WO2014142644A1

WO2014142644A1 - Antiviral activity of baicalein against japanese encephalitis virus

Info

Publication number: WO2014142644A1
Application number: PCT/MY2014/000031
Authority: WO
Inventors: Sazaly ABU BAKAR; Keivan ZANDI; Mohd Iskandar JEFREE JOHARI
Original assignee: University Of Malaya
Priority date: 2013-03-15
Filing date: 2014-03-13
Publication date: 2014-09-18
Also published as: MY188046A

Abstract

The present invention provides an antiviral medicament for treating Japanese Encephalitis Virus (JEV) infection comprises a natural flavonoid compound namely baicalein. In the present invention, antiviral activity of baicalein was evaluated against JEV replication in African green monkey kidney cell line (Vero). Anti-JEV activities of baicalein were examined at different stages of JEV replication cycle. The effects of baicalein on virus replication were determined from Foci Forming Unit Reduction Assay (FFURA) and quantitative RT-PCR.

Description

ANTIVIRAL ACTIVITY OF BAICALEIN AGAINST JAPANESE ENCEPHALITIS VIRUS

FIELD OF THE INVENTION

The present invention relates to an antiviral activity of a natural flavonoid compound against Japanese Encephalitis Virus. More particularly, the present invention relates to a use of a natural flavonoid compound namely baicalein in the manufacture of a medicament for use in the treatment of Japanese Encephalitis. BACKGROUND OF THE INVENTION

Japanese encephalitis virus (JEV) is an arthropod-borne virus belongs to the Flaviviridae family. It is one of the most important causative agents of viral encephalitis in human which can cause febrile to mortal illnesses notably in children with 30,000-50,000 cases around the world annually. JEV infection is endemic in eastern and southern Asia including Nepal, Indonesia, China, Thailand, Australia, Sapian Island, Pakistan and Torres Strait (Hsiao et al, 2010; Paul et al, 1993; Wakai, 1998). The fatality rate of JEV infection is estimated at 30% with life-long neurological impairments and sequel among half of survivors (Solomon et al, 2000). JEV is an enveloped virus with a positive sense single stranded RNA of 11 kb in length. Its genome formed a single long open reading frame (ORF) flanked by the 5'- UTR and 3'-UTR. The ORF is translated into a polyprotein which is processed by viral and cellular proteases to yield three structural proteins called capsid (C), premembrane (prM), and envelope (E) and seven non-structural (NS) proteins namely NS1. NS2 A/B, NS3, NS4 A/B and NS5 (Nazmi et al, 2010).

There are still concerns on the efficacy, long term safety and cost for all current available vaccines resulting in high percentage of unvaccinated population in endemic regions and this translates to many cases of Japanese encephalitis (JE) in these regions (Gubler DJ., 2011). Besides, currently there is still no effective therapeutic is available for JE. Thus, there is still a need to find effective antiviral therapy against JEV infection (Gould et al, 2008). There have been efforts to find effective antivirals among the natural products such as plants or algal derived compounds (Zhang et al, 2012; Lee et al, 2006; Chiu et al, 201 1). Besides, US patent no. WO2009/068872A1 disclosed a method in the treatment of infections or disease caused by one or more genus of the flaviridae family of viruses by use of an extract of Astragalus in manufacture of a medicament for Dengue Virus, West Nile Virus, JE and also Yellow fever as well as other related viruses.

The above mentioned journal and patent indicate that compounds from natural resources are regarded as possible alternatives as they may pose low side effects and easily accessible from nature. Among the natural flavonoids compounds from plants' fruits, roots, nuts, seeds, bark, steams and flowers of plants with numerous possible biological benefits including antiviral activity have been investigated (Tapas et al., 2008).

As there is still lack of effective therapeutic compound available for JEV infection, therefore, finding the effective compound against JEV infection is crucial at this moment. In finding of the effective antiviral compound for JEV, flavonoids are considered to be an important class of natural compounds to serve as the lead compounds.

SUMMARY

An object of the present invention is to provide an antiviral medicament for treating Japanese Encephalitis Virus (JEV) infection comprises a natural flavonoid compound namely baicalein.

This and other objects, features and advantages of the present invention will be readily apparent from the following description. BRIEF DESCRIPTION OF THE DRAWING/FIGURES

The accompanying drawings which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention.

Figure 1 : Showed the chemical structure of baicalein.

Figure 2: Showed the cytotoxicity of baicalein on Vero cells. MTT assay was used to evaluate the cytotoxicity of the flavonoid. All experiments were conducted in triplicates. Figure 3: Showed the evaluation of the prophylactic effects of baicalein on JEV in vitro replication. Foci forming unit reduction assay was used to evaluate the prophylactic effects (A) and the respective JEV RNA copies were quantified using qRT-PCR (B). All experiments were performed in triplicates. Data were plotted using Graph Pad Prism Version 5.

Figure 4: Displayed the effects of baicalein against JEV adsorption to the Vero cells. Foci forming unit reduction assay was used to evaluate the antiviral activities (A) and the respective JEV RNA copies were quantified using qRT-PCR (B). All experiments were performed in triplicates. Data were plotted using Graph Pad Prism Version 5.

Figure 5: Displayed the antiviral activity of baicalein against JEV intracellular replication. Foci forming unit reduction assay was used to evaluate the antiviral activities (A) and the respective JEV RNA copies were quantified using qRT-PCR (B). All experiments were performed in triplicates. Data were plotted using Graph Pad Prism Version 5.

Figure 6: Showed the direct virucidal activity of baicalein against JEV. Foci forming unit reduction assay was used to determine the direct virucidal activities of the compounds against extracellular JEV (A) and the respective JEV RNA copies were quantified using qRT-PCR (B). All experiments were performed in triplicates. Data were plotted using Graph Pad Prism Version 5. DETAILED DESCRIPTION OF THE PRESENT INVENTION

In the following detailed description, reference is made to various specific embodiments in which the invention may be practiced. These embodiments are described with sufficient detail to enable those skilled in the art to practice the invention and it is to be understood that other embodiments may be employed and that structural and logical changes may be made without departing from the spirit or scope of the present invention.

Japanese encephalitis (JE) is an important public health problem in many parts of the world especially in east and southeast of Asia due to its limited therapeutic options. It is therefore crucial to identify compounds that could be used as antivirals against Japanese Encephalitis Virus (JEV) replication. Among the different molecules, natural compounds from plants such as bioflavonoids are of interest to many scientists (Cushnie et al, 2005; Guo et al, 2007; Zandi et al, 2011).

In one embodiment of the present invention, the present invention disclosed an antiviral activity of baicalein against JEV. Baicalein is a flavone, a type of flavonoid, can be found naturally from various plant with an IUPAC name of 5,6,7-Trihydroxy- 2-phenyl-chromen-4-one and other common name is 5,6,7-Trihydroxyflavone. The chemical structure of baicalein is shown in figure 1.

In the present invention, antiviral activity of baicalein was evaluated against JEV replication in Vero cell line derived from the kidney of African green monkey. Anti- JEV activities of baicalein were examined at different stages of JEV replication cycle as below :- i) prophylactic activity,

ii) intracellular antiviral activity after virus adsorption,

iii) against virus adsorption to the cells, and

iv) adding directly to virus suspension to examine the direct virucidal effect.

The effects of baicalein on virus replication were determined from Foci Forming Unit Reduction Assay (FFURA) and quantitative RT-PCR. After the antiviral activity evaluation, the inventors encounter that baicalein showed potent antiviral activity with ICso= 5.8 μ§/ηι1 when it was used after adsorption of JEV to Vero cells and exhibited significant anti-adsorption effects against JEV with IC50 = 7.27 μg/ml. Besides, baicalein also exhibited direct extracellular virucidal activity on JEV with ICso = 2.97 μg/ml. Moreover, results of quantitative RT-PCR experiments confirmed the findings from FFURA.

These results indicated that baicalein exhibited potent in vitro anti-JEV effects at all different stages of JEV infection. Baicalein exhibited significant direct virucidal activity (SI= 38.7) as well as intracellular anti-JEV activity (SI= 15.8) and anti- adsorption activity (SI= 15.8) but its prophylactic activity was not significant (SI = 1.3). The mechanism(s) conferring the antiviral properties of baicalein against JEV is unknown. One of the possible mechanisms for the baicalein prophylactic activity against JEV replication can be due to its accumulation in to the cells during the treatment and/or because of its probable biding to the JEV cell receptors. One of the possible mechanisms of action for intracellular anti-JEV activity is biding of baicalein. This possibility was shown in a recent study for two other flavonoids, kaempferol and daidzin using the JEV frame shift RNA (Zhang et al., 2012). Results from qRT-PCR showing significant reduction of JEV RNA copy number is consistent with inhibition of RNA synthesis.

The other possible mechanism of action for baicalein includes interaction with JEV structural and/or non structural protein(s). It has previously been shown that baicalein affects Sendai virus replication through inhibition of virus hemagglutinin- neuraminidase activity (Dou et al., 2010). Other studies have also shown that baicalein binds to HIV-1 integrase and reverse transcriptase enzymes (Ahn et al., 2001 ; Kitamura et al., 1998). These suggest that baicalein can bind to a number of viral enzymes important for their replication. To further illustrate the present invention in greater detail without any limitation, the following examples are given.

EXAMPLE 1

Compound, Cell and Virus Preparation

In order to evaluate the potential antiviral activity against JEV of baicalein, Dimethyl sulfoxide (DMSO) was used as a proper solvent to prepare the baicalein stock solution (20 mg/ml) and prepared stock solutions were stored at -20° C. Stock solution was diluted using cell culture medium and sterilized using syringe filter with 0.2 micron pore size.

Vero cell line derived from the kidney of African green monkey was used in this invention. The cell line was maintained and propagated in Eagle's Minimum Essential Medium (EMEM) containing 10% fetal bovine serum. Cultured Vero cell was incubated at 37°C in 5% C0₂ humidified chamber. At the time of virus propagation, serum concentration was reduced to 2%. JEV (Accession Number: HE861351) was propagated and harvested after CPE presentation on day four postinfection. Viral stock was titred using foci forming assay (FFA) and stored at -70° C. EXAMPLE 2

In Vitro Cytotoxicity Assay

Cytotoxicity assays of baicalein against Vero cells were performed using the MTT assay method. Briefly, a confluent monolayer of Vero cells was prepared in 96-well microplates and treated by different concentrations of each compound in triplicates. The treated cells were incubated for two days at 37° C that is consistent with the incubation period for anti-JEV activity assay. After two days treatment MTT assay was performed strictly according to the manufacturer's recommendation. Dose- response curves were plotted using Graph Pad Prism 5 (Graph Pad Software Inc., San Diego, CA) and the cytotoxic concentration was determined from the plot.

MTT assay was used to determine the cytotoxicity of baicalein on Vero cells and the CC₅o value was calculated (Figure 2). Vero cells were treated by baicalein for 2 days which was the same duration used for antiviral activity assay. Results showed that the CC₅₀ value of baicalein is CCso= 1 15.2 ± 0.2 g/ml. Cells treated with vehicle control, 1% DMSO did not show any cytotoxicity against Vero cells. EXAMPLE 3

In order to evaluate the antiviral activity of baicalein against JEV, the following antiviral assays were performed using the Vero cell line derived from the kidney of African green monkey prepared in Example 1. Foci Forming Reduction Assay (FFURA)

Antiviral activities of baicalein were evaluated by measuring the reduction in the number of viral foci which was formed following treatments. Briefly, confluent monolayers of Vero cells were prepared in 24 wells cell culture microplate. Infected cell monolyaers were treated using different procedures that will be described later and overlaid with 1.5% CMC containing EMEM with 2% FBS and incubated at 37°C in 5% C0₂ humidified chamber for 2 days. Viral foci formed were stained using JEV monoclonal antibody (Pierce, Illinois USA) and goat anti-rabbit IgG conjugated with horse-radish peroxidase (HRP). Foci were counted under a stereomicroscope and expressed as Foci-Forming-Unit (FFU). Reduction in number of viral foci (RF%) compared against the mock treated controls was calculated as follows:

RF (%) = (C-T) x 100/C

Where, C is the mean of the number of foci for the mock treated control well infected with JEV and T is the mean of the number of foci formed in the JEV infected cell cultures.

Assays of Antiviral Activity

The prophylactic effects of the compounds on JEV replication was evaluated by adding the different concentrations of baicalein to the Vero monolayer cells in triplicates, 5 h prior to JEV infection. Cells were then washed using sterile PBS to remove baicalein and infected with JEV to give an estimated infection of 200 FFU (0.01 MOI) per well and kept at 37 °C for 1 h. The cells were then washed with PBS to eliminate unabsorbed viruses, overlaid by 1.5 CMC containing EMEM with 2% and incubated for another two days.

The antiviral activity of the compounds against intracellular JEV replication was evaluated by inoculating of 200 FFU of virus (0.01 MOI) to each well in triplicates. After 1 h incubation at 37 °C for virus adsorption, the cells were washed with PBS and different concentrations of each compound that prepared in 1.5% CMC containing EMEM with 2% FBS were added to the cells, followed by two days of incubation at 37 °C.

To determine the effect of baicalein against adsorption of JEV to the host cells, Vero cells at 80% confluence were infected with 200 FFU of JEV in the presence or absence of different concentrations of each compound. After washing, the infected cells were overlaid by 1.5% CMC containing EMEM with 2% FBS and incubated at 37 °C for two days.

Direct Virucidal Activity Assay

Extracellular effects of the baicalein against JEV particles were investigated by incubating the JEV suspension containing 10⁵ FFU (5 MOI) with an equal volume of the different concentrations of each compound for 2 h at 37 °C. Then, Vero cells were infected with the 1000 fold diluted treated viral suspension in triplicates. After 1 h adsorption at 37 °C, cells were washed twice with PBS in order to remove unattached viruses. Cells were overlaid by 1.5% CMC containing EMEM with 2% FBS and incubated at 37 °C for two days.

Quantitative RT-PCR (qRT-PCR)

Quantitative RT-PCR was performed to evaluate the effects of baicalein on JEV replication by quantifying the JEV RNA copy number. Briefly, intracellular and extracellular JEV RNAs were harvested from the JEV-infected Vero cells. Viral RNA was extracted using RNA extraction kits (Qiagen, Hilden, Germany). Quantitative RT-PCR assay was performed using the SensiMix SYBR green reagent (Quantace, Watford, United Kingdom) in a reaction mix consisting of 7.4 μΐ of ddH20, 10 μΐ of 2X SensiMix One-Step, 0.4 μΐ of 50X SYBR Green solution, 10 units of RNAse Inhibitor, 50 pmol of forward 5 'AGAGCGGGGAAAAAGGTCAT3 ' and reverse

5'CTTCACGCTCTTCCTACAGT3' JEV amplification primers. All samples were assayed in triplicates. The amplifications were done on the StepOnePlus™ Real- Time PCR System (Applied Biosystems, USA) with the following thermal conditions: reverse transcription at 50°C for 30 min, initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 5 sec and 60°C for 10 sec. Melting curve analysis was subsequently performed at temperature from 60°C to 98°C to verify the assay specificity. For absolute quantitation of the viral RNA, a standard curve was established with a serially diluted in vitro transcribed RNA of JEV with known copy number.

Statistical Analysis

Graph Pad Prism for Windows, version 5 (Graph Pad Software Inc., San Diego, CA, 2005) was used to calculate the cytotoxic concentration 50 (CC50) and inhibitory concentration 50 (IC50) values of the tested compounds. Selectivity Index value (SI) was determined as the ratio of CC50 to ICs₀ for each compound. Result of Antiviral Activity of Baicalein Against JEV

Results of prophylactic treatment with the tested baicalein showed that 100 μg/ml of baicalein could decrease the copy number of JEV RNA 55.9% ± 0.4 when compared to the non treated cells (Figure 3B) and IC₅₀ value for baicalein based on the data from FFURA was 84.18 μg/ml (Figure 3 A).

Indeed, baicalein showed anti-adsorption activity against JEV with ½₀ = 7.27 μg/ml (Figure 4A). Also, JEV RNA copy number decreased 84.9% ± 2 in the presence of 50 μg/ml of baicalein during the viral adsorption period (Figure 4B). In post adsorption assay, baicalein exhibited potent antiviral activity against JEV with IC50 = 5.8 μg/ml (Figure 5A). The copy number of viral R A was decreased 93.36% ± 2.15 when the infected cells were treated by 50 μg/ml (Figure 5B). Baicalein showed direct virucidal activity with IC₅₀ = 2.97 μg/ml (Figure 6A) against JEV particles with similarly, qRT-PCR analyses showed that 50 μg/ml of baicalein decreased the DENV-2 RNA production 89.73% ± 1.55 (Figure 6B).

List of References

Ahn, H.C., Lee, S.Y., Kim, J.W., Son, W.S., Shin, C.G., Lee, B.J., 2001. Binding aspects of baicalein to HIV-1 integrase. Mol. Cells. 31, 127-30.

Hsiao, N.W., Chen, J.W., Yang, T.C., Orloff, G.M., Wu, Y.Y., Lai, C.H., Lan, Y.C., Lin, C.W., 2010. ISG15 over-expression inhibits replication of the Japanese encephalitis virus in human medulloblastoma cells. Antiviral. Res. 85, 504-511.

Chiu, Y.H, Chan, Y.L, Li, T.L., Wu, C.J., 2011. Inhibition of Japanese Encephalitis Virus Infection by the Sulfated Polysaccharide Extracts from Ulva lactuca. Mar. Biotechnol, Dec 23.

Cushnie, T.P., Lamb, A.J., 2005. Antimicrobial activity of flavonoids. Int. J. Antimicrob. Agents. 26, 343-356.

Dou, J., Chen, L., Xu, G., Zhang, L., Zhou, H., Wang, H., Zhenzhen, S., Ke, M., Guo, Q., Zhou, C, 2011. Effects of baicalein on Sendai virus in vivo are linked to serum baicalin and its inhibition of hemagglutinin-neuraminidase. Arch. Virol. Epub. Ahead of print.

Gould, E.A., Solomon, T., Mackenzie, J.S., 2008. Does antiviral therapy have a role in the control of Japanese encephalitis. Antiviral. Res. 78, 140-149. Gubler, D.J., 2011. Emerging vector-borne flavivirus diseases: are vaccines the solution. Expert. Rev. Vaccine. 10, 563-565.

Guo, Q., Zhao, L., Qidong, Y., Yang, Y., Gu, H., Song, G., Lu, N., Xin, J., 2007. Anti-hepatitis B virus activity of wogonin in vitro and in vivo. Antiviral. Res. 74,16- 24.

Kitamura, K., Honda, M, Yoshizaki, H., Yamamoto, S., Nakane, H., Fukushima, M., Ono, K., Tokunaga, T., 1998. Baicalin, an inhibitor of HIV-1 production in vitro. Antiviral. Res. 37, 131-140.

Lee, E., Pavy, M, Young, N., Freeman, C, Lobigs, M., 2006. Antiviral effect of the heparan sulfate mimetic, PI-88, against dengue and encephalitic flaviviruses. Antiviral. Res. 69, 31-38.

Nazmi, A., Dutta, K., Basu, A., 2010. Antiviral and neuroprotective role of octaguanidinium dendrimer-conjugated morpholino oligomers in Japanese encephalitis. Plos. Negl. Trop. Dis. 4, e892. Paul, W.S., Moore, P.S., Karabatsos, N., Flood, S.P., Yamada, S., Jackson, T., Tsai, T.F., 1993. Outbreak of Japanese encephalitis on the island of Saipan, 1990. J. Infect. Dis. 167, 1053-1058.

Solomon, T., Dung, N.M., Kneen, R., Gainsborough, M, Vaughn, D.W., Khanh, V.T., 2000. Japanese encephalitis. J. Neurol. Neurosurg. Psychiatry 68, 405^115.

Tapas, A.R., Sakarkar, D.M., Kakde, R.B., 2008. Flavonoids as nutraceuticals: a review. Tropic. J. of Pharm. Res. 7, 1089-1099. Wakai, S., 1998. Scourge of Japanese encephalitis in southwestern Nepal. Lancet 351,759. Zandi, K., Teoh, B.T., Sam, S.S., Wong, P.F., Mustafa, M.R., Abubakar, S., 2011. Antiviral activity of four types of bioflavonoid against dengue virus type-2. Virol. J. 8, 560. Zandi, K., Teoh, B.T., Sam, S.S., Wong, P.F., Mustafa, M.R., Abubakar, S., 2011. In vitro antiviral activity of Fisetin, Rutin and Naringenin against Dengue virus type-2. Med. Plants. Res. 5, 5534-5539.

Zhang, T., Wu, Z., Du, J., Hu, Y., Liu, L., Yang, F., Jin, Q., 2012. Anti-Japanese- encephalitis-viral effects of kaempferol and daidzin and their RNA-binding characteristics. PLoS. One. 7, e30259.

Claims

WE CLAIM:

1. A method for manufacture of a medicament for use in treating Japanese Encephalitis Virus infection, comprising the steps of introducing a natural flavonoid compound namely baicalein which possesses antiviral activity in a therapeutically effective amount into the medicament.

The method according to claim 1, wherein the IUPAC name of baicalein is 5,6,7-Trihydroxy-2-phenyl-chromen-4-one and other common name of baicalein is 5,6,7-Trihydroxyflavone.

Use of a natural flavonoid compound namely baicalein in the manufacture of a medicament for the treatment of Japanese Encephalitis Virus infection.

The use according to claim 3, wherein the IUPAC name of the baicalein is 5,6,7-Trihydroxy-2-phenyl-chromen-4-one and other common name of baicalein is 5,6,7-Trihydroxyflavone.

The use according to claim 3, wherein the medicament further comprises coadministering at least one pharmaceutically, acceptable additive.

The use according to claim 3, wherein said additive is a pharmaceutically acceptable carrier, excipient, diluent, solvent or any others antiviral agent.