WO2014100346A1 - Genetic loci associated with soybean cyst nematode resistance and methods of use - Google Patents

Genetic loci associated with soybean cyst nematode resistance and methods of use Download PDF

Info

Publication number
WO2014100346A1
WO2014100346A1 PCT/US2013/076414 US2013076414W WO2014100346A1 WO 2014100346 A1 WO2014100346 A1 WO 2014100346A1 US 2013076414 W US2013076414 W US 2013076414W WO 2014100346 A1 WO2014100346 A1 WO 2014100346A1
Authority
WO
WIPO (PCT)
Prior art keywords
marker
seq
locus
linkage group
soybean
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/076414
Other languages
French (fr)
Inventor
Jonathan B. Allen
Bryce R. DAINES
JR. David L. HYTEN
Donald Kyle
Clinton W. MAPEL
Joshua M. SHENDELMAN
Jeffrey A. Thompson
John B. WOODWARD
Yanwen XIONG
Meizhu Yang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
Original Assignee
Pioneer Hi Bred International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi Bred International Inc filed Critical Pioneer Hi Bred International Inc
Priority to BR112015014632-5A priority Critical patent/BR112015014632B1/en
Priority to CA2893847A priority patent/CA2893847C/en
Publication of WO2014100346A1 publication Critical patent/WO2014100346A1/en
Priority to ZA2015/03510A priority patent/ZA201503510B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display improved resistance to Soybean Cyst Nematode.
  • sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 430287seqlist.txt, a creation date of February 26, 2013 and a size of 111 KB.
  • ASCII American Standard Code for Information Interchange
  • the sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
  • Soybeans ⁇ Glycine max L. Merr. are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
  • Soybean Cyst Nematode is a parasitic pest which has threatened soybean production in the U.S. for more than fifty years. Soybean cyst nematode resistance is an economically important trait as infection can substantially reduce yields. Molecular characterization of soybean cyst nematode resistance would have important implications for soybean cultivar improvement.
  • the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resitance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode, as well as soybean plants and seeds comprising one or more soybean cyst nematode loci.
  • Figure 1 A-C provides a genetic map for loci on linkage group CI .
  • Figure 2 A-B provides a genetic map for loci on linkage group Bl .
  • Figure 3 A-D provides a genetic map for loci on linkage group D2.
  • Figure 4 A-D provide a genetic map for loci on LG B 1. Genetic map positions are based on the public integrated map (Hyten et al. (2010) Crop Sci 50:960-968).
  • Figure 5 A-C provides a genetic map for loci on linkage group Dlb.
  • Figure 6 A-C provides a genetic map for loci on linkage group C2.
  • Figure 7 A-B provides a genetic map for loci on linkage group B2.
  • Figure 8 A-B provides a genetic map for loci on linkage group E.
  • Figure 9 A-B provides a genetic map for loci on linkage group L.
  • kits comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers.
  • the term “comprising” is intended to include examples encompassed by the terms “consisting essentially of and “consisting of.” Similarly, the term “consisting essentially of is intended to include examples encompassed by the term “consisting of.”
  • Agronomics refers to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season.
  • Individual agronomic traits include emergence vigor, vegetative vigor, stress resistance, disease resistance or resistance, insect resistance or resistance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
  • Allele means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy
  • allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
  • amplifying in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced.
  • An “amp licon” is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method
  • An "ancestral line” is a parent line used as a source of genes, e.g., for the development of elite lines.
  • An "ancestral population” is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
  • Backcrossing is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
  • chromosome segment designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome.
  • Chrosome interval refers to a chromosome segment defined by specific flanking marker loci.
  • Crop and “variety” are used synonymously and mean a group of plants within a species ⁇ e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
  • An "elite line” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
  • An "elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
  • an “exotic soybean strain” or an “exotic soybean germplasm” is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm.
  • an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
  • a "genetic map” is a description of genetic linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form.
  • Gene is a description of the allelic state at one or more loci.
  • Germplasm means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
  • An individual is "homozygous” if the individual has only one type of allele at a given locus (e.g. , a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes).
  • An individual is "heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles).
  • the term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
  • “Introgression” means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
  • label or “detectable label” refer to a molecule capable of detection.
  • a detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqManTM probes.
  • reporter refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher.
  • the detectable signal of the reporter is, e.g., fluorescence in the detectable range.
  • quencher refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter.
  • quenching and “fluorescence energy transfer” refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
  • a “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic).
  • a “subline” refers to an inbred subset of
  • a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are "fixed” or homozygous across most or all loci.
  • Commercial soybean varieties (or lines) are typically produced by aggregating ("bulking") the self- pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self- pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was
  • Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant.
  • the seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample.
  • seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, resistance, etc.).
  • Linkage refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage. "Linkage disequilibrium" or "LD" is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
  • Linkage group refers to traits or markers that generally co-segregate.
  • a linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
  • Locus is a defined segment of DNA.
  • a “map location” or “map position” is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968.
  • a “physical position” or “physical location” or “physical map location” is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463: 178- 183, available from the Phytozome website (phytozome-dot-net/soybean).
  • Mapping is the process of defining the linkage relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
  • Marker or “molecular marker” or “marker locus” is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
  • Marker assisted selection refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
  • Haplotype refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-0 are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
  • a "marker profile” means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes.
  • a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
  • plant includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
  • Plant parts means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
  • Polymorphism means a change or difference between two related nucleic acids.
  • a “nucleotide polymorphism” refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
  • Polynucleotide “polynucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” and “oligonucleotide” are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi- stranded, that optionally contains synthetic, non-natural, or altered R A or DNA nucleotide bases.
  • a DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
  • Primer refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase.
  • primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed.
  • Primers may be provided in double-stranded form, though the single-stranded form is more typically used.
  • a primer can further contain a detectable label, for example a 5' end label.
  • Probe refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
  • probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed.
  • a probe can further contain a detectable label.
  • Quantitative trait loci or “QTL” refer to the genetic elements controlling a quantitative trait.
  • Recombination frequency is the frequency of a crossing over event
  • Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
  • Resistance and “improved resistance” are used interchangeably herein and refer to any type of increase in resistance or resistance to, or any type of decrease in susceptibility.
  • a "resistant plant” or “resistant plant variety” need not possess absolute or complete resistance. Instead, a “resistant plant,” “resistant plant variety,” or a plant or plant variety with “improved resistance” will have a level of resistance or resistance which is higher than that of a comparable susceptible plant or variety.
  • Self-crossing or “self-pollination” or “selfmg” is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
  • SNP single nucleotide polymorphism
  • A, T, C, or G single nucleotide sequence
  • SNP markers exist when SNPs are mapped to sites on the soybean genome.
  • yield refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
  • an "isolated” or “purified” polynucleotide or polypeptide, or biologically active portion thereof is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment.
  • an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived.
  • the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived.
  • a polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%>, 10%), 5%o, or 1%) (by dry weight) of contaminating protein, culture media or other chemical components.
  • Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook”).
  • Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode.
  • the method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with resistance to soybean cyst nematode.
  • marker loci associated with soybean cyst nematode resistance that have been identified and mapped to genomic loci on linkage groups Dlb, B2, Bl, C2, E, CI, D2, and L. These genomic regions represent both major and minor QTLs associated with soybean cyst nematode resistance.
  • soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with resistance or improved resistance to soybean cyst nematode.
  • it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with resistance for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Sat_123 and about marker Satt453 on linkage group Bl .
  • the marker locus comprises one or more of S04196-1-B, S04938-1- A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a closely linked marker.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Sat_207 and about marker Satt713 on linkage group CI .
  • the marker locus comprises S07162-1-Q1, or a closely linked marker.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Satt574 and about marker Satt615 on linkage group D2.
  • the marker locus comprises S07161-1-Q1, or a closely linked marker.
  • Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Table 1 and Table 9 and Figures 1, 2, 3, 4, 5, 6, 7, 8 and 9.
  • Table 1 Marker Positions For Marker Loci Associated With Resistance to Soybean Cyst
  • multiple marker loci that collectively make up the soybean cyst nematode resistance haplotype of interest are investigated.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a soybean cyst nematode resistance haplotype.
  • the haplotype comprises: (a) two or more marker loci found between about marker Sat_123 and about marker Satt453 on linkage group Bl; (b) two or more marker loci comprising S04196-1- B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (c) two or more marker loci between about marker Sat_207 and about marker Satt713 on linkage group CI; and/or (d) two or more marker loci between about marker Satt574 and about marker Satt615 on linkage group D2.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are in an interval flanked by and including marker locus S00875 and about marker S02621 on linkage group Dlb.
  • the marker locus is in an interval flanked by and including S00479 and S02136.
  • the marker is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S 12962, S00144, S08166, S08177, SO 1081, and S02621.
  • the marker is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621.
  • the marker locus comprises one or more of S01519-1-A; S08177-1-Q1; S00479-1-A; S02136-1-A; S00875-1-A; S12875-1-Q1; S12950-1-Q1; S12947-1-Q1; S12933-1-Q1; S12853-1-Q1; S03246-1-A or S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, and S02621-1-A, or a marker closely linked thereto.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are in an interval flanked by and including Sat_264 and about BARC-020449-04623 on linkage group B2. In some examples one or more loci are in an interval flanked by and including S02874 and S04785- on linkage group B2. In some examples, the marker is within 30 cM of one or more of S02864 and S04785. In some examples, the marker is within 10 cM of one or more of S02864 and S04785. In a specific embodiment, the marker locus comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval flanked by and including S04348 and SO 1999 on linkage group Bl are within 30 cM of one or more of S04348, S01209, or SO 1999. In some examples, the marker is within 10 cM of one or more of S04348, S01209, or S01999. In a specific embodiment, the marker locus comprises S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval flanked by and including SO 1209 and SO 1999 on linkage group Bl In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode associated with one or more marker locus selected from the group consisting of S04937- 2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1- Ql, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1- Ql, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, S06792-1-Q1.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst in an interval flanked by and including Satt557 and Satt307 on linkage group C2.
  • the interval is flanked by and includes S03252 and S02112 on linkage group C2.
  • the marker is within 30 cM of one or more of S03252 or S02112.
  • the marker is within 10 cM of one or more of S03252 or S02112.
  • the marker locus comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval comprising the bottom 30 cM of linkage group E for example from about 66 cM to the end.
  • the interval is flanked by and includes BARC-062799- 18070 to the end of linkage group E.
  • the interval is flanked by and includes Sat_107 to the end of linkage group E.
  • the interval is flanked by and includes S00350 to S02183 on linkage group E.
  • the marker is within 30 cM of one or more of S00350 or S02183.
  • the marker is within 10 cM of one or more of S00350 or S02183.
  • the marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval comprising the top 30 cM of linkage group L for example from about 0-30 cM.
  • the interval is flanked by and comprises S02074 and S03991 on linkage group L.
  • the marker is within 30 cM of one or more of S02074 or S03991.
  • the marker is within 10 cM of one or more of S02074 or S03991.
  • the marker locus comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
  • Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Table 1 and 9 and Figures 1, 2, 3, 4, 5, 6, 7, 8 and 9.
  • multiple marker loci that collectively make up the soybean cyst nematode resistance haplotype of interest are investigated.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a soybean cyst nematode resistance haplotype.
  • the haplotype comprises: (a) two or more marker locus flanked by and including S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of
  • S04348, S01209, or S01999 on linkage group Bl (c) two or more marker locus within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) two or more marker locus comprising S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto on linkage group Bl; (e) two or more marker locus flanked by and including SO 1209 and SO 1999 on linkage group Bl; (f) two or more marker locus selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938- 2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1- Ql, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1,
  • the method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the resistance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
  • two or more marker loci or haplotypes can collectively make up a marker profile.
  • the marker profile can comprise any two or more marker loci comprising: (a) any marker loci between about marker Sat_123 and about marker Satt453 on linkage group Bl; (b) marker loci comprising S04196-1-B, S04938-1-A, S04937-1- Ql, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (c) any marker loci between about marker Sat_207 and about marker Satt713 on linkage group CI; (d) marker loci comprising S07162-1-Q1 on linkage group CI, or a closely linked marker; (e) any marker loci between about marker Satt574 and about marker Satt615 on linkage group D2;
  • marker loci comprising S07161-1-Q1 on linkage group D2, or a closely linked marker
  • marker loci comprising S07160-1 on linkage group A2, or a closely linked marker
  • marker loci comprising S07160-1 on linkage group A2, or a closely linked marker
  • any marker loci associated with the rhg4 locus on linkage group A2 any marker loci associated with the rhgl locus on linkage group G, or a closely linked marker
  • marker loci associated with the rhg2 locus on linkage group M and/or (k) any marker loci associated with resistance to soybean cyst nematode.
  • two or more marker loci or haplotypes can collectively make up a marker profile.
  • the marker profile can comprise any two or more marker loci comprising: (a) two or more marker locus flanked by and including S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) two or more marker locus within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) two or more marker locus comprising S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto on linkage group Bl; (e) two or more marker locus flanked by and including SO 1209 and SO 1999 on linkage group Bl; (f) two or more marker locus selected from the group consisting of S04937-2-A, S04937-1-
  • the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with resistance to soybean cyst nematode provided herein.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the resistance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein.
  • soybean markers In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org.
  • identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with resistance (or susceptibility) is determined for the particular germplasm under study.
  • methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
  • the method of identifying comprises detecting at least one marker locus associated with resistance to soybean cyst nematode.
  • the term "associated with" in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype.
  • an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
  • Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode. Any one marker locus or any combination of the markers set forth in Table 1 and 9 or Figures 1, 2, 3, 4, 5, 6, 7, 8 or 9, or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or first soybean germplasm an allele of at least one marker locus that is associated with resistance.
  • the at least one marker locus can be between about marker Sat_123 and about marker Satt453 on linkage group Bl;
  • (B) can comprise one or more of the marker loci S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343- 1-Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker;
  • C can be between about marker Sat_207 and about marker Satt713 on linkage group CI;
  • (D) can comprise the marker locus S07162-1-Q1, or a closely linked marker;
  • (E) can be between about marker Satt574 and about marker Satt615 on linkage group D2; and/or
  • (F) can comprise the marker locus S07161-1-Q1, or a closely linked marker.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with resistance.
  • the at least one marker locus (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, SO 1209, or SO 1999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1
  • two or more marker loci are detected in the method.
  • the germplasm is a soybean variety.
  • the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
  • the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
  • the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated soybean cyst nematode resistance alleles encompassed by the methods provided herein include, for example, those listed in Table 1 and 9 and Figures 1, 2, 3, 4, 5, 6, 7 , 8 and 9.
  • the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon.
  • amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is
  • the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
  • the method involves amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,
  • the primer pair comprises SEQ ID NO: l and SEQ ID NO:2, SEQ ID NO: 8 and SEQ ID NO:9, SEQ ID NO: 10 and SEQ ID NO: 13, SEQ ID NO: 18 and SEQ ID NO: 19, SEQ ID NO: 31 and SEQ ID NO:32, SEQ ID NO: 39 and SEQ ID NO:40, SEQ ID NO: 50 and SEQ ID NO:51, SEQ ID NO: 64 and SEQ ID NO:65, SEQ ID NO: 66 and SEQ ID NO:67, SEQ ID NO: 72 and SEQ ID NO:73, or SEQ ID NO: 82 and SEQ ID NO: 83 or the primer pairs set forth in Table 3.
  • the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
  • the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
  • the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314,
  • Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4, 5, 6, 7, and 8.
  • Table 2 Non-Limiting Examples of Primer Sequences.
  • GGTTAGATACAGTTGAATTGCCTTAAAGTCAAAATTTCCACAAG : :AC: : : AACA
  • the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein.
  • sequencing refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A.N, et al. (2012) American Journal of Botany 99(2): 175- 185;
  • NGS Next Generation Sequencing
  • genotyping by sequencing (GBS) methods for example, as described in Elshire, R.J., et al. (2011) PLoS ONE 6(5):el9379; Molecular Inversion Probe (MIP) genotyping, as described, for example, in Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673- 678; or high throughput genotyping by whole-genome resequencing, as described, for example in Huang, X et al., (2009) Genome Research 19: 1068-1076.
  • GGS sequencing
  • MIP Molecular Inversion Probe
  • fragment is intended a portion of the polynucleotide.
  • a fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-158 as long as it is capable of amplifying and/or detecting the marker locus of interest.
  • sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof.
  • equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
  • Traits or markers are considered to be linked if they co-segregate.
  • a 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM).
  • Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g. , such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time.
  • Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%), 0.5%), or 0.25%> or less.
  • cM centimorgans
  • Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about lOcM of a closely linked marker).
  • a closely linked marker is within lOcM, 9cM, 8cM, 7cM, 6cM, 5cM, 4cM, 3cM, 2cM or lcM of any given marker disclosed herein.
  • a marker associated with one of the markers disclosed herein can be within 75Kb, 60Kb, 50Kb, 40Kb, 30Kb, 20K, 10Kb, 5Kb or less of the disclosed marker.
  • closely linked loci co-segregate at least about 90% of the time. Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci. Typically, the region is assumed to have a euchromatin structure during initial evaluations. However, some regions, such are regions closer to centrosomes, have a heterochromatin structure. Without further information, the predicted physical distance between genetic map positions is based on the assumption that the region is euchromatic, however if the region comprises heterochromatin the markers may be physically closer together. With regard to physical position on a chromosome, closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000
  • nucleotides about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
  • coupling phase linkage indicates the state where the "favorable” allele at the resistance locus is physically associated on the same chromosome strand as the "favorable” allele of the respective linked marker locus.
  • both favorable alleles are inherited together by progeny that inherit that chromosome strand.
  • the "favorable” allele at the locus of interest e.g., a QTL for resistance
  • the two "favorable” alleles are not inherited together (i.e., the two loci are "out of phase” with each other).
  • Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co- segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait.
  • Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies.
  • one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like.
  • a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21 :673-678).
  • the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GBS) may be used.
  • a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GBS) may be used.
  • GGS genotyping-by-sequencing
  • no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11 :31-46; and, Egan et al.
  • sequencing by synthesis e.g., Roche 454 pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or Proton systems
  • sequencing by ligation e.g., SOLiD from Applied Biosystems, and Polnator system from Azco Biotech
  • SOMiD single molecule sequencing
  • SMS single molecule sequencing
  • Further technologies include optical sequencing systems (e.g., Starlight from Life Technologies), and nanopore sequencing (e.g., GridlON from Oxford Nanopore Technologies).
  • Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:el9379), and expression methods.
  • no reference genome sequence is needed in order to complete the analysis.
  • MAS marker assisted selection
  • soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with soybean cyst nematode resistance, without actually raising soybean and measuring for resistance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with resistance).
  • MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines).
  • MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
  • the molecular markers or marker loci are detected using a suitable amplification-based detection method.
  • nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region.
  • nucleic acid probes that bind to the amplified region are also employed.
  • synthetic methods for making oligonucleotides, including primers and probes are well known in the art.
  • oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22: 1859-1862, e.g., using a commercially available automated synthesizer, e.g. , as described in Needham- VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168.
  • Oligonucleotides, including modified oligonucleotides can also be ordered from a variety of commercial sources known to persons of skill in the art.
  • suitable primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe.
  • primers can be designed using any suitable software program, such as LASERGENE ® or Primer3.
  • primers be limited to generating an amplicon of any particular size.
  • the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus.
  • marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
  • Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and 3 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176,
  • PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g. , those comprising marker loci), facilitating detection of the markers.
  • nucleic acids of interest e.g. , those comprising marker loci
  • Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al (1987) U.S. Patent No. 4,683,202; Arnheim & Levinson (October 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173; Guatelli, et al, (1990) Proc. Natl. Acad. Sci.
  • nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci.
  • Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided.
  • exemplary primers and probes are provided in SEQ ID NOS: 1-110 and in Tables 2 and 4, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 135-158 and in Table 6.
  • Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in Table 8.
  • exemplary primers and probes are provided in SEQ ID NOS: 159-248 and in Tables 3 and 5, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 339-337 and in Table 7.
  • primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci.
  • the precise probe to be used for detection can vary, e.g. , any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein.
  • the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
  • probes will possess a detectable label. Any suitable label can be used with a probe.
  • Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means.
  • Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels.
  • Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes.
  • a probe can also constitute radiolabeled PCR primers that are used to generate a radiolabeled amplicon.
  • Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene OR); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene OR).
  • Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqManTM probes.
  • the reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3' carbon or terminal 5' carbon.
  • the quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching.
  • Non- fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
  • reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971 , the content of which is incorporated herein by reference. Examples of modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland,
  • reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the
  • naphthylamines having an amino group in the alpha or beta position. Included among such naphthylamino compounds are l-dimethylaminonaphthyl-5 sulfonate, l-anilino-8- naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate.
  • Other dyes include 3- phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2- benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like.
  • the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art.
  • Suitable examples of reporters may be selected from dyes such as SYBR green, 5- carboxyfluorescein (5-FAMTM available from Applied Biosystems of Foster City, Calif), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy- 4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy- 2',4,7,7'-tetrachlorofluorescein (6-TETTM available from Applied Biosystems), carboxy- X-rhodamine (ROX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (6-JOETM available from Applied Biosystems), VICTM dye products available from Molecular Probes, Inc., NEDTM dye products available from Applied Biosystems, and the like. Suitable examples of quenchers may be
  • TAMRA TAMRA
  • BHQ-0TM BHQ-1TM
  • BHQ-2TM BHQ-3TM
  • QSY-7TM QSY-9TM
  • QSY-21TM QSY-35TM
  • Molecular Probes, Inc. and the like.
  • a molecular beacon is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure.
  • the MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher. Under conditions where the MB does not display intra-molecular hybridization (e.g.
  • MB label when bound to a target nucleic acid, such as to a region of an amplicon during amplification), the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res.
  • Another real-time detection method is the 5'-exonuclease detection method, also called the TaqManTM assay, as set forth in U.S. Patent Nos. 5,804,375; 5,538,848;
  • a modified probe typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair.
  • the modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal.
  • the intrinsic 5' to 3' nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted.
  • the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
  • the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases.
  • the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter- quencher pair to the 5' end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3' end of the probe.
  • Separate detection probes can also be omitted in amplification/detection methods, e.g. , by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamp lifted precursors (e.g. , by fluorescence polarization).
  • amplification is not a requirement for marker detection—for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA.
  • Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular Cloning - A Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2000 (“Sambrook”); Current Protocols in Molecular Biology, F.M.
  • ASH technology is based on the stable annealing of a short, single- stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe.
  • two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences.
  • Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
  • Real-time amplification assays including MB or TaqManTM based assays, are especially useful for detecting SNP alleles.
  • probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, "A" or "C,” then one probe is designed with an "A" at the SNP position, while a separate probe is designed with a "C” at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be.
  • the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases.
  • the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes.
  • a different detectable label for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe.
  • each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3' end and either the 6-FAM (6- carboxyfluorescein) or VIC (4,7,2'-trichloro-7'-phenyl-6-carboxyfluorescein) fluorophore at the 5 ' end.
  • a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus.
  • detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed.
  • 6-FAM- and VIC-labeled probes the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured.
  • a sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence.
  • KASPar® and Illumina® Detection Systems are additional examples of commercially-available marker detection systems.
  • KASPar® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with soybean cyst nematode resistance).
  • Illumina® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The Illumina® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
  • Introgression of soybean cyst nematode resistance into non-tolerant or less- tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains soybean cyst nematode resistance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such resistance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm.
  • progeny germplasm are screened to determine the presence of soybean cyst nematode resistance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of resistance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
  • MAS One application of MAS is to use the resistance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a resistance trait into a desired (typically high yielding) background.
  • marker assisted backcrossing of specific markers from a donor source e.g., to an elite genetic background
  • markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (resistance, along with any other available markers for yield, disease resistance, etc.).
  • Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance.
  • the number of alleles associated with resistance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
  • any of the marker loci provided herein can be introduced into a soybean line having one or more of the soybean cyst nematode resistance alleles rhgl, rhgl, rhg3, rhg or rhg5.
  • any one or more of the marker loci provided herein can be stacked with the rhgl allele.
  • any one or more of the marker loci provided herein can be stacked with the rhg allele.
  • any one or more of the marker loci provided herein can be stacked with the rhgl and rhg alleles.
  • any of the marker loci provided herein can be introduced into a soybean line having one or more of the soybean cyst nematode resistance loci rhgl, rhgl, rhg3 or rhg5.
  • any one or more of the marker loci provided herein can be stacked with the rhgl locus.
  • any one or more of the marker loci provided herein can be stacked with the rhgl locus.
  • any one or more of the marker loci provided herein can be stacked with the rhgl and rhgl loci.
  • This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se.
  • the method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art.
  • Such soybean plant progeny can be assayed for alleles associated with resistance and, thereby, the desired progeny selected.
  • Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding.
  • At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
  • a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired resistance can be traced.
  • the number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
  • MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
  • markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving elite x exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the resistance marker alleles herein.
  • transgenic approaches can also be used to create transgenic plants with the desired traits.
  • exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm.
  • a nucleic acid that codes for a resistance trait is cloned, e.g. , via positional cloning, and introduced into a target plant or germplasm.
  • plant breeder recognizes "resistant” and “non-resistant” or “susceptible” soybean plants.
  • plant resistance is a phenotypic spectrum consisting of extremes in resistance and susceptibility, as well as a continuum of intermediate resistance phenotypes. Evaluation of these intermediate phenotypes using reproducible assays are of value to scientists who seek to identify genetic loci that impart resistance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a resistance trait into an elite soybean line, for example.
  • improved resistance is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to soybean cyst nematode. That is, the damage caused by soybean cyst nematode is prevented, or alternatively, the disease symptoms caused by soybean cyst nematode is minimized or lessened.
  • improved resistance to soybean cyst nematode can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%), or at least about 50%> to about 90%> or greater.
  • the methods provided herein can be utilized to protect plants from soybean cyst nematode.
  • soybean cyst nematode resistance can be determined by visual observations after plant exposure to a particular race of soybean cyst nematode, such as race 1, 2, 3, 5 or 14. Scores range from 1 to 9 and indicate visual observations of resistance as compared to other genotypes in the test. A score of 1 indicates soybean cyst nematode are able to infect the plant and cause yield loss, while a score of 9 indicates soybean cyst nematode resistance. Preliminary scores are reported as double digits, for example, '55' indicates a preliminary score of 5 on the scale of 1 to 9.
  • Non-limiting examples of soybean cyst nematode resistance phenotypic screening are described in detail below.
  • E2 Eggs or second stage juveniles (J2) are used to inoculate host plants to increase their population. Soybean cyst nematode infestation requires a minimum 35 days before the cysts reach maturity and can be used to inoculate soybean experiments. Cyst eggs/J2 inoculant is harvested through a series of washings, grindings, and screenings. Screens are used progressing from larger to smaller sizes, ending with a #500 (25 ⁇ ) screen.
  • Soybean plants are grown in cones.
  • Cones are long containers approximately 12 inches long and 1.5 inches in diameter at the top ⁇ e.g., Ray Leach Cone-tainersTM).
  • the cone is designed to easily remove the root mass.
  • an inoculum channel is made in the cone containing the experimental line by poking a 4 inch hole with a 10 ml pipette tip.
  • One ml of inoculum is dispensed into the channel.
  • the plants are watered manually for the duration of the test, with watering being moderately light during the first 3-5 days until J2 infects the roots. Plants are scored approximately 28-35 days following inoculation when cyst reproduction on susceptible checks is sufficiently high.
  • Plants are removed from their cones and the soil is removed from the roots by gently dipping the roots into a bucket of water.
  • the plants are screened to identify native resistance to one or more of the five races of soybean cyst nematode inoculated using a combination of three methods (1) visual 9-6-1 score; (2) visual full count; and/or (3) microscope count score depending on the stage of the line when screened.
  • lines earlier in the development cycle (R1-R2) are screened by the visual 9-6-1 method
  • lines that have progressed to later development phases (R3-R5) are screened by the visual full count and/or microscope count method(s) .
  • One typical phenotyping method is a visual evaluation of the roots. Susceptible checks are first evaluated for the development of cysts on the root system. These counts are recorded and averaged across the experiment to determine the susceptible (SUS) check average. Roots from the test plants are then scored based on a comparison with the average of the susceptible checks as follows:
  • FI female index
  • Cysts counts for soybean cyst nematode assays for checks and experimental line are determined by washing cysts from roots and counting the number of cysts under the microscope.
  • roots from the susceptible check controls are examined for yellow cysts to assess whether to begin the process of evaluating the test.
  • Experimental lines are compared with known standard checks. Once adequate levels of cysts are detected on the check varieties, plants from the test lines are removed from cones one at a time. Soil is removed from roots by gently dipping the roots into a bucket of water. The root tissue is placed on a 850 micron (#20) pore sieve stacked over a 250 micron (#60) pore sieve and sprayed with a jet of water to dislodge cysts from the roots. Collected cysts are rinsed from the #60 sieve into a clean labeled cup using no more than 30 mis of additional water.
  • each sample is counted using a gridded counting dish under a stereo microscope. The number of cysts counted are recorded for each sample. Cyst counts on the test plants are converted to the 1-9 scoring scale based on the female index (FI) described above.
  • Table 10 Exemplary soybean cyst nematode checks.
  • kit refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the
  • a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprises (a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) between about marker Sat_123 and about marker Satt453 on linkage group Bl; (ii) between about marker Sat_207 and about marker Satt713 on linkage group CI; or (iii) between about marker Satt574 and about marker Satt615 on linkage group D2; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode.
  • the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (b) S07162-1-Q1 on linkage group CI, or a closely linked marker; or (c) S07161-1-Q1 on linkage group D2, or a closely linked marker.
  • a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprises (I) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on
  • the primers and probes of the kit are capable of detecting a marker locus comprising a marker that: (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) comprises S04348-1-A, S01209-1- A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1,
  • a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with resistance to soybean cyst nematode, for instance a favorable marker locus, haplotype or marker profile.
  • These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g., using any available allele detection format, such as solid or liquid phase array based detection, microfluidic- based sample detection, etc.
  • the systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
  • a typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
  • a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
  • signal detection apparatus including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo- scans, microfluidic nucleic acid amplification detection appliances and the like.
  • the precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used.
  • Typical detector examples include light (e.g. , fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele. The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to "real time" amplification assay results.
  • light e.g. , fluorescence
  • radioactivity detectors e.g., detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of
  • System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted resistance are also provided.
  • the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted resistance.
  • the precise form of the instructions can vary depending on the components of the system, e.g. , they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g. , computers or computer readable media) operably coupled to the detector.
  • the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted resistance.
  • the instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
  • isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein.
  • the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising S04196-1-B, S04938-1-A, S04937-1-Q1 , S08344-1-Q1 , S08343-1-Q1 , S08346-1-Q1 , S06786-1 , S06787-1 , S06803-1 , S04197-1 , S07162-1-Q1 , S07162-1-Q1 , or a marker closely linked thereto.
  • the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising a marker locus (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, SO 1209, or SO 1999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A,
  • the isolated polynucleotide comprises: (a) a
  • polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187
  • the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to soybean cyst nematode, for instance to particular SNPs that comprise a marker locus, haplotype or marker pro file .
  • a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions.
  • polynucleotide is said to be the "complement” of another polynucleotide if they exhibit complementarity.
  • molecules are said to exhibit "complete
  • nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other.
  • Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency” conditions.
  • the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency” conditions.
  • stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
  • wash buffers may comprise about 0.1%> to about 1%> SDS.
  • Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
  • the duration of the wash time will be at least a length of time sufficient to reach equilibrium.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
  • the at least one marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
  • the at least one marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI; or
  • the at least one marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2.
  • the at least one marker locus of part (a) comprises S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto.
  • the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
  • amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template;
  • said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, or complements thereof.
  • said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 or 106.
  • An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1- Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto.
  • a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or 71;
  • An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S07161-1-Q1 or a marker closely linked thereto.
  • kits for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprising: a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein the primers or probes are capable of detecting a marker locus, wherein:
  • the marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
  • the marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI;
  • the marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2;
  • kits of embodiment 40, wherein the primers or probes are capable of detecting a marker locus comprising
  • a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
  • the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
  • the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
  • the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
  • the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2; (e) the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
  • the at least one marker locus is flanked by marker locus SO 1209 and SO 1999 on linkage group Bl;
  • the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
  • the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2; or,
  • the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or,
  • the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L.
  • the at least one marker locus of part (a) comprises S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875- 1-Ql, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1- Ql S00144-1-A, S08166- 1-Ql, SO 1081, and, S02621-1 -A or a marker closely linked thereto.
  • the at least one marker locus of part (f) comprises S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786- 3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788- 1-Ql, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto.
  • the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
  • amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template;
  • said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
  • said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 24
  • said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350,
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 3
  • S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, S02621-1-A or a marker closely linked thereto;
  • polynucleotide having at least 90% sequence identity to the polynucleotides set forth in part (a); or (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in part (a).
  • a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprising:
  • a primer or a probe for detecting one or more marker loci associated with resistance to soybean cyst nematode wherein the primer or probe are capable of detecting a marker locus, wherein:
  • the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
  • the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
  • the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
  • the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2;
  • the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
  • the at least one marker locus is flanked by marker locus SO 1209 and SO 1999 on linkage group Bl;
  • the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
  • the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2; or,
  • the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or,
  • the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L;
  • the at least one marker locus comprises S01519-1-A, S08177-1-Q1, S00479-1- A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, S02621- 1-A or a marker closely linked thereto;
  • the at least one marker locus comprises S02874-1-A, S04785-1-A, or a marker closely linked thereto;
  • the at least one marker locus comprises S04348-1-A, S01209-1-A, S01999-1- A, or a marker closely linked thereto;
  • the at least one marker locus comprises S04937-2-A, S04937-1-Q1, S04938-1- A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1- Ql, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1- Ql, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto;
  • the at least one marker locus of part (g) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto.
  • the at least one marker locus of part (j) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the SCN loci on linkage groups Bl, CI and D2. Markers were screened against various known resistant and susceptible parents. During development, these markers were validated and confirmed against a panel of 31 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines.
  • markers were validated against the panel of SCN resistant or susceptible varieties described above.
  • the markers are capable of detecting SCN loci likely derived from one or more of PI88788, Peking, PI437654, as well markers from other sources.
  • markers can be used in other assays or with other assay conditions. Some markers were assayed under additional conditions, an example of which is summarized below.
  • the parameters used for the TaqMan assay are as follows in Table 12 and 13.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Botany (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode. In certain embodiments, the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resistance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode.

Description

GENETIC LOCI ASSOCIATED WITH SOYBEAN CYST
NEMATODE RESISTANCE AND METHODS OF USE
FIELD OF THE INVENTION
This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display improved resistance to Soybean Cyst Nematode.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS-WEB
The official copy of the sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 430287seqlist.txt, a creation date of February 26, 2013 and a size of 111 KB. The sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
BACKGROUND
Soybeans {Glycine max L. Merr.) are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
Soybean Cyst Nematode (SCN) is a parasitic pest which has threatened soybean production in the U.S. for more than fifty years. Soybean cyst nematode resistance is an economically important trait as infection can substantially reduce yields. Molecular characterization of soybean cyst nematode resistance would have important implications for soybean cultivar improvement.
There remains a need for soybean plants with improved resistance to soybean cyst nematode and methods for identifying and selecting such plants. SUMMARY
Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode. In certain embodiments, the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resitance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode, as well as soybean plants and seeds comprising one or more soybean cyst nematode loci.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 A-C provides a genetic map for loci on linkage group CI .
Figure 2 A-B provides a genetic map for loci on linkage group Bl .
Figure 3 A-D provides a genetic map for loci on linkage group D2.
Figure 4 A-D provide a genetic map for loci on LG B 1. Genetic map positions are based on the public integrated map (Hyten et al. (2010) Crop Sci 50:960-968).
Physical map positions are based on the public physical map Glymal Williams82 soybean reference assembly (Schmutz et al. (2010) Nature 463: 178-183; and
www.phytozome.net/soybean).
Figure 5 A-C provides a genetic map for loci on linkage group Dlb.
Figure 6 A-C provides a genetic map for loci on linkage group C2.
Figure 7 A-B provides a genetic map for loci on linkage group B2.
Figure 8 A-B provides a genetic map for loci on linkage group E.
Figure 9 A-B provides a genetic map for loci on linkage group L.
DETAILED DESCRIPTION
Before describing the present invention in detail, it is to be understood that this invention is not limited to particular embodiments, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:
As used in this specification and the appended claims, terms in the singular and the singular forms "a," "an," and "the," for example, include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "plant," "the plant," or "a plant" also includes a plurality of plants; also, depending on the context, use of the term "plant" can also include genetically similar or identical progeny of that plant; use of the term "a nucleic acid" optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term "probe" optionally (and typically) encompasses many similar or identical probe molecules.
Additionally, as used herein, "comprising" is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Thus, for example, a kit comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers. Additionally, the term "comprising" is intended to include examples encompassed by the terms "consisting essentially of and "consisting of." Similarly, the term "consisting essentially of is intended to include examples encompassed by the term "consisting of."
"Agronomics," "agronomic traits," and "agronomic performance" refer to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress resistance, disease resistance or resistance, insect resistance or resistance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
"Allele" means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy
corresponding loci on a pair of homologous chromosomes. With regard to a SNP marker, allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
The term "amplifying" in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. . An "amp licon" is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method
An "ancestral line" is a parent line used as a source of genes, e.g., for the development of elite lines.
An "ancestral population" is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
"Backcrossing" is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
The term "chromosome segment" designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome. "Chromosome interval" refers to a chromosome segment defined by specific flanking marker loci.
"Cultivar" and "variety" are used synonymously and mean a group of plants within a species {e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
An "elite line" is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
An "elite population" is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
An "exotic soybean strain" or an "exotic soybean germplasm" is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm. In the context of a cross between two soybean plants or strains of germplasm, an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
A "genetic map" is a description of genetic linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form.
"Genotype" is a description of the allelic state at one or more loci.
"Germplasm" means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
An individual is "homozygous" if the individual has only one type of allele at a given locus (e.g. , a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes). An individual is "heterozygous" if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). The term "homogeneity" indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that individuals within the group differ in genotype at one or more specific loci.
"Introgression" means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
The terms "label" or "detectable label" refer to a molecule capable of detection. A detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqMan™ probes. The term "reporter" refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher. The detectable signal of the reporter is, e.g., fluorescence in the detectable range. The term "quencher" refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter. As used herein, the terms "quenching" and "fluorescence energy transfer" refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
A "line" or "strain" is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic). A "subline" refers to an inbred subset of
descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are "fixed" or homozygous across most or all loci. Commercial soybean varieties (or lines) are typically produced by aggregating ("bulking") the self- pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self- pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was
heterozygous in the originally selected F3 to F5 plant. Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant. The seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample. Optionally, seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, resistance, etc.).
"Linkage" refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage. "Linkage disequilibrium" or "LD" is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
"Linkage group" (LG) refers to traits or markers that generally co-segregate. A linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
"Locus" is a defined segment of DNA.
A "map location" or "map position" is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968. A "physical position" or "physical location" or "physical map location" is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463: 178- 183, available from the Phytozome website (phytozome-dot-net/soybean).
"Mapping" is the process of defining the linkage relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
"Marker" or "molecular marker" or "marker locus" is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
"Marker assisted selection" refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
"Haplotype" refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-0 are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
As used herein, a "marker profile" means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes. For instance, in one example, a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
The term "plant" includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
"Plant parts" means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
"Polymorphism" means a change or difference between two related nucleic acids. A "nucleotide polymorphism" refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
"Polynucleotide," "polynucleotide sequence," "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "nucleic acid fragment," and "oligonucleotide" are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi- stranded, that optionally contains synthetic, non-natural, or altered R A or DNA nucleotide bases. A DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
"Primer" refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase. Typically, primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed. Primers may be provided in double-stranded form, though the single-stranded form is more typically used. A primer can further contain a detectable label, for example a 5' end label.
"Probe" refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
Typically, probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed. A probe can further contain a detectable label.
"Quantitative trait loci" or "QTL" refer to the genetic elements controlling a quantitative trait.
"Recombination frequency" is the frequency of a crossing over event
(recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
"Resistance and "improved resistance" are used interchangeably herein and refer to any type of increase in resistance or resistance to, or any type of decrease in susceptibility. A "resistant plant" or "resistant plant variety" need not possess absolute or complete resistance. Instead, a "resistant plant," "resistant plant variety," or a plant or plant variety with "improved resistance" will have a level of resistance or resistance which is higher than that of a comparable susceptible plant or variety.
"Self-crossing" or "self-pollination" or "selfmg" is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
"SNP" or "single nucleotide polymorphism" means a sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or variable. "SNP markers" exist when SNPs are mapped to sites on the soybean genome.
The term "yield" refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
As used herein, an "isolated" or "purified" polynucleotide or polypeptide, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment. Typically, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%>, 10%), 5%o, or 1%) (by dry weight) of contaminating protein, culture media or other chemical components.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook").
Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode. The method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with resistance to soybean cyst nematode. Also provided are isolated polynucleotides and kits for use in identifying and/or detecting a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode, and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved resistance to soybean cyst nematode, and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved resistance to soybean cyst nematode.
Provided herein are marker loci associated with soybean cyst nematode resistance that have been identified and mapped to genomic loci on linkage groups Dlb, B2, Bl, C2, E, CI, D2, and L. These genomic regions represent both major and minor QTLs associated with soybean cyst nematode resistance.
These findings have important implications for soybean production, as identifying markers that can be used for selection of soybean cyst nematode resistance will greatly expedite the development of soybean cyst nematode resistance into elite cultivars. Marker loci, haplotypes and marker profiles associated with resistance to soybean cyst nematode, are provided. Further provided are genomic loci that are associated with soybean resistance to soybean cyst nematode.
In certain embodiments, soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with resistance or improved resistance to soybean cyst nematode. However, in other embodiments, it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with resistance, for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
In one embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Sat_123 and about marker Satt453 on linkage group Bl . In a specific embodiment, the marker locus comprises one or more of S04196-1-B, S04938-1- A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a closely linked marker.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Sat_207 and about marker Satt713 on linkage group CI . In a specific embodiment, the marker locus comprises S07162-1-Q1, or a closely linked marker.
In yet another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Satt574 and about marker Satt615 on linkage group D2. In a specific embodiment, the marker locus comprises S07161-1-Q1, or a closely linked marker.
Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Table 1 and Table 9 and Figures 1, 2, 3, 4, 5, 6, 7, 8 and 9. Table 1 : Marker Positions For Marker Loci Associated With Resistance to Soybean Cyst
Nematode.
Figure imgf000014_0001
*Gm composite v4.0 Genetic Map
** JGI Glymal assembly
In certain embodiments, multiple marker loci that collectively make up the soybean cyst nematode resistance haplotype of interest are investigated. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a soybean cyst nematode resistance haplotype. In some embodiments, the haplotype comprises: (a) two or more marker loci found between about marker Sat_123 and about marker Satt453 on linkage group Bl; (b) two or more marker loci comprising S04196-1- B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (c) two or more marker loci between about marker Sat_207 and about marker Satt713 on linkage group CI; and/or (d) two or more marker loci between about marker Satt574 and about marker Satt615 on linkage group D2. In one embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are in an interval flanked by and including marker locus S00875 and about marker S02621 on linkage group Dlb. In some examples, the marker locus is in an interval flanked by and including S00479 and S02136. In some examples, the marker is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S 12962, S00144, S08166, S08177, SO 1081, and S02621. In some examples, the marker is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621. In a specific embodiment, the marker locus comprises one or more of S01519-1-A; S08177-1-Q1; S00479-1-A; S02136-1-A; S00875-1-A; S12875-1-Q1; S12950-1-Q1; S12947-1-Q1; S12933-1-Q1; S12853-1-Q1; S03246-1-A or S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, and S02621-1-A, or a marker closely linked thereto.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are in an interval flanked by and including Sat_264 and about BARC-020449-04623 on linkage group B2. In some examples one or more loci are in an interval flanked by and including S02874 and S04785- on linkage group B2. In some examples, the marker is within 30 cM of one or more of S02864 and S04785. In some examples, the marker is within 10 cM of one or more of S02864 and S04785. In a specific embodiment, the marker locus comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto.
In yet another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval flanked by and including S04348 and SO 1999 on linkage group Bl . In some examples, the marker is within 30 cM of one or more of S04348, S01209, or SO 1999. In some examples, the marker is within 10 cM of one or more of S04348, S01209, or S01999. In a specific embodiment, the marker locus comprises S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval flanked by and including SO 1209 and SO 1999 on linkage group Bl . In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode associated with one or more marker locus selected from the group consisting of S04937- 2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1- Ql, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1- Ql, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, S06792-1-Q1.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst in an interval flanked by and including Satt557 and Satt307 on linkage group C2. In some examples the interval is flanked by and includes S03252 and S02112 on linkage group C2. In some examples, the marker is within 30 cM of one or more of S03252 or S02112. In some examples, the marker is within 10 cM of one or more of S03252 or S02112. In a specific embodiment, the marker locus comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end. In some example the interval is flanked by and includes BARC-062799- 18070 to the end of linkage group E. In some examples the interval is flanked by and includes Sat_107 to the end of linkage group E. In some examples the interval is flanked by and includes S00350 to S02183 on linkage group E. In some examples, the marker is within 30 cM of one or more of S00350 or S02183. In some examples, the marker is within 10 cM of one or more of S00350 or S02183. In a specific embodiment, the marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM. In some examples the interval is flanked by and comprises S02074 and S03991 on linkage group L. In some examples, the marker is within 30 cM of one or more of S02074 or S03991. In some examples, the marker is within 10 cM of one or more of S02074 or S03991. In a specific embodiment, the marker locus comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Table 1 and 9 and Figures 1, 2, 3, 4, 5, 6, 7, 8 and 9.
In certain embodiments, multiple marker loci that collectively make up the soybean cyst nematode resistance haplotype of interest are investigated. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a soybean cyst nematode resistance haplotype. In some embodiments, the haplotype comprises: (a) two or more marker locus flanked by and including S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of
S04348, S01209, or S01999 on linkage group Bl; (c) two or more marker locus within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) two or more marker locus comprising S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto on linkage group Bl; (e) two or more marker locus flanked by and including SO 1209 and SO 1999 on linkage group Bl; (f) two or more marker locus selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938- 2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1- Ql, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2- Ql, S06791-1-Q1, or S06792-1-Q1 on linkage group Bl; (g) two or more marker locus flanked by Satt557 and Satt307 on linkage group C2; (h) two or more marker locus flanked by S03252 and S02112 on linkage group C2; (i) two or more marker locus within 30 cM of one or more of S03252 or S02112 on linkage group C2; (j) two or more marker locus within 10 cM of one or more of S03252 or S021 12 on linkage group C2; (k) two or more marker locus comprising S03252-1-A, S021 12-1 -A, or a marker closely linked thereto on linkage group C2; (1) two or more marker locus an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end; (m) two or more marker locus flanked by BARC-062799- 18070 to the end of linkage group E; (n) two or more marker locus flanked by Sat_107 to the end of linkage group E; (o) two or more marker locus flanked by S00350 to S02183 on linkage group E; (p) two or more marker locus within 30 cM of one or more of S00350 or S02183 on linkage group E; (q) two or more marker locus within 10 cM of one or more of S00350 or S02183 on linkage group E; (r) two or more marker locus comprising S00350-1-A, S02183-1-A, or a marker closely linked thereto on linkage group E; (s) two or more marker locus in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM; (t) two or more marker locus in an interval is flanked by S02074 and S03991 on linkage group L; (u) two or more marker locus within 30 cM of one or more of S02074 or S03991 on linkage group L; (v) two or more marker locus within 10 cM of one or more of S02074 or S03991 on linkage group L; (w) two or more marker locus comprising S02074-1-A, S03991-1-A, or a marker closely linked thereto on linkage group L; (x) two or more marker locus flanked by marker locus S00875 and about marker S02621 on linkage group Dlb; (y) two or more marker locus flanked by S00479 and S02136 on linkage group Dlb; (z) two or more maker locus within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (aa) two or more marker locus within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (ab) two or more marker locus comprising one or more of S01519-1-A; S08177-1-Q1; S00479-1-A; S02136-1-A; S00875-1-A; S12875-1- Ql; S12950-1-Q1; S12947-1-Q1; S12933-1-Q1; S12853-1-Q1; S03246-1-A or S12962- 1-Ql S00144-1-A, S08166-1-Q1, SO 1081, and S02621-1-A, or a marker closely linked thereto on linkage group Dlb; (ac) two or more marker locus flanked by Sat_264 and about BARC-020449-04623 on linkage group B2; (ad) two or more marker locus flanked by S02874 and S04785 on linkage group B2; (ae) two or more marker locus within 30 cM of one or more of S02864 and S04785 on linkage group B2; (af) two or more marker locus within 10 cM of one or more of S02864 and S04785 on linkage group B2; and/or (ag) two or more marker locus comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto on linkage group B2.
In one embodiment, the method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the resistance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
In certain embodiments, two or more marker loci or haplotypes can collectively make up a marker profile. The marker profile can comprise any two or more marker loci comprising: (a) any marker loci between about marker Sat_123 and about marker Satt453 on linkage group Bl; (b) marker loci comprising S04196-1-B, S04938-1-A, S04937-1- Ql, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (c) any marker loci between about marker Sat_207 and about marker Satt713 on linkage group CI; (d) marker loci comprising S07162-1-Q1 on linkage group CI, or a closely linked marker; (e) any marker loci between about marker Satt574 and about marker Satt615 on linkage group D2;
and/or (f) marker loci comprising S07161-1-Q1 on linkage group D2, or a closely linked marker; (g) marker loci comprising S07160-1 on linkage group A2, or a closely linked marker; (h) any marker loci associated with the rhg4 locus on linkage group A2; (i) any marker loci associated with the rhgl locus on linkage group G, or a closely linked marker; (j) any marker loci associated with the rhg2 locus on linkage group M; and/or (k) any marker loci associated with resistance to soybean cyst nematode.
In certain embodiments, two or more marker loci or haplotypes can collectively make up a marker profile. The marker profile can comprise any two or more marker loci comprising: (a) two or more marker locus flanked by and including S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) two or more marker locus within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) two or more marker locus comprising S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto on linkage group Bl; (e) two or more marker locus flanked by and including SO 1209 and SO 1999 on linkage group Bl; (f) two or more marker locus selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938- 2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1- Ql, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2- Ql, S06791-1-Q1, or S06792-1-Q1 on linkage group Bl; (g) two or more marker locus flanked by Satt557 and Satt307 on linkage group C2; (h) two or more marker locus flanked by S03252 and S02112 on linkage group C2; (i) two or more marker locus within 30 cM of one or more of S03252 or S02112 on linkage group C2; (j) two or more marker locus within 10 cM of one or more of S03252 or S021 12 on linkage group C2; (k) two or more marker locus comprising S03252-1-A, S021 12-1 -A, or a marker closely linked thereto on linkage group C2; (1) two or more marker locus an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end; (m) two or more marker locus flanked by BARC-062799- 18070 to the end of linkage group E; (n) two or more marker locus flanked by Sat_107 to the end of linkage group E; (o) two or more marker locus flanked by S00350 to S02183 on linkage group E; (p) two or more marker locus within 30 cM of one or more of S00350 or S02183 on linkage group E; (q) two or more marker locus within 10 cM of one or more of S00350 or S02183 on linkage group E; (r) two or more marker locus comprising S00350-1-A, S02183-1-A, or a marker closely linked thereto on linkage group E; (s) two or more marker locus in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM; (t) two or more marker locus in an interval is flanked by S02074 and S03991 on linkage group L; (u) two or more marker locus within 30 cM of one or more of S02074 or S03991 on linkage group L; (v) two or more marker locus within 10 cM of one or more of S02074 or S03991 on linkage group L; (w) two or more marker locus comprising S02074-1-A, S03991-1-A, or a marker closely linked thereto on linkage group L; (x) two or more marker locus flanked by marker locus S00875 and about marker S02621 on linkage group Dlb; (y) two or more marker locus flanked by S00479 and S02136 on linkage group Dlb; (z) two or more maker locus within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (aa) two or more marker locus within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (ab) two or more marker locus comprising one or more of S01519-1-A; S08177-1-Q1; S00479-1-A; S02136-1-A; S00875-1-A; S12875-1- Ql; S12950-1-Q1; S12947-1-Q1; S12933-1-Q1; S12853-1-Q1; S03246-1-A or S12962- 1-Ql S00144-1-A, S08166-1-Q1, SO 1081, and S02621-1-A, or a marker closely linked thereto on linkage group Dlb; (ac) two or more marker locus flanked by Sat_264 and about BARC-020449-04623 on linkage group B2; (ad) two or more marker locus flanked by S02874 and S04785 on linkage group B2; (ae) two or more marker locus within 30 cM of one or more of S02864 and S04785 on linkage group B2; (af) two or more marker locus within 10 cM of one or more of S02864 and S04785 on linkage group B2; and/or (ag) two or more marker locus comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto on linkage group B2; (ah) marker loci comprising S07160-1 on linkage group A2, or a closely linked marker; (ai) any marker loci associated with the rhg4 locus on linkage group A2; (aj) any marker loci associated with the rhgl locus on linkage group G, or a closely linked marker; (ak) any marker loci associated with the rhg2 locus on linkage group M; and/or (al) any marker loci associated with resistance to soybean cyst nematode.
Any of the marker loci in any of the genomic loci disclosed herein can be combined in the marker profile. For example, the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with resistance to soybean cyst nematode provided herein.
In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the resistance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein.
Not only can one detect the various markers provided herein, it is recognized that one could detect any markers that are closely linked to the various markers discussed herein.
In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org. One of skill in the art will recognize that the identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with resistance (or susceptibility) is determined for the particular germplasm under study. One of skill will also recognize that methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
Various methods are provided to identify soybean plants and/or germplasm with improved resistance to soybean cyst nematode. In one embodiment, the method of identifying comprises detecting at least one marker locus associated with resistance to soybean cyst nematode. The term "associated with" in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype. Thus, an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode. Any one marker locus or any combination of the markers set forth in Table 1 and 9 or Figures 1, 2, 3, 4, 5, 6, 7, 8 or 9, or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode.
In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode is provided. The method comprises detecting in the genome of the first soybean plant or first soybean germplasm an allele of at least one marker locus that is associated with resistance. In such a method, the at least one marker locus: (A) can be between about marker Sat_123 and about marker Satt453 on linkage group Bl; (B) can comprise one or more of the marker loci S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343- 1-Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (C) can be between about marker Sat_207 and about marker Satt713 on linkage group CI; (D) can comprise the marker locus S07162-1-Q1, or a closely linked marker; (E) can be between about marker Satt574 and about marker Satt615 on linkage group D2; and/or (F) can comprise the marker locus S07161-1-Q1, or a closely linked marker. In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode is provided. The method comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with resistance. In such a method, the at least one marker locus (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, SO 1209, or SO 1999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1- Ql or a marker closely linked thereto on linkage group Bl; (g) is flanked by Satt557 and Satt307 on linkage group C2; (h) is flanked by S03252 and S02112 on linkage group C2; (i) is within 30 cM of one or more of S03252 or S02112 on linkage group C2; (j) is within 10 cM of one or more of S03252 or S02112 on linkage group C2; (k) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto on linkage group C2; (1) is in an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end; (m) is flanked by BARC-062799- 18070 to the end of linkage group E; (n) is flanked by Sat_107 to the end of linkage group E; (o) is flanked by S00350 to S02183 on linkage group E; (p) is within 30 cM of one or more of S00350 or S02183 on linkage group E; (q) is within 10 cM of one or more of S00350 or S02183 on linkage group E; (r) comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto on linkage group E; (s) is in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM; (t) is in an interval is flanked by S02074 and S03991 on linkage group L; (u) is within 30 cM of one or more of S02074 or S03991 on linkage group L; (v) is within 10 cM of one or more of S02074 or S03991 on linkage group L; (w) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto on linkage group L; (x) is flanked by marker locus S00875 and about marker S02621 on linkage group Dlb; (y) is flanked by S00479 and S02136 on linkage group Dlb; (z) is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (aa) is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, SO 1081, and S02621 on linkage group Dlb; (ab) comprises one or more of S01519-1-A; S08177-1-Q1; S00479-1-A; S02136-1-A; S00875-1-A; S12875-1-Q1; S12950-1-Q1; S12947-1-Q1; S12933-1-Q1; S12853-1-Q1; S03246-1-A or S12962-1-Q1 S00144-1-A, S08166-1-Q1, SO 1081, and S02621-1-A, or a marker closely linked thereto on linkage group Dlb; (ac) is flanked by Sat_264 and about BARC-020449-04623 on linkage group B2; (ad) is flanked by S02874 and S04785 on linkage group B2; (ae) is within 30 cM of one or more of S02864 and S04785 on linkage group B2; (af) is within 10 cM of one or more of S02864 and S04785 on linkage group B2; and/or (ag) comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto on linkage group B2.
In other embodiments, two or more marker loci are detected in the method. In a specific embodiment, the germplasm is a soybean variety.
In other embodiments, the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm. In a further embodiment of the method, the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
In specific embodiments, the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated soybean cyst nematode resistance alleles encompassed by the methods provided herein include, for example, those listed in Table 1 and 9 and Figures 1, 2, 3, 4, 5, 6, 7 , 8 and 9.
In another embodiment, the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon. In such a method, amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is
complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and (b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon. In such a method, the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
In one embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, and/or 248 or variants or fragments thereof.
In a specific embodiment, the primer pair comprises SEQ ID NO: l and SEQ ID NO:2, SEQ ID NO: 8 and SEQ ID NO:9, SEQ ID NO: 10 and SEQ ID NO: 13, SEQ ID NO: 18 and SEQ ID NO: 19, SEQ ID NO: 31 and SEQ ID NO:32, SEQ ID NO: 39 and SEQ ID NO:40, SEQ ID NO: 50 and SEQ ID NO:51, SEQ ID NO: 64 and SEQ ID NO:65, SEQ ID NO: 66 and SEQ ID NO:67, SEQ ID NO: 72 and SEQ ID NO:73, or SEQ ID NO: 82 and SEQ ID NO: 83 or the primer pairs set forth in Table 3.
In another embodiment, the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified. In such a method, the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein. In one embodiment, the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, and/or 338 or variants or fragments thereof.
Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4, 5, 6, 7, and 8. Table 2: Non-Limiting Examples of Primer Sequences.
Figure imgf000026_0001
Figure imgf000027_0001
Linkage SEQ
Marker Primer Allele
Group Locus ID Primer Sequence
position Name (Res/Sus)
(ch) NO
Bl
36781754 S08344-1 136828 24 AATACCCTTCCACGACACCA C/T
(Gml l)
Bl
36781754 S08344-1 136829 25 CGGAACTTGGCATCTTTGAT C/T
(Gml l)
Bl
36781754 S08344-1 136832 25 TCAAACTTGACAAAGCCACAA C/T
(Gml l)
Bl
36781754 S08344-1 136833 27 TGCAAAGAGGGTAAGGACTTG C/T
(Gml l)
Bl CCATTTTTGGAGAATCTCGTGTC
37020399 S08343-1 19661 28 C/A
(Gml l) CGTAG
Bl GACTTACCAAATGAGTTTGACCA
37020399 S08343-1 19389 29 C/A
(Gml l) GGTTTTACC
Bl
37020399 S08343-1 96347 30 GATGATYCCAAATCTGCTTCA C/A
(Gml l)
Bl CA....G/GA
37020092 S08346-1 136886 31 TTGTTCTCCCGYTTACACCA
(Gml l) ....T
Bl CA....G/GA
37020092 S08346-1 136887 32 TGATACAACGYCCCATTCTTC
(Gml l) ....T
P8584A-
Bl GGTCAAACTCATTTGGTAAGTCT CA....G/GA
37020092 S08346-1 1-F2, 33
(Gml l) RAGTTTGC ....T
82593
Reverse
Bl CCCATTCTTCATGTACTCATACA CA....G/GA
37020092 S08346-1 primer 34
(Gml l) CCAAGAG ....T
15081
Bl CA....G/GA
37020092 S08346-1 136884 35 TTCTCCCGYTTACACCACAA
(Gml l) ....T
Bl CA....G/GA
37020092 S08346-1 136885 36 CAACGYCCCATTCTTCATGT
(Gml l) ....T
Bl CA....G/GA
37020092 S08346-1 136888 37 GGTTGCAATCAAGAGGGGTA
(Gml l) ....T
Bl CA....G/GA
37020092 S08346-1 136889 38 TGATGATACAACGYCCCATTC
(Gml l) ....T
Bl
3731 1443 S06786-1 144687 39 GCTTTAGACGTGTCCTCCTCA A/C
(Gml l)
Bl
3731 1443 S06786-1 144688 40 CCACTTGGAAAGAGTGGGTTA A/C
(Gml l)
Bl S06786-1-
3731 1443 S06786-1 41 AGACGTGTCCTCCTCAACCA A/C
(Gml l) Q1F
Bl S06786-1-
3731 1443 S06786-1 42 AGGAGAACCCTTCACACTCG A/C
(Gml l) Q1R
Bl S06786-1-
3731 1443 S06786-1 43 CACACTCGCGAGCATAGAAC A/C
(Gml l) Q2R
Bl S06786-1-
3731 1443 S06786-1 44 TTCAATTTGTTGAAGCCTTTTCA A/C
(Gml l) Q3F
Figure imgf000029_0001
Figure imgf000030_0001
Table 3: Non-Limiting Examples of Primer Sequences.
Figure imgf000031_0001
Linkage SEQ Allele
Marker Primer Sequence
Group (ch) ID (Res/Sus)
A 210 agctagggaaggatttgggta
S04937-1- 21 1 TCAACCGTGGAAAGTAACCA
Bl (11) A/G Ql 212 TCAATTTAGTTCTTGAAAGTTGGAGAC
S04938-1- 213 ccacaacctattgttgaagcac
Bl (11) G/A A 214 tgtgcactcctgactgcttt
S04938-2- 215 tcaaaaccattgttcatctgg
Bl (11) T/G A 216 gaatagaagatgacaacrcattaaagat
S06786-2- 217 cggacaaggtcctgtaaggt
Bl (11) G/A Ql 218 ttttgtggattgaattcatggt
S06786-3- 219 tgcaaacactgtaaataacactaatagg
Bl (11) C/T Ql 220 aaatggttgaggaggacacg
S06786-1- 221 agacgtgtcctcctcaacca
Bl (11) A/C Ql 222 aggagaacccttcacactcg
S06787-2- 223 attgctggatgtgaggttcc
Bl (11) A/G Ql 224 tggccaacaaggatgaaaat
S06787-1- 225 tgctgttccataattagaattggag
Bl (11) G/T Ql 226 cctgcatcaagatgaacaagaa
S06803-1- 227 gcttcaacatcaccagcaga
Bl (11) A/G Ql 228 gaaggctgagaacggacaag
S06804-1- 229 aggtttctgtcctttgcttcag
Bl (11) C/A Ql 230 gccaataaagcttggtggaa
S06788-1- 231 aagaaaccccaccaataggg
Bl (11) G/A Ql 232 aacggtttcagggaacattg
S06805-1- 233 gatgaaatgtttctggcttgaaatta
Bl (11) T/C Ql 234 cctggaaacttgcatgagtg
S06789-1- 235 cgtcagctattccacccttc
Bl (11) A/G Ql 236 ggtgagatcaagagggcatt
S06790-1- 237 tcctgaaatcccaagcaatc
Bl (11) T/G Ql 238 cttcaatgggtcgcaaaaag
S06791-2- 239 atgcggaagatcaayagcag
Bl (11) A/T Ql 240 atgcagacccaattcatgct
S06791-1- 241 acaacgwaaggtatgaggtcaa
Bl (11) C/T Ql 242 atcggtgagcaagggaaac
S06792-1- 243 tcaaccaaaagtttcccttcc
Bl (11) C/G Ql 244 gcagccacctaacagaacaaa
S02112-1- 245 CATGTTGCTCGCGACCTTGAC
C2 (6) A/G A 246 GAAGGTGATTGAGGTGGTGAAGGA
S03252-1- 247 gcttggaatattaatctatggctgt
C2 (6) G/A A 248 cgcgttacaaattaaagcatgt
Table 4: Non-Limiting Examples of Probe Sequences.
Figure imgf000032_0001
Figure imgf000033_0001
Table 5: Non-Limiting Examples of Probe Sequences.
Figure imgf000033_0002
Figure imgf000034_0001
S06791-1- Bl (11) ctgctGttgatctt 292 ctgctAttgatcttc 337
Figure imgf000035_0001
Table 6: Non-Limiting Examples of Genomic Loci Comprising the Various Marker Loci Provided Herein.
Figure imgf000035_0002
SEQ ID
Marker
Locus NO Reference Sequence [Res/Sus]
Position
(Res/Sus)
GACAGCGCCATAAGGAGTGATACTGGGTCCATTTTTGGAGAATCTCGTGTCCG
TAGCTTTGCTTCGTTAGTGGACAGTGCCATAAGGAGTAGTAGTGCTACTGAAG
CAGATTTGGAATCATCCCTTGTCCAGGCAGAAGACAGGGCGATGAGGACTGTT
GCAGCACGATTAACAAAAGCCGTGTCAAATGCAAAAAGACATTTTGCTAAAG
GATTATTTACCCGGGCTGAGCTTATACCAGTCACCCAGGCTGAGCTTGAACCA
GCCACCAACAATTTCCMRSSAYYAWTAWTTWCYCWKKATSACCWYARMKCC
AGCCACCAATAATTTCTCATTTGACAACAAGATTGGTACTGGAGGCTTTGGTG
TTGTTGAGT:ACAGAGGCAAACTCATTGATGGTCGTGAGGTTGCAATCAAGAG
GGGTAAAACCTGGTCAAACTCATTTGGTAAGTCTRAGTTTGCCTTGTTCTCCCG
YTTACACCACAAGAATTTGGTTGGGCTGGTTGGATTTTGTGAA[C/G][A/A]AAA
A[G/T]ATGAAAGGCTCTTGGTGTATGAGTACATGAAGAATGGGRCGTTGTATC
ATCATTTGCATRRCAAGAAGGGTARCAGTGTGTTGAATTGGTAAAWANRYGR
ASRWRGSWATSWGTGK
3731 1443 S06786- 147/148 STATTGCACSCGCTTTTCGTCCCGGTCAAGAAAAGATGGTTTATGTGTATCAGC
1 TCTTGGCAACAGGCACATTGGAGGAAGATAAGTACATAAGAACCACTTGGAA
AGAGTGGGTTACTAGCATGATTTTTAGTGAGGCTTTTGAGGAGAACCCTTCAC
ACTCGCGAGCATAGAACATTGAAGATGAT[A/C]TACTGAGGGAAATGGTTGAG
GAGGACACGTCTAAAGCAATTCATATGATTCTAAAGAATGAAAAGGCTTCAA
YAAATTGAAGAGAGGTAATTACGCTTTTTTCATATGAAAACATGTGCTTAATT
TATGTTTATATATCTTAATCCTACATTCTCCCTATTAGTGTTATTTACAGTGTTT
GCACTAGATCACTAGAATGCTTGTTGGCATTCACCTTCAGTGTTGGAGACAGA
TTTGACACTTGTCGTCTCGAATGCCAGGGCAAGTTCGAGTTTAGTAGAAACTT
ATCATCCAAAATTAAAATTGAAAGCACTAATACAAAATGCACAATTTGAAGC
CATTCATGTCCTCTCTTGGTCTGAGTCTTGTCATTTTGTGGATTGAATTCATGG
TTTCTCTTATCCGGTGACATTGTTRMCAAGTAATACTACTATAAATTCAGATTT
GGATATCAGATAACCATGGTCATTAATAGTAATACTAACATACTATACATATA
ATACCTTACAGGACCTTGTCCGAAACTTGAAACAGGATCAGGGACAGCGAAA
AACAAACATGGTCAWAnCYKKTTYY
37333894 S06787- 149/150 TTACAAATAGGAGAAAACTTAGATATACATAGTTCTTTAAGTTTGATTACATT
1 ACAAATAGGAGAAAACTTAAACATACATAGTTCTTTAAGTGTTGTGTGTGCTG
TTCCATAATTAGAATTGGAGTTTTACTTACCTTAGTAATATGTATAATTCTAAT
TGGAGAACAGTACAAACAAAAACACCTAA[G/T]GAACAATACCTTAGTTTTAA
TCATATTTGTTTTGTTCATATAGCTTATCAATAAGTGAAGTATTTTCTTGTTCAT
CTTGATGCAGGTGGTGGAACTGAAACCTTCATTGATTGGCCAACAAGGATGAA
AATAGCACAGGACATGACTCGTGGCTTGTTTTGTCTTCATTCCCTGGAGAACA
TTATACATGGGAACCTCACATCCAGCAATGTGTTGCTTGATGAGAACACAAAT
GCTAAAATTGCAGATTTTGGTCTTTCTCGGTTGATGTCAACTGCTGCTAACTCC
AACGTGATAGCTACTGCTGGAGCATTGGGATACCGGGCACCAGAGCTCTCAA
AGCTCAAGAAAGCAAACACTAAAACTGATATATACAGTCTTGGTGTTATCTTG
TTAGAACTCCTAACTAGGAAGTCACCTGGGGTGTCTATCATGGTCATAGCTGT
T
37334507 S06803- 151/152 TTGCGTAATCTTTCTGTTCTGATTTTGAGTAGGAACCAATTTAGTGGACATATT
1 CCTTCAAGCATTGCAAACATTTCCATGCTTAGGCAGCTTGATTTGTCACTGAAT
AATCTCAGTGGAGAAATTCCAGTCTCCTTTGAAAGTCAACGTAGTCTTGATTT
CTTCAATGTTTCTTACAATAGCCTTTCAGGTTCTGTTCCACCTCTACTTGCCAA
GAAATTTAACTCAAGCTCATTTGTGGGAAATATTCAACTATGTGGGTATAGCC
CTTCAACCCCATGTCTTTCACAAGCTCCATCACAAGGAGTCATTGCCCCAACT
CCAGAAGTACTGTCAGAACAGCACCATCGTAGGAACCTCAGTACCAAAGACA
TAATTCTCATAGTAGCAGGAGTTCTCCTAGTAGTCCTGATTATACTTTGTTGCA
TCCTGCTTTTCTGCTTGATCAGAAAGAGATCAACATCGAAGGCTGAGAACGGA
CAAGCCACGGGGAGAGCAGCC[A/G]CTGGAAGGACAGAAAAAGGAGTCCCTC
CAGTTTCTGCTGGTGATGTTGAAGCAGGTGGGGAGGCTGGAGGGAAACTAGT
CCATTTTGATGGACCATTGGCTTTTACAGCCGATGATCTCTTGTGTGCAACTGC
TGAGATCATGGGAAAGAGCCATGGTCATAGCCTGT
37117244 S04197- 153/154 TTTCTTAAGTTATATGTTATTTCATTTAAGTCCTAACTGTCNNTTNACTCCTCTT
1 CTTGCTATTGTCATTAGTATTCACTTNNTTTNAATAACTGTGGAAGCAAAATG
TTGGATGATTTAAGAGTAAAATATTAATTTATTTATAGTAAATTTTTTAATTAA
TATTTTGTATTCATTGGTTGAATTTATAACAAGTAAAGTATGGATAAGATGTG
CAATAATGAATATATAAATGCCTAATGGGAGAGATGAAGATTAAAGTTATTAT
TATATACATAAATATAAAATTGGAAATGAATATTTGTTTTAAATGGAGTATGA
AGATCATACCCTATCCAGTATCTACTACCRGTATCTACTACCAT[C/A]CCTAAA
CTCGACAAGGCACCTACACTACAATATAAATATAGTAAGGCTTCGAGTAACA
GAACCTGCGACATATAATAAGCCATAAAAGGCTTCAACCCAAAGACCCTACG
TTACGAGAAAAGAAGAAAACATTTGTTGAAGTGAACCACAACAACGCAATGG SEQ ID
Marker
Locus NO Reference Sequence [Res/Sus]
Position
(Res/Sus)
CATGGTCAT (CONSENSUS)
42916770 S07162- 155/156 CGCAATTAACCCTCACTAAAGGGAACAAAAGCTTGCATGCCTGCAGCAATAT
1 AACCAGGATTCAGAATTAATCTAGTTAGTATATCATACAATGCAGGGCCAGTT
ACAATACATACATACGCATAACCAAAACAGTAACATCAATGGAACAGTAATA
ACCATTTGTACAAAAAAGGTATTAATACATAGCTACATGGAAGAAACCTACAT
TAAAATCCAGTAGTGAGAAAAGATGGGGGCAATTATGATAATCTCGGAAAGC
CTCTGCCAAGGGTCAGCATTCAAAATTGAGTTCCTTAGCCTGCTGTCTGCATAT
GCTTATCCACAAGGAATATTGTCTCCGTGAGGATTAACCAAAAGCATACCTCA
ATGGGTCCAGATATCCTGAAGATAGCGCCCAATTTGCTGAGCACCAAAATATA
GGGCATCGGCAACGAGAAAGACTCCAATCTACGCCACAAATGTCAAACTTGT
GAATGTCAAGGTTAAGAAATAAGATTTACAATTGAAGGTCTACAGCAGATAG
ATTACCAGGCGTGCAGAAAACACTAATCTATATCCCCAACCTTCCTTGGCTGC
AGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGCCCTATAGTGA
GTCGTATTACACCCTATAGTGAGTCGTATTACGCCCTATAGTGAGTCGTATTAC
34888681 S07161- 157/158 CTTG:AAGTTATAAGTTTTGAGAGAGATTTTATGCTTATCTTGTCTGAAAACCA
1 CTAATGCTCTCTTCAGTG[A T]GAATAAAAGGGCTACAAGATATCATACATAT
GCTTTAATATTATATCACTAAATACAATTAAGGATGCTCATCACATTAGGTTA
GGTTAGATACAGTTGAATTGCCTTAAAGTCAAAATTTCCACAAG: : :AC: : : AACA
GTAACAGTTACCAAAAACCATGCCCACAACAAGCAATATTGGCTGCGTGACTT
AAAAACTGTTTAAACATCTCAACTGATGTCTTACAAGGAAAGGTAACCTAATG
AAAAGACATCAATCTAGAAATCAAGGCACTTCAGTGAGAAGACAAATGAAGT
CCAACTGATTGCATTTTGTCTTGTCATATTAGGACTTAACATTAGAAGCAAGTT
GCATATAGAACAAATCTGAAGGATCATTTTATATATATTTAACAACTACTGGT
TGACCACCCAATACGATAAACAGGAACAACCACACAAAAGCTCTTGATCAAC
ATAAAGAAAACAAAATTAAACACAAAAAACTGCTACAGAATTTAAAAAACAC
TTTAGCAGACGTAACAGAAGTACAGAACAAATTCTGTCAGCAATTAAGCTAA
CTAGATACCAAACAGGATACTTCCATTGTAGTAGAAAAGGTGAAACACTATA
GAAAAATTCAACAGTCTAGGTGATTAAATCTAGACTCAAATCTCTCAATGTAT
AAATGGTCCTCTTAAAAACCAACCCTGCCAATGGTAGCAAATCCCCTGGACAT
AATGAAGCACACGAACCAACAAAGAATCCAATAGAATAAAACCAAAAACCA
AAAAACTTAAAGTCCAAACAACAAATACACAGGCAATCAAATCAACCAAACA
AAATGATGTACACACATACACAAAATGATGTACACATACATATAATTAGGCTT
AAATATGTTTTTGATTCCTTAAATTTGGAGTTTGAACAATTTTG
Table 7: Non-Limiting Examples of Genomic Regions Comprising the Various Marker
Loci Provided Herein.
Figure imgf000037_0001
Figure imgf000038_0001
Locus SEQ ID
Sequence
Name NO
TATACATATTTCTAACACAAATGATTGATGCAATCATATAAGGTTTCGTTGTGT
TTATATAAGTGAAAACGATCTAGTTAATATGAGAATCASTGTTTGATTCCCACT
ATTGCAAAATTTTATCAAACAAACAAAATTAGGGAACACTCGTGATTTGCGAC
CTAAGACAAAAGAGACATCAAAGTTCAAAAAACACTACTTACATATCAAGTT
AAGTTATGGATTACAAGATCTTCGTATTTACAATGAAAATTCATATTGCATAT
GAAAAGTAGATTATGCATTTCAGTTAT
S12853 349 ATGACATATCTCTTTTTGTTTTTTCAAATGTTAAATTAATATTGAGGTGCTTAT
ATTTGGCAATTTTGAATTAAGTCTGAATATTTTAAAAATTTGTGATTGAGACA
ATCAACTATTTTAATTTCCAATAGTATGCTACCCGTGTRTATACACAGGTTATC TAAGAATTGAGATCTGCTAGAAATGCAAAGCAATTAGGGATCGTGTACAAGA
ATATTTTTAAAAGAAATCAACACAAGTATTTAAGCAAGTTTTGATTTGAAAAT TCTGCATAATCCCCCAAAAGGAAAAG
S03246 350 aACTTTTTATGATTGACTTGGTTCTCAAATTCCGACGGTATTGAGTTAAGGAAT
TTTAATGGTGCCTATGCTATCRGTTTTGGAATAACGATTATGAGGTTTGGATGA ATATTTGGAGTTGCATAAATACGTTGCTACAAAGGTTTATTTTTCTCTTCTGGT AGTAATATGGAATAACAGGTTACAACCTATTGATTTAATATTAATATAATAGG
TAGACGTTAAGACTGAAATCTACAGTTTTGGGCTTATATTGGGTTTGCTTTTAT TACTATTGGGCTGCATACATACAATATAGTTATTTTAATTAATTTTCTTTATGC TCTAACACTTTGGTTGGCAGGGTACAATTTGCAGCTCATGGT
S12962 351 TGCAATGGTCAGACTACTCAACACAACTCTTGTTGACTTATTGTTCTTTAAATT
TCTAATTTCTTTCTTCCAAAAATGATTTTGAGAGGATGAATAGAATAAAATTCT
TAGAAGCTTCCTTCCTGCAAGCTGAGGAAGATTACTTACTAGGAGTGATAACT
TGGTGCACCACTGCAATTAGTTTGATCCATGTGGAGACCRTTCAAAAAAATTT
ACATTGATTTCTCTAGATGCATCATGGATCGCAATTCAAAACTAAACTTTACC
AAGAACCAAAGACTCTTGGCAGCTTAA
S00144 352
TTTCCAACATGAAACGCTTGTTCCACATATTCAACAAACCATTTTATTTTCTTT
TTTCAAGAAGAAAGAAACTTCCAAACATGCATCAATTTTATTGTACTAATCTC
TCCCTTGCCTTGAGCTTACAGGAACATTGTTACAATTGGTGTTCTGCTTGCTCA
TGATAAAACCCAAATCAACACCACATAATTTAGGAAGTGAATTGGCCTTGTTT
TCGAGCAAGGAAGGAAGGCGAGTTGCTACGTCGAAAAAGCACTTACATGCAG
CCATTCGTTGAATTTGTGTTGGTGCTGATGCTTTCACTGCATTAACACTTTGGC
AACAAACACCTGAAGGGGCACCATCATCTCCACCAATCATGTAATCTACGCAC
GAAACTAACAGGTTATASACTTGTGAACAATTGTAGTCATTTGATGCTGAATT
TGTTTTAACTGGTAGTCGTGCCTCTGAAGCTTTCGCTGTAAGAACAAATACAA
CTAGCACAGCTAAAAATGTGACAAACACTTTCTTCATTTTGTGAAATTGAAGC
GGTCGACCAGGGTATTCCGGACCGGTACCTGCAGGCGTACCAGCTTTCCCT
S08166 353 ATGAGTTCCGTATGAAAAATATACTGTTCTGGATGAATTGTGGCACGAACCAT
ACATCCATGTATATATATCCTAATACTGTCCTACCGTCCACTTACAATGATTGT
GCAAAGTTCTTCAATGAGAAAATAAGTCCTAAAAACGGTAGAGCTTAATGAC
AACAAAGAAAATAACCAATGCGTTACCATATTGGCAACTATAACTAAATGTG
AGTGCATGTCATTCCAAATTACGCATTTCTGCGTTATTCACGAGATTATTCATA
CTCTGGGAGTCACAGCACCTCCCATTGAATTCCACACGACATTTGACAATGGA
TGCCACCCGGAAGAGGGCTGCATAAAGTCTCCTGAGATTACAAACGAGAGAT
CTGGAGGGGTATCACTGAAACATCTCCCACYGGCGGGAACAAATCTAGCTCC
CCATAACGCTCCAGGACACGCATCCTGCAGTCCTCAGCAGCCATCATTCCAGT
AGAGTATGCACCATGCACAGACCCCGTATACAACATACTTGTTGCTTCCCCTG
CAAAGAATAAATTGTCTACAGGAACCCGTAGCTTCTCATACAGATCATGTGGT
TTCCCAACTGCATCATAGCTATAGGAACCTAGTGTATTAATATCTGTACCCCAT
CGAGACACAAGATACTGAATCTGCATGATTGAAACAAATTGCATCTTCAAAAC
ACCAACAACATACTAGTCACTGAAAAACAACTTATTAAATTCAATCATATAGC
GATTGAACTAAAATGAATAAAACTTAGGACTTTAGGAGTCTGCCACTTATAAA
AATATGG
S01081 354 ACGTACTTtcnTTTTCTTTTTATTATTAATTCTAACAGCTTTAGCCTTCAACCATT
TTTTATGGTTTGTTCAACCATGMCTTTCCGTTCCTTGAGACTGGTTTAAACTTG
TGGTCAAAAGCCTTTTTTGCTGCTGCTGCTTCTTGGACACAACATGGGTGTGAT
ACAAAATGATATTAGGCTTCATATCGAAGTACCTTATAAAATGATCTGCTGTT
GCATCTTGTACCTGTTGATCTTGAAKAAGATCTTTAATTGCTTCAGGCATRGGT
TSGTCATTCATCATTTTCTTCCAATAATCCCCCAGGTCTTTTCTTGCATGGCTTA
AGTTGATGTTGGCAACCTATTTATTAGTAGAGATAACATAGAAAASTCATAAA
CCATAATTAGCACAAACTCAATGGTTCAAATTTTAAAACAAATRAGTTRCTAC Locus SEQ ID
Sequence
Name NO
TGAAAAGCTTACCAGGAGAAGMGAMAAGACTAMGAASAAGGCAAAGRTCAK GGTCATAGCYKKT
S02183 355 gaccnntgctTACATCCAGTCCCCAMRWMMCSYnntYRGGAGWTnCAntWKSKRKCn
AATCnmmaCAnWTTnTGAAAimcmTnimTnnnTnnmuimuimuiACCATGGGAGGACC
TTGATGATGTCGGATCACCATACCCCCACTTTGCTTTTCAAACRAAGTATTATG
AGGAACATCTTTCTCAYCTAAAAACATAATTCTATGTTCAAAAACAAATATAC
AAGGCATAAAAGTACRTGTATCCAAAAKTAGCATGAATAAAAACTCGATACC
TTGGGGTTGATTAGAAGGAATCAAAGTAGTCGACTTCTCCACGTGCTTGTCAT
TAACATCAACATTAGTGATCGACTTCTCATCGTTATKTGGTTGGATCACATCA
ACATTCCTACCCTTAGTAGCAGGCTCGYAGTAGTTTTGGACTRRGCTTGTTYA
GTTTTGTCACTTTGTTGGCCAACCTCTRTAGCAACTCTTTTCCTTTTCTTTGGCT
TCACTAGGTCGGCAAAGTGTTGGTGGTATGCTAnGATTATGAGATTTCGACAT
GGAAGCCCAAACCTTCCTGAAAT
356 TGggttgtttggtgagaacgaTAAGTTTGCCACAGGAACAGAGGTAAGAATAATAAAATA
ATAAATCATCCATTGCTTTTGAAAGATTTTGCAAGACTGTCTCACTGTAAAGT
ACTTCCAGTCCAAATATTGGATTCTTCTTTATAAGCCTGGTTACATCACTTGTA
CTCAAGTCTTCAGATTTGGGCCATTATTCATGGATCAAACTGTGAAAAAAAAG
TTAAACAAAATTTATTTACAATTGAAAATCAGTTATCTTCCTTTTAATTTGCCC
AATGTGAGAGAAATGCATTAGAGTCTTTSACAATCTACAATGGGAAGTTTCAT
GCTGGGACTAACATAGGACGACAATTTTTATCTATTTTCTTTTACTTATTTCAT
GCTTCTGTTGTAGGTTAGAAAAYGATACTGCCATAGTGGTATTAGTATAATAT
AATATACTACATCTGYTTTAGAAAAAGATATGCATTTATCTGAAACTATATCA
TGCATATGTTAAACTCTGAGAAGCTCTTTGATAGATGTGCAACTGTAAAACTT
CAGAGCATTACATGCACTAATGAAAAGCTCTTTGATGCTTTAAAATCTGATAC
TTGAAACTTCTATAAAATTTGATGTACTTGATCACTAGTAACTGAAGACTCTA
GGAGTGACAACCATCATTGGAGGAGGTGACTCCGTTGCCGCTGTGGAGAAGG
TTGGACTTGCAGACAAGATGAGCCACATCTCCACTGGTGGTGGTGCCAGCTTA
GAGCTTCTTGAGGGAAAGCAACTCCCTGGTGTCCTTGCTCTTGATGATGCTTG
AGCAAAAATCATTCGTTCCTTTGAAGTTTGTGCTTTATATTATTATTATGGTTG
GGTTTCAGCCAACAGTGGATTAAGGTACAATGAGAGCTGCGAagttctTgcTCCctga
S00350 aaGGCTTAA
357 ATGGanTTCTAAAAGAATGCCTTGTATGTGACGCGTACCATTCTAATCCTAaCT ATATTTCTTTATATTCCTTATTTCACAAAAAGACACATTACAATGTGTGCCCTG TGAGGGAAATATTGTAAATGTTAACARCGCAAGAGTAGTTTACACAACCTCAA
AAAATTTTATTCTCATATACTTATCAAAGCCACAAGATGTGACCTAAATATAT AAGCCAAACATTACAGAAATTATTTTTTGCCATATGGTTGCAGCACCAAATTA ACATCATCCCTAAACACAAGAAAATTTGAACACTAAATCCATCTAGAAAGCCT TCKTAAACATAGTTTTTCTAGGCTTAGAAACCACAATCCTAGAATCAAATAAA
GCTAGGACATTAAAACATATTCTTTCTCTAATGAAACCTCCTCTAAAAAACTA
S02074 GYCGGAGAATCCCACCAACAGAACCATGTGTCATGGT
358 agcttatYCCCCaaGAcgCTGTCAGCCATGTCGATTTCATTGTCAAACWAGGATCTC
CTCCCTATGAAGTTCCACTCCCAACCTACATCTGTGTGACTCCCTATGTGCTGA
ATTAGCTGTTTTTGCTGGCAGGAAATGTGATATAGCTTAGGATATTTTGTTATT
AGTGGAGCATCATTAGCAATTCCATTTTGAAAGACATTGCCCTGTTGCGATTG
GTGGAACACCGCCTTTAGGTCCTGCCACCATAAAGATTCATTGTTGCCTCTTGT
TACGTCATCCATGCACCTCCAGCCACCATATTTTGAATCCAATATTCTGGCCCA
TAGTTCCCCTKGGTGCTGAAATARAWCCSATCTCCATCTTCCAAGCAGTGCTA
S03991 GAKTGRAGGTGTTGATGTCcttcatgctctaacacatacctgtttccatcc
359 ATTCAGTGATTTTACCTGTTTGCTTGCGAGATTCAGGAGGAGGGGCCCCATAT
TGACGAGGCAAGAAAACCCCYGTTCCAGCGCAACCCCTTTTAGTAACACCGG
ATCCACCTTGCAACCCGGGTCGCGACCCGGATCCGAAATAAGGCACCTGTTGG
GTATTCTGGTYCTTCACTTGAAGAGGGTGCCATGCARAGTGAGGCAAAACGTG
S04785 CGTGCAWTTCACAGCTTCATAGTCATACC
360 GTATTATGCAGCTATGGTCAAGACATACTCATACTAGCAAAACAGCATTAATT
TGATGATTTGACTCATGGCTCATTTCCCTTGTTTAAATATAGCCATGTGGAAGT
TCACTTTGTTATGGATTCCAYTTTCCTATTCATGTGAGGGATTTGGTAATTKGT
GAGGCACGACCAAGGAGAAGGGAAAATAAAAAAGGTGCAAGACCATGCTAA
AAAGGCTAGAAGAAACTATAAATCCTGATATTGTTGTTGAGAAAGAAGTGGT
TTGATTTGTGATAAATAAATGATAATATCTCACACAACCGGCCWGCTTCATCT
TACCCACACAGTTATTTCATAAACTTTAGAAGAWAACGTAAACTTATAGTAGT
TGATTAGAAAATTAACAGTTGAAATTGTGATTAAATACATTCACATATGTTCG
AAAATATAGAATTGTTATCCACTAACGTGTATCAAGCTCTTTTTGCGGGATCTT
S02874 GCATGGTCATAGCYKKTT
S04348 361 KHVKWYWHAAYYWRATGARMAGKGMATRKGRTAACWKRSMKWSCAgAgniui Locus SEQ ID
Sequence
Name NO
nnGAGACTAGAACCATTAACATTAGCCAGAGCCACAAAAGGTCTAATAAAAAC
ATATCATGAAAATAATTTTCTAAAAAGAGCAGCAAAAGACCTGTGCCATCAC
AGTTGTAGGAATCTGAATAAAATTAACACCACGTAGGAAGGCAGAGGCAGCA
AAGCCACACATGTCGCCAATCACACCACCACCAAGAGCAACAAAYGTACACC
GCCGGTCGAGCCGCGACTCGATGGCCTTGTCAAAGACTTTCATAAGAGTATCC
TATCAGTTGAACACACAAAGACTTTCTTATGCAATTCTCAAGAGTGCCAACAA
ACACCACAGCCAATTCAAAACACATGAGACCTACCATGTCCTTGTACTGCTCA
CCATCAGGTAAAATTACACTCTCCACAGAAACATTCGGGTTTCCCCTTGTCAA
AGCATCAACAACCTTGTCTAGATAAAGTGGCGCAACGGTTTCGTTAGTTACAA
CTAGGACTCTCTTTCCATGCACATGCCTATTCCAATAGTGAGAACAGAGCACT
TCAGAATAAATATTAAACAAGAAATAAAATCCATGCCTTGTTAGAAACTTTAA
TTGAATTGAACTTCTCCCACATACYATTAAATTTTATAGAAGCTCTTTCATTTA
AAGTCTCCAAAAGTTGAGGCACATATGTTGATTTTAGCTTAGAGGAGACTTCA
ATTCATTCTATCTTCT
362 AATACTAAGCTGAAGGAATCGATTGCAAAATAATAACCCTTAGAAAACACTA
CGGCTTTGTAAATCATAAACCCTAAGCTCTCTCGCCCCTAATCCTACGAGCTA
GCTGAATGTCCTTGGGCATAATGGTAACCCTCTTAGCATGAATAGCGCAGAGG
TTGGTATCCTCAAAGAGCCCAACGAGGTAGGCCTCAGCGGCTTCCTGAAGAGC
GGAGACAGCRCTGCTCTGGAAGCGTAGATCGGTCTTGAAGTCYTGAGCGATTT
CCCTTACGAGCCTCTGGAAAGGAAGCTTCCTTATGAGAAGCTCCGTGCTCTTC
TGGTACTTCCGAATCTCCCTCAGAGCCACTGTCCCCGGCCTGAAACGGTGGGG
CTTCTTCACGCCGCCCGTCGCCGGAGCGGACTTRCSTGCTGCCTTGGTGGCGA
S01209 GCTGCTTCCTTGGAGCTTTTCCTCCATGGTCATAGCTGTTT
363 CaMCGGCGATTAAGCAGCCATATTTncTGGTCAACACCAAGMnWGTCTTAAGT TCCCTTCAGCTACTCTTTGGTCTAATTTTGATAGGAACCTGTCTCAGACCAAGC CTAAGGTTTAATTCCATAGGCCCAAAAGGGCAAATGCGTCCTAGGTGAAAAG AAGTTAGTTAGAGATGAGACAGTGTGAGTGAGGGGTCTGTTATATGGGAGGG GGTGAGGCTTGTAMGGGGTATGGATGAATTTGGAATGTGAATTGGAGTCTAG AGATTCTTCTCCGACTTTGGGGAGCACTTGCTCTCACTTCTTTCTGTGTGTTTTC
TTGGTGCTTTCATTGAGAGATTTGTTCCAATCASCATATGCAAACGAGGATGA CGTCCTGCCTYGATGCTGTTGAATAAAAAAWMTCTACCATCGACTTCMTCCTT MAAWCWCATCWYCAAYMAMTTMAKYWACATTCCDYYCMCATGGTCAWAG
S01999 SHDKT
364 CCATAGATCTGAAACAGAGATCACAAGGTTAACGCTTTTATTCtccaTTGGATGT
TACCCCAAACACCCCGYACCTATAATCTAGCACCAATCCAACCCGTTTTCACT
CGGATCTAGGACCTCAGGTAATCCCCCATGAATTTTCAATTATTATCAATGCTT
TTTCAACTTTAGTTTATTAATTCAGCYAGGGTTTAGTGTCTAAGTGAATAAGGT
TGGGATTTGYGATGGCTCCGACRATGRTCCGGAAGGTGATTGAGGTGGTGAA
GGACCAGACCARCATAGGAATAGTCAAGGTCGCGAGCAACATGGCGTCGGAG
ATGGAGGTCACGATTGTGAAGGCGATGAGCCACGAAGATGACCCTGYCAGTG
ACAAGTACATAAGARAGATCTTGAACCTCATGTCTCACTCRYRCGRCTACATC
CACACATGTGTCACCGCCATGTCCAAGCGATTGGGTAAGATGCRCGAATGGAT
S02112 TGTGTCGCTCAAGGCRCTGATGCTCGTGAACAGGCTCATG
365 GtAGCATAACTGAaAATATAAATTCCCAATGCTCCTATTCTTCAAGAAGCAATT
CAAACTATAAGACAAGTTATATGACCTTCAAAAGTGTGCCCATAGAAAGTGTG
TTTTTAAGGTTTTTCGTTGTCCTGGTAATAATTTAACTAACTAGATGGCTTGTA
GTACTGTCAGAACATGTTCTCACTTGTTAAATTTCTATTTTGTGGTACGGTCCC
AGCTCAAAGATGTTTGCTTTATACAAATTACGCGTTACAAATTAAAGCATGTT
AAACAAGGTTTATGAGAGAGGAAGTTTTGACGTRATTCAAAGCCAAACCAAT
AAGTGGTTAGACATGTATTTATAATAGAACATAGATTTACCATAACAGCCATA
GATTAATATTCCAAGCTAATTAAGTGGTTGACAACCCCGACAATACCAATATA
TACTGAAATTCCTGATTACACGCCCTCTCTCCAACGTGTTGCTGAATTKTCAAG
S03252 AGGCTTTCCTATGTGGCTGGATATATTGCATCACACAACATCTGGGCACCAT
366 gaatgcttgtttcacgtaagcttcttgactttaTCRlTCTCTCCCCCGCCCCCCAAATACCACWAAA
ATTCCGAACGCTGTCATATTGCAATCTAATTGTTTAATACCCAAATCCTTCCCT
AGCTCTTTTCCAGTATCTTGAGCTTGTAATCTTCCATCTTAAAAGCATACTGAC
TGATGCAATCTTCTGATTAATTTAGACCTGCATCAGTTACTTGCTTGCAAGTTG
TAGAATCTCTTATTTTYCTTTTCACTTCACTGGTTTGCATGTCCATACAATTCG
AACTATTTTTTATCTTTCAAAGATTGGAATGACATTAACTTGGTTTTTGATCCT
AATAGATAAGTCATATCAATTTAGTTCTTGAAAGTTGGAGACTRAATGTCCTC
TAAATAAATTGACATCAATGTAGATCCTCAATAATAGAAAGATGACATCAATT
TASTCCCTAAATCTTGCRGTTTGTGCATAGAAGGATGGTTTTTTGGTTACTTTC
CACGGTTGAGGTWCTAAAYTGATGCAATATCTCTTAKGGAGTTARRRVMMAA
S04937 AGTGATGTCTACCGAACCTTCCAAGGAACTGGCCGWMgTTT
367 aMMAKYTATGACCATKCGAACCTTCCAASSMCCAAAAKGRAWTTTCACTCYW
S04938 AAATWTATGTSCACTCCTGACTGCTTTTACATTTAGTGTYTTCATTTCATTGGG Locus SEQ ID
Sequence
Name NO
TTTCRTCTATCAGAATTCAGTGATAAGAAACAGTGCTTCAACAATAGGTTGTG GAACATGTTTTTYTGAGAGGTAAGGTAGTCACAATGAAAAAAAGGACAAAAC TTAGATCCAAAGCTATGTTGCATTGATTAACAAAGTAATCACATAATTTTGGT GTCATTTTCTAATAAGAATTGGAGTTTCATCTTGAAAGTTTATGTTGACCTGTA
GAATAACATCAAAAGCATTTATGGATCTGCATGAGTTTTKTCCTAAAAAGGTG TGAAATAGGGGGAAAAAAGCCACACTGGATGTCAAAACCATTGTTCATCTGG TATATATTTTCATCTCCWTATGATARTTTTTTTTTCTTTTCTGATTTCTTGTGAA ATATATTAATTAACTKCCTTCTTTTACAKGTAAATGAGAATGTTGTTAATTAAT ATGTTAACCTAAACSATATCTTTAATGYGTTKYCATYTTCTWTTCGTTTTGCAG TGATGGTATCC
368 STATTGCACSCGCTTTTCGTCCCGGTCAAGAAAAGATGGTTTATGTGTATCAGC
TCTTGGCAACAGGCACATTGGAGGAAGATAAGTACATAAGAACCACTTGGAA
AGAGTGGGTTACTAGCATGATTTTTAGTGAGGCTTTTGAGGAGAACCCTTCAC
ACTCGCGAGCATAGAACATTGAAGATGATMTACTGAGGGAAATGGTTGAGGA
GGACACGTCTAAAGCAATTCATATGATTCTAAAGAATGAAAAGGCTTCAAYA
AATTGAAGAGAGGTAATTACGCTTTTTTCATATGAAAACATGTGCTTAATTTA
TGTTTATATATCTTAATCCTACATTCTCCCTATTAGTGTTATTTACAGTGTTTGC
ACTAGATCACTAGAATGCTTGTTGGCATTCACCTTCAGTGTTGGAGACAGATT
TGACACTTGTCGTCTCGAATGCCAGGGCAAGTTCGAGTTTAGTAGAAACTTAT
CATCCAAAATTAAAATTGAAAGCACTAATACAAAATGCACAATTTGAAGCCA
TTCATGTCCTCTCTTGGTCTGAGTCTTGTCATTTTGTGGATTGAATTCATGGTTT
CTCTTATCCGGTGACATTGTTRMCAAGTAATACTACTATAAATTCAGATTTGG
ATATCAGATAACCATGGTCATTAATAGTAATACTAACATACTATACATATAAT
ACCTTACAGGACCTTGTCCGAAACTTGAAACAGGATCAGGGACAGCGAAAAA
S06786 CAAACATGGTCAWAnCYKKTTYY
369 TTACAAATAGGRRAAAACTTAGATATACATAGTTCTTTAAGTTTGATTACATT
ACAAATAGGAGAAAACTTAAAYATRCATAGTTCTTTAAGTGTTGTGTGTGCTG
TTCCATAATTAGAATTGGAGTTTTACTTACCTTAGTAATATGTATAATTCTAAT
TGGAGAACAGTACAAACAAAAACACCTAAKGAACAATACCTTAGTTTTAATC
ATATTTGTTTTGTTCATATAGCTTATCAATAAGTGAAGTATTTTCTTGTTCATCT
TGATGCAGGTGGTGGAACTGAAACCTTCATTGATTGGCCAACAAGGATGAAA
ATAGCACAGGACATGRCTCGTGGCTTGTTTTGTCTTCATTCCCTGGAGAACATT
ATACATGGGAACCTCACATCCAGCAATGTGTTGCTTGATGAGAACACAAATGC
TAAAATTGCAGATTTTGGTCTTTCTCGGTTGATGTCAACTGCTGCTAACTCCAA
CGTGATAGCTACTGCTGGAGCATTGGGATACCGGGCACCAGAGCTCTCAAAG
CTCAAGAAAGCAAACACTAAAACTGATATATACAGTCTTGGTGTTATCTTGTT
S06787 AGAACTCCTAACTAGGAAGTCACCTGGGGTGTCTATCATGGYCAWAGCTKKT
370 ttgcgtaatctttctgttctgattttgagtaggaaccaatttagtggacatattccttcaagcattgcaaacatttccatgcttaggcagct tgatttgtcactgaataatctcagtggagaaattccagtctcctttgaaagtcaacgtagtcttgatttcttcaatgtttcttacaatagcct ttcaggttctgttccacctctacttgccaagaaatttaactcaagctcatttgtgggaaatattcaactatgtgggtatagcccttcaacc ccatgtctttcacaagctccatcacaaggagtcattgccccaactccagaagtactgtcagaacagcaccatcgtaggaacctcag taccaaagacataattctcatagtagcaggagttctcctagtagtcctgattatactttgttgcatcctgcttttctgcttgatcagaaag agatcaacatcgaaggctgagaacggacaagccacggggagagcagccRctggaaggacagaaaaaggagtccctccagtt tctgctggtgatgttgaagcaggtggggaggctggagggaaactagtccattttgatggaccattggcttttacagccgatgatctc
S06803 ttgtgtgcaactgctgagatcatgggaaagagccatggtcatagcctgt
371 tttgtttctcttatgtatgtggagtcttgttgtgctcccttcatgcgtgagaccagctttgtgtgaagatgaaagttgggacggagtggtt gtgacagcatcaaacctcttagcacttcaagctttcaagcaagagttggtggacccagaagggttcttgcggagctggaacgaca gtggctatggtgcttgttcaggaggttgggttggaatcaagtgtgctcagggacaggttatcgtgatccagcttccttggaagggttt gaagggtcgaatcactgacaaaattggccaacttcaaggccttaggaagcttagtcttcatgataaccaaattggtggttcaatccct tcaactttgggacttcttcccaaccttagaggggttcagttattcaacaataggttaactggttccatcccttcttctttaggtttctgtcct ttgcttcagtctcttgacctcagcaacaacttgctcacMggagcaatcccttatagccttgccaattccaccaagctttattggcttaa cttgagtttcaactccttctctggtactttaccaactagcctaactcactcattttctctcactttcctttctcttcaaaataataatctttctg
S06804 gcaaccttcctaactcttggggtgggagtcccaagagtggcttctttaggcatggtcatagctgtt
372 gTATTTGATTAGTTAAACCGCAACGCGGAATCTCTTTTCTCGAACTGGCTAACT
CTCAGGCAAGTGGTTCGGACGCTGATTCCAGCAACAAGCGGCTGGTGCTCGCA
CTGTATGACGCCCTAAACTCCGGCGACTCCGACGCCGTCGTCAAGATCGTCGC
CGCCGACCTCGAGTGGTGGTTCCATGGTCCGCCCTCACACCAGTTTTTGATGC
GCATGCTCACCGGCGACTCCGCTGCCGACAACTCCTTCCGCTTCCTTCCGCAGT
CCATCGCCGCCTTCGGCTCCACCGTCATCGTCGAGGGCTGCGACACCGCCCGC
AACATTGCCTGGGTCCACGCCTGCACCGTCACGGATGGGATAATTACTCAGAT
CAGAGAGTACTTCAACACCGCCCTCACCGTCACCCGCATCCACGATTCCGGCG
AGATTGTTCCGGCTAGCTCCGGCGCCGGCCGTTTGCCCCTGTGTCTGGGAAAG
CAGCGTCTCCGGTCGGGTCGGGAAATCCGTACCCGGTTTGGTTCTTGCAATAT
AAAATAATTATTAACAAGTAATTAGGGAAGAACGCGGTCACGTGTGAATAAT
AATTAAATAAGGAGGTTGTGCACGTGGCGGTGACTGGGTCGAACGGTTTCAG
S06788 GGAACATTGATATATTTTCGTAGTATTGGTGTGTTCTRGAGGTTAGAGAGATG Locus SEQ ID
Sequence
Name NO
TGAGACCCTATTGGTGGGGTTTCTTATTTCTTTAATTTTCTCAGGTTTGGTTTGT TTTTGTTTTGTTTGCTTGTGTGTTTTGGGCATGGTCATAGCCKK
373 TATTTTAATTAAGAAAATAAAGGAGTTTGTTTATGCTGCAATTTATGATCTAG
ATCCAATATAGGGAAGATGAATGCTAGTAAGGCACTATTTATTGGGTAAAATC
CATGTGGGTCCCAATCCATATTTACTAGTTCTCACTCCGTACTTAGTGTAACTT
ACATGTGTCATCCGATTATGGAGTGTTGTGCTAGCATTTCTCTTATATAGGGAA
TTAGGGATACAAAATGGCTTTCCCTACTTTTCGTGGGCAACCCCAATTTGATA
ACTTGGCCACTTTATGGCTAGACTTCAGCCTAATTTATGTACTAGATATAGTAT
ATGAATTTATACATAACTTCACATGCCCTGAAATTTTCCACTTGATTTGCAGGC
AATTGTGACAGAAGAGGATGGAATGGAGTCAATAGCTCATAGATTTCTTTCTG
TGGCTTGAAATTATTACTATATTTATTATTGTATTTTAACACTTGYCTTTACAA CATGTAGTATAATACTATAATTACACTCATGCAAGTTTCCAGGTCCATCTTTAC AAAATTGTAAATACTAACACTGCAGRAATTTGGAAAGTTATAGTAGTAGTCGT
S06805 CTACCATCTACGGccAAAMCMWKGKYMWWRSYBKKt
374 ggSttYcccaaaTAggtcagcctctccataaaccctcaagagcgtattatagctaatgacgttgggttgaatccccattttcctcat gctccagaagaggcggtcggcttccttgggcatgtgaagctggccataaacatcaatcatgatgttacaagtggtgagatcaaga gggcatttagcttcattcatttcggaRaatagagaaagtgcttcaacaaacttttggttgtcaacgtagatggcaagaagggtggaa tagctgacggtgtcgggttgaacggcattgtctctcatctcttgaagaagaaggcgagcctcacggaagagcttggcttttccaaa gacattgatcatggagttataagcaataaggtcgggggtaatagtggaggctttcAatctggagaaGatagaaatggccttggaa taatcGgacaacttgcgggcaaggtcaatcaagttactgtagagaacgaggtcgccggagacGttgtcttgctccatctgctgga gccaaaagagggaagaatcAaacaagccgtgtttgccgaaacaagtaattagggtggagtaagtgtacctatcgggggagag gcccttttggcGcattTcATcGaacaggccgtgtgcgaggtgccactgcttggcccGaaggacgttgcggagaaGgAC
GTgGTgGGCGaMGWKGSRGRRAMRRWMGWKgBMCKYSWMSWKKRWSSVWB
S06789 GDYMKAGSBBBttBYMnWtgatccMtggtcatagcYKKtt
375 gWcWMKWWTTKGCAMASRMKCVARGCTCGACMCTGKTCTATAATCTTACCC
CTGATAGAACCTTCAAGTTCAGGCCTTGGAGCTCCGGTGAAAGTGAACAAGTA
TGGCCGCTTTTGATGTCTGATTTTTCTCTGCCACCGGTAAACATGAGTGTCCTC
TGATGGGTGGAAAGAAGTTGGGTACGGAATTGCGTAGTCATTATTCCACGAAC
TTGCTTCAACTGCTAACATGGACATGTTCATGGATTCGGGTATAAACCTGAAC
TTACTACCCCAATAGGACGCATCATCATATTGTCTCCTGAAATCCCAAGCAAT
CCTCCCAGAAACAAGGAAATGATCTCTGCCCCACATTTKCTTCCACTCGGGTC
TTTTTGCGACCCATTGAAGAAGATCACGACCAGAGGAATCTCTCTCTGTGAGA
TTAGAGAGCCAAAGGAAACGGCTAACATCAAGACCAGCATAGAATGGGACGA
AAATTGCAGAGGCGAGGGAGGAATCGTTGGTCAAGCAGCCATATTTGGTCAT
CCTGTTGTGAAAAATAACTTCCAACAAGAACTGGTTGGTGGCATAGCAAGTGT
TGTTGGAGAAAAGCCCTTGGGAGTAGGTAATGTGAGGACCTAAACCATTGTTT
TGCATGTATGGACACATGTTGGGTTTGTCAGTGCCTCTAGTGAGGGACTGGCA
S06790 ATTCTGAAGCAAGTAATCgTTnAAGCGGGAGCATGGTCATAGCBKKTTT
376 tACBTAATTTTAAGTAGGTTGAAATGTYTCTTACCCTTTGTATGAGATCTCTGTT
TGATTCACCTAGAAAGTGTTCCTTCACAAGTGACATATATAATTGAATCGGTG
AGCAAGGGAAACATGCGGAAGATCAAYAGCAGTTAAACATTGAYMAAAGAA
AGAAAGSATAATTGACCTCATACCTTWCGTTGTAGATCAGAAAGCTGATCCAG
CATGAATTGGGTCTGCATATATAGAATGCTATGAGAAAAGTTGATATAGACCA
TTGACCATTGAGATTATATATGAAGTTATGAGAAAGATCAACTAATTTCTTCT
ATTCTTTATTGCACAGCTAAAAAAAAAATGATTATATATGTCAAAATGGAAAT
TGGCAACGTTGGAAACTTTAGTACCCTTATTGATCTGATTTGTTTCAAAGACG
AATCTAGCTGCCTTTCAAGTGACTCAAGCTCTTTGCTGCTTAGAGGACCAAGA
TCTTCTCCCATAAGGTTCCTAATGAGTATCGACCAGTCAAATATATATTAATA
ACTCATCAGTTCGTATTATGTAGCTAGCATATACTTCTAGACATAGTCGAGTCT
AGCTCTTTACCTTTGAGAACGCTGAAGAGCTTCATAACGCGCTTTCAGCCTCA
S06791 AGTATTCTTCATGGTCATAGCYKKTT
377 KWRTWAACTTCnaTTCCWTATCRTCTCTATGATCARYATSRGCATAAGTTTCAG
AAGAAGTAATTGGAGAGTTGTCTTCAACCAAAAGTTTCCCTTCCTTAGCTGCA
ACGAACASGTCCTGAATAGGACCATACAAGGCATTGTGATTTGTTCTGTTAGG
TGGCTGCGGAAAATCAGTCAAACTCTCCCTTATCAAACTACATTGTTTCTCTAT
GCTTAATGCCCCAGGAATAAAATAAAAGCCTGCAAATTAAGTATCACCAAGT
GTGCTTGAGTTCATTAGTTACAAATGCACTTATGATTAGTTTCTAATCACTAAT
TAATTATCCCAGTCAAGTACAATTCAAGCCATTTGTTTCAAGTTACTAAGATA
AACGGCAAATAAAAGAAAAAAGAAAATACCTGGGCGATTTTGTAAAGCAAAA
ACCGGAGAGGTGAACTTGTCGTGAAGAACGATAACACCCGAAGGAAGCACAG
CGTTTTGGTGATAGCATTCTAGAATAGATCTAAAGTCAAGGACCTCCGCTAAG
TCCACGGGTTTAGGTTGTTTTTTCCTGTTAAGAAAGGGAATTTCAATTASAATT
TGCAGAGATTACAACTGAAACAATCTACGTTCAAAGGAAATGAAATAGTAAA
ATACTTTTTGTTCTTGGAAGAAGCATTGTAGTCSTAGTAGAGCTTGTACTTCTT
S06792 CTCTGCATGGTCAWAGCSKKTT Table 8: Non- limiting Examples of Amplicons Comprising the Various Marker Loci
Provided Herein.
Figure imgf000044_0001
Figure imgf000045_0001
Table 9: Positions of various markers
Figure imgf000045_0002
Figure imgf000046_0001
In another embodiment, the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein. As used herein, "sequencing" refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A.N, et al. (2012) American Journal of Botany 99(2): 175- 185;
genotyping by sequencing (GBS) methods, for example, as described in Elshire, R.J., et al. (2011) PLoS ONE 6(5):el9379; Molecular Inversion Probe (MIP) genotyping, as described, for example, in Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673- 678; or high throughput genotyping by whole-genome resequencing, as described, for example in Huang, X et al., (2009) Genome Research 19: 1068-1076. Each of the above references is incorporated by reference in their entirety herein. An active variant of any one of SEQ ID NOS: 1-377 can comprise a
polynucleotide having at least 75%, 80% 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NOS: 1-377 as long as it is capable of amplifying and/or detecting the marker locus of interest. By "fragment" is intended a portion of the polynucleotide. A fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-158 as long as it is capable of amplifying and/or detecting the marker locus of interest.
Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
Traits or markers are considered to be linked if they co-segregate. A 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM). Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g. , such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time. Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%), 0.5%), or 0.25%> or less. Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about lOcM of a closely linked marker). In specific embodiments, a closely linked marker is within lOcM, 9cM, 8cM, 7cM, 6cM, 5cM, 4cM, 3cM, 2cM or lcM of any given marker disclosed herein. In further embodiments, a marker associated with one of the markers disclosed herein can be within 75Kb, 60Kb, 50Kb, 40Kb, 30Kb, 20K, 10Kb, 5Kb or less of the disclosed marker.
Put another way, closely linked loci co-segregate at least about 90% of the time. Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci. Typically, the region is assumed to have a euchromatin structure during initial evaluations. However, some regions, such are regions closer to centrosomes, have a heterochromatin structure. Without further information, the predicted physical distance between genetic map positions is based on the assumption that the region is euchromatic, however if the region comprises heterochromatin the markers may be physically closer together. With regard to physical position on a chromosome, closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000
nucleotides), about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
When referring to the relationship between two genetic elements, such as a genetic element contributing to resistance and a proximal marker, "coupling" phase linkage indicates the state where the "favorable" allele at the resistance locus is physically associated on the same chromosome strand as the "favorable" allele of the respective linked marker locus. In coupling phase, both favorable alleles are inherited together by progeny that inherit that chromosome strand. In "repulsion" phase linkage, the "favorable" allele at the locus of interest (e.g., a QTL for resistance) is physically linked with an "unfavorable" allele at the proximal marker locus, and the two "favorable" alleles are not inherited together (i.e., the two loci are "out of phase" with each other).
Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co- segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait. By measuring the appearance of the marker(s) in progeny of crosses, the existence of the trait can be detected by relatively simple molecular tests without actually evaluating the appearance of the trait itself, which can be difficult and time-consuming because the actual evaluation of the trait requires growing plants to a stage and/or under environmental conditions where the trait can be expressed. Molecular markers have been widely used to determine genetic composition in soybeans.
Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies. In some examples one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like. In some methods, a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21 :673-678). In some examples, the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GBS) may be used. In some examples, no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11 :31-46; and, Egan et al. (2012) Am J Bot 99: 175-185) such as sequencing by synthesis (e.g., Roche 454 pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or Proton systems), sequencing by ligation (e.g., SOLiD from Applied Biosystems, and Polnator system from Azco Biotech), and single molecule sequencing (SMS or third-generation sequencing) which eliminate template amplification (e.g., Helicos system, and PacBio RS system from Pacific Biosciences). Further technologies include optical sequencing systems (e.g., Starlight from Life Technologies), and nanopore sequencing (e.g., GridlON from Oxford Nanopore Technologies). Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:el9379), and expression methods. In some examples, no reference genome sequence is needed in order to complete the analysis.
The use of marker assisted selection (MAS) to select a soybean plant or germplasm which has a certain marker locus, haplotype or marker profile is provided. For instance, in certain examples a soybean plant or germplasm possessing a certain predetermined favorable marker locus or haplotype will be selected via MAS. In certain other examples, a soybean plant or germplasm possessing a certain predetermined favorable marker profile will be selected via MAS .
Using MAS, soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with soybean cyst nematode resistance, without actually raising soybean and measuring for resistance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with resistance). MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines). MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
In some embodiments, the molecular markers or marker loci are detected using a suitable amplification-based detection method. In these types of methods, nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region. In certain methods, nucleic acid probes that bind to the amplified region are also employed. In general, synthetic methods for making oligonucleotides, including primers and probes, are well known in the art. For example, oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22: 1859-1862, e.g., using a commercially available automated synthesizer, e.g. , as described in Needham- VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168. Oligonucleotides, including modified oligonucleotides, can also be ordered from a variety of commercial sources known to persons of skill in the art. It will be appreciated that suitable primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe. For example, primers can be designed using any suitable software program, such as LASERGENE® or Primer3.
It is not intended that the primers be limited to generating an amplicon of any particular size. For example, the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus. In some embodiments, marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and 3 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, and/or 248 or variants or fragments thereof.
PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g. , those comprising marker loci), facilitating detection of the markers. Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al (1987) U.S. Patent No. 4,683,202; Arnheim & Levinson (October 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173; Guatelli, et al, (1990) Proc. Natl. Acad. Sci.
USA87: 1874; Lomell, et al, (1989) J. Clin. Chem. 35: 1826; Landegren, et al, (1988) Science 241 : 1077-1080; Van Brunt, (1990) Biotechnology 8:291-294; Wu and Wallace, (1989) Gene 4:560; Barringer, et al, (1990) Gene 89: 117, and Sooknanan and Malek, (1995) Biotechnology 13:563-564.
Such nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci.
Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided. For example, exemplary primers and probes are provided in SEQ ID NOS: 1-110 and in Tables 2 and 4, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 135-158 and in Table 6. Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in Table 8. In other embodiments, exemplary primers and probes are provided in SEQ ID NOS: 159-248 and in Tables 3 and 5, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 339-337 and in Table 7. However, one of skill will immediately recognize that other primer and probe sequences could also be used. For instance primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci. Further, it will be appreciated that the precise probe to be used for detection can vary, e.g. , any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein. Further, the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
In certain examples, probes will possess a detectable label. Any suitable label can be used with a probe. Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels. Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes. A probe can also constitute radiolabeled PCR primers that are used to generate a radiolabeled amplicon. Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene OR); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene OR).
Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqMan™ probes. The reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3' carbon or terminal 5' carbon. The quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching. Non- fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
Selection of appropriate reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971 , the content of which is incorporated herein by reference. Examples of modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland,
Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes of Eugene, Oreg., 1992, the content of which is incorporated herein by reference.
In certain examples, reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the
naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are l-dimethylaminonaphthyl-5 sulfonate, l-anilino-8- naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate. Other dyes include 3- phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2- benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like. In certain other examples, the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art.
Suitable examples of reporters may be selected from dyes such as SYBR green, 5- carboxyfluorescein (5-FAM™ available from Applied Biosystems of Foster City, Calif), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy- 4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy- 2',4,7,7'-tetrachlorofluorescein (6-TET™ available from Applied Biosystems), carboxy- X-rhodamine (ROX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (6-JOE™ available from Applied Biosystems), VIC™ dye products available from Molecular Probes, Inc., NED™ dye products available from Applied Biosystems, and the like. Suitable examples of quenchers may be selected from 6-carboxy-tetramethyl-rhodamine, 4-(4-dimethylaminophenylazo) benzoic acid (DABYL), tetramethylrhodamine
(TAMRA), BHQ-0™, BHQ-1™, BHQ-2™, and BHQ-3™, each of which are available from Biosearch Technologies, Inc. of Novato, Calif, QSY-7™, QSY-9™, QSY-21™ and QSY-35™, each of which are available from Molecular Probes, Inc., and the like.
In one aspect, real time PCR or LCR is performed on the amplification mixtures described herein, e.g., using molecular beacons or TaqMan™ probes. A molecular beacon (MB) is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure. The MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher. Under conditions where the MB does not display intra-molecular hybridization (e.g. , when bound to a target nucleic acid, such as to a region of an amplicon during amplification), the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res. 26:2150-2155; Tyagi and Kramer, (1996) Molecular beacons: probes that fluoresce upon hybridization, Nature Biotechnology 14:303-308; Blok and Kramer, (1997) Amplifiable hybridization probes containing a molecular switch, Mol Cell Probes 11 : 187- 194; Hsuih. et al, (1997) Novel, ligation-dependent PCR assay for detection of hepatitis C in serum, J Clin Microbiol 34:501-507; Kostrikis, et al., (1998) Molecular beacons: spectral genotyping of human alleles, Science 279: 1228-1229; Sokol, et al, (1998) Real time detection of DNA:RNA hybridization in living cells, Proc. Natl. Acad. Sci. U.S.A. 95: 11538-11543; Tyagi, et al., (1998) Multicolor molecular beacons for allele discrimination, Nature Biotechnology 16:49-53; Bonnet, et al., (1999) Thermodynamic basis of the chemical specificity of structured DNA probes, Proc. Natl. Acad. Sci. U.S.A. 96:6171-6176; Fang, et al. (1999) Designing a novel molecular beacon for surface-immobilized DNA hybridization studies, J. Am. Chem. Soc. 121 :2921-2922; Marras, et al, (1999) Multiplex detection of single- nucleotide variation using molecular beacons, Genet. Anal. Biomol. Eng. 14: 151-156; and Vet, et al, (1999) Multiplex detection of four pathogenic retroviruses using molecular beacons, Proc. Natl. Acad. Sci. U.S.A. 96:6394-6399. Additional details regarding MB construction and use is found in the patent literature, e.g., U.S. Patent Nos. 5,925,517; 6,150,097; and 6,037,130.
Another real-time detection method is the 5'-exonuclease detection method, also called the TaqMan™ assay, as set forth in U.S. Patent Nos. 5,804,375; 5,538,848;
5,487,972; and 5,210,015, each of which is hereby incorporated by reference in its entirety. In the TaqMan™ assay, a modified probe, typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair. The modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal. However, as the polymerase extends the primer during amplification, the intrinsic 5' to 3' nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted. Generally, the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
It is well known that the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases. As quenching is strongly dependent on the physical proximity of the reporter and quencher, the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter- quencher pair to the 5' end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3' end of the probe.
Separate detection probes can also be omitted in amplification/detection methods, e.g. , by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamp lifted precursors (e.g. , by fluorescence polarization).
Further, it will be appreciated that amplification is not a requirement for marker detection— for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA. Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular Cloning - A Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2000 ("Sambrook"); Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2002) ("Ausubel")) and PCR Protocols A Guide to Methods and Applications (Innis, et al., eds) Academic Press Inc. San Diego, CA (1990) (Innis). Additional details regarding detection of nucleic acids in plants can also be found, e.g. , in Plant Molecular Biology (1993) Croy (ed.) BIOS Scientific Publishers, Inc. Other techniques for detecting SNPs can also be employed, such as allele specific hybridization (ASH). ASH technology is based on the stable annealing of a short, single- stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe. For each polymorphism, two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences. Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
Real-time amplification assays, including MB or TaqMan™ based assays, are especially useful for detecting SNP alleles. In such cases, probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, "A" or "C," then one probe is designed with an "A" at the SNP position, while a separate probe is designed with a "C" at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be. For instance, the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases. However, if the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes. Further, a different detectable label, for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe. In certain examples, each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3' end and either the 6-FAM (6- carboxyfluorescein) or VIC (4,7,2'-trichloro-7'-phenyl-6-carboxyfluorescein) fluorophore at the 5 ' end.
To effectuate SNP allele detection, a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus. By then detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal, a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed. For instance, when 6-FAM- and VIC-labeled probes are employed, the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured. A sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence.
The KASPar® and Illumina® Detection Systems are additional examples of commercially-available marker detection systems. KASPar® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with soybean cyst nematode resistance). Illumina® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The Illumina® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
These systems and methods represent a wide variety of available detection methods which can be utilized to detect markers associated with improved resistance to soybean cyst nematode, but any other suitable method could also be used.
Introgression of soybean cyst nematode resistance into non-tolerant or less- tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains soybean cyst nematode resistance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such resistance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm. These progeny germplasm are screened to determine the presence of soybean cyst nematode resistance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of resistance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
One application of MAS is to use the resistance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a resistance trait into a desired (typically high yielding) background. In marker assisted backcrossing of specific markers from a donor source, e.g., to an elite genetic background, one selects among backcross progeny for the donor trait and then uses repeated backcrossing to the elite line to reconstitute as much of the elite background's genome as possible.
Thus, the markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (resistance, along with any other available markers for yield, disease resistance, etc.). Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance. The number of alleles associated with resistance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
The markers and methods provided herein can also be utilized to guide marker assisted selection or breeding of soybean varieties comprising other soybean cyst nematode resistance markers or alleles to create a molecular stack for soybean cyst nematode resistance. For example, any of the marker loci provided herein can be introduced into a soybean line having one or more of the soybean cyst nematode resistance alleles rhgl, rhgl, rhg3, rhg or rhg5. In one embodiment, any one or more of the marker loci provided herein can be stacked with the rhgl allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rhg allele. In a further embodiment, any one or more of the marker loci provided herein can be stacked with the rhgl and rhg alleles. For example, any of the marker loci provided herein can be introduced into a soybean line having one or more of the soybean cyst nematode resistance loci rhgl, rhgl, rhg3 or rhg5. In one embodiment, any one or more of the marker loci provided herein can be stacked with the rhgl locus. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rhgl locus. In a further embodiment, any one or more of the marker loci provided herein can be stacked with the rhgl and rhgl loci.
This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se. The method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art. Such soybean plant progeny can be assayed for alleles associated with resistance and, thereby, the desired progeny selected. Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding. At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
Often, a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired resistance can be traced. The number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
Genetic diversity is important for long term genetic gain in any breeding program.
With limited diversity, genetic gain will eventually plateau when all of the favorable alleles have been fixed within the elite population. One objective is to incorporate diversity into an elite pool without losing the genetic gain that has already been made and with the minimum possible investment. MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
For example, the markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving elite x exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the resistance marker alleles herein.
As an alternative to standard breeding methods of introducing traits of interest into soybean (e.g., introgression), transgenic approaches can also be used to create transgenic plants with the desired traits. In these methods, exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm. For example, a nucleic acid that codes for a resistance trait is cloned, e.g. , via positional cloning, and introduced into a target plant or germplasm.
Experienced plant breeders can recognize tolerant soybean plants in the field, and can select the tolerant individuals or populations for breeding purposes or for
propagation. In this context, the plant breeder recognizes "resistant" and "non-resistant" or "susceptible" soybean plants. However, plant resistance is a phenotypic spectrum consisting of extremes in resistance and susceptibility, as well as a continuum of intermediate resistance phenotypes. Evaluation of these intermediate phenotypes using reproducible assays are of value to scientists who seek to identify genetic loci that impart resistance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a resistance trait into an elite soybean line, for example.
By "improved resistance" is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to soybean cyst nematode. That is, the damage caused by soybean cyst nematode is prevented, or alternatively, the disease symptoms caused by soybean cyst nematode is minimized or lessened. Thus, improved resistance to soybean cyst nematode can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%), or at least about 50%> to about 90%> or greater. Hence, the methods provided herein can be utilized to protect plants from soybean cyst nematode. Screening and selection of soybean cyst nematode tolerant soybean plants may be performed, for example, by exposing plants to soybean cyst nematode and selecting those plants showing resistance to soybean cyst nematode. Various assays can be used to measure resistance or improved resistance to soybean cyst nematode. For example, soybean cyst nematode resistance can be determined by visual observations after plant exposure to a particular race of soybean cyst nematode, such as race 1, 2, 3, 5 or 14. Scores range from 1 to 9 and indicate visual observations of resistance as compared to other genotypes in the test. A score of 1 indicates soybean cyst nematode are able to infect the plant and cause yield loss, while a score of 9 indicates soybean cyst nematode resistance. Preliminary scores are reported as double digits, for example, '55' indicates a preliminary score of 5 on the scale of 1 to 9.
Non-limiting examples of soybean cyst nematode resistance phenotypic screening are described in detail below.
Multiple populations of Heterodera glycines are maintained and increased on host plants. These populations are used to identify, purify, and characterize elite soybean varieties for resistance to soybean cyst nematode. The following races of soybean cyst nematode are maintained: Race 1 (Type HG 2.5), Race 2 (Type HG 1.2.5.7), Race 3 (Type HG 0 or Type HG 7), Race 5 (Type HG 2.5.7), and Race 14 (Type HG 1.3.6.7).
Eggs or second stage juveniles (J2) are used to inoculate host plants to increase their population. Soybean cyst nematode infestation requires a minimum 35 days before the cysts reach maturity and can be used to inoculate soybean experiments. Cyst eggs/J2 inoculant is harvested through a series of washings, grindings, and screenings. Screens are used progressing from larger to smaller sizes, ending with a #500 (25μιη) screen.
Soybean plants are grown in cones. Cones are long containers approximately 12 inches long and 1.5 inches in diameter at the top {e.g., Ray Leach Cone-tainers™). The cone is designed to easily remove the root mass. Three to seven days after planting, an inoculum channel is made in the cone containing the experimental line by poking a 4 inch hole with a 10 ml pipette tip. One ml of inoculum is dispensed into the channel. The plants are watered manually for the duration of the test, with watering being moderately light during the first 3-5 days until J2 infects the roots. Plants are scored approximately 28-35 days following inoculation when cyst reproduction on susceptible checks is sufficiently high. Plants are removed from their cones and the soil is removed from the roots by gently dipping the roots into a bucket of water. The plants are screened to identify native resistance to one or more of the five races of soybean cyst nematode inoculated using a combination of three methods (1) visual 9-6-1 score; (2) visual full count; and/or (3) microscope count score depending on the stage of the line when screened. In general, lines earlier in the development cycle (R1-R2) are screened by the visual 9-6-1 method, and lines that have progressed to later development phases (R3-R5) are screened by the visual full count and/or microscope count method(s) .
One typical phenotyping method is a visual evaluation of the roots. Susceptible checks are first evaluated for the development of cysts on the root system. These counts are recorded and averaged across the experiment to determine the susceptible (SUS) check average. Roots from the test plants are then scored based on a comparison with the average of the susceptible checks as follows:
9 = 0-15% of the susceptible checks average
6 = 16-40% of the susceptible checks average
1 = >41 > of the susceptible checks average
Visual counts: In this method, known checks are counted and reported in full. Observed cysts on the test plants are counted for comparison to the susceptible check plant scores. Cyst counts are converted to 1-9 scores based on the female index (FI). The female index (FI) is the percentage of the number of females cysts produced on each experimental line divided by the number produced on a standard susceptible soybean check, then the result is multiplied by 100. A low FI (<10) means that the soybean cyst nematode population is not able to reproduce well on the test line, a high FI means that the soybean cyst nematode population is able to reproduce well on the test line.
Microscope counts: Cysts counts for soybean cyst nematode assays for checks and experimental line are determined by washing cysts from roots and counting the number of cysts under the microscope.
At about 28-35 days after inoculation, roots from the susceptible check controls are examined for yellow cysts to assess whether to begin the process of evaluating the test. Experimental lines are compared with known standard checks. Once adequate levels of cysts are detected on the check varieties, plants from the test lines are removed from cones one at a time. Soil is removed from roots by gently dipping the roots into a bucket of water. The root tissue is placed on a 850 micron (#20) pore sieve stacked over a 250 micron (#60) pore sieve and sprayed with a jet of water to dislodge cysts from the roots. Collected cysts are rinsed from the #60 sieve into a clean labeled cup using no more than 30 mis of additional water.
Once all the samples are collected, each sample is counted using a gridded counting dish under a stereo microscope. The number of cysts counted are recorded for each sample. Cyst counts on the test plants are converted to the 1-9 scoring scale based on the female index (FI) described above.
The following exemplary soybean cyst nematode checks, as depicted in Table 6, can be planted and used to monitor cyst development:
Table 10: Exemplary soybean cyst nematode checks.
Figure imgf000064_0001
RES = Resistant; SUS = Susceptible; and, MR = Moderately Resistant
In some examples, a kit or an automated system for detecting marker loci, haplotypes, and marker profiles, and/or correlating the marker loci, haplotypes, and marker profiles with a desired phenotype (e.g., soybean cyst nematode resistance) are provided. As used herein, "kit" refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the
identification and/or the detection of a soybean plant or germplasm having improved resistance to soybean cyst nematode.
In one embodiment, a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode is provided. Such a kit comprises (a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) between about marker Sat_123 and about marker Satt453 on linkage group Bl; (ii) between about marker Sat_207 and about marker Satt713 on linkage group CI; or (iii) between about marker Satt574 and about marker Satt615 on linkage group D2; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode.
In a specific embodiment, the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (b) S07162-1-Q1 on linkage group CI, or a closely linked marker; or (c) S07161-1-Q1 on linkage group D2, or a closely linked marker.
In one embodiment, a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode is provided. Such a kit comprises (I) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938- 2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1- Ql, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2- Ql, S06791-1-Q1, or S06792-1-Q1 or a marker closely linked thereto on linkage group Bl; (g) is flanked by Satt557 and Satt307 on linkage group C2; (h) is flanked by S03252 and S02112 on linkage group C2; (i) is within 30 cM of one or more of S03252 or S02112 on linkage group C2; (j) is within 10 cM of one or more of S03252 or S02112 on linkage group C2; (k) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto on linkage group C2; (1) is in an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end; (m) is flanked by BARC-062799- 18070 to the end of linkage group E; (n) is flanked by Sat_107 to the end of linkage group E; (o) is flanked by S00350 to S02183 on linkage group E; (p) is within 30 cM of one or more of S00350 or S02183 on linkage group E; (q) is within 10 cM of one or more of S00350 or S02183 on linkage group E; (r) comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto on linkage group E; (s) is in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM; (t) is in an interval is flanked by S02074 and S03991 on linkage group L; (u) is within 30 cM of one or more of S02074 or S03991 on linkage group L; (v) is within 10 cM of one or more of S02074 or S03991 on linkage group L; (w) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto on linkage group L; (x) is flanked by marker locus S00875 and about marker S02621 on linkage group Dlb; (y) is flanked by S00479 and S02136 on linkage group Dlb; (z) is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, SO 1081, and S02621 on linkage group Dlb; (aa) is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (ab) comprises one or more of S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S 12853-1-Q1, S03246-1-A or S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, and S02621-1-A, or a marker closely linked thereto on linkage group Dlb; (ac) is flanked by Sat_264 and about BARC-020449-04623 on linkage group B2; (ad) is flanked by S02874 and S04785 on linkage group B2; (ae) is within 30 cM of one or more of S02864 and S04785 on linkage group B2; (af) is within 10 cM of one or more of S02864 and S04785 on linkage group B2; and/or (ag) comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto on linkage group B2; and (II) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode.
In a specific embodiment, the primers and probes of the kit are capable of detecting a marker locus comprising a marker that: (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) comprises S04348-1-A, S01209-1- A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1- Ql or a marker closely linked thereto on linkage group Bl; (g) is flanked by Satt557 and Satt307 on linkage group C2; (h) is flanked by S03252 and S02112 on linkage group C2; (i) is within 30 cM of one or more of S03252 or S02112 on linkage group C2; (j) is within 10 cM of one or more of S03252 or S02112 on linkage group C2; (k) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto on linkage group C2; (1) is in an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end; (m) is flanked by BARC-062799- 18070 to the end of linkage group E; (n) is flanked by Sat_107 to the end of linkage group E; (o) is flanked by S00350 to S02183 on linkage group E; (p) is within 30 cM of one or more of S00350 or S02183 on linkage group E; (q) is within 10 cM of one or more of S00350 or S02183 on linkage group E; (r) comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto on linkage group E; (s) is in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM; (t) is in an interval is flanked by S02074 and S03991 on linkage group L; (u) is within 30 cM of one or more of S02074 or S03991 on linkage group L; (v) is within 10 cM of one or more of S02074 or S03991 on linkage group L; (w) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto on linkage group L; (x) is flanked by marker locus S00875 and about marker S02621 on linkage group Dlb; (y) is flanked by S00479 and S02136 on linkage group Dlb; (z) is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (aa) is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, SO 1081, and S02621 on linkage group Dlb; (ab) comprises one or more of S01519-1-A, S08177-1-Q1 , S00479-1-A, S02136-1-A, S00875-1-A, S 12875-1-Q1 , S 12950-1-Q1 , S 12947-1-Q1 , S 12933-1-Q1 , S 12853-1-Q1 , S03246-1-A or S 12962-1-Q1 S00144-1-A, S08166-1-Q1 , SO 1081 , and S02621-1-A, or a marker closely linked thereto on linkage group Dlb; (ac) is flanked by Sat_264 and about BARC-020449-04623 on linkage group B2; (ad) is flanked by S02874 and S04785 on linkage group B2; (ae) is within 30 cM of one or more of S02864 and S04785 on linkage group B2; (af) is within 10 cM of one or more of S02864 and S04785 on linkage group B2; and/or (ag) comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto on linkage group B2.
Thus, a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with resistance to soybean cyst nematode, for instance a favorable marker locus, haplotype or marker profile. These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g., using any available allele detection format, such as solid or liquid phase array based detection, microfluidic- based sample detection, etc. The systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
A typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele. A wide variety of signal detection apparatus are available, including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo- scans, microfluidic nucleic acid amplification detection appliances and the like. The precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used.
Typical detector examples include light (e.g. , fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele. The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to "real time" amplification assay results.
System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted resistance are also provided. For example, the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted resistance. The precise form of the instructions can vary depending on the components of the system, e.g. , they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g. , computers or computer readable media) operably coupled to the detector. As noted, in one typical example, the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted resistance. The instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
Isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein. In one embodiment, the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising S04196-1-B, S04938-1-A, S04937-1-Q1 , S08344-1-Q1 , S08343-1-Q1 , S08346-1-Q1 , S06786-1 , S06787-1 , S06803-1 , S04197-1 , S07162-1-Q1 , S07162-1-Q1 , or a marker closely linked thereto.
Isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein. In one embodiment, the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising a marker locus (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, SO 1209, or SO 1999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1- Ql or a marker closely linked thereto on linkage group Bl; (g) is flanked by Satt557 and Satt307 on linkage group C2; (h) is flanked by S03252 and S02112 on linkage group C2; (i) is within 30 cM of one or more of S03252 or S02112 on linkage group C2; (j) is within 10 cM of one or more of S03252 or S02112 on linkage group C2; (k) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto on linkage group C2; (1) is in an interval comprising the bottom 30 cM of linkage group E, for example from about 66 cM to the end; (m) is flanked by BARC-062799- 18070 to the end of linkage group E; (n) is flanked by Sat_107 to the end of linkage group E; (o) is flanked by S00350 to S02183 on linkage group E; (p) is within 30 cM of one or more of S00350 or S02183 on linkage group E; (q) is within 10 cM of one or more of S00350 or S02183 on linkage group E; (r) comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto on linkage group E; (s) is in an interval comprising the top 30 cM of linkage group L, for example from about 0-30 cM; (t) is in an interval is flanked by S02074 and S03991 on linkage group L; (u) is within 30 cM of one or more of S02074 or S03991 on linkage group L; (v) is within 10 cM of one or more of S02074 or S03991 on linkage group L; (w) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto on linkage group L; (x) is flanked by marker locus S00875 and about marker S02621 on linkage group Dlb; (y) is flanked by S00479 and S02136 on linkage group Dlb; (z) is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621 on linkage group Dlb; (aa) is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, SO 1081, and S02621 on linkage group Dlb; (ab) comprises one or more of S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A or S12962-1-Q1 S00144-1-A, S08166-1-Q1, SO 1081, and S02621-1-A, or a marker closely linked thereto on linkage group Dlb; (ac) is flanked by Sat_264 and about BARC-020449-04623 on linkage group B2; (ad) is flanked by S02874 and S04785 on linkage group B2; (ae) is within 30 cM of one or more of S02864 and S04785 on linkage group B2; (af) is within 10 cM of one or more of S02864 and S04785 on linkage group B2; and/or (ag) comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto on linkage group B2.
In specific embodiments, the isolated polynucleotide comprises: (a) a
polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, and/or 248; (b) a polynucleotide comprising SEQ ID NOs: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, and/or 338; (c) a polynucleotide having at least 90% sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, and/or 338; or (d) a polynucleotide comprising at least 10 contiguous nucleotides of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, and/or 338.
In certain embodiments, the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to soybean cyst nematode, for instance to particular SNPs that comprise a marker locus, haplotype or marker pro file . As used herein, a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions. A
polynucleotide is said to be the "complement" of another polynucleotide if they exhibit complementarity. As used herein, molecules are said to exhibit "complete
complementarity" when every nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency" conditions.
Appropriate stringency conditions which promote DNA hybridization, for example, 6Xsodium chloride/sodium citrate (SSC) at about 45° C, followed by a wash of 2XSSC at 50° C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. Optionally, wash buffers may comprise about 0.1%> to about 1%> SDS.
Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
Non-limiting examples of methods and compositions disclosed herein are as follows:
1. A method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
(a) the at least one marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
(b) the at least one marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI; or
(c) the at least one marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2.
2. The method of embodiment 1, wherein the at least one marker locus of part (a) comprises S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto.
3. The method of embodiment 1, wherein the at least one marker locus of part (b) comprises S07162-1-Q1 or a marker closely linked thereto.
4. The method of embodiment 1, wherein the at least one marker locus of part (c) comprises S07161-1-Q1 or a marker closely linked thereto.
5. The method of any one of embodiments 1-4, wherein at least two marker loci are detected.
6. The method of embodiment 5, wherein the at least two marker loci comprise a haplotype that is associated with said resistance.
7. The method of embodiment 5, wherein the at least two marker loci comprise a marker profile that is associated with said resistance.
8. The method of any one of embodiments 1-7, wherein the germplasm is a soybean variety. 9. The method of any one of embodiments 1-8, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
10. The method of embodiment 9, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
11. The method of embodiment 10, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
12. The method of any one of embodiments 1-11, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
13. The method of embodiment 12, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
14. The method of embodiment 13, wherein said method comprises amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153 or 154.
15. The method of embodiment 13, wherein said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, or complements thereof.
16. The method of embodiment 15, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15. 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 or variants or fragments thereof.
17. The method of embodiment 16, wherein said primer pair comprises:
a) SEQ ID NO: 1 and SEQ ID NO:2;
b) SEQ ID NO: 8 and SEQ ID NO:9;
c) SEQ ID NO: 10 and SEQ ID NO: 13;
d) SEQ ID NO: 18 and SEQ ID NO: 19;
e) SEQ ID NO: 31 and SEQ ID NO:32;
f) SEQ ID NO: 39 and SEQ ID NO:40;
g) SEQ ID NO: 50 and SEQ ID NO:51;
h) SEQ ID NO: 64 and SEQ ID NO:65; or
i) SEQ ID NO: 66 and SEQ ID NO:67.
18. The method of embodiment 13, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 155 or 156.
19. The method of embodiment 13, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 155, 156 or complements thereof.
20. The method of embodiment 19, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 or variants or fragments thereof.
21. The method of embodiment 20, wherein said primer pair comprises SEQ ID NO: 72 or SEQ ID NO: 73.
22. The method of embodiment 13, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 157 or 158.
23. The method of embodiment 13, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 157, 158 or complements thereof.
24. The method of embodiment 23, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 82, 83, 84, 85, 86 or variants or fragments thereof.
25. The method of embodiment 23, wherein said primer pair comprises SEQ ID NO: 82 and SEQ ID NO: 83. 26. The method of embodiment 13, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
27. The method of embodiment 26, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154 or complements thereof.
28. The method of embodiment 27, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 or 106.
29. The method of embodiment 26, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 155, 156 or complements thereof.
30. The method of embodiment 29, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 107 or 108.
31. The method of embodiment 26, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 157, 158 or complements thereof.
32. The method of embodiment 31, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 109 or 110.
33. The method of any one of embodiments 1-7, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
34. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1- Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto.
35. The isolated polynucleotide of embodiment 34, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or 71;
(b) a polynucleotide comprising SEQ ID NOs: 87, 88, 89, 90, 91, 92,
93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 or 106;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
36. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S07162-1-Q1 or a marker closely linked thereto.
37. The isolated polynucleotide of embodiment 36, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 72, 73, 74, 75, 76, 77,
78, 79, 80 or 81;
(b) a polynucleotide comprising SEQ ID NOs: 107 or 108;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
38. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S07161-1-Q1 or a marker closely linked thereto.
39. The isolated polynucleotide of embodiment 38, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 82, 83, 84, 85 or 86;
(b) a polynucleotide comprising SEQ ID NOs: 109 or 110;
(c) a polynucleotide having at least 90%> sequence identity to the
polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of
the polynucleotides set forth in parts (a) or (b).
40. A kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode, the kit comprising: a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein the primers or probes are capable of detecting a marker locus, wherein:
(i) the marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
(ii) the marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI; or
(iii) the marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2; and
b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode.
41. The kit of embodiment 40, wherein the primers or probes are capable of detecting a marker locus comprising
(a) S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-
Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto;
(b) S07162-1-Q1 or a marker closely linked thereto; or
(c) S07161-1-Q1 or a marker closely linked thereto.
42. A method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
(a) the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
(b) the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
(c) the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
(d) the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2; (e) the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
(f) the at least one marker locus is flanked by marker locus SO 1209 and SO 1999 on linkage group Bl;
(g) the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
(h) the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2; or,
(i) the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or,
(j) the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L.
43. The method of embodiment 42, wherein the at least one marker locus of part (a) comprises S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875- 1-Ql, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1- Ql S00144-1-A, S08166- 1-Ql, SO 1081, and, S02621-1 -A or a marker closely linked thereto.
44. The method of embodiment 42, wherein the at least one marker locus of part (c) comprises S02874-1-A, S04785-1-A, or a marker closely linked thereto.
45. The method of embodiment 42, wherein the at least one marker locus of part (e) comprises S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto.
46. The method of embodiment 42, wherein the at least one marker locus of part (f) comprises S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786- 3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788- 1-Ql, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto.
47. The method of embodiment 42, wherein the at least one marker locus of part (g) comprises S03252-1-A, S02112-1-A, or a marker closely linked thereto.
48. The method of embodiment 42, wherein the at least one marker locus of part (j) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto. 49. The method of any one of embodiments 42-48, wherein at least two marker loci are detected.
50. The method of any one of embodiments 42-49, wherein the germplasm is a soybean variety.
51. The method of any one of embodiments 42-50, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
52. The method of embodiment 51 , further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
53. The method of embodiment 52, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
54. The method of any one of embodiments 42-51 , wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
55. The method of embodiment 54, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
56. The method of embodiment 55, wherein said method comprises amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377. 57. The method of embodiment 55, wherein said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
58. The method of embodiment 57, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, and/or 248 or variants or fragments thereof.
59. The method of embodiment 58, wherein said primer pair comprises the pairs as shown in Table 3.
60. The method of embodiment 55, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
61. The method of embodiment 60, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350,
351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
62. The method of embodiment 61, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, and/or 338.
63. The method of any one of embodiments 41-53, wherein the detecting comprises DNA sequencing of at least one of said marker loci. 64. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising
a) S00350-1-A, S02183-1-A, or a marker closely linked thereto;
b) S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A,
S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, S02621-1-A or a marker closely linked thereto;
c) S02874-1-A, S04785-1-A, or a marker closely linked thereto;
d) S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto;
e) S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto;
f) S03252-1-A, S02112-1 -A, or a marker closely linked thereto; or, g) S02074-1-A, S03991-1-A, or a marker closely linked thereto.
65. The isolated polynucleotide of embodiment 64, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, and/or 338;
(b) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in part (a); or (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in part (a).
66. A kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode, the kit comprising:
a) a primer or a probe for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein the primer or probe are capable of detecting a marker locus, wherein:
(i) the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
(ii) the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
(iii) the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
(iv) the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2;
(v) the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
(vi) the at least one marker locus is flanked by marker locus SO 1209 and SO 1999 on linkage group Bl;
(vii) the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
(viii) the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2; or,
(iix) the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or,
(ix) the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L; and,
b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode. 67. The kit of embodiment 66, wherein the primer or probe is capable of detecting a marker locus comprising
(a) the at least one marker locus comprises S01519-1-A, S08177-1-Q1, S00479-1- A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, S02621- 1-A or a marker closely linked thereto;
(b) the at least one marker locus comprises S02874-1-A, S04785-1-A, or a marker closely linked thereto;
(c) the at least one marker locus comprises S04348-1-A, S01209-1-A, S01999-1- A, or a marker closely linked thereto;
(d) the at least one marker locus comprises S04937-2-A, S04937-1-Q1, S04938-1- A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1- Ql, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1- Ql, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto;
(e) the at least one marker locus of part (g) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto.
(f) the at least one marker locus of part (j) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
EXPERIMENTAL
The following examples are offered to illustrate, but not to limit the claimed invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.
Example 1 :
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the SCN loci on linkage groups Bl, CI and D2. Markers were screened against various known resistant and susceptible parents. During development, these markers were validated and confirmed against a panel of 31 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines.
Table 11 Assay conditions:
Figure imgf000086_0001
Further development and testing was done to optimize the marker components for high throughput analysis of soybean. From this testing, an optimal set of primer and probe combinations were chosen for high throughput analysis needs, but other versions can be used to detect the polymorphism(s) associated with the phenotype.
Similar development, testing and analysis was done to produce any additional markers to detect polymorphisms associated with the identified SCN loci and soybean cyst nematode resistance, with the results of this work summarized in the Tables provided herein. The markers were validated against the panel of SCN resistant or susceptible varieties described above. The markers are capable of detecting SCN loci likely derived from one or more of PI88788, Peking, PI437654, as well markers from other sources.
These markers may have further been optimized for robust and consistent performance in high throughput assay conditions.
These markers can be used in other assays or with other assay conditions. Some markers were assayed under additional conditions, an example of which is summarized below.
The parameters used for the TaqMan assay are as follows in Table 12 and 13.
Table 12
Cycle Settings
94°C 120 sec 1 cycle
60°C 60 sec 40 cycles 72°C lsec
94°C 30 sec
Table 13
Assay Mix lx (ul)
DNA (1.5ng) - dried down in assay plate ddH20 3.95 Hottub buffer 0.5 dNTP (2.5mM) 0.375 Primer 1+ Primer 2 (lOOuM F+R) 0.02 Probe 1 (lOuM) 0.05 Probe 2 (10uM) 0.05 Hottub enzyme 0.025
Rox dye (50x) 0.075
Total 5.05
Table 14: Summary of SEQ ID NOs.
Figure imgf000087_0001
SEQ ID Description Linkage NO Group
25 Primer 136829 Bl
26 Primer 136832 Bl
27 Primer 136833 Bl
28 Primer 19661 Bl
29 Primer 19389 Bl
30 Primer 96347 Bl
31 Primer 136886 Bl
32 Primer 136887 Bl
33 Primer P8584A-1-F2, 82593 Bl
34 Primer Reverse primer 15081 Bl
35 Primer 136884 Bl
36 Primer 136885 Bl
37 Primer 136888 Bl
38 Primer 136889 Bl
39 Primer 144687 Bl
40 Primer 144688 Bl
41 Primer S06786-1-Q1F Bl
42 Primer S06786-1-Q1R Bl
43 Primer S06786-1-Q2R Bl
44 Primer S06786-1-Q3F Bl
45 Primer S06786-1-Q3R Bl
46 Primer S06786-1-Q4F Bl
47 Primer S06786-1-Q4R Bl
48 Primer S06786-1-Q5F Bl
49 Primer S06786-1-Q5R Bl
50 Primer 142755 Bl
51 Primer 142756 Bl
52 Primer 142759 Bl
53 Primer 142760 Bl
54 Primer S06787-1-Q2F Bl
55 Primer S06787-1-Q2R Bl
56 Primer S06787-1-Q3R Bl
57 Primer S06787-1-Q4F Bl
58 Primer S06787-1-Q4R Bl
59 Primer S06803-1-Q1F Bl
60 Primer S06803-1-Q1R Bl
61 Primer S06803-1-Q2F Bl
62 Primer S06803-1-Q3F Bl
63 Primer S06803-1-Q3R Bl
64 Primer 142386 Bl
65 Primer 142387 Bl
66 Primer S04197-1-F2 Bl
67 Primer S04197-1-R2 Bl SEQ ID Description Linkage NO Group
68 Primer S04197-1-F3 Bl
69 Primer S04197-1-R3 Bl
70 Primer S04197-1-F4 Bl
71 Primer S04197-1-R4 Bl
72 Primer 136849 CI
73 Primer 136850 CI
74 Primer 80907 CI
75 Primer 80908 CI
76 Primer 87501 CI
77 Primer 87504 CI
78 Primer 136845 CI
79 Primer 136846 CI
80 Primer 136847 CI
81 Primer 136848 CI
82 Primer 137370 D2
83 Primer 137374 D2
84 Primer 137371 D2
85 Primer 137372 D2
86 Primer 137373 D2
87 Probe 141540 Bl
88 Probe 141539 Bl
89 Probe S04938-1-P1 Bl
90 Probe S04938-1-P2 Bl
91 Probe 141537 Bl
92 Probe 141538 Bl
93 Probe 102404 Bl
94 Probe 102405 Bl
95 Probe 102406 Bl
96 Probe 102407 Bl
97 Probe 102384 Bl
98 Probe 102385 Bl
99 Probe 142753 Bl
100 Probe 142754 Bl
101 Probe 142757 Bl
102 Probe 142758 Bl
103 Probe 142761 Bl
104 Probe 142762 Bl
105 Probe 142389 Bl
106 Probe 142388 Bl
107 Probe 102396 CI
108 Probe 102397 CI
109 Probe 125316 D2
110 Probe 125331 D2 SEQ ID Description Linkage
NO Group
111 Amplicon for S04196-1-B comprising resistance allele Bl
112 Amplicon for S04196-1-B comprising susceptible allele Bl
113 Amplicon for S04938-1-A comprising resistance allele Bl
114 Amplicon for S04938-1-A comprising susceptible allele Bl
115 Amplicon for S04937-1-Q1 comprising resistance allele Bl
116 Amplicon for S04937-1-Q1 comprising susceptible allele Bl
117 Amplicon for S08344-1-Q1 comprising resistance allele Bl
118 Amplicon for S08344-1-Q1 comprising susceptible allele Bl
119 Amplicon for S08343-1-Q1 comprising resistance allele Bl
120 Amplicon for S08343-1-Q1 comprising susceptible allele Bl
121 Amplicon for S08346-1-Q1 comprising resistance allele Bl
122 Amplicon for S08346-1-Q1 comprising susceptible allele Bl
123 Amplicon for S06786-1 comprising resistance allele Bl
124 Amplicon for S06786-1 comprising susceptible allele Bl
125 Amplicon for S06787-1 comprising resistance allele Bl
126 Amplicon for S06787-1 comprising susceptible allele Bl
127 Amplicon for S06803-1 comprising resistance allele Bl
128 Amplicon for S06803-1 comprising susceptible allele Bl
129 Amplicon for S04197-1 comprising resistance allele Bl
130 Amplicon for S04197-1 comprising susceptible allele Bl
131 Amplicon for S07162- 1-Ql comprising resistance allele CI
132 Amplicon for S07162- 1-Ql comprising susceptible allele CI
133 Amplicon for S07161-1-Qlcomprising resistance allele D2
134 Amplicon for S07161-1-Qlcomprising susceptible allele D2
135 Reference sequence for S04196-1-B comprising resistance allele Bl
136 Reference sequence for S04196-1-B comprising susceptible allele Bl
137 Reference sequence for S04938-1-A comprising resistance allele Bl
138 Reference sequence for S04938-1-A comprising susceptible allele Bl
139 Reference sequence for S04937-1-Q1 comprising resistance allele Bl
140 Reference sequence for S04937-1-Q1 comprising susceptible allele Bl
141 Reference sequence for S08344-1-Q1 comprising resistance allele Bl
142 Reference sequence for S08344-1-Q1 comprising susceptible allele Bl
143 Reference sequence for S08343-1-Q1 comprising resistance allele Bl
144 Reference sequence for S08343-1-Q1 comprising susceptible allele Bl
145 Reference sequence for S08346-1-Q1 comprising resistance allele Bl
146 Reference sequence for S08346-1-Q1 comprising susceptible allele Bl
147 Reference sequence for S06786-1 comprising resistance allele Bl
148 Reference sequence for S06786-1 comprising susceptible allele Bl
149 Reference sequence for S06787-1 comprising resistance allele Bl
150 Reference sequence for S06787-1 comprising susceptible allele Bl
151 Reference sequence for S06803-1 comprising resistance allele Bl
152 Reference sequence for S06803-1 comprising susceptible allele Bl
153 Reference sequence for S04197-1 comprising resistance allele Bl SEQ ID Description Linkage NO Group
154 Reference sequence for S04197-1 comprising susceptible allele Bl
155 Reference sequence for S07162- 1-Ql comprising resistance allele CI
156 Reference sequence for S07162- 1-Ql comprising susceptible allele CI
157 Reference sequence for S07161-1-Qlcomprising resistance allele D2
158 Reference sequence for S07161-1-Qlcomprising susceptible allele D2
Example 2:
Materials and Methods:
Population: Three different homozygous PI90763 -derived donor parents were used to create three backcross populations, consisting of five replicates of 92, 83, and 69 progeny, respectively. The respective family names for the populations are LP40401802 (1802), LP40401803 (1803), and LP40401805 (1805). Six punches from separate plants were sampled per line and submitted for genotyping as JB29911. The plates were CTAB extracted to isolate DNA for analysis.
Genotyping: The putative QTL region on linkage group Dlb_(2) was saturated with 16 polymorphic markers for genotyping
Phenotyping: SCN2 scores (1-9 scale) were provided for each replication of each line and the scores were averaged to give one score per line. A haplotype analysis of the Dlb region and the results were used to divide the progeny into a recombinant data set and a non-recombinant data set.
QTL analysis: Single marker analysis was executed using QTL Cartographer 2.5 (Wang et al. (2011) Windows QTL Cartographer 2.5; Dept. of Statistics, North Carolina State University, Raleigh, NC. Available online at
statgen.ncsu.edu/qtlcart/WQTLCart.htm).
Results:
Genotyping: Three markers were removed from all three families that were segregating between the two susceptible parents, one monomorphic marker was removed from family 1802, and two monomorphic markers were removed from family 1805. The remaining allele calls were converted to the A (maternal), B (paternal), H (heterozygous) convention for QTL analysis.
The segregation ratios among the three families varied widely with family 1802 skewed towards the susceptible parents, 1803 skewed towards the resistant parent, and 1805 fairly equal
Phenotyping: The phenotypic distributions for the populations were evaluated with eachline represented once using the average score across samples. Each population was evaluated as a whole and then broken down into a recombinant data set and a non- recombinant data set (family 1803 progeny were all classified as recombinant). The average SCN2 score for the parents are as follows: Parent 1 = 3.0, Parent 2 = 2.2, and PI090763 = 8.4.
Single Marker Analysis: Highly significant markers associated with SCN were found on Lg-D lb. Single marker analysis was conducted for each family and then the families were broken down into recombinant and non-recombinant groups and the analysis was repeated. The tables below show the markers found to be significant at a pr(F) <.05, and the markers/intervals of highest significance are indicated in bold for each set.
Family LP40401802: No highly significant associations were identified in family 1802. The highest significance was found in the non-recombinant data set at marker S00479-1-A (91.61cM), explaining 24% of the variation. Minor significance was found at marker S01519-1-A across all progeny and in the recombinant data set, explaining
11% of the variation.
Table 15
Family Data Set Marker LG LRS pr(F) R2
I.P404II 18(12 All progeny S00479-1-.A Dlb (2) 3.966 0.04957
LP40401802 All progeny S00875-1-A Dlb (2) 6.084 0.01501 0.065
I.P4040I 02 All progeny S12947-1-Q1 Dlb (2) 6.084 0.01501 llisiiii
LP40401802 All progeny S12933-1-Q1 Dlb (2) 9.304 0.00263 0.087
1 1*4(14(11X02 Ml [>Ι Ι¾ΙΊΙ\ MM?l9-l-\ DM) (2) 1(1.-43 0.(1(1123 0.113
LP40401802 All progeny S08177-1-Q1 Dlb (2) 6.986 0.00916 0.074
I.I II4III.MI2 N II- MMM-' -\ DM) (2) 9. 10 0.(1(1324 0.239
rcnmihiiiani
I.I II4III.MI2 Non-recombinant SOI 519- 1 -A Dlb_(2) 4.478 0.04120 o.i r
I.I 04IIIMI2 Recombinant SI 2933-1 -Ql Dlb (2) 5.166 0.02643 iii iii:
LP40401802 Recombinant S01519-1-A Dlb (2) 6.316 0.01411 0.110
I.P4040I 02 Recombinant SOS 177-1 -Ol Dlb_(2) 4.278 0.04338 !!iiiiii
L S= likelihood ratio statistic. pr(F) is the F test statistic testing the null hypothesis. 0.05 is the lowest level of significance, anything <0.0001 is highly significant.
Family LP40401803: Significance was found in family 1803 between markers S00875-1-A (113.96cM) and S12933-1-Q1 (cM), explaining 15% of the variation. No recombination was observed in this interval.
Table 16
Family Data Set Marker LG LRS F(F) R2
1 I 040I 03 Recombinant S02136-1-A Dlb (2) 4.731 oo;:^ 0.059
LP40401803 Recombinant S00875-1-A Dlb (2) 12.686 0.00046 0.150
1.P4040I 03 Recombinant SI 2X75- 1 - l Dlb (2) 11.423 0.1 SS 0.125
LP40401803 Recombinant S12950-1-Q1 Dlb (2) 12.686 0.00046 0.150
1 P4040IS03 Recombinant SI 'i4--l-QI Dlb (2) 1 .03" 0.00064 0.137
LP40401803 Recombinant S12933-1-Q1 Dlb (2) 12.686 0.00046 0.150
1 ['404(11803 Recombinant S12853-1-QI Dlb (2) 10.248 0.00163
LP40401803 Recombinant S03246-1-A Dlb (2) 10.744 0.00126 0.129
1 P4040I803 Recombinant S12962-1-QI Dlb (2) 7.494 ()()(Γ(Γ lliliilli
LP40401803 Recombinant S08177-1-Q1 Dlb (2) 8.056 0.00523 0.098
Family LP40401805: Highly significant markers were found in family 1805 between markers S12875-1-Q1 (cM) and S12933-1-Q1 (cM), explaining 31% of the variation using all progeny and 18% of the variation using only recombinant progeny. No recombination was observed in this interval. Significance was not found using the non- recombinant data set.
Table 17
Family Data Set Marker LG LRS pr(F) R2
1 P4040I 05 All progeny S02136-1-A Dlb (2) 4.158 ()()4.^- 0.059
LP40401805 All progeny S00875-1-A Dlb_(2) 11.254 0.00099 0.153
1 1*40401805 Ml piogcin S 1 8"5- 1 -Q 1 Dlb (2) 24.834 0.00000 0.304
LP40401805 All progeny S12950-1-Q1 Dlb (2) 24.834 0.00000 0.306
1 P4040I 05 Ml progcin M2«)4--I-QI Dlb (2) 24.129 0.00000 0.299
LP40401805 All progeny S12933-1-Q1 Dlb (2) 24.129 0.00000 0.304
I.P4040I805 All progeny S12853-1-Q1 Dlb (2) 22.994 t) lllilllll
LP40401805 All progeny S03246-1-A Dlb_(2) 22.994 0.00000 0.287
1 P4040I 05 All progeny S01519-1 -A Dlb (2) 22.377 OIK iiiei
LP40401805 Recombinant S12875-1-Q1 Dlb (2) 9.076 0.00339 0.179
l> iiiKeeojnbi s. t:::::;: SI2950-1-QI Dlb (2) ιι"ϊ/. . llllAlW 0.179
LP40401805 Recombinant S12947-1-Q1 Dlb (2) 9.076 0.00339 0.179
1 IUIUIIIXII^ 1 Dl h "Ί (MitV) II 17Q
LP40401805 Recombinant S12853-1-Q1 Dlb (2) 7.411 0.00 11 0.149
1 I 040I805 Recombiiuuit S03246-1-A Dlb (2) 7.411 0.00811 lllilllll
LP40401805 Recombinant S01519-1-A Dlb (2) 7.411 0.00811 0.149
1 I 040I 05 Recombinant S08177-1-Q1 Dlb (2) -o" IIIKW"' iiiiiii Recombinant and non-recombinant haplotypes were identified in these three populations, and are summarized below in Table ?? , where r= resistant, h=heterozygous, and s=susceptible Table 18
Figure imgf000094_0001
Example 3
Materials and Methods:
Population: The population LP40401802 comprised of 204 progeny replicated five times each, was submitted as JB 15967 and CTAB extracted for genotyping.
Genotyping: The putative QTL region on linkage group Dlb_(2) was saturated with 17 polymorphic markers, with the rest of the chromosome covered by an additional 13 markers. All marker selections were made using a proprietary software to select markers distributed across the linkage group.
Phenotyping: Raw cyst counts and the derived 1-9 SCN2 scores were provided for each of the 1020 progeny and parental samples. The scores were averaged for each variety, resulting in 204 progeny scores.
Linkage Analysis: Map Manager QTX.b20 was used for linkage map construction with the following parameters:
1) Linkage Evaluation: Advanced Backcross 2
2) Search Criteria: P = le"5 3) Map Function: Haldane
4) Cross Type: Line Cross
QTL analysis: Single marker analysis and composite interval mapping (CIM) were executed using QTL Cartographer 2.5. The standard CIM model and forward and backward regression method was used, and the LRS threshold for statistical significance was set to the default value of 11.5.
Results:
Genotyping: A consensus call was calculated for each variety and then converted to the A (maternal), B (paternal), H (heterozygous) convention for QTL analysis. Three markers were removed from the analysis because the maternal call was heterozygous while Parent 2 and PI90763 were homozygous for opposite alleles. An additional marker was removed that failed genotyping.
Phenotyping: The phenotypic distributions were evaluated using an average score across samples for eachline . The population was evaluated as a whole and then broken down into a recombinant data set and a non-recombinant data set.
Mapping Analysis: Linkage mapping was performed in Map Manager QTX.b20 using Advanced Backcross 2 for the Linkage Evaluation setting.
Single Marker Analysis: Single marker analysis was performed using all 204 progeny, 107 recombinant progeny, and 97 non-recombinant progeny for both the raw cyst counts and SCN2 scores. Highly significant markers were observed at the p=.0001 level using all progeny and recombinant progeny across both data setsThe non- recombinant data set identified peak markers in a similar area, but showed less significance (p=.001 level). All significant markers among the data sets have effects coming from PI90763. Table 19
Figure imgf000096_0001
Table 20
Figure imgf000096_0002
Table 21
Figure imgf000096_0003
Table 22
Figure imgf000097_0001
Table 23
Figure imgf000097_0002
mm-x^A oi&jg to,44^ 10^0 0.00142 o.ioa
Table 24
Marker Chrom LRS F(l,n-2) pr(F) R2
SO0875-1-A Dlb_(2) 9.014 9.251 0.00304 lli llll
¾12875- k 01b &Ϊ 1 ,47$ 000883 iiiiiiiii
S12950-1-Q1 Dlb_(2) 11.116 11.535 0.00100
..s-xz iri- oibi?.S ii,82& nam 0.0.00159 0,11s
S12933-1-Q1 Dlb_(2) 11.479 11.935 0.00083
Dlh (2S £.593 8.8O0 ΰ.0.0381 0,QS5
S03246-1-A M b (2) 8360 0.00432 |||il8||||
S01519-I-A Dlb fli 10.234 10.571 «,00159 0.1(30
S12962-1-Q1 Dlb_(2) 12.627 13.207 0.00045
U t■", DlbJ2} 12.831 0,00054
S08166-1-Q1 DlbJ2) 11.900 12.400 0.00066
SOlOSt-l-A BlbJ2) 10.737 O,0&i43
Example 4
The goal of this study was to confirm the QTLs reported in the paper TAG (2005) 111 :965- another F4 population from a biparental cross with PI90763. This population has been previously phenotyped and an initial genotyping job assayed 119 markers from the 7 chromosomes (Lg-A2/Bl/E/G/J/L/0) reported as significant in the above literature. Marker regression significant associations on Lg-L and Bl (p=0.001), and interval mapping also indicated Lg-L as significant. However, the chromosome positions of each QTL were inconsistent with the QTL positions reported in the literature. In combination with a subsequent genome-wide scan of the population (an additional 163 markers), a second mapping analysis confirmed the minor QTL on Lg-L and indicated a major QTL on Lg-Dlb. The QTL on Lg-L was not consistent with the QTL reported in the literature, while the QTL on Lg-Dlb was not reported in either paper. New phenotypic data was analyzed in this study using the previous genotypic calls. A minor QTL was identified on Lg-B2, explaining 8% of the phenotypic variation, and the QTL on Lg-Dlb was confirmed from the prior analysis, explaining 40% of the variation. When the first and second sets of phenotypic scores were averaged, one major and six minor QTLs were identified. The major QTL mapped to Lg-Dlb in the interval reported previously and explained 39% of the variation. Two minor QTLs were identified on Lg-Bl , each explaining 7% of the phenotypic variation, and one minor QTL was identified on each of Lg-C2, E, F, and L, explaining 7%, 8%, 10%>, and 9% of the variation, respectively. While QTLs were identified on Lg-Bl, E, and L in the literature, the positions do not seem consistent with the current findings.
Materials and Methods:
Population: An F4 population from a biparental cross with PI90763 PI90763 consisting of 276 progeny was used for the study, PI90763 was the resistant donor. The tissue was lyophilized and submitted for genotyping as JB1048. The tissue was then CTAB extracted to isolate DNA.
Genotyping: Genotypic data from jobs J-D306 (119 markers) and J-G285 (163 markers) were employed in this analysis.
Phenotyping: Phenotypic scores, ranged from a score of 1 (susceptible) to 9 (resistant). The new data set was analyzed both alone (Set2_AVE) and as an average with the original data set (Total AVE). Linkage Analysis: Map Manager QTX.b20 was used to construct the linkage map and perform QTL analysis. The initial Map Manager Parameters were set to:
1) Linkage Evaluation: Intercross
2) Search Criteria: P = le"5
3) Map Function: Kosambi
4) Cross Type: Line Cross
Genetic map: Preliminary analysis showed that 24 markers from J-G285 were non- informative for QTL analysis due to the absence of a heterozygous class. These markers were removed and the data for the remaining 139 markers was combined with the data for 78 markers from J-D306. In all, 45 markers showed segregation distortion but were retained in the analysis. Allele calls for the 217 markers were then converted to the A (maternal), B (paternal), H (heterozygous) convention for QTL analysis. The 217 markers formed 48 linkage groups across the 20 chromosomes, with 19 markers remaining unlinked. Marker arrangement was checked to ensure the distorted markers linked as expected, and four markers were found to have rearrangements. These were removed from the analysis.
Marker Regression Analysis: Marker regression was performed (p=0.001) across all 217 markers, indicating significant associations on Lg-B2, Dlb, E, L, and I in the Set2_AVE data set, and Lg-Bl, C2, Dlb, E, and L in the Total AVE data set.
A permutation test was run 1000 times using the free model, establishing the threshold for statistical significance (LOD ratio statistic - LRS) to determine putative QTL. LRS cutoffs were 11.0 for suggestive in Set2_AVE and total AVE, 17.7 or 17.3 for significant in Set2_AVE and total AVE, and 26.8 or 28.9 for highly significant in Set2_AVE and total AVE. Interval mapping was performed using the bootstrap test, free regression model, and the LRS cutoffs determined by the permutation test.
Set! A VE: Major QTL on Lg-Dlb, minor QTL on Lg-B2
A major QTL was indicated near the bottom of Lg-Dlb with a 1-LOD support interval of 3cM between markers S01519-1-A and S02621-1-A and an LRS of 131.6, explaining 40% of the phenotypic variation. A minor QTL was also indicated near the of Lg-B2 at marker S02874-1-A with a 1-LOD support interval of 3cM between markers. The LRS was 21.1 and the QTL explained 8% of the phenotypic variation.
Total A VE: Major QTL on Lg-Dlb, six minor QTL on Lg-Bl, C2, E, and L
A major QTL was indicated near the bottom of Lg-Dlb with a 1-LOD support interval of 3cM between markers S01519-1-A and S02621-1-A and an LRS of 131.1, explaining 39% of the phenotypic variation.
Two minor QTLs were identified about 28cM apart in the top half of Lg-Bl, each explaining 7% of the phenotypic variation. The first has a 1-LOD support interval of 9cM and LRS of 19.9. The second minor QTL has a 1-LOD support interval of 5cM between markers S01209-1-A and S01999-1-A and an LRS of 18.7.
A minor QTL was indicated near the bottom of Lg-C2 at marker S02112-1 -A, This QTL had an LRS of 17.3, explaining 7% of the variation.
A minor QTL was identified near the bottom of Lg-E, highly associated with marker S02183- 1 -A and flanked to the north by S00350- 1 -A. No markers were linked to the south. The QTL had an LRS of 20.2, explaining 8% of the phenotypic variation.
A minor QTL was found at the top of Lg-L at marker S02074-1-A and flanked to the south by S03991-1-A. No markers were linked to the north. The QTL had an LRS of 20.7 and explained 9% of the phenotypic variation.
All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED
1. A method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
(a) the at least one marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
(b) the at least one marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI;
(c) the at least one marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2;
(d) the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
(e) the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
(f) the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
(g) the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2;
(h) the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
(i) the at least one marker locus is flanked by marker locus SO 1209 and S01999 on linkage group B 1 ;
(j) the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
(k) the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2;
(1) the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or (m) the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L.
2. The method of claim 1, wherein:
(a) the at least one marker locus of part (a) comprises S04196-1 -B,
S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto;
(b) the at least one marker locus of part (b) comprises S07162-1-Q1 or a marker closely linked thereto;
(c) the at least one marker locus of part (c) comprises S07161-1-Q1 or a marker closely linked thereto;
(d) the at least one marker locus of part (d) comprises SO 1519- 1 -A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1-Q1 S00144-1-A, S08166-1-Q1, SO 1081, S02621-1-A, or a marker closely linked thereto;
(e) the at least one marker locus of part (f) comprises S02874-1-A, S04785-1-A, or a marker closely linked thereto;
(f) the at least one marker locus of part (h) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto;
(g) the at least one marker locus of part (i) comprises S04937-2-A,
S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, S06792-1-Q1, or a marker closely linked thereto;
(h) the at least one marker locus of part (j) comprises S03252-1 -A,
S02112-1 -A, or a marker closely linked thereto; or
(i) the at least one marker locus of part (m) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
3. The method of claim 1, wherein at least two marker loci are detected.
4. The method of claim 3, wherein the at least two marker loci comprise a haplotype that is associated with said resistance.
5. The method of claim 3, wherein the at least two marker loci comprise a marker profile that is associated with said resistance.
6. The method of claim 1, wherein the germplasm is a soybean variety.
7. The method of claim 1, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
8. The method of claim 7, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
9. The method of claim 8, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
10. The method of claim 1, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
11. The method of claim 10, wherein the amplifying comprises:
(a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
12. The method of claim 11 , wherein said method comprises:
(a) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153 or 154;
(b) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155 or 156;
(c) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 157 or 158; or
(d) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376 or 377.
13. The method of claim 11 , wherein said primer or primer pair comprises:
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149,
150, 151, 152, 153, 154, or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 157, 158, or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, or complements thereof.
14. The method of claim 13, wherein said primer or primer pair comprises:
(a) a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, or variants or fragments thereof;
(b) a nucleic acid sequence comprising SEQ ID NOs: 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, or variants or fragments thereof;
(c) a nucleic acid sequence comprising SEQ ID NOs: 82, 83, 84, 85, 86, or variants or fragments thereof; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, or variants or fragments thereof.
15. The method of claim 14, wherein said primer pair comprises:
(a) SEQ ID NO : 1 and SEQ ID NO :2; SEQ ID NO: 8 and SEQ ID
NO:9; SEQ ID NO: 10 and SEQ ID NO: 13; SEQ ID NO: 18 and SEQ ID NO: 19; SEQ ID NO: 31 and SEQ ID NO:32; SEQ ID NO: 39 and SEQ ID NO:40; SEQ ID NO: 50 and SEQ ID NO:51; SEQ ID NO: 64 and SEQ ID NO:65; or SEQ ID NO: 66 and SEQ ID NO:67;
(b) SEQ ID NO : 72 and SEQ ID NO : 73 ;
(c) SEQ ID NO: 82 and SEQ ID NO: 83; or
(d) the primer pairs as shown in Table 3.
16. The method of claim 11, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
17. The method of claim 16, wherein said labeled nucleic acid probe comprises:
(a) a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142,
143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, or complements thereof;
(b) a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, or complements thereof;
(c) a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 157, 158, or complements thereof; or
(d) a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, or complements thereof
18. The method of claim 17, wherein the labeled nucleic acid probe comprises:
(a) a nucleic acid sequence comprising SEQ ID NOs: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 or 106;
(b) a nucleic acid sequence comprising SEQ ID NOs: 107 or 108;
(c) a nucleic acid sequence comprising SEQ ID NOs: 109 or 110; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 249, 250, 251 , 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337 or 338.
19. The method of claim 1, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
20. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising:
(a) S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343- 1-Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1, or a marker closely linked thereto;
(b) S07162- 1 -Q 1 or a marker closely linked thereto;
(c) S07161 - 1 -Q 1 or a marker closely linked thereto;
(d) S00350-1-A, S02183-1-A, or a marker closely linked thereto;
(e) S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1- A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1- A, S12962-1-Q1 S00144-1-A, S08166-1-Q1, SO 1081, S02621-1-A, or a marker closely linked thereto;
(f) S02874-1-A, S04785-1-A, or a marker closely linked thereto;
(g) S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto;
(h) S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2- Ql, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1- Ql, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1- Ql, S06792-1-Q1, or a marker closely linked thereto;
(i) S03252-1-A, S02112-1 -A, or a marker closely linked thereto; or (j) S02074-1-A, S03991-1-A, or a marker closely linked thereto.
21. The isolated polynucleotide of claim 20, wherein the polynucleotide comprises:
(a) a polynucleotide comprising:
(i) SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or 71;
(ii) SEQ ID NOs: 72, 73, 74, 75, 76, 77, 78, 79, 80 or 81;
(iii) SEQ ID NOs: 82, 83, 84, 85 or 86; or (iv) SEQ ID NOs: 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247 or 248;
(b) a polynucleotide comprising:
(i) SEQ ID NOs: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 or 106;
(ii) SEQ ID NOs: 107 or 108;
(iii) SEQ ID NOs: 109 or 110; or
(iv) SEQ ID NOs: 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337 or 338;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
22. A kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode, the kit comprising:
a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein the primers or probes are capable of detecting a marker locus, wherein:
(i) the marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
(ii) the marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI; (iii) the marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2;
(iv) the marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
(v) the marker locus is flanked by marker locus S00479 and
S02136 on linkage group Dlb;
(vi) the marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
(vii) the marker locus is flanked by marker locus S02874 and S04785 on linkage group B2;
(viii) the marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
(ix) the marker locus is flanked by marker locus S01209 and SO 1999 on linkage group Bl;
(x) the marker locus is flanked by marker locus Satt557 and
Satt307 on linkage group C2;
(xi) the marker locus is flanked by marker locus S03252 and S02112 on linkage group C2;
(xii) the marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or
(xiii) the marker locus is flanked by marker locus S02074 and S03991 on linkage group L; and
b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode.
23. The kit of claim 22, wherein the primers or probes are capable of detecting a marker locus comprising
(a) S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1- Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1, or a marker closely linked thereto; (b) S07162- 1 -Q 1 or a marker closely linked thereto;
(c) S07161-1-Q1 or a marker closely linked thereto;
(d) S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1- A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1- A, S12962-1-Q1 S00144-1-A, S08166-1-Q1, SO 1081, S02621-1 -A, or a marker closely linked thereto;
(e) S02874-1-A, S04785-1-A, or a marker closely linked thereto;
(f) S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto;
(g) S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-
Ql, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1- Ql, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1- Ql, S06792-1-Q1, or a marker closely linked thereto;
(h) S03252-1-A, S02112-1 -A, or a marker closely linked thereto; or (i) S02074-1-A, S03991-1-A, or a marker closely linked thereto.
PCT/US2013/076414 2012-12-21 2013-12-19 Genetic loci associated with soybean cyst nematode resistance and methods of use Ceased WO2014100346A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
BR112015014632-5A BR112015014632B1 (en) 2012-12-21 2013-12-19 IDENTIFICATION METHOD
CA2893847A CA2893847C (en) 2012-12-21 2013-12-19 Genetic loci associated with soybean cyst nematode resistance and methods of use
ZA2015/03510A ZA201503510B (en) 2012-12-21 2015-05-19 Genetic loci associated with soybean cyst nematode resistance and methods of use

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261745002P 2012-12-21 2012-12-21
US61/745,002 2012-12-21
US13/786,948 2013-03-06
US13/786,948 US9464330B2 (en) 2012-12-21 2013-03-06 Genetic loci associated with soybean cyst nematode resistance and methods of use

Publications (1)

Publication Number Publication Date
WO2014100346A1 true WO2014100346A1 (en) 2014-06-26

Family

ID=50976403

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/076414 Ceased WO2014100346A1 (en) 2012-12-21 2013-12-19 Genetic loci associated with soybean cyst nematode resistance and methods of use

Country Status (5)

Country Link
US (2) US9464330B2 (en)
AR (1) AR094235A1 (en)
BR (1) BR112015014632B1 (en)
WO (1) WO2014100346A1 (en)
ZA (1) ZA201503510B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9464330B2 (en) 2012-12-21 2016-10-11 Pioneer Hi-Bred International, Inc. Genetic loci associated with soybean cyst nematode resistance and methods of use

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11180795B1 (en) 2015-06-02 2021-11-23 Syngenta Participations Ag Nematode resistance alleles in soybean
US20220056470A1 (en) 2020-08-18 2022-02-24 Pioneer Hi-Bred International, Inc. Multiple disease resistance genes and genomic stacks thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999031964A1 (en) * 1997-12-19 1999-07-01 Pioneer Hi-Bred International, Inc. Nucleotide polymorphisms in soybean
US20040031072A1 (en) * 1999-05-06 2004-02-12 La Rosa Thomas J. Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement
WO2005075685A1 (en) * 2004-02-02 2005-08-18 Nestec S.A. Genes associated with canine osteoarthritis and related methods and compositions
US20070083945A1 (en) * 2000-03-10 2007-04-12 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
US20120278953A1 (en) * 1995-10-24 2012-11-01 Pioneer Hi-Bred International, Inc Quantitative Trait Loci Associated With Soybean Cyst Nematode Resistance and Uses Thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6162967A (en) 1994-01-26 2000-12-19 Pioneer Hi-Bred International, Inc. Positional cloning of soybean cyst nematode resistance genes
US5491081A (en) 1994-01-26 1996-02-13 Pioneer Hi-Bred International, Inc. Soybean cyst nematode resistant soybeans and methods of breeding and identifying resistant plants
CA2192920A1 (en) 1995-12-15 1997-06-16 Richard A. Vierling Methods for conferring broad-based soybean cyst nematode resistance to asoybean line
US6300541B1 (en) 1997-01-14 2001-10-09 Southern Illinois University Soybean sudden death syndrome resistant soybeans, soybean cyst nematode resistant soybeans and methods of breeding and identifying resistant plants
BRPI0107440B1 (en) 2000-01-07 2018-02-27 Monsanto Technology Llc METHODS FOR SELECTION OF SOYBEAN PLANT HAVING RHG1-RESISTANT NEMATODE ALELO
CA2331674A1 (en) 2000-01-28 2001-07-28 Southern Illinois University Isolated polynucleotides and polypeptides relating to loci underlying resistance to soybean cyst nematode and soybean sudden death syndrome and methods employing same
EP2222154A1 (en) * 2007-10-12 2010-09-01 Monsanto Technology LLC Methods and compositions for high yielding soybeans with nematode resistance
US8692064B2 (en) * 2009-10-02 2014-04-08 The Curators Of The University Of Missouri Quantitative trait loci associated with soybean cyst nematode resistance and methods of their use
US9464330B2 (en) 2012-12-21 2016-10-11 Pioneer Hi-Bred International, Inc. Genetic loci associated with soybean cyst nematode resistance and methods of use

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120278953A1 (en) * 1995-10-24 2012-11-01 Pioneer Hi-Bred International, Inc Quantitative Trait Loci Associated With Soybean Cyst Nematode Resistance and Uses Thereof
WO1999031964A1 (en) * 1997-12-19 1999-07-01 Pioneer Hi-Bred International, Inc. Nucleotide polymorphisms in soybean
US20040031072A1 (en) * 1999-05-06 2004-02-12 La Rosa Thomas J. Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement
US20070083945A1 (en) * 2000-03-10 2007-04-12 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
WO2005075685A1 (en) * 2004-02-02 2005-08-18 Nestec S.A. Genes associated with canine osteoarthritis and related methods and compositions

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9464330B2 (en) 2012-12-21 2016-10-11 Pioneer Hi-Bred International, Inc. Genetic loci associated with soybean cyst nematode resistance and methods of use

Also Published As

Publication number Publication date
US20160376668A1 (en) 2016-12-29
US20140182009A1 (en) 2014-06-26
US9464330B2 (en) 2016-10-11
CA2893847A1 (en) 2014-06-26
BR112015014632B1 (en) 2022-10-18
AR094235A1 (en) 2015-07-22
BR112015014632A2 (en) 2017-07-11
ZA201503510B (en) 2016-08-31

Similar Documents

Publication Publication Date Title
WO2013188612A1 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US9994920B2 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US20170022575A1 (en) Genetic loci associated with phytophthora tolerance in soybean and methods of use
US11319599B2 (en) Genetic loci associated with reproductive growth phenotypes in soybean and methods of use
US20120174246A1 (en) Methods of identifying aphid resistant soybeans
US20160376668A1 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US10017829B2 (en) Genetic loci associated with Frogeye Leaf Spot resistance and Brown Stem Rot resistance and methods of use
CA2845522C (en) Molecular markers associated with soybean root-knot nematode tolerance and methods of their use
US11357185B2 (en) Polynucleotides and kits associated with soybean iron deficiency tolerance and methods of detection and breeding
US20160150749A1 (en) Rag-based selection methods for improving aphid resistance in soybeans
US20170298452A1 (en) Carlavirus tolerant soybeans and methods of use
US20160272997A1 (en) Stem canker tolerant soybeans and methods of use
US20130061347A1 (en) Qtl associated with aphid resistance in soybeans and methods of their use
CA2893847C (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US20140162250A1 (en) Marker-assisted selection of tolerance to chloride salt stress

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13866225

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2893847

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13866225

Country of ref document: EP

Kind code of ref document: A1

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015014632

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015014632

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150618