WO2014125369A2 - Deletion mutants of gallid herpes virus and vaccinal compositions containing the same - Google Patents

Abstract

The present invention provides a stable composition comprising a Gallid HerpesVirus (GaHV-2) with at least a deletion of a 60bp repeated sequence inthe 5' LAT gene promoter, a vaccine comprising said composition.

Description

DELETION MUTANTS OF GALLID HERPES VIRUS AND VACCINE COMPOSITIONS

CONTAINING THE SAME

INTRODUCTION

The present disclosure provides vaccine compositions comprising deletions of a 60bp region (also called 60bp repeat) of the 5' LAT gene promoter region of the pathogenic Gallid Herpes Virus (GaHV-2), the causative agent of Marek's Disease. The compositions described provide stable virus compositions that are lacking part of the GaHV-2 genome which can be useful as "stable" vaccine strains that are unable to revert to a pathogenic phenotype.

BACKGROUND

Marek's disease (MD) is a highly contagious neoplastic disease of chickens caused by Marek's disease virus- 1 (also known as Gallid herpesvirus type 2 or GaHV-2). Infection and resultant MD causes the largest losses of any poultry disease worldwide. It is mainly controlled by vaccination and the CVI988 vaccine is actually the most effective vaccine against MD used worldwide.

The CVI988 vaccine is a GaHV-2 cell-associated vaccine, produced from an isolate obtained in 1972 from a MDV-infected chicken flock with no MD lesions and attenuated by passages in cell culture (Rispens et al., 1972). Comparative genomic analyses of nucleotide sequences from CVI988 vaccine and virulent strains have identified several mutations between these strains. However, with the exception of mutations in Meq, the major oncogene of GaHV-2 and the most studied gene of this virus, the causal mutations responsible for attenuation and the protection induced by CVI988 remained to be established.

Spatz and Silva (2007) described different sequence patterns in the 5' LAT gene region and showed that virulent GaHV-2 strains harbored 60 bp repeats that were found to be deleted in vaccine strains. These repeats have promoter activity that regulate expression of both the L^J gene and the microRNAs (miRNAs) cluster located into the first intron of the LAT gene (Strassheim et al., 2012, Stik et al, 2010), and are potentially involved in GaHV-2 lymphomas. Furthermore, an analysis of database sequences showed that this region varied between different CVI988 isolates (i.e., BP5, Intervet and CVI988-BAC).

The emergence of novel very virulent MD virus strains that escape vaccinal immunity has been repeatedly described. Therefore, remains a need for new vaccines to protect chickens against MD.

The present description relates in part to the region of the CVI988 genome located at the 5' end of the LAT (latency-associated transcript) gene. The 60 bp repeats control expression of both the LAT gene and the miRNA cluster located into the first intron of the LAT gene.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1A, IB, 1C. Show the heterogeneity of various deletions of the 60bp repeats region in the CVI988 vaccine.

(Figure 1A) The 5 'LAT molecular subtypes in CVI988/Rispens vaccine produced by Pfizer AH. (Top of the figure) LAT gene and cluster of microRNAs mdvl-miR-M8-M10 in GaHV-2 genome. The GaHV-2 genome harbours a genomic organization of class E with 2 unique regions, long and short (UL and US), both flanked by inverted repeated region, IRL/TRL (internal and terminal region) and IRS/TRS. The LAT gene and the cluster of microRNAs M8-M10 are localized in RS regions, in antisens of the ICP4 gene. Tandem 60bp repeats are present upstream the LAT gene and the miRNA cluster, corresponding to their promoter with one response element to the p53 protein. Telomeric repeats and putative cleavage/packaging signals PACI and PACII are localised just before these 60bp repeats. ICP4, Grey hatched arrow; LAT gene, grey arrow; 60bp repeats, grey hatched box; cleavage/packaging signals PACI and PACII, white diamonds; microRNAs mdv-l-miR-M8 to M10, black triangles. (Bottom) The GaHV-2 subtypes for the 5' LAT region. The 5' LAT region of RB 1B, CVI988 BP-5 and CVI988 Intervet analysed by Spatz and Silva in 2007 are illustrated. The different molecular subtypes annotated a to ε, A to N, are represented after analyse of the 5 'LAT region from 5 batches of CVI988/Rispens vaccine by PCR with primers upstream the 60 bp repeats and downstream the microRNAs cluster, cloning and sequencing. The frequency of each variant is indicated in percentage from all batches. Majoritary (a to ε) and minoritary (A to N) variants have been identified from their frequency, the first one corresponding to > 5%. The 5' extremity of deletions is illustrated by a white triangle, whereas the 3' extremity by a black triangle. Common deletions with CVI988-BP5 and Intervet are indicated. Cleavage/packaging signal PACII, white diamond; 60bp repeat, grey hatched box; response element p53, black diamond; LAT gene exon 1, pale grey box; LAT gene and microRNAs TSS, grey square; 5'region of the L^Jgene, grey box; microRNAs, white boxes.

(Figure IB) Schematic representation of the GaHV-2 genome (top), expanded below to show the details of the LAT locus between primers M448 and M766, with coordinates relative to the RB-1B genome (EF 523390). (Figure 1C) Representation of the different molecular subtypes found in five batches of CVI988/Rispens from Pfizer AH and one from Intervet. Subtypes common to all batches of vaccine are named a to ε. The minority subtypes present only in some batches of vaccine, mostly at frequencies below 5%, are named A to N, the letter i in lower case corresponds to subtypes detected only in the CVI988 batch from Intervet. Black arrows, microRNAs mdvl- miR-M8 to 10; black squares, sequence downstream from the telomeric region to the 60 bp repeat promoter region; white hatched boxes, 60 bp repeats; black diamonds, p53 response elements; pale gray box, LAT gene exon 1; gray box, LAT gene intron 1; white boxes, microRNAs; white triangles, 5 'ends of molecular subtypes (a to ε, and A to N); gray square, TSS, transcription start site; black triangles, 3' boundary of molecular subtypes (a to ε, and A to N).

Figure 2A, 2B, 2C, 2D. Deletion of one copy of the 5' LAT region by the two-step recombination procedure.

(Figure 2A) The first Red recombination replaced the Lat promoter by the kanR gene and I- Scel recognition site by homologous recombination. This step needs the design of a transfer vector with specific extremities according to the required deleted region. The kanR gene and I-Scel (black flash) recognition site sequences have been extended in 5' end by 50bp from upstream the Lat promoter region (black box) and 50bp from downstream the Lat promoter (light grey box) and in 3 'end by the same 50bp from downstream the Lat promoter region. (Figure 2B) Arabinose induction at 42°C was performed on kanamycin resistant clones to allow I-Scel restriction enzyme expression and cleavage of the BAC genome at the I-Scel recognition site. (Figure 2C) The second Red recombination step allowed complete deletion of the positive marker and I-Scel recognition site (Figure 2D) resulting in a Lat promoter- deleted BacRB lBAp. The procedure was repeated to delete the second copy of the Lat promoter. The BAC genome was illustrated by 3 black horizontal lines.

Figure 3A, 3B, 3C: Diagram of mutagenesis of pRBlB-5 to delete the 5' LAT region. (Figure 3 A) Schematic structure of the pRB 1B-5 genome, with 2 unique regions named UL and US region (Unique long and short) respectively flanked by two repeated region named IRL/TRL (Internal and Terminal Long Repeats) and IRS/TRS, showing the insertion of the pDS-pHAl vector in the US2 locus. The structure of the 7.2-kb Pad mini-F vector (light grey box) shows the gpt and chloramphenicol resistance (CamR) genes. (Figure 3B) Schematic illustration of the promoter region, named 60bp repeats, of the LAT gene and its associated pre-microRNAs (8, 6, 10 and 7), and its replacement with the kanamycin resistance (KanR) gene by homologous recombination. (Figure 3C) Schematic illustration of the final structure of the 5' region of the LAT gene after the second step of homologous recombination.

Long light grey box = 7,2-kb Pad mini-F vector ; thin black rectangle = telomeric repeats; white diamonds = encapsidation signals Pad and II ; light grey box and circled in black = 60bp pattern ; dark grey arrow = Lat gene; grey stem-loop = pre-miR ; light grey arrow = ICP4 gene ; dark grey and black boxes flanking the kanamycin resistance gene in white box = homologous regions allowing the 2 steps of recombination for deletion of the LAT promoter.

Figure 4: Alignment of the sequence of the 5' LAT region from parental and deleted pRB lB clones. In dark grey, Beta Del Seq for and rev primers for the PCR amplification are represented, p53 response elements are highlighted in grey. pRB lB-5 is the parental virus and pRB lBApi and pRB lBAp2 the two clones generated by mutagenesis designing the β subtype of the 5 ' LAT region.

Figure 5: Viral load of recombinant viruses BACRBlBApi and 2 during in vivo infection. DNA from PBL at 12, 21, 33 and 69 dpi (days post inoculation) has been analysed by qPCR targeting the UL26 gene. Histograms represent the mean of the number of copies detected in 2.104 cells in different inoculations (log). Three chickens per inoculation group have been analysed at 12 dpi, and six at 21, 33 dpi and 7 to 13 at 69 dpi. Results have been tested by a Wilcoxon-Mann Whitney test with p < 0,05 significant. Significant differences between CVI988/Rispens and the other groups are indicated by an asterisk, and the star, significant differences between BACRBlB-5 and the others. Figure 6: Evaluation of the attenuation of BACRBlBAp 1 or 2-derived viruses. Day-old maternal-antibody negative chickens were inoculated via the intramuscular (IM) route with 1,000 PFU of BACRBlBApi and 2-derived viruses. A group of chickens inoculated with 1,000 PFU of RB IBB AC 5 -derived virus was used as the positive control and a group of chickens was vaccinated with 1,000 PFU of CVI988 vaccine. Negative control corresponds to a group of non-infected chickens from the same hatching. The cumulative number of chickens that died from Marek's disease was used to calculate the percent survival rates for different groups. Figure 7 A, 7B: Protection induced by CVI988 and BACRB lBAp 1 or 2-derived viruses against a challenge with vvRBIB or w+648A. Day-old chickens were vaccinated via the intramuscular (IM) route with 1,000 PFU of CVI988, or BACRB lBApl and 2 derived viruses and challenged with 1,000 PFU of vvRBIB (Figure 7A) or vv+648A (Figure 7B) 7 days later. Unvaccinated chickens were also inoculated with 1,000 PFU of vvRBIB (Figure 7 A) or W+648A (Figure 7B). Negative control corresponds to a group of non-infected chickens from the same hatching. The cumulative number of chickens that died from Marek's disease was used to calculate the percent survival rates for different groups Figure 8A, 8B: Effect of infection with BAC-derived viruses and CVI988 vaccine on lymphoid organs at 68 days post-infection. (Figure 8A and 8B). Distribution of the relative weights of lymphoid organs (Figure 8A) Histograms representing the mean of relative lymphoid organ weights (bursa, thymus and spleen) (Figure 8B). Day-old maternal-antibody negative chickens were inoculated via the intramuscular (IM) route with CVI988 vaccine, ΒΑΟΙΒΙΒΔβΙ and 2, or BACRB lB-5 viruses. Negative control corresponds to a group of non-infected chickens from the same hatching. The bars represent the mean lymphoid organ relative weights (calculated as ratios of whole body weight) from still alive chickens.

Figure 9: Effect of vaccination and challenge on lymphoid organs at 68-71 days post- challenge. Histograms represent the mean of relative lymphoid organ weights (bursa, thymus and spleen). Day-old chickens were vaccinated via the intramuscular (IM) route with CVI988, or BACRB lBApl or 2 - derived viruses and challenged with vvRBIB (Figure 9A) or W+648A (Figure 9B) 7 days later. Negative control corresponds to a group of non- infected chickens from the same hatching. The bars represent the mean lymphoid organ relative weights (calculated as ratios of whole body weight) from still alive chickens.

Figure 10: Alignment of the sequence of the 5' L^Jregion from parental and deleted pRBIB clones. In dark grey, Alpha Del Seq for and rev primers for the PCR amplification are represented, p53 response elements are highlighted in grey. pRB lB-5 is the parental virus and pRB ΙΒΔαΙ and pRB 1ΒΔα2 the two clones generated by mutagenesis designing the a subtype of the 5 ' LAT region.

Figure 11A, 11B. Changes in 5' LAT molecular subtype frequencies in CVI988 during serial passages in CEFs. Percentages of the different molecular subtypes as a function of the number of passages, noted PO to P80, PO representing the subtype distribution in the initial MC18800 batch. The α, β and N subtypes are represented individually, whereas the other subtypes are clustered together as "Others". "Complete" subtypes correspond to the non-deleted 5' LAT region with at least one 60-bp repeat. (Figure 11 A) First series, from PO to P80. (Figure 11B) Second series, initiated from frozen CVI988/Rispens-infected cells, from P55 to P80.

Figure 12. Changes in 5' LAT molecular subtype frequencies in the CVI988 vaccine after chicken infection. Percentages of the different molecular subtypes in PBLs at 7, 14 and 29 dpi (Figure 12 A) and in FF (feather follicles) at 7 and 21 dpi (Figure 12B), in chickens vaccinated with batch MCI 8800. The α, β and N subtypes are represented individually, whereas the other subtypes are clustered together as "Others".

SUMMARY OF THE INVENTION

The disclosure presented herein provides compositions comprising avian viral genomes wherein the genome comprises a unique short region (Us) segment flanked at each end by an inverted short repeat sequence segment (Rs), wherein each Rs comprises a 60 base pair (bp) repeat sequence segment in the native viral genome wherein at least part of the 60 bp repeat sequence segment is deleted from one or both Rs segments.

In some embodiments, the compositions are derived from or are a GaHV-2 viral strain. The genomes can comprise deletions in the 5' region of the latency-associated transcript (LAT) gene encompassing the promoter for the latency-associated transcript (LAT) gene and can provide a genomic deletion of at least a portion encompassing the 60 base pair (bp) repeat sequence segment within each Rs sequence. The genomic deletions can comprise a complete deletion of one or both of the 60 bp repeat sequence segments in the Rs sequence segments and can comprise a complete deletion of the 60 bp repeat sequence segments in both Rs sequence segments.

The genomic deletions can comprise at least one or both of a beta and alpha type deletion of the Rs gene segments as described herein. A subtype means a virus in general, and in particular a virus bearing a beta or alpha type deletion or any deletion described herein.

In some embodiments, the genomic deletions are recombinant (i.e., constructed following molecular manipulation of the viral genome to delete specific segments) in part or in whole and are generated in cell culture following transfection or electroporation of other suitable means of transfer of a recombinant Bacterial Artificial Chromosome (BAC) vector. In some embodiments, the compositions comprise one or more immunogenic compositions that can be selected from one or more of a virus or virus-like particle (VLP) containing the genomic deletion(s) or can be delivered as nucleic acid compositions.

The genomic deletion(s) disclosed herein can be capable of replicating and propagating in vivo and or in vitro and can in some embodiments be inactivated following propagation.

The viral genomes harbouring genomic deletion(s) disclosed herein can be capable of replicating and propagating in vitro and or in vivo and can in some embodiments be inactivated following propagation.

In some embodiments, the viral particles can replicate in vivo in an Avian species and can be a recombinant GaHV Type 2 virus.

The disclosure describes compositions that can be either a nucleic acid or virus that further comprises an additional recombinant GaHV Type 2 virus or nucleic acid comprising a different deletion in the genome from the first recombinant virus or nucleic acid.

The compositions comprising a recombinant genome can also further comprise additional antigens to the same or a different pathogen such as, e.g., a turkey herpes virus antigen.

The compositions comprising a recombinant genome can also further comprise additional antigens to the same or a different pathogen such as, e.g., IBDV (Infectious bursal disease) antigen, Newcastle disease antigen, influenza antigen or any other avian pathogen.

The compositions comprising a recombinant genome can also further comprise multivalent vaccines mixed with any other vaccine, such as, e. g. turkey herpes virus vaccine, recombinant turkey herpes virus vaccine, SB-1 vaccine or any other Marek's disease vaccine.

The compositions disclosed herein can further comprising an adjuvant, cytokine or other immunoregulatory agent.

In some examples, the compositions can comprise a deletion derived from one or more of the RB-1B, CV1988 and 648 A genomes or any GaHV-2, GaHV-3 genome or Herpes virus of turkey genome.

The compositions may find use as immunogenic compositions and more particularly as a vaccine.

In other embodiments, the disclosure provides methods of treating or preventing infection of an animal with Marek's disease which comprises administering to the animal the composition described and claimed herein. The methods of claim can be applied to avian species selected, e.g., from the group consisting of chicken, duck, and turkey. In other embodiments, the disclosure provides methods of treating or preventing infection of an animal with Marek's disease (MD) which comprises administering to the animal the composition described and claimed herein. The methods of claim can be applied to avian species selected, e.g., from the group consisting of chicken, duck, quail, guinea-fowl, pheasant and turkey.

The compositions described and claimed herein may find use in the manufacture of a medicament for the treatment or prevention of Marek's Disease in an animal and in some embodiments the animal is an avian selected from chicken, duck, turkey or other poultry or any animal susceptible to infection by a GaHV-2 pathogen.

Vaccines or Compositions to Mediate an Immune Response

Suitably a vaccine or immunogenic composition as described and claimed herein may comprise a pharmaceutical carrier or diluent, for example physiological saline, propylene glycol and the like. Suitably a vaccine or immunogenic composition as described and claimed herein may comprise immunodulatory molecules including adjuvants, cytokines, and or modulators of Toll like Receptors, as discussed in greater detail below.

Methods of Vaccination

The vaccine may be delivered orally, parenterally, intranasally or intravenously, intramuscularly or subcutaneously. The dosage of the vaccine provided will typically take into account the age and/or weight and/or physical condition of the avian species.

In one embodiment a vaccine may be prepared as a live vaccine, or as a cell associated vaccine. In other embodiments, the vaccine may be inactivated and administered with or without one or more adjuvants and or other antigens as described in greater detail below.

In one embodiment a vaccine may be prepared as an attenuated virus which may be produced by growing the virus in embryos or cell culture. Such an attenuated vaccine could also be directly injected, given by drinking water or spray. It is also possible that an attenuated or non-attenuated virus could be given by inoculation (e.g. subcutaneous route).

In one embodiment the administration is performed immediately after hatch, referred to as Day 0 in growout. In one embodiment the administration can be one or more administrations performed after Day 0 in growout.

In one embodiment the method of the present invention further comprises one or more additional administrations of a high dose of immunogenic compositions of the invention administered after an initial dose is administered. In one embodiment the one or more additional administrations are selected from the group consisting of: oral gavage; direct injection; spray administration; gel administration; feed administration and drinking water administration. In one embodiment the one or more additional administrations comprise a spraying administration. In one embodiment the one or more additional administrations are performed immediately after hatch, or referred to as Day 0 in the relevant field. In one embodiment the one or more administrations are performed after Day 0 in growout.

The present vaccination method also may involve the in ovo administration, during the final quarter of incubation, of live immunogenic compositions, into birds' eggs. In the case of chickens, in ovo administration is performed in ovo or day old birds. In other in ovo embodiments, vaccination can occur at other times, e.g., between days 1 and 2, 1 and 3, 1 and 4, land 5 or days 1-20 of incubation, and on days 18 or 19 of incubation. In the case of turkeys, in ovo administration can also be performed on days 21-26 of incubation. The day of in ovo inoculation can be adjusted to maximize effects of vaccination.

A successful MD vaccine usually must be able to replicate in cell cultures and must not be immunosuppressive and must elicit an immune response that is protective. However, in some embodiments, the vaccines or immunogenic compositions described herein may be administered as an inactivated viral preparation or as a nucleic acid vaccine.

A protective response will be able to prevent or reduce the signs and symptoms of MD in a bird caused by infection with GaHV Type 2 or other applicable pathogenic virus that receives a vaccine as described and embodied herein.

Treatment

A virus, virus like particle, cell-associated virus, or nucleic acid sequence, of the invention may be used to modify the immune system of an avian. Such modification of the immune response may be used to treat an avian or prevent the avian from infection. Treatment includes any regimen that can benefit an avian. The treatment may be in respect of an existing condition or may be prophylactic (preventive treatment). Treatment may include curative, alleviation or prophylactic effects. Treatment may be provided via any suitable route. The precise dose will depend upon a number of factors, for example the precise nature of the antigen of the vaccine or the use of particular adjuvants.

Adjuvants: In some embodiments, immunogenic compositions as disclosed herein comprise at least one adjuvant. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. Suitable adjuvants include, but are not limited to, alum, aluminum phosphate, aluminum hydroxide, MF59 (4.3% w/v squalene, 0.5% w/v polysorbate 80 (Tween 80), 0.5% w/v sorbitan trioleate (Span 85)), CpG-containing nucleic acid (where the cytosine is unmethylated), QS21 (saponin adjuvant), MPL (Monophosphoryl Lipid A), 3DMPL (3-O-deacylated MPL), extracts from Aquilla, ISCOMS LT/CT mutants, poly(D,L-lactide-co-glycolide) (PLG) microparticles, Quil A, interleukins, and the like.

For veterinary applications including but not limited to animal experimentation, one can use Freund's, in particular incomplete Freund's adjuvant, N-acetyl-muramyl-L-threonyl- D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(l'-2'- dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835 A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion.

Further exemplary adjuvants to enhance effectiveness of the composition include, but are not limited to: (1) oil-in- water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) MF59™, containing 5% Squalene, 0.5% Tween 80 (polyoxy ethylene sorbitan mono-oleate), and 0.5% Span 85 (sorbitan trioleate) (optionally containing muramyl tri-peptide covalently linked to dipalmitoyl phosphatidylethanolamine (MTP-PE)) formulated into submicron particles using a microfluidizer, (b) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (c) RIBI™ adjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components such as monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (DETOX™); (2) saponin adjuvants, such as QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA), Abisco® (Isconova, Sweden), or Iscomatrix® (Commonwealth Serum Laboratories, Australia), may be used or particles generated therefrom such as ISCOMs (immunostimulating complexes), which ISCOMS may be devoid of additional detergent (3) Complete Freund's Adjuvant (CFA) or incomplete Freund's Adjuvant (IF A); (4) cytokines, such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g. gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), or chicken myelomonocytic growth factor (cMGF) etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL), optionally in the substantial absence of alum when used with pneumococcal saccharides (6) combinations of 3dMPL with, for example, QS21 and/or oil-in-water emulsions (7) oligonucleotides comprising CpG motifs, i.e. containing at least one CG dinucleotide, where the cytosine is unmethylated; (8) a polyoxyethylene ether or a polyoxyethylene ester; (9) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol; (10) a saponin and an immunostimulatory oligonucleotide (e.g. a CpG oligonucleotide); (1 1) an immunostimulant and a particle of metal salt; (12) a saponin and an oil-in-water emulsion (13) a saponin (e.g. QS21) + 3dMPL + IM2 (optionally + a sterol) (14) other substances that act as immunostimulating agents to enhance the efficacy of the composition. Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr- MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L- alanyl-D-isoglutarninyl-L-alanine-2-( -2'-dipalmitoyl-5«-gIycero-3-hydroxyphosphoryloxy)- ethylamine MTP-PE), etc.

Particularly useful immunomodulatory compounds for regulation of an immune response in avian species may include one or more of the following: IFN-a; IFN-β; IFN-γ; Interleukin-ΐβ; Interleukin-2; Interleukin-6; Interleukin-8; Interleukin-15; Interleukin-16; Interleukin-18; SCF; MGF; TGFp Lymphotactin; ΜΠ>-1β; CXC; and CC chemokines.

An "immune response" to an antigen or vaccine composition is the development in a subject of a humoral and/or a cell-mediated immune response to molecules present in the antigen or vaccine composition of interest. For purposes of the present invention, a "humoral immune response" is an antibody-mediated immune response and involves the generation of antibodies with affinity for the antigen/vaccine of the invention, while a "cell-mediated immune response" is one mediated by T-lymphocytes and/or other white blood cells.

A "cell-mediated immune response" is elicited by the presentation of antigenic epitopes in association with Class I or Class II molecules of the major histocompatibility complex (MHC). This activates antigen- specific CD4+ T helper cells or CD8+ cytotoxic T lymphocyte cells ("CTLs"). CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells. CTLs help, induce and promote the intracellular destruction of intracellular microbes, or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves an antigen-specific response by helper T-cells. Helper T-cells act to help, stimulate the function, and focus the activity of, nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface. A "cell-mediated immune response" also refers to the production of cytokines, chemokines and other such molecules produced by activated T-cells and/or other white blood cells, including those derived from CD4+ and CD8+ T-cells. The ability of a particular antigen or composition to stimulate a cell-mediated immunological response may be determined by a number of assays, such as by lymphoproliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, by assaying for T-lymphocytes specific for the antigen in a sensitized subject, or by measurement of cytokine production by T cells in response to restimulation with antigen. Such assays are well known in the art.

A "protective" immune response or "treatment" with an immune response refer to the ability of a vaccine or immunogenic composition to elicit an immune response, either humoral and/or cell mediated, which serves to protect the mammal from an infection or the post infection sequelae following infection.

A "protective" immune response or "treatment" with an immune response refer to the ability of a vaccine or immunogenic composition to elicit an immune response, either humoral and/or cell mediated, which serves to protect the avian or bird from an infection or the post infection sequelae following infection.

In the present invention, a "protective" immune response or "treatment" with an immune response refer to the ability of a vaccine or immunogenic composition to elicit an immune response, either humoral and/or cell mediated, which serves to protect an avian from an infection or the post infection sequelae following infection.

The protection provided need not be absolute, i.e., the infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population of mammals.

In the present invention, the protection provided needs not be absolute, i.e., the infection needs not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population of avian. Protection may be limited to mitigating the severity or rapidity of onset of symptoms of the infection.

Antigens as used herein may also be mixtures of several individual antigens. The term "antigen" refers to a compound, composition, or immunogenic substance that can stimulate the production of antibodies or a T-cell response, or both, in an animal, including compositions that are injected or absorbed into an animal. In the present invention, the animal may be a bird. The immune response may be generated to the whole molecule, or to a portion of the molecule (e.g., an epitope or hapten). The term may be used to refer to an individual macromolecule or to a homogeneous or heterogeneous population of antigenic macromolecules. An antigen reacts with the products of specific humoral and/or cellular immunity. The term "antigen" broadly encompasses moieties including proteins, polypeptides, antigenic protein fragments, nucleic acids, oligosaccharides, polysaccharides, organic or inorganic chemicals or compositions, and the like. The term "antigen" includes all related antigenic epitopes.

The term "immunogenic composition" refers to any pharmaceutical composition containing an antigen which composition can be used to elicit an immune response in a mammal. In the present invention, the term "immunogenic composition" refers to any composition, in particular a pharmaceutical composition containing an antigen which composition can be used to elicit an immune response in an avian.

The immune response can include a T cell response, a B cell response, or both a T cell and B cell response. Antigen-specific T-lymphocytes or antibodies can be generated to allow for the future protection of an immunized host.

DETAILED DESCRIPTION

The present description discloses new features of the sequence just downstream from the telomeres, extending from the 5' upstream region of the LAT gene to the end of the mdvl- miR-M8-M10 microRNA (miRNA) cluster mapped in the first intron of the LAT gene, referred as "the 5 ' LAT gene region" (Strassheim et al., 2012). Two copies of this region are present in the genomes of the CVI988 and pathogenic GaHV-2 strains.

One of each of the two copies of the 5' LAT 60bp region lies in the Rs repeats, flanking the Us region. More precisely, one of each of at least two copies of a 60bp motif of SEQ ID N° 31:

TGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCGGTCATGTAGAGGGCGCG, present in the 5' region of the LAT gene promoter in GaHV-2) lies in the Rs repeats, IRs and TRs, flanking the Us region.

The CVI988 vaccine is a GaHV-2 cell-associated vaccine, produced from an isolate obtained in 1972 from a MDV-infected chicken flock with no MD lesions (mildly sick chicken) and attenuated by passages in cell culture (Rispens et al., 1972). Comparative genomic analyses of nucleotide sequences from CVI988 vaccine and virulent strains have identified several mutations between these strains. However, with the exception of mutations in Meq, the major oncogene of GaHV-2 and the most studied gene of this virus, the causal mutations responsible for attenuation and the protection induced by CVI988 remain to be established. This work focused on the region of the CVI988 genome located at the 5' end of the LAT (latency-associated transcript) gene, a long non coding highly spliced RNA, encoding no associated protein. The sequence just downstream from the telomeres, extending from the 5' upstream region of the LAT gene to the end of the mdvl-miR-M8-M10 microRNA (miRNA) cluster mapped in the first intron of the LAT gene (Strassheim et al, 2012) was analyzed in detail. This region comprises from its 5' end to its 3' end, tandemly repeated 60 bp motifs, the transcription starting site of the LAT gene, the first exon of the LAT gene and the first intron of the LAT gene till the end of the mdvl-miR-M8-M10 microRNA (miRNA) cluster. Two copies of this region are present in the genomes of the CVI988 and pathogenic GaHV-2 strains, in each inverted short repeat (IRs and TRs) flanking the unique short region (U_s) of the genome. Spatz and Silva (2007) described different sequence patterns in this region and showed that virulent GAHV-2 strains harbored 60 bp repeats that were deleted in vaccine strains. These repeats have promoter activity, regulating expression of both the LAT gene and the miRNAs (Stik et al, 2010; Strassheim et al., 2012), potentially involved in GaHV-2 lymphomas. Furthermore, an analysis of database sequences showed that this region varied between different CVI988 isolates (i.e., BP5, Intervet and CVI988-BAC). This work included an investigation and analysis of the sequence pattern present in CVI988 vaccines from Fort-Dodge/Pfizer Animal Health and Intervet companies.

By analyzing six batches of commercial vaccines, four monovalent CVI988 vaccines and two bivalent vaccines (CVI988 combined with HVT, Meleagrid turkey herpesvirus), it was demonstrated that all batches of CVI988 consisted of a mixed population of genetic subtypes. Twenty nine different subtypes were identified and all these subtypes displayed a partial or complete deletion of the 60 bp repeat region, corresponding to the promoter of the LAT gene, and the mdvl-miR-M8-M10 miRNA cluster (Figure 1A or IB). Five deletion subtypes were common to all CVI988 batches and the so-called alpha and beta major subtypes have been detected with the highest frequencies (51% and 24%, respectively in Fort Dodge/Pfizer vaccines, taken collectively and 28 and 45 %, respectively in the Intervet vaccine) in all batches. As shown by an analysis of different batches of the CVI988 vaccine, the genomic composition of the viral content of this vaccine comprises a heterogeneous population of different genomic structures in the attenuated strains. This analysis of CVI988 batches revealed at least twenty nine different subtypes (Figure 1C). The sequence of the region comprising the LAT gene promoter and the miRNA cluster in the twenty nine different subtypes correspond to SEQ ID N°226, SEQ ID N°227, SEQ ID N°228, SEQ ID N°229, SEQ ID N°230, SEQ ID N°231, SEQ ID N°232, SEQ ID N°233, SEQ ID N°234, SEQ ID N°235, SEQ ID N°236, SEQ ID N°237, SEQ ID N°238, SEQ ID N°239, SEQ ID N°240, SEQ ID N°241, SEQ ID N°242, SEQ ID N°243, SEQ ID N°244, SEQ ID N°245, SEQ ID N°246, SEQ ID N°247, SEQ ID N°248, SEQ ID N°249, SEQ ID N°250, SEQ ID N°251, SEQ ID N°252, SEQ ID N°253, SEQ ID N°254. This observation clearly demonstrates that the CVI vaccine is a mixture of different subtypes.

In virulent RB-IB strain samples, we showed that the 5 'LAT region was also variable and that RB-IB consisted of a mixed population of genetic subtypes mostly encompassing a variable number of 60 bp repeats, deleted subtypes being very rarely detected.

Production of CVI988 vaccines needs passages in cell culture and we investigated whether these CVI988 subtype populations remained stable after the infection of cell cultures, using secondary chicken embryo fibroblasts for 80 successive passages of CVI988. We observed a dynamic evolution of CVI988 subtype frequencies, and, strikingly, non deleted subtypes harboring two to seven repeats were observed from passage 65-70 onwards. A dynamic evolution of CVI988 subtype frequencies was also observed in vivo.

The present design of potential new vaccines more closely related to emerging viral strains than CVI988 is based on the description of the mixed population of 5 'LAT genetic subtypes present in CVI988 vaccine. The goal is to mimic CVI988 subtypes by creating 5' LAT deleted subtypes from an emerging GaHV-2 viral strain while preserving its entire immunogenicity. In particular, the goal is to prepare a new composition, in particular, a new vaccine composition comprising or consisting in an avian herpes virus bearing a deletion extending at the 5 'extremity, from the 5' region of the LAT gene promoter and at the 3' extremity, to a region located downstream the cluster mdvl-miR-M8-M10.

The deletion of the 5'LAT region from a virulent GaHV-2 strain would reduce its pathogenicity and induce vaccinal protection. Moreover, the "vaccine" would be able to replicate in avian embryo fibroblasts in vitro. It would also replicate in chickens in vivo meanwhile it would be devoid of immunosuppressive effect.

We have constructed recombinant deleted viruses from the vvRBIB virus (SEQ ID N°l) as a model. We deleted the RB-IB bacmid, named pRB-lB-5 from the 5'LAT region. The « core » promoter of the L^Jgene, is as follows. SEQ ID N°32:

GGTTGGCCGCTAGGGGTTGGCCGCTAGGGGTTCGACGAAATTTTTTTTTATACAGTGTGTGG CCGCGAGAGGGTTAGAGGSCGCGTGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATG CGCGGTCATGTAGAGGGCGC|GTGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCG CGGTCATGTAGAGGGCGCGTGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCG GTCATGTAGAGGGCGCGTTCCTGATTT

Position of the sens M448 oligonucleotide (SEQ ID N°104) is underlined, ^ represents the 5 'end deletion in all subtypes but one (subtype N) which starts at |c|. We designed deletions (SEQ ID N°49 beta deletion and SEQ ID N°48 alpha) corresponding to the beta and alpha CVI988 subtypes, (comprising SEQ ID N°3 and 2) respectively. It should be stressed that there are two copies of the 5 'LAT sequence in GaHV-2 genome, one in each of the Rs regions (IRs and TRs). We generated one pRBlB-5 harbouring two beta deletions, one pRB lB-5 harbouring two alpha deletions and one pRBlB-5 harbouring one alpha and one beta deletion. The two-step Red-recombination (Tischer et al., 2006) procedure combining Red recombination originated from the phage λ and cleavage with the endonuclease l-Scel to allow scarless deletions was used.

Two major subtypes observed were the "alpha" (a) and "beta" (β) subtypes. The "beta" deletion comprises the promoter of the LAT gene (SEQ ID N°32) including a 60 bp repeats (SEQ ID N°31) and extends to upstream the cluster mdvl-miR-M8-M10 while the "alpha" deletion extends to inside the miRNA cluster, deleting miR-M8. (See Figure 1A, or 1C). The present invention also provides a composition wherein the genomic deletion comprises both an alpha and beta deletion.

In contrast, in virulent RB-IB strain samples (in particular in the RB-IB strain, SEQ

ID N°l), the 5' LAT region mostly encompasses a variable number of 60 bp repeats and deleted subtypes were very rarely detected.

Deletion of the region encompassing the 60 bp repeats from a pathogenic strain was investigated to determine if such constructs could be used in the development of new vaccines. A high prevalence of deleted subtypes in the CVI988 vaccine strains that were not deleted in the virulent RB-IB strain was observed. The deleted region corresponds to a promoter region of the LAT gene, which transcribes a long non-coding RNA and does not encode for any known protein. This work therefore explored involved deletion of this region from a virulent strain in order to decrease its pathogenicity while maintaining a protective immune response following administration as a vaccine.

As noted above, two copies of the region extending from the 5' upstream region of the LAT gene to the end of the mdvl-miR-M8-M10 microRNA (miRNA) cluster are present in the genomes of the CVI988, attenuated and pathogenic MDV strains, each one within each inverted short repeat (Rs) flanking the unique short region (Us) of the genome.

Recombinant viruses were constructed by deleting the 60 bp repeat region from a bacmid encoding the RB-IB genome. There are two copies of this repeat sequence in MDV genome, one in each of the Rs region. Deletions corresponding to the beta subtype from pRBlB-5, deleting promoter but preserving the entire miRNA mdvl-miR-M8-M10 cluster, using two-step Red-recombination (Tischer et al, 2006) were constructed. This procedure combines Red recombination originated from the phage λ and cleavage with the endonuclease l-Scel to allow scarless deletions. In this way, RB-1B bacmids harboring two copies of the beta deletion were isolated and we assessed their pathogenicity and their vaccine protection properties.

The present invention contemplates the various deletion constructs of this region for

Marek's Disease GaHV-2 strains such as attenuated strains, virulent, very virulent, very virulent plus GaHV-2 strains already isolated and described as well as any new further isolated GaHV-2 strains in any part of the world. The present invention also contemplates the various deletions of GaHV-3 strains.

As noted above, five deletion subtypes were common to all CVI988 batches, and the so-called alpha and beta major subtypes have been detected with the highest frequencies (51% and 24%, respectively in Fort Dodge/Pfizer batches) in all batches. In contrast, in virulent RB-1B strain samples, the 5'LAT region mostly encompasses a variable number of 60 bp repeats and deleted subtypes were very rarely detected. Based on the foregoing, deletion of the region encompassing the 60bp repeats from a pathogenic strain was conducted to construct new vaccines. The deleted region corresponds to a promoter region of LAT gene, which transcribes a long non-coding RNA which does not encode any protein. As a result of the reported deletions, it is presumed that total immunogenicity of the RB-IB virus containing these deletions was preserved.

General Methods

(i) Cells and Viruses

Chicken embryo fibroblasts (CEF) were prepared from 11 day-old specific-pathogen-free (SPF) White Leghorn B13/B 13 embryos raised at INRA (PFIE, 37380, Nouzilly, France) and used as secondary cells (Schat and Purchase, 1998). CEFs were maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 2,5 % fetal calf serum, 1,25% chicken serum, 1% penicillin/streptomycin, 1% fungizone and 2% Tryptose Phosphate Broth (TPB). The vvRB-lB virus used in this study was prepared from a stock of peripheral blood leukocytes (PBLs) collected from a B 13/B 13 chicken 42 days post infection (dpi). This stock was stored at -140°C. The vv+ 648 A virus was prepared from a stock of splenocytes provided by A. Fadly from USDA-ARS, ADOL, East Lansing, MI, USA. CVI988 (Poulvac, batch MD 18800 Pfizer/Fort Dodge) vaccine was used as a control vaccine. BAC-derived viruses were recovered from the parental pRB-ΙΒ BAC clone 5 and BAC deleted constructs, as described below. (ii) Bacteria, Plasmids and BAC clones

BAC maintenance and Red recombinations were performed in E.coli strains EL250

(DH10B λ c/857 recA⁺<>araC-P_BAD flpe) provided by V. Nair (IAH, Compton, Berkshire,

UK) and GS1783 (DH10B λ c/857 A(cro-bioA)<>araC-V_BAD I-scel) provided by N.

Osterrieder (Freie Universitat, Berlin, Germany). PCR products were cloned using E. coli

TGI (SupE hsdA5 thi A(lac-proAB)/F [traD36 proAB+ laclq lacZAM15).

The plasmid pEPKanS-2, which harbors the kanamycin resistant gene, aphAl and an adjoining l-Scel recognition site and the plasmid p- AD-I-scel, expressing the I-Scel enzyme under arabinose induction used to construct recombinant bacmids were provided by V. Nair

(IAH, Compton, Berkshire, UK).

The pRBlB clone 5 used for mutagenesis was provided by V. Nair (IAH, Compton,

Berkshire, UK). It contains BAC vector sequences inserted into the Us2 locus of the RB-IB genome (Petherbridge et al., 2004), as described for MDV genomes by Schumacher et al.,

2000.

(iii) Primers

Primers that we used for the cloning manipulations are listed in Table 1. Oligonucleotides were custom-synthesized (Sigma).

Table 1: Primers used during the two-step mutagenesis

Template Primer Name Sequence primers PCR

Product

or/goal

pEPkan-S2 Beta Del-I- CGTGGCATATTCCTACGGAAACCTATTGTTCTGT Kanl- SEQ ID N°33

See for GGTTGGTTTCGATC TTAATTTTAAGGCGGATAACAGGGTAAT Sce

CGATTT

Beta Del-I- ATAGATCGAAACCAACCACAGAACAATAGGTTTC SEQ ID N° 34

See rev CGTAGGAATATGCCACGGCCAGTGTTACAACCAAT

TAACC

Alpha Del-I- TTGTTCCGTAGTGTTCTCGTGACACTAACTCGAG o Kanl- SEQ ID N° 35 See for ATCCCTGCGAAATGACATAGGGATAACAGGGTAA See

TCGATTT

Alpha Del-I TGTCATTTCGCAGGGATCTCGAGTTAGTGTCACG SEQ ID N° 36

See rev AGAACACTACGGAACAAGCCAGTGTTACAACCAAT

TAACC

Kanl-Sce Beta Del TCGACGAAATTTTTTTTTATACAGTGTGTGGCCG Kanl-Sce SEQ ID N° 37

PCR for CGAGAGGGTTAGAGGGCGTGGCATATTCCTACGG Full

Length for

insertion

in

pRBIB- Beta Del ATAGATCGAAACCAACCAC SEQ ID N° 38 PCR rev

aKanl-Sce Alpha Del TCGACGAAATTTTTTTTTATACAGTGTGTGGCCG aKanl-Sce SEQ ID N° 39

PCR for CGAGAGGGTTAGAGGGTTGTTCCGTAGTGTTCTCG Full

TG Length for

insertion

in

pRBlB-5

Alpha Del TGTCATTTCGCAGGGATCTCG SEQ ID N° 40 PCR rev

pRBlBBA Alpha/Beta Deletion SEQ ID C5^d,pRBlB Del Seq for screening

Δβ ^ε· 41 pRB ΙΒΔα,

pRB ΙΒΔαβ

Beta Del Seq GCGTGACCTCTACGGAACAATAGTT SEQ ID N° 42 rev

Alpha Del GTTCTTCCTATGAGGCTTCCATTCC SEQ ID N° 43 Seq rev

Footnotes for Table 1: bold underlined, 5' end primers, extensions homologous to targeted

beta flanking sequences; ^a Sequence primer in 5 '-3 ' orientation; ^b fisrt PCR product for the

cassette insertion; ^c second and final PCR product for the insertion in pRBlB-5 ; ^d pRBlB-5

as negative control for insertion during PCR screening ; ^e BAC RB-ΙΒΔβ, Δα or Δαβ both

copies deleted

The following primers are used to clone viral subtypes according to the invention :

I-Scel for primer sequence TAGGGATAACAGGGTAATCGATTT (SEQ ID N° 116)

I-Scel rev primer sequence GCCAGTGTTACAACCAATTAACC (SEQ ID N° 117)

Gamma mutagenesis

GammaDell-Sce for

TTCGTCTAAACGAACTAACTTGCTTTGAAGAAATCTACGAATTGATAGACTAGGGA TAACAGGGTAATCGATTT (SEQ ID N° 118)

GammaDell-Sce rev

GTCTATCAATTCGTAGATTTCTTCAAAGCAAGTTAGTTCGTTTAGACGAAGCCAG TGTTACAACCAATTAACC (SEQ ID N° 119)

GammaDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGJrCGJC

TAAACGAACTAACTT (SEP ID N° 120)

GammaDelPCR rev

GTCTATCAATTCGTAGATTTCT (SEQ ID N° 121) Delta mutagenesis

DeltaDell-Sce for

TCGAGA TCCCTGCGAAA TGA C AGTTTTCTCTGGGAATT AC ATCGTCCTGATAGGGA TAACAGGGTAATCGATTT (SEQ ID N° 122)

DeltaDell-Sce rev

TCAGGACGATGTAATTCCCAGAGAAAACTGTCATTTCGCAGGGATCTCGAGCCA GTGTTACAACCAATTAACC (SEQ ID N° 123)

DeltaDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG7UC G ATCCCTGCGAAATGA (SEP ID N° 124)

DeltaDelPCR rev

TCAGGACGATGTAATTCCCAG (SEQ ID N° 125)

Epsilon mutagenesis

EpsilonDell-Sce for

TACA TCGTCCTGA TTGTCGCG AC ATGGAATGGAAGCCTC AT AGGAAGAACTAGGG ATAACAGGGTAATCGATTT (SEQ ID N° 126)

EpsilonDell-Sce rev

GTTCTTCCTATGAGGCTTCCATTCCATGTCGCGACAATCAGGACGATGTAGCCAG TGTTACAACCAATTAACC (SEQ ID N° 127)

EpsilonDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG∑4G47U GTCCTGATTGTCGCG (SEP ID N° 128)

EpsilonDelPCR rev

GTTCTTCCTATGAGGCTTCCA (SEQ ID N° 129)

A mutagenesis

ADell-Sce for

JrJ C4 C4^GrrJGGCGGC4GCTCCAGCATCCGTTTTTGGAACTCGATTTAGGGA TAACAGGGTAATCGATTT (SEQ ID N° 130)

ADell-Sce rev

AATCGAGTTCCAAAAACGGATGCTGGAGCTGCCGCCAAACTTGTGCCAAAGCCA GTGTTACAACCAATTAACC (SEQ ID N° 131)

ADelPCR for TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGJ7TGG CACAAGTTTGGCGGCA (SEP ID N° 132)

ADelPCR rev

AATCGAGTTCCAAAAACGGAT (SEQ ID N° 133)

Al mutagenesis

AlDell-Sce for

TTTTGTTTTTGTTTTA TTAA J7TGTTCTGTGTTTCCTTCTCCCTAT AC AATAGGGATAA CAGGGTAATCGATTT (SEQ ID N° 134)

AlDell-Sce rev

TTGTATAGGGAGAAGGAAACACAGAACAAATTAATAAAACAAAAACAAAAGCC AGTGTTACAACCAATTAACC (SEQ ID N° 135)

AlDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG7222GI TTTTGTTTTA TTAA TT (SEP ID N° 136)

AlDelPCR rev

TTGTATAGGGAGAAGGAAACA (SEQ ID N° 137)

A2 mutagenesis

A2DelI-Sce for

TTGTTC TGTGTTTCC TTC 7UCCT ATAC AAACGTGTTTGTT AATTT ATAGGTAGGGAT AACAGGGTAATCGATTT (SEQ ID N° 138)

A2DelI-Sce rev

CCTATAAATTAACAAACACGTTTGTATAGGGAGAAGGAAACACAGAACAAGCCA GTGTTACAACCAATTAACC (SEQ ID N° 139)

A2DelPCR for

TCGACGAAATTTTTTTTTAT AC AGTGTGTGGCCGCGAGAGGGTT AGAGGGTTGTTC TGTGTTTCCTTCTC (SEQ ID N° 140)

A2DelPCR rev

CCTATAAATTAACAAACACGT (SEQ ID N° 141)

B mutagenesis

BDell-Sce for

TTA CA C TGACC r7TGC4CTGCGTCGGGGATCT ATGGGTTTCTGTGTGCTTTAGGGAT AACAGGGTAATCGATTT (SEQ ID N° 142)

BDell-Sce rev AAGCACACAGAAACCCATAGATCCCCGACGCAGTGCAAAGGTCAGTGTAAGCCA GTGTTACAACCAATTAACC (SEQ ID N° 143)

BDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG77¾C4C TGACCTTTGCACTGC (SEP ID N° 144)

BDelPCR rev

AAGCACACAGAAACCCATAGA_(SEQ ID N° 145)

Bl mutagenesis

BIDell-Sce for

JG^CCrrrGC4CrGCGrCGGGGATCTATGGGTTTCTGTGTGCTTACTACGTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 146)

BIDell-Sce rev

CGTAGTAAGCACACAGAAACCCATAGATCCCCGACGCAGTGCAAAGGTCAGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 147)

BIDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG7G4CC TTTGCACTGCGTCGGG (SEP ID N° 148)

BIDelPCR rev

CGTAGTAAGCACACAGAAACC_(SEQ ID N° 149)

C mutagenesis

CDell-Sce for

GGTTTCTGTGTGCTTACTACGATTTTAAACTTGTTATTTTACGGTTTGAATAGG GATAACAGGGTAATCGATTT_(SEQ ID N° 150)

CDell-Sce rev

TTC AAACCGTAAAATAAC AAGTTTAAAATCGT AGTAAGC AC AC AGAAACCGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 151)

CDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGCCCCT CTAGGCTGATGCGCGG (SEP ID N° 152)

CDelPCR rev

CGT AGTAAGC ACACAGAAACC_(SEQ ID N° 153)

D mutagenesis

DDell-Sce for TCA GGCA TTGCGGAGTTA TA JGTT ACGCGGTTCCC AGCCT AT AAGAATCGT AGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 154)

DDell-Sce rev

CGATTCTTATAGGCTGGGAACCGCGTAACATATAACTCCGCAATGCCTGAGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 155)

DDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGJC4 GG CA TTGCGGAGTTA TA T (SEP ID N° 156)

DDelPCR rev

CGATTCTTATAGGCTGGGAAC_(SEQ ID N° 157)

E mutagenesis

EDell-Sce for

r∑4G^GGG∑4^CC4^A4A4JGCGCGCCAACAAAAAGGCGCCAAAAAATTGTAGGG ATAACAGGGTAATCGATTT_(SEQ ID N° 158)

EDell-Sce rev

CAATTTTTTGGCGCCTTTTTGTTGGCGCGCATTTTTTGGTTACCCTCTAAGCCAGT GTTACAACCAATTAACC_(SEQ ID N° 159)

EDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG77¾G4 GGGTAACCAAAAAATG (SEP ID N° 160)

EDelPCR rev

CAATTTTTTGGCGCCTTTTTG_(SEQ ID N° 161)

F mutagenesis

FDell-Sce for

CGCGCCATACCAA JrJCA4^GTTCCCGCCATTTGGCCAACACGCTATTATTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 162)

FDell-Sce rev

ATAATAGCGTGTTGGCCAAATGGCGGGAACTTTGAAATTGGTATGGCGCGGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 163)

FDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGCGCGC CATACCAATTTCAAAG (SEP ID N° 164)

FDelPCR rev ATAATAGCGTGTTGGCCAAAT (SEQ ID N° 165)

G mutagenesis

GDell-Sce for

CCACATA TCCAGTGACA GG^GTTCGGAATAAACGTTGTGATACGCGATCGTAGGG ATAACAGGGTAATCGATTT (SEQ ID N° 166)

GDell-Sce rev

CGATCGCGTATCACAACGTTTATTCCGAACTCCTGTCACTGGATATGTGGGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 167)

GDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGCG4G4 TATCCAGTGACAGGAG (SEP ID N° 168)

GDelPCR rev

CGATCGCGTATCACAACGTTT_(SEQ ID N° 169)

Gi mutagenesis

GiDell-Sce for

rrCCJCG^rrCCCG^rCC^C^TATCCAGTGACAGGAGTTCGGAATAAACGTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 170)

GiDell-Sce rev

CGTTTATTCCGAACTCCTGTCACTGGATATGTGGATCGGGAATCGAGGAAGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 171)

GiDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG7TCC7U GATTCCCGATCCACA (SEP ID N° 172)

GiDelPCR rev

CGTTTATTCCGAACTCCTGTC_(SEQ ID N° 173)

G2i mutagenesis

G2iDelI-Sce for

GTGACAGGAGTTCGGAA TAAA CGTTGTGATACGCGATCGAGTTTTCGTGGTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 174)

G2iDelI-Sce rev

CCACGAAAACTCGATCGCGTATCACAACGTTTATTCCGAACTCCTGTCACGCCAG TGTTACAACCAATTAACC_(SEQ ID N° 175)

G2iDelPCR for TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGGJX C AGGAGTTCGGAATAAA (SEP ID N° 176)

G2iDelPCR rev

CCACGAAAACTCGATCGCGTA_(SEQ ID N° 177)

G3i mutagenesis

G3iDelI-Sce for

G^GJrCGGA4rA4^CGrrGJGATACGCGATCGAGTTTTCGTGGCATATTCTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 178)

G3iDelI-Sce rev

GAATATGCCACGAAAACTCGATCGCGTATCACAACGTTTATTCCGAACTCGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 179)

G3iDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGG4G7 CGGAATAAACGTTGTG (SEP ID N° 180)

G3iDelPCR rev

GAATATGCCACGAAAACTCGA_(SEQ ID N° 181)

G4i mutagenesis

G4iDelI-Sce for

TAAACGTTGTGA TACGCGA 7UGAGTTTTCGTGGC ATATTCCT ACGGAAACTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 182)

G4iDelI-Sce rev

GTTTCCGTAGGAATATGCCACGAAAACTCGATCGCGTATCACAACGTTTAGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 183)

G4iDelPCR for

TCGACGAAATTTTTTTTTAT AC AGTGTGTGGCCGCGAGAGGGTT AGAGGGTAAAC GTTGTGATACGCGATC (SEP ID N° 184)

G4iDelPCR rev

GTTTCCGTAGGAATATGCCAC_(SEQ ID N° 185)

H mutagenesis

HDell-Sce for

G4GG^G^rrrCCCGGJrrCG^CTGCCGAAGCATGGAAACGTCCTGGGAAATAGGG ATAACAGGGTAATCGATTT_(SEQ ID N° 186)

HDell-Sce rev TTTCCCAGGACGTTTCCATGCTTCGGCAGTCGAAACCGGGAAATCTCCTGGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 187)

HDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGC4 GGA GATTTCCCGGTTTCGA (SEP ID N° 188)

HDelPCR rev

TTTCCCAGGACGTTTCCATGC_(SEQ ID N° 189)

I mutagenesis

IDell-Sce for

TGGGAAAATCTGTTGTTCCGT AGTGTTCTCGTG AC ACT AACTCG AG ATCCTAGGG A TAACAGGGTAATCGATTT_(SEQ ID N° 190)

IDell-Sce rev

GGATCTCGAGTTAGTGTCACGAGAACACTACGGAACAACAGATTTTCCCAGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 191)

IDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGJGGG^ AAA TCTGTTGTTCCGT ( SEP ID N° 192)

IDelPCR rev

GGATCTCGAGTTAGTGTCACG_(SEQ ID N° 193)

Ii mutagenesis

IiDell-Sce for

A4^rCrGrrGrrCCG∑4GJG7TCTCGTGACACTAACTCGAGATCCCTGCGTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 194)

IiDell-Sce rev

CGC AGGGATCTCGAGTT AGTGTC ACGAGAAC ACTACGGAAC AAC AGATTTGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 195)

IiDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG4A47Ur GTTGTTCCGTAGTGT (SEP ID N° 196)

IiDelPCR rev

CGC AGGGATCTCGAGTT AGTG_(SEQ ID N° 197)

J mutagenesis

JDell-Sce for CGACA TGGAA TGGAA GCCJC4 TAGGAAGAACTCGATGTGATGATGCTCTCTAGGG ATAACAGGGTAATCGATTT_(SEQ ID N° 198)

JDell-Sce rev

GAGAGCATCATCACATCGAGTTCTTCCTATGAGGCTTCCATTCCATGTCGGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 199)

JDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGCG^G4 TGGAATGGAAGCCTCA (SEP ID N° 200)

JDelPCR rev

GAGAGCATCATCACATCGAGT_(SEQ ID N° 201)

K mutagenesis

KDell-Sce for

TGTTGGCAA C TCGAAA TC TC JACGAGAT AAC AGTTTGTCT AGGAAACTTTTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 202)

KDell-Sce rev

AAAGTTTCCTAGACAAACTGTTATCTCGTAGAGATTTCGAGTTGCCAACAGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 203)

KDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG7G72G GCAAC TCGAAA TCTCT (SEP ID N° 204)

KDelPCR rev

AAAGTTTCCTAGACAAACTGT_(SEQ ID N° 205)

Ki mutagenesis

KiDell-Sce for

GGGG^A4rGJGrCCrC^G^CTGCTTAATCGTAGAAGCTTCCTAGTGGATTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N°206)

KiDell-Sce rev

ATCCACTAGGAAGCTTCTACGATTAAGCAGTTCTGAGGACACATTTCCCCGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 207)

KiDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGGGGG^ AATGTGTCCTCAGAAC (SEP ID N° 208)

KiDelPCR rev ATCCACTAGGAAGCTTCTACG_(SEQ ID N° 209)

L mutagenesis

LDell-Sce for

GGCACCATTTATCTTGTA JJCCTGTACATCCCCTCCTTAATACTTTAATTTAGGGAT AACAGGGTAATCGATTT_(SEQ ID N° 210)

LDell-Sce rev

AATTAAAGTATTAAGGAGGGGATGTACAGGAATACAAGATAAATGGTGCCGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 211)

LDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGGGC4C CATTTATCTTGTATTC (SEP ID N° 212)

LDelPCR rev

AATTAAAGTATTAAGGAGGGG_(SEQ ID N° 212)

Li mutagenesis

LiDell-Sce for

C TTTCCTCCCAA C TAAA G^GCGATGACTT AGGAAGT AAACGTGCCCTC ATTAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 213)

LiDell-Sce rev

ATGAGGGCACGTTTACTTCCTAAGTCATCGCTCTTTAGTTGGGAGGAAAGGCCAG TGTT AC A ACC A ATT A AC C_(SE Q ID N° 214)

LiDelPCR for

TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGGCJ7TCC TCCCAACTAAAGAGC (SEP ID N° 215)

LiDelPCR rev

ATGAGGGCACGTTTACTTCCT_(SEQ ID N° 216)

M mutagenesis

MDell-Sce for

TTTCCTTTCCCTGTAA CA4JGGTTACATTCTAAACGAACTAACTTGCTTTTAGGGAT AACAGGGTAATCGATTT_(SEQ ID N° 217)

MDell-Sce rev

AAAGCAAGTTAGTTCGTTTAGAATGTAACCATTGTTACAGGGAAAGGAAAGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 218)

MDelPCR for TCGACGAAATTTTTTTTTATACAGTGTGTGGCCGCGAGAGGGTTAGAGGG772ECI TTCCCTGTAACAATG (SEP ID N° 219)

MDelPCR rev

AAAGCAAGTTAGTTCGTTTAG_(SEQ ID N° 220)

N mutagenesis

NDell-Sce for

CAGTTTTC TC TGGGAA TTA CA TCGTCCTGATTGTCGCGAC ATGGAATGGATAGGGA TAACAGGGTAATCGATTT_(SEQ ID N° 221)

NDell-Sce rev

TCCATTCCATGTCGCGACAATCAGGACGATGTAATTCCCAGAGAAAACTGGCCA GTGTTACAACCAATTAACC_(SEQ ID N° 222)

NDelPCR for

CGGCCCCGCGCATGCGCGGTCATGTAGAGGGCGCTTCCTATTTTGGAGTTC4GJrr TCTCTGGGAATTACA (SEP ID N° 223)

NDelPCR rev

TCCATTCCATGTCGCGACAAT_(SEQ ID N° 224)

(iv) Two-step Red recombination method for mutagenesis of pRB-lB BAC

For mutagenesis of pRB-lB BAC, we used the two-step recombination methodology (Tischer et al, 2006; 2010). This procedure consists on the use of the Red recombination system associated to the use of the megaendonuclease I-Scel. A positive selection marker, used to introduce the desired modification through the first Red recombination, was removed by the second and intra-molecular Red recombination through previously introduced sequence duplication.

Generation of a transfer PCR construct

Precisely, we generated a transfer PCR construct which contained 50 nt homologous to the 5' sequence flanking the targeted sequence to be deleted, upstream the 60 bp repeats i.e. the same sequence for both beta and alpha deletions (Figure 2A, 2B, 2C, 2D, shown by a black box), 20 nt from the inserted positive selection marker i.e. aphAI which confers kanamycin resistance, an adjoining I-Scel site, and a duplication of 51 nt, homologous to the 3' sequence flanking the targeted sequence to be deleted in the first intron of the LAT gene, i.e. 142,544 nt to 143389 nt for the beta deletion and 142,544 nt to 143535 nt for the alpha deletion (Figure 2A, 2B, 2C, 2D, shown by a grey box). The positive selection marker, aphAl or kan^R, and the I-Scel restriction site used to introduce the desired modification in a first step of recombination were amplified by two successive PCRs from the pEPkan-S2 plasmid with appropriate primers (Table 1). PCRs were performed from 2 ng of template with GoTaq® DNA Polymerase (Promega). After PCR amplification, digestion of PCR products with Dpnl was performed at 37°C during 1 h. PCR products were gel-purified, after a 0,7% agarose electrophoresis by using the NucleoSpin Gel & PCR Clean-up® kit (Macherey-Nagel). In order to verify the PCR product integrity, amplicon was cloned using the pGEM-T Easy Vector Systems® (Promega). After an overnight incubation at 12°C, the ligation mix was electroporated into electrocompetent E. coli TGI with the following settings: 15 kV/cm (1,5 kV with 0, 1 cm cuvettes), 25[iF and 200Ω. Electroporated bacteria were spread on LB-agar plates with ampicilline, X-gal (5- bromo-4-chloro-indolyl-P-D-galactopyranoside) and IPTG (Isopropyl β-D-l- thiogalactopyranoside) and incubated at 37°C during the night. A PCR screening was performed in order to control the cloning efficiency. After gel-purification, positive clones were sequenced by ©Eurofins MWG Operon services.

Preparation of electrocompetent E. coli EL250 or GS1783 (Tischer et al. 2006; 2010) E. coli EL250 or GS1783 bacteria containing BACs was grown overnight in lOmL LB containing chloramphenicol for BAC selection, and grown overnight at 32°C with shaking at 200rpm (rotation per minute). Ten milliliters of the overnight culture was inoculated to new LB medium at a 1 :20 ratio with chloramphenicol, shaked at 32°C and 200rpm until soo reached 0,5nm. Then, culture was placed in a 42°C water bath and vigorously shaked during 15min in order to induce the Red recombination system. Bacteria growth was stopped by placing the culture on ice during 20min. Three wash steps were performed with ice-cold water after a spin down at 4°C at 4500g for 5min. The bacterial pellet was resuspended in 10% glycerol at 1 : 100 of culture volume.

Electroporation and first Red Recombination

One hundred nanograms of the transfer vector were electroporated into 50μΕ bacteria with the following settings: 15 kV/cm (1,5 kV with 0,1 cm cuvettes), 25[iF and 200Ω. LB medium (950[iL) was added to the electroporated bacteria and after an incubation at 32°C, 200rpm for lh, bacteria were spread on LB-agar plates with appropriate antibiotics, chloramphenicol and kanamycin. Positive clones were selected by PCR and RFLP (restriction fragment length polymorphism) and subsequently amplified in overnight culture. Electrocompetent cells were prepared without the 42°C induction step. Then, expression of the I-Scel enzyme was provided either through electroporation of lOOng of pB AD-I-scel as previously described or through 1% arabinose induction. Positive bacteria were selected on agar plates containing chloramphenicol, kanamycin and ampicillin.

Second Red recombination

The second Red recombination was performed as the first without selection for the positive marker kan^R. A 1% arabinose induction was performed in order to allow the BAC cleavage by the I-Scel enzyme. Bacteria were plated on agar plates containing chloramphenicol and ampicillin, and incubated at 32°C during the night. Loss of the positive selection marker was checked by selective medium and PCR done as previously described. In order to loose p-BAD, positive clones were cultured on agar plates with or without ampicillin, and, finally, those clones which had lost ampicillin resistance were selected for the continuation of mutagenesis,

(v) DNA Analyses:

To check the deletions in pRB lB BAC constructs, PCR amplification with the appropriate primers was performed on DNA purified from pRB lB mutant constructs with the silica-based affinity chromatography NucleoBond® Xtra Midi kit (Macherey Nagel).

To assess whether the mutagenesis procedure introduced any unwanted rearrangements or deletions, DNA from p-RB lB mutant constructs and parental pRB lB-5 was digested with EcoRI and separated on 0.7% agarose gels, and stained with ethidium bromide.

(vi) Reconstitution of BAC-derived viruses

B AC-derived viruses were reconstituted by transfection of secondary CEF with 1 μg of BAC DNA using Lipofectamine® (Invitrogen®) according to supplier instructions. Monolayer cells were cultured for 4-5 days, trypsinized and seeded on fresh, non-infected monolayer CEF for three successive passages.

(vii) Immunofluorescence assays:

For immunofluorescence assays (IF), secondary CEF were grown in 6- or 96-well plates and subsequently transfected with l g of pRB lB-5, ρΡνΒ ΙΒβΔΙ or pRB lBpA2 DNA as described below or infected with CVI988 vaccine. Cells were fixed with 1% of paraformaldehyde (PFA) at 4-5 days post transfection or infection. Immunofluorescence staining was performed with mouse monoclonal anti-VP5 antibody, clone 3F 19 (1 :200 dilution) (unpublished data) as the primary antibody and goat anti-mouse Alexa 488- conjugated secondary antibody (1 : 1000, Invitrogen). Cell nuclei were stained with Hoechst stain. (viii) Vims Titration

Virus titration was performed by serial dilution of frozen cells, seeded on fresh, non- infected monolayer CEF. Monolayer cells were cultured for 4-5 days and treated for IF assays. Virus plaques were identified through VP5 labelling. The virus titre in the sample was determined in triplicate and expressed as plaque-forming unit (PFU) per mL.

(ix) Statistical methods

Statistical analysis was carried out with the non-parametric Wilcoxon-Mann Whitney test, as implemented in "R: A language and environment for statistical computing".

(x) Nomenclature

The DNA bacmids are referred as pRBlB-5 for the parental strain, ρΡνΒΙΒΔβΙ, ρΡνΒ1ΒΔβ2, pRBlBAod, pRBlBAa2, ρΡνΒΙΒΔαβΙ, ρΡνΒ1ΒΔαβ2 for the different DNA bacmid recombinant deleted constructs.

Virus particles reconstituted from transfection with DNA bacmids in CEF are referred as BACRBlB-5 for the parental strain, ΒΑΟ ΒΙΒΔβΙ, ΒΑΟ Β1ΒΔβ2, BACRBlBAod, BACRBlBAa2, ΒΑΟ ΒΙΒΔαβΙ, ΒΑΟ Β 1ΒΔαβ2 for the recombinant deleted constructs.

The present invention provides a composition comprising a set of avian herpes virus subtypes, in particular sub types GaHV-2, GaHV-3 or HVT

each subtype consisting in a genome having (a) deletion (s), of at least 60 base pair, in a promoter for the latency-associated transcript (LAT) gene,

said genome comprising a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IRs or TRs comprises at least one copy of said LAT gene,

said deletion of at least 60 base pair in a promoter for the latency-associated transcript (LAT) gene being in either the IRs segment and/or in the TRs segment,

said deletion ending at most downstream a microRNA (miRNA) cluster,

said composition inducing a decrease in viremia or in viral load of at least equal to 3 times- fold that of a CVI988 vaccine used at the same dose or being stable over at least 10 passages of chicken embryonic fibroblasts in vitro, preferably after at least 20 passages of chicken embryonic fibroblasts in vitro.

In a preferred embodiment, the present invention provides a composition comprising a set of avian herpes virus subtype(s), in particular subtype(s)of a GaHV-2 virus, each subtype consisting in a genome having (a) deletion (s), of at least 60 base pair, in a promoter for the latency-associated transcript {LAT) gene,

said genome comprising a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IRs or TRs comprises at least one copy of said LAT gene,

said deletion of at least 60 base pair in a promoter for the latency-associated transcript (LAT) gene being in either the IRs segment and/or in the TRs segment,

said deletion ending at most downstream a microRNA (miRNA) cluster,

said composition being stable over at least 10 serial passages in chicken embryo fibroblasts, or said composition inducing a decrease in viremia or in viral load of at least equal to at least 3 times-fold that of a CVI988 vaccine used at the same dose. Advantageously, the present invention provides a composition comprising a set of avian herpes virus subtype(s), in particular subtype(s) of a GaHV-2 virus, each subtype consisting in a genome having (a) deletion (s), of at least 60 base pair, corresponding to SEQ ID N°31, said genome comprising a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IRs or TRs comprises at least one copy of a 60 base pair repeat sequence segment (60bpRS), corresponding to SEQ ID N° 31, said deletion being in either the IRs segment and/or in the TRs segment, said deletion of at least one of the said 60 bpRS, being located in the promoter for the latency-associated transcript {LAT) gene,

said deletion ending at least upstream the mdvl-miR-M8-M10 microRNA (miRNA) cluster of the first intron of the LAT gene, said cluster comprising from 5' to 3' the miR-M8, miR- M6, miR-M7 and miR-MlO, said composition inducing a decrease in viremia or in viral load of at least equal to 3 times-fold that of a CVI988 vaccine used at the same dose or said composition being stable over at least 10 serial passages in chicken embryo fibroblasts,

In a preferred embodiment, the present invention provides a composition comprising a set of avian herpes virus subtype(s), in particular subtype(s) of a GaHV-2 virus, each subtype consisting in a genome having (a) deletion (s), of at least 60 base pair, corresponding to SEQ ID N°31,

said genome comprising a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IRs or TRs comprises at least one copy of a 60 base pair repeat sequence segment (60bpRS), corresponding to SEQ ID N° 31, said deletion being in either the IRs segment and/or in the TRs segment, said deletion of at least one of the said 60 bpRS, being located in the 5 'region of the promoter for the latency-associated transcript (LAT) gene, said deletion ending at least upstream the mdvl-miR-M8-M10 microRNA (miRNA) cluster of the first intron of the LAT gene, said cluster comprising from 5' to 3' the miR-M8, miR- M6, miR-M7 and miR-MlO,

said composition being stable over at least 10 serial passages in chicken embryo fibroblasts.

In a more preferred embodiment the present invention provides a composition comprising a set of avian herpes virus GaHV-2 subtype(s), each subtype consisting in a genome having (a) deletion (s), of at least 60 base pair, corresponding to SEQ ID N° 31,

said genome (when having no deletion) comprises a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IR_S or TR_S comprises at least one copy of a 60 base pair repeat sequence segment (60bpRS motif), [corresponding to SEQ ID N° 31], said deletion being in either the IRs segment and/or in the TRs segment,

said deletion of at least one of the said 60 bpRS, being located in the promoter of the latency- associated transcript {LAT) gene,

said deletion ending at least upstream the mdvl-miR-M8-M10 microRNA (miRNA) cluster of the first intron of the LAT gene said cluster comprising from 5' to 3' the miR-M8, miR-M6, miR-M7 and miR-MlO,

said composition inducing a decrease in viremia or in viral load of at least 3 times-fold that of a CVI988 vaccine used at the same dose or said composition being stable over at least 10 serial passages in chicken embryo fibroblasts.

The composition provided is a composition wherein the set of avian herpes virus subtype(s) comprises one or several avian herpes virus subtype(s).

In the present invention, a set of avian herpes virus subtype(s), means one or several avian herpes virus subtype(s).

In general, a set of avian herpes virus subtype(s), means one or several subtype(s) of a GaHV- 2 virus or GaHV-2 subtype(s), in particular one or several subtype(s) of a GaHV-2 virus. An avian herpes virus subtype(s), is an avian herpes virus genome, a bacmid, an artificial chromosome, a nucleotide construction, a virus, a cell-associated virus comprising one avian herpes virus genome, in particular a GaHV-2 virus genome comprising a deletion of at least 60 base pair, or 60 bp RS motif, corresponding to SEQ ID N°31, The composition of the invention has an immunogenic activity equal to or higher that of a CVI988 vaccine used at the same dose.

In particular, vaccines may be selected from CVI988 vaccine, CVI988, HVT or HVT+SBl (containing the FC-126 strain of turkey herpesvirus and the SB-1 strain of chicken herpesvirus).

An avian herpes virus GaHV-2 genome comprising a SEQ ID N°: 3 (beta) and/or with a SEQ ID N°: 2 (alpha) for use as a vaccine is another object of the present invention. A use of an avian herpes virus GaHV-2 genome comprising a SEQ ID N°: 3 (beta) and/or with a SEQ ID N°: 2 (alpha) as an active substance in a vaccine is another object of the invention. A stable vaccine comprising an avian herpes virus GaHV-2 genome with a SEQ ID N°:3 (beta) and/or with a SEQ ID N°:2 (alpha).

The present invention provides a stable composition comprising a Gallid Herpes Virus (GaHV-2) with at least a deletion of a 60bp repeated sequence in the 5' LAT gene promoter, a vaccine comprising said composition.

The composition of the invention is stable over at least 10 serial cultures or serial passages on chicken fibroblasts in vitro or at least 20 serial cultures or serial passages on chicken fibroblasts in vitro. Preferably, the composition of the invention is stable over at least 30, or at least 40, or at least 50, or at least 60 or at least 70, or at least 80, or at least 90, or at least 100 serial cultures or serial passages on chicken fibroblasts in vitro and more preferably at least 80 serial cultures or serial passages on chicken fibroblasts in vitro.

The composition of the invention has an immunogenic activity that reduces viral load in animals infected with an avian herpes virus to a greater extend than a CVI988 vaccine.

By "to a greater extend", means that said composition induces a 2 to 5 time greater decrease in viral load, as compared to a CVI988 vaccine. In particular, the composition of the invention is inducing a decrease in viral load of at least 2 times that of a CVI988 vaccine used at the same dose.

In a preferred embodiment, the composition of the invention is inducing a decrease in viral load of at least 3 times that of a CVI988 vaccine used at the same dose, in a more preferred embodiment said decrease in viral load is at least 4 times that of a CVI988 vaccine, used at the same dose.

In any case, the present invention provides a vaccine composition inducing a 0.15 to 8 log 10 decrease in viral load, in animal challenged with an avian herpes virus, in particular a GaHV- 2 virus as compared to non vaccinated animal challenged with said avian herpes virus (in particular a GaHV-2 virus) at the same dose.

Advantageously, the present invention provides a vaccine composition inducing a 2 to 5 loglO decrease in viral load as compared to viral load measured, in animals vaccinated with a CVI988 vaccine and challenged with a virulent GaHV-2 virus at the same dose.

As compared to animal vaccinated with a known vaccine, for example with a CVI988 vaccine, used at the same dose, the reduction in viral load induced by the composition according to the invention is increased by a factor 1.5, preferably a factor 2 and more preferably a factor 3 or 4 that of animal vaccinated with a known vaccine, for example with a CVI988 vaccine.

The decrease in viral load induced by the composition according to the invention results in a stronger protection and less pathogenic effect in organs as compared to CVI988 vaccinated animals.

In a particular embodiment animals are challenged or infected with a very virulent avian herpes virus, in particular with a highly virulent avian herpes virus, and preferably with a very virulent avian herpes GaHV-2 virus, in particular with a highly virulent avian herpes GaHV-2 virus.

The present invention provides a vaccine composition that can overcome such infection and significantly alter an epidemia related to a very virulent GaHV-2 avian herpes virus, in particular related to a highly virulent GaHV-2 avian herpes virus.

The vaccine composition may protect birds against highly virulent GaHV-2 viruses as the prototypes RB-IB, Md-5 strains and any GaHV-2 strain classified as highly virulent strain (Witter, 1997) and against the highly virulent plus GaHV-2 viruses as the 648 A strain and any GaHV-2 strain classified as highly virulent plus strain (Witter, 1997).

In a particular embodiment the present invention provides a composition, in particular a vaccine composition which is efficient in vaccinating and protecting animals against a very virulent avian herpes virus, in particular against a highly virulent avian herpes virus. In particular embodiments, viral load is measured at day 10 post infection, preferably at day 15, and more preferably at day 21 or 30 or 69 post infection. Preferably the amount of vaccine, or the dose of vaccine according to the invention required to protect animals against an avian herpes virus infection according to the invention is comprised between from 100 to 2000 Plaque Forming Units, (PFU , preferably between from 500 and 2000 (PFU), preferably 10, 100, 1000, or 10 000 PFU. A stable composition according to the invention is a composition containing between from 0 to 10 %, or a non detectable amount, as determined by PCR and cloning using SEQ ID N° 104, SEQ ID N° 47, or SEQ ID N° 105 and SEQ ID N° 106. as primers,

of an avian herpes virus genome corresponding to the wild type virus, or to a revertant virus, after infection and at least 20 successive serial passages cultures., preferably 30 serial passages, more preferably 50 serial passages, even more preferably 70 serial passages.

A revertant virus means a mutant virus or a virus with a deleted genome, or a deleted virus that has reverted to its former genotype or to the original or wild type phenotype by means of a suppressor mutation, or suppressor deletion or else by compensatory mutation or deletion at the same location than said deletion or somewhere else in the gene or genome (second site reversion).

A stable composition according to the invention is a composition containing between 0, and 10 %, or a non detectable amount, as determined by PCR and cloning

using SEQ ID N° 104 and SEQ ID N° 47, or SEQ ID N° 105 and SEQ ID N° 106, as primers, of an avian herpes virus genome comprising at least 60 base pair, in particular at least 60 base pair corresponding to SEQ ID N°31, after infection and at least 20 successive serial passages cultures, preferably 30 serial passages, more preferably 50 serial passages, even more preferably 70 serial passages.

A stable composition according to the invention is a composition containing between 0 and 10 %, or a non detectable amount of a genome as determined by PCR and cloning using SEQ ID N° 104, SEQ ID N° 47, or SEQ ID N° 105 and SEQ ID N° 106, as primers, of an avian herpes virus genome comprising at least 60 base pair, in particular at least 60 base pair corresponding to SEQ ID N°31 after infection of 80 successive serial passages cultures.

In one embodiment, said composition of the invention is inducing a decrease in viral load comparable to that of a CVI988 vaccine used at the same dose and is stable over at least 20 cultures in chicken embryonic fibroblasts in vitro.

Characterizing the genetic stability of a vaccine virus means measuring the influence of serial passage (at least 10 passages) in a cell substrate on retention of a mutation or a deletion. In the present invention, retention of a deletion of at least one 60 base pair, or of at least one 60 base pair motif, corresponding to SEQ ID N°31 or to any one of the sequence selected from SEQ ID N° 48 to SEQ ID N° 76, in particular SEQ ID N°48 or SEQ IDN°49 is measured after at least 10 passages in chicken embryonic fibroblasts or at least 69 days after injection in a host.

In a preferred embodiment, retention of deletion means retention of a deletion of at least one 60 base pair, in particular at least one 60 base pair motif, corresponding to SEQ ID N°31 or retention of a deletion selected from SEQ ID N° 48 to SEQ ID N° 76, preferably SEQ ID N° 48 and/or SEQ ID N° 49, and is detected after at least 10 passages in chicken embryonic fibroblasts, preferably at least after 20 serial passages in chicken embryonic fibroblasts or at least 30 days after injection in a host.

In the present invention, said deletion can be in either the IRs segment and/or in the TRs segment, preferably in the IRs segment and in the TRs segment. In the composition according to the present invention, the set of avian herpes virus subtype(s) comprises one or several avian herpes virus subtype(s).

In a preferred embodiment, the composition according to the present invention, comprises one or several GaHV-2 subtype(s).

In an embodiment, said deletion of at least one 60 base pair comprises the following sequence:

XXXX(TGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCGGTCATGT AGAGGGCGCG)„X(XXXXXXXXXX)m wherein n is 1- 20; m is 20 to 160 and X is A, or T, or G or C.

In a preferred embodiment said deletion consists at least in a deletion of the following sequence:

(TGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCGGTCATGTAGA GGGCGCG)„ with n is 1- 20.

In another particular embodiment, said deletion is a deletion of at least one 60 base pair motif consisting in at least a deletion of a fragment corresponding to SEQ. ID N°31.

In general, said deletion ends at least upstream the mdvl-miR-M8-M10 microRNA (miRNA) cluster of the first intron of the LAT gene said cluster comprising from 5' to 3' the miR-M8, miR-M6, miR-M7 and miR-MlO. According to an embodiment of the invention, the deletion ends at least at the nucleotide preceding the nucleotide located at the position 5' of the mdvl-miR-M8-M10 microRNA (miRNA) cluster

According to another embodiment of the invention, the deletion ends at least at the nucleotide located at position 3'of the mdvl-miR-M8-M10 microRNA (miRNA) cluster, in the first intron of the LAT gene,

According to another embodiment of the invention, the deletion ends at most about 500 nucleotides, in particular 400, 300, 200, 100, downstream the 3' extremity of the mdvl-miR- M8-M10 microRNA (miRNA) cluster.

The composition according the invention comprises a deletion, said deletion starts from at least at a nucleotide located at position 5 'of the LAT promoter to a nucleotide located at position 3' of the first 60bpRS, in particular starts at a nucleotide located at most at position 5 ' of the LA T promoter to 4 nucleotides upstream the first 60bpRS motif.

In general, said deletion of at least one of the said 60 bp motif, starts from the 5 'extremity of the promoter for the latency-associated transcript (LAT) gene. In a preferred embodiment said deletion starts 4 nucleotides upstream said first 60 bpRS motif. In another preferred embodiment said deletion starts in the first 60 bpRS motif.

In a more preferred embodiment, said deletion starts at, and encompasses a 4 nucleotides sequence CGCG upstream a 60 bpRS motif (underlined):

CGCGTGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCGGTCATGT AGAGGGCGCG (SEQ ID N° 115)

In another embodiment said deletion starts at and encompasses the two last nucleotides of the first 60 bpRS motif (at the 3' end) :

TGCGCAGTCGGAGT T T TCCTAT T TTCGGCCCCGCGCATGCGCGGTCATGTAGAGGGCG§G

The composition according the invention comprises a deletion, said deletion starts at least at a nucleotide located at position 5'of the LAT promoter to a nucleotide located at position 3' of the first 60bpRS, in particular starts at a nucleotide located at most at position 5'of the LAT promoter to a nucleotide located at position 5' of the first 60bpRS and said deletion ends at least at the nucleotide located at position 5'of the mdvl-miR-M8-M10 microRNA (miRNA) cluster in the first intron of the LAT gene.

The composition according the present invention comprises a deletion, said deletion starts at least at a nucleotide located at position 5'of the LAT promoter to a nucleotide located at position 3' of the first 60bpRS, in particular starts at a nucleotide located at most at position 5'of the LAT promoter to a nucleotide located at position 5' of the first 60bpRS and wherein said deletion ends at least at the nucleotide located at position 3'of the mdvl-miR- M8-M10 microRNA (miRNA) cluster, in the first intron of the LAT gene.

The composition according the present invention comprises a deletion, said deletion starts at least at a nucleotide located at position 5'of the LAT promoter to a nucleotide located at position 3' of the first 60bpRS, in particular starts at a nucleotide located at most at position 5'of the LAT promoter to a nucleotide located at position 5' of the first 60bpRS and at most about 500 nucleotides downstream the 3' of the mdvl-miR-M8-M10 microRNA (miRNA) cluster. In a preferred embodiment said deletion starts at most about 400 nucleotides upstream the 3' extremity of the mdvl-miR-M8-M10 microRNA (miRNA) cluster, more preferably about 300 nucleotides upstream the 3' of the mdvl-miR-M8-M10 microRNA (miRNA) cluster, even more preferably about 200 or 100 nucleotides upstream the 3' of the mdvl-miR-M8-M10 microRNA (miRNA) cluster.

The composition according the invention comprises an avian herpes virus subtype, which is a subtype selected from the group consisting of: - a beta subtype comprising a genome with a beta deletion, said beta deletion extending from the 5' extremity of the LAT gene promoter to a nucleotide located at position 5 'of the microRNA (miRNA) cluster.

- an alpha subtype comprising a genome with an alpha deletion, said alpha deletion extending from the 5' extremity of the LAT gene promoter to a nucleotide located in the microRNA

(miRNA) cluster.

- a gamma subtype comprising a genome with a gamma deletion, said gamma deletion extending from the 5' extremity of the LAT gene promoter to the nucleotide located down stream a microRNA (miRNA) cluster, or a mixture thereof

In a preferred embodiment the vaccinal part of said composition consists in a subtype selected from the group consisting of: - a beta subtype comprising a genome with a beta deletion, said beta deletion extending from the 5' extremity of the LAT gene promoter to a nucleotide located at position 5 'of the microRNA (miRNA) cluster.

- an alpha subtype comprising a genome with an alpha deletion, said alpha deletion extending from the 5' extremity of the LAT gene promoter to a nucleotide located in the microRNA

(miRNA) cluster.

- a gamma subtype comprising a genome with a gamma deletion, said gamma deletion extending from the 5' extremity of the LAT gene promoter to the nucleotide located down stream a microRNA (miRNA) cluster, or a mixture thereof

The composition according to the invention is a composition wherein said avian herpes virus subtype is a subtype selected from the group consisting of

- a beta subtype comprising a genome with a beta deletion, said beta deletion extending from the nucleotide located at position 5' of the first 60bpRS to the nucleotide located at position 5 Of the mdvl-miR-M8-M10 microRNA (miRNA) cluster in the first intron of the LAT gene,

- an alpha subtype comprising a genome with an alpha deletion, said alpha deletion extending from the nucleotide located at position 5' of the first 60bp RS to the nucleotide located at position 5' of the miR-M6 in said mdvl-miR-M8-M10 microRNA (miRNA) cluster, - a gamma subtype comprising a genome with a gamma deletion, said gamma deletion extending from the nucleotide located at position 5' of the first 60bpRS to the nucleotide located at position 3' of the miR-MlO in said mdvl-miR-M8-M10 microRNA (miRNA) cluster, The composition according the invention comprises an avian herpes virus subtype, in particular a GaHV-2 subtype, which is a subtype selected from the group consisting of:

- a beta subtype comprising a genome with a beta deletion, said beta deletion extending from 4 nucleotides upstream the nucleotide located at position 5' of the first 60bpRS to the nucleotide located at position 5 'of the mdvl-miR-M8-M10 microRNA (miRNA) cluster

- an alpha subtype comprising a genome with an alpha deletion, said alpha deletion extending from the nucleotide located at position 5' of the first 60bp RS to the nucleotide located at position 5' of the miR-M6 in said mdvl-miR-M8-M10 microRNA (miRNA) cluster,

- a gamma subtype comprising a genome with a gamma deletion, said gamma deletion extending from the nucleotide located at position 5' of the first 60bpRS to the nucleotide located at position 3' of the miR-MlO in said mdvl-miR-M8-M10 microRNA (miRNA) cluster, or a mixture thereof The present invention provides a composition comprising a set of avian herpes virus GaHV- 2 subtype(s), each subtype consisting in a genome having (a) deletion (s), of at least a 60 base pair repeat sequence segment (60bpRS motif), [corresponding to SEQ ID N° 31],

said genome (when having no deletion) comprises a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IR_S or TR_S comprises at least one copy of a 60 base pair repeat sequence segment (60bpRS motif), [corresponding to SEQ ID N° 31], said deletion being in either the IRs segment and/or in the TRs segment,

said deletion of at least one of the said 60 bpRS, being located in the 5'region of the latency- associated transcript (LAT) gene, in the promoter of the latency-associated transcript (LAT) gene,

said deletion ending at least upstream the mdvl-miR-M8-M10 microRNA (miRNA) cluster of the first intron of the LAT gene said cluster comprising from 5' to 3' the miR-M8, miR-M6, miR-M7 and miR-M 10,

said composition being stable over at least 10 passages in chicken embryonic fibroblasts, in vitro.

In a preferred embodiment, the composition according the invention comprises an avian herpes virus subtype which is a subtype selected from the group consisting of:

- a beta subtype comprising a genome with a beta deletion, said beta deletion extending from at position 5,' 4 nucleotides upstream the first 60bpRS motif to the nucleotide located at position 5'of the mdvl-miR-M8-M10 microRNA (miRNA) cluster in the first intron of the L^Jgene,

- an alpha subtype comprising a genome with an alpha deletion, said alpha deletion extending from at position 5,' 4 nucleotides upstream the first 60bp RS motif to the nucleotide located at position 5' of the miR-M6 in said mdvl-miR-M8-M10 microRNA (miRNA) cluster,

- a gamma subtype comprising a genome with a gamma deletion, said gamma deletion extending from at position 5,' 4 nucleotides upstream the first 60bpRS motif to the nucleotide located at position 3' of the miR-MlO in said mdvl-miR-M8-M10 microRNA (miRNA) cluster, or a mixture thereof In another preferred embodiment, the composition according the invention comprises an avian herpes virus subtype which is a subtype selected from the group consisting of:

- a beta subtype (the genome of said beta subtype comprising a SEQ ID N°3) comprising a genome with a beta deletion (SEQ ID N°49), said beta deletion extending from the 4^th nucleotide located before the position 5' of the first 60bpRS to a nucleotide located at position 5 Of the mdvl-miR-M8-M10 microRNA (miRNA) cluster in the first intron of the LAT gene

- an alpha subtype (the genome of said alpha subtype comprising a SEQ ID N°2) comprising a genome with an alpha deletion (SEQ IDN°48), said alpha deletion extending from the nucleotide located at position 5' of the first 60bp RS to the nucleotide located at position 5' of the miR-M6 in said mdvl-miR-M8-M10 microRNA (miRNA) cluster, in the first intron of the LAT gene,

- a gamma subtype (the genome of said gamma subtype comprising a SEQ ID N°4) comprising a genome with a gamma deletion (SEQ ID N° 50), said gamma deletion, extending from the nucleotide located at position 5' of the first 60bpRS to the nucleotide located at position 3' of the miR-MlO in said mdvl-miR-M8-M10 microRNA (miRNA) cluster, in the first intron of the LAT gene, or a mixture thereof

In a more preferred embodiment, the composition according the invention comprises an avian herpes virus GaHV-2 subtype which is a GaHV-2 subtype selected from the group consisting of: - a beta subtype (the genome of said beta subtype comprising a SEQ ID N°3) comprising a genome with a beta deletion of SEQ ID N°49,

- an alpha subtype (the genome of said alpha subtype comprising a SEQ ID N°2) comprising a genome with an alpha deletion (SEQ IDN°48),

- a gamma subtype (the genome of said gamma subtype comprising a SEQ ID N°4) comprising a genome with a gamma deletion (SEQ ID N° 50),

or a mixture thereof In other embodiments, the composition according to the invention comprises an avian herpes virus subtype which is a GaHV-2 subtype comprising a sequence selected from SEQ ID N°2, SEQ ID N°3, SEQ ID N°4, SEQ ID N°5, SEQ ID N°6, SEQ ID N°7, SEQ ID N°8, SEQ ID N°9, SEQ ID N°10, SEQ ID N°l l, SEQ ID N°12, SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, SEQ ID N°19, SEQ ID N°20, SEQ ID N°21, SEQ ID N°22, SEQ ID N°23, SEQ ID N°24, SEQ ID N°25, SEQ ID N°26, SEQ ID N°27, SEQ ID N°28, SEQ ID N°29, and SEQ ID N°30.

In other embodiments, the composition according to the invention comprises one or several avian herpes virus subtype(s), in particular GaHV-2 subtypes, said GaHV-2 subtypes comprising a sequence selected from SEQ ID N°2, SEQ ID N°3, SEQ ID N°4, SEQ ID N°5, SEQ ID N°6, SEQ ID N°7, SEQ ID N°8, SEQ ID N°9, SEQ ID N°10, SEQ ID N°l 1, SEQ ID N°12, SEQ ID N°13, SEQ ID N°14, SEQ ID N°15, SEQ ID N°16, SEQ ID N°17, SEQ ID N°18, SEQ ID N°19, SEQ ID N°20, SEQ ID N°21, SEQ ID N°22, SEQ ID N°23, SEQ ID N°24, SEQ ID N°25, SEQ ID N°26, SEQ ID N°27, SEQ ID N°28, SEQ ID N°29, SEQ ID N°30.

The composition according the present invention comprises as deletion said deletion is a deletion of nucleotides which are contiguous in said genome when having no deletion.

The composition according the present invention comprises as deletion said deletion is a deletion of contiguous nucleotides.

The composition according the present invention comprises a deletion of 200 to 1600 nucleotides, preferably of 845(β) to 1000 nucleotides, and more particularly to 845(β) to 941(a) nucleotides.

In preferred embodiments, the composition according the present invention comprises the deletion of a fragment selected from SEQ ID N°48, SEQ ID N°49, SEQ ID N°50, SEQ ID N°51, SEQ ID N°52, SEQ ID N°53, SEQ ID N°54, SEQ ID N°55, SEQ ID N°56, SEQ ID N°57, SEQ ID N°58, SEQ ID N°59, SEQ ID N°60, SEQ ID N°61, SEQ ID N°62, SEQ ID N°63, SEQ ID N°64, SEQ ID N°65, SEQ ID N°66, SEQ ID N°67, SEQ ID N°68, SEQ ID N°69, SEQ ID N°70, SEQ ID N°71, SEQ ID N°72, SEQ ID N°73, SEQ ID N°74, SEQ ID N°75, SEQ ID N°76. In a more preferred embodiment said deletion represents a fragment of SEQ ID N°49.

The composition according the present invention comprises more than 90% of an alpha subtype or more than 90% of a beta subtype bearing a beta deletion, with respect to the total number of subtypes.

In one embodiment, the composition according the present invention comprises a set of avian herpes virus subtype(s) comprising at least 25 % of a beta subtype with respect to the total number of subtypes, or at least 50 % of a beta subtype with respect to the total number of subtypes.

In another embodiment, said set of avian herpes virus subtype(s) is comprising at least 46 or 50 % of a beta subtype with respect to the total number of subtypes. In another embodiment, the composition according the present invention comprises a set of avian herpes virus subtype(s) comprising at least 52 % or at least 60 % of an alpha subtype with respect to the total number of subtypes.

In another embodiment, said set of avian herpes virus subtype(s) is comprising at least 57 or 60 % of an alpha subtype with respect to the total number of subtypes.

In a preferred embodiment, the composition according to the invention comprises more than 60% of an alpha subtype, or more than 50 % of a beta subtype with respect to the total number of subtypes.

In general, the composition according the invention comprises a set of avian herpes virus subtype(s), in particular GaHV-2 subtypes comprising one or several avian herpes virus subtype(s), in particular one or several GaHV-2 subtypes said subtype having:

one alpha deletion in IRs and one alpha deletion in TRs,

one alpha deletion in IRs and one beta deletion in the TRs,

one beta deletion in IRs and one alpha deletion in TRs, or

one beta deletion in IRs and one beta deletion in TRs. In one most preferred embodiment, the composition according the invention consists in 100% of an alpha subtype with one alpha deletion in IRs and one alpha deletion in TRs or the composition according the invention consists in 100% of a beta subtype with one beta deletion in IRs and one beta deletion in TRs.

In a preferred embodiment, the composition according to the invention comprises or consists in an avian herpes virus GaHV-2 subtype comprising an avian herpes virus GaHV-2 genome with a SEQ ID N°:3(beta) and/or with a SEQ ID N°:2 (alpha). The composition according to the invention is a composition wherein the genome

is present within a viral particle or a virus-like particle, in particular a cell-associated viral particle and more particularly a chicken embryonic fibroblast- associated viral particle

In a preferred embodiment, the composition according to the invention is a composition wherein the viral particle or the virus-like particle or the cell-associated virus is a recombinant GaHV Type 2 virus.

In a more preferred embodiment, the composition according to the invention is a composition wherein the viral particle or the virus-like particle is a recombinant GaHV Type 2 virus.

The present invention provides a composition comprising a GaHV Type 2 virus comprising a deletion encompassing in the promoter for the latency-associated transcript (LAT) gene, at least two 60 base pair (bp) repeat sequence segments (60 bp RS motif) located at each end of a unique short region (Us) in inverted short repeat sequence (IRs and TRs) segment and regions encoding microRNAs mdvl-miR-M8-M10.

The present invention provides a composition comprising a set of GaHV Type 2 virus subtypes, said subtype(s) comprising one or more additional deletion encompassing the promoter for the latency-associated transcript {LAT) gene, at least two 60 base pair (bp) repeat sequence segments (60 bp RS motif) located at each end of a unique short region (Us) in inverted short repeat sequence (IRs and TRs) segment and regions encoding microRNAs mdvl-miR-M8-M10. In a preferred embodiment, the composition comprises a virus which is derived from BACRlBlAa.

In another preferred embodiment, the composition comprises a virus which is derived from BACRlB lAp.

In a more preferred embodiment, the composition comprises a virus derived from BACRlBlAa, BACRB lBApl, BACRB lBAp2, or a mixture thereof.

The present invention provides a composition that further comprises an additional antigen.

In a preferred embodiment, the composition according to the invention comprises additional antigen comprising at least one of a turkey herpes virus antigen (HVT).

In a more preferred embodiment, the composition according to the invention comprises at least one of HVT genome or part of HVT genome.

The composition of the present invention is comprising an adjuvant, cytokine or other immunoregulatory agent. The composition of the present invention comprises a deletion of a segment derived from one of the RB-1B, CV1988 and 648 A genomes or any GaHV-2 or GaHV-3 genome.

22. In a preferred embodiment, the composition of the invention comprised one of the RB-1B, CV1988 and 648 A genomes or any GaHV-2 or GaHV-3 genome bearing a deletion encompassing at 5', the 5'extermity of the promoter of the LAT gene and at 3', the mdvl- miR-M8-M10 microRNA (miRNA) cluster.

The present invention provides a vaccine comprising a composition according the invention. A vaccine according to the present invention is provided for treating or preventing infection of an animal with Marek's disease. A vaccine according to the present invention is provided for treating an animal, said animal is an avian species selected from the group consisting of chicken, duck, turkey, quail, guinea- fowl, pheasant and pigeon. In a preferred embodiment, a vaccine according to the present invention is provided for treating an avian species which is a chicken.

In a particular embodiment, the composition of the invention is provided for use in the treatment or prevention of Marek's Disease in an animal.

In another particular embodiment, the composition of the invention is provided for use in the treatment or prevention of Marek's Disease in an animal wherein the animal is an avian species selected from the group consisting of a chicken, duck, turkey, quail, guinea-fowl, pheasant and pigeon.

In a preferred embodiment, the composition of the invention is provided for use in the treatment or prevention of Marek's Disease in an animal wherein the avian species is a chicken. The present invention provides a vaccine or a composition as described and claimed herein which elicits an immune response that is protective.

In an advantageous embodiment, the present invention provides a vaccine or a composition as described and claimed herein which is not immunosuppressive.

In a more advantageous embodiment, the present invention provides a vaccine or a composition as described and claimed herein which elicits an immune response that is protective and is not immunosuppressive. Immunosuppressive means that does not inhibit an immune response, in particular that does not inhibit an immune response naturally occurring against an infection by a pathogen or that does not inhibit an immune response which is inhibited during an infection by a mardi virus, in particular a GaHV-2, a GaHV-3 or HVT virus. A protective response will be able to prevent or reduce the signs and symptoms of MD in a bird caused by infection with GaHV, in particular a GaHV Type 2 or other applicable pathogenic virus that receives a vaccine as described and embodied herein. The present invention also provides a genome of an avian herpes virus, said genome having (a) deletion (s), of at least 60 base pair motif, in particular having at least one deletion of at least one 60 base pair motif.

In a particular embodiment, said deletion of at least one 60 bp RS motif consists in a deletion of a fragment of SEQ ID N° 31.

In particular, a deletion according to the invention encompasses the following sequence:

(TGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCGGTCATGTAGAGGGCGCG)_n with n is 1- 20;

and in a more preferred embodiment said deletion consists in a deletion of the following sequence

XXXX(TGCGCAGTCGGAGTTTTCCTATTTTCGGCCCCGCGCATGCGCGGTCATGTAGAGGGC

GCG)_n(XXXXXXXXXX)m

wherein n is 1- 20; m is 20 to 160 and X is A, T, G or C.

In an even more preferred embodiment said deletion comprises or consists in a deletion of the sequence selected from SEQ ID N°48, SEQ ID N°49, SEQ ID N°50, SEQ ID N°51 SEQ ID N°52 SEQ ID N°53 SEQ ID N°54 SEQ ID N°55 SEQ ID N°56 SEQ ID N°57, SEQ ID N°58 SEQ ID N°59 SEQ ID N°60, SEQ ID N°61, SEQ ID N°62, SEQ ID N°63, SEQ ID N°64, SEQ ID N°65, SEQ ID N°66 SEQ ID N°67 SEQ ID N°68 SEQ ID N°69 SEQ ID N°70 SEQ ID N°71 SEQ ID N°72 SEQ ID N°73 SEQ ID N°74 SEQ ID N°75 SEQ ID N°76.

In a particular embodiment said deletion comprises or consists in a deletion of the sequence selected from_SEQ ID N°77, SEQ ID N°78, SEQ ID N°79, SEQ ID N°80, SEQ ID N°81, SEQ ID N°82, SEQ ID N°83, SEQ ID N°84, SEQ ID N°85, SEQ ID N°86, SEQ ID N°87, SEQ ID N°88, SEQ ID N°89, SEQ ID N°90, SEQ ID N°91, SEQ ID N°92, SEQ ID N°93, SEQ ID N°94, SEQ ID N°95, and in particular a deletion corresponding to fragment of SEQ ID N°96, SEQ ID N°97, SEQ ID N°98, SEQ ID N°99, SEQ ID N°100, SEQ ID N° 101, SEQ ID N°102, SEQ ID N°103, SEQ ID N°225. In a preferred embodiment, the present invention provides an avian herpes virus GaHV-2 genome with a SEQ ID N°:3 (beta) and/or with a SEQ ID N°:2 (alpha), in particular an avian herpes virus GaHV-2 genome with a SEQ ID N°:3 (beta) and/or with a SEQ ID N°:2 (alpha) for use as a vaccine.

EXAMPLE 1

Isolation of BAC ΚΒΙΒΔβ viruses

(i) Isolation of ρΚΒΙΒΔβ bacmid constructs

Isolation of ρΚΒΙΒΔβ bacmid constructs was carried out using the two-step recombination methodology as described above (Tischer et al, 2006). The first beta deletion was generated as briefly described. A transfer construct was generated from plasmid pEPkanS-2 by two successive PCR amplification using primers Beta Del I-Sce for and rev for the first one, and Beta Del PCR for and rev for the second one. After electroporation of this transfer construct into EL250 bacteria, Red recombination was induced at 42°C during 15 mn and bacterial clones resistant to kanamycin were isolated and screened by PCR with primers Beta del Seq for and rev (Tablel). One clone showing both expected PCR products with 1177 bp and 982 bp, corresponding to the βΙ-Sce insert and to the wild type 5' LAT region, respectively was isolated. The I-Scel enzyme was induced by electroporating the p-BAD-7- scel plasmid and adding 1% arabinose to excise Kan^R resistance gene that was achieved through induction of Red recombination. Recombinant clones that had lost kanamycine resistance were screened with Beta Del Seq for and rev primers (Table 1). One clone showing two PCR products, 138 bp and 982 bp corresponding to the beta deletion and to the wild type 5' LAT region, respectively was isolated. The deletion of the second copy of the 5' LAT region was performed by electroporation of the transfer construct into GS1783 bacteria, and further steps were carried out as previously described. After screening with Beta Del Seq for and rev primers, two bacterial clones showing one unique expected 138 bp PCR product were isolated and bacmid DNA was further analysed.

PCR amplification with primers Beta del Seq for and rev (Tablel) bordering the expected deleted region was performed on two selected clones of pRBlBAp, clones 1 and 2 as well as on the parental pRBlB-5 DNA. The expected size of 138pb after the beta deletion were amplified with pRB lBApi and 2 clones indicating that both constructions harboured the beta deletion in both copies of the 5' Lat region. In contrast, PCR amplification performed on parental pRB lB-5 DNA produced a single 982 bp amplicon corresponding to both non- deleted copies of the 5' Lat region . The PCR product sequences from both pRBlBApi and 2 clones corresponded to the expected beta deletion (coordinates 142 545 - 143 389 in IRs), in comparison with the parental pRB lB BAC5 sequence (Figure 4).

The electrophoresis patterns of the EcoRI-digested DNA from the pRBlBApi and 2 clones or the parental pRBlB-5 did not show any major rearrangement, suggesting that viral DNA overall integrity was preserved during the two-step red-mediated recombination procedure for both BAC constructs (data not shown),

(ii) Reconstitution of infectious BAC ΚΒΙΒΔβ viruses

DNA from ρΙ ΒΙΒΔβΙ or 2, or pRB lB-5 was transfected into secondary CEF, cultured for 4-5 days and co-seeded with fresh CEF for three passages. Cell cultures were daily observed under microscope to monitor the presence of virus plaques. We usually observe virus plaques at the second passage and we did not observe any major difference between cultures resulting from transfection with pRB lB-5 or with the BAC deleted constructs. To confirm production of GAHV-2 virus progeny, we performed IIF by labelling the major capsid protein VP5 with anti-VP5 monoclonal antibody. CEF infected with pRBlB- 5, ρΙ ΒΙΒΔβΙ or 2 showed comparable VP5 labelling, confirming the occurrence of lytic cycles induced by viruses recovered either from the parental pRBlB-5 or the deleted ρΙ ΒΙΒΔβΙ or 2. Virus titers obtained from CEF harvested by trypsinization at the third passage after bacmid DNA transfection were roughly comparable (data not shown), indicating that all viruses reconstituted from parental and deleted bacmids exhibited comparable growth characteristics. At the third passage, CEF producing BACRBlBApi and 2 viruses were trypsinized and frozen at -142°C as stocks of cell-associated BACRBlBApi and 2 viruses.

To assess the 5'LAT region of the BACRBlBApi and 2 viruses at the third passage, analyses by PCR and cloning were performed. All clones showed a PCR amplicon corresponding to the beta deletion, showing that BACRBlBApi and 2 viruses displayed an homogeneous population of beta subtypes in contrast to CVI988 vaccine.

Moreover, despite the 5' LAT deletion, all of the constructs have conserved their ability to replicate in an in vitro system as the parental BAC construct, suggesting that the 5' LAT region is dispensable for MDV in vitro lytic replication.

(iii) Replication in vivo of BAC RBlBAp viruses

To determine whether BAC ΚΒΙΒΔβΙ and 2 viruses replicate in vivo, we performed qPCR on DNA extracted from peripheral blood lymphocytes from infected chickens. Sixteen day-old chickens were inoculated intramuscularly (IM) with 1000 PFU of reconstituted virus from BACRBlBApl, BACRBlBAp2 or BACRBlB-5 as a MD positive control. A group of 16 chickens was also inoculated with 1000 PFU of CVI988 vaccine. Day-old White Leghorn specific pathogen free (SPF), MD susceptible maternal antibody-negative chickens (Lohmann, Germany) with a group of control chickens hatched at the same time as a control were used. PBLs were collected from 3 to 6 chickens in each group at various time points (12, 21, 33, 69 day post infection dpi), as previously described (Debba-Pavard et al., 2008) and DNA was prepared using phenol chloroform extraction (Sambrook et al , 1989).

Real time quantitative PCR (q-PCR) reactions were set up, on ice, in MicroAmp® Fast 96-Well Reaction Plate (Applied Biosystems). Briefly, each reaction contained Ο.ΙμΜ of each primer, lOOng of DNA, 10 iL of Fast SYBR® Green Master Mix 2X (Applied Biosystems) in a total reaction volume of 20 μί,. Triplicate reactions were run for all standards, test samples and controls. An StepOnePlus" Real-Time PCR System (Applied Biosystem) was used to amplify and detect the reaction products.

The estimation of the viral load in PBL from BACRBlBA l, 2, BACRBlB-5 and CVI988 infected chickens was estimated using qPCR targeting GaHV-2 viral UL26 gene. Specific primers U_L26 forward TTGCACAGTCGGAGCAGTTCTTGCGC (SEQ ID N° 111) and U_L26 reverse TGACTGGCGGCTGTCTCTAGTGTACG (SEQ ID N° 112) were used. Forty cycles were performed with following cycling parameters: 94°C for 15s, 56°C for 30s, 72°C for 1 min. The copy number of UL26 gene was calculated from a standard curve established with a pGEM-T easy UL26 plasmid.

The results reported on figure 5 showed that BACRBlBA i and 2 viruses were able to replicate in PBL from infected chickens at a lower rate than BACRBlB-5 virus and at a higher rate than CVI988. For both recombinant BACRBlBA i and 2 viruses, a viral load increase was observed from day 12 pi to day 21 pi, and a threshold viral load was observed afterwards.

EXAMPLE 2

Attenuation and stability of BAC ΚΒΙΒΔβ viruses (i) Pathogenesis study in chickens

To determine whether BAC RB lBAp i and 2 were attenuated, 16 day-old chickens were inoculated intramuscularly (IM) with 1000 PFU of reconstituted virus from BACRB lBApl, BACRB lBAp2 and BACRB lB-5 as a MD positive control. A group of 16 chickens was also inoculated with 1000 PFU of CVI988 vaccine. Day-old White Leghorn specific pathogen free (SPF), MD susceptible maternal antibody-negative chickens (Lohmann, Germany) with a group of control chickens hatched at the same time as a control were used. All groups of chickens were monitored for 68-71 days. All the surviving chickens were euthanized at the end of the experiments. All chickens that died naturally or were killed underwent post-mortem examination to check the presence of gross MD tumours, atrophy of lymphoid organs. Mortality due to MD was determined. All experimental procedures were conducted at INRA (PFIE, 37380 Nouzilly, France) in compliance with approved protocols for the use of animals in research.

Mortality due to MD was monitored during the pathogenesis experiment. The percentage of survival was calculated every 7 days from the day of inoculation. As shown in figure 7A, no chicken died during the 68 days of experimental period following inoculation with BAC ΡνΒ ΙΒΔβ-derived viruses or vaccinated with CVI988. In contrast, 55% of chickens inoculated with BAC RB lB-5-derived virus died with well-developed lymphoma MD from day 42 dpi and 77% of them showed thymus or bursa atrophy and gross MD lesions at the final necropsy, 68 dpi (Figure 6, Table 2). At day 68 dpi, one chicken inoculated with BAC Ι Β ΙΒΔβΙ showed bursa atrophy without any other sign of MD and one chicken inoculated with BAC ΚΒ 1ΒΔβ2 showed a moderate proventriculus enlargement that required further histological examination to determine whether it was a specific MD lesion. Therefore, the BAC RB lBAP-derived viruses showed low residual pathogenicity in comparison with BAC RBlB-5-derived virus, the subtype beta deletion designed in the Lat promoter leading to BAC RB1B-5 attenuation. Complete loss of pathogenicity could be achieved by further successive in vitro cell passages.

(ii) Stability of the 5'LAT region in BAC ΚΒΙΒΔβ viruses

At the end of in vivo experiment, we assessed whether there were molecular variants of the 5' LAT region in PBL from BAC ΡνΒ ΙΒΔβΙ and 2 infected chickens. By performing PCR with primers pair GCTAGGGGTTCGACGAAAT/CCGGACCGAGAACACAGTGAT (SEQ ID NO° 46/SEQ ID N°47) and cloning, we observed more than 95% clones harbouring the beta deletion, showing the stability of BAC ΡνΒ ΙΒΔβ Ι and 2 viruses. Example 3:

Vaccinations with BACRBlBAp viruses

(i) Protection assay

Six groups of 16 day-old chickens each were used. Four groups were vaccinated by FM injection of 1000 PFU of BACRB lBApl or 2 and were inoculated with 500 PFU of vvRBlB or vv+648A, respectively, 7 days after vaccination. The two last groups were left unvaccinated and inoculated at the same time as the vaccinated groups with 500 PFU of vvRBlB or vv+648A, respectively. Two additional groups of 16 and 10 chickens were vaccinated by IM injection of 1000 PFU of CVI988 and were inoculated with 500 PFU of vvRBlB or vv+648A, respectively, 7 days after vaccination. Day-old White Leghorn specific pathogen free (SPF), MD susceptible maternal antibody-negative chickens (Lohmann, Germany) with a group of control chickens hatched at the same time as a control were used. All groups of chickens were monitored for 68-71 days. All the surviving chickens were euthanized at the end of the experiments. All chickens that died naturally or were killed underwent post-mortem examination to check the presence of gross MD tumours, atrophy of lymphoid organs. Mortality due to MD was determined. All experimental procedures were conducted at INRA (PFIE, 37380 Nouzilly, France) in compliance with approved protocols for the use of animals in research. (ii) Protection induced by BACRBlBAp viruses or CVI988 vaccine against challenge with vvRBIB or vv+648A

Mortality due to MD was monitored to determine whether BACRBlBAP-derived viruses could induce protection against challenge with vvRBIB or vv+648A (Figure 7B). Lymphoid organs atrophy and MD gross lesions were also recorded during challenge and summarized in Table 2. All unvaccinated chickens inoculated with vvRBIB died with bursa or thymus atrophy, and MD gross lesions from the 14^th to the 52^th dpc (Figure 7A, Table 2). In contrast, no chicken vaccinated with CVI988 died after vvRBIB challenge while two and three chickens died in the groups vaccinated with BACRB lBApi or ΒΑΟ Β 1ΒΔβ2, respectively (Figure 7A, Table 2). It should be noticed that one CVI988-vaccinated chicken showed transient clinical signs of paralysis and primary lymphoid organs atrophy at the end of the experiment. In the case of vv+648A challenge, all unvaccinated chickens died from the 10^th to the 28^th dpc (Figure 7B). As expected for vv+ infection of maternal antibody negative chickens, we observed an early stage of mortality, with severe atrophy of primary lymphoid organs in the absence of MD lymphomas followed by a stage of MD lymphoma development. In contrast, after w+648A challenge, no CVI988-vaccinated chicken died during the experimental period (Figure 7B) while three chickens died in each of the ΒΑΟ ΒΙΒΔβ- vaccinated chickens (Figure 7B, Table 2). At the end of the experiment, one of the CVI988- vaccinated chickens showed obvious lymphoma development and three BACRBlBApi- vaccinated chickens showed small-sized nodules suspicious of MD that required further histological examination (Table 2). Therefore, BACRBlBAp-derived viruses could induce about 80 % of protection against mortality due to vv RB1B or vv+648 challenge during the experimental period.

Table 2. Pathogenicity and protection studies: overall data Challenge

Batch Vaccine/BAC Virus Day Route ^A ΤΑ7ΒΑ^Β MD MD death⁸

Pathogenicity

Negative Control None None - - 0/7 on 0/7

CVI988 CVI988 None - - 0/7 0/7 0/7

BAC RBlBApi BAC RBlBΔβl None - - 0/13 0/13 0/13

ΒΧδ¾Β Β β2 ^" BAC RB ΪΒΔβ2 None - - 1/13 Ϊ/Ϊ3 1/13

RB1B BAC5 RB1B BAC5 None - - 9/13 9/13 6/13

Vaccination Negative Control None None - - 1/10 0/10 6/ 10 challenge CVI988 + RBiB CVI988 RB1B 7 ΪΜ 1/6 0/6 0/6

BAC RB ΙΒΔβ 1 + BAC RBlBΔβl RB1B 7 ΪΜ 3/12 2/12 2/12 RB1B

B AC RB ΪΒΔβ2 + BAC RBlBΔβ2 RB1B 7 ΪΜ 4/13 3/13 3/13 RB1B

RB1B None RB1B 7 13/13 13/13 13/13

CV1988 + 648A CVI988 648A 7 ΪΜ 1/13 1/13 0/13

B AC RB ΪΒΔβ Ϊ + BAC RBlBΔβl 648A 7 ΪΜ 4/14 3/14 3/14 648A

BAC RBTB¾2 +" BAC RBlBΔβ2 648A 7 3/13 3?Ϊ3 3/13

648A

648A None 648A 7 ΪΜ 13/13 13/13 13/13

Footnotes for Table 2:

A. IM intra-muscular; B Number of chickens with either thymic (TA) or bursal (BA) atrophy.

Number of chickens with gross lesions, excluding bursal or thymic atrophy (suspicious

lesions have not been included). MD mortality

(iii) Effect of BACRBlBApiand 2 vaccination on the wRBIB challenge viral load

The estimation of the wRBIB challenge viral load in PBL from BACRBlBA l, 2,

and CVI988 vaccinated chickens were estimated using qPCR targeting GaHV-2 viral Us2

gene. PBLs were collected from 6 chickens in each group at various time points (21, 33, 69

day post infection dpi), as previously described (Debba-Pavard et al., 2008). The qPCR assay

specifically detected wRBIB challenge viral load in BACRBlBA i, 2 vaccinated chickens

as BAC cassette was inserted within the Us2 locus. Specific primers Us2 forward

TATTGTCGGGAATGGCCCACG (SEQ ID N° 44) and U_s2 reverse TCGCATTGCGCTCGAATGTA (SEQ ID N° 45) were used. Forty cycles were performed with following cycling parameters: 94°C for 15s, 59°C for 30s, 72°C for30 s. The copy number of Us2 gene was calculated from a standard curve established with a pGEM-T easy Us2 plasmid. The results are shown in table 3. In all vaccinated groups, we detected a significant decrease of wRB challenge viral load, representing less than 1 per cent that of non vaccinated wRBIB infected chickens. Moreover, the vvRBIB challenge viral load decreased in the course of experiment for the BACRBlBA i and CVI988 vaccinated chickens but not in the BACRB1BA 2 vaccinated chickens. Indeed, the decrease of wRBIB challenge viral load was more important in chickens vaccinated with BACRBlBA l than in those vaccinated with BACRBlBA 2.

Table 3: wRBIB viral load impaired by vaccination with recombinant viruses BACRBlBApl and 2

Footnotes for Table 3 ^a Viremia, or Number of GaHV-2 genome copies /2.10⁴ cells, percentages of copies are calculated in comparison to those of wRBIB.

Differences between groups have been analysed by a Wilcoxon test. ^b Differences between non vaccinated and challenged by wRBIB are significant (p < 0,05).

c Non-vaccinated and challenged chicken were dead before 69 dpc, no percentages. dpc, days post-challenge

Reduction of vv+648A viral load in PBLs of vaccinated chickens. One-day-old chickens were vaccinated with 1000 PFU of vaccine and challenged seven days later with 500 PFU of the W+648A strain. Survival rates are presented in Figure 7B. The viral load of the challenge viruses, expressed as the number of copies detected in 2 x 10⁴ cells, was determined by qPCR detecting the US 2 gene sequence, replaced by the BAC cassette in recombinant viruses. The percentage of genome copies was calculated as a function of that in unvaccinated chickens injected with the vv+648A strain. Differences between treatments were analyzed in a Wilcoxon test. The results are illustrated table 5.

Table 5 vv+648A viral load impaired by vaccination with recombinant viruses BACRBlBApi and 2

Sample Day (pc) Batch U_s2^a

648A 22400 (100%)

21 CVI988 + 648A 40 (0,18%)

BACRBlBApl + 648A 0 (0%)

BACRB1BA[32 + 648A 0 (0%)

CVI988 + 648A 30^b

33 BACRBlBApl + 648A 10^b

BACRB1BA[32 + 648A 10^b

CVI988 + 648A 40^b

69 BACRBlBApl + 648A 0^b

BACRBlBAp2 + 648A 0^b

^a Number of genome copies for 2 x 10⁴ cells, percentage of copies calculated as a function of that for 648 A.

b Non-vaccinated and 648A -inoculated chickens died before 69 dpc

dpc; days post-challenge.

Table 5 shows that in all vaccinated groups, we detected a significant decrease of viral load, as compared to non vaccinated w+648A infected animals. The vv+648A challenge viral load decreased in the course of experiment for the ΒΑΟΙΒΙΒΔβΙ, ΒΑΟ Β1ΒΔβ2 and for CVI988 vaccinated chickens. Moreover, the decrease of vv+648A challenge viral load was significantly more important in chickens vaccinated with BACRBlBA ior ΒΑΟ Β1ΒΔβ2 than in those vaccinated with CVI988. In these experiments, at day 21 post challenge, the composition according to the invention induces a 82% decrease in viral load as compared to non vaccinated chicken and reduces by a factor 4 the viral load as compared to CVI988 vaccinated chickens.

EXAMPLE 4

EFFECT on lymphoid organs

(i) Effect of infection with BAC ΚΒΙΒΔβ viruses on lymphoid organs:

We assessed the effect of infection with CVI988 vaccine and BAC Ι Β ΙΒΔβΙ, 2 or BACRBlB-5-derived viruses on weight of lymphoid organs at 13 dpi and at 68 dpi, the end of the experiment. At 12 dpi, 3 chicks of each group were sacrificed. After body weighting, collection and weighting of lymphoid organs, the mean of relative weight of lymphoid organs was calculated. We did not observe any obvious difference for the bursa relative weight among the groups of chickens in comparison with control chickens. In contrast, all groups of infected chickens seemed to have a decrease of thymus relative weight and an increase of spleen relative weight, in comparison with controls. We noticed the same tendency in all groups of infected chickens, including the CVI988 infected group, which exhibited the highest spleen relative weight value. This observation may indicate that ΒΑΟ ΒΙΒΔβ- derived viruses did not exhibit specific effects on lymphoid organs in comparison with parental BACRB lB-5 or CVI988 vaccine.

At the end of the in vivo experiment, all live chickens were weighted, lymphoid organs collected and weighted and relative weights were calculated. The distribution and histograms of means of lymphoid organs relative weights is shown in Figure 8 A and 8B. We did not notice any obvious significant difference for relative weights of bursa of Fabricius among the groups of chickens (p> 0.05, Wilcoxon-Mann Withney test), and a large range of values mainly for spleens of the BAC RB-1B-5 group, due to a significant splenomegaly in one MD chicken. It should be noticed that only 6 BAC RB 1B-5 chickens were still alive at 69 dpi, the 7 others being died from 38 dpi with MD specific lesions. Concerning the thymus, all groups including the CVI988-inoculated chickens exhibited comparable values, slightly lower than that of the control group. In addition, we observed 3/13 chickens with moderate splenomegaly in the BAC RBlBApl group and 1/12 with bursa and thymus atrophy in the BAC RBlBAp2 group.

(ii) Effect of vaccination with BACRBlBAp viruses or CVI988 vaccine on atrophy of lymphoid organs induced by vvRBIB or vv+648A challenge.

We investigated whether vaccination with BAC Ι ΒΙΒΔβ viruses or CVI988 vaccine could impair atrophy of lymphoid organs induced by vvRBIB or w+ 648A challenge. At 13 dpc, 3 chicks of each group were sacrificed. After body weighting, collection and weighting of lymphoid organs, the mean of relative weight of lymphoid organs was calculated. As expected, vvRB IB and vv+648A induced a severe bursa and thymus atrophy, illustrated by a drop of the relative weight of thymus and bursa. Remarkably, BAC Ι Β ΙΒΔβ viruses seemed to impair atrophy induced by vvRBIB as efficiently as CVI988 did. In the same way, chickens vaccinated with CVI988 or BAC Ι ΒΙΒΔβ-Ι and challenged with vv+648A did not show bursa or thymus atrophy. However, the mean relative weight of thymus of the BAC RBlBAP-2-vaccinated chickens challenged with 648 A was lower than that of CVI988 or BAC Ι ΒΙΒΔβ-Ι vaccinated chickens and challenged with 648 A, but significantly higher than that of unvaccinated 648A-infected chickens. In fact, a large range of data were obtained in the BAC Ι Β1ΒΔβ2 group challenged with 648 A, one chicken exhibiting thymus and bursa atrophy comparable to the vv+648A group, the others not. We observed an increase of spleen relative weights in all groups of chickens vaccinated or not and challenged with vvRBIB, in comparison with the control group. A moderate increase was observed upon challenge with W+648A, the non-vaccinated group exhibiting a decrease of spleen relative weight in comparison with the control group. It should also be noticed that a large range of spleen relative weight values were obtained in some groups of chickens with a loss or a gain of weight likely due to lymphocyte cytolytic infection, lymphocyte immune activation or neoplasic lymphoproliferation.

At the end of the in vivo challenge experiment, 68-71 dpc, all alive chickens were weighted, lymphoid organs collected, weighted, and relative weights were calculated. All non- vaccinated chickens challenged with vvRBIB or vv+648A were died from MD lesions. Figure 9A and 9B represents the mean of relative weights of lymphoid organs from the vaccinated and challenged groups of chickens and from the controls. We did not observe any obvious difference on the relative weights of thymus among the vaccinated groups of chickens, indicating that BAC Ι ΒΙΒΔβ viruses may have the same effect as CVI988 vaccines on this lymphoid organ, The relative weights of bursa of Fabricius were slightly increased in comparison with that of unvaccinated controls, showing that BAC ΡνΒ ΙΒΔβ and CVI988 viruses were able to impair atrophy and subsequent immunosuppression induced by vv or vv+ MDV strains. A moderate splenomegaly most often significantly different from unvaccinated controls was observed for all vaccinated groups (Figure 9 A, B). To conclude, BAC ΡνΒ ΙΒΔβ viruses showed the same effect as CVI988 vaccine on lymphoid organs from chickens challenged with both vvRBIB and vv+648A strains.

Example 5

EFFECT OF SERIAL PASSAGES ON BACRBlBAp viruses Additional cell passages are performed to achieve complete loss of pathogenicity, as described above. Briefly, chicken embryo fibroblasts (CEF) are prepared from 11 day-old specific-pathogen-free (SPF) White Leghorn B13/B 13 embryos raised at INRA (PFIE, 37380, Nouzilly, France) and used as secondary cells (Schat and Purchase, 1998). CEFs are maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 2,5 % fetal calf serum, 1,25% chicken serum, 1% penicillin/streptomycin, 1% fungizone and 2% Tryptose Phosphate Broth (TPB). BACRBlBAp viruses recovered at the third passage post DNA bacmid transfection were co-seeded with fresh CEF, cultured for 4-5 days, and recovered to perform serial passaging on fresh CEF. Cell cultures were daily observed under microscope to monitor the presence of virus plaques. Usually, MDV typical plaques were observed from the third day post-infection. To confirm production of MDV virus progeny, IIF by labelling the major capsid protein VP5 with anti-VP5 monoclonal antibody was performed. Twenty serial passages were done with BACRB lBApi and 2 viruses. GaHV-2 virus progeny was maintained through these twenty passages. To assess the stability of the 5'LAT region of the BACRBlBApi and 2 viruses, analyses by PCR using primers pair GCTAGGGGTTCGACGAAAT/CCGGACCGAGAACACAGTGAT and cloning were performed every fifth passage. All clones except one showed a PCR amplicon corresponding to the beta deletion, showing the stability of BACRB lBApi and 2 viruses during serial in vitro passages in contrast to CVI988 vaccine.

Example 6

Isolation of BACRBlBAa viruses

(i) Isolation of ρΚΒΙΒΔα bacmid constructs

New deletions -as the alpha subtype in the 5 Lat region were constructed from BAC genome pRB lB-5 of the vvRB IB as detailed above. These deletions comprise "alpha" deletions of the LAT mi croRNA region of the genome using similar molecular techniques as described for the beta deletions described above. Alpha deletions have been achieved as follows and recombinant viruses BACRB lBAa have been recovered. The first alpha deletion was generated as briefly described. A transfer construct was generated from plasmid pEPkanS-2 by two successive PCR amplification using primers Alpha Del I-Sce for and rev for the first one, and Alpha Del PCR for and rev for the second one. After el ectr op oration of this transfer construct into GS1783 bacteria, Red recombination was induced at 42°C during 15 mn and bacterial clones resistant to kanamycin were isolated and screened by PCR with primers Alpha del Seq for and rev (Tablel). One clone showing both expected PCR products with 1203 bp and 1156 bp, corresponding to the al-Sce insert and to the parental 5_ LAT region, respectively was isolated. The I-Scel enzyme was induced by adding 1% arabinose to excise Kan^R resistance gene that was achieved through induction of Red recombination. Recombinant clones that had lost kanamycin resistance were screened with Alpha Del Seq for and rev primers (Table 1). One clone showing two PCR products, 166 bp and 1156 bp corresponding to the alpha deletion and to the wild type 5' LAT region, respectively was isolated. The deletion of the second copy of the 5' LAT region was performed by electroporation of the transfer construct into GS1783 bacteria, and further steps were carried out as previously described. After screening with Alpha Del Seq for and rev primers, two bacterial clones showing one unique expected 166 bp PCR product were isolated and bacmid DNA was further analysed.

PCR amplification with primers Alpha del Seq for and rev (Tablel) bordering the expected deleted region was performed on two selected clones of pRBlBAa, clones 1 and 2 as well as on the parental pRB-lB BAC5 DNA. The expected size of 166 bp after the alpha deletion was amplified with pRBlB"al and 2 clones indicating that both constructions harboured the alpha deletion in both copies of the 5_ Lat region. In contrast, PCR amplification performed on parental pRBlB-5 DNA produced a single 1156 bp amplicon corresponding to both non-deleted copies of the 5' Lat region. The PCR product sequences from both pRBlBAod and 2 clones corresponded to the expected alpha deletion (coordinates 142 545 - 143 535 in IRs, Figures 1A,1B, 1C), in comparison with the parental pRBlB-5 sequence (Figure 10).

The electrophoresis patterns of the EcoRI-digested DNA from the pRB lBAod and 2 clones or the parental pRBlB-5 did not show any major rearrangement, suggesting that viral DNA overall integrity was preserved during the two-step red-mediated recombination procedure for both BAC constructs (data not shown),

(ii) Reconstitution of infectious BAC RBlBAa virus

DNA from pRB lBAal or 2, or pRB lB-5 was transfected into secondary CEF, cultured for 4-5 days and co-seeded with fresh CEF for three passages. Cell cultures were daily observed under microscope to monitor the presence of virus plaques. We usually observe virus plaques at the second passage and we did not observe any major difference between cultures resulting from transfection with pRB lB-5 or with the BAC deleted constructs. To confirm production of MDV virus progeny, we performed IIF by labelling the major capsid protein VP5 with anti-VP5 monoclonal antibody. CEF infected with pRBlB-5, pRBlB"al or 2 showed comparable VP5 labelling, confirming the occurrence of lytic cycles induced by viruses recovered either from the parental pRBlB-5 or the deleted pRBlB"al or 2. At the third passage, CEF producing BACRBlB"a 1 and 2 viruses were trypsinized and frozen at -142°C as stocks of cell-associated BACRBlBAa 1 and 2 viruses.

To assess the 5'LAT region of the BACRBlBAal and 2 viruses at the third passage, analyses by PCR with primers pair

GCTAGGGGTTCGACGAAAT/CCGGACCGAGAACACAGTGAT ( SEQ ID N° 46 and SEQ ID N°47 ) and cloning were performed. All the clones showed a PCR amplicon corresponding to the alpha deletion, showing that BACRBlBAod and 2 viruses displayed homogeneous population of alpha subtypes in contrast to CVI988 vaccine. Therefore, despite the 5_ LAT alpha deletion, these constructs have conserved their ability to replicate in an in vitro system as the parental bacmide, suggesting that the mdvl-miR-M8 is dispensable for MDV in vitro lytic replication.

Additional cell passages are performed as described above for beta deletions to achieve complete loss of pathogenicity and to assess deletion stability.

Example 7

Isolation of BACRB1B Δα² viruses

(i) Isolation of pRBlBAa² bacmid constructs

In order to mimic CVI988 with a unique construct, we isolated a recombinant harbouring an alpha deletion in one copy of the 5'LAT region and a beta deletion in the second copy. This recombinant was generated from pRBlB-5 as detailed in general methods. In a first step of recombination, the alpha deletion was generated. A transfer construct was generated from plasmid pEPkanS-2 by two successive PCR amplifications using primers Alpha Del I-Sce for and rev for the first one, and Alpha Del PCR for and rev for the second one (Table 1). After electroporation of this PCR product into GS1783 bacteria, Red recombination was induced at 42°C during 15 mn and bacterial clones resistant to kanamycin were isolated and screened by PCR with primers alpha del Seq for and rev (Table 1). One clone showing both expected PCR products with 1203 bp and 1156 bp, corresponding to the al-Sce insert and to the wild type 5_ LAT region, respectively was isolated. The I-Scel enzyme was induced by adding 1% arabinose to excise Kan^R resistance gene. Recombinant clones that had lost kanamycine resistance were screened with alpha del Seq for and rev primers (Table 1). One clone showing two PCR products, 166 bp and 1156 bp corresponding to the alpha deletion and to the parental type 5' LAT region, respectively was isolated. A transfer construct was generated from plasmid pEPkanS-2 by two successive PCR amplifications using Beta Del I-Sce for and rev for the first one, and Beta Del PCR for and rev for the second one (Table 1). After electroporation of this PCR transfer product into the alpha deleted clone, Red recombination was induced at 42°C during 15 mn and bacterial clones resistant to kanamycin were isolated and screened by PCR with primers alpha del Seq for and rev (Table 1). One clone showing both expected PCR products with 1351 bp and 166 bp, corresponding to the β I-Sce insert and to the 5' LAT alpha deletion, respectively was isolated. The I-Scel enzyme was induced by adding 1% arabinose to excise Kan^R resistance gene. Recombinant clones that had lost kanamycine resistance were screened with alpha del Seq for and rev primers bordering the expected deleted region. Two clones showing two PCR products, 166 bp and 312 bp corresponding to the alpha and to the beta deletions, respectively were isolated. The PCR product sequences from both pRBlBAa² 1 and 2 clones corresponded to the expected alpha and beta deletion sequences, in comparison with the parental pRBlB BAC5 sequence.

The electrophoresis patterns of the EcoRI-digested DNA from the BAC RB lBAa² 1 and 2 clones or the parental pRB lBBAC5 did not show any major rearrangement, suggesting that viral DNA overall integrity was preserved during the two-step red-mediated recombination procedure for both BAC constructs (data not shown),

(ii) Reconstitution of infectious BAC RBlBAa² virus

DNA from pRBlBAa² 1 or 2, or pRB lB-5 was transfected into secondary CEF, cultured for 4-5 days and co-seeded with fresh CEF for three passages. Cell cultures were daily observed under microscope to monitor the presence of virus plaques. We usually observe virus plaques at the second passage and we did not observe any major difference between cultures resulting from transfection with pRB lB-5 or with the BAC deleted constructs. To confirm production of MDV virus progeny, we performed IIF by labelling the major capsid protein VP5 with anti-VP5 monoclonal antibody. CEF infected with pRBlB-5, pRBlB"a²l or 2 showed comparable VP5 labelling, confirming the occurrence of lytic cycles induced by viruses recovered either from the parental BACRBlB-5 or the deleted BACRB IB'O² 1 or 2. At the third passage, CEF producing BACRB IB'O² 1 and 2 viruses were trypsinized and frozen at -142°C as stocks of cell-associated BACRBIB'O² 1 and 2 viruses.

To assess the 5 'LAT region of the BACRB lBAa² 1 and 2 viruses at the third passage, analyses by PCR and cloning are performed.

Additional cell passages are performed as described above for beta deletions to achieve complete loss of pathogenicity and to assess deletion stability.

The present invention also provides infectious BAC RBlBAa² virus bearing two alpha deletions, one alpha and one beta deletion.

Table 4: Primers used to characterize the 5' LAT region, to carry out BAC mutagenesis and for qPCR

F, forward; R, reverse.

Bold sequence: nucleotides just downstream from the 3' end of the β deletion (Positions 143390-144441, RB-1B EF 523390)

Bold italic sequence: nucleotides just upstream from the 5' end of the β deletion (Positions 142492-142543, RB-1B EF 523390)

Underlined sequences: template binding region of the pEPKanS plasmid. EXAMPLE 8

1- Dynamic changes in 5'L i CVI988 subtypes occur in vitro and in vivo

The demonstration that the CVI988 vaccine consisted of a population of molecular subtypes for 5 'Juried to assess whether the frequencies of these subtypes were stable or varied during serial passages in cell culture, as currently used in vaccine production. We infected secondary B13 CEFs with CVI988 MCI 8800, provided by Pfizer AH, and subjected the cells to 65 serial passages in culture. GaHV-2 viral infection was checked by microscopic observation and labeling in an indirect immunofluorescence assay with the anti-capsid protein VP5 antibody clone 3F19. Every five passages, we performed a molecular analysis of the 5' LAT region as previously described above. We analyzed about 100 clones per passage sampled and molecular subtypes were identified on the basis of data obtained for CVI988 vaccine batches, by evaluating the length of the PCR products generated with the M448/M766 primers by gel electrophoresis, typing with specified primers or sequencing.

Figure 11 shows changes in 5' LAT molecular subtype frequencies in CVI988 during serial passages in CEFs. Percentages of the different molecular subtypes as a function of the number of passages, noted P0 to P80, P0 representing the subtype distribution in the initial MCI 8800 batch. The α, β and N subtypes are represented individually, whereas the other subtypes are clustered together as "Others". "Complete" subtypes correspond to the non- deleted 5' LAT region with at least one 60-bp repeat. (A) First series, from P0 to P80. (B) Second series, initiated from frozen CVI988/Rispens-infected cells, from P55 to P80.

Figure 11 shows the change in 5' LAT subtype frequencies with the number of passages. From passage 1 to 40, infection with the CVI988 vaccine strain could be performed regularly with the same split ratio. There was a gradual, continuous change in 5 'LAT subtypes, characterized principally by a dynamic equilibrium mostly involving the a and β subtypes, with a continuous decrease in the frequency of the a subtype (44% in the CVI988 vaccine vial, decreasing to 13% at passage 40) and a continuous increase in β subtype frequency (21% in the vaccine vial, rising to 80% at passage 35) (Fig. 11 A). At passage 45, a breakdown of subtype evolution occurred, with an unusual pattern showing a sudden decrease of the β subtype frequency (59%) and a substantial increase in the N minor subtype frequency (from 2% in the CVI988 vaccine vial to 26% at passage 45) (Fig 11 A). From passage 45 onwards, CVI988 infection was more difficult to manage, and split ratios had to be adapted (increased or decreased) as a function of the passage concerned. The frequency of the a subtype fell to below 10%) and a decrease in the frequency of the β subtype (59% at passage 45, decreasing to 33%) at passage 60) was observed in parallel with an increase in the frequency of the N subtype (26%> at passage 45, reaching 52% at passage 60) (Fig 1 1 A). At passage 65, a second breakdown occurred, with an absence of detection of CVI988 infection, as no labeling with VP5 antibody was observed and no PCR product was obtained with the M448/M766 primers. We carried out additional serial passages after passage 65, and a few plaques typical of GaHV-2 infection were again observed from passage 66. The frequency of the N subtype was very high, accounting for more than 80%> of the subtypes at passages 70 and 75, whereas the β subtype was not detectable. We investigated whether these frequencies resulted from a specific bottleneck effect due to the loss of infection at passage 65, by initiating a new series of passages from CVI988-infected frozen CEFs at passage 55. In these serial passages, the β subtype was observed at a frequency from 17 to 46%>, whereas the N subtype was observed at a frequency from 30 to 37%, indicating that the loss of the β subtype in the previous series was probably due to a stochastic bottleneck effect (Fig 11B). Surprisingly, in both series, we observed the emergence of new CVI988 subtypes, harboring complete 5' LAT regions with one to four 60-bp repeats. At passage 80, these complete CVI988 subtypes accounted for 25 and 15%) of all subtypes for the first and second series of passages, respectively. We investigated whether changes in 5'LAT subtypes of the CVI988 vaccine also occurred in vivo. We investigated the pattern of change in 5'LAT subtypes at various time points after infection, in peripheral blood leukocytes (PBLs) and feather follicles (FFs), both representative of GaHV-2 infection. PBLs and FFs were sampled from B 13 chickens vaccinated with the same batch of vaccine used for serial passages, CVI988 MCI 8800. CVI988 infection rates were lower in PBLs and FFs than in CEFs, and nested PCR was required for the detection of a CVI988 PCR product. We analyzed about 1000 clones and observed changes in the distribution of CVI988 subtypes in both tissues at different times post infection (pi). PBLs data showed an increase in a subtype frequency and a decrease in β subtype frequency with respect to the content of the vial of CVI988 used to inoculate chickens, on day 7 post infection (pi) (Fig. 12).

Figure 12 shows changes in 5' LAT molecular subtype frequencies in the CVI988 vaccine after chicken infection. Percentages of the different molecular subtypes in PBLs at 7, 14 and 29 dpi (A) and in FF (feather follicles) at 7 and 21 dpi (B), in chickens vaccinated with batch MCI 8800. The α, β and N subtypes are represented individually, whereas the other subtypes are clustered together as "Others".

The overall proportions of a and β subtypes were similar on day 14 pi, but the frequencies of these two subtypes differed from those in the vial and those on day 7 pi (Fig. 12 A). Remarkably, as observed from passage 45 after CEF infection, the frequency of the minor subtype N reached 69% on day 29 pi. FFs gave a pattern similar to that for PBLs, but with a time lag, demonstrating an absence of tissue specificity in the changes in CVI988 subtypes (Fig. 12B). No subtype without deletions was observed in samples collected for this in vivo CVI988 infection survey.

EXAMPLE 9 Stability of the S LAT region in BAC RBlBAp-derived viruses in vitro and in vivo We then compared the stability of the 5'LAT region in BAC RBlBAP-derived viruses to that of CVI988. We carried out up to 20 serial passages after transfection with bacmid DNA. We extracted DNA from BAC RBlBAp-derived virus-infected CEFs at passages 3, 5, 10, 15 and 20. We analyzed the 5' LAT region of BAC RBlBAP-derived viruses, by generating PCR products with M448/M688 primers, inserting them into the pGEM-T Easy vector and screening 48 clones per sample. We analyzed 288 clones, 99.6% of which corresponded to the expected 5 LAT deletion, demonstrating the stability of BAC RB lBAp-derived viruses upon serial passages in CEF cultures in vitro, by contrast to the CVI988 vaccine strain. We also extracted DNA from PBLs sampled from three chickens infected the day of hatching with 1,000 PFU of BACRB-ΙΒΔβΙ- or BAC RB-lBAp2-derived viruses at 68 days pi. We analyzed 288 clones, 98% of which corresponded to the expected 5' LAT β deletion, confirming that BACRB-lBAP-derived viruses remained stable in vivo. The present study provides a composition, in particular a vaccine composition, wherein the 5 'LAT deletion, in particular a 5 LAT , a or αβ deletion is stable, that is to say with less than 0.04 %,preferably less than 0.02% variation in the genome sequence after at least 20 serial passages in CEFs in vitro or at least at day 60, in particular 68 post -infection, as compared to the genome of the composition initially inoculated.

REFERENCES

Debba-Pavard, M., Ait-Lounis, A., Soubieux, D., Rasschaert, D., and Dambrine, G. (2008):

Vaccination against Marek's disease reduces telomerase activity and viral gene transcription in peripheral blood leukocytes from challenged chickens. Vaccine 26, 4904-12.

Petherbridge, L., Brown, A. C, Baigent, S. J., Howes, K., Sacco, M. A., Osterrieder, N., and

Nair, V. K. (2004): Oncogenicity of virulent Marek's disease virus cloned as bacterial artificial chromosomes. J Virol 78, 13376-80.

Rispens, B. H., van Vloten, H., Mastenbroek, N., Maas, H. J., and Schat, K. A. (1972):

Control of Marek's disease in the Netherlands. I. Isolation of an avirulent Marek's disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Dis

16, 108-25. Sambrook, J., Fritch, E.F., Maniatis, T., (1989): Molecular Cloning: A Laboratory Manual.

Cold Spring Harbour Laboratory Press.

Schat, K. A., and Purchase, H. G. (1998): Cell-culture methods. In A laboratory Manual for the Isolation and Identification of Avian Pathogens, 4th edn, pp. 223-234. Kennet

Square, PA: American Association of Avian Pathologists.

Schumacher, D., Tischer, B.K.,Fuchs, W., and Osterrieder, N. (2000): Reconstitution of

Marek's disease virus serotype 1 (MDV-1) from DNA clones as a bacterial artificial chromosome and characterization of a glycoprotein-B negative MDV-1 mutant. J

Virol 74, 11088-98.

Spatz, S. J., and Silva, R. F. (2007): Sequence determination of variable regions within the genomes of gallid herpesvirus-2 pathotypes. Arch Virol 152, 1665-78.

Stik, G., Laurent, S., Coupeau, D., Coutaud, B., Dambrine, G., Rasschaert, D., and Muylkens, B. (2010): A p53-dependent promoter associated with polymorphic tandem repeats controls the expression of a viral transcript encoding clustered microRNAs. RNA 16, 2263-76.

Strassheim, S., Stik, G., Rasschaert, D., and Laurent, S. (2012): mdvl-miR-M7-5p, located in the newly identified first intron of the latency-associated transcript of Marek's disease virus, targets the immediate-early genes ICP4 and ICP27. J Gen Virol 93, 1731-42. Tischer, B. K., von Einem, J., Kaufer, B., and Osterrieder, N. (2006): Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in

Escherichia coli. Biotechniques 40, 191-7.

Tischer, B. K., Smith, G.A., and Osterrieder, N. (2010): En passant mutagenesis: A two step markerless Red recombination system. In Vitro Mutagenesis Protocols, Methods in

Molecular Biology 634, 421-30.

Witter, R.L. (1997): Increased virulence of Marek's disease virus field isolates. Avian Dis 41,

149-63.

Claims

1. A composition comprising a set of avian herpes virus GaHV-2 subtype(s), each subtype consisting in a genome having (a) deletion (s), of at least a 60 base pair repeat sequence segment (60bpRS motif), [corresponding to SEQ ID N° 31],

said genome (when having no deletion) comprises a unique short region (Us) segment flanked at one end by an Internal Repeat short segment (IRs) and at the other end by a terminal repeat short segment (TRs), wherein each IR_S or TR_S comprises at least one copy of a 60 base pair repeat sequence segment (60bpRS motif), [corresponding to SEQ ID N° 31],

said deletion being in either the IRs segment and/or in the TRs segment, said deletion of at least one of the said 60 bpRS, being located in the 5 'region of the latency-associated transcript (LAT) gene, in the promoter of the latency- associated transcript (LAT) gene,

said deletion ending at least upstream the mdvl-miR-M8-M10 microRNA (miRNA) cluster of the first intron of the LAT gene said cluster comprising from 5' to 3' the miR-M8, miR-M6, miR-M7 and miR-MlO,

said composition being stable over at least 10 passages in chicken embryonic fibroblasts in vitro.

2. The composition according to claim 1 wherein the set of avian herpes virus subtype(s) comprises one or several avian herpes virus subtype(s).

3. The composition according to claim 1 or 2 wherein said deletion starts from at least at a nucleotide located at position 5 'of the LAT promoter to a nucleotide located at position 3' of the first 60bpRS motif, in particular starts at a nucleotide located at most at position 5 Of the LAT promoter to 4 nucleotides upstream the first 60bpRS motif.

4. The composition according to any one of claims 1 to 3 wherein said avian herpes virus subtype is a subtype selected from the group consisting of

- a beta subtype comprising a genome with a beta deletion, said beta deletion extending from, at position 5,' 4 nucleotides upstream the first 60bpRS motif to the nucleotide located at position 5 Of the mdvl-miR-M8-M10 microRNA (miRNA) cluster in the first intron of the LAT gene,

- an alpha subtype comprising a genome with an alpha deletion, said alpha deletion extending from, at position 5,' 4 nucleotides upstream the first 60bp RS motif to the nucleotide located at position 5' of the miR-M6 in said mdvl-miR- M8-M10 microRNA (miRNA) cluster,

- a gamma subtype comprising a genome with a gamma deletion, said gamma deletion extending from, at position 5,' 4 nucleotides upstream the first 60bpRS motif to the nucleotide located at position 3' of the miR-MlO in said mdvl-miR- M8-M10 microRNA (miRNA) cluster, or a mixture thereof.

5. The composition according to any one of claims 1 to 4 wherein said deletion is a deletion of nucleotides which are contiguous in said genome when having no deletion.

6. The composition according to any one of claims 1 to 5 wherein said deletion is a deletion of 210 to 1600 nucleotides, preferably of 845(β) to 1576 (g), and more particularly to 845(β) to 941(a) nucleotides.

7. A composition according to any one of claims 4 or 6 comprising more than 90% of an alpha subtype and/or more than 90% of a beta subtype bearing a beta deletion, with respect to the total number of subtypes.

8. The composition according to any one of claims 4 to 6 wherein the set of avian herpes virus subtype(s) comprises at least 46 or 50 % of a beta subtype with respect to the total number of subtypes.

9. The composition according to any one of claims 4 to 6 wherein the set of avian herpes virus subtype(s) comprises at least 57 or 60 % of an alpha subtype with respect to the total number of subtypes.

10. The composition according to claim 4 or 6 comprising more than 60% of an alpha subtype, and more than 50 % of a beta subtype with respect to the total number of subtypes.

11. A composition according to claim 4 to 10 wherein the set of avian herpes virus subtype(s) comprises one or several avian herpes virus subtype(s), said subtype having

one alpha deletion in I s and one alpha deletion in TRs,

one alpha deletion in IRs and one beta deletion in the TRs,

one beta deletion in IRs and one alpha deletion in TRs, or

one beta deletion in IRs and one beta deletion in TRs.

12. The composition according to claim 11 comprising or consisting in 100% of an alpha subtype with one alpha deletion in IRs and one alpha deletion in TRs or in 100% of a beta subtype with one beta deletion in IRs and one beta deletion in TRs.

13. The composition according to any one of claims 4 to 12 wherein said avian herpes virus GaHV-2 subtype comprises an avian herpes virus GaHV-2 genome with a SEQ ID N°:3 (beta) and/or with a SEQ ID N°:2 (alpha).

14. The composition according to any of claims 1-13 wherein the genome is present within a viral particle or a virus-like particle, in particular a cell- associated viral particle and more particularly a chicken embryonic fibroblast- associated viral particle.

15. A vaccine comprising an avian herpes virus GaHV-2 genome with a SEQ ID N°:3 (beta) and/or with a SEQ ID N°:2 (alpha).