmine (R), Lysine (K);
5) Isoleueme (I), Leucine (L), Methionine (M), Valine (V);
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
7) Serine (S), Threonine (T); and
8) Cysteine (C), Methionine (M)
[0034] Macromolecular structures such as polypeptide structures are described in terms of various levels of organization. For a general discussion of this organization, see, e.g. , Alberts ei at.. Molecular Biology of the Cell (3rd ed., 1994) and Cantor and Schiinmel, Biophysical Chemistry Part I: The Conformation of Biological Macromolecuies (1 80). "Primary structure" refers to the amino acid sequence of a particular peptide. "Secondary structure" refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains. Domains ar e portions of a polypeptide that form a compact unit of the polypeptide and are typically 50 to 350 amino acids long.
Typical domains are made up of sections of lesser organization such as stretches of β-sheet and a-helices. "Tertiary structure" refers to the complete three dimensional structure of a polypeptide monomer. "Quaternary structure" refers to the three dimensional structure
formed by the noncovalent association of independent tertiary units. Anisotropic terms are also known as energy terms.
f 0035] The term "label" as used herein, refers to a composition detectable by
spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
Exemplary labels include J~P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available.
[0036] As used herein a "nucleic acid probe or oligonucleotide" refers to a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. As used herein, a probe may include natural f..e.. A, G, C, or T) or modified bases (e.g. , 7-deazaguanosine, mosme, etc.). In addition, the bases in a probe may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization. Thus, for example, probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. It will be understood by one of skill in the ait that probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the
hybridization conditions. In one exemplary embodiment, probes are directly labeled as with isotopes, chromophores. lumiphores, chromogens etc. hi other exemplar}' embodiments probes are indirectly labeled e.g., with biotin to which a srreptavidm complex may later bind. By assaying for the presence or absence of the probe, one can detect the presence or absence of the select sequence or subsequence.
[0037] Thus, the term "labeled nucleic acid probe or oligonucleotide" as used herein refers to a probe that is bound, either covalently, through a linker or a chemical bond, or iioneovaieiitly, through ionic, van der Waals, electrostatic, or hydrogen bonds to a label such that the presence of the probe may be detected by detecting the presence of the label bound to the probe .
[0038] The term "primer" as used herein, refers to short nucleic acids, typically DNA oligonucleotides of at least about 15 nucleotides in length. In an exemplary embodiment, primers are annealed to a complementary target DNA stand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand. Annealed primers are then
extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be vised for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other nucleic-acid amplification methods known in the art.
[0039] PCR primer pairs are typically derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5 ©1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). One of skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 20 consecutive nucleotides of a guayule chloroplast genome sequence nucleic acid or a cytosolic mevalonaie pathway nucleic acid will anneal to a related target sequence with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in an exemplary embodiment, .gr eater specificity of a nucleic acid primer or probe is attained with probes and primers selected to comprise 20, 25, 30, 35. 40, 50 or more consecutive nucleotides of a selected sequence.
[ΘΘ4Θ] Nucleic acid probes and primers are readily prepared based on the nucleic acid sequences disclosed herein. Methods for prepar ing and using probes and primers and for labeling and guidance in the choice of labels appropriate for various piuposes are discussed. e.g., in Sambrook et ah, Molecular Cloning, A Laboratory Manual 2nd ed. 1989, Cold Spring Harbor Laboratory; and Current Protocols in Molecular Biology, Ausubel et al. , eds., 1994, John Wiley & Sons). The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the ceil, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells comprise and or express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, over expressed, under expressed or not expressed at all. |0041] The term "promoter" or "promoter complex" or "promoter sequence" as used herein refers to an array of nucleic acid expression control sequences that direct
transcription of a nucleic acid. As used herein, a "promoter" or "promoter complex" or "promoter sequence" comprises necessary nucleic acid sequences near the start site of transcription, such as, e.g., a polymerase II type promoter, a TATA element etc to "control" tr anscription of an operably linked nucleic acid, in some exemplary embodiments, a
- ίί -
"promoter complex" or "promoter sequence" also includes distal enhancer or repressor elements, which can be, but are not necessarily located as much as several thousand base pairs from the start site of transcription. In other exemplary embodiments, "promoter" or "promoter complex" or "promoter sequence" includes sequences that facilitate transcription of an operably linked heterologous nucleic acid and/or expression of the final protein product of the heterologous nucleic acid e.g., intron sequence and/or nitron and ubiquitin monomer sequences as disclosed herein.
[0042] As is well known in the art, a "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation, e.g., ^regulation in response to wounding of plant tissues. Promoters may be derived in their entirety from a native gene, may comprise a segment or fragment of a native gene, or may be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. It is further miderstood that the same promoter may be differentially expressed in different tissues and/or differentially expressed under different conditions.
[0043] The term "capable of hybridizing under stringent hybridization conditions" as used herein, refers to annealing a first nucleic acid to a second nucleic acid under stringent hybridization conditions (defined below). In an exemplary embodiment, the first nucleic acid is a test sample, and the second nucleic acid is the sense or aiitisense strand of a guayule chloroplast genome sequence nucleic acid e.g., a guayuie DNA barcode sequence. Hybridization of the first and second nucleic acids is conducted under standard stringent conditions, e.g., high temperature and/or low salt content, winch tend to disfavor
hybridization of dissimilar nucleotide sequences.
[0044] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as e.g., a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence (such as e.g., a nucleic acid encoding in a single operon the six enzymes comprising the complete cytosolic mevalonate pathway) wherein the expression control sequence directs expression e.g. , tr anscription, of the nucleic
acid corresponding to the second sequence. In an exemplary embodiment, a promoter thai is "operably linked" to a heterologous nucleic acid is located upstr eam of and in-frame with the heterologous nucleic acid.
£0045] The term "heterologous" when used with reference to portions of a nucleic ac id indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically
recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g. , a synthetic operon encoding the complete cytosolic mevalonate pathway. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g.. a fusion protein).
J0046] An "expression cassette" as used herein, refers to a nucleic acid construct, typically generated recombinantly or synthetically, which comprises a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. In an exemplary embodiment, an expression cassette comprises a heterologous nucleic acid to be transcribed e.g., a synthetic operon encoding the six genes encoding enzymes comprising the complete cytosolic the mevalonate pathwayoperably linked to a promoter.
[0047] Typically, an "expression cassette" is part of an "expression vector". The term "vector" as used herein, refers to nucleic acid capable of replica ting in a selected host cell or organism. A vector can replicate as an autonomous structure, or alternatively can integrate into the host cell chromosomes and thus replicate along with the host cell genome. In some exemplary embodiments, an expression vector is integrated mto the host cell chromosomes in its entirety. In other exemplary embodiments, a f agment of the expression vector e.g., the expression cassette and flanking sequences, is integrated into the host ceii chromosome. Thus, an "expression vector" is a nucleic acid capable of replicating in a selected host cell or organism e.g., a plasniid, virus, artificial chromosome, nucleic acid fragment, or any suitable construct known in the art, which comprises an "expression cassette".
[0048] The term "transformation" as used herein encompasses any and all techniques by which a nucleic acid molecule might be introduced into a ceil, including but not limited to, transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, Agrobacterium infection, and particle gun
acceleration, etc. The term "transtormation" as used herein applies to plants or plant parts e.g, leaf tissue, callous, chloroplasts. such tha t one obtains a transgenic plant e.g., a transplastomic plant. The term "transformation as used herein also refers to the
transformation of chloroplasts such that one obtains transgenic plants that are transplastomic plants.
[0049] The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity", and "substantial identity". A
"reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length guayule chloroplast genome sequence, a segment of guayule DNA barcode sequence or gene sequence, or gene sequence given in a sequence listing, or may comprise a complete guayule chloroplast genome sequence, guayule DNA barcode sequence, or gene sequence.
[0050] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequence , refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 85% identity, 90% identity, 99%, or 100% identity), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection.
[0051] The phr ase "substantially identical " in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least about 85%, identity, at least about 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. In an exemplary embodiment, the substantial identity exists over a region of the sequences that is at least about 50 residues in length. In another exemplary embodiment, the substantial identity exists over a region of the sequences that is at least about 100 residues in length. In still another exemplary embodiment, the substantial identity exists over a region of the sequences that is at least about 1 0 residues or more, in length, in one exemplary embodiment, the sequences are substantially identical over the
entire length of nucleic acid or protein sequence.
[0052] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default progr am par ameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0053] A "comparison window'*, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g.. by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunseh, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nail. Acad. Sci. USA 85:2444 (1988), by computerized impleineniations of these
algorithms (GAP, BESTFIT, FASTA. and TFASTA in the Wisconsin Genetics Software Package. Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see. e.g.. Current Protocols in Molecular Biology (Ausubel ei al, eds. 1995 supplement)).
[0054] An exemplary algorithm for sequence comparason is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progr essive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Moi. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5: 151-153 (1989). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of
two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple exiensicai of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program is run by designating specific sequences and t eir amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. Using PILEUP, a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00). default gap length weight (0.10). and weighted end gaps. PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395 (1984).
f 0055] Another example of algorithm thai is suitable for deiemiining percent sequence identity and sequence similarity are the BL AST and BLAST 2.0 algorithms., which are described in Altschul el al, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al, J. Mol. Biol. 215:403-410 (1990), respectively. Software for performing BLAST analyses is publicly a vailable through the National Center for Biotechnology Information (NCBI). This algorithm mvolves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (re war d score for a pan of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits hi each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences)
uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3. and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc, Natl. Acad. Sci. USA 89:10915 (1 89)) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
[0056] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Kailin & Altschul, Proc. Nat . Acad. Sci. USA 90:5873- 5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)). which provides an indica tion of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01. and most preferably less than about 0.001.
[0057] An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the aQtibodies raised against the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication tha t two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
[0058] The phrase "selectively (or specifically) hybridizes to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g.. total cellular or library DNA or ENA). In general, two nucleic acid sequences are said to be "substantially identical" when the two molecules or their complements selectively or specifically hybridize to each other under stringent conditions.
[0059] The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences. Stringent conditions are sequence-dependent and will be
different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, "Overview of principles of hybridiza tion and the stra tegy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10 °C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength. pH, and nucleic ccaiceniration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to LO M sodium ion concentration (or oilier salts) at pH 7.0 to 8.3 and the temperatur is at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For high stringency hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplar}' high stringency or stringent hybridization conditions include; 50% formamide, 5xSSC and 1% SDS incubated at 42°C or 5xSSC and 1% SDS incubated at 65 °C, with a wash in 0.2xSSC and 0.1% SDS at 65°C. However, other high stringency hybridization conditions known in the art can be used.
[006Θ] Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they enc ode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplar ' "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M aCL 1% SDS at 370C„ and a wash in IxSSC at 45 °C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize thai alternative hybridization and wash conditions can be utilized to provide conditions of similar
stringency.
I. Introduction:
[0061] Natural rubber is a raw material vital to industry., transportation, medicine and defense. Parikenium argentatum Gray (guayuie) produces high quality, rubber in its bark parenchyma and thus, there is considerable interest in developing guayuie as a source of natural mbber latex.
[0062] Thus, in an exemplary embodiment the invention provides a transplastoinie guayuie plant comprising chloroplasts engineered to express the complete cytosoiic nievalonate (MEV) pathway. These transplastomic plants are capable of producing increased amounts of isopeniylpyrophosphate (IPP) and other isoprenoid pathway products e.g. , terpenoids, sterols, carotenoids, phytoliomiones such as abscisic acid, squalene, and dolichols.
[0063] In some exemplary embodiments, a transplastomic guayuie plant comprising chloroplasts engineered to express the complete cytosoiic mevalonate (MEV) pathway capable of producing increased amounts of isopentylpyrophosphate (IPP) produces increased amounts of natural mbber as compared to a noii-traiisplastomic guayuie plant.
[0064] Isoprenoid biosyiithetic pathways are responsible for the formation of the most chemically diverse family of metabolites found in nature, including sterols (C30), caiotenoids (C40), dolichols (C40-50), ubiquinones (C30-50), and natural mbber (C'2,000- 300,000).
[0065] As is known in the art, isopentenyl diphosphate (IPP) and dimethylaliyl diphosphate (DMAPP), are the two 5-carbon isoprenoid building-blocks from which most isoprenoids are built. Their synthesis occurs by two distinct routes in plants, in the cytosol and in plastids (see e.g., Bick, J.A. & Lange, B.M. (2003) Arch. Biochem. Biophys.
415: 146-154; Cornish, K., and Scott, D.J. (2005) Industrial Crops and Products 22 (2005) 49-58). In the cytosol, IPP and DMAPP are assembled from three molecules of acetyl Co- A by the mevalonate (MEV) pathway. In plastids. an independent pathway, called the
2-C-methyl-D-erythritol 4-phosphate (MEP) pathway, makes IPP and DMAPP from pyruvate and glyeeraldehyde 3-phosphate.
[0066] Without being bound by theory it is believed that because the efficiency of nuclear tiansformation and especially chloroplast transformation is so low in guayuie it is not possible to make or find iraiisforniants cabable of prodieing increased amounts of
natural rubber by comparison to wild type. Fortunately however, the inventors now disclose herein methods for chioroplast transformation of guayule which permit the construction of transplastomic guayule plants comprising chloroplasts engineered to express the complete cytosolic mevalonate ( EV) pathway. These transplastomic plants are capable of producing increased amounts of isopentylpyrophosphate (IPP) and natural rubber. In some exemplary embodiments, a transplastomic guayule plant comprising chloroplasts engineered to express the complete cytosolic mevalonate (MEV) pathway capable of producing increased amounts of isoperitylpyrophospliate (IPP) produces increased amoimis of natural rubber as compared to a non-traasplastomic guayule plant.
Π. Isolating the guayule chioroplast genomic DNA the complete cytosolic mevalonate (MEV) pathway nuclei acids and Constructing Expression Vectors
A. General Recombinant DNA Methods
[0067] This invention utilizes routine techniques in the field of recombinant genetics. Basic texts disclosing the general methods of use in this invention include Sanibrook et !., Molecular Cloning— A Laboratory Manual (2nd Ed.), Vol. 1-3. Cold Spring Harbor Laboratory, Coid Spring Harbor. N.Y., 1989; Kriegler, Gene Transfer arid Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et l., eds., 1 94)). Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology maybe found in e.g., Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9): Kendrew et al. (eds. ), The Encyclopedia of Molecular Biology, published by Biackweii Science Ltd., 1 94 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.). Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
f 0068] For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp). Estimates are typically derived from agarose or aciylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kiiodaltoiis (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
[0069] Oligonucleotides that are not commercially available can be chemically
synthesized e.g., according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et a!., Nucleic Acids Res. 12:6159- 6168 (1984). Purification of oligonucleotides is by either native acrylamide gel
electrophoresis or by anion-exchange HPLC as described in Pearson & Reanier, J. Chroin. 255: 137-149 (1983).
[OO70J The sequence of the cloned genes and synthetic oligonucleotides can be verified after cloning using, e.g. , the chain termination method for sequencing double-stranded templates of Wallace et a , Gene 16:21-26 (1981).
B. Methods for the Isolation of Cytosolic Meva!onate Pathway Genes and Guayule Chioroplast Genome Sequence Nucleic Acids
[0071] Porthmium argeniatum Gray commonly known as guayule, is a shrub in the family Asteraceae, native to the southwestern United States and northern Mexico. P.
argeniatum produces high quality rubber in bark tissue and finds particular value as a source of na tural mbber latex . Indeed, guayule is an important source of natural rubber la tex that is safe for people with Type I latex allergy.
[0072J Guayule chioroplast genome sequence nucleic acids, and cytosolic mevalonate pathway genes can be isolated using any of a variety of methods known to those of skill in the art which may be used for isolation of chioroplast genome sequence nucleic acids. For example, guayule chioroplast genome sequence nucleic acids can be isolated from a guayule genomic library and' or from a guayule chioroplast genomic library,
f 0073] Similarly, cytosolic mevalonate pathway genes can be isolated using any of a variety of methods known to those of skill in the art which may be used for isolation of genome sequence nucleic acids.
J0074] Genomic fragments can be prepared as disclosed below.
|0075] To prepare a genomic library, typically DNA is extracted from plant tissue and either mechanically sheared or enzyrnatically digested to yield fr agments of about 15-20 kb. The fragments are then separated by gradient eentrifugation from undesired sizes and are constructed in bacteriophage lambda vectors. These vectors and phage are packaged in vitro,
as described e.g., in Sambrook, et al. supra. Recombinant phage are analyzed by plaque hybridization as described in Benton and Davis, Science, 196:180-182 (1977). Colony hybridization is carried out as generally described in M. Granstein et al. Proc. Natl. Acad. Sci. USA., 72:3961-3965 (1975). DNA sequences encoding the complete cytosolic mevaionate pathway and/ r fragments thereof, are identified in genomic libraries by the ability of the sequences to hybridize with labeled nucleic acid probes that comprise sequences which encode one or more individual genes (or fragments thereof) that comprise the cytosolic mevaionate pathway, e.g., on Southern blots. The hybridizing DNA regions are isolated by standard methods familiar to those of skill in the art. See e.g., Sambrook, et al. supra.
[0076] Other methods known to those of skill i the art can also be used to isolate sequences encoding the complete cytosolic mevaionate pathway. See e.g., Sambrook, et al. for a description of other techniques for the isolation of DNAs related to DNA molecules of known sequence.
Sequence Features of Sequences Encoding the Compleie Cytosolic Mevaionate Pathway f 0077] The genes encoding enzymes comprising the complete cytosolic mevaionate pathway from yeast and a synthetic operon comprising all si cytosolic mevaionate pathway genes are known in the ait (see e.g., U.S. Patent 7,129,392). The sequence of a plastid transformation vector comprising full length synthetic operon encoding the complete cytosolic mevaionate pathway is also shown in FIG. I , as SEQ ID NO: I. A diagrammatic representation of the nucleic acid sequence illustrated in FIG. I . Is provided in FIG. 2. f 0078] The transformation vector includes guayme-specifie flanking sequences to allow site-specific insertion of the cassette.
[0079] The order of the six cytosolic mevaionate pathway genes on the transformation vector is: Phosphonievalonate kinase; Mevaionate kinase, mevaionate diphosphate decarboxylase, acetoacetyl co-A thiolase, HMGco-A synthase, HMGco-A reductase.
C. Construction of Vectors Comprising Sequences Encoding the Cytosolic
Mevaionate Pathway Genes
[ΘΘ8Θ] Once sequences encoding cytosolic mevaionate pathway enzymes have been
isolated, various methods may be used to constmct expression cassettes, vectors and other DNA constructs. Expression cassettes comprising sequences encoding the complete cytosolic mevalonate pathway can be constructed in a variety of ways. The skilled artisan is well aware of the genetic elements that must be present on an expression construct/Vector in order to successfully transform, select and propagate the expressicai construct in host cells e.g., in chloropiasts, see e.g., Wu. S. et al (2006) Nat. Bioteclmol.24: 1441-1447; Maliga, P. (2004) Anna. Rev. Plant Biol. 2004. 55:289-313) Techniques for manipulation of nucleic acids encoding enzymes comprising the complete cytosolic mevalonate pathway such as subcloning nucleic acid sequences into expression vectors, labeling probes, DNA
hybridization, and the like are described generally in Sambrook, et a!.,, supra.
f 0081] Although cytosolic mevalonate pathway genes can be individually cloned and expressed, in an exemplary embodiment, the six genes encoding cytosolic mevalonate enzymes acetoacetyl-CoA synthase, 3-hydroxy-3-methylglutaryi-C A {HMG-CoA) synthase, HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, and pyrophosphomevalonate decarboxylase, are cloned and expressed from a single synthetic operon (see e.g., U.S. Patent 7,129,392; FIG. I and FIG. 2.).
[0082] DNA constructs comprising sequences encoding the complete cytosolic mevalonate pathway can be inserted into a variety of vectors. Typically, the vector chosen is a vector suitable for expressing the complete cytosolic mevalonate pathway in chloropiasts. An exemplary vector comprising a synthetic operon encoding the complete cytosolic mevalonate pathway is shown in FIG. 2. Such vectors can be constructed by the use of recombinant DNA techniques well known to those of skill in the art. See e.g., Sambrook et al. supra. An expression vector comprising e.g.., a sequence encoding all six enzymes that comprise the complete cytosolic mevalonate pathway, may then be transfected/fraiisfomied into the target cMoroplasi/plastid. Successfully transformed plastids are then selected based on the presenc e of a suitable marker gene as disclosed below.
[0083] A number of recombinant vectors are available to those of skill in the art for use in the stable transaction of chloropiasts for the establishment of transplastomic plants (see e.g., FIG. 3. In particular, recombinant vectors are available to those of skill in the art for use in the stable transfection of chloropiasts typically comprise homologous flanking sequences on either side of the transgene cassette to facilitate double recombination. The
flanking sequences are generally about Ikb in size. Chloroplast vectors may also cany an origin of replication that facilitates replication of the plasmkl insidethe chloroplast, thereby increasing the template copynumber for homologous recombination arid consequently enhancing the probability of transgene integration.
(i) Elements
[0084] in addition to sequences encoding the complete cytosoiic mevalonate pathway, expression constructs prepared as disclosed may comprise additional elements..
(it) Marker Genes
[008S] As noted above, plastid transformation vectors typically include a selectable and/or screeiiable marker gene to allow for the ready identification of transformants.
Exemplary selectable marker genes include, but are not limited to those encoding antibiotic resistance (e.g. resistance to hygromycin, kananiycin, bleomycin, G418, streptomycin or spectinomycin) and herbicide resistance genes (e.g., phosphmotkricin aeetyltransfera.se). Exemplary screeiiable markers include e.g., green fiorescent protein.
[0086] In an exemplary embodiment, a selectable or screeiiable marker gene is employed in addition to sequences encoding the complete cytosoiic mevalonate pathway, to provide or enhance the ability to identify transformants. As is known in the art, "marker genes" are genes that impart a distinct phenotype to cells expressing the marker gene, such that transformed cells can be distinguished from cells that do not have the marker. In one exemplary embodiment, marker genes encode a selectable marker which one can "select" for by chemical means, e.g., through the use of a selective agent (e.g. , a herbicide, antibiotic, or the like). In another exemplary embodiment, marker genes encode a screeiiable marker, which is identified through observation or testing, e.g., by "screening" (e.g., the green fluorescent protein).
f 0087] Numerous selectable marker genes are known to the art. Some exemplary selectable markers are disclosed in e.g. , Potrykus et o , (1985) Mol. Gen. Genet., 199:183- 188; Stalker et a!., (1 88) Science. 242: 19 422; Thillet et at., (1 88) J. Biol. Ctiem., 263:12500 12508; Thompson et a!., (1987),. EMBO J 6:2519-2523; Deblock et al (1987), EMBO J. 6:2513-2518; U.S. Patent 5.646,024; U.S. Patent 5,561,236: U.S. Patent application Publication 20030097687; and Boutsalis, P., and Powles, S.B. (1995) Weed
Research 35: 149-155.
f 0088] Some exemplary screenable markers include, but are not limited to a β- glucuronidase (GUS) or iiidA gene, see e.g. , U.S. Patent 5,268,463, U.S. Patent 5,432,081 and U.S. Patent 5,599,670; a β-gene, see e.g., Suteliffe, (1978) Proc. Natl. Acad. Sci. USA, 75:3737-3741 ); β-galactosidase: and lueiferase (lux) gene (see e.g. , Ow et at., (1986) Science, 234:856-859; Sheen et al., (1995) Plant J., 8(5): 777-784; and WO 97/41228).
[0089] Exemplaiy selectable or screenable marker genes also include genes which encode a "secretable marker" whose secretion c an be detected as a means of identifying or selecting for transformed cells. Exemplary secretable markers include but are not limited to secretable antigens that can be identified by antibody interaction, e.g., small, diffusible proteins detectable, e.g., by ELISA; and/or secretable enzymes which can be detected by their catalytic activity. E.g., small active enzymes detectable in extracellular solution (e.g., a-amylase, β-lactainase, phosphmothricin acetyltiansferase): and proteins that are inserted or trapped in the cell wall (e.g., proteins that include a leader sequence such as that found e.g., in the expression unit of extensin or tobacco PR-S).
[0090] The choice of a particular marker gene is readily made by the skilled practioner according to the needs arid considerations of the particular' application or use.
(iv) Other Vector Components
[0091] in some exemplary embodiments, an expression vector further comprises sequences that are joined to the sequences encoding the complete cytosolic mevalonate pathway, which are removed p st-translationally from the initial translation product. In one exemplary embodiment, post-translationally removed sequences facilitate the transport of the protein into or through intracellular- or extracellular membranes, thereby facilitating the transport of the protein into compartments inside and/or outside the cell. In an exemplary embodiment, post-translationally removed sequences protect a nascent protein from intracellular proteolytic degradation. In one exemplary embodiment, a nucleic acid segment encoding a leader peptide sequence upstream and in reading frame with a selected coding sequence is used i recombinant expression of the coding sequence i a host cell
[0092] in another exemplary embodiment, an expression construct comprises a bacterial origin of replication, e.g., a colE i origin. In still another exemplary embodiment, an
expression construct/vector comprises a bacterial selectable marker e.g., an ampieillin, tetracyclic hygromycin, neomycin or chloramphenicol resistance gene,
f 0093] As is well known in the art. expression constructs typically comprise restriction endonuelease sites to facilitate vector construction. Exemplary restriction endonuelease recognition sites include, but are not limited to recognition site for the restriction endonueleases Noil, Aatll, SacII, Pmei Hindlll, Pstl, EcoRI, and BamHL
D. Plant Hosts, hioroplast Transformation and Plant Selection and Regeneration Techniques
[0094] DNA constructs comprising a gene or a synthetic operon encoding all six genes comprising the complete cytosolic nievaionate pathway, can be transformed into plastids to provide trarispiastoimc plants with desired phenotypic characteristics e.g., having the ability to produce increased amounts of natural rubber as c ompared to non-ti ansplastonnc plants. Exemplary plants for transformation with expression constructs comprising the complete cytosolic nievaionate pathway include, but are not limited to; dicotyledonous species, such as e.g., guayule (Parthenium argentatum); tobacco (Nicotiana spp.), Lactuca spp. and sunflower (Heliaathus spp.).
f 0095] In an exemplary embodiment, guayule (Parthenium argentatiim) is transformed with a DNA construct that comprises a synthetic operon which encodes the six genes comprising the complete cytosolic mevalonate pathway.
[0096] Although plastid transformation in higher plants is know in the art (see e.g., Svab Z, et al. (1990), Proc. Nail. Acad. Set. USA 87:5526-30; U.S. Patent Application Publication 2006/0248608; U. S. Patent Application Publication 2010/0218277). In general, chloropiast transformation is a routine procedure only in tobacco (see e.g., Maliga. P.
(2004) Annu. Rev. Plant Biol. 2004. 55:289-313).
[0097] Therefore, before now it has not been possible to produce a transplastomic guayule plant comprising chloroplasts engineered to express the complete cytosolic mevalonic acid (MEV) pathway wherein the transplastomic guayule plants are capable of producing increased amounts of isopentylpyrophosphate (IPP), and ultimately increased amounts of rubber (see e.g., Liu et al.. Plant Cell Rep 2007; Sikdar et al. (1998) Journal of Physiology 511, 851-859; Bogorad (2000) TTBTech 18:257-263; Verma and Danielle (2007): Plant Physiology 145: 1129-1143. indeed, it is generally accepted that the harder it is
to transform any given species' nuclear D A, all the more difficult it will be to transform tie chloroplast. Guayuie is considered difficult in nuclear t ms formation (under 2% efficiency usually) so for chloroplast transformation one might expect zero success or fractional percentage efficiencies at best.
[0098] Fortunately., the present inventors have discovered, and now herein disclose, reliable methods for the transformation of guayuie ehloroplasts (see e.g.. Examples 2, 3 and 7} and regeneration of the transformed protoplasts thereby making it possible to produce a transplastomie guayuie plant comprising ehloroplasts engineered to express the complete cytosolic mevalonic acid MEV) pathway. Such transformed guayuie plants are capable of producing increased amounts of isopentylpyrophosphafe (IPP), and increased amounts of natural rubber.
[9999] Exemplary aspects of the transformation and propagation methods disclosed herein which contribute to the success of the method include e.g. :
[99199] Media composition: Transformation media: MS (Murashige and Skoog.
Miuashige T and Skoog F (1962) Physiol Plant 15:473-497 ) media or DKW (Driver and uniyuki Walnut; Driver and Kuniyuki 1 84)) media supplemented with calcium nitrate; and activated charcoal Propagation media; WPM (, or Woody Plant Medium; Lloyd and McCown 1981) supplemented with activated charcoal.
[00101 ] When present, concentration of activated charcoal is typically a t least about .2% w/v (or 2g/L). However, in some exemplary embodiments, activated charcoal is present in concentration that is in a range that is between about lg L to about 10 g/L. In other exemplary embodiments, activated charcoal is present in a concentration that is a range that is between about lg L to about 5 g/L. Thus, in some exemplary embodiments, activated charcoal is present in a concentration that is about lg/L, about 2 g/L, about 3 g/L, about 4g/L, about 5g/L, about 6g/L, about 7 g/L, about 8 /L, about 9g/L, or about lOg L.
[00102] When present, the concentration of calcium nitrate is typically at least about 100 mg/L. However, in some exemplary embodiments, calcium nitrate is present in a concentration that is in a range that is between about lOGnig/L to about 1500 mg/L. In other exemplary embodiments, calcium nitrate is present in a concentration that is about 150 mg/L, about 200 mg L, about 250 mg/L. about 300 mg/L, about 350 mg/L, about 400 mg/L, about 450 mg/L, about 500 mg/L, about 550 mg L, about 600 mg/L. about 650 mg/L, about
7000 mg/L, about 750 mg/L, about 800 rng/L, about S50 mg/L, about 900 mg/L, about 950 mg/L, about 1000 mg L, about 1100 mg/L, about 1200 mg/L, about 1300 mg/L, about 1400 rng/L or about 1500 rng/L.
£00103] Zeatin shock: before and immediately after introducing the transgene, plants are exposed to high concentration of trans zeatin riboside (or similar chemicals as listed in table) Typical concentration of trans zeotin-riboside is at least about 5 rng/L. However, concentrations in a range t at is between about I mg/L to about 160 mg/L are used effectively. Thus, in some exemplary embodiments trans-zeotin-riboside is present in a concentration of about 1 mg/L , about 3 mg/L , about 5mg/L, about 10 mg L, about 15 mg L, about 20 mg/L, about 30mg/L, about 40 mg/L, about 50 mg L, about 60 mg/L, about 70 mg/L, about 80 mg/L, about 90 mg L, about 100 mg/L, about 110 mg/L, about 120 mg L, about 130 mg L, about 140 mg/L, about 150 mg L, or about 160 mg/L.
[00104] Dipping method for rooting: optimized exposure (cone and time) to plant hormone (IBA specifically) for rooting.
f 00195] One of skill will recognize that, after an expression cassette is stably
incorporated into cMoroplasts and confirmed to be operable, a transplastoniic plant is thereby provided, hi one exemplary embodiment, an expression cassette comprising complete cytosolic mevalonic acid (MEV) pathway is stably incorporated into chloroplasts and confirmed to be operable, thereby providing a transplastoniic plant having increased production of na tural la tex rubber. Transplastoniic plants can be used to introduce the metabolically engineerered chloroplasts into new plants by sexual crossing, thereby developing new transplastoniic lines. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
[00166] The skilled artisan will recognize that multiple events may need to be screened in order to obtain lines displaying the desired expression level and pattern. Exemplary method for screening transformation events may be accomplished e.g., by PGR as disclosed hereinbelow; by Southern analysis of DNA blots (Southern, (1975) J. Mo! Biol. 98: 503), Northern analysis of inRNA expression (Kroczek, J., (1993) Chrornatogr. Biomed. AppL, 618(1 2): 133 145), Western analysis of protein expression, and/or phenotypic analysis e.g.. resistance to an herbicide can be detected by treatment with the herbicide. Expression of the heterologous DNA can also be detected by measurement of the specific RNA transcription
product. This can be done by, for example, R Ase protection or Northern blot procedures. If heterologous DNA sequences encode a novel protein, the protein product may be assayed, for instance, by its function or by a variety of immunoassay techniques. Alternatively, a novel protein product with enzymatic activity can be measured in an enzyme assay. In another exemplary embodiment, protein expression is quantitated and/or detected in different plant tissues using a reporter gene, e.g., GUS.
[00107] Once transplastornic plants have been obtained, they may be grown to produce plant tissues or parts having the desired phenotvpe. The plant tissue or plant parts may be harvested, and/or the seed collected. The seed may serve as a source for growing additional plants with tissues or par ts having the desired characteristics.
E. Detecting Expression of Heterology Nucleic Acids in Transplastomic Plants
[001Θ8] The introduction of expression vectors into chloroplasts as disclosed herein is useful for the introduction of one or more new tr aits to a host plant ceil e.g.., introducing a synthetic operon encoding the six genes that encode enzymes comprising the complete cytosolie mevalonate pathway and thereby providing a transplastomic guayule plant capable of producing increased amounts of isopentylpyrophosphate (IPP). There are a var iety of different approaches one can use detemiine if a desired phenotype has been produced in transplastomic plants (see e.g., Kumar et ai. Metabolic Engineering 14 (2012) 19-28).
[00109] In general, a transplastomic guayule plant is detected by means which include but are not limited to;
[00110] Growth on selection: a) In an exemplary embodiment, the independently- generated transplastomic lines are subjected to 4-6 rounds of regeneration on
spectinomycm. Spectinomycin is an antibiotic that is fatal to guayule plants at about 12 mg/L. The aadA gene, included in the operon, confers resistance to spectinomycin. Plants that survive under spectinomycin selection pressur e (12-20 mg L-) are putative
transplastomic guayule. b) Regeneration on kanamycin. Kanamycin is an antibiotic that is also fatal to guayule. The ΝΡΤΠ gene, included in the operon, confers resistance to
kanamycin. Plants that survive under selection pressure are possibly putativeiy
transplastomic.
[00111] Genomic PCR analysis: To test integration of gene cassettes into the chloroplast genome, PCR is performed with primers that are targeted to one of the introduced genes (e.g.. GFP, aadA, ΝΡΤΠ or other genes) and compared to the native chloroplast genomic DNA.
[00112] Green Fluorescent Protein detection: Transplastomic plant tissues with the GFP gene exhibit fluorescence when exposed to visible light. The emission peak is at 509 mn. which is in the lower green portion of the visible spectrum.
[00113] Leaf painting: Transformed plants expressing the antibiotic resistance genes should be resistant to antibiotics. To confirm that all parts of the plant have been
transformed, leaf painting techniques can be used. This technique are used to detect and eliminate chimeric plants, hi practice, various leaves from different sections of the plant are brushed spotted with antibiotic solution, then inspected for browning over a period of time. This is preferably done on plants that have been transferred to soil. Plants exhibiting no browning on any leaf sections may be homoplasmic.
[00114] Genomic southern blot analysis: Southern blots are performed to analyze gene integration into the plant DNA. Total genomic DNA (2 mg) of transgenics and wildtype, are digested with appropriate restriction enzymes and hybridized with a P32-labeled DNAprobe amplified by the PCR using primers to internal regions of flanking native DNA. f 00115] Gene expression analysis: Performed by isolation of total RNA followed by addition of specific reverse-traiiscriptase primers targeted to specific genes or junctions of genes within the insert, followed by amplification by PCR and sequencing of the PCR products.
[00116] To functionally confirm the presence of the MEV6 genes, transplastomic and wildtvpe plants are grown on medium containing fosmidomvcm at 100 mM. Fosmidomycin is a specific inhibitor of dxr in the plastidial MEP pathway (Zeidier etai..(1998) Z
Naturforsch 53: 980—986). When dxr is inhibited in chloroplasts, the plastids no longer appear green, and turn white. If IPP is a vailable through the alternative, inserted ME V6 pathway, the plant can use that IPP to produce chlorophyll and the tissues will appear green.
[00117] Analysis of metabolic pathway products: including sterols, ratty acids and triglycerides, carotenoids, squaiene, and of course, natural rubber produced in the plants.
|00I18] Measurement of the IPP levels in the plant is made according to methods known in the art see e.g., : Monkkorien, H., Auriola, S.. Lehenkari, P., Kellmsaimi, M., Hassinen, I.E.. Vepsaiainen. J. & Monkkooen, J. A. (2006). British Journal of Pharmacology, 147. 437-445.
Detecting increased production of IPP and Natural Rubber
[00119] Natural rubber content of plants that grow successfully on selection media, and/or plants that test positive for the presence of the tans genes, is quantified vs. control plants. In an exemplary embodiment, natural rubber content is quantified by extraction of rubber in latex form, latex quantification, by methods known in the art (see e.g., Cornish et al. Industrial Crops and Products 10 (1999) 121-136) In another exemplary embodiment, natural rubber content is quantified by using solvent (e.g., toluene, eyeiohexane, or THF) extraction of harvested, gr ound plant tissues by methods known in the ait (Pearson et al. Industrial Crops and Products 31 (2010) 469-475). The quality of natural rubber is usually indicated by molecular weight and molecular weight distribution, as determined by gel permeation chromatography, well known to those skilled in the art (see e.g., Wyatt, P.J. 1993 Light scattering and the absolute characterization of macromolecnles. Analytica
Chimica Acta 272, 1-40; Jackson, C. et al.., 1 96 Size exclusion chrornaiography with multiple detectors: solution properties of linear chains of varying flexibility in
tetrahydrofixran. Journal of Applied Polymer Science 61, 865-874).
[ΘΘ12Θ] In some exemplary embodiments, increased rubber concentration is
accompanied by equivalent or increased concentration of resins and/or biomass.
[00121] The following examples are offered to illustrate, but not to limit the invention.
EXAMPLES
Example i:
[00122] The following example illustrates successful guayule chloroplast transformation.
Materials and Methods for Example 1
Plant Material
[00123] In vitro cultures of guayule were established from seeds of cultivar AZ-2 obtained from the USDA-ARS US- Arid Lands Research Center (Maricopa, AZ). Seeds were excised, then soaked sequentially in a 2% Tween-20 solution for 5 niin, 70% ethanol for 1 mill and in a 0.525% sodium hypochlorite (Clorox®) solution for 15 mm. Seeds were tr iple rinsed with sterile water for 5 lain each time. After germination, 3cm of shoot tip was placed into a rna magenta box containing 88 inL ofMurashige and Skoog (MS) (1962) basal medium supplemented with MS vitamins (PhyioTechnoiogy Laboratories, Shawnee Mission, S), 3% (w v) sucrose and 0.3% (w/v) phatagel (Cat. No. p8169. Sigma). The solution was adjusted to pH 5.7-5.8 prior to autoclaving ai 121°C and 103.5 kPa (15 lb m-2) for 30 min. This was the established medium used to maintain in vitro guayule cultures in our laboratory (Dong et al, 2006). The cultures were maintained in a growth chamber at 25 °C under a i 6-h photoperiod provided by cool- white fluorescent lamps. The lamps provided a phorosynthetie photon flux of 125 μπιοί·πϊ2·8_Ι, held at the top of the culture vessels. All of the stock cultures in the following experiment were maintained under these conditions.
Propagation of guayule expl nts
[00124] In vitro guayule shoots were cultured aseptically on woody plant medium
(WPM) (Lloyd and McCowri ( 1981) Combined Proceedings - International
[0012S] Plant Propagator's Society, 30: 421-427) without any plant growth regulator (PGR). Vigorously growing -3cm shoot tips were excised for guayule propagation as disclosed herembe!ow in Examples I and 6.
[00126] All medium were supplemented with 0.1% MS vitamins, 3% (w/v) sucrose, 0.2% Activated charcoal (w/v) and 0.3% (w/v) phatagel (Sigma).
Resistance of regenerated shoot on speclinomycin media
[00127] To confirm whether the guayule explants were resistant to spectinomycin, in vitro leaf explants from control plants were cultured on regeneration DKW media that contained 0.75 mg»L_I BA and 0.25 mg»L"5 NAA at 12 mg»L"1 spectinomycin antibiotic levels.
Vector and E. coif strain
£00128] The piasmid transformation vectors used in this work were pUY-Gua- aadA/NPTH/GFP. The piasmid pITi'-Giia-aadA/ PTII/GFP vector (FIG. 3) contains the aadA (aminoglycoside 3-adenyl transferase) arid NPTII gene as a selectable, and the multiple cloning site flanked guayule plastid DNA homologous sequences to target the insertion of the linked transgenes into the plastid genome by homologous recombination. Also piasmid contained the green fluorescent protein (GFP). The aadA and NPTII gene encodes resistance to spectinomycin and kanainycin, respectively.
|00129] All cloning steps were carried out in E. coli according to the methods of
Sambrook et al (1989).
Transformation of Guayule
[0013Θ] For transformation, young leaves were harvested from 4 weeks old plants produced from outgrowing axillary iiieristems in stem cutting. The vigorous young leaves were placed in media (MSZ5 media) for bombardment and recovery. The leaves were then bombarded with gold particles of 0.6 mm in diameter coated with pUY-Gua- aadA NPTil GFP piasmid, using a PDS 1000/He Biohstic® (Bio-Rad, Hercules, CA) device employing 1100 psi raptme disks and a target distance of 6 cm. In each bombardment. 0.7 nig of 0.6 micron gold and 12.5 ug of piasmid DNA were used. After bombardment, guayule expiants were cultured at 25*C in growth chamber for 5 days on the MSZ5 medium (MS medium supplemented with 5 nig-L"1 trans zeatiii riboside) for recovering,
f 00131] To select an optimal medium for callus and shoot formation, DKW medium were used. Recovered expiants were transferred onto DKW-CN-SP12 (DKW medium
supplemented with 0.75 mg-L"! N6 benzylaminopurine (BA), 0.25 mg-L"! a- naphthaleneaeetic acid (NAA), 250 iiig-L"1 calcium nitrate and 12 mg-L 3 spectinomycin) selection medium for callus and shoots induction. After 6 weeks later, the regenerated green shoots were transferred onto the new D W-CN-SP 15 (DKW medium supplemented with 0.75 mg-L"1 N6 benzylanunopurine (BA), 0.25 mg-L"1 a-naphtha eneacetic acid (NAA), 250 mg'L"1 calcium nitr ate and 15 mg-L"1 spectinomycin) to remove chimerical shoots and for selection of resistant and elongation shoots for 6 weeks. E very 3 weeks the callus and
explants were transferred to the new fresh plates of the same media types. Regenerated shoot transferred to rooting medium (WP medium supplement with 0.2 nig-L"1 IB A and 12 mg'L"1 spectiaoinycm) when it grow up over 2 cm.
[00132] All in vitro explants were aseptieally grown on MS or DKW supplemented with
0.1% MS vitamins, 3% (w/v) sucrose and 0.3% (w/v) phatagel (Sigma).
[00133] in general the method disclosed herein differs from known methods in: 1) media composition (transformation and propagation, 2) the use of cytokinin shock, 3) Dipping method for rooting. The bombardment conditions used were pretty standard.
[00134] Our observation is that for plants are growing on media containing activated chaicoat the chlorophyll A content is apparently mcreased (greener). Without being bound by theory it is believed that the ehloroplasts are healthier, or more numerous, or both.
Accordingly, the health of the ehloroplasts could be one reason for the success of the method.
[00135] Furthermore, Cytokimns (CK) e.g., zeatin, are naturally-occurring secondary metabolites that function in plant growth, development, and signaling (see e.g.. Hitoshi Sakakibara (2006) Cytokimns: Activity, Biosynthesis, and Translocation Annu. Rev. Plant Biol. 57:431-449). The specific nature of these interactions is not completely understood. However, including Zeatin hi the media before and after bombardment cleaily contributes to the success of the method.
[00Ϊ36] Thus, the fransformation methods disclosed herein in Example 1, 2 and 6 utilize the following elements for successful guayule chloroplast transformation: 1) Media composition: (a) Transformation media: MS (Mumshige and Skoog, Murashige T and Skoog F (1 62) Physiol Plant 15:473-497 ) media or DKW (Driver and Kuniyuki Walnut; Driver and Kuniyuki 1 84) media supplemented with calcium nitrate, (b) Propagation media: WPM (Woody Plant Medium Lloyd and McCown 1981) supplemented with activated charcoal.
[00137] 2.) C tokinin (Zeatin) shock: before and immediately after introducing the transgene, plants are exposed to high concentration of trans zeatm riboside (or similar chemicals a.s listed in table).
|00138] 3.) Dipping method for rooting optimized exposure (cone and time) to plant hormone (IBA specifically) for rooting.
DNA extraction and PCR amplification
£00139] Total DNA was extracted from 100 nig leaf tissues of the transformed and wild type guayuie plants. The Polymerase chain reaction (PCR) was performed by using the Taq 2x Master Mix (Prornega, Madison, WI) with -100 ng leaf DNA as template. For the PCR identification of transgenic plants, primers GFP1 (5'-CTGAAGTTCATCTGCACCAC-3\ SEQ ID NO:6) and GFP2 (5 '-GGTGCTCAGGTAGTGGTTGT-3' SEQ ID NO: 7) were used to amplify the sequence of GFP. Template DNA was denatured at 94 for 2 in and 35 cycles of amplification was carried out as follows: 94°C for 30 s, primer annealing at 52°C for 30s and extension at 72°C for 1 min; The samples are followed by 7 min final extension at 72'3G. PCR products were examined by electrophoresis through 1.0% agarose gels containing 1 pg mg*L_I ethidium bromide under UV illumination.
[ΘΘ14Θ] We have confimied the transformation of guayuie ehloroplasts by PCR. We have positive PCR for the empty vector (control) lines, at least 4 lines, determined using the primers for GFP, as described above. We have guayuie with the MEV6 cassette mserted and growing on selection.
[00141] The transformation frequency is about 5%. While this may seem a low frequency on its face, every other method yields 0%. (This finding is discussed further in Example 5 herein below)
Example 2: f00142] The following example illustrates an improved, highly efficient propagation and regeneration protocol for guayuie transformation.
Materials and Methods
Plant Material
f00143] In vitro cultures of guayuie were established from seeds of cultivar AZ-2 (ref) obtained from the USDA-ARS US- Arid Lands Research Center (Maricopa, AZ). Seeds were excised, then soaked sequentially in a 2% Tween-20 solution for 5 min, 70% ethanol for 1 min and in a 0.525% sodium hypochlorite (CTorox ) solution for 1 min. Seeds were triple rinsed with sterile water for 5 min each time. After germination, 3cm of shoot tip was placed into a magenta box containing 88 niL of Murashige and Skoog (MS) (1962) basal medium supplemented with MS vitamins (PhytoTeclmology Laboratories, Shawnee
Mission, KS), 3% (w/v) sucrose and 0.3% (w/v) phatagel (Cat. No. p8169, Sigma). The solution was adjusted to pH 5.7-5.8 prior to autoclaving at 121°C and 103.5 kPa (15 lb in"2) for 30 min. This was the established medium used to maintain in vitro guayuie cultures in our laboratory (Dong et al, 2006). The cultures were maintained in a growth chamber at 25 °C under a 16-h pliotoperiod provided by cool-white iluorescent lamps. The lamps provided a photosynthetic photon flux of 125
held at the top of the culture vessels. All of the stock cultures in the following experiment were maintained under these conditions.
The effect of basal medium for guayuie propagation
|00144] To evaluate the effect of basal medium salt on plant propagation, guayuie shoots were cultured asepiically on either MS, woody plant medium (WPM) (Lloyd and McCown (1981) International Plant Propagator's Society, 30: 421-427 or Driver and Kuniyuki walnut (DKW) medium (Driver and Kuiriyuki (1984) Hort. Sci 19:507). Vigorously growing 3-cm shoot tips were excised for guayuie propagation (Table I ). All medium were supplemented with 0.1% MS vitamins, 3% (w/v) sucrose and 0.3% (w/v) phatagel (Sigma).
Efficiency of Guayuie shoots regeneration
100145] MS and DKW medium with cytokinin and auxin effects for guayuie regeneration
[00146] All in vitro expiants were aseptically grown on woody plant medium
supplemented with 0.1% MS vitamins. 3% (w/v) sucrose and 0.3% (w/v) phatagel (Sigma). They were transferred to fresh medium (hormone free WPM) every 6-7 weeks as leaves were used as a source of expiants for shoot regenera ion.
£00147] Twenty shoot induction media, differencing in nutrient formulation (MS, DKW), were employed. The effect of naphthalene acetic acid (NAA) and 6-benzyladenine (BA) of guayuie expiants on shoot r egeneration was examined in combinations of five levels of NAA (0.1, 0.25, 0.50, 0.75 and 1.0 nig-I/5) and four levels of BA (0.25, 0.50, 0.75 and 1.0 nig-L"1). Petri-dishes (100 x 20 mm) were cultured and kept under a 16 hour light period and 25 °C temperature. After 3 weeks the callus (expiants) were transferred to fresh plates of the same media types and maintained for an additional 3 weeks. Data was collected at 3 and 6 week time intervals. The expiants were evaluated for both shoot regeneration and callus growth.
Effect of calcium nitrate tetr hydrate (CaA^O^H^O) on DKW and MS medi for regeneration
[00148] To evaluate the effect of eaieiuni nitrate on guayule regeneration, guayule explants were cultured on MS basal medium with plant growth regulators (PGRs) (1.0 mg-L"1 BA and 0.1 mg-L"5 NAA) and calcium nitrate. Six calcium nitrate concentrations, 0, 100, 250, 500. 750, 1000 and 1500 mg-L"1, were tested (Table 3). Calcium nitrate was added to the culture medium before adjusting the pH to 5.7, prior to autoclaving, DKW basal medium (0.75 mg-L"1 BA and 0.25 mg-L"1 NAA) was used as a control.
Resistance of regenerated shoot on medi with spectinomycin
[00149] To confirm whether the guayule explants were resistant to spectinomycin, leaf explants from control plants were cultured on regeneration DKW media that contained 0.75 mg-L"1 BA and 0.125 mg-L"1 NAA at var ious spectinomycin antibiotic levels. Several concentration of spectinomycin (0, 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 mg-L"1) was added to the media to confirm the effects of antibiotic concentration on regeneration.
Experimental design, data collection and statistical analysis
fOOlSO] In the first experiments (the effects of basal medium for guayule propagation), 10 magenta boxes containing one shoot per magenta box were used for each treatment, and experiments were repeated three times. Plant performance was evaluated at 6 weeks for growing rate. The length of each plant was measured every 2 weeks for 6 weeks. The experimental design was a Completely Randomized Design (CRD), and the length date were evaluated by analysis of variance (ANOVA) using SAS version 9.1 (SAS Institute Inc. Cary, NC).
Results:
The effect of basal medium for guayule propagation
[00151] Shoot tips grown on MS, DKW and WP medium were compared without the use of plant growth regulators. Results indicate that significantly faster rooting and significantly higher performance ratings were found for WPM than for the MS and DKW medium (Table 1). The lengths of shoots was also significantly higher when WPM was used.
[00152] Table 1. Effect of MS, DKW and WPM for guayule propagation after 4 weeks on three a al media
Basal Day of first root Performance Length of Performance
Medium coining rating* shoots (4weeks) rating
MS 5.9 days b 4.22 cm be
DKW 7.4 days c 3.87 cm c
WPM 4.8 days a 5.28 cm a
Mean length of guayule shoots grown on MS, DKW and WPM PGR-free phatagel medium after 4 weeks. Cultures were placed in growth chamber. The lamps provided a photosynthetie photon flux of 125 juaol-m^-s"
\ held at the top of the culture vessels.
The same letters in the different rows indicate that there is no significant difference (P≤0,05)
Efficiency of Guayule shoots regeneration
MS and DKW medium with BA and NAA effects for guayule regeneration
[00153] Twenty combinations of NAA and BA concentrations were used for guayule regeneration. The maximum frequency of callus with mititi shoots was obtained in the MS medium supplemented with 1.0 mg/L BA and 0.1 mg/L NAA (MS#4) and DKW medium supplemented with 0.75 mg-L-1 BA and 0.25 mg-L"1 NAA (DKW#7), respectively (Table 2). On those medium, each explant regenerated multiple shoots. The explants grown on MS medium showed larger size callus growing than DKW medium. Though there was no significant difference in shoot regeneration frequency between MS #4 and DKW #7.
However, DKW #7 produced true shoots appeared from callus.
Table 2. Effect of cytokmm and auxin on MS and DKW media for regeneration of suaytile
MS DKW
BA NAA Callus/total ¾aiius with Calkis/total ¾ alius with
(iiig-L"1) (ais-L" !) explants uiulti expiants mold
Condition shoots total shoots/tots! expiatits expiaiits.
I 0.25 0.10 16/30 12/3 C 20/30 7/30d
2 0.50 0.10 25/30 ISVSObc 22/30 8/30cd
;> 0.75 0.10 29/30 24/30b 30/30 22/30b
4 UO o.io 30/30 30/30a 30/30 22/30b
5 0.25 0.25 11/30 4/3 Oe 11/30 3/30f
6 0.50 0.25 16/30 4/3 Oe 18/30 11/30C
■7 0.75 0.25 25/30 19/30bc 30/30 30/30a
8 1.00 0.25 28/30 16/30C 29/30 24/30b
9 0.25 0.50 9/30 0/3 Oe 5/30 i/30e
10 0.50 0.50 12/30 6/30d 19/30 9/30cd
11 0.75 0.50 19/30 12/30C 18/30 12 30c
12 1.00 0.50 18/30 9/30c 20/30 13 30c
13 0.25 0.75 4/30 0/3 Oe 3/30 0/30f
14 0.50 0.75 9/30 2/30d 4/30 i/30e
15 0.75 0.75 17/30 6/30d 8/30 4/30e
16 1.00 0.75 22/30 8 30c 13/30 7/30d
17 0.25 1.00 0/30 0/3 Oe 0/30 0/30f
18 0.50 1.00 2/30 0/3 Oe 0/30 0/30f
19 0.75 1.00 9/30 2/30d 0/30 0/30f
20 1.00 LOO 8/30 2/30d 3/30 l/30e
Several eoiicerifratioris of BA (0.25, 0.5, 0.75 and 1.0 nig-L" ) and NAA (0.1, 0.25, 0.75 and 1 mg-L~ ) were added to MS or DKW medium to compare the effects of regeneration. For regeneration, three replicate plates were used, each with five 0.5 cm" leaf segments. Each experimeni■■was repeated two times. Expiants leaves were grown hi petri-dish (20 x 100 aim) in sterile conditions at 25 °C and 16 h pliotoperiod. Ali media were supplemented with 0.1 % MS vitsaaiis, 3% (w/v) sucrose and 0.6% (w/v) phatagei (sigrna). Explants were sub- cuitured every two weeks and data were collect at six weeks.
The same letters in the different rows indicate that there is no significant difference (p≤0.05)
Effect of calcium nitrate tetrahydrate (Ca iC liiO) on DKW and MS media for regeneration
|001S4] The addition of calci um nitrate tetrahydrate at moderate concentrations (0. 100, 250, 500 and 1000 mg-L 1) into MS medium significantly improved the number of elongated shoots in both MS and DKW medium. Higher concentrations bad a negative effect (see e.g.. Table 3).
Table 3. Effect of calcium nitrate tetrahydrate (Ca 20g4¾0) on DKW and MS media for true shoots regeneration
MS DKW
xSiz of Callus 5 Number of Size of Callus Number of
Calcium Nitrate with iiHiiti shoots elongated shoots wife roalti shoots elongated shoots
0 mg-L"1 4.8a 0/30 3.6a 4/30 lOO nig-L"1 4.5a 3/30 3.0b 6/30
250 mg-L"1 4.4a 13/30 2.9b 3/30
500 mg-L"1 4. lab 6/30 2.2bc 0/30
1000 mg-L"1 3.6c 0/30 2.0c 0/30
1500 mg-L"1 2. Id 0/30 Lid Q/30
Explants were grown on MS basal medium with 1,0 mg-L 1 BA and 0.1 mg-L"1 NAA or DKW basal medium wife 0.75 mg-L"5 BA and 0.25 mg- L"1 NAA, and supplemented with either 0, 100, 250, 500, 750, 1000 or 1500 mg-L"3 calcium nitrate tetrahydrate
"Callus were rated on a. S-potut scale: (5) actively growing and callus size over 2 cm; (4) actively growing and callus size over 1.5 cm; (3) callus size over 1.0 cm; (2) callus size less than 1 ,0 cm: and (1) no callus
"Total number of elongated true shoot from regenerated callus / total number of explants
The same letters in the different rows i dicate feat there is no significant difference (p 0.05).
Table 4.
Resistance of regenerated shoot on media with spectinoniycin
£00155] Spectinoniycin present in the media had a significant effect car callus iomiation and shoot regeneration of guayule. Callus formation and shoot emergence was not affected by specfinomycin at 8 mg-L'', but was significantly reduced at 10 mg-L"1 and completely inhibited by 12 mg-L 1 or higher.
Example 3:
[001S6] The iollowing example illustrates transformation of guayule using the following standard bombardment protocol.
|00157] Chloroplast transformation with Guayule chioroplast specific vector:
[00158] The leaves of Parfbenium argent t m (guayule) of AZ-2 lines was transformed using S550d Gold Carrier Particles (SeaShell Technology, CA. USA). A modified protocol for bombarding five leaf samples is described as following. Sonication of S550d particles at 40kHz (Ultrasonic Cleaner Branson, CA, USA). Transfer 50-ul to 1.5 mL microcentrifuge tube. Add 20-μ1 plasmid (0.5- Ι .Ο-με/ul) to S550d particles and vortex the mixture briefly. Add 70-μί Precipitation Buffer (supplied by vendor) and vortex briefly. Incubate 3 min at room temp. Spin tube at 10,000 rpm for 10 sec. Wash pellet with 500ul cold Abs EtOH. Vorte briefly, spi at 10,000 rpm for 10 sec. Discard supernatant and re-suspend the precipitated DNA and S5 0d particles in 50 μΐ absolute Alcohol. After brief sonication, distribute Ι0-μί mixture per microcarrier disc. DNA coated particles were bombarded over leaf disks using Biolistic® PDS-1000 He (Bio-rad), ai 1100 psi rapture disc pressure and 9 cm distance and transgenic shoots were selected on 100 mg L spectinomycin, following the tissue culture method as described by Dong et ai (2006) Plant Cell Rep., 25 (2006), pp. 26— 34.
[00159] No trans fonnants were recovered. See Example 5 hereinbelow. Example 4:
[ΘΘ16Θ] The following example illustrates transformation of guayule using the folio whig standard protoplast method.
[ΘΘΪ6Ϊ] Transformation of guayule using a protoplast method, as described by Pan et al. (2004), Kofer et al. (1 98) and Golds et al. (1993) was attempted. See Pan, ZG.; Liu. CZ,;
Zobayed, SMA.; Saxena. PK. (2004) Plant regeneration from niesophyll protoplasts of Echinacea purpurea. Plant cell, tissue and organ culture. 77: 251-2 5; Kofer, W., Eibl, C, Steinmueller. K., and Koop. H-U. (1998) PEG-niediated plastid transformation hi higher plants. In Vitro Cell. Dev. Biol. Plant. 34:303-309; Golds, T., Maliga, P. and Koop H-U. (1 93) Stable Plastid Transformation hi PEG-treated Protoplasts of Nicotiana tabacimi. Nature Biotechnology 1 1 95 - 97.
[ΘΘ162] Transient expression of GFP into transformed Guayitie chloroplasts was observed under a fluoroscent microscope in micro calii of a transformed protoplast, after 1 week of culture on Semi-solid MS medium, as shown in following picture. Unfortunately, no plants could be recovered from the transformed protoplasts.
Example 5:
[00163] The following example provides a s iinniary Table comparing transformation efficiencies for guayule transformed according to the methods disclosed herein (Example 1 and Example 2, hereinafter "our method") and the standard methods described in Examples 3 and 4.
TABLE 5
The following Example illustrates cMoroplast transformation of guayule (Parihenium argenkttum) using an optimized protocol.
Preparation of Plasmid D A
f 00 i 64] The pUY-Gua-MEV6 (FIG. 1 ) and pUY -Gvta-aadA/NPTII/GF? chloroplasi transformation plasmids were used in this example. Both plasmids feature guayule-specific flanking sequences to target insertion into the guayule c oroplast. The flanking sequences were identified by analysis of the chloroplast genome of guayule (Kumar et ai. 2009 BMC Plant Biology. 9: 131) by PCR. Based on the genome, primers were designed to target the flanking sequences and were PCR amplified, cloned, and inserted into the plasmids. The pUY-Gua-MEV6 plasmid contained the 6-gene cluster comprising the complete yeast mevaionate pathway. pUY-Q .-aadA NPTII/GFP chloroplast plasmid contained aadA, NPT11 and gfp genes. The aadA gene, included in the operon, confers resistance to spectinomycin, the NPTII gene, included in the operon, confers resistance to kanamycin, and plant tissues with the GFP gene exhibit fluorescence from Green Fluorescent Protein when exposed to visible light at 509 mn.
[00165] The guayule chloroplast transformation vector was constructed following that previously described (Kumar and DanielL 2004 Methods Mot Biol 267. 365-383). Flanking sequences for homologous recombination were amplified using the Guayule Chloroplast Genome Sequences (Kumar et al., 2009, supra) with the forward primer GuaFL F:
GGCCGACACTGACACTGAGAGACGA (SEQ ID NO: 8) and the reverse primer GuaFL R: GCCATCCTAAGGTGCTGCTAAATGGA (SEQ ID NO:9). The 3.0 kb PCR product was amplified using PFU-Ultra Fidelity Polymerase (Stratagene) following vendor's instructions. The PCR product was purified and sequenced. The complete DNA sequence of flanking region, which is 100% specific, for chloroplast transformation of Parihenium argentatum (Guayule) line AZ-2, is given as below:
Guayide Flanking Cp-D A sequence (SEQ ID NO: 10)
GGCCGACACTGACACTGAGAGACGAAAGCTAGGGGAGCGAATGGGATTAGATA
CCCCAGTAGTCCTAGCCGTAAACGATGGATACTAGGCGCTGTGCGTATCGACCC
GTGCAGTGCTGTAGCTAACGCGTTAAGTATC:CCGCCTGGGGAGTACGTTCG :AA
GAATGAAACTCAAAGGAATTGACGGGGGCCCGCACAAG GGTGGAG ATGTGG
TTTAATTCGATGCAAAGC'GAAGAACCTTACCAGGGCTTGACATGCCGCGAATCC
TCTTGAAAGAGAGGGGTGCCTTCGGGAACGCGGACACAGGTGGTGCATGGCTG
TCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCCCGCAACGAGCGCAACCCT
CGTGTTTAGTTGCCATCATTGAGTTTGGAACCCTGAACAGACTGCCGGTGATAA
GCCGGAGGAAGGTGAGGATGACGTCAAGTCATCATGCCCCTTATGCCCTGGGCG
ACACACGTGCTACAATGGCCGGGACAAAGGGTCGCGATCCCGCGAGGGTGAG :
TAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATG
AAGCCGGAATCGCTAGTAATCGCCGGTCAGCCATACGGCGGTGAATCCGTTCCC
GGGCCTTGTACACACCGCCCGTCACACTATGGGAGCTGGCCATGCCCGAAGTCG
TTACCTTAACCGCAAGGAGGGGGATGC'CGAAGGC'AGGGCTAGTGACTGGAGTG
AAGTCGTAACAAGGTAGCCGTACTGGAAGGTGCGGC GGATCACCTCCTTTTCA
GGGAGAGCTAATGCTTGTTGGGTATTTTGGTTTAACACTGC'TTCACACCCAAAA
AGAAGGGAGC'TACGTCTGAGTGAAACTTGGAGATGGAAGTCTTCTTTCGTTTCT
CGACAGTGAAGTAAGACCAAGCTCATGAGCTTATTATCTCAGGTCGGAACAAGT
TGATAGGATCCCCCTTTTTACGTCCCCATGC'CGCCTGTGTGGTGACATGGGC'CGA
AAAAAGGAAAGAGAGGGATGGGGTTTCTCTCGCTTTTGGC;ATAGTGGGCCCCCG
GTGGGGGGC. CGCACGACGGGCTATTAGCTCAGTGGTAGAGCGCGCCCCTGATA
ATTGCGTCGTTGTGCCTGGGCTGTGAGGGCTCTCAGCCACATGGATAGTTCAAT
GTGCTCATCGGCGCCTGACCCTGAGATGTGGATCATCCAAGGCACATTAGCATG
GCGTACTCCTCCTGTTCGAACCGGGGTTTGAAACCAAA TCTCCTCAGGAGGA
TAGATGGGGCGATTCAGGTGAGATCCAATGTAGATCCAACTTTCGATTCACTCG
TGGGATCCGGOCGGTCCGGGGGGGACCACCATGGCTCCTCTCTTCTCGAGAATC
CATACATCCCTTATCAGTGTATGGACAGCTATCTCTCGAGCACAGGTTTAGGTTC
GGCCTCAATGGGAAAATAAAATGGAGCACX AACAACGCATCTTCACAGACCA
AGAACTACGAGATCACCCCTTTCATTCTGGGGTGACGGAGGGATCATACCATTC
GAGCC TTT1 TTTCATGCTTTTCCCCGAGGTCTGGAGAAAGC GAAATCAAATG
GGATGTGTCTATTTATCTATC CTTGAC CGAAATGGGAGCAGGTTTGAAAAAG
GATCTTAGAGTGTCTAGGGTTGGGCCAGGAGGGTCTCTTAACGCCTTCTTTTTTC
TTCTCATCGGAGTTCTTTCACAAAGACTTG :CATGGTAAGGAAGAAGGGGGGAA
CAGGCACACTTGGAGAGCGCAGTACAACGGAGAGTTGTATGCTGCGTTCGGGA
AGGATGAATCGCTCCCGAGAAAGGAATCTATTGATTCTCTCCCAATTGGTTGGA
CCGTAGGTGCGATGATTTACTTCACGGGCGAGGTCTCTGGTTCAAGTCCAGGAT
GGCCCAGCTGC'GCCAGGGAAAAGAATAGAAGAAGCATCTGACTACTTCATGCA
TGC'TCCACTTGGCTCGGGGGGATATAGCTCAGTTGGTAGAGCTCCGC'TCTTGCA
ATTGGGTCGTTGCGATTACGGGTTGGATGTCTAATTGTCCAGGCGGTAATGATAG
TATCT GTACCTGAACCGGTGGC CACTTTTTCTAAGTAATGGGGAAGAGGACC
GAAACATGCCACTGAAAGACTCTACTGAGACAAAGATGGGCTGTCAAGAACGT
CAAGAACGTAGAGGAGGTAGGATGGGCAGTTGGTCAGATCTAGTATGGATCGT
ACATGGACGGTAGTTGGAGTCGGC:GGCTCTCCTAGGGTTCCCTTATCGGGGATC
CCTGGGGAAGAGGATCAAGTTGGCCCTTGCGAACAGCTTGATGCACTATCTCCC
TTCAACCCT TGAGCGAAATACGGCAAAAGGAAGGAAAATCCATGGACCGACC
CCATCATCTCCACCCCGTAGGAAGTACGAGATTACCCCAAGGACGCX TCGGCA
TCCAGGGGTCACGGACCGACCATAGAACCCTGTTCAATAAGTGGAACGCATTAG
CTGTCCGCTCTCAGGTTGGGCAGTAAGGGTCGGAGAAGGGCAATCACTCATTCT
TAAAACCAGCGTTCTTAAGGCCAAAGAGTCGGCGGAAAAGGGGGGAAAGCTCT
CCGTTCCTGGTTCTCCTGTAGCTGGATCCTC:CGGAACCACAAGAATCCTTAGTTA
GAATTAGAATGCGAT CCAAC CAGCAC:CTTT GAGTTAGATTTTGAGAAGAGT
TGCTCTTTGGAGAGCACAGTACGATGAAAGTTGTAAG GTGTTCGGGGGGGAG
TTATTGTCTATCGTTGGCCTCTATGGTAGAATCAGTCGGGGGACCTGAGAGGCG
GTGGTTTACCCTGCGGCGGATGTCAGCGGTTCGAGTCCGCTTATCTCCAACTCGT
GAACTTAGC:CGATACAAAGCTATATGATAGCACCCAATTTTTCCGATTCGGCGG
TTCGATCTATGATTTATCATTCATGGACGTTGATAAGATCCATCCATTTAGCAGC
ACCTTAGGATGGC
|00I 6] To construct the Giiayule specific chloroplast transformation vector, the above rml6-tmI-trnA region (Flanking DNA sequence) was inserted into the easily available pUC19 cloning vector, winch has one ampicillin resistance gene. The pUC19 vector was digested with PvuII and Sspl and the bhmt PGR fragment of flanking sequence was directly cloned into pUC 1 vector following standard molecular techniques. The other essential elements like Prrn promoter (Silhavy and Maliga. (1998) Current Genetics 34:67-70) and regulatory sequences were amplified using oligos as described from the tobacco chloroplast genome (see e.g., Kumar, S. & Danieil, H. Methods Mol. Biol. 267, 365-383 (2004)).
{00167] The psbA (light regulated) promoter along with 5' UTR was obtained as synthetic DNA from Bio Basic Inc. (Canada). The empty vector control pUY-Gua- aadA/npill/GFP was made for optimization of Guayule's chioroplasis transformation. The physical map of pUY-Gtia-aadA nptll/GFP is given below and the vector was tested with Ndel-Xbal digestion and GFP fluorescence was observed in the E.coli cells under
fluorescent microscope as shown in FIG. 4.
Plant transformation
[00168] The guayule plants were grown aseptically on hormone free Wood Plant Media (WPM) supplemented with 0.3% (w/v) gelrite, 3.0% (w/v) sucrose and 2.0% (w/v) activated Charcoal (Sigma). All media were adjusted to a pH of 5.7 - 5.8 prior to autoclaving at 121°C and 103.5kPa (15 lb in-2) for 20 rnin. All of the stock cultures in the following experiments were maintained under these conditions.
{00169] pUY-Gua-MEV6 and pUY-Gua-aadA/NPTII/GF plasmid DNAs (12.5 ug each) were transformed in guayule using standard micro-projectile bombardment procedures as described by Biechl and Anderson (1996) Nat. Bioieehnol. 14:875-879. Guayule leaves harvested from in viiro-grown guayule plants were cut into 0.5 cm2 segments. The explants were placed in MS supplemented with 5 mg-L"1 /ra?«'-zeatin-riboside for bombardment and recovery. Leaves were bombarded with the PDSIOOO/He Bioiistic Gun (Bio-Rad) at 1100 psi. In each bombardment, 2.1 mg of 0.6 μηι gold particles and 12.5 2 of plasmid DNA were used.
[00170] The bombarded guayule leaves were incubated in the MS supplemented with 5 mg-L"1 /mm'-zeatin-ri oside for recovery. After 5 days of recovering, the explants were transferred onto Callus and Shoot Induction Medium for selection of resislant shoots [MS medium supplemented with 1.0 nig-L"1 BA, 0.1 nig*L~3 NAA and 250 nig-L"1 calcium nitrate]; 12 mg'L"1 spectinoinycin was used for selecting transformed cells. After 4 weeks, induced caili and small shoot were transferred to Shoot Induction Medium [DKW
supplemented with 0.75 mg'L"1 BA and 0.25 mg'L"1 NAA and 250 mg'L"1 calcium nitrate]; 15 to 20 mg'L"1 spectinoinycin was used for selecting transformed shoots. Every 2 weeks regenerated shoots were subcultured until shoots were elongated. Elongated shoots were transferred to Rooting Medium [WPM supplemented with 10 iii-L spectinoinycin]. The shoots were later transplanted to soil after confirmation by PCR.
Plant genomic D A isolation and PCR analysis
f 00171] To confirm the presence of the transgene in plants that were speciinomycin- resistant. guayule genomic DNA was isolated from 0.5 g transgenic and non-transgenic plant leaf tissues using a GeiieElute™ Plant Genomic DNA Miniprep Kit (Sigma, USA) according to the manufacturer's protocol. 50ng genomic DNA was used for PCR amplification by using the spectinomycm-gfp gene primers (forward 5 '- TGA ATG AAC TGC AGG ACG AG -3' (SEQ ID NO:l 1) primers and reverse 5'- GGG TGT TCT GCT GGT AGT GG -3 '(SEQ ID NO: 12)). The expected size for the gene was 1200 bp.
Amplified fragments were separated on 1% agarose gels using a DNA 1 KB ladder (Fisher Scientific inc., Pittsburgh, PA).
Results
f 00172] Guayule plants transformed by pUY-Gua-MEV6 and pUY-Gua- aadAsNPTII!GYP genes and non-transgenic control plants wer transferred into soil after confirmation by PCR. Plants were moved to the greenhouse; all grew normally and ail transgenic plants appeared morphologically normal. There were no significant differences among 9-week-old transgenic and non-transgenic plants in plant height and shape of plants (FIG. 5).
|00I73j Both pUY-Gua-MEV6 (FIG. 1 and FIG. 2) and pUY-Gua- aadA/NFTII!GFP genes were PCR amplified using specific HMGS primer pairs (forward 5'- TTGGACTTCCCGGACATTAG -3 ' (SEQ ID NG:2) primers and reverse 5'- TTTCTCGGTGACCAACACAC -3' SEQ ID NO: 3} and aadA-GFP gene primers pairs (forward 5'- TGAATGAACTGCAGGACGAG -3 ' (SEQ ID NO:4) primers and reverse 5'- GGGTGTTCTGCTGGTAGTGG -3% SEQ ID NO:5), yielding the expected band sizes of 0.7 kb and 1.2 kb, respectively.
[00174] The efficiency of chioropiasi transformation using this method was calculated using two criteria. First was based on plants confirmed positive by PCR after surviving selection media [DKW with 15 to 20 mg-L"1 speciionrnycin] . In that case, the 6.9% of guayule plants (8 total) transformed by the pUY-Gua-MEV6 and 13.0% of guayule plants (9 total) transformed by the pUY-Gna- dA/NPTII/GFV gene were confirmed transplastomie. The second basis used was that of the number of PCR-coniimied transplasiomic plants out of all attempted bombardment experiments. In that case, 699 guayule explanis were used for pUY-Gua-MEV6 transformation resulting in a 1.14% transformation efficiency and 523 explants were used for pIJY-Gxia-aa(M/ATPTII/GFP, resulting in a 1.72% transformation efficiency (Table 6).
Table 6. Efficiency of chioropiasi transformation of guayule
Hasmid umbs r of bombard e d NiH!iber of Nuiabei of % of PCR % of fiaaf
Ex lains Resistance on PCR positive positive3 efficiency*1 selection media
pUY-MEV6 699 116 8 6.9 1.14 pUY-Gua- 523 69 9 13.0 1.72 aadA-nptll'OFP
5 % of PCR positive = (Number of PCR positive Nijniber of spectiaoiriycin resistance on selection media x 100 * % of fiaat efficiency = (Ntan er of PCR positive otei mmtber of Expiairts) x 100
Example 7:
[00175] The following Example summarizes compositions and methods disciosed herein.
Example 7:
The following Exampie illustrates that growing on medium supplemented with activated charcoal results in plants having increased chlorophyll content.
Chlorophyll content analysis by Minolta chlorophyll meter SPAD-502
[00176] Plants grown in the medium supplemented with activated charcoal (AC) were significantly healthier and greener in color than those grown in media without AC.
Therefore, leaves were analyzed for chlorophyll content. FOOT leaves from each of the hi vitro treatments were sampled. We also analyzed the chlorophyll content of plants grown on potting mix without AC in a greenhouse. Soil plant analysis development (SPAD)
Chlorophyll meter were taken at the center of the leaves throughout the experiments.
Results
|00177] Guayule grown on basal wood plant medium (WPM) with AC appeared to have greener leaves. Guayule leaves from shoots grown on the medium containing AC had
44.4 - 46.4 μιηοΐ photons m ~ SPAD value, much higher than those grown on the without
AC (26.3 μηιοΐ photons m The greenhouse plants grown under the sun light had 52.5 -
54.5 μηιοΐ photons in-2. pUY-MEV6 transgenic plant showed 30.5 umol photons n SPAD value.
Chlorophyll content analysis by Minolta chlorophyll meter SPAD-502
Gro tl} c amber Greenhouse £1 Gre n ouse Wl Growth chamber Grow i chamber Growth chamber WPM \v >\ii Plant grown on Plant grown on #1 Wl pliY-M£ 6
AC Pittin mix Potting met WPM with AC WPM wriii AC transgenic plant
~ ¾¾h AC*
SPAD value' 263 543 52~6 ~ ~\ 305
Plants were grown oa plant growth regulator free WPM basal medium, solidified with gtirke, and supplemented with 2 g-L~ activated charcoal (AC). The reenhouse lants were grown cm potting mix soil with AC.
"AC : 2g/L activated charcoal
¾S D value For each treatment, the average of 3 measurements was given as SPAD alue
[00178] It is understood that the examples and embodiments described herein are for illustrative piuposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit arid purview of this application and scope of the appended claims.
Claims
1. A method for transforming guayuie chloroplasts to provide a hansplastoniic guayuie plant, the method comprising:
(i) growing guayuie plants on hormone free media supplemented with activated charcoal to provide cultured guayuie plants;
(ii) collecting leaves f om the cultured guayuie plants to provide leaves from the cultured guayuie plants;
(iii) placing the leaves from the cultured guayuie plants in medium comprising trans-zeoiin-riboside for bombarding and recovery;
(iv) bombarding the leaves from the cultured guayuie plants with gold particles, wherein the gold particles are coated with chloroplast transformation vector DNA, and wherein the chloroplast transformation vector DNA
comprises guayuie specific flanking sequences that target insertion of the chloroplast transformation DNA to chloroplast DNA, thereby providing bombarded guayuie leaves;
(v) incubating the bombarded guayuie leaves in the medium comprising trans- zeotm-riboside, to provide recovered bombarded guayuie leaves;
(vi) transferring the recovered bombarded guayuie leaves to Callus and Shoot Induction medium comprising a selection agent and calcium nitrate;
(vii) growing the recovered bombarded guayuie leaves in Callus and Shoot Induction medium to provide calli and small shoots;
(viii) transferring the calli and small shoots to Shoot Induction Medium wherein the Shoot Induction Medium comprises calcium nitrate ;
(ix) growing the calli and small shoots in the Shoot Induction Medium until shoots are elongated, to provide elongated shoots;
(x) transferring the elongated shoots to Rooting Medium comprising a selection agent;
(xi) growing the elongated shoots on the Rooting Medium until roots are formed, to provide rooted shoots;
(xii) transplantin the rooted shoot to soil, and
(xiii) growing the rooted shoots in the soil;
thereby providing a traiisplastomic g ayuie plant.
2. The method of claim 1 , wherein the chloropiast transiomiation vector DNA further comprises the 6- ene cluster comprising the complete cytosoiie mevaionate pathway.
3. A traiisplastomic guayuie plant made according to the method of claim 1.
4. The traiisplastomic guayuie plant of claim 3, whereiii the iransplastomic guayuie plant comprises recombinant chioropiasts transformed with the 6-gene cluster comprising the complete cytosoiie mevaionate pathway.
5. The traiisplastomic guayuie plant of claim 4, wherein the transplastoniie guayuie plant is capable of producing increased amounts of isopentyipyrophosphate and increased amounts of natural latex.
6. A iransplastomic seed of the transplastoniie guayuie plant of claim 3.
7. A traiisplastomic guayuie plant, or a part thereof, produced by growing the seed of claim 6.
8. A tissue culture of legenerable transplastoniie cells produced from the transplastoniie guayuie plant of claim 3.
9. A iransplastomic protoplast produced from the tissue culture of claim 8.
10. A transplastoniie guayuie plant, regenerated from the tissue culture of claim 8.
11. A hybrid traiisplastomic guayuie plant, wherein the lineage of at least one parent plant comprises the transplastoniie guayuie plant of claim 3.
12. A transplastomic guayule plant or part thereof.
13. The transplastoimc guayule plant of claim 12, wherei the transplastomic guayule plant comprises recombinant chloroplasts transformed with the 6-geiie cluster comprising the complete eytosolic mevaloiiate pathway.
14. The traiisplastomic guayule plant of claim 13, wherein the transplastoimc guayule plant is capable of producing increased amounts of isopentylpyrophosphate and increased amounts of natural latex.
1 . A transplastomic seed of the traiisplastomic guayule plant of claim 12.
16. A transplastomic guayule plant, or a part thereof, produced by growing the seed of claim 15.
17. A tissue culture of regenerable transplastomic cells produced from the
transplastomic guayule plant of claim 12.
IS. A transplastomic protoplast produced from the tissue culture of claim 17.
19. A traiisplastomic guayule plant, regenerated from the tissue culture of claim 17.
20. A hybrid transplastomic guayule plant, wherein the lineage of at least one parent plant comprises the transplastomic guayule plant of claim 12.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361789228P | 2013-03-15 | 2013-03-15 | |
| US61/789,228 | 2013-03-15 | ||
| US14/209,255 | 2014-03-13 | ||
| US14/209,255 US9523097B2 (en) | 2013-03-15 | 2014-03-13 | Engineering rubber production in plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014152747A1 true WO2014152747A1 (en) | 2014-09-25 |
Family
ID=51581304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/027689 Ceased WO2014152747A1 (en) | 2013-03-15 | 2014-03-14 | Engineering rubber production in plants |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US9523097B2 (en) |
| WO (1) | WO2014152747A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108289430A (en) * | 2015-10-16 | 2018-07-17 | 株式会社普利司通 | The molecular labeling and primer of guayule rubber and the molecular labeling and primer of guayule rubber and the rate of apomixia are for guayule rubber identification, the purposes of characterization and breeding |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016161359A1 (en) * | 2015-04-03 | 2016-10-06 | The Regents Of The University Of California | Induction of latex accumulation in rubber-producing shrubs |
| US20180110195A1 (en) | 2015-05-01 | 2018-04-26 | Yulex Corporation | Methods for promoting production of viable seeds from apomictic guayule plants |
| US20180327770A1 (en) * | 2017-05-11 | 2018-11-15 | The United States Of America, As Represented By The Secretary Of Agriculture | Guayule with increased rubber production and yield |
| US10961541B2 (en) | 2017-09-19 | 2021-03-30 | The United States Of America As Represented By The Secretary Of Agriculture | Genetically altered guayule having increased rubber production and methods thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030119098A1 (en) * | 2001-07-25 | 2003-06-26 | Hallahan David L. | Genes involved in the biosynthesis of isopentenyl diphosphate in Hevea brasiliensis latex |
| US7129392B2 (en) * | 2000-07-31 | 2006-10-31 | Hahn Frederick M | Materials and methods for increasing isoprenoid production in cells |
| US20060248608A1 (en) * | 2002-08-08 | 2006-11-02 | Lelivelt Cecilia L C | Method of plastid transformation in asteraceae, vector for use therein and plants thus obtained |
| WO2013036100A1 (en) * | 2011-09-05 | 2013-03-14 | Universiti Sains Malaysia | A method for regulating plastidial isoprenoid biosynthesis in hevea brasiliensis |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6541682B1 (en) * | 1998-11-12 | 2003-04-01 | Calgene Llc | Plastid transformation of solanaceous plants |
| US6936467B2 (en) * | 2000-03-27 | 2005-08-30 | University Of Delaware | Targeted chromosomal genomic alterations with modified single stranded oligonucleotides |
| US8013213B2 (en) * | 2004-11-24 | 2011-09-06 | The United States Of America As Represented By The Secretary Of Agriculture | Guayule plants, products, and derivatives |
-
2014
- 2014-03-13 US US14/209,255 patent/US9523097B2/en not_active Expired - Fee Related
- 2014-03-14 WO PCT/US2014/027689 patent/WO2014152747A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7129392B2 (en) * | 2000-07-31 | 2006-10-31 | Hahn Frederick M | Materials and methods for increasing isoprenoid production in cells |
| US20030119098A1 (en) * | 2001-07-25 | 2003-06-26 | Hallahan David L. | Genes involved in the biosynthesis of isopentenyl diphosphate in Hevea brasiliensis latex |
| US20060248608A1 (en) * | 2002-08-08 | 2006-11-02 | Lelivelt Cecilia L C | Method of plastid transformation in asteraceae, vector for use therein and plants thus obtained |
| WO2013036100A1 (en) * | 2011-09-05 | 2013-03-14 | Universiti Sains Malaysia | A method for regulating plastidial isoprenoid biosynthesis in hevea brasiliensis |
Non-Patent Citations (1)
| Title |
|---|
| VERMA, D. ET AL.: "Chloroplast vector systems for biotechnology applications.", PLANT PHYSIOLOGY, vol. 145, no. 4, December 2007 (2007-12-01), pages 1129 - 1143 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108289430A (en) * | 2015-10-16 | 2018-07-17 | 株式会社普利司通 | The molecular labeling and primer of guayule rubber and the molecular labeling and primer of guayule rubber and the rate of apomixia are for guayule rubber identification, the purposes of characterization and breeding |
| CN108289430B (en) * | 2015-10-16 | 2022-09-09 | 株式会社普利司通 | Molecular markers and primers of guayule and their use and rates of apomixis for identification, characterization and breeding of guayule |
Also Published As
| Publication number | Publication date |
|---|---|
| US9523097B2 (en) | 2016-12-20 |
| US20140325699A1 (en) | 2014-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2679510C2 (en) | Fluorescence activated cell sorting (facs) enrichment to generate plants | |
| EP2018435B1 (en) | Artificial plant minichromosomes | |
| US20240182917A1 (en) | Compositions and methods for improving plastid transformation efficiency in higher plants | |
| WO2022055751A1 (en) | Plastid transformation by complementation of nuclear mutations | |
| US9523097B2 (en) | Engineering rubber production in plants | |
| CN103114076A (en) | Rice leaf color control gene heme oxygenase2 (HO2) and application thereof | |
| US20150141714A1 (en) | Engineering plants with rate limiting farnesene metabolic genes | |
| CN111295093B (en) | Plant promoters for transgenic expression | |
| CA2856485A1 (en) | Plant transformant, transformation method for plant, and vector used in said method | |
| EP3052633B1 (en) | Zea mays metallothionein-like regulatory elements and uses thereof | |
| CN111386035B (en) | Plant Promoters for Transgene Expression | |
| CN104650204B (en) | The albumen related to rice ATP transports and Development of Chloroplasts and its encoding gene and application | |
| CN103173425B (en) | Sickle alfalfa elongation factor 2MfEF2 as well as coding gene and application thereof | |
| KR101040579B1 (en) | Stress-induced self-cutting plant transformation vector and method for producing a selection marker-free plant using the same | |
| US20160278382A1 (en) | Usage of Oligonucleotides in Plant Biology | |
| AU2024346662A1 (en) | Methods of producing homoplasmic modified plants or parts thereof | |
| KR101613367B1 (en) | A promoter for ubiquitous gene expression in monocotyledones and use thereof | |
| KR101497832B1 (en) | Leaf-, stem- or both- specific promoter, expression vector comprising the same, transformed Oryza sativa thereby and method for preparation thereof | |
| CN118086332A (en) | Wheat seed dormancy gene TaPer-3A and application thereof | |
| Yang et al. | Production of transgenic sweet potato (Ipomoea batatas (L.) Lam.) lines via microprojectile bombardment. | |
| Wasley | Tools and Methodologies for Manipulation of the Nuclear and Plastid Genome of Lolium perenne L. | |
| GOULD et al. | Using Agrobacterium tumefaciens and the Shoot Apex | |
| KR20140049127A (en) | Leaf-, stem- or both- specific promoter, expression vector comprising the same, transformed plants thereby and method for preparation thereof | |
| KR20140046554A (en) | Leaf-, stem- or both- specific promoter, expression vector comprising the same, transformed plants thereby and method for preparation thereof | |
| KR20140049128A (en) | Leaf-, stem- or both- specific promoter, expression vector comprising the same, transformed plants thereby and method for preparation thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14767810 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14767810 Country of ref document: EP Kind code of ref document: A1 |


