WO2014132032A1 - Culture de cellules initiatrices de leucémie - Google Patents

Culture de cellules initiatrices de leucémie Download PDF

Info

Publication number
WO2014132032A1
WO2014132032A1 PCT/GB2014/050424 GB2014050424W WO2014132032A1 WO 2014132032 A1 WO2014132032 A1 WO 2014132032A1 GB 2014050424 W GB2014050424 W GB 2014050424W WO 2014132032 A1 WO2014132032 A1 WO 2014132032A1
Authority
WO
WIPO (PCT)
Prior art keywords
lics
cells
ltc
leukemia
culture
Prior art date
Application number
PCT/GB2014/050424
Other languages
English (en)
Inventor
Dominique Bonnet
Emmanuel GRIESSINGER
Original Assignee
Cancer Research Technology Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cancer Research Technology Limited filed Critical Cancer Research Technology Limited
Publication of WO2014132032A1 publication Critical patent/WO2014132032A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0693—Tumour cells; Cancer cells
    • C12N5/0694—Cells of blood, e.g. leukemia cells, myeloma cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/02—Atmosphere, e.g. low oxygen conditions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/145—Thrombopoietin [TPO]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/22—Colony stimulating factors (G-CSF, GM-CSF)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1305—Adipocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1311—Osteocytes, osteoblasts, odontoblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1317—Chondrocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1323—Adult fibroblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1329—Cardiomyocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1335—Skeletal muscle cells, myocytes, myoblasts, myotubes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1341—Tenocytes, cells from tendons and ligaments
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1347—Smooth muscle cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1358—Bone marrow mesenchymal stem cells (BM-MSC)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1364—Dental pulp stem cells, dental follicle stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/137—Blood-borne mesenchymal stem cells, e.g. Msc from umbilical cord blood
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1376—Mesenchymal stem cells from hair follicles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1382—Adipose-derived stem cells [ADSC], adipose stromal stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1352—Mesenchymal stem cells
    • C12N2502/1388—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1394—Bone marrow stromal cells; whole marrow
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to the in vitro and ex vivo culture of leukemia initiating cells.
  • the invention relates to a method for culturing leukemia initiating cells in vitro.
  • This method has various applications, including screening for candidate agents for treating leukemia, identifying leukemia patients likely to respond to a candidate agent for treating leukemia, monitoring a leukemia patient for drug-resistance, e.g. chemoresistance, to an agent, predicting the prognosis of a leukemia patient and determining the ability of a therapeutic agent to reduce the proportion of LICs in a leukemic patient.
  • drug-resistance e.g. chemoresistance
  • Leukemia is a type of cancer of the blood or bone marrow and is characterised by an abnormal increase of immature white blood cells.
  • Myeloid leukemia is a type of leukemia affecting myeloid tissue. Myeloid leukemia can be divided into acute and chronic forms .
  • Acute myeloid leukemia (AML) is characterised by the infiltration of leukemic myeloid blasts that have been arrested at various maturation steps into the bone marrow, whereas chronic myeloid leukemia (CML) is characterised by the excessive build up of relatively mature, but still abnormal, myeloid cells.
  • AML Acute myeloid leukemia
  • CML chronic myeloid leukemia
  • Myelodysplastic syndrome refers to a heterogeneous group of closely related clonal hematopoietic disorders characterised by a hypercellular or hypocellular marrow with impaired morphology and maturation and peripheral blood cytopenias resulting from ineffective blood cell production (Besa, 1992) .
  • CML and MDS can be considered as a premalignant condition in a subgroup of patients that often progresses to AML when additional genetic abnormalities are acquired.
  • LICs are typically chemo-resistant due to intrinsic and extrinsic factors: efficient DNA repair pathways, high level of drug efflux pumps and quiescence account for intrinsic drug resistance, whereas environment-mediated drug resistance (EM-DR) arises from a complex concomitance of soluble factors (SFM-DR) and cell adhesion-mediated drug resistant mechanisms (CAM-DR) (Damiano et al . , 1999; Meads et al., 2008).
  • SFM-DR soluble factors
  • CAM-DR cell adhesion-mediated drug resistant mechanisms
  • Chemo-resistant LICs are responsible for AML relapse and represent the target for future innovative therapies (Zhou et al., 2009).
  • a number of studies also indicate the existence of LIC in CML and MDS (Chung et al . , 2008; Holyoake et al . , 1999).
  • Myeloid leukemias are a highly heterogeneous group of clonal leukemias, i.e. AML can be divided into 8 subtypes, with 54 cytogenetic subgroups identified with (i) different abnormalities distributed on all chromosomes and/or (ii) dozens of mutations and/or overexpressions responsible for constitutive signalling pathway activations at the molecular level (Grimwade et al . , 2010) .
  • the AML xenograft assay requires a timeframe of eight to twenty-four weeks before analysing and remains prospectively blind with little ability to monitor progress.
  • HSCs haematopoietic stem cells
  • LICs leukemia initiating cells
  • L- CAFC leukemic cobblestone area-forming cells
  • L-LTC- IC leukemic long-term culture initiating cells
  • a primary goal of establishing long-term cultures of HSC has involved mimicking the bone marrow microenvironment ex vivo.
  • Cytokines and extracellular matrix proteins play an essential role in providing a supportive environment but HSCs are also influenced by cues provided through cell-cell contact, "stem cell niche synapses", between different cell types in the bone marrow microenvironment .
  • stem cell niche synapses between different cell types in the bone marrow microenvironment .
  • Pre-osteoblasts , osteoblasts, endothelial cells and mesenchymal cells have each been shown to be
  • HSC co-culture with endothelial cells from different origins have been shown to promote an increase in L-LTC-IC frequency and cobblestone area- forming cells (CAFC) (Lu et al., 1996; Rafii et al . , 1995), as well as the maintenance of repopulating cells (Li et al . , 2004).
  • the mesenchymal cell line MS-5 has been used for expanding human hematopoietic stem/progenitor cells in vitro (Bennaceur-Griscelli et al . , 1999; Issaad et al . , 1993) .
  • SCID normal human HSCs capable of repopulating NOD/SCID mice
  • repopulating cell [SRC] activity could be expanded in vitro for up to five weeks (Amsellem et al., 2003; Vanheusden et al . , 2007) .
  • survival and proliferative benefit have been reported in AML samples co-cultured with the SaOS-2 or HUVEC cell lines (Bruserud et al., 2004; Dias et al . , 2002; Glenjen et al., 2005; Liesveld et al., 2005).
  • MS-5 co- cultures supplemented with IL3, G-CSF and TPO can also sustain primary AML samples over 24 weeks with successful generation of leukemic CAFC and primary leukemic LTC-ICs (van Gosliga et al., 2007) .
  • van Gosliga et al., 2007 van Gosliga et al., 2007
  • HSC functions are maintained through distinct physical and chemical features of the HSC niche, one of which is oxygen levels (Kubota et al., 2008; Parmar et al., 2007; Rehn et al . , 2011; Simsek et al., 2010; Takubo et al., 2010) .
  • hypoxia favors normal hematopoietic stem cell quiescence and maintenance
  • normoxia induces proliferation and differentiation, followed by exhaustion (Danet et al., 2003; Hammoud et al . , 2011; Hermitte et al., 2006).
  • hypoxia-inducible factor 1 alpha pathway for the maintenance of LICs in vivo (Wang et al., 2011) .
  • AML cells cultured at a reduced oxygen level increase SDF-1/CXCR4 and PI3K signaling by promoting lipid raft formation (Fiegl et al . , 2009; Fiegl et al., 2010).
  • the impact hypoxia has on survival in steady state conditions or under drug treatment is less clear, depending on which population and which drug is being studied (Chan et al., 2008; Comerford et al., 2002; Erler et al., 2004).
  • the chemo-protective role of hypoxia in LICs in vitro has not been explored.
  • the present invention arises from the first direct comparison between different co-culture systems and the assessment of the impact of low oxygen availability on functionally defined early progenitors and stem cells via long-term secondary culture assays and in vivo repopulating activity.
  • the inventors have identified a reliable, easy and reproducible culture system suitable for the maintenance of both human primary HSC and LICs.
  • This system can be used as a xenograft surrogate model for LIC handling.
  • the present invention provides methods to study and quantify the drug-resistance of LICs and to screen the activity of new therapeutic agents on LICs. Therefore, the method of the invention can assist in conducting or monitoring a clinical study.
  • the invention provides a method for culturing leukemia initiating cells (LICs) in vitro, the method comprising culturing the LICs at an oxygen concentration of 6.8% per volume or lower. This method allows the long term culture (e.g. for at least three weeks) of LICs in vitro.
  • LICs leukemia initiating cells
  • the oxygen concentration may be 6.8% per volume or lower, 6% per volume or lower, 5% per volume or lower, 4% per volume or lower, or 3% per volume or lower. Preferably, the oxygen concentration is between 0.1% per volume and 6.8% per volume inclusive.
  • the method may comprise co-culturing the LICs with primary stromal cells from adult or embryonic tissues or with stromal cell derived cell lines.
  • the stromal cells may be mesenchymal cells, such as mesenchymal stem cells (MSC) , pre-osteoblasts , osteoblasts, chondrocytes or endothelial cells.
  • the stromal cells may be primary MSC, primary pre-osteoblasts, primary osteoblasts, primary chondrocytes or primary endothelial cells. These types of stromal cells may be directly isolated from adult or embryonic tissues. Alternatively, pre-osteoblasts, osteoblasts, chondrocytes and endothelial cells, may be derived from MSC by differentiation or by other methods known to one skilled in the art.
  • Primary mesenchymal cells may be pericytes or mesenchymal cells derived from the endothelial-to-mesenchymal transition.
  • Primary endothelial cells may be bone marrow microvascular endothelial cells (BMEC) , endothelial progenitor cells (EPC) , umbilical vein endothelial cells (UVEC) .
  • Stromal cells may be of mammalian origin.
  • the mammal may be a mouse or human.
  • the stromal cells are mesenchymal cells, e.g. MS-5 cells.
  • the method may comprise culturing the LICs in medium supplemented with one or more cytokines.
  • the method may comprise culturing the LICs in a defined medium, such as serum free medium supplemented with cytokines.
  • Cytokines known to one skilled in the art may promote myeloid activation, such as interleukin-3 (IL-3) , granulocyte colony-stimulating factor (G-CSF) or thrombopoietin (TPO) , or they may promote endothelial support and/or activation such as vascular endothelial growth factor (VEGF) or interleukin-1 (IL-1) .
  • the medium is supplemented with cytokines IL-3, G-CSF and/or TPO ("3GT" when added in combination) .
  • the method may comprise culturing the LICs in the presence of undefined medium, for example medium supplemented with mammalian serum, such as serum of human, bovine and/or equine origin.
  • the method may comprise culturing the LICs using conditioned media harvested from cultured primary normal or cancerous cells or cell lines. "Conditioned medium” is obtained culturing cells in a medium such that the cells release factors into the medium changing its composition. The medium is then collected as "conditioned medium”.
  • the method may comprise culturing the LICs in defined or undefined media supplemented with one or more extracellular matrix protein such as collagen, fibronectin, and/or one or more proteoglycans.
  • extracellular matrix protein such as collagen, fibronectin, and/or one or more proteoglycans.
  • proteoglycans that can mimic the bone marrow extracellular matrix are known to those skilled in the art.
  • three-dimensional (3D) semi-solid media may be formed from natural molecules and/or synthetic polymers such as fibronectin, collagen type I, II, IV, laminin, methylcellulose , a Matrigel based matrix, or an alginate based hydrogel (Celebi et al., 2011; Leisten et al . , 2012) .
  • the LICs may be drug-resistant, e.g. chemoresistant, and the results presented herein show that, using the method of the invention, drug-resistant, e.g. chemoresistant, LICs can be maintained and indirectly quantified through long term culture in vi tro .
  • the LICs may have been obtained from a patient with leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • the AML may be AML de novo, secondary AML or therapy related AML.
  • the LICs may have been obtained from a patient with leukemia at diagnosis or during different stages of the disease evolution and clinical care.
  • the LICs may be cultured in vitro for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, at least 20 weeks, at least 21 weeks, at least 22 weeks, at least 23 weeks, or at least 24 weeks.
  • LICs Once LICs have been cultured according to the method of the invention for at least one week and are capable of re-initiating secondary culture and ultimately giving rise to leukemic colony forming cells (L-CFC) progeny, they may be referred to as leukemia long term culture initiating cells (L-LTC-ICs) . LICs that have been cultured according to the method of the invention for at least five weeks may also be referred to as L-LTC-ICs.
  • L-LTC-ICs leukemia long term culture initiating cells
  • the method may further comprise the step of re-plating the LICs and/or the L-LTC-ICs onto fresh stromal cells.
  • Secondary culture may be maintained for at least 1 week, at least 2 weeks, at least 3 Weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, at least 20 weeks, at least 21 weeks, at least 22 weeks, at least 23 weeks, or at least 24 weeks.
  • the stromal cells used for this secondary culture may be the same type or a different type of stromal cells from the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine supplementation.
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different oxygen concentration.
  • the secondary culture may be performed at an oxygen concentration of 20% per volume (i.e. under normoxic conditions).
  • the secondary culture of re-plated LICs and/or L-LTC- ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L-LTC-ICs, such as normoxia, e.g.
  • long term co-cultured leukemic cells may be harvested and seeded into semi-solid methylcellulose supplemented with cytokines promoting myeloid colony formation, such as stem cell factor (SCF) , IL-3, interleukin-6 (IL-6) , macrophage colony- stimulating factor (M-CSF) , granulocyte macrophage colony- stimulating factor (GM-CSF) , or granulocyte colony-stimulating factor (G-CSF)
  • SCF stem cell factor
  • IL-3 interleukin-6
  • M-CSF macrophage colony- stimulating factor
  • GM-CSF granulocyte macrophage colony- stimulating factor
  • G-CSF granulocyte colony-stimulating factor
  • L-LTC-ICs may be referred to as secondary L-LTC-ICs. However, if no step of re- plating onto fresh stromal cells is undertaken, the L-LTC-ICs may be referred to as primary L-LTC-ICs.
  • the method may further include the step of determining the total number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the total number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • the invention provides an in vitro method of screening for a candidate agent for treating leukemia, the method comprising:
  • the test sample may be contacted with a single candidate agent or with a combination of one or more candidate agents.
  • the test sample may be contacted with the different agents simultaneously or sequentially.
  • the test sample may also be contacted with an agent already known for treating leukemia.
  • the test sample may be contacted with the different agents simultaneously or sequentially.
  • the effectiveness of the candidate agent, or combined candidate agents, may be compared to the effectiveness of the agent already known for treating leukemia .
  • the i n vitro method of screening may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (ii) .
  • the stromal cells used in this secondary culture may be the same type or a different type from the stromal cells used in the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different oxygen concentration.
  • the oxygen concentration may by about 20% per volume (i.e. normoxic conditions) .
  • the secondary culture of re-plated LICs and/or L-LTC-ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L-LTC-ICs. Such conditions are known to a person skilled in the art and include normoxia, i.e. an oxygen concentration of about 20% per volume .
  • the method may further include the step of determining the number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the total number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • a decrease in the number or frequency of LICs and/or secondary L-LTC-ICs following re-plating compared to a control sample that has not been contacted with the candidate agent indicates that the candidate agent may be effective for treating leukemia.
  • the invention provides an ex vivo method for identifying a leukemia patient likely to respond to a candidate agent for treating leukemia, the method comprising:
  • test sample may be contacted with a single candidate agent or with a combination of one or more candidate agents.
  • the test sample may be contacted with the different agents simultaneously or sequentially.
  • the test sample may also be contacted with an agent already known for treating leukemia. The effectiveness of the candidate agent, or combined candidate agents, may be compared to the effectiveness of the agent already known for treating leukemia.
  • the method may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (ii) .
  • the method may further include the step of determining the number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • a decrease in the number or frequency of LICs and/or secondary L-LTC-ICs following re-plating compared to a control sample that has not been contacted with the candidate agent indicates that the leukemia patient is likely to respond to the candidate agent.
  • the invention provides an ex vivo method for monitoring a leukemia patient for resistance to a therapeutic agent, the method comprising:
  • step (iii) determining the frequency or number of LICs and/or L- LTC-ICs present in the test sample before and after step (ii) , wherein a decrease in the frequency or number of LICs and/or L- LTC-ICs following step (ii) indicates that the leukemia patient is not resistant to the agent.
  • the method may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (ii) .
  • the method may further include the step of determining the total number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the total number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • a decrease in the number or frequency of LICs and/or secondary L-LTC-ICs following re-plating compared to a control sample that has not been contacted with the agent indicates that the patient is not resistant to the agent.
  • the invention provides an ex vivo method for predicting the prognosis of a leukemia patient, the method comprising :
  • test sample may be cultured according to the method described in the first aspect above.
  • the test sample of leukemic cells may be obtained from a patient with any type of leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • These test samples may have been obtained from peripheral blood, bone marrow or leukapheresis samples taken from these leukemia patients .
  • the invention provides an ex vivo method for determining the ability of a therapeutic agent to reduce the proportion of LICs in a leukemia patient, the method comprising:
  • a decrease in the proportion of LICs and/or L-LTC-ICs in the sample following step (iii) indicates that the therapeutic agent is likely to reduce the proportion of LICs when used to treat the patient.
  • the method may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (iii) .
  • the sample of LICs may be obtained from a patient with any type of leukemia, such as acute myeloid leukemia (AML) ,
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • CD34+CD38- (lower right quadrant), CD34+CD38+ (upper right quadrant) and CD34-CD38+ (upper left quadrant) were injected into NOD/SCID mice.
  • IVIG human immunoglobulin
  • Mice received a dose of sub-lethal radiation (330-375 cGy) from a 137 caesium source twenty-four hours pre-transplant .
  • Intravenous injection was the preferred route of administration, unless fewer than 10 6 cells were administered where direct intra bone marrow injection was preferred. Black or grey panels indicates a negative or positive human chimerism respectively determined 12 weeks after inj ection .
  • Figure 2 shows the xenograft assay potential for distinguishing the drug sensitivity of LICs versus non-LICs.
  • Thawed AML cells were co-cultured with MS-5 + 3GT at 3% 02 for 1 week in the absence (CT) or in the presence of 3 ⁇ Ara-C (ARA) .
  • An arbitrary 3-fold reduction in the bulk tumour size is displayed in the schematic representation.
  • Xenograft potential was determined after ex vivo chemotherapy.
  • NSG NOD scid gamma mice
  • Figure 3 shows the potential of the secondary L-LTC assay for distinguishing the drug sensitivity of LICs versus non-LICs.
  • L-LTC re-plating potential was determined following ex vivo chemotherapy.
  • LDA analysis was done using LCalc Software (Stem Cell Technologies) according to the Poisson statistics and the method of maximum likelihood.
  • secondary L-LTC-IC frequency in the CT group (i) equals that in the ARA group
  • CKARA is inferior to that in the ARA group
  • Figure 4 shows that the MS-5+3GT preferential supportive
  • LTC long term culture
  • Figure 5 shows the effect of long term low oxygen culture on HSC read out in vitro and in vivo.
  • CB Lin " cells were co-cultured for 5 weeks with MS-5+3GT under 20% or 3% 0 2 .
  • B Data shown represent fold expansion of 5 CB samples co-cultured at 20%O 2 or 3%0 2 in parallel. *p ⁇ 0.05 in paired t-test.
  • D Total input LTC-IC (90% CI) determined at week 5 after the first plating maintained at 20% or 3% 0 2 ; ***p ⁇ 0.001.
  • E Total secondary LTC-IC (90% CI) determined at week 10 in the secondary replated culture at week 5.
  • I Total input and output SRC (90% CI) determined for 10 7 CB lin " cells uncultured (TO) or co-cultured for 5 weeks with MS-5+3GT under 20% or 3% 0 2 ; NS p>0.05.
  • SRC 90% CI
  • Figure 6 shows that normal HSC expanded with 20% oxygen present a defect in efficient lymphoid lineage engraftment associated with signs of oxidative stress.
  • (+SEM) derived from 4 independent LTC.
  • Figure 7 shows the effect of different feeder cell layers on the viability, maintenance and expansion of AML cells and the requirement for 3GT for long-term maintenance of leukemic cells.
  • A2: MS-5 and HUVEC comparison n 38 samples.
  • B AML cells fold expansion comparison after 1-week co-culture with MS-5, SaOS-2 or HUVEC cells without cytokines.
  • 3GT is required for long-term maintenance of leukemic cells.
  • AML samples #12 and #1 were co-cultured with MS-5 in normoxia for 5-weeks in absence (MS-5) or in presence of 3GT (MS-5 3GT) .
  • NPM1 mutated AML samples #12 (mutation type 1) and #1 (mutation type 4) expanded cells after 5 weeks.
  • Amplification plots and standard curves for total NPMl (Dl, 3) and NPM mutated type 1 (D2) and type 4 (D4) Standard curves are derived from a dilution series of NPM mutated genomic DNA ranging from 200 ng to 0.02 ng from non-manipulated samples.
  • equivalent genomic DNA from MS-5 only were subject to PCR.
  • MS-5 were negative or below 0.02 ng level nor for human NPMl total primers nor for human NPMl mutation type 1 and 4.
  • Amplification plots for sample #12 showing mean of 51.4 ng of NPMl total DNA (Dl) and mean of 55 ng NPMl mutated type 1 (D2) in 100 ng of DNA processed (100% mutated) .
  • Amplification plots for sample #1 showing mean of 14 ng of NPMl total DNA (D3) and mean of 11.6 ng NP 1 mutated type 4 (D4) in 58 ng of DNA processed (82% mutated) .
  • Figure 8 shows that low oxygen concentrations favour long term in vitro maintenance of LICs over 3 weeks.
  • AML samples were co- cultured for 3 weeks with MS-5+3GT at 20% 0 2 or 3% 0 2 in parallel.
  • Data shown represents fold expansion of 5 AML samples (samples #2, #7, #10, #3 and #6) determined in 20% 0 2 (open symbol) or 3% 0 2 (closed symbol) .
  • C Replating potential at week-3. Sorted CD45+ AML#6, #2 and #3 cells co-cultured at 20% 0 2 or 3% 0 2 for 3- weeks were replated in limiting dilution analysis (LDA) for 5 additional weeks at 20% 0 2 .
  • D Total input and output SL-IC count (90% CI) determined for 4 10 7 samples #2 cells uncultured (TO) or co-cultured for 3 weeks at 20% or 3% 0 2 . *p ⁇ 0.05; NS p>0.05.
  • B-D data presented take into account first culture fold expansion.
  • F Primary and secondary leukemic engraftment of AML samples co- cultured for 3 weeks. The data show the percentage of human leukemic chimerism in primary recipient mice (1st) for 6 samples #1, #2, #3, #4, #5 and #6 and secondary recipients (2nd) for samples #1, #2 and #3. Plain lines represent mean levels of leukemic cell engraftment in each group. Dashed line represent the threshold of positivity. Each symbol represents a single transplanted mouse.
  • Figure 9 shows the effect of cytarabine treatment on various cell types.
  • AML cells thin dashed lines
  • MS-5 cells thin plain line
  • B Suspension culture and MS- 5 based co-culture system comparison for assessing chemotherapy impact on normal and leukemic hematopoietic cells.
  • Bl Data shown represent the mean ( ⁇ SEM) normalized cellular count percent as compared to the more permissive condition (untreated CT MS-5 3GT) .
  • Figure 10 shows that low oxygen concentration enhances in vitro chemoresistance of AML cells in co-culture and allows the preservation of LIC activity.
  • B Replating potential after Ara-C treatment.
  • AML#6 and #2 cells treated during the first week with Ara-C 3 ⁇ in co-culture at 20% 0 2 or 3% 0 2 were recovered after 3 weeks and replated in limiting dilution analysis for 5 additional weeks.
  • C Total input uncultured and untreated LTC (grey bars) and 3 weeks co-cultured and treated with Ara-C at 20% 0 2 (black bars) or 3% 0 2 (white bars) output LTC-IC per 10 5 starting cells from samples #6 and #2.
  • Ara-C treatment occurs during the first week.
  • Uncultured input LTC was determined at week-5 at 20% 0 2 .
  • Ara-C treatment occurred during the first week only.
  • C Xenograft potential after ex vivo chemotherapy. A single cell dose (20,000 cells, #3 #2 and #6) of sorted CD45+ cells at 3-weeks was injected into NSG mice.
  • F Total input uncultured and output cultured SL-IC for 4x107 cells of samples #2.
  • G In vivo Ara-c treatment: At week 11, after establishment of samples #6 leukemia in NSG mice, recipients were treated with Ara-C 10 mg/kg for 7 days. Data show the absolute number of leukemic cells in the recipient mice treated with or without Ara-C (*p ⁇ 0.05). H: Data shown represent leukemic engraftment in recipient bone marrow 12-weeks after secondary xenotransplantation. Indicated cell doses of sorted samples #6 cells recovered from primary recipient were injected into secondary NSG mice. NS p>0.05.
  • Figure 12 shows that AML immunodeficient mice engrafter samples (E) yield a higher number of output cells and are enriched in L- LTC-IC as compared to non-engrafter samples (NE) .
  • E versus NE in vitro expansion. Data shows live leukemic cell count determined by FACS after 5 weeks for 15 E and 13 NE co-cultured with MS-5 + 3GT at 20% oxygen. The horizontal line marked
  • Figure 13 shows that the direct use of amino-reactive fluorescent probes for tracking AML cell division is complicated due to the lower cell viability and expansion after 1 week as compared to a normal hematopoietic sample.
  • Amino-reactive fluorescent probe cell division tracking principle the amino-reactive fluorescent probe readily crosses intact cell membranes and crosslinks to intracellular proteins. Cell division can be measured as successive halving of the fluorescence intensity of the fluorescent probe. The assay can be used to separately quantify the number of cells in the culture that have not divided vs. those that have divided a specified number of times.
  • CFSE carboxyfluorescein diacetate, succinimidyl ester.
  • Bl Data shown represent percent viability determined by Annexin-V and DAPI negative cells proportion after 1 week of culture for 16 CB lin- and 59 AML samples.
  • B2 Data shown represent fold cell expansion determined by precise cell counts using absolute counting beads after 1 week culture for 8 CB lin- and 28 AML samples . **p ⁇ 0.01 determined by unpaired Student's t-test.
  • Figure 14 shows that the AML starting fluorescent probe intensity is over-estimated due to apoptosis.
  • Annexin-V staining is essential for determining cell division related fluorescence intensity reliably.
  • Al gating strategy: Doublets and DAPI positive cells were excluded and debris eliminated by forward and side light scatter (i-ii-iii) to define R3 population. Then Annexin V was used (iv) to discriminate non apoptotic (R4) from apoptotic cells (R5). Representative FACS plot for CFSE
  • AML CFSE intensity is over-estimated due to apoptosis.
  • CFSE mean fluorescence intensity (MFI) was determined for gate R3 R4 and R5 for 14 AML samples 18 hours after staining. Data shown represent CFSE MFI in R4 (annexin V negative) and in R5 (Annexin-V positive) normalised to CFSE MFI in superior gate R3. * p ⁇ 0.05 and ***p ⁇ 0.001 determined by unpaired Student's t- test.
  • FIG. B Schematic representation of the use of Annexin-V/DAPI positive cells exclusion (grey bar) to focus the analysis on live dividing/non dividing cells (black bar) .
  • Figure 15 shows that Fluorescence Dilution Factor (FDF) allows a low resolution proliferation quantification of AML cell
  • Representative FACS double scatter dot plot of an AML sample (i) where a low scatter (R3A thick line) and a high scatter (R3B dashed line) gates are applied, (ii) CFSE fluorescence intensity histogram plot for R3A gated cells (thick line and arrow) and R3B gated cells (dashed line and arrow) 18h after CFSE loading, (iii) Cord Blood representative peak of division where computational model is applicable, (iv) AML representative of 14% of the samples where peak of division are still noticeable and
  • A2 variance on the fluorescence distribution within each generation. Data shown represent the coefficient of variation (CVF) for the CFSE fluorescence peaks determined with the FlowJo Proliferation Tool for 45 CB lin- samples and 27 AML samples co-cultured for 1-week with MS-5+3GT at 20% 0 2 . ****p ⁇ 0.0001
  • CVF coefficient of variation
  • FDF fluorescence dilution factor
  • Figure 16 shows the distinctive and predictive behaviour of NOD/SCID engrafting (E) and non-engrafting (NE) AML samples in vitro.
  • FDF Fluorescence Dilution Factor
  • B FDF and viability regression analysis for E and NE samples co-cultured for 1-week with MS-5 and/or with SaOS-2 and/or with HUVEC. The 95% confidence band is displayed (dashed curve) .
  • C A training data set was generated from (B) to derive a computational modelling for predicting E and NE status for an unknown sample. The data shows the observed False Discovery Rate (FDR) of predictions against the percentage of samples for which no prediction is made: e.g. as displayed by the dashed line in (C) , if no prediction is made for 25% of samples, then, 15% of the predictions will be false for those samples for which a
  • FDR False Discovery Rate
  • Figure 17 shows the overall survival (OS) of NOD/SCID engrafting and non-engrafting (A) or low proliferating and high
  • AML samples proliferating (B) AML samples.
  • a and B The overall survival data of 30 de novo AML cases ( ⁇ 60 years old) that received intensive multi-agent chemotherapy. Allografted patients in first complete remission were censored.
  • AML MNCs ⁇ '
  • CD3+ depleted were injected into each NOD/SCID and/or B2m-/-N0D/SCID and/or N0D/SCID- m "/_ mice .
  • a mouse was scored as engrafted if a distinct single human CD45 + CD33 + CD19 ⁇ and murine CD45 ⁇ population with a cut-off of 0.1% was detectable at 8 to 12 weeks in the recipient bone marrow.
  • the present invention is based on the finding that a low concentration of oxygen is able to support the long term in vitro or ex vivo culture and maintenance of leukemia initiating cells (LICs) , preferably when co-cultured with stromal cells in the presence of medium supplemented with cytokines. Furthermore, whereas the original distribution of LICs within the leukemic population is diluted at higher oxygen concentrations (e.g.
  • concentrations of oxygen i.e. 0.1 to 6.8% per volume maintain the original LIC distribution within the leukemic population.
  • the invention provides a method for culturing leukemia initiating cells (LICs) in vitro, the method comprising culturing the LICs at an oxygen concentration of 6.8% per volume or lower.
  • LICs leukemia initiating cells
  • the method represents an efficient culture system for maintaining and quantifying LICs in vitro. These culture conditions allow LICs to be maintained in vitro for at least three weeks, i.e. they allow the long term culture of LICs. In addition, the drug- resistance, e.g. chemoresistance, of these cells may be studied using the method of the invention.
  • the method of the invention also allows for the high-throughput screening of candidate agents, which is not possible when using the xenotransplantation assay (the gold standard model for studying normal human HSCs and LICs (Anj os-Afonso and Bonnet, 2008; Bonnet, 2008; Bonnet, 2009a; Bonnet, 2009b) ) .
  • Normal HSCs may also be maintained in vitro long term (e.g. for at least 3 weeks) using the method of the invention.
  • the LICs are preferably mammalian in origin and are most preferably human LICs.
  • LICs are responsible for maintaining leukemia (Bonnet and Dick, 1997; Lapidot et al . , 1994) and have the ability to recapitulate leukemia and to self-renew. They are typically chemoresistant due to intrinsic and extrinsic factors: efficient DNA repair pathways, high level of drug efflux pumps and quiescence account for intrinsic drug resistance, whereas environment-mediated drug resistance (EM-DR) arises from a complex concomitance of soluble factor drug resistance (SFM-DR) and cell adhesion-mediated drug resistance (CAM-DR) (Damiano et al., 1999; Meads et al., 2008). LICs are derived from HSCs and are synonymous with leukemic stem cells (LSCs) and these terms can define the same entity and can be used interchangeably.
  • LSCs leukemic stem cells
  • LICs are cells that are capable of maintaining leukemia. They have the capacity to self-renew and to differentiate into leukemic blasts, which re-initiate the leukemic cell diversity seen in leukemia patients. LICs are capable of re-initiating leukemia when transplanted into a xenotransplant model (e.g. NOD/SCID immunodeficient mice) . LICs identified in this way can also be called SCID-leukemia initiating cells (SL-IC) because of the type of mice used in the test.
  • SL-IC SCID-leukemia initiating cells
  • the frequency of LICs or L- LTC-ICs in a test sample may be evaluated by, for example, limiting dilution analysis.
  • the frequency of LICs or L-LTC-ICs capable of engrafting mice in a test sample may be determined by injecting at least 4 different doses of cells into a minimum of four mice per dose. After 10-12 weeks, the number of positive mice are scored, i.e. the mice that have detectable CD33+CD19- leukemic engraftment.
  • the frequency of LICs is calculated using extreme limiting dilution analysis software (available from the Bioinformatics section of the Walter and Eliza Hall Institute of Medical Research, http : //bioinf .
  • LICs Once LICs have been cultured in vitro for at least one week and are capable of re-initiating secondary culture and ultimately giving rise to leukemic colony forming cells (L-CFC) progeny, they may be referred to as leukemia long term culture initiating cells (L-LTC-ICs). LICs that have been cultured in vitro for at least five weeks may also be referred to as L-LTC-ICs.
  • LICs may be enriched using various antigens, such as CD34, CD38, TIM.l, CD123, CD33, CLL.l, CD44, CD133, CD117, CD90 and/or CD45RA.
  • markers are universally expressed in LICs and the phenotype of the LICs depends on the patient sample from which there were obtained.
  • No marker that is absolutely specific for LICs has yet been identified, i.e. no marker that is solely expressed by LICs and not by non-LICs, such as HSCs, has been identified. Identification of LICs using phenotypically defined cell populations is therefore unreliable and instead requires functional confirmation of activity, e.g. using the xenotransplantation model described above or LTC (see Figure 1).
  • the experimental results provided herein identify an in vitro functional test for LICs which mimics their
  • LICs may be obtained from leukemia patient samples, e.g.
  • peripheral blood samples may be obtained from leukemia patients at diagnosis or during different stages of the disease evolution and clinical care.
  • the LICs are cultured at an oxygen concentration of about 6.8% per volume or lower.
  • the oxygen concentration is measured at 37°C in an incubator.
  • the oxygen concentration is measured at 37°C in an incubator.
  • concentration may be varied using a sensor in the incubator that allows the level of oxygen being distributed to the cells to be selected.
  • Hypoxia is considered to be between 0.1 to 3% oxygen per volume.
  • a level of 6.8% oxygen per volume is the mean concentration of oxygen that has been measured directly in the bone marrow of samples from leukemia patients.
  • HSCs may be retained in areas of the bone marrow where the oxygen concentration is less than 3% per volume. Re-creating this hypoxic environment in vitro is therefore a genuine feature of the "niche" in which these cells exist in vivo.
  • the LICs may be cultured at an oxygen concentration of about 6.8% per volume or lower, about 6% per volume or lower, about 5% per volume or lower, about 4% per volume or lower, or about 3% per volume or lower.
  • the oxygen concentration may be between about 0.1% per volume and about 6.8% per volume, between about 0.1% per volume and about 6% per volume, between about 0.1% per volume and about 5% per volume, between about 0.1% per volume and about 4% per volume, between about 0.1% per volume and about 3% per volume, between about 0.5% per volume and about 6.8% per volume, between about 0.5% per volume and about 6% per volume, between about 0.5% per volume and about 5% per volume, between about 0.5% per volume and about 4% per volume, between about 0.5% per volume and about 3% per volume, between about 1% per volume and about 6.8% per volume, between about 1% per volume and about 6% per volume, between about 1% per volume and about 5% per volume, between about 1% per volume and about 4% per volume, between about 0.5% per volume and about 3% per
  • the LICs may be co-cultured with stromal cells.
  • Stromal cells are cells that are able to adhere to tissue culture dishes or flaks and are able to form a monolayer. These stromal cells are able to provide a feeder layer for the culture of other cell types. Alternatively, stromal cells may be encapsulated in three-dimensional (3D) semi-solid media through standard methods known in the art. Semi-solid media may be formed from natural molecules and/or synthetic polymers such as fibronectin, collagen type I, II, IV, laminin, methylcellulose, a Matrigel based matrix, or an alginate based hydrogel .
  • stromal cells examples include stromal cells from adult or embryonic tissues or cell lines.
  • the stromal cells may be mesenchymal cells, such as mesenchymal stem cells (MSC) , pre-osteoblasts, osteoblasts, chondrocytes or endothelial cells.
  • MSC mesenchymal stem cells
  • the stromal cells may be primary MSC, primary pre-osteoblasts, primary osteoblasts, primary chondrocytes or primary endothelial cells. These types of stromal cells may be directly isolated from adult or embryonic tissues.
  • pre-osteoblasts pre-osteoblasts
  • osteoblasts may be derived from MSC by differentiation or by other methods known to one skilled in the art.
  • Primary mesenchymal cells may be pericytes or mesenchymal cells derived from endothelial-to-mesenchymal transition.
  • Primary endothelial cells may be bone marrow microvascular endothelial cells (BMEC) , endothelial progenitor cells (EPC) , umbilical vein endothelial cells (UVEC) .
  • Stromal cells may be of mammalian origin (the mammal may be a mouse or human).
  • the stromal cells are mesenchymal cells, e.g. MS-5 cells.
  • Stromal cells may be cell lines, for example, the 2012 cell line, the AC6.21 cell line, the AFT024 cell line, the AGM-S3 cell line, the CAL-72 cell line, the FLS4.1 cell line, the FS-1 cell line, the HAS303 cell line, the HBMEC-33 cell line, the HBMEC-60 cell line, the HBMEC-28 cell line, the HCB1-SV40 cell line, the HESS-5 cell line, HM1-SV40 cell line, the HM2-SV40 cell line, the HS27a cell line, the HS5 cell line, the HYMEQ-5 cell line, the KM-101 cell line, the KM-102 cell line, the KM-103 cell line, the KM-104 cell line, the K -105 cell line, the L87/4 cell line, the M210-B4 cell line, the MRL104.8a cell line, the MS-5 cell line, the OP9 cell line, the PA6 cell line, the PK-2 cell line, the PU-34 cell line,
  • the stromal cells are mesenchymal cells, e.g. MS-5 cells. These cells create a supportive stromal layer that helps to mimic part of the bone marrow environment ex vivo and helps to support long term (i.e. one week or more) culture of LICs.
  • the stromal cells form a confluent monolayer. More than one type of stromal cell may be used. For example, different types of stromal cells may be mixed together to form a confluent monolayer. Alternatively, one type of stromal cell may adhere to the culture dish or flask, while a different type of stromal cell may be set down over the top of the adherent layer in a semi-solid medium.
  • the method may comprise culturing the LICs in the presence of undefined medium, for example medium supplemented with mammalian serum.
  • the serum may, for example, be of human, bovine and/or equine origin.
  • the LICs may be cultured in the presence of about 12.5% fetal calf serum and about 12.5% horse serum.
  • the method may comprise culturing the LICs using conditioned media harvested from cultured primary normal or cancerous cells or cell lines. "Conditioned medium” is obtained culturing cells in a medium such that the cells release factors into the medium changing its composition. The medium is then collected as "conditioned medium”.
  • the LICs may be cultured in defined or undefined medium complemented with an extracellular matrix protein such as collagen (e.g. collagen I, III, IV, V, VI, VIII and XVIII), fibronectin, and/or various proteoglycans known to those skilled in the art that can mimic the bone marrow extracellular matrix, such as chondroitin sulphate proteoglycan 1, versican and heparan sulphate proteoglycan 2.
  • collagen e.g. collagen I, III, IV, V, VI, VIII and XVIII
  • fibronectin e.g. collagen I, III, IV, V, VI, VIII and XVIII
  • proteoglycans known to those skilled in the art that can mimic the bone marrow extracellular matrix, such as chondroitin sulphate proteoglycan 1, versican and heparan sulphate proteoglycan 2.
  • the method of the invention may comprise culturing the LICs in medium supplemented with one or more cytokines.
  • the method may comprise culturing the LICs in a defined or an undefined medium, such as serum free medium, supplemented with cytokines .
  • the cytokines used in the method of the invention may, for example, promote myeloid activation, such as interleukin-3 (IL- 3), granulocyte colony-stimulating factor (G-CSF) or
  • TPO thrombopoietin
  • they may promote endothelial support and/or activation, such as vascular endothelial growth factor (VEGF) or interleukin-1 (IL-1) .
  • VEGF vascular endothelial growth factor
  • IL-1 interleukin-1
  • the medium is supplemented with cytokines IL-3, G-CSF and TPO ("3GT") .
  • Cytokines used in the method of the invention may, for example, be from the interferon family, the interleukin family, the tumor necrosis factor family, the colony stimulating factors family, or the transforming growth factor family.
  • the method of the invention may comprise culturing the LICs in medium supplemented with a glycoprotein hormone or a growth factor, for example Interferon-alpha, Interferon-beta, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-17, IL-18, IL-23, CCL1, CCL2, CCL3 , CCL4, CCL5 , CCL6, CCL7, CCL8 ,
  • a glycoprotein hormone or a growth factor for example Interferon-alpha, Interferon-beta, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6,
  • the growth factors used may be from the epidermal growth factor family (EGF) , the fibroblast growth factor family (FGF) , the Insulin-like growth factor family (IGF) , the platelet-derived growth factor family (PDGF) , or the vascular endothelial growth factor family (VEGF) .
  • the cytokines are IL-3, G-CSF and TPO ("3GT") .
  • the concentration of each cytokine used may, for example, be at least 1 ng/ml, at least 5 ng/ml or at least 10 ng/ml.
  • the concentration of each cytokine used may, for example, be less than 1 g/ml, less than 500 ng/ml, less than 200 ng/ml, less than 100 ng/ml, or less than 50 ng/ml.
  • the concentration of each cytokine used is between 10 and 500 ng/ml.
  • the concentration of each cytokine may be about 20 ng/ml.
  • the method comprises culturing LICs in the presence of the cytokines IL-3, G-CSF and TPO ("3GT") , with each cytokine present at a concentration of about 20 ng/ml.
  • the LICs are preferably co- cultured with MS-5 cells in the presence of the cytokines IL-3, G-CSF and TPO ("3GT") .
  • the LICs cultured in the method of the present invention may be drug-resistant. This means that they are resistant to the action of a specific therapeutic agent. For example, they may be refractory to treatment with a particular chemotherapeutic agent, such as cytarabine (Ara-C) , i.e. they may be chemoresistant .
  • a chemotherapeutic agent such as cytarabine (Ara-C)
  • This drug- or chemo-resistance may be due to either intrinsic factors or extrinsic factors or both.
  • Intrinsic factors responsible for drug- or chemo-resistance include efficient DNA repair pathways, high levels of drug efflux pumps and quiescence.
  • Environment-mediated drug resistance (EM-DR) arises from a complex concomitance of soluble factors (SFM-DR) and cell adhesion-mediated drug resistant mechanisms (CAM-DR) (Damiano et al . , 1999; Meads et al., 2008).
  • Drug-resistant e.g.
  • chemoresistant, LICs are responsible for AML relapse and represent the target for future innovative therapies (Zhou et al . , 2009). Therefore, being able to culture and maintain drug- resistant, e.g. chemoresistant, LICs in vitro represents an important advance for screening for candidate therapeutic agents that may be effective against drug-resistant, e.g.
  • chemoresistant, LICs chemoresistant, LICs.
  • the results presented herein show that the method of the invention is capable of supporting functionally defined drug-resistant, e.g. chemoresistant LICs, as efficiently as in vivo. This is in contrast to conventional culture systems that are unable to maintain drug-resistant, e.g. chemoresistant, LICs ex vivo.
  • the LICs may have been obtained from a patient with leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • leukemia such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • the method of the invention allows the long term culture and maintenance of LICs in vitro or ex vivo.
  • the LICs may be cultured according to the method of the invention for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks or at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, 13 weeks, at least 14 weeks, at least 15 weeks, at least 16 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, at least 20 weeks, at least 21 weeks, at least 22 weeks, at least 23 weeks, or at least 24 weeks.
  • the experimental results presented herein demonstrate that functionally defined LICs may be maintained in vitro for at least three weeks using the method of the invention.
  • LICs Once LICs have been cultured according to the method of the invention for at least one week and are capable of re-initiating secondary culture and ultimately giving rise to leukemic colony forming cells (L-CFC) progeny, they may be referred to as leukemia long term culture initiating cells (L-LTC-ICs) . LICs that have been cultured according to the method of the invention for at least five weeks may also be referred to as L-LTC-ICs.
  • L-LTC-ICs leukemia long term culture initiating cells
  • the method of the invention screening may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells. This can be used as an in vitro surrogate bioassay to predict the sensitivity of LICs towards candidate therapeutic agents .
  • the stromal cells used in this secondary culture may be the same or different from the stromal cells used in the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine supplementation.
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different
  • the secondary culture of re-plated LICs and/or L-LTC- ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L-LTC-ICs, e.g. using the colony forming assay.
  • Such conditions include normoxia, i.e. a concentration of about 20% oxygen per volume.
  • L-LTC-ICs may be referred to as secondary L-LTC-ICs. However, if no step of re- plating onto fresh stromal cells is undertaken, the L-LTC-ICs may be referred to as primary L-LTC-ICs.
  • the method may further include the step of determining the total number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the total number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • the principle of secondary long term culture is the same as primary long term culture.
  • the secondary long term culture may be maintained according to the method of the invention for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks or at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, 13 weeks, at least 14 weeks, at least 15 weeks, at least 15 weeks, at least 17 weeks, at least 18 weeks, at least 19 weeks, at least 20 weeks, at least 21 weeks, at least 22 weeks, at least 23 weeks, or at least 24 weeks.
  • the method may further comprise the step of determining the frequency of L-LTC-ICs in primary or secondary culture, e.g.
  • a limiting dilution assay (Ploemacher et al., 1989).
  • a limiting dilution assay In this assay, different cell numbers or concentrations from the primary or secondary culture are seeded over the top of feeder cells. Co-culture is maintained for 5 weeks. After 5 weeks, a colony forming assay is performed. This assay has a duration of 2 weeks and is carried out in a semi-solid medium, such as methylcellulose supplemented with cytokines that promote myeloid colony formation, such as stem cell factor (SCF) , IL-3,
  • SCF stem cell factor
  • CFC interleukin-6
  • M- CSF macrophage colony-stimulating factor
  • GM-CSF granulocyte macrophage colony-stimulating factor
  • G-CSF granulocyte colony-stimulating factor
  • the inverse of this threshold number is the L-LTC-IC frequency within the starting population.
  • a potential problem with using the colony-forming assay to determine the frequency of L-LTC-ICs is that conditions favouring the maintenance of LICs or HSCs (i.e. low oxygen concentrations and/or the presence of certain types of feeder cells) may reduce the colony forming potential of the cells. Therefore, those conditions which favour the LICs or HSCs maintenance may hamper the CFC quantification which may introduce a bias in the analysis aiming to identify the retrospective presence of LICs or HSCs.
  • secondary long term culture following re-plating may be performed in conditions favouring CFC (e.g. normoxic conditions of 20% oxygen per volume) to allow accurate quantification of L-CFC derived from secondary L-LTC-ICs.
  • This method of secondary long term culture serves as a surrogate assay to the
  • the invention provides an in vitro method of screening for a candidate agent for treating leukemia, the method comprising:
  • step (iii) determining the number or frequency of LICs and/or L- LTC-ICs present in the test sample before and after step (ii) , wherein a decrease in the frequency or number of LICs and/or L- LTC-ICs following step (ii) indicates that the candidate agent may be effective for treating leukemia.
  • the test sample may be contacted with a single candidate agent or with a combination of one or more candidate agents.
  • the test sample may be contacted with the different agents simultaneously or sequentially.
  • test sample may also be contacted with an agent already known for treating leukemia, such as Azacitidine, Decitabine, Doxorubicine,
  • test sample may be contacted with the different agents simultaneously or sequentially.
  • the effectiveness of the candidate agent, or combined candidate agents, may be compared to the effectiveness of the agent already known for treating leukemia .
  • the in vitro method of screening may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (ii) .
  • the stromal cells used in this secondary culture may be the same type or a different type from the stromal cells used in the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine supplementation.
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different oxygen concentration, e.g. an oxygen concentration of about 20% per volume (i.e. normoxia) .
  • the secondary culture of re-plated LICs and/or L-LTC- ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L-LTC-ICs.
  • Such conditions are known to a person skilled in the art and include normoxic conditions, e.g. an oxygen concentration of about 20% per volume.
  • the method may further include the step of determining the number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • the LICs may be drug-resistant to one or more other therapeutic agents.
  • the LICs may be chemoresistant to one or more chemotherapeutic agents.
  • the results presented herein demonstrate that drug-resistant, e.g. chemoresistant, LICs can be maintained in culture long term (e.g. for at least 3 weeks) using the method of the invention.
  • This screening method of the invention allows for high throughput drug discovery, which is not possible when using a xenograft assay (which is the current gold standard model for studying human normal HSCs and LICs) , as this assay requires a time frame of eight to twenty four weeks before analysing and remains prospectively blind with little ability to monitor progress.
  • the screening method of the invention allows routine, high throughput screening of candidate drugs for treating leukemia, while also allowing the progress of the assay to be monitored at intermediate time points .
  • the test sample of LICs may be obtained from a patient with leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) . These test samples may have been obtained from peripheral blood, bone marrow or leukapheresis samples taken from these leukemia patients.
  • the screening method may include the step of comparing the frequency or number of LICs and/or L-LTC-ICs in a test sample that has been contacted with the candidate agent with the frequency or number of LICs and/or L-LTC-ICs in a control sample of LICs and/or L-LTC-ICs that has not been contacted with the candidate agent.
  • a decrease in frequency or number of LICs and/or L-LTC-ICs in the test sample following treatment compared to the frequency or number of LICs and/or L-LTC-ICs in the control sample indicates that the candidate agent may be effective for treating leukemia.
  • the screening method may also include the step of culturing a control sample of normal HSCs according to the method described in the first aspect above, contacting the control sample with the candidate agent and determining the number or frequency of normal HSCs present in the control sample before and after treatment with the candidate agent.
  • a decrease in the number or frequency of HSCs indicates that the candidate agent may not be suitable for treating leukemia as it may not be specific for leukemic cells .
  • the in vitro method of screening may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (ii) .
  • the stromal cells used in this secondary culture may be the same type or a different type from the stromal cells used in the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different oxygen concentration.
  • the oxygen concentration may by about 20% per volume (i.e. normoxic conditions) .
  • the secondary culture of re-plated LICs and/or L-LTC-ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L-LTC-ICs. Such conditions are known to a person skilled in the art and include normoxia, i.e. an oxygen concentration of about 20% per volume.
  • the method may further include the step of determining the number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the total number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • a decrease in the number or frequency of LICs and/or secondary L-LTC-ICs following re-plating compared to a control sample that has not been contacted with the candidate agent indicates that the candidate agent may be effective for treating leukemia.
  • the method of the invention also has utility in identifying or selecting for leukemia patients likely to respond to a candidate agent for treating leukemia.
  • the invention provides an ex vivo method for identifying a leukemia patient likely to respond to a candidate agent for treating leukemia, the method comprising:
  • step (iii) determining the frequency or number of LICs and/or L- LTC-ICs present in the test sample before and after step (ii) , wherein a decrease in the frequency or number of LICs and/or L- LTC-ICs following step (ii) indicates that the leukemia patient is likely to respond to the candidate agent.
  • the patient may be refractory to treatment with one or more other therapeutic agents, e.g. chemotherapeutic agents, i.e. the patient may not be responding to treatment with one or more other therapeutic agents, e.g. chemotherapeutic agents.
  • the method for identifying patients likely to respond to the candidate agent may include the step of comparing the frequency or number of LICs and/or L-LTC-ICs in a test sample that has been contacted with the candidate agent with the frequency or number of LICs and/or L-LTC-ICs in a control sample of LICs and/or L- LTC-ICs from the patient that has not been contacted with the candidate agent.
  • a decrease in the frequency or number of LICs and/or L-LTC-ICs in the test sample following treatment compared to the frequency or number of LICs and/or L-LTC-ICs in the control sample indicates that the patient is likely to respond to the candidate agent .
  • the method for identifying patients likely to respond to the candidate agent may also include the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after they have been contacted with the candidate agent (i.e. after step (ii) ) .
  • the stromal cells used in this secondary culture may be the same type or a different type from the stromal cells used in the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine supplementation.
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different oxygen concentration.
  • the secondary culture of re-plated LICs and/or L-LTC-ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L- LTC-ICs. Such conditions are known to a person skilled in the art and include normoxic conditions, i.e. an oxygen concentration of about 20% per volume.
  • the number or frequency of secondary L-LTC- ICs may be determined.
  • the method may further include the step of determining the total number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re- plating and/or the total number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • a decrease in the number or frequency of LICs and/or secondary L-LTC-ICs following re-plating compared to a control sample that has not been contacted with the candidate agent indicates that the leukemia patient is likely to respond to the candidate agent .
  • the test sample may be contacted with a single candidate agent or with a combination of one or more candidate agents.
  • the test sample may be contacted with the different agents simultaneously or sequentially.
  • test sample may also be contacted with an agent already known for treating leukemia .
  • the test sample of LICs may be obtained from a patient with leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • leukemia such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • the method of the invention also has utility in monitoring a leukemia patient for drug-resistance to an agent.
  • the invention provides an ex vivo method for monitoring a leukemia patient for resistance to a therapeutic agent, the method comprising:
  • LTC-ICs present in the test sample before and after step (ii) wherein a decrease in the frequency or number of LICs and/or L- LTC-ICs following step (ii) indicates that the leukemia patient is not resistant to the agent.
  • the method may further comprise the step of re-plating the LICs and/or L-LTC-ICs onto fresh stromal cells after step (ii) .
  • the stromal cells used in this secondary culture may be the same type or a different type from the stromal cells used in the first culture.
  • the secondary culture may use the same defined or undefined media and cytokine supplementation as the first culture, or different media and cytokine supplementation.
  • the secondary culture may be performed using the same oxygen concentration as the first culture or a different oxygen concentration, e.g. about 20% oxygen per volume (i.e. normoxia) .
  • the secondary culture of re-plated LICs and/or L-LTC- ICs may be performed using conditions that allow clonogenic potential quantification of the LICs and/or L-LTC-ICs. Such conditions are known to a person skilled in the art, e.g.
  • the method may further include the step of determining the number or frequency of LICs and/or primary L-LTC-ICs present in the culture before the step of re-plating and/or the number or frequency of LICs and/or secondary L-LTC-ICs present in the secondary culture following the step of re-plating.
  • a decrease in the number or frequency of LICs and/or secondary L-LTC-ICs following re-plating compared to a control sample that has not been contacted with the agent indicates that the patient is not resistant to the agent.
  • the therapeutic agent may be a chemotherapeutic agent, such as cytarabine (Ara-C) .
  • the method for monitoring leukemia patients for resistance to a therapeutic agent may include the step of comparing the frequency or number of LICs and/or L-LTC-ICs in a test sample that has been contacted with the agent with the frequency or number of LICs and/or L-LT-LICs in a control sample of LICs obtained from the patient that has not been contacted with the agent.
  • a decrease in frequency or number of LICs and/or L-LTC-ICs in the test sample following treatment compared to the frequency of LICs and/or L-LTC-ICs in the control sample indicates that the patient is not resistant to the agent.
  • the test sample of LICs may be obtained from a patient with leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • leukemia such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • the inventors have shown that the engraftment potential of LICs in the xenotransplantation assay is related to the proliferation rate of the LICs in vitro, with engrafter cells displaying a higher proliferation rate than non-engrafter cells.
  • the invention provides an ex vivo method for predicting the prognosis of a leukemia patient, the method comprising:
  • the test sample of leukemic cells may be cultured according to the method described in the first aspect above for at least one week.
  • the test sample may be cultured under normoxic conditions, i.e. at an oxygen
  • the test sample of leukemic cells may be obtained from a patient with any type of leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) . These test samples may have been obtained from peripheral blood, bone marrow or leukapheresis samples taken from these leukemia patients .
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • CML chronic myeloid leukemia
  • the method may comprise staining the test sample of leukemic cells with a dye or probe and determining the amount of dye or probe bound to the test sample on the day of initiating culture (DO) .
  • DO initiating culture
  • the amount of dye or probe bound to the test sample may again be determined.
  • the ratio of the amount of dye or probe bound to the test sample following culture compared to the amount of dye or probe bound to the test sample at DO is indicative of the proliferation rate of the cells.
  • the dye or probe may, for example, be fluorescent.
  • the probe or dye may be carboxyfluorescein diacetate, succinimidyl ester (CFSE) .
  • the test sample of leukemic cells may be stained with an amine-reactive cell permeable dye or probe the day before initiating the culture (D-l) .
  • the mean fluorescence intensity (FI) of the bound amino-reactive dye or probe may then be determined on the day culture is initiated (DO) .
  • the MFI of a control sample e.g. fluorescent beads, may also be determined at DO for normalisation and calibration purposes.
  • the test sample of leukemic cells may then be cultured in vitro for at least 7 days.
  • the MFI of the amino-reactive dye or probe bound to the test sample may then be determined (e.g. after 7 days of culture, i.e. at D7) .
  • the MFI of a control sample e.g.
  • FDF the MFI of the test sample at DO normalised to the MFI of the control sample at DO / the MFI of the test sample at D7 normalised to the MFI of the control sample at D7.
  • An FDF of between 1 and 2 indicates that most living leukemic cells have not divided during step (i) .
  • An FDF of >2 indicates that most live leukemic cells have divided at least once during step (i) .
  • Test samples with a viability of ⁇ 30% at D7 and with an FDF of ⁇ 2.56 are predicted to be able to engraft immunodeficient mice, whereas test samples with a viability of ⁇ 30% at D7 and with an FDF of ⁇ 1.7 are predicted to be non-engrafters of immunodeficient mice, with a false discovery rate of 10% respectively.
  • Test samples with a viability of >30% at D7 and with an FDF of ⁇ 2.94 are predicted to be able to engraft immunodeficient mice, whereas test samples with a viability of ⁇ 30% at D7 and with an FDF of ⁇ 1.44 are predicted to be non-engrafters of immunodeficient mice, with a false discovery rate of 5% respectively.
  • Leukemia patients from which test samples predicted to be able to engraft immunodeficient mice are obtained are predicted to have a worse prognosis than leukemia patients from which test samples of LICs predicted to be non-engrafters are obtained. Therefore, if a sample obtained from a leukemia patient has a high
  • this patient is likely to have a worse prognosis (e.g. lower survival rate) than a leukemia patient from which a sample has a lower proliferation rate.
  • a worse prognosis e.g. lower survival rate
  • the invention provides an ex vivo method for determining the ability of a therapeutic agent to reduce the proportion of LICs in a leukemia patient, the method comprising:
  • a decrease in the proportion of LICs and/or L-LTC-ICs in the sample following step (iii) indicates that therapeutic agent is likely to reduce the proportion of LICs when used to treat the patient .
  • the tissue sample may be obtained from a patient with leukemia, such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • leukemia such as acute myeloid leukemia (AML) , myelodysplastic syndrome (MDS) or chronic myeloid leukemia (CML) .
  • the tissue sample may, for example, be a peripheral blood, bone marrow or leukapheresis sample taken from a leukemia patient.
  • the therapeutic agent may be a therapeutic agent, such as a chemotherapeutic agent, known for the treatment of leukemia.
  • the therapeutic agent may be an agent identified in the in vitro screening method of the present invention.
  • This method allows the effectiveness of the therapeutic agent to be monitored more accurately than by measuring bulk tumour shrinkage, which may understate or overstate the LIC injury (see Figures 2 and 3) .
  • CB Human cord bloods
  • UK Royal London Hospitals
  • AML cells were obtained after informed consent at St Bartholomew's Hospital (London, UK). The protocol was approved by the East London Ethical Committee and in accordance with the Declaration of Helsinki. Samples were collected at diagnosis and screened for their ability to engraft in
  • mice Details of the patient samples are listed in Table 3 and sample processing is detailed below.
  • the stromal cell line MS-5 was kindly gifted by Dr John Dick and maintained in IMDM 10% FCS + 2 mM L-glutamine.
  • CB cord bloods
  • Lineage markers expressing cells were depleted using StemSep columns and human progenitor enrichment cocktail (StemCell
  • osteosarcoma cell line SaOS-2 was purchased from German
  • endothelial growth medium-2 EGM-2-MV (Clonetics) in culture dishes coated with type I collagen (from StemCell Technologies) .
  • Feeders were cultured in their respective media and sub-cultured when reaching 80% confluency. Immunophenotyping was performed to determine a unique marker allowing identification of feeder cells in co-culture experiments. Sca-1, CD56 and CD31 were identified as a marker for 100% of MS-5, SaOS-2 and HUVEC respectively. All three antibodies were from BD Pharmingen, Oxford Science Park, UK.
  • feeder cells were plated in type-I collagen coated 96- well, 12-well plates (Corning) or 150 mm culture Dishes (Falcon) and allowed to reach confluency.
  • culture media were removed, wells were washed twice with PBS and fresh Myelocult® LTC medium (from StemCell Technologies) was added.
  • Myelocult® LTC medium from StemCell Technologies
  • HUVEC cells require stimulation by IL1 in order to induce bone marrow endothelial cells (B EC) similar properties for hematopoietic support (Jazwiec et al . , 1998; Schweitzer et al., 1996; Yildirim et al., 2005).
  • HUVEC co-cultures were supplemented with recombinant rhu-ILla/VEGFa (10 and 50 ng/ml respectively) .
  • CB lin or sorted HSC or progenitor cells were seeded at 1,500 cells/cm 2 onto feeders.
  • AML cells were plated at 80 to 200 10 3 cells/cm 2 .
  • Short-Term i.e. 3-7 days
  • Long-Term Culture i.e. 1 to 12 weeks
  • secondary LTC secondary LTC
  • Co-cultures were performed in bulk culture or limiting dilution assay (LDA) on MS-5 confluent monolayer supplemented as indicated with recombinant human-IL3/G-CSF/TP0, i.e. "3GT” (20 ng/ml each Peprotech London, UK) in MyeloCult H5100 (StemCell Technologies, Vancouver, CA) in absence of Hydroxycortisone .
  • Cells were cultured at 37 °C in 5% C0 2 humidified incubators at 20% or 3% 0 2 conditions. Low oxygen cultures were performed in a two-gas HERAcell® incubator.
  • Cytosine ⁇ -D-arabinofuranoside (Ara-C, Sigma-Aldrich) treatment CB lin- or AML cells were pre-incubated in co-culture 72h prior to addition of 3 ⁇ final of Ara-C. Ara- C treatment occurs for 7 days. In some experiments, co-cultures were washed after treatment 4 times with PBS, fresh MyeloCult H5100 medium was added and co-culture were maintained for 2 additional weeks.
  • LTC-LDA and secondary LTC-LDA cells were plated in 20 replicates in 96 well microplates containing confluent S-5 monolayer. After 5 weeks LTC, medium was replaced by methylcellulose H4435 (Stem Cell Technologies) .
  • LTC-IC LTC Initiating Cells
  • FACS analysis was performed on BD LSRII flow cytometer or BD Biosciences FACS Aria 4 laser cytometers . Subsequent analysis was performed with FlowJo software (Tree Star, Oten,
  • hematopoietic cells were stained with anti-CD45-APC-Cy7, anti- CD34-Percp, anti-CD38-PE-Cy7 antibodies, and Lin-FITC (or CFSE or carboxy-H2DFFDA) as well as with AlexaFluor647-conjugated-
  • Annexin-V Invitrogen
  • DAPI 4,6 diamidino-2-phenylindole
  • All antibodies were obtained from BD Biosciences, UK. Only viable (DAPI and Annexin-V negatives) human hematopoietic cells (CD45-APC-Cy7 positive and Sca-l-PE negative) were assessed and/or sorted for all analysis.
  • CB HSC and progenitors frequency were quantified through Lin D34 + CD38 ⁇ and Lin " CD34 + CD38 + phenotype respectively.
  • LIC and non-LIC phenotype were first pre-established through xenograft
  • RT Reverse transcription
  • Sensiscript Qiagen kit according to the manufacturer's instructions.
  • Q-PCR quantitative real-time polymerase chain reaction
  • the primers used in this study were: CDKN2A (pi 6) F: 5'- GAAGGTCCCTCAGACATCCC-3 ' R: 5' -CCCTGTAGGACCTTCGGTGA-3 ' and GAPDH F: 5' -GGGAAGGTGAAGGTCGGAGT-3 ' R: 5 ' -GGGTCATTGATGGCAACAATA-3 ' .
  • DNA was extracted from co-cultures recovered content using a QIAamp DNA mini kit (Qiagen) according to the manufacturer's instructions.
  • Real time quantitative analysis of NPM exon 12 mutations was done using following gene-specific primers: common forward primer: 5 ' GTGTTGTGGTTCCTTAACCACAT3 ' Reverse primer for total NPM1: 5' CTGTTACAGAAATGAAATAAGACGGAAA 3' Reverse primer for NPM1 mutation type 1 (TCTG) : 5' TCCTCCACTGCCAGACAGAG 3' and Reverse primer for NPMl mutation type 4 (CTTG) : 5' TCCTCCACTGCCAAGCAGAG 3' . All samples were tested in triplicate.
  • Standard curves for total NPM and NPM mutated were established by amplifying a 10-fold serial dilution of uncultured sample genomic DNA. A standard curve was created with each run. MS-5 DNA alone was negative or below log -4 level for NPM1 total primers or NPM1 mutation type 1 and 4. Thus the percentage of mutated NPM was determined by dividing the value for NPM mutation by the total NPM value. Percentages greater than 100% were treated as 100%.
  • AML cell lines HEL, HL60, KG1 and MS-5 feeders were seeded in 96- well plates at an initial concentration of 1 * lOVmL for AML cells and 1 ⁇ lOVcm 2 for MS-5, at a final volume of 200 pL/well, and were exposed to varying concentrations of Ara-C.
  • Cytotoxicity was assessed using the XTT Cell Proliferation Kit II (Roche Applied Science) after 72 h of drug (or control) exposure. 50 ⁇ i of XTT solution were added. After 2-h incubation at 37°C, absorbance at 490 nm was measured using a microplate reader (DYNEX Technologies, Inc.) . The IC50 values were computed using CalcuSyn software (Biosoft) .
  • NOD/SCID/ ⁇ 2-microglobulin null (NOD/SCID- 2 nf'' " ) and NOD/SCID/interleukin-2 receptor ⁇ -chain null (NSG) mice were originally obtained from Dr Leonard Schultz (Jackson Laboratory, Bar Harbor, ME, USA) and bred at Charles Rivers Laboratories (Margate, United Kingdom) . Mice were irradiated at 375 cGy ( 13, Cs source) 24 hours before xenograft. Xenografts were performed via intra-tibial injection due to previous reports on HSC homing defect described after in vitro manipulation (Szilvassy et al., 2001).
  • MS-5 were eliminated by cell sorting prior to xenograft. Animals were sacrificed at 12 weeks and bone marrow cells were collected from the injected bone and contralateral non-injected long bones separately.
  • cell doses of 10 2 to 10 7 cells from 8 primary AML samples from were injected into at least 3 NOD/SCID- 2 nf x ⁇ mice per dose.
  • a mouse was scored as engrafted if a distinct human CD45 + and murine CD45 ⁇ population was detectable in the contralateral bone marrow.
  • AML engraftment was defined by the presence of a single CD45 + CD33 + CDl9 " population.
  • mice were injected intravenously with 7.10 s primary AML samples #6 cells. After demonstrating AML engraftment at 11- weeks through tibial bone marrow aspiration, mice were treated with cytosine arabinoside (Ara-C) given IP daily for 7 days at lOmg/kg daily. 6 hours after last injection, mice were
  • femurs, tibias, and pelvis were dissected and flushed with PBS. Red blood cells were lysed via ammonium chloride. Cells were stained with human- specific FITC-conjugated anti-CD19, PE-conjugated anti-CD33, APC- Cy7-conjugated anti-CD45 and PERCP-conj ugated anti-murine CD45 antibodies. Dead cells and debris were excluded via DAPI staining. A BD LSR II flow cytometer was used for analysis.
  • Engraftment of AML was said to be present if a single population of mCD45-CD45+CD33+CDl9- cells was present without accompanying mCD45-CD45+CD33-CD19+cells .
  • mesenchymal related MS-5, osteoblast-derived SaOS-2 and endothelial HUVEC cell lines were first compared for their ability to support umbilical cord blood- derived HSCs/progenitors .
  • LTC long-term culture
  • CFC colony forming cell
  • MS-5 was again the most efficient co-culture feeder layer for maintaining secondary LTC-IC, resulting in the highest total number of secondary LTC-IC ( Figure 4C) .
  • CB lin cells were cultured for 5 weeks with MS-5+3GT at 3% or 20% 0 2 . Phenotypic analysis shows a 3.7 ⁇ 1.46 fold increase in the frequency of HSC cells at 3% 0 2 compared to 20% 0 2 (p ⁇ 0.05), whereas no difference was observed in the frequency of progenitors cells at 5 weeks ( Figure 5A) .
  • CB lin cells cultured at 3% 0 2 expanded 18.7-fold less ( Figure 5B) and derived 261 times fewer colonies, compared to 20% 0 2 ( Figure 5C and Table 1, p ⁇ 0.01). Moreover, a >90-fold reduction of primary LTC-ICs was observed at 3% 0 2 compared to 20% 0 2 ( Figure 5D and Table 1, p ⁇ 0.0001). To determine whether the dramatic reduction of CFC at 3% 0 2 represented HSC
  • AML is a heterogeneous disease and we first aimed to identify the co-culture system allowing the best viability of a wide number of samples. Between 38 to 57 AML samples were compared for their viability after being co-cultured for one week with MS-5, SaOS-2 or HUVEC cells without cytokine supplements. We observed a highly variable level of viability, ranging from 3.23% to 96.4%, and thus a comparable mean viability across the three systems (data not shown) . However, in a cross comparison analysis per sample, we observed that MS-5 cells were the most supportive co- culture system (Figure 7, Al-3, MS-5>SaOS-2>HUVEC, p ⁇ 0.05 and p ⁇ 0.0001 respectively, in a paired t-test) .
  • Figure 8A We determined for three AML samples the total primary and secondary leukemic LTC-IC yielded at week-3 in both oxygen concentrations. In conventional 20% 0 2 co-culture, secondary LTC-IC were found either to decrease, maintain or increase compared to the input number for samples #6, #2 and #3 respectively ( Figure 8B) . Low oxygen co-culture system was only found beneficial for sample #2 in term of total LTC-IC number whereas no impact was observed for samples #6 and #3.
  • Chemoresistant LICs can be studied in vitro
  • Cytarabine (Ara- C) was used at a concentration >25 times higher than the IC 50 dose determined after 3 days for three leukemic cell lines
  • LTC-ICs were enriched in the group cultured at 3% 0 2 as compared to 20% 0 2 ( Figure 10B, 34 and 3 times more secondary LTC-IC per cells re-plated at 3% than at 20% 0 2 for sample #6 and #2, p ⁇ 0.0001 and p ⁇ 0.01, respectively). More importantly, low oxygen chemo-protective impact was also observed when looking at the total yield of secondary LTC for these two samples: 32 and 3 times more secondary LTC-IC were recovered in 3% 0 2 cultures ( Figure IOC, p ⁇ 0.01and p ⁇ 0.05, for sample #6 and #2,
  • Ara-C treatment at a concentration of 3 ⁇ for 1 week was very effective at killing the tumor burden (Figure 11A and 9B1) .
  • the residual viable cells were selected for a population with a low division profile history (data not shown) .
  • LICs are reported to be quiescent (Guan et al., 2003)
  • the phenotype appeared globally unchanged despite the drastic impact of the Ara-C treatment at the cell number level (data not shown) .
  • E and thirteen NE were co-cultured for 5-weeks with MS- 5+3GT in bulk culture or in LDA.
  • AML immunodeficient mice engrafter samples (E) yielded a higher number of output cells and were enriched in L-LTC-IC as compared to non-engrafter samples (NE) (p ⁇ 0.05).
  • NE non-engrafter samples
  • AML cells were thawed and contaminating T lymphocyte CD3+ cells were depleted using cell sorting or the immunomagnetic depletion method.
  • AML cells were stained with 0.8 ⁇ of the amine-reactive cell permeable dye carboxyfluorescein diacetate, succinimidyl ester (CFSE) (Invitrogen, UK) for 10 min at 37 °C in PBS.
  • Cells were washed twice and incubated for 18h (overnight) in serum-free expansion medium StemSpan® SFEM (StemCell Technologies) in the absence of cytokines to allow unbound CFSE molecules to be released (Nordon et al .
  • CFSE-stained leukemic cells were incubated on an MS-5 confluent monolayer at D-l in MyeloCult H5100 (StemCell Technologies, Vancouver, CA) in the absence of cytokine and hydroxycortisone for 18h.
  • the cell subpopulation within the leukemic sample may be purified using methods known to one skilled in the art, such as fluorescence-activated cell sorting (FACS) technology according to cells surface antigen markers.
  • FACS fluorescence-activated cell sorting
  • Recovered cells were re-suspended and stained in Annexin binding buffer (BD Biosciences) .
  • Human leukemic cells were stained with anti-CD45- APC-Cy7, anti-CD34-Percp, anti-CD38-PE-Cy7 antibodies, and
  • MS-5 stromal cells were stained with Sca-l-PE (Sca-1 was identified as a specific marker of 100% of MS-5). All antibodies were obtained from BD Biosciences, UK. Fluorescent beads were also used for determining the precise cell count of leukemic viable cells. Stained cells were analyzed by FACS at DO. The direct use of an amino-reactive fluorescent probe for tracking AML cell division is complicated due to the lower cell viability and expansion after 1 week (see Figure 13) . Only viable (DAPI and Annexin-V negatives) were assessed for all analysis. This is because probe fluorescence intensity is over- estimated due to apoptosis (see Figure 14).
  • the starting bounded amino-reactive probe Mean Fluorescence Intensity (DO Leukemic CFSE MFI) was determined for leukemic viable cells (DAPI and Annexin-V negatives, CD45-APC-Cy7 positive and Sca-l-PE negative cells) .
  • the MFI of the fluorescent beads (DO beads MFI) was also determined for normalisation and calibration purpose.
  • a narrow CFSE gate may be applied for sorting live subpopulation for example, CB lin- CD34+CD381ow/neg and CD34+CD38+ and CD34-CD38+ and CD34-CD38- cells may be purified by FACS to obtain a very tight homogenous CFSE staining.
  • Non-adherent cells were harvested through 3 gentle washes and adherent cells through trypsinisation at D7. Recovered cells were re-suspended and stained in Annexin binding buffer (BD Biosciences) . Human leukemic cells were stained with anti-CD45- APC-Cy7, anti-CD34-Percp, anti-CD38-PE-Cy7 antibodies, and
  • D7 Leukemic CFSE MFI The MFI of bound amino-reactive probe at D7 was determined for leukemic viable cells (DAPI and Annexin-V negatives, CD45-APC-Cy7 positive and Sca-l-PE negative cells) .
  • the MFI of fluorescent beads at D7 was also determined for normalisation and calibration purposes .
  • FDF Fluorescence dilution factor
  • An FDF between 1 and 2 indicates the most live cells have not divided during 1 week of culture and an FDF>2 indicates that most live cells have divided at least once.
  • Measurement of FDF allows a low-resolution measurement of AML cell proliferation in one week (see Figure 15).
  • Figure 16 shows that NOD/SCID engrafting (E) samples have a higher FDF value than non-engrafting (NE) samples.
  • test samples with a viability of >30% at D7 and with an FDF of >2.56 are predicted to be able to engraft immunodeficient mice, whereas test samples with a viability of ⁇ 30% at D7 and with an FDF of ⁇ 1.7 are predicted to be non-engrafters of immunodeficient mice, with a false discovery rate of 10% respectively.
  • Test samples of AML cells with a viability of >30% at D7 and with an FDF of >2.94 are predicted to be able to engraft immunodeficient mice, whereas test samples with a viability of ⁇ 30% at D7 and with an FDF of ⁇ 1.44 are predicted to be non-engrafters of immunodeficient mice, with a false discovery rate of 5% respectively.
  • Figure 17A shows that the overall survival rate of patients whose AML samples were NOD/SCID engrafting was statistically lower than those whose AML samples were non-engrafting.
  • Figure 17B shows that the overall survival rate of patients whose AML samples had a high proliferation rate (FDF>2.23) was significantly lower than those whose AML samples had a low proliferation rate (FDF ⁇ 2.23). Therefore, the proliferation rate of AML cells in vitro may be used to predict the prognosis (e.g. likely survival rate) of leukemia patients.
  • LICs are not enriched by Ara-C treatment either in vitro or in vivo. This indicates for the first time that not all LICs are chemoresistant . For one sample we could actually correlate the in vitro anti-neoplastic treatment to an in vivo conditioning as well as the subsequent read-out comparing in vitro replating assay to the xenograft assay.
  • Murine stromal cells counteract the loss of long-term culture-initiating cell potential induced by cytokines in CD34 (+) CD38 (low/neg) human bone marrow cells. Blood. 94:529-538.
  • Osteoblasts increase proliferation and release of pro-angiogenic interleukin 8 by native human acute myelogenous leukemia blasts. Haematologica . 89:391- 402.
  • Cicuttini F.M., M. Martin, E. Salvaris, L. Ashman, C.G. Begley,
  • a stromal cell line from myeloid long-term bone marrow cultures can support
  • MDR1 multidrug resistance
  • CAM- DR Cell adhesion mediated drug resistance
  • VEGF endothelial growth factor
  • Nuclear factor-kappaB is constitutively activated in primitive human acute myelogenous leukemia cells. Blood. 98:2301- 2307.
  • a murine stromal cell line allows the proliferation of very primitive human CD34++/CD38- progenitor cells in long-term cultures and semisolid assays. Blood. 81:2916-2924.
  • hematopoiesis is differentially altered by IL-1 and glucocorticoids.
  • Hematopoietic stem cell repopulating ability can be maintained in vitro by some primary endothelial cells. Exp Hematol. 32:1226-1237.
  • Pessina A., E. Mineo, M.G. Neri, L. Gribaldo, R. Colombi, P.
  • microvascular endothelial cells support long-term
  • osteoblasts support human hematopoietic progenitor cells in vitro bone marrow cultures. Blood. 87:518-524.
  • osteosarcomas inhibit hematopoietic colony formation
  • FoxOs are critical mediators of hematopoietic stem cell resistance to
  • stromal cell line SPY3-2 maintains long-term hematopoiesis in vitro. Blood. 85:3107-3116.
  • Vanheusden K.
  • S. Van Coppernolle M. De Smedt
  • J. Plum and B.
  • HIFlalpha eliminates cancer stem cells in hematological malignancies.
  • endothelial cells (HUVEC) is superior to cytokine- supplemented liquid culture. Bone Marrow Transplant. 36:71- 79.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne la culture in vitro et ex vivo de cellules initiatrices de leucémie (LIC). Celle-ci a une utilité dans différentes applications, telles que le criblage d'agents candidats pour traiter une leucémie, l'identification des patients leucémiques susceptibles de répondre à un agent candidat pour traiter une leucémie, la surveillance d'un patient leucémique pour détecter une pharmacorésistance, par exemple, une chimiorésistance, à un agent, la prédiction du pronostic d'un patient leucémique et la détermination de la capacité d'un agent thérapeutique à réduire la proportion de LIC chez un patient leucémique.
PCT/GB2014/050424 2013-02-27 2014-02-13 Culture de cellules initiatrices de leucémie WO2014132032A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1303491.3 2013-02-27
GBGB1303491.3A GB201303491D0 (en) 2013-02-27 2013-02-27 Culture of leukemia initiating cells

Publications (1)

Publication Number Publication Date
WO2014132032A1 true WO2014132032A1 (fr) 2014-09-04

Family

ID=48092193

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2014/050424 WO2014132032A1 (fr) 2013-02-27 2014-02-13 Culture de cellules initiatrices de leucémie

Country Status (2)

Country Link
GB (1) GB201303491D0 (fr)
WO (1) WO2014132032A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016201077A1 (fr) * 2015-06-12 2016-12-15 Emory University Compositions de croissance et de survie pour des cellules capables de produire des anticorps et procédés associés
WO2017070353A1 (fr) * 2015-10-20 2017-04-27 Celcuity Llc Procédés de préparation d'un échantillon cellulaire primaire
WO2019214058A1 (fr) * 2018-05-11 2019-11-14 南京先声医学检验有限公司 Amorce, combinaison d'amorces, kit et application d'amorce
WO2020068615A1 (fr) * 2018-09-24 2020-04-02 Albert Einstein College Of Medicine Interleukine-8 pour entretien d'une culture de cellules de leucémie myéloïde aiguë humaine et du syndrome myélodysplasique et leurs utilisations
WO2020229300A1 (fr) 2019-05-10 2020-11-19 Griessinger Emmanuel Méthode de mesure et de ciblage du métabolisme dependant de la phosphorylation oxydative
US11125757B2 (en) 2017-05-26 2021-09-21 Emory University Methods of culturing and characterizing antibody secreting cells

Non-Patent Citations (111)

* Cited by examiner, † Cited by third party
Title
"High Throughput Leukaemia initiating cell assay", CRT COLLABORATION OPPORTUNITY, ENABLING TECHNOLOGY, CANCER RESEARCH TECHNOLOGY, 1 October 2013 (2013-10-01), XP055119805, Retrieved from the Internet <URL:http://www.cancertechnology.co.uk/sites/default/files/CRT_LIC Assay_October 2013.pdf> [retrieved on 20140523] *
A BENNACEUR-GRISCELLI ET AL: "Murine stromal cells counteract the loss of long-term culture-initiating cell potential induced by cytokines in CD34(+)CD38(low/neg) human bone marrow cells", BLOOD, 15 July 1999 (1999-07-15), UNITED STATES, pages 529, XP055120278, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/10397720> [retrieved on 20140526] *
AILLES, L.E.; B. GERHARD; D.E. HOGGE: "Detection and characterization of primitive malignant and normal progenitors in patients with acute myelogenous leukemia using long-term coculture with supportive feeder layers and cytokines", BLOOD, vol. 90, 1997, pages 2555 - 2564
AMSELLEM, S.; F. PFLUMIO; D. BARDINET; B. IZAC; P. CHARNEAU; P.H. ROMEO; A. DUBART-KUPPERSCHMITT; S. FICHELSON: "Ex vivo expansion of human hematopoietic stem cells by direct delivery of the HOXB4 homeoprotein", NAT MED., vol. 9, 2003, pages 1423 - 1427, XP003016543, DOI: doi:10.1038/nm953
ANJOS-AFONSO, F.; D. BONNET: "Curr Protoc Stem Cell Biol.", 2008, article "Isolation, culture, and differentiation potential of mouse marrow stromal cells"
ARDESHNA, K.M.; P. SMITH; A. NORTON; B.W. HANCOCK; P.J. HOSKIN; K.A. MACLENNAN; R.E. MARCUS; A. JELLIFFE; G. VAUGHAN, HUDSON; D.C.: "Long-term effect of a watch and wait policy versus immediate systemic treatment for asymptomatic advanced-stage non-Hodgkin lymphoma: a randomised controlled trial", LANCET, vol. 362, 2003, pages 516 - 522, XP004783747, DOI: doi:10.1016/S0140-6736(03)14110-4
BENNACEUR-GRISCELLI, A.; C. TOURINO; B. IZAC; W. VAINCHENKER; L. COULOMBEL: "Murine stromal cells counteract the loss of long-term culture-initiating cell potential induced by cytokines in CD34(+)CD38(low/neg) human bone marrow cells", BLOOD, vol. 94, 1999, pages 529 - 538
BOB LÖWENBERG ET AL: "Autonomous proliferation of leukemic cells in vitro as a determinant of prognosis in adult acute myeloid leukemia", THE NEW ENGLAND JOURNAL OF MEDICINE, VOL. 328, 4 March 1993 (1993-03-04), pages 614 - 619, XP055120298, Retrieved from the Internet <URL:http://www.nejm.org/doi/pdf/10.1056/NEJM199303043280904> [retrieved on 20140527] *
BONNET, D.: "Curr Protoc Stem Cell Biol.", 2008, article "In vivo evaluation of leukemic stem cells through the xenotransplantation model"
BONNET, D.: "Humanized model to study leukemic stem cells", METHODS MOL BIOL., vol. 538, 2009, pages 247 - 262
BONNET, D.: "Humanized mouse models to study the human haematopoietic stem cell compartment", METHODS MOL BIOL., vol. 506, 2009, pages 331 - 340
BONNET, D.; J.E. DICK: "Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell", NAT MED., vol. 3, 1997, pages 730 - 737, XP009065505, DOI: doi:10.1038/nm0797-730
BRUSERUD, 0.; A. RYNINGEN; L. WERGELAND; N.I. GLENJEN; B.T. GJERTSEN: "Osteoblasts increase proliferation and release of pro-angiogenic interleukin 8 by native human acute myelogenous leukemia blasts", HAEMATOLOGICA, vol. 89, 2004, pages 391 - 402
CAIROLI, R.; A. BEGHINI; G. GRILLO; G. NADALI; F. ELICE; C.B. RIPAMONTI; P. COLAPIETRO; M. NICHELATTI; L. PEZZETTI; M. LUNGHI: "Prognostic impact of c-KIT mutations in core binding factor leukemias: an Italian retrospective study", BLOOD, vol. 107, 2006, pages 3463 - 3468
CALVI, L.M.; G.B. ADAMS; K.W. WEIBRECHT; J.M. WEBER; D.P. OLSON; M.C. KNIGHT; R.P. MARTIN; E. SCHIPANI; P. DIVIETI; F.R. BRINGHURS: "osteoblastic cells regulate the haematopoietic stem cell niche", NATURE, vol. 425, 2003, pages 841 - 846, XP002389181, DOI: doi:10.1038/nature02040
CELEBI, B.; D. MANTOVANI; N. PINEAULT: "Effects of extracellular matrix proteins on the growth of haematopoietic progenitor cells", BIOMED MATER., vol. 6, 2011, pages 055011
CHAN, N.; M. KORITZINSKY; H. ZHAO; R. BINDRA; P.M. GLAZER; S. POWELL; A. BELMAAZA; B. WOUTERS; R.G. BRISTOW: "Chronic hypoxia decreases synthesis of homologous recombination proteins to offset chemoresistance and radioresistance", CANCER RES., vol. 68, 2008, pages 605 - 614
CHEONG, J.W.; J.I. EOM; H.Y. MAENG; S.T. LEE; J.S. HAHN; Y.W. KO; Y.H. MIN: "Phosphatase and tensin homologue phosphorylation in the C-terminal regulatory domain is frequently observed in acute myeloid leukaemia and associated with poor clinical outcome", BR J HAEMATOL., vol. 122, 2003, pages 454 - 456
CHUNG, Y.J.; C.W. CHOI; C. SLAPE; T. FRY; P.D. APLAN: "Transplantation of a myelodysplastic syndrome by a long- term repopulating hematopoietic cell", PROC NATL ACAD SCI U S A., vol. 105, 2008, pages 14088 - 14093
CICUTTINI, F.M.; M. MARTIN; E. SALVARIS; L. ASHMAN; C.G. BEGLEY; J. NOVOTNY; D. MAHER; A.W. BOYD: "Support of human cord blood progenitor cells on human stromal cell lines transformed by SV40 large T antigen under the influence of an inducible (metallothionein) promoter", BLOOD, vol. 80, 1992, pages 102 - 112, XP001345288
CIPOLLESCHI, M.G.; P. DELLO SBARBA; M. OLIVOTTO: "The role of hypoxia in the maintenance of hematopoietic stem cells", BLOOD, vol. 82, 1993, pages 2031 - 2037, XP007908065
COLLINS, L.S.; K. DORSHKIND: "A stromal cell line from myeloid long-term bone marrow cultures can support myelopoiesis and B lymphopoiesis", J IMMUNOL., vol. 138, 1987, pages 1082 - 1087
COMERFORD, K.M.; T.J. WALLACE; J. KARHAUSEN; N.A. LOUIS; M.C. MONTALTO; S.P. COLGAN: "Hypoxia-inducible factor-1-dependent regulation of the multidrug resistance (MDR1) gene", CANCER RES., vol. 62, 2002, pages 3387 - 3394, XP002219186
DAMIANO, J.S.; A.E. CRESS; L.A. HAZLEHURST; A.A. SHTIL; W.S. DALTON: "Cell adhesion mediated drug resistance (CAM-DR): role of integrins and resistance to apoptosis in human myeloma cell lines", BLOOD, vol. 93, 1999, pages 1658 - 1667
DANET, G.H.; Y. PAN; J.L. LUONGO; D.A. BONNET; M.C. SIMON: "Expansion of human SCID-repopulating cells under hypoxic conditions", J CLIN INVEST., vol. 112, 2003, pages 126 - 135, XP002427321, DOI: doi:10.1172/JCI200317669
DAO, M.A.; M.H. CREER; J.A. NOLTA; C.M. VERFAILLIE: "Biology of umbilical cord blood progenitors in bone marrow niches", BLOOD, vol. 110, 2007, pages 74 - 81
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; November 2011 (2011-11-01), NG KING-PAN ET AL: "Physiologic Hypoxia Promotes Maintenance of CML Stem Cells Despite Effective BCR-ABL Inhibition", XP055120308, Database accession no. PREV201200217735 *
DIAS, S.; M. CHOY; K. ALITALO; S. RAFII.: "Vascular endothelial growth factor (VEGF)-C signaling through FLT-4 (VEGFR-3) mediates leukemic cell proliferation, survival, and resistance to chemotherapy", BLOOD, vol. 99, 2002, pages 2179 - 2184, XP002318502, DOI: doi:10.1182/blood.V99.6.2179
DURIE, B.G.; J. JACOBSON; B. BARLOGIE; J. CROWLEY: "Magnitude of response with myeloma frontline therapy does not predict outcome: importance of time to progression in southwest oncology group chemotherapy trials", J CLIN ONCOL., vol. 22, 2004, pages 1857 - 1863
ERLER, J.T.; C.J. CAWTHORNE; K.J. WILLIAMS; M. KORITZINSKY; B.G. WOUTERS; C. WILSON; C. MILLER; C. DEMONACOS; I.J. STRATFORD; C. D: "Hypoxia-mediated downregulation of Bid and Bax in tumors occurs via hypoxia-inducible factor 1-dependent and -independent mechanisms and contributes to drug resistance", MOL CELL BIOL., vol. 24, 2004, pages 2875 - 2889
FIEGL, M.; I. SAMUDIO; K. CLISE-DWYER; J.K. BURKS; Z. MNJOYAN; M. ANDREEFF: "CXCR4 expression and biologic activity in acute myeloid leukemia are dependent on oxygen partial pressure", BLOOD, vol. 113, 2009, pages 1504 - 1512
FIEGL, M.; I. SAMUDIO; Z. MNJOYAN; B. KORCHIN; H. FRITSCHE; M. ANDREEFF: "Physiological hypoxia promotes lipid raft and PI3K-dependent activation of MAPK 42/44 in leukemia cells", LEUKEMIA, vol. 24, 2010, pages 1364 - 1367
FOGH, J.; J.M. FOGH; T. ORFEO: "One hundred and twenty- seven cultured human tumor cell lines producing tumors in nude mice", J NATJ CANCER INST., vol. 59, 1977, pages 221 - 226
GILLETTE, J.M.; A. LAROCHELLE; C.E. DUNBAR; J. LIPPINCOTT-SCHWARTZ: "Intercellular transfer to signalling endosomes regulates an ex vivo bone marrow niche", NAT CELL BIOL., vol. 11, 2009, pages 303 - 311
GLENJEN, N.I.; K. HATFIELD; 0. BRUSERUD: "Coculture of native human acute myelogenous leukemia blasts with fibroblasts and osteoblasts results in an increase of vascular endothelial growth factor levels", EUR J HAEMATOL., vol. 74, 2005, pages 24 - 34
GOARDON, N.; E. MARCHI; A. ATZBERGER; L. QUEK; A. SCHUH; S. SONEJI; P. WOLL; A. MEAD; K.A. ALFORD; R. ROUT: "Coexistence of LMPP-like and GMP-like leukemia stem cells in acute myeloid leukemia", CANCER CELL., vol. 19, 2011, pages 138 - 152, XP002672216, DOI: doi:10.1016/J.CCR.2010.12.012
GRIMWADE, D.; R.K. HILLS; A.V. MOORMAN; H. WALKER; S. CHATTERS; A.H. GOLDSTONE; K. WHEATLEY; C.J. HARRISON; A.K. BURNETT: "Refinement of cytogenetic classification in acute myeloid leukemia: determination of prognostic significance of rare recurring chromosomal abnormalities among 5876 younger adult patients treated in the United Kingdom Medical Research Council trials", BLOOD, vol. 116, 2010, pages 354 - 365
GUAN, Y.; B. GERHARD; D.E. HOGGE: "Detection, isolation, and stimulation of quiescent primitive leukemic progenitor cells from patients with acute myeloid leukemia (AML", BLOOD, vol. 101, 2003, pages 3142 - 3149
GUZMAN, M.L.; C.F. SWIDERSKI; D.S. HOWARD; B.A. GRIMES; R.M. ROSSI; S.J. SZILVASSY; C.T. JORDAN: "Preferential induction of apoptosis for primary human leukemic stem cells", PROC NATL ACAD SCI USA., vol. 99, 2002, pages 16220 - 16225
GUZMAN, M.L.; S.J. NEERING; D. UPCHURCH; B. GRIMES; D.S. HOWARD; D.A. RIZZIERI; S.M. LUGER; C.T. JORDAN: "Nuclear factor-kappaB is constitutively activated in primitive human acute myelogenous leukemia cells", BLOOD, vol. 98, 2001, pages 2301 - 2307
HAMMOUD, M.; M. VLASKI; P. DUCHEZ; J. CHEVALEYRE; X. LAFARGE; J.M. BOIRON; P.B. DE LA GRANGE; Z. IVANOVIC: "Combination of low 0(2) concentration and mesenchymal stromal cells during culture of cord blood CD34(+) cells improves the maintenance and proliferative capacity of hematopoietic stem cells", J CELL PHYSIOL., 2011
HARDY, R.R.; T. KISHIMOTO; K. HAYAKAWA: "Differentiation of B cell progenitors in vitro: generation of surface IgM+ B cells, including Ly-1 B cells, from Thy-1- asialoGMl+ cells in newborn liver", EUR J IMMUNOL., vol. 17, 1987, pages 1769 - 1774
HARIGAYA, K.; H. HANDA: "Generation of functional clonal cell lines from human bone marrow stroma", PROC NATL ACAD SCI U S A., vol. 82, 1985, pages 3477 - 3480
HERMITTE, F.; P. BRUNET DE LA GRANGE; F. BELLOC; V. PRALORAN; Z. IVANOVIC: "Very low 02 concentration (0.1%) favors GO return of dividing CD34+ cells", STEM CELLS., vol. 24, 2006, pages 65 - 73, XP002615117, DOI: doi:10.1634/STEMCELLS.2004-0351
HOLYOAKE, T.; X. JIANG; C. EAVES; A. EAVES: "Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia", BLOOD, vol. 94, 1999, pages 2056 - 2064
HOOPER, A.T.; J.M. BUTLER; D.J. NOLAN; A. KRANZ; K. IIDA; M. KOBAYASHI; H.G. KOPP; K. SHIDO; I. PETIT; K. YANGER: "Engraftment and reconstitution of hematopoiesis is dependent on VEGFR2- mediated regeneration of sinusoidal endothelial cells", CELL STEM CELL., vol. 4, 2009, pages 263 - 274, XP055008269, DOI: doi:10.1016/j.stem.2009.01.006
HUFF, C.A.; W. MATSUI; B.D. SMITH; R.J. JONES: "The paradox of response and survival in cancer therapeutics", BLOOD, vol. 107, 2006, pages 431 - 434
ILLMER, T.; C. THIEDE; A. FREDERSDORF; S. STADLER; A. NEUBAUER; G. EHNINGER; M. SCHAICH: "Activation of the RAS pathway is predictive for a chemosensitive phenotype of acute myelogenous leukemia blasts", CLIN CANCER RES., vol. 11, 2005, pages 3217 - 3224
ISSAAD, C.; L. CROISILLE; A. KATZ; W. VAINCHENKER; L. COULOMBEL: "A murine stromal cell line allows the proliferation of very primitive human CD34++/CD38- progenitor cells in long-term cultures and semisolid assays", BLOOD, vol. 81, 1993, pages 2916 - 2924, XP000574186
ITO, K.; A. HIRAO; F. ARAI; S. MATSUOKA; K. TAKUBO; I. HAMAGUCHI; K. NOMIYAMA; K. HOSOKAWA; K. SAKURADA; N. NAKAGATA: "Regulation of oxidative stress by ATM is required for self-renewal of haematopoietic stem cells", NATURE, vol. 431, 2004, pages 997 - 1002, XP002992010, DOI: doi:10.1038/nature02989
ITOH, K.; H. TEZUKA; H. SAKODA; M. KONNO; K. NAGATA; T. UCHIYAMA; H. UCHINO; K.J. MORI: "Reproducible establishment of hemopoietic supportive stromal cell lines from murine bone marrow", EXP HEMATOL., vol. 17, 1989, pages 145 - 153
JAZWIEC, B.; A. SOLANILLA; C. GROSSET; F.X. MAHON; M. DUPOUY; V. PIGEONNIER-LAGARDE; F. BELLOC; K. SCHWEITZER; J. REIFFERS; J. RIP: "Endothelial cell support of hematopoiesis is differentially altered by IL-1 and glucocorticoids", LEUKEMIA, vol. 12, 1998, pages 1210 - 1220, XP003004053, DOI: doi:10.1038/sj.leu.2401086
JULIANA BENITO ET AL: "Pronounced Hypoxia in Models of Murine and Human Leukemia: High Efficacy of Hypoxia-Activated Prodrug PR-104", PLOS ONE, vol. 6, no. 8, 11 August 2011 (2011-08-11), pages e23108, XP055119815, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0023108 *
JULIANA M BENITO ET AL: "Leukemia Microenvironment and Pathologic Hypoxia: Sensitivity to Hypoxia-activated cytotoxin TH-302", 31 December 2012 (2012-12-31), XP055119833, Retrieved from the Internet <URL:http://www.thresholdpharm.com/pdf/Benitoetal-ASH2012-TH-302inpreclinicalleukemia.pdf> [retrieved on 20140523] *
K. P. NG ET AL: "Physiologic hypoxia promotes maintenance of CML stem cells despite effective BCR-ABL1 inhibition", BLOOD, vol. 123, no. 21, 4 April 2014 (2014-04-04), pages 3316 - 3326, XP055120323, ISSN: 0006-4971, DOI: 10.1182/blood-2013-07-511907 *
KIEL, M.J.; O.H. YILMAZ; T. IWASHITA; C. TERHORST; S.J. MORRISON: "SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells", CELL, vol. 121, 2005, pages 1109 - 1121
KODAMA, H.; M. NOSE; S. NIIDA; S. NISHIKAWA: "Involvement of the c-kit receptor in the adhesion of hematopoietic stem cells to stromal cells", EXP HEMATOL., vol. 22, 1994, pages 979 - 984
KODAMA, H.A.; Y. AMAGAI; H. KOYAMA; S. KASAI: "A new preadipose cell line derived from newborn mouse calvaria can promote the proliferation of pluripotent hemopoietic stem cells in vitro", J CELL PHYSIOL., vol. 112, 1982, pages 89 - 95
KUBOTA, Y.; K. TAKUBO; T. SUDA: "Bone marrow long label- retaining cells reside in the sinusoidal hypoxic niche", BIOCHEM BIOPHYS RES COMMUN., vol. 366, 2008, pages 335 - 339, XP029162611, DOI: doi:10.1016/j.bbrc.2007.11.086
LAPIDOT, T.; C. SIRARD; J. VORMOOR; B. MURDOCH; T. HOANG; J. CACERES-CORTES; M. MINDEN; B. PATERSON; M.A. CALIGIURI; J.E. DICK: "A cell initiating human acute myeloid leukaemia after transplantation into SCID mice", NATURE, vol. 367, 1994, pages 645 - 648, XP003025767, DOI: doi:10.1038/367645a0
LEISTEN, I.; R. KRAMANN; M.S. VENTURA FERREIRA; M. BOVI; S. NEUSS; P. ZIEGLER; W. WAGNER; R. KNUCHEL; R.K. SCHNEIDER: "3D co-culture of hematopoietic stem and progenitor cells and mesenchymal stem cells in collagen scaffolds as a model of the hematopoietic niche", BIOMATERIALS, vol. 33, 2012, pages 1736 - 1747, XP028341211, DOI: doi:10.1016/j.biomaterials.2011.11.034
LEMOINE, F.M.; R.K. HUMPHRIES; S.D. ABRAHAM; G. KRYSTAL; C.J. EAVES: "Partial characterization of a novel stromal cell-derived pre-B-cell growth factor active on normal and immortalized pre-B cells", EXP HEMATOL., vol. 16, 1988, pages 718 - 726
LI, W.; S.A. JOHNSON; W.C. SHELLEY; M.C. YODER: "Hematopoietic stem cell repopulating ability can be maintained in vitro by some primary endothelial cells", EXP HEMATOL., vol. 32, 2004, pages 1226 - 1237, XP004674872, DOI: doi:10.1016/j.exphem.2004.09.001
LIESVELD, J.L.; J. BECHELLI; K. ROSELL; C. LU; G. BRIDGER; G. PHILLIPS, 2ND; C.N. ABBOUD: "Effects of AMD3100 on transmigration and survival of acute myelogenous leukemia cells", LEUK RES., vol. 31, 2007, pages 1553 - 1563, XP022317113, DOI: doi:10.1016/j.leukres.2007.02.017
LIESVELD, J.L.; K.E. ROSELL; C. LU; J. BECHELLI; G. PHILLIPS; J.E. LANCET; C.N. ABBOUD: "Acute myelogenous leukemia--microenvironment interactions: role of endothelial cells and proteasome inhibition", HEMATOLOGY, vol. 10, 2005, pages 483 - 494
LOWENBERG, B.; J.R. DOWNING; A. BURNETT: "Acute myeloid leukemia", N ENGL J MED., vol. 341, 1999, pages 1051 - 1062
LU, L.S.; S.J. WANG; R. AUERBACH: "In vitro and in vivo differentiation into B cells, T cells, and myeloid cells of primitive yolk sac hematopoietic precursor cells expanded > 100-fold by coculture with a clonal yolk sac endothelial cell line", PROC NATL ACAD SCI U S A., vol. 93, 1996, pages 14782 - 14787, XP000941667, DOI: doi:10.1073/pnas.93.25.14782
MARTELLI, A.M.; P.L. TAZZARI; C. EVANGELISTI; F. CHIARINI; W.L. BLALOCK; A.M. BILLI; L. MANZOLI; J.A. MCCUBREY; L. COCCO: "Targeting the phosphatidylinositol 3- kinase/Akt/mammalian target of rapamycin module for acute myelogenous leukemia therapy: from bench to bedside", CURR MED CHEM., vol. 14, 2007, pages 2009 - 2023
MEADS, M.B.; L.A. HAZLEHURST; W.S. DALTON: "The bone marrow microenvironment as a tumor sanctuary and contributor to drug resistance", CLIN CANCER RES., vol. 14, 2008, pages 2519 - 2526, XP055195865, DOI: doi:10.1158/1078-0432.CCR-07-2223
MENDEZ-FERRER, S.; T.V. MICHURINA; F. FERRARO; A.R. MAZLOOM; B.D. MACARTHUR; S.A. LIRA; D.T. SCADDEN; A. MA'AYAN; G.N. ENIKOLOPOV;: "Mesenchymal and haematopoietic stem cells form a unique bone marrow niche", NATURE, vol. 466, 2010, pages 829 - 834, XP008156278, DOI: doi:10.1038/nature09262
MICHELE TANTURLI ET AL: "Hypoxia Selects Bortezomib-Resistant Stem Cells of Chronic Myeloid Leukemia", PLOS ONE, vol. 6, no. 2, 11 February 2011 (2011-02-11), pages e17008, XP055120155, DOI: 10.1371/journal.pone.0017008 *
MIRANDA, A.F.; G.J. DUIGOU; E. HERNANDEZ; P.B. FISHER: "Characterization of mutant human fibroblast cultures transformed with simian virus 40", J CELL SCI., vol. 89, 1988, pages 481 - 493
MONACO, G.; M. KONOPLEVA; M. MUNSELL; C. LEYSATH; R.Y. WANG; C.E. JACKSON; M. KORBLING; E. ESTEY; J. BELMONT; M. ANDREEFF: "Engraftment of acute myeloid leukemia in NOD/SCID mice is independent of CXCR4 and predicts poor patient survival", STEM CELLS, vol. 22, 2004, pages 188 - 201
NATHAN, D.G.: "On Discovering Drugs", HARVARD MAGAZINE, 2011
NI, K.; H.C. O'NEILL: "Long-term stromal cultures produce dendritic-like cells", BR J HAEMATOL., vol. 97, 1997, pages 710 - 725
NORDON, R.E.; S.S. GINSBERG; C.J. EAVES: "High- resolution cell division tracking demonstrates the FLt3- ligand-dependence of human marrow CD34+CD38- cell production in vitro", BR J HAEMATOL., vol. 98, 1997, pages 528 - 539
OBINATA, M.; R. OKUYAMA; K.I. MATSUDA; M. KOGUMA; N. YANAI: "Regulation of myeloid and lymphoid development of hematopoietic stem cells by bone marrow stromal cells", LEUK LYMPHOMA., vol. 29, 1998, pages 61 - 69
OGATA, M.; H. MATSUBARA; Y. TAKAI; H. KOSAKA; T. KATAGIRI; H. SANO; K. ISHIMURA; H. FUJITA; T. HAMAOKA; H. FUJIWARA: "Capacities of a newly established thymic stromal cell clone to express Ia antigens and to produce interleukin-6, colony-stimulating factor, and thymic stroma-derived T-cell growth factor", J LEUKOC BIOL., vol. 45, 1989, pages 69 - 78
PARMAR, K.; P. MAUCH; J.A. VERGILIO; R. SACKSTEIN; J.D. DOWN: "Distribution of hematopoietic stem cells in the bone marrow according to regional hypoxia", PROC NAT1 ACAD SCI U S A., vol. 104, 2007, pages 5431 - 5436
PAUL, S.R.; Y.C. YANG; R.E. DONAHUE; S. GOLDRING; D.A. WILLIAMS: "Stromal cell-associated hematopoiesis: immortalization and characterization of a primate bone marrow-derived stromal cell line", BLOOD, vol. 77, 1991, pages 1723 - 1733, XP000574283
PEARCE, D.J.; D. TAUSSIG; K. ZIBARA; L.L. SMITH; C.M. RIDLER; C. PREUDHOMME; B.D. YOUNG; A.Z. ROHATINER; T.A. LISTER; D. BONNET: "AML engraftment in the NOD/SCID assay reflects the outcome of AML: implications for our understanding of the heterogeneity of AML", BLOOD, vol. 107, 2006, pages 1166 - 1173
PESSINA, A.; E. MINEO; M.G. NERI; L. GRIBALDO; R. COLOMBI; P. BRAMBILLA; G. ZALESKIS: "Establishment and characterization of a new murine cell line (SR-4987) derived from marrow stromal cells", CYTOTECHNOLOGY, vol. 8, 1992, pages 93 - 102
PLOEMACHER, R.E.; J.P. VAN DER SLUIJS; J.S. VOERMAN; N.H. BRONS: "An in vitro limiting-dilution assay of long-term repopulating hematopoietic stem cells in the mouse", BLOOD, vol. 74, 1989, pages 2755 - 2763
RAFII, S.; F. SHAPIRO; R. PETTENGELL; B. FERRIS; R.L. NACHMAN; M.A. MOORE; A.S. ASCH: "Human bone marrow microvascular endothelial cells support long-term proliferation and differentiation of myeloid and megakaryocytic progenitors", BLOOD, vol. 86, 1995, pages 3353 - 3363, XP002913230
REHN, M.; A. OLSSON; K. RECKZEH; E. DIFFNER; P. CARMELIET; G. LANDBERG; J. CAMMENGA: "Hypoxic induction of vascular endothelial growth factor regulates murine hematopoietic stem cell function in the low-oxygenic niche", BLOOD, 2011
RODAN, S.B.; Y. IMAI; M.A. THIEDE; G. WESOLOWSKI; D. THOMPSON; Z. BAR-SHAVIT; S. SHULL; K. MANN; G.A. RODAN: "Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties", CANCER RES., vol. 47, 1987, pages 4961 - 4966
SARRY, J.E.; K. MURPHY; R. PERRY; P.V. SANCHEZ; A. SECRETO; C. KEEFER; C.R. SWIDER; A.C. STRZELECKI; C. CAVELIER; C. RECHER: "Human acute myelogenous leukemia stem cells are rare and heterogeneous when assayed in NOD/SCID/IL2Rgammac-deficient mice", J CLIN INVEST., vol. 121, 2011, pages 384 - 395
SCHWEITZER, K.M.; A.M. DRAGER; P. VAN DER VALK; S.F. THIJSEN; A. ZEVENBERGEN; A.P. THEIJSMEIJER; C.E. VAN DER SCHOOT; M.M. LANGENH: "Constitutive expression of E-selectin and vascular cell adhesion molecule-1 on endothelial cells of hematopoietic tissues", AM J PATHOL., vol. 148, 1996, pages 165 - 175
SERENA GIUNTOLI ET AL: "Severe Hypoxia Defines Heterogeneity and Selects Highly Immature Progenitors Within Clonal Erythroleukemia Cells", STEM CELLS, vol. 25, no. 5, 1 May 2007 (2007-05-01), pages 1119 - 1125, XP055120168, ISSN: 1066-5099, DOI: 10.1634/stemcells.2006-0637 *
SIMSEK, T.; F. KOCABAS; J. ZHENG; R.J. DEBERARDINIS; A.I. MAHMOUD; E.N. OLSON; J.W. SCHNEIDER; C.C. ZHANG; H.A. SADEK: "The distinct metabolic profile of hematopoietic stem cells reflects their location in a hypoxic niche", CELL STEM CELL, vol. 7, 2010, pages 380 - 390
SINGER, J.W.; P. CHARBORD; A. KEATING; J. NEMUNAITIS; G. RAUGI; T.N. WIGHT; J.A. LOPEZ; G.J. ROTH; L.W. DOW; P.J. FIALKOW: "Simian virus 40-transformed adherent cells from human long-term marrow cultures: cloned cell lines produce cells with stromal and hematopoietic characteristics", BLOOD, vol. 70, 1987, pages 464 - 474
SZILVASSY, S.J.; T.E. MEYERROSE; P.L. RAGLAND; B. GRIMES: "Homing and engraftment defects in ex vivo expanded murine hematopoietic cells are associated with downregulation of betal integrin", EXP HEMATOL., vol. 29, 2001, pages 1494 - 1502
TAICHMAN, R.S.; M.J. REILLY; S.G. EMERSON: "Human osteoblasts support human hematopoietic progenitor cells in vitro bone marrow cultures", BLOOD, vol. 87, 1996, pages 518 - 524, XP002982010
TAICHMAN, R.S.; M.J. REILLY; S.G. EMERSON: "Human osteosarcomas inhibit hematopoietic colony formation: partial reversal by antibody to transforming growth factor- beta 1", BONE, vol. 21, 1997, pages 353 - 361
TAKAHASHI, S.; S.V. REDDY; M. DALLAS; R. DEVLIN; J.Y. CHOU; G.D. ROODMAN: "Development and characterization of a human marrow stromal cell line that enhances osteoclast- like cell formation", ENDOCRINOLOGY, vol. 136, 1995, pages 1441 - 1449, XP000857459, DOI: doi:10.1210/en.136.4.1441
TAKUBO, K.; N. GODA; W. YAMADA; H. IRIUCHISHIMA; E. IKEDA; Y. KUBOTA; H. SHIMA; R.S. JOHNSON; A. HIRAO; M. SUEMATSU: "Regulation of the HIF-lalpha level is essential for hematopoietic stem cells", CELL STEM CELL, vol. 7, 2010, pages 391 - 402
TAUSSIG, D.C.; F. MIRAKI-MOUD; F. ANJOS-AFONSO; D.J. PEARCE; K. ALLEN; C. RIDLER; D. LILLINGTON; H. OAKERVEE; J. CAVENAGH; S.G. AG: "Anti-CD38 antibody-mediated clearance of human repopulating cells masks the heterogeneity of leukemia-initiating cells", BLOOD, vol. 112, 2008, pages 568 - 575
TAUSSIG, D.C.; J. VARGAFTIG; F. MIRAKI-MOUD; E. GRIESSINGER; K. SHARROCK; T. LUKE; D. LILLINGTON; H. OAKERVEE; J. CAVENAGH; S.G. A: "Leukemia-initiating cells from some acute myeloid leukemia patients with mutated nucleophosmin reside in the CD34(-) fraction", BLOOD, vol. 115, 2010, pages 1976 - 1984
THALMEIER, K.; P. MEISSNER; G. REISBACH; M. FALK; A. BRECHTEL; P. DORMER: "Establishment of two permanent human bone marrow stromal cell lines with long-term post irradiation feeder capacity", BLOOD, vol. 83, 1994, pages 1799 - 1807, XP002978175
TOTHOVA, Z.; R. KOLLIPARA; B.J. HUNTLY; B.H. LEE; D.H. CASTRILLON; D.E. CULLEN; E.P. MCDOWELL; S. LAZO-KALLANIAN; I.R. WILLIAMS; C: "FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic oxidative stress", CELL, vol. 128, 2007, pages 325 - 339, XP055203673, DOI: doi:10.1016/j.cell.2007.01.003
TSAI, S.; S.G. EMERSON; C.A. SIEFF; D.G. NATHAN: "Isolation of a human stromal cell strain secreting hemopoietic growth factors", J CELL PHYSIOL., vol. 127, 1986, pages 137 - 145
TSUCHIYAMA, J.; M. MORI; S. OKADA: "Murine spleen stromal cell line SPY3-2 maintains long-term hematopoiesis in vitro", BLOOD, vol. 85, 1995, pages 3107 - 3116
VAN GOSLIGA, D.; H. SCHEPERS; A. RIZO; D. VAN DER KOLK; E. VELLENGA; J.J. SCHURINGA: "Establishing long-term cultures with self-renewing acute myeloid leukemia stem/progenitor cells", EXP HEMATOL., vol. 35, 2007, pages 1538 - 1549, XP022264534, DOI: doi:10.1016/j.exphem.2007.07.001
VANHEUSDEN, K.; S. VAN COPPERNOLLE; M. DE SMEDT; J. PLUM; B. VANDEKERCKHOVE: "In vitro expanded cells contributing to rapid severe combined immunodeficient repopulation activity are CD34+38-33+90+45RA", STEM CELLS., vol. 25, 2007, pages 107 - 114
VARGAFTIG, J.; D.C. TAUSSIG; E. GRIESSINGER; F. ANJOS-AFONSO; T.A. LISTER; J. CAVENAGH; H. OAKERVEE; J. GRIBBEN; D. BONNET: "Frequency of leukemic initiating cells does not depend on the xenotransplantation model used", LEUKEMIA, 2011
WANG, Y.; Y. LIU; S.N. MALEK; P. ZHENG: "Targeting HIFlalpha eliminates cancer stem cells in hematological malignancies", CELL STEM CELL, vol. 8, 2011, pages 399 - 411
XU, Q.; S.E. SIMPSON; T.J. SCIALLA; A. BAGG; M. CARROLL: "Survival of acute myeloid leukemia cells requires PI3 kinase activation", BLOOD, vol. 102, 2003, pages 972 - 980
YAHATA, T.; T. TAKANASHI; Y. MUGURUMA; A.A. IBRAHIM; H. MATSUZAWA; T. UNO; Y. SHENG; M. ONIZUKA; M. ITO; S. KATO: "Accumulation of oxidative DNA damage restricts the self-renewal capacity of human hematopoietic stem cells", BLOOD, vol. 118, 2011, pages 2941 - 2950
YILDIRIM, S.; A.M. BOEHMLER; L. KANZ; R. MOHLE: "Expansion of cord blood CD34+ hematopoietic progenitor cells in coculture with autologous umbilical vein endothelial cells (HUVEC) is superior to cytokine- supplemented liquid culture", BONE MARROW TRANSPLANT., vol. 36, 2005, pages 71 - 79, XP002471209, DOI: doi:10.1038/sj.bmt.1705001
ZHANG, J.; C. NIU; L. YE; H. HUANG; X. HE; W.G. TONG; J. ROSS; J. HAUG; T. JOHNSON; J.Q. FENG: "Identification of the haematopoietic stem cell niche and control of the niche size", NATURE, vol. 425, 2003, pages 836 - 841, XP002552834, DOI: doi:10.1038/nature02041
ZHOU, B.B.; H. ZHANG; M. DAMELIN; K.G. GELES; J.C. GRINDLEY; P.B. DIRKS: "Tumour-initiating cells: challenges and opportunities for anticancer drug discovery", NAT REV DRUG DISCOV., vol. 8, 2009, pages 806 - 823

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016201077A1 (fr) * 2015-06-12 2016-12-15 Emory University Compositions de croissance et de survie pour des cellules capables de produire des anticorps et procédés associés
US11124766B2 (en) 2015-06-12 2021-09-21 Emory University Growth and survival compositions for cells capable of producing antibodies and methods related thereto
WO2017070353A1 (fr) * 2015-10-20 2017-04-27 Celcuity Llc Procédés de préparation d'un échantillon cellulaire primaire
JP2018531021A (ja) * 2015-10-20 2018-10-25 セルキュイティー， エルエルシー 初代細胞試料を調製する方法
AU2016341938B2 (en) * 2015-10-20 2022-12-01 Celcuity Inc. Methods of preparing a primary cell sample
JP7202613B2 (ja) 2015-10-20 2023-01-12 セルキュイティー インコーポレイテッド 初代細胞試料を調製する方法
US11591573B2 (en) 2015-10-20 2023-02-28 Celcuity Inc. Methods of preparing a primary cell sample
US11125757B2 (en) 2017-05-26 2021-09-21 Emory University Methods of culturing and characterizing antibody secreting cells
WO2019214058A1 (fr) * 2018-05-11 2019-11-14 南京先声医学检验有限公司 Amorce, combinaison d'amorces, kit et application d'amorce
WO2020068615A1 (fr) * 2018-09-24 2020-04-02 Albert Einstein College Of Medicine Interleukine-8 pour entretien d'une culture de cellules de leucémie myéloïde aiguë humaine et du syndrome myélodysplasique et leurs utilisations
WO2020229300A1 (fr) 2019-05-10 2020-11-19 Griessinger Emmanuel Méthode de mesure et de ciblage du métabolisme dependant de la phosphorylation oxydative

Also Published As

Publication number Publication date
GB201303491D0 (en) 2013-04-10

Similar Documents

Publication Publication Date Title
Ratajczak et al. Adult murine bone marrow-derived very small embryonic-like stem cells differentiate into the hematopoietic lineage after coculture over OP9 stromal cells
Li et al. The microenvironment in myelodysplastic syndromes: Niche-mediated disease initiation and progression
Mazzon et al. The critical role of agrin in the hematopoietic stem cell niche
WO2014132032A1 (fr) Culture de cellules initiatrices de leucémie
Rao et al. High-level Gpr56 expression is dispensable for the maintenance and function of hematopoietic stem and progenitor cells in mice
TW202003837A (zh) 表現趨化因子受體及細胞接著分子之cd3陰性細胞之集團、及其用途及其製造方法
Bruno et al. Different growth factor requirements for the ex vivo amplification of transplantable human cord blood cells in a NOD/SCID mouse model
US20210088505A1 (en) Unipotent Neutrophil Progenitor Cells, Methods of Preparation, and Uses Thereof
Hale et al. CXCR 2 modulates bone marrow vascular repair and haematopoietic recovery post‐transplant
US20090117653A1 (en) Method and apparatus for evaluating therapeutics on cancer stem cells
Eaves et al. Anatomy and physiology of hematopoiesis
Pronk et al. Deciphering developmental stages of adult myelopoiesis
US20200048610A1 (en) New method to obtain lymphoid progenitors
Tornack et al. Flt3 ligand‐eGFP‐reporter expression characterizes functionally distinct subpopulations of CD150+ long‐term repopulating murine hematopoietic stem cells
AU780468B2 (en) Method for enhancing hematopoiesis
Bräunig Human Bone Marrow Microenvironment in Health and Disease
Sandhow Mesenchymal Niche Contribution to Normal and Malignant Hematopoiesis
Dolinska Understanding the role of bone marrow niche in myeloid malignancies
Oedekoven Extrinsic regulation of fate choice in mouse haematopoietic stem cells
Xiao Bone Marrow Mesenchymal Stem and Progenitor Cells in Myeloid Malignancies
Warsi Novel Insights into Haematopoietic Stem Cell Regulation and Function
Faltusová The role of stem and progenitor cells in regeneration of hematopoietic tissue
Dhami Identifying novel drug therapies for acute myeloid leukaemia by targeting the interactions between leukaemia cells and bone marrow microenvironment
KR20220068305A (ko) 역분화 줄기세포에서 유래된 조혈모세포를 이용한 동물 모델의 제조
Grušanović Identification and characterization of novel regulators of hematopoietic stem cell function

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14708929

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14708929

Country of ref document: EP

Kind code of ref document: A1