WO2014117472A1

WO2014117472A1 - Α-amylase, gene of α-amylase, engineering bacteria containing the gene, and applications of engineering bacteria

Info

Publication number: WO2014117472A1
Application number: PCT/CN2013/078680
Authority: WO
Inventors: 崔中利; 李周坤; 黄彦
Original assignee: 南京农业大学
Priority date: 2013-02-04
Filing date: 2013-07-02
Publication date: 2014-08-07
Also published as: CN103103206A; CN103103206B

Abstract

Disclosed are an α-amylase, a gene of the α-amylase, engineering bacteria containing the gene, and applications of the engineering bacteria. The present invention provides an α-1,4-starch sugar incision enzyme gene, wherein the overall length of the gene is 1569 bp and the G+C content of the gene is 67%, 522 amino acids are encoded, a nucleotide sequence is SEQ ID NO:1, and a coded incision enzyme protein amino acid sequence is SEQ ID NO:2. The engineering bacterial strain constructed by using the gene can express an α-1,4-starch sugar incision enzyme. The enzyme preparation produced by using the gene can be used for industries such as grain processing, food processing, brewing, fermenting, textile, and medicine.

Description

Instruction manual

Alpha-amylase and its gene, engineering bacteria containing the same and application thereof

Technical field

The present invention belongs to the field of applied industrial microorganisms, and discloses an α-starch and an enzyme gene thereof, an engineered strain containing the same, and an application thereof. Background technique

In recent years, due to the rapid development of the deep processing industry of starch raw materials at home and abroad, the application field of α-amylase has been continuously expanded. Therefore, screening α-amylases with different characteristics has become a hot spot in the field of enzyme preparation research. . China is a large agricultural country. The deep processing industry of starch raw materials is a huge system. The continuous updating and improvement of enzyme preparations also provides good conditions for the deep processing of starchy raw materials, and also provides a basis for the development of innovative enzyme processes. It not only improves efficiency, reduces consumption, but also plays a vital role in saving industrial grain.

Amylase is a very important enzyme preparation, which accounts for about 25% of the entire enzyme preparation market, almost completely replacing the use of chemical reagents in the starch industry. Since 1833, Payen has used white precipitates precipitated from alcohol in malt extracts and successfully applied to the desizing of cotton. The research and application of α-amylase has received great attention from scholars at home and abroad, and great progress has been made. At present, α-amylases have been found to be widely distributed, mainly using microbial-derived amylases for large-scale fermentation production. Alpha-amylase is widely used in the food processing, food industry, brewing, fermentation, textile and pharmaceutical industries, and it not only solves the problem of reprocessing of starchy raw materials, but also achieves considerable economic benefits.

The α-amylase can cleave α-1,4 glycosidic bonds from the inside of the starch molecule to form malto-oligosaccharides, mainly from animals, plants, and microorganisms. The amylase acts on both amylose and amylopectin, and randomly cleaves the α-1,4 chain inside the sugar chain without distinction. Therefore, it is characterized by a sharp drop in the viscosity of the substrate solution and the disappearance of the iodine reaction. The final product is mainly glucose when the amylose is decomposed, and a small amount of maltotriose and maltose, among which the fungal α-amylase is hydrolyzed. The final product of starch is mainly maltose and does not contain macromolecular limit dextrin. It has a wide range of applications in the baking industry and maltose manufacturing. On the other hand, in the decomposition of amylopectin, in addition to maltose, glucose, and maltotriose, α-limit dextrin (also referred to as α-dextrin) having a branching portion having an α-1,6 bond is also produced. The general decomposition limit is 35-50% based on glucose, but in the bacterial amylase, it also exhibits a decomposition limit of up to 70% (final release of glucose). The use of genetic engineering to construct high-efficiency expression strains can achieve large-scale expression of amylase, and the highest specific activity of amylase is about 5000u/mg. The acquisition of amylase gene has great application potential in the field of utilization of starchy raw materials, and at the same time, the ability of amylase can be improved by genetic modification, and realized by genetic engineering. The synergistic effect of each starch hydrolase gene, in order to better develop and utilize the starchy raw material resources and realize the transformation and utilization of biomass, which is of great significance to the sustainable development of human beings. Summary of the invention

It is an object of the present invention to provide a novel alpha-amylase gene, and a protein encoded thereby.

Another object of the present invention is to provide a genetically engineered bacterium containing the α-amylase gene.

A further object of the invention is to provide the use of this gene.

The α- 1,4 amylase endonuclease gene has the nucleotide sequence: SEQ ID N0.1, the full length of the gene (from the start codon to the stop codon) is 1569 bp, and the G+C content is 67%. , encoding 522 amino acids.

The α-1,4 amylase endonuclease protein encoded by the α-1,4 amylase endonuclease gene of the present invention has an amino acid sequence of -SEQ ID N0.2. The optimum pH of the α-1,4 amylase is 7.0, the optimum reaction temperature is 50 ° C, and at 20'C-50 ° C (lh) and _P H 5. 0-10. 0 (24h) The activity was kept stable between the two, while the enzyme remained active (15d) in 4mol/L NaCl and KC1.

The 23 amino acids at the beginning of the α-1,4 amylase endonuclease of the present invention are a typical signal peptide, and the amino acid sequence thereof is SEQ ID N0.4.

A recombinant plasmid containing the α-1,4 amylase endonuclease gene of the present invention.

Preferably, the recombinant plasmid is obtained by cloning the α-1,4 amylase endonuclease gene into ρΕΤ-29α(+).

A recombinant microorganism comprising the recombinant plasmid of the present invention.

The recombinant microorganism preferably has a host strain of £co//BL21 (DE3).

The genetic engineering application of the α-1,4 amylase endonuclease gene of the present invention in starch hydrolysis.

The use of the α-1,4 amylase endonuclease protein of the present invention in starch hydrolysis or industrial production.

Beneficial effect

1. The present invention uses a viscobacterial strain EGB selected from Dongying soil samples in Shandong Province as a material to purify a highly active α-amylase from the fermentation supernatant of the strain, and successfully obtains by protein amino acid sequencing combined with PCR amplification. The α- 1,4 amylase endonuclease gene sequence, the enzyme activity of up to 10013 u / mg when measured with soluble starch as a substrate.

2. The full length of the gene (from the start codon to the stop codon) is 1569 bp, the G+C content is 67%, and encodes 522 amino acids.

3. Amplify the complete α-1,4 amylase endonuclease gene fragment containing the Λ/del and ΛοΙ cleavage sites by PCR and ligated it to the E. coli high expression vector ρΕΤ-29α(+) ( Purchased from the Χ Ι Ι Ι site of Novegen) The expression expression host E. coli BL21 (DE3) (purchased from Invitrogen:) was subjected to IPTG-induced expression.

4. The present invention has the activity of α- 1,4 amylase endonuclease gene expression, and can efficiently hydrolyze soluble starch, and the specific activity when using soluble starch as a substrate is as high as 10013 u/mg.

5. Engineered strains constructed using this gene can efficiently express α-1,4 amylase endonuclease, and the enzyme preparations can be used in industries such as grain processing, food industry, brewing, fermentation, textile industry and medicine. DRAWINGS

Figure 1. Electropherogram of SDS-PAGE protein after purification and analysis of amylase zymogram.

Where l _: Marker 2: Protein 3 after purification: Spectroscopic analysis of starch plate denaturing enzyme

Figure 2 Strategy map of α-1,4 amylase endonuclease gene cloning

Fig. 3 High-efficiency expression of α-1,4 amylase endonuclease gene in £co//' BL21 ( pET-29a(+) )Fig. 4 Effect of temperature on enzyme activity

Figure A shows the optimum reaction temperature; Figure B shows the thermal stability.

Figure 5 Effect of pH on enzyme activity

Figure A shows the optimum pH measurement and Figure B shows the pH stability.

Figure 6 Salt-tolerant properties of α-amylase

The map shows the effect of salt on enzyme activity, B is the effect of NaCI on enzyme stability, and C is the effect of KCI on enzyme stability. Biomaterial preservation information

Corallococcus coralloldes EGB, preserved in the China Center for Type Culture Collection, deposited at Wuhan University, Wuhan, China, with a deposit date of December 17, 2012, and a deposit number of CCTCC NO: M2012528. detailed description

Example 1 Cloning of α-1,4 amylase endonuclease gene

1.1 Separation and purification of α-1,4 amylase

Corallococcus coralloldes EGB CCCTCC NO: M2012528 was cultured in W/4 liquid medium (Anji Yeast 0. 5%, CaCl ₂ -2H ₂ 0 0.1%, Vitamin B ₁₂ 0.5 g/mL, 0.1% crystal violet; 7.2; ) The fermentation supernatant was collected, and the supernatant was concentrated by 40%-80% ammonium sulfate gradient precipitation. The DEAE weak anion exchange column, the hydrophobic column, the sephardex G200 molecular sieve, and the glycogen-amylase-40% ethanol complex were adsorbed. Analytical and other means, combined with zymography analysis (Figure 1), to determine the SDS-PAGE protein on the molecular weight of about 43KD band for the purpose of the band. 1.2 α-1,4 amylase amino acid sequencing

After electrophoresis of the purified α-1,4 amylase SDS-PAGE protein, the band size was determined, and then the peptide was recovered by gelation, and the peptide fingerprinting sequence alignment was performed by Shanghai Boyuan Technology Co., Ltd., and the peptide fragment mass spectrometry information was combined. As well as database search alignment, the results compare three peptides. Separately

1. DKLWFFAGFAPSFQR

2. DDGNTYFLGNPGSGFAK

3. DDGNTYFLGNPGSGFAK

1.3 Cloning of α-1,4 amylase gene

The intermediate fragment gene of the enzyme was successfully amplified by designing the merging primers by the three peptides that have been compared. Based on the fragment gene, primers were designed to extend in both the forward and reverse directions by SEFAPCR to amplify the flanking sequences.

Forward primer:

SP3 forward primer: 5-GGCTACGCCTACGTGCTCN NNNN NGGGCAT-3 (SEQIDN0.5);

SP2 forward primer: 5- GTCGTGCGGCA ACGGGCAGA AC-3 (SEQ IDN0.6)

SP1 forward primer: 5- GCCAGCCGCCACGTCACCTT- 3 ( SEQ IDN0.7)

Reverse primer:

SP3 Reverse Primer: 5- GGC A GCC A G A TC A TCGTGN NNNN NGCCTTC-3 ( SEQ IDN0.8)

SP2 Reverse Primer: 5- A GC A CGTTG A GCTGCCGGGG-3 (SEQ IDN0.9)

SP1 reverse primer: 5- TG A TGCCCTGCGCGTTG A GC-3 ( SEQ ID NO. 10)

PCR reaction is divided into two cycles

Cycle 1.

reaction system

2x Gcbuffer I 12.5 μΙ

dNTP mixture 4μΙ

Lataq 0.3μΙ

SP3 (SEQIDNO.3 and SEQIDNO.6) 0.7μΙ

EGB bacteria genome cDNA 0.5μΙ

ddH ₂ 0 7.0μΙ

25 μΙ

Reaction conditions: (1) 94° C, 4min

(2) 2x (94 ° C, 30 s; 35 ° C, 3 min; 70 ° C, 5 min)

Add SP1 (SECUDN0.5 and SEQIDN0.8) ΙμΙ

(3) 25x (94°C, 30s; 70°C, 5min30s)

(4) 2x (94. C, 30s; 70°C, 5min30s)

(5) 8x (94 ° C, 30 s; 70 ° C, 5 min 30 s; 94 ° C, 30 s; 50 ° C, 30 s; 70 ° C, 5 min)

(6) 70 ° C, lOmin

(7) 10 ° C, lOmin

Cycle 2.

reaction system

10 x GCbuffer 2.5 μΙ

1 x dNTP 2 μΙ

Mg ²⁺ 2 μΙ

LaTaq 0.3 μΙ

SP2 (SEQIDN0.4 and SEQIDN0.7) 1.2 μΙ

PCR product of cycle 1 1 μΙ

ddH ₂ 0 16 μΙ

25μΙ total

Reaction conditions

(1) 30x (94°C, 30s; 68°C, 30s; 70°C, 5min)

The full-length sequence of the amyloid gene was obtained by performing ORF prediction and binding function verification on the flanking sequences (cycle 1 and cycle 2 products) amplified by SEFA PCR, and the amylase gene primers F and R were designed with full-length sequence to fGB. The genomic DNA of the genome is used as a template for full-length PCR amplification of the amylase gene.

F: CATATGACGTTGAAGACCCGCC (SEQIDNO.il)

R: CTCGAGGAAGCTGGCGGTGGC (SEQIDN0.12)

1.4 Preparation of E.coli DH10B electrotransfer competent state

The strain E.coli DH10B was streaked from a -70 °C refrigerator on a fresh LB plate and cultured overnight. A colony with a diameter of about 2 mm was picked up into a SOB tube without added Mg ²⁺ and cultured at 37 ° C until the OD 600 arrived. After 1.0, a 0.5 L shake flask containing 100 ml of SOB medium was added at a dose of 1/100, and cultured at 18 ° C, 220 rpm until the OD 600 reached 0.7 to 0.8; Place in an ice bath, cool for 10 min, centrifuge at 4000 °C for 5 min at 4 °C to collect the bacterial pellet; resuspend in an equal volume of sterile ultrapure water, wash the cells, and centrifuge at 4000 °C for 5 min at 4 °C. Body precipitation; repeated washing once; 100 ml 10% glycerol resuspended cells, centrifuged at 4000 rpm for 5 min at 4 °C to collect the bacterial pellet; repeat the washing once; carefully discard the supernatant, invert the centrifuge bottle and drain on the sterile absorbent paper About 1 min. Each 1000 ml culture was carefully resuspended with 2 ml of 10% glycerol, and each tube was dispensed in a centrifuge tube at 100 μΙ, and then quickly placed in a -70 ° C refrigerator for later use.

1.5 Enzyme conversion

The PCR-produced α-amylase DNA fragment was mixed with pMD 19-T Vector (TaKaRaCode: D102A) in a molar ratio of 3:1, and allowed to stand at 16 ° C in a water bath overnight. The enzyme system is as follows:

pMD 19-T vector 0.5 μΙ

PCR plus A-tailed α-amylase DNA fragment 3μΙ

Solution I (TAKARA) 5 μ 1

Sterilize double distilled water to 10 μΙ

10 μL of the enzyme-linked product was added to 200 μL of E. coli DH5a competent cells thawed on ice, ice-bathed for 30 min, and heat-stimulated in a 42 ° C water bath for 90 s. Rapidly transfer to an ice bath for 1 to 2 min, add 800 μM liquid LB medium to each tube, and incubate for 45 min at 37-C shaker at 80-90 rpm to resuscitate the cells. After centrifugation at 4000 rpm for 3 min, the remaining 200 μL of competent cells were plated on LB agar plates containing 100 mg/1 ampicillin, and the plates were placed in a 37 °C incubator.

1.6 Extraction and sequencing of the target gene plasmid

Single colonies in 1.5 were picked and cultured in LB medium containing ampicillin overnight, and the cells were collected by centrifugation at 12,000 rpm for 10 min. The plasmid was extracted using a plasmid extraction kit and sent to Shanghai Yingjie Jieji Biological Co., Ltd. for sequencing. Results of the full length of the gene

(from the start codon to the stop codon) is 1569 bp, the G+C content is 67%, and the sequence is SEQ ID N0.1; the gene encodes 522 amino acids and the amino acid sequence is SEQ ID N0.2. By analyzing the amino acid sequence encoded by the gene, the first 23 amino acids after the start of the start is a typical signal peptide, the gene is 69 bp in length, the G+C content is 72%, and the sequence is SEQ ID N0.3; The gene encodes 23 amino acids whose amino acid sequence is SEQ ID N0.4. Example 2. Induction of ct-amylase gene in E. coli BL21 (pET-29a(+))

2.1 The recombinant plasmid extracted from 1.6 was digested with the enzymatic X )ol

Enzyme digestion system:

Nde I 1 μΙ

Xho I 1 μΙ

ΙΟχΗ buffer 5 μΙ Recombinant plasmid 20 μΙ

Sterilized distilled water to 50 μΙ

In a 37 'C water bath, the reaction was carried out for more than 3 h. The digested product was subjected to 0.75% agarose gel electrophoresis.

2.2 pET-29a(+) ( Merck-Novagen, Cat NO. 69871) is digested with Wdel and ίοΙ (Ref. 2.1).

2.3 Transformation and expression

The recovered fragment in 2.1 and the enzymatically cleaved pET-29a(+) in 2.2 were enzymatically ligated to obtain the pET-29a(+) recombinant plasmid containing α-amylase.

Enzyme-linked pET-29a(+) recombinant plasmid containing α-amylase was transformed into expression host E. coli BL21(DE3) (BE, Cat NO.C2527H) to obtain recombinant microorganism f.co//' BL21 (DE3 ), the LB plate containing 50 mg/L kanamycin was coated, and the single colony extraction plasmid was picked and verified by sequencing to confirm the gene sequence.

2.4 Verifying the hydrolysis function of soluble starch by enzymes expressed by the target gene

After sequencing, the bacteria were sequenced into LB medium and cultured at 37 °C until ODeoonm was between 0.5 and 0.6. IPTG was added to a concentration of 0.2 mM, and incubation was continued at 18 °C for 24 h. The collected cells were resuspended in Tris-HCI (pH 7.0), and the cells were disrupted by sonication, and centrifuged at 20000 g for 15 min, and the resulting supernatant was an α-amylase crude enzyme solution. Appropriate amount of α-amylase crude enzyme solution was added to 1 ml of Tris-HCI buffer containing 0.5% soluble starch, and reacted at 50 °C for 10 min, and the formation of reducing sugar was detected by DNS. The enzyme activity unit is defined as the amount of enzyme required to produce ΙμΓηοΙ reducing sugar per minute, which is a unit of activity. The specific activity of the crude enzyme is 112.83 u/mgo, and the enzyme is purified by Ni-NTA affinity chromatography. After filtration and concentration, the specific activity of the enzyme when using soluble starch as a substrate was 10013 u/mg. The results showed that the specific enzyme activity after purification and concentration was about 100 times that of the crude enzyme. The enzyme preparations produced can be used in industries such as food processing, food industry, brewing, fermentation, textile industry and medicine. Example 3. Study on the enzymatic properties of α-amylase gene

3.1 Effect of temperature on enzyme activity

Determination of optimum reaction temperature: Determination of recombinant enzymes at different temperatures (20 ° C, 30 ° C, 40 ° C, 50 ° C, 60 ° C, 70 ° C, 80 ° C), pH 7.0 For the activity of the enzyme, the highest enzyme activity was set to 100% (Fig. 4a).

Determination of thermal stability: The recombinant enzyme-purified enzyme solution was incubated at 20 ° C, 30 ° C, 40 ° C, 50 ° C, 60 ° C, 70 ° C, 80 ° C, pH 7.0, lh, every Samples were taken at lOmin and rapidly cooled on ice, and the residual enzyme activity was measured, respectively, to 100% of the enzyme activity without incubation (Fig. 4b).

The optimum reaction temperature of the amylase was determined to be 50 ° C and remained stable between 20 ° C and 5 °C.

3.2 Effect of pH on enzyme activity

Determination of the optimum pH for the reaction: at different pH values (3.0, 4.0, 5. 0, 6. 0, 7. 0, 8. 0, 9. 0, 10. 0), 50. C The activity of the recombinase-purified enzyme solution was measured, and the highest activity was set to 100% (Fig. 5a).

Determination of pH stability: The recombinant enzyme-purified enzyme solution was kept at pH 3.0, 4.0, 5. 0, 6. 0, 7. 0, 8. 0, 9. 0, 10. 0 at 4 ° C for 24 h. Thereafter, the residual viability was measured, and the enzyme activity at pH 7.0 was 100% (Fig. 5b).

The optimum pH of the amylase was determined to be 7.0, and remained stable at pH 5. 0-10.

3.3 α-amylase salt tolerance

Effect of salt on enzyme activity: NaCI and KCI were added to the living system of the recombinant enzyme-purified enzyme solution, and the final concentrations were 1 mol/L, 2 mol/L, 3 mol/L, and 4 mol/L, respectively. The activity of the enzyme was measured, and the activity without adding a salt was set to 100% (Fig. 6a).

Effect of salt on enzyme stability: Recombinase purified enzyme solution was kept at 1mol/L, 2mol/L, 3mol/L, 4mol/L NaCI (Fig. 6b) and KCI (Fig. 6c), 4'C for 15d, each The activity of the enzyme was measured by Id, and the enzyme activity without salt was set to 100%.

The amylase was determined to have an activity of about 80% in the presence of 1 mol/L of NaCI and KCI, and remained stable in the presence of up to 4 mol/L NaCI and KCI.

Print (original is in electronic form)

The following descriptions are mentioned here with the instructions in this application.

Preserved microorganisms or other biological materials related:

-1 Page 3

-2 Line number: 17-19

-3 Preservation

-3-1 Name of the depositary unit CCTCC China Type Culture Collection

-3-2 Deposited Address Address Wuhan University, Wuhan, Hubei Province, China, 430072, Hubei

(GN).

-3-3 Date of Deposit December 17, 2012 (17.12.2012)

-3-4 Deposit No. CCTCC M2012528

-4 Additional information Classification s Cor α I Iococcus coral loldes EGB

-5 This note is for the following designated countries

All designated countries

Filled in by the receiving office -4 This form is received with the international application:

(Yes or no)

-4-1 Authorized Officials Completed by the International Bureau -5 International Bureau receives the date of this form: -5-1 Authorized Officer

Claims

An α-1,4 amylase endonuclease gene characterized in that the nucleotide sequence is: SEQ ID NO.

The ct-1,4 amylase endonuclease protein encoded by the α-1,4 amylase endonuclease gene according to claim 1, which is characterized in that the amino acid sequence is: SEQ ID NO.

3. The 69 bases at the beginning of the α-1,4 amylase gene of claim 1 is a typical signal peptide sequence characterized in that the nucleotide sequence is: SEQ ID NO.

A signal peptide encoded by 69 bases of the _α- 1,4 amylase endase gene according to claim 3, wherein the amino acid sequence is SEQ ID N0.4.

A recombinant plasmid comprising the α-1,4 amylase endonuclease gene of claim 1.

The recombinant plasmid according to claim 5, wherein the recombinant plasmid is obtained by cloning the α-1,4 amylase endonuclease gene of claim 1 into ρΕΤ-29α(+).

7. A recombinant microorganism comprising the recombinant plasmid of claim 5.

The recombinant microorganism according to claim 6, characterized in that E. co//BL21 (DE3) is preferably used as a host strain.

9. The genetic engineering application of the α-1,4 amylase endonuclease gene according to claim 1 in starch hydrolysis.

10. The use of an alpha-1,4 amylase endonuclease protein according to claim 2 for starch hydrolysis or industrial production.