WO2014100346A1 - Genetic loci associated with soybean cyst nematode resistance and methods of use - Google Patents
Genetic loci associated with soybean cyst nematode resistance and methods of use Download PDFInfo
- Publication number
- WO2014100346A1 WO2014100346A1 PCT/US2013/076414 US2013076414W WO2014100346A1 WO 2014100346 A1 WO2014100346 A1 WO 2014100346A1 US 2013076414 W US2013076414 W US 2013076414W WO 2014100346 A1 WO2014100346 A1 WO 2014100346A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- marker
- seq
- locus
- linkage group
- soybean
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display improved resistance to Soybean Cyst Nematode.
- sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 430287seqlist.txt, a creation date of February 26, 2013 and a size of 111 KB.
- ASCII American Standard Code for Information Interchange
- the sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
- Soybeans ⁇ Glycine max L. Merr. are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
- Soybean Cyst Nematode is a parasitic pest which has threatened soybean production in the U.S. for more than fifty years. Soybean cyst nematode resistance is an economically important trait as infection can substantially reduce yields. Molecular characterization of soybean cyst nematode resistance would have important implications for soybean cultivar improvement.
- the method comprises detecting at least one marker locus that is associated with resistance to soybean cyst nematode. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with resitance to soybean cyst nematode. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode, as well as soybean plants and seeds comprising one or more soybean cyst nematode loci.
- Figure 1 A-C provides a genetic map for loci on linkage group CI .
- Figure 2 A-B provides a genetic map for loci on linkage group Bl .
- Figure 3 A-D provides a genetic map for loci on linkage group D2.
- Figure 4 A-D provide a genetic map for loci on LG B 1. Genetic map positions are based on the public integrated map (Hyten et al. (2010) Crop Sci 50:960-968).
- Figure 5 A-C provides a genetic map for loci on linkage group Dlb.
- Figure 6 A-C provides a genetic map for loci on linkage group C2.
- Figure 7 A-B provides a genetic map for loci on linkage group B2.
- Figure 8 A-B provides a genetic map for loci on linkage group E.
- Figure 9 A-B provides a genetic map for loci on linkage group L.
- kits comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers.
- the term “comprising” is intended to include examples encompassed by the terms “consisting essentially of and “consisting of.” Similarly, the term “consisting essentially of is intended to include examples encompassed by the term “consisting of.”
- Agronomics refers to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season.
- Individual agronomic traits include emergence vigor, vegetative vigor, stress resistance, disease resistance or resistance, insect resistance or resistance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
- Allele means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy
- allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
- amplifying in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced.
- An “amp licon” is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method
- An "ancestral line” is a parent line used as a source of genes, e.g., for the development of elite lines.
- An "ancestral population” is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
- Backcrossing is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
- chromosome segment designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome.
- Chrosome interval refers to a chromosome segment defined by specific flanking marker loci.
- Crop and “variety” are used synonymously and mean a group of plants within a species ⁇ e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
- An "elite line” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
- An "elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
- an “exotic soybean strain” or an “exotic soybean germplasm” is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm.
- an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
- a "genetic map” is a description of genetic linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form.
- Gene is a description of the allelic state at one or more loci.
- Germplasm means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
- An individual is "homozygous” if the individual has only one type of allele at a given locus (e.g. , a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes).
- An individual is "heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles).
- the term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
- “Introgression” means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
- label or “detectable label” refer to a molecule capable of detection.
- a detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqManTM probes.
- reporter refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher.
- the detectable signal of the reporter is, e.g., fluorescence in the detectable range.
- quencher refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter.
- quenching and “fluorescence energy transfer” refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
- a “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic).
- a “subline” refers to an inbred subset of
- a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are "fixed” or homozygous across most or all loci.
- Commercial soybean varieties (or lines) are typically produced by aggregating ("bulking") the self- pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self- pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was
- Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant.
- the seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample.
- seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, resistance, etc.).
- Linkage refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage. "Linkage disequilibrium" or "LD" is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
- Linkage group refers to traits or markers that generally co-segregate.
- a linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
- Locus is a defined segment of DNA.
- a “map location” or “map position” is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968.
- a “physical position” or “physical location” or “physical map location” is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463: 178- 183, available from the Phytozome website (phytozome-dot-net/soybean).
- Mapping is the process of defining the linkage relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
- Marker or “molecular marker” or “marker locus” is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
- Marker assisted selection refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
- Haplotype refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-0 are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
- a "marker profile” means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes.
- a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
- plant includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
- Plant parts means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
- Polymorphism means a change or difference between two related nucleic acids.
- a “nucleotide polymorphism” refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
- Polynucleotide “polynucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” and “oligonucleotide” are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi- stranded, that optionally contains synthetic, non-natural, or altered R A or DNA nucleotide bases.
- a DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
- Primer refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase.
- primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed.
- Primers may be provided in double-stranded form, though the single-stranded form is more typically used.
- a primer can further contain a detectable label, for example a 5' end label.
- Probe refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
- probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed.
- a probe can further contain a detectable label.
- Quantitative trait loci or “QTL” refer to the genetic elements controlling a quantitative trait.
- Recombination frequency is the frequency of a crossing over event
- Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
- Resistance and “improved resistance” are used interchangeably herein and refer to any type of increase in resistance or resistance to, or any type of decrease in susceptibility.
- a "resistant plant” or “resistant plant variety” need not possess absolute or complete resistance. Instead, a “resistant plant,” “resistant plant variety,” or a plant or plant variety with “improved resistance” will have a level of resistance or resistance which is higher than that of a comparable susceptible plant or variety.
- Self-crossing or “self-pollination” or “selfmg” is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
- SNP single nucleotide polymorphism
- A, T, C, or G single nucleotide sequence
- SNP markers exist when SNPs are mapped to sites on the soybean genome.
- yield refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
- an "isolated” or “purified” polynucleotide or polypeptide, or biologically active portion thereof is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment.
- an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived.
- the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived.
- a polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%>, 10%), 5%o, or 1%) (by dry weight) of contaminating protein, culture media or other chemical components.
- Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook”).
- Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode.
- the method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with resistance to soybean cyst nematode.
- marker loci associated with soybean cyst nematode resistance that have been identified and mapped to genomic loci on linkage groups Dlb, B2, Bl, C2, E, CI, D2, and L. These genomic regions represent both major and minor QTLs associated with soybean cyst nematode resistance.
- soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with resistance or improved resistance to soybean cyst nematode.
- it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with resistance for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Sat_123 and about marker Satt453 on linkage group Bl .
- the marker locus comprises one or more of S04196-1-B, S04938-1- A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a closely linked marker.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Sat_207 and about marker Satt713 on linkage group CI .
- the marker locus comprises S07162-1-Q1, or a closely linked marker.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are between about marker Satt574 and about marker Satt615 on linkage group D2.
- the marker locus comprises S07161-1-Q1, or a closely linked marker.
- Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Table 1 and Table 9 and Figures 1, 2, 3, 4, 5, 6, 7, 8 and 9.
- Table 1 Marker Positions For Marker Loci Associated With Resistance to Soybean Cyst
- multiple marker loci that collectively make up the soybean cyst nematode resistance haplotype of interest are investigated.
- 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a soybean cyst nematode resistance haplotype.
- the haplotype comprises: (a) two or more marker loci found between about marker Sat_123 and about marker Satt453 on linkage group Bl; (b) two or more marker loci comprising S04196-1- B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (c) two or more marker loci between about marker Sat_207 and about marker Satt713 on linkage group CI; and/or (d) two or more marker loci between about marker Satt574 and about marker Satt615 on linkage group D2.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are in an interval flanked by and including marker locus S00875 and about marker S02621 on linkage group Dlb.
- the marker locus is in an interval flanked by and including S00479 and S02136.
- the marker is within 30 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S 12962, S00144, S08166, S08177, SO 1081, and S02621.
- the marker is within 10 cM of one or more of S00479, S02136, S00875, S12875, S12950, S12947, S12933, S12853, S03246, S01519, S12962, S00144, S08166, S08177, S01081, and S02621.
- the marker locus comprises one or more of S01519-1-A; S08177-1-Q1; S00479-1-A; S02136-1-A; S00875-1-A; S12875-1-Q1; S12950-1-Q1; S12947-1-Q1; S12933-1-Q1; S12853-1-Q1; S03246-1-A or S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, and S02621-1-A, or a marker closely linked thereto.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode are in an interval flanked by and including Sat_264 and about BARC-020449-04623 on linkage group B2. In some examples one or more loci are in an interval flanked by and including S02874 and S04785- on linkage group B2. In some examples, the marker is within 30 cM of one or more of S02864 and S04785. In some examples, the marker is within 10 cM of one or more of S02864 and S04785. In a specific embodiment, the marker locus comprises S02874-1-A, S04785-1-A,or a marker closely linked thereto.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval flanked by and including S04348 and SO 1999 on linkage group Bl are within 30 cM of one or more of S04348, S01209, or SO 1999. In some examples, the marker is within 10 cM of one or more of S04348, S01209, or S01999. In a specific embodiment, the marker locus comprises S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval flanked by and including SO 1209 and SO 1999 on linkage group Bl In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode associated with one or more marker locus selected from the group consisting of S04937- 2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1- Ql, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1- Ql, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, S06792-1-Q1.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst in an interval flanked by and including Satt557 and Satt307 on linkage group C2.
- the interval is flanked by and includes S03252 and S02112 on linkage group C2.
- the marker is within 30 cM of one or more of S03252 or S02112.
- the marker is within 10 cM of one or more of S03252 or S02112.
- the marker locus comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval comprising the bottom 30 cM of linkage group E for example from about 66 cM to the end.
- the interval is flanked by and includes BARC-062799- 18070 to the end of linkage group E.
- the interval is flanked by and includes Sat_107 to the end of linkage group E.
- the interval is flanked by and includes S00350 to S02183 on linkage group E.
- the marker is within 30 cM of one or more of S00350 or S02183.
- the marker is within 10 cM of one or more of S00350 or S02183.
- the marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto.
- marker loci useful for identifying a first soybean plant or first soybean germplasm that displays improved resistance to soybean cyst nematode in an interval comprising the top 30 cM of linkage group L for example from about 0-30 cM.
- the interval is flanked by and comprises S02074 and S03991 on linkage group L.
- the marker is within 30 cM of one or more of S02074 or S03991.
- the marker is within 10 cM of one or more of S02074 or S03991.
- the marker locus comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
- Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Table 1 and 9 and Figures 1, 2, 3, 4, 5, 6, 7, 8 and 9.
- multiple marker loci that collectively make up the soybean cyst nematode resistance haplotype of interest are investigated.
- 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a soybean cyst nematode resistance haplotype.
- the haplotype comprises: (a) two or more marker locus flanked by and including S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of
- S04348, S01209, or S01999 on linkage group Bl (c) two or more marker locus within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) two or more marker locus comprising S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto on linkage group Bl; (e) two or more marker locus flanked by and including SO 1209 and SO 1999 on linkage group Bl; (f) two or more marker locus selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938- 2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1- Ql, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1,
- the method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the resistance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
- two or more marker loci or haplotypes can collectively make up a marker profile.
- the marker profile can comprise any two or more marker loci comprising: (a) any marker loci between about marker Sat_123 and about marker Satt453 on linkage group Bl; (b) marker loci comprising S04196-1-B, S04938-1-A, S04937-1- Ql, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (c) any marker loci between about marker Sat_207 and about marker Satt713 on linkage group CI; (d) marker loci comprising S07162-1-Q1 on linkage group CI, or a closely linked marker; (e) any marker loci between about marker Satt574 and about marker Satt615 on linkage group D2;
- marker loci comprising S07161-1-Q1 on linkage group D2, or a closely linked marker
- marker loci comprising S07160-1 on linkage group A2, or a closely linked marker
- marker loci comprising S07160-1 on linkage group A2, or a closely linked marker
- any marker loci associated with the rhg4 locus on linkage group A2 any marker loci associated with the rhgl locus on linkage group G, or a closely linked marker
- marker loci associated with the rhg2 locus on linkage group M and/or (k) any marker loci associated with resistance to soybean cyst nematode.
- two or more marker loci or haplotypes can collectively make up a marker profile.
- the marker profile can comprise any two or more marker loci comprising: (a) two or more marker locus flanked by and including S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) two or more marker locus within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) two or more marker locus comprising S04348-1-A, S01209-1-A, S01999-1-A, or a marker closely linked thereto on linkage group Bl; (e) two or more marker locus flanked by and including SO 1209 and SO 1999 on linkage group Bl; (f) two or more marker locus selected from the group consisting of S04937-2-A, S04937-1-
- the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with resistance to soybean cyst nematode provided herein.
- a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the resistance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein.
- soybean markers In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org.
- identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with resistance (or susceptibility) is determined for the particular germplasm under study.
- methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
- the method of identifying comprises detecting at least one marker locus associated with resistance to soybean cyst nematode.
- the term "associated with" in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype.
- an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
- Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays improved resistance to soybean cyst nematode. Any one marker locus or any combination of the markers set forth in Table 1 and 9 or Figures 1, 2, 3, 4, 5, 6, 7, 8 or 9, or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with improved resistance to soybean cyst nematode.
- a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or first soybean germplasm an allele of at least one marker locus that is associated with resistance.
- the at least one marker locus can be between about marker Sat_123 and about marker Satt453 on linkage group Bl;
- (B) can comprise one or more of the marker loci S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343- 1-Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker;
- C can be between about marker Sat_207 and about marker Satt713 on linkage group CI;
- (D) can comprise the marker locus S07162-1-Q1, or a closely linked marker;
- (E) can be between about marker Satt574 and about marker Satt615 on linkage group D2; and/or
- (F) can comprise the marker locus S07161-1-Q1, or a closely linked marker.
- a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with resistance.
- the at least one marker locus (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, SO 1209, or SO 1999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1
- two or more marker loci are detected in the method.
- the germplasm is a soybean variety.
- the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
- the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
- the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated soybean cyst nematode resistance alleles encompassed by the methods provided herein include, for example, those listed in Table 1 and 9 and Figures 1, 2, 3, 4, 5, 6, 7 , 8 and 9.
- the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon.
- amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is
- the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
- the method involves amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or variants or fragments thereof.
- the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
- the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,
- the primer pair comprises SEQ ID NO: l and SEQ ID NO:2, SEQ ID NO: 8 and SEQ ID NO:9, SEQ ID NO: 10 and SEQ ID NO: 13, SEQ ID NO: 18 and SEQ ID NO: 19, SEQ ID NO: 31 and SEQ ID NO:32, SEQ ID NO: 39 and SEQ ID NO:40, SEQ ID NO: 50 and SEQ ID NO:51, SEQ ID NO: 64 and SEQ ID NO:65, SEQ ID NO: 66 and SEQ ID NO:67, SEQ ID NO: 72 and SEQ ID NO:73, or SEQ ID NO: 82 and SEQ ID NO: 83 or the primer pairs set forth in Table 3.
- the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
- the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
- the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
- the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314,
- Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4, 5, 6, 7, and 8.
- Table 2 Non-Limiting Examples of Primer Sequences.
- GGTTAGATACAGTTGAATTGCCTTAAAGTCAAAATTTCCACAAG : :AC: : : AACA
- the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein.
- sequencing refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A.N, et al. (2012) American Journal of Botany 99(2): 175- 185;
- NGS Next Generation Sequencing
- genotyping by sequencing (GBS) methods for example, as described in Elshire, R.J., et al. (2011) PLoS ONE 6(5):el9379; Molecular Inversion Probe (MIP) genotyping, as described, for example, in Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673- 678; or high throughput genotyping by whole-genome resequencing, as described, for example in Huang, X et al., (2009) Genome Research 19: 1068-1076.
- GGS sequencing
- MIP Molecular Inversion Probe
- fragment is intended a portion of the polynucleotide.
- a fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-158 as long as it is capable of amplifying and/or detecting the marker locus of interest.
- sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof.
- equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
- Traits or markers are considered to be linked if they co-segregate.
- a 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM).
- Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g. , such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time.
- Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%), 0.5%), or 0.25%> or less.
- cM centimorgans
- Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about lOcM of a closely linked marker).
- a closely linked marker is within lOcM, 9cM, 8cM, 7cM, 6cM, 5cM, 4cM, 3cM, 2cM or lcM of any given marker disclosed herein.
- a marker associated with one of the markers disclosed herein can be within 75Kb, 60Kb, 50Kb, 40Kb, 30Kb, 20K, 10Kb, 5Kb or less of the disclosed marker.
- closely linked loci co-segregate at least about 90% of the time. Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci. Typically, the region is assumed to have a euchromatin structure during initial evaluations. However, some regions, such are regions closer to centrosomes, have a heterochromatin structure. Without further information, the predicted physical distance between genetic map positions is based on the assumption that the region is euchromatic, however if the region comprises heterochromatin the markers may be physically closer together. With regard to physical position on a chromosome, closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000
- nucleotides about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
- coupling phase linkage indicates the state where the "favorable” allele at the resistance locus is physically associated on the same chromosome strand as the "favorable” allele of the respective linked marker locus.
- both favorable alleles are inherited together by progeny that inherit that chromosome strand.
- the "favorable” allele at the locus of interest e.g., a QTL for resistance
- the two "favorable” alleles are not inherited together (i.e., the two loci are "out of phase” with each other).
- Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co- segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait.
- Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies.
- one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like.
- a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21 :673-678).
- the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GBS) may be used.
- a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GBS) may be used.
- GGS genotyping-by-sequencing
- no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11 :31-46; and, Egan et al.
- sequencing by synthesis e.g., Roche 454 pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or Proton systems
- sequencing by ligation e.g., SOLiD from Applied Biosystems, and Polnator system from Azco Biotech
- SOMiD single molecule sequencing
- SMS single molecule sequencing
- Further technologies include optical sequencing systems (e.g., Starlight from Life Technologies), and nanopore sequencing (e.g., GridlON from Oxford Nanopore Technologies).
- Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:el9379), and expression methods.
- no reference genome sequence is needed in order to complete the analysis.
- MAS marker assisted selection
- soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with soybean cyst nematode resistance, without actually raising soybean and measuring for resistance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with resistance).
- MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines).
- MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
- the molecular markers or marker loci are detected using a suitable amplification-based detection method.
- nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region.
- nucleic acid probes that bind to the amplified region are also employed.
- synthetic methods for making oligonucleotides, including primers and probes are well known in the art.
- oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22: 1859-1862, e.g., using a commercially available automated synthesizer, e.g. , as described in Needham- VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168.
- Oligonucleotides, including modified oligonucleotides can also be ordered from a variety of commercial sources known to persons of skill in the art.
- suitable primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe.
- primers can be designed using any suitable software program, such as LASERGENE ® or Primer3.
- primers be limited to generating an amplicon of any particular size.
- the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus.
- marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
- Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and 3 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176,
- PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g. , those comprising marker loci), facilitating detection of the markers.
- nucleic acids of interest e.g. , those comprising marker loci
- Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al (1987) U.S. Patent No. 4,683,202; Arnheim & Levinson (October 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173; Guatelli, et al, (1990) Proc. Natl. Acad. Sci.
- nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci.
- Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided.
- exemplary primers and probes are provided in SEQ ID NOS: 1-110 and in Tables 2 and 4, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 135-158 and in Table 6.
- Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in Table 8.
- exemplary primers and probes are provided in SEQ ID NOS: 159-248 and in Tables 3 and 5, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 339-337 and in Table 7.
- primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci.
- the precise probe to be used for detection can vary, e.g. , any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein.
- the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
- probes will possess a detectable label. Any suitable label can be used with a probe.
- Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means.
- Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels.
- Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes.
- a probe can also constitute radiolabeled PCR primers that are used to generate a radiolabeled amplicon.
- Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene OR); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene OR).
- Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqManTM probes.
- the reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3' carbon or terminal 5' carbon.
- the quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching.
- Non- fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
- reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971 , the content of which is incorporated herein by reference. Examples of modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland,
- reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the
- naphthylamines having an amino group in the alpha or beta position. Included among such naphthylamino compounds are l-dimethylaminonaphthyl-5 sulfonate, l-anilino-8- naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate.
- Other dyes include 3- phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2- benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like.
- the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art.
- Suitable examples of reporters may be selected from dyes such as SYBR green, 5- carboxyfluorescein (5-FAMTM available from Applied Biosystems of Foster City, Calif), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy- 4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy- 2',4,7,7'-tetrachlorofluorescein (6-TETTM available from Applied Biosystems), carboxy- X-rhodamine (ROX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (6-JOETM available from Applied Biosystems), VICTM dye products available from Molecular Probes, Inc., NEDTM dye products available from Applied Biosystems, and the like. Suitable examples of quenchers may be
- TAMRA TAMRA
- BHQ-0TM BHQ-1TM
- BHQ-2TM BHQ-3TM
- QSY-7TM QSY-9TM
- QSY-21TM QSY-35TM
- Molecular Probes, Inc. and the like.
- a molecular beacon is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure.
- the MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher. Under conditions where the MB does not display intra-molecular hybridization (e.g.
- MB label when bound to a target nucleic acid, such as to a region of an amplicon during amplification), the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res.
- Another real-time detection method is the 5'-exonuclease detection method, also called the TaqManTM assay, as set forth in U.S. Patent Nos. 5,804,375; 5,538,848;
- a modified probe typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair.
- the modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal.
- the intrinsic 5' to 3' nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted.
- the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
- the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases.
- the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter- quencher pair to the 5' end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3' end of the probe.
- Separate detection probes can also be omitted in amplification/detection methods, e.g. , by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamp lifted precursors (e.g. , by fluorescence polarization).
- amplification is not a requirement for marker detection—for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA.
- Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular Cloning - A Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2000 (“Sambrook”); Current Protocols in Molecular Biology, F.M.
- ASH technology is based on the stable annealing of a short, single- stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe.
- two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences.
- Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
- Real-time amplification assays including MB or TaqManTM based assays, are especially useful for detecting SNP alleles.
- probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, "A" or "C,” then one probe is designed with an "A" at the SNP position, while a separate probe is designed with a "C” at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be.
- the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases.
- the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes.
- a different detectable label for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe.
- each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3' end and either the 6-FAM (6- carboxyfluorescein) or VIC (4,7,2'-trichloro-7'-phenyl-6-carboxyfluorescein) fluorophore at the 5 ' end.
- a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus.
- detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed.
- 6-FAM- and VIC-labeled probes the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured.
- a sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence.
- KASPar® and Illumina® Detection Systems are additional examples of commercially-available marker detection systems.
- KASPar® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with soybean cyst nematode resistance).
- Illumina® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The Illumina® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
- Introgression of soybean cyst nematode resistance into non-tolerant or less- tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains soybean cyst nematode resistance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such resistance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm.
- progeny germplasm are screened to determine the presence of soybean cyst nematode resistance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of resistance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
- MAS One application of MAS is to use the resistance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a resistance trait into a desired (typically high yielding) background.
- marker assisted backcrossing of specific markers from a donor source e.g., to an elite genetic background
- markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (resistance, along with any other available markers for yield, disease resistance, etc.).
- Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance.
- the number of alleles associated with resistance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
- any of the marker loci provided herein can be introduced into a soybean line having one or more of the soybean cyst nematode resistance alleles rhgl, rhgl, rhg3, rhg or rhg5.
- any one or more of the marker loci provided herein can be stacked with the rhgl allele.
- any one or more of the marker loci provided herein can be stacked with the rhg allele.
- any one or more of the marker loci provided herein can be stacked with the rhgl and rhg alleles.
- any of the marker loci provided herein can be introduced into a soybean line having one or more of the soybean cyst nematode resistance loci rhgl, rhgl, rhg3 or rhg5.
- any one or more of the marker loci provided herein can be stacked with the rhgl locus.
- any one or more of the marker loci provided herein can be stacked with the rhgl locus.
- any one or more of the marker loci provided herein can be stacked with the rhgl and rhgl loci.
- This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se.
- the method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art.
- Such soybean plant progeny can be assayed for alleles associated with resistance and, thereby, the desired progeny selected.
- Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding.
- At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
- a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired resistance can be traced.
- the number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
- MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
- markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving elite x exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the resistance marker alleles herein.
- transgenic approaches can also be used to create transgenic plants with the desired traits.
- exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm.
- a nucleic acid that codes for a resistance trait is cloned, e.g. , via positional cloning, and introduced into a target plant or germplasm.
- plant breeder recognizes "resistant” and “non-resistant” or “susceptible” soybean plants.
- plant resistance is a phenotypic spectrum consisting of extremes in resistance and susceptibility, as well as a continuum of intermediate resistance phenotypes. Evaluation of these intermediate phenotypes using reproducible assays are of value to scientists who seek to identify genetic loci that impart resistance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a resistance trait into an elite soybean line, for example.
- improved resistance is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to soybean cyst nematode. That is, the damage caused by soybean cyst nematode is prevented, or alternatively, the disease symptoms caused by soybean cyst nematode is minimized or lessened.
- improved resistance to soybean cyst nematode can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%), or at least about 50%> to about 90%> or greater.
- the methods provided herein can be utilized to protect plants from soybean cyst nematode.
- soybean cyst nematode resistance can be determined by visual observations after plant exposure to a particular race of soybean cyst nematode, such as race 1, 2, 3, 5 or 14. Scores range from 1 to 9 and indicate visual observations of resistance as compared to other genotypes in the test. A score of 1 indicates soybean cyst nematode are able to infect the plant and cause yield loss, while a score of 9 indicates soybean cyst nematode resistance. Preliminary scores are reported as double digits, for example, '55' indicates a preliminary score of 5 on the scale of 1 to 9.
- Non-limiting examples of soybean cyst nematode resistance phenotypic screening are described in detail below.
- E2 Eggs or second stage juveniles (J2) are used to inoculate host plants to increase their population. Soybean cyst nematode infestation requires a minimum 35 days before the cysts reach maturity and can be used to inoculate soybean experiments. Cyst eggs/J2 inoculant is harvested through a series of washings, grindings, and screenings. Screens are used progressing from larger to smaller sizes, ending with a #500 (25 ⁇ ) screen.
- Soybean plants are grown in cones.
- Cones are long containers approximately 12 inches long and 1.5 inches in diameter at the top ⁇ e.g., Ray Leach Cone-tainersTM).
- the cone is designed to easily remove the root mass.
- an inoculum channel is made in the cone containing the experimental line by poking a 4 inch hole with a 10 ml pipette tip.
- One ml of inoculum is dispensed into the channel.
- the plants are watered manually for the duration of the test, with watering being moderately light during the first 3-5 days until J2 infects the roots. Plants are scored approximately 28-35 days following inoculation when cyst reproduction on susceptible checks is sufficiently high.
- Plants are removed from their cones and the soil is removed from the roots by gently dipping the roots into a bucket of water.
- the plants are screened to identify native resistance to one or more of the five races of soybean cyst nematode inoculated using a combination of three methods (1) visual 9-6-1 score; (2) visual full count; and/or (3) microscope count score depending on the stage of the line when screened.
- lines earlier in the development cycle (R1-R2) are screened by the visual 9-6-1 method
- lines that have progressed to later development phases (R3-R5) are screened by the visual full count and/or microscope count method(s) .
- One typical phenotyping method is a visual evaluation of the roots. Susceptible checks are first evaluated for the development of cysts on the root system. These counts are recorded and averaged across the experiment to determine the susceptible (SUS) check average. Roots from the test plants are then scored based on a comparison with the average of the susceptible checks as follows:
- FI female index
- Cysts counts for soybean cyst nematode assays for checks and experimental line are determined by washing cysts from roots and counting the number of cysts under the microscope.
- roots from the susceptible check controls are examined for yellow cysts to assess whether to begin the process of evaluating the test.
- Experimental lines are compared with known standard checks. Once adequate levels of cysts are detected on the check varieties, plants from the test lines are removed from cones one at a time. Soil is removed from roots by gently dipping the roots into a bucket of water. The root tissue is placed on a 850 micron (#20) pore sieve stacked over a 250 micron (#60) pore sieve and sprayed with a jet of water to dislodge cysts from the roots. Collected cysts are rinsed from the #60 sieve into a clean labeled cup using no more than 30 mis of additional water.
- each sample is counted using a gridded counting dish under a stereo microscope. The number of cysts counted are recorded for each sample. Cyst counts on the test plants are converted to the 1-9 scoring scale based on the female index (FI) described above.
- Table 10 Exemplary soybean cyst nematode checks.
- kit refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the
- a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprises (a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) between about marker Sat_123 and about marker Satt453 on linkage group Bl; (ii) between about marker Sat_207 and about marker Satt713 on linkage group CI; or (iii) between about marker Satt574 and about marker Satt615 on linkage group D2; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted resistance to soybean cyst nematode.
- the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 on linkage group Bl, or a closely linked marker; (b) S07162-1-Q1 on linkage group CI, or a closely linked marker; or (c) S07161-1-Q1 on linkage group D2, or a closely linked marker.
- a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprises (I) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on
- the primers and probes of the kit are capable of detecting a marker locus comprising a marker that: (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (d) comprises S04348-1-A, S01209-1- A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1,
- a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with resistance to soybean cyst nematode, for instance a favorable marker locus, haplotype or marker profile.
- These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g., using any available allele detection format, such as solid or liquid phase array based detection, microfluidic- based sample detection, etc.
- the systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
- a typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
- a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
- signal detection apparatus including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo- scans, microfluidic nucleic acid amplification detection appliances and the like.
- the precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used.
- Typical detector examples include light (e.g. , fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele. The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to "real time" amplification assay results.
- light e.g. , fluorescence
- radioactivity detectors e.g., detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of
- System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted resistance are also provided.
- the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted resistance.
- the precise form of the instructions can vary depending on the components of the system, e.g. , they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g. , computers or computer readable media) operably coupled to the detector.
- the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted resistance.
- the instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
- isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein.
- the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising S04196-1-B, S04938-1-A, S04937-1-Q1 , S08344-1-Q1 , S08343-1-Q1 , S08346-1-Q1 , S06786-1 , S06787-1 , S06803-1 , S04197-1 , S07162-1-Q1 , S07162-1-Q1 , or a marker closely linked thereto.
- the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising a marker locus (a) is flanked by S04348 and SO 1999 on linkage group Bl; (b) two or more marker locus within 30 cM of one or more of S04348, S01209, or S01999 on linkage group Bl; (c) is within 10 cM of one or more of S04348, SO 1209, or SO 1999 on linkage group Bl; (d) comprises S04348-1-A, SO 1209-1 -A, SO 1999-1 -A, or a marker closely linked thereto on linkage group Bl; (e) is flanked by SO 1209 and SO 1999 on linkage group Bl; (f) is selected from the group consisting of S04937-2-A,
- the isolated polynucleotide comprises: (a) a
- polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187
- the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to soybean cyst nematode, for instance to particular SNPs that comprise a marker locus, haplotype or marker pro file .
- a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions.
- polynucleotide is said to be the "complement” of another polynucleotide if they exhibit complementarity.
- molecules are said to exhibit "complete
- nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other.
- Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency” conditions.
- the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency” conditions.
- stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
- wash buffers may comprise about 0.1%> to about 1%> SDS.
- Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
- the duration of the wash time will be at least a length of time sufficient to reach equilibrium.
- a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
- the at least one marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
- the at least one marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI; or
- the at least one marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2.
- the at least one marker locus of part (a) comprises S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1-Q1, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto.
- the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
- amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template;
- said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, or complements thereof.
- said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154 or complements thereof.
- the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105 or 106.
- An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S04196-1-B, S04938-1-A, S04937-1-Q1, S08344-1-Q1, S08343-1- Ql, S08346-1-Q1, S06786-1, S06787-1, S06803-1, S04197-1 or a marker closely linked thereto.
- a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or 71;
- An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S07161-1-Q1 or a marker closely linked thereto.
- kits for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprising: a) primers or probes for detecting one or more marker loci associated with resistance to soybean cyst nematode, wherein the primers or probes are capable of detecting a marker locus, wherein:
- the marker locus is between about marker Sat_123 and about marker Satt453 on linkage group Bl;
- the marker locus is between about marker Sat_207 and about marker Satt713 on linkage group CI;
- the marker locus is between about marker Satt574 and about marker Satt615 on linkage group D2;
- kits of embodiment 40, wherein the primers or probes are capable of detecting a marker locus comprising
- a method of identifying a first soybean plant or a first soybean germplasm that displays improved resistance to soybean cyst nematode comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the resistance, wherein:
- the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
- the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
- the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
- the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2; (e) the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
- the at least one marker locus is flanked by marker locus SO 1209 and SO 1999 on linkage group Bl;
- the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
- the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2; or,
- the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or,
- the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L.
- the at least one marker locus of part (a) comprises S01519-1-A, S08177-1-Q1, S00479-1-A, S02136-1-A, S00875-1-A, S12875- 1-Ql, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1- Ql S00144-1-A, S08166- 1-Ql, SO 1081, and, S02621-1 -A or a marker closely linked thereto.
- the at least one marker locus of part (f) comprises S04937-2-A, S04937-1-Q1, S04938-1-A, S04938-2-A, S06786-2-Q1, S06786- 3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1-Q1, S06803-1-Q1, S06804-1-Q1, S06788- 1-Ql, S06805-1-Q1, S06789-1-Q1, S06790-1-Q1, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto.
- the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
- amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template;
- said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, and/or 377 or complements thereof.
- said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 24
- said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350,
- the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 3
- S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, S02621-1-A or a marker closely linked thereto;
- polynucleotide having at least 90% sequence identity to the polynucleotides set forth in part (a); or (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in part (a).
- a kit for detecting or selecting at least one soybean plant or soybean germplasm with improved resistance to soybean cyst nematode comprising:
- a primer or a probe for detecting one or more marker loci associated with resistance to soybean cyst nematode wherein the primer or probe are capable of detecting a marker locus, wherein:
- the at least one marker locus is flanked by marker locus S00875 and S02621 on linkage group Dlb;
- the at least one marker locus is flanked by marker locus S00479 and S02136 on linkage group Dlb;
- the at least one marker locus is flanked by marker locus Sat_264 and BARC-020449-04623 on linkage group B2;
- the at least one marker locus is flanked by marker locus S02874 and S04785 on linkage group B2;
- the at least one marker locus is flanked by marker locus S04348 and SO 1999 on linkage group Bl;
- the at least one marker locus is flanked by marker locus SO 1209 and SO 1999 on linkage group Bl;
- the at least one marker locus is flanked by marker locus Satt557 and Satt307 on linkage group C2;
- the at least one marker locus is flanked by marker locus S03252 and S02112 on linkage group C2; or,
- the at least one marker locus comprises S00350-1-A, S02183-1-A, or a marker closely linked thereto; or,
- the at least one marker locus is flanked by marker locus S02074 and S03991 on linkage group L;
- the at least one marker locus comprises S01519-1-A, S08177-1-Q1, S00479-1- A, S02136-1-A, S00875-1-A, S12875-1-Q1, S12950-1-Q1, S12947-1-Q1, S12933-1-Q1, S12853-1-Q1, S03246-1-A, S12962-1-Q1 S00144-1-A, S08166-1-Q1, S01081, S02621- 1-A or a marker closely linked thereto;
- the at least one marker locus comprises S02874-1-A, S04785-1-A, or a marker closely linked thereto;
- the at least one marker locus comprises S04348-1-A, S01209-1-A, S01999-1- A, or a marker closely linked thereto;
- the at least one marker locus comprises S04937-2-A, S04937-1-Q1, S04938-1- A, S04938-2-A, S06786-2-Q1, S06786-3-Q1, S06786-1-Q1, S06787-2-Q1, S06787-1- Ql, S06803-1-Q1, S06804-1-Q1, S06788-1-Q1, S06805-1-Q1, S06789-1-Q1, S06790-1- Ql, S06791-2-Q1, S06791-1-Q1, or S06792-1-Qlor a marker closely linked thereto;
- the at least one marker locus of part (g) comprises S03252-1-A, S02112-1 -A, or a marker closely linked thereto.
- the at least one marker locus of part (j) comprises S02074-1-A, S03991-1-A, or a marker closely linked thereto.
- Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the SCN loci on linkage groups Bl, CI and D2. Markers were screened against various known resistant and susceptible parents. During development, these markers were validated and confirmed against a panel of 31 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines.
- markers were validated against the panel of SCN resistant or susceptible varieties described above.
- the markers are capable of detecting SCN loci likely derived from one or more of PI88788, Peking, PI437654, as well markers from other sources.
- markers can be used in other assays or with other assay conditions. Some markers were assayed under additional conditions, an example of which is summarized below.
- the parameters used for the TaqMan assay are as follows in Table 12 and 13.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112015014632-5A BR112015014632B1 (en) | 2012-12-21 | 2013-12-19 | IDENTIFICATION METHOD |
| CA2893847A CA2893847C (en) | 2012-12-21 | 2013-12-19 | Genetic loci associated with soybean cyst nematode resistance and methods of use |
| ZA2015/03510A ZA201503510B (en) | 2012-12-21 | 2015-05-19 | Genetic loci associated with soybean cyst nematode resistance and methods of use |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261745002P | 2012-12-21 | 2012-12-21 | |
| US61/745,002 | 2012-12-21 | ||
| US13/786,948 | 2013-03-06 | ||
| US13/786,948 US9464330B2 (en) | 2012-12-21 | 2013-03-06 | Genetic loci associated with soybean cyst nematode resistance and methods of use |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014100346A1 true WO2014100346A1 (en) | 2014-06-26 |
Family
ID=50976403
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/076414 Ceased WO2014100346A1 (en) | 2012-12-21 | 2013-12-19 | Genetic loci associated with soybean cyst nematode resistance and methods of use |
Country Status (5)
| Country | Link |
|---|---|
| US (2) | US9464330B2 (en) |
| AR (1) | AR094235A1 (en) |
| BR (1) | BR112015014632B1 (en) |
| WO (1) | WO2014100346A1 (en) |
| ZA (1) | ZA201503510B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9464330B2 (en) | 2012-12-21 | 2016-10-11 | Pioneer Hi-Bred International, Inc. | Genetic loci associated with soybean cyst nematode resistance and methods of use |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11180795B1 (en) | 2015-06-02 | 2021-11-23 | Syngenta Participations Ag | Nematode resistance alleles in soybean |
| US20220056470A1 (en) | 2020-08-18 | 2022-02-24 | Pioneer Hi-Bred International, Inc. | Multiple disease resistance genes and genomic stacks thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999031964A1 (en) * | 1997-12-19 | 1999-07-01 | Pioneer Hi-Bred International, Inc. | Nucleotide polymorphisms in soybean |
| US20040031072A1 (en) * | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| WO2005075685A1 (en) * | 2004-02-02 | 2005-08-18 | Nestec S.A. | Genes associated with canine osteoarthritis and related methods and compositions |
| US20070083945A1 (en) * | 2000-03-10 | 2007-04-12 | Byrum Joseph R | Nucleic acid molecules and other molecules associated with plants |
| US20120278953A1 (en) * | 1995-10-24 | 2012-11-01 | Pioneer Hi-Bred International, Inc | Quantitative Trait Loci Associated With Soybean Cyst Nematode Resistance and Uses Thereof |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6162967A (en) | 1994-01-26 | 2000-12-19 | Pioneer Hi-Bred International, Inc. | Positional cloning of soybean cyst nematode resistance genes |
| US5491081A (en) | 1994-01-26 | 1996-02-13 | Pioneer Hi-Bred International, Inc. | Soybean cyst nematode resistant soybeans and methods of breeding and identifying resistant plants |
| CA2192920A1 (en) | 1995-12-15 | 1997-06-16 | Richard A. Vierling | Methods for conferring broad-based soybean cyst nematode resistance to asoybean line |
| US6300541B1 (en) | 1997-01-14 | 2001-10-09 | Southern Illinois University | Soybean sudden death syndrome resistant soybeans, soybean cyst nematode resistant soybeans and methods of breeding and identifying resistant plants |
| BRPI0107440B1 (en) | 2000-01-07 | 2018-02-27 | Monsanto Technology Llc | METHODS FOR SELECTION OF SOYBEAN PLANT HAVING RHG1-RESISTANT NEMATODE ALELO |
| CA2331674A1 (en) | 2000-01-28 | 2001-07-28 | Southern Illinois University | Isolated polynucleotides and polypeptides relating to loci underlying resistance to soybean cyst nematode and soybean sudden death syndrome and methods employing same |
| EP2222154A1 (en) * | 2007-10-12 | 2010-09-01 | Monsanto Technology LLC | Methods and compositions for high yielding soybeans with nematode resistance |
| US8692064B2 (en) * | 2009-10-02 | 2014-04-08 | The Curators Of The University Of Missouri | Quantitative trait loci associated with soybean cyst nematode resistance and methods of their use |
| US9464330B2 (en) | 2012-12-21 | 2016-10-11 | Pioneer Hi-Bred International, Inc. | Genetic loci associated with soybean cyst nematode resistance and methods of use |
-
2013
- 2013-03-06 US US13/786,948 patent/US9464330B2/en active Active
- 2013-12-19 BR BR112015014632-5A patent/BR112015014632B1/en not_active IP Right Cessation
- 2013-12-19 WO PCT/US2013/076414 patent/WO2014100346A1/en not_active Ceased
- 2013-12-20 AR ARP130104972A patent/AR094235A1/en active IP Right Grant
-
2015
- 2015-05-19 ZA ZA2015/03510A patent/ZA201503510B/en unknown
-
2016
- 2016-09-09 US US15/260,627 patent/US20160376668A1/en not_active Abandoned
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120278953A1 (en) * | 1995-10-24 | 2012-11-01 | Pioneer Hi-Bred International, Inc | Quantitative Trait Loci Associated With Soybean Cyst Nematode Resistance and Uses Thereof |
| WO1999031964A1 (en) * | 1997-12-19 | 1999-07-01 | Pioneer Hi-Bred International, Inc. | Nucleotide polymorphisms in soybean |
| US20040031072A1 (en) * | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| US20070083945A1 (en) * | 2000-03-10 | 2007-04-12 | Byrum Joseph R | Nucleic acid molecules and other molecules associated with plants |
| WO2005075685A1 (en) * | 2004-02-02 | 2005-08-18 | Nestec S.A. | Genes associated with canine osteoarthritis and related methods and compositions |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9464330B2 (en) | 2012-12-21 | 2016-10-11 | Pioneer Hi-Bred International, Inc. | Genetic loci associated with soybean cyst nematode resistance and methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160376668A1 (en) | 2016-12-29 |
| US20140182009A1 (en) | 2014-06-26 |
| US9464330B2 (en) | 2016-10-11 |
| CA2893847A1 (en) | 2014-06-26 |
| BR112015014632B1 (en) | 2022-10-18 |
| AR094235A1 (en) | 2015-07-22 |
| BR112015014632A2 (en) | 2017-07-11 |
| ZA201503510B (en) | 2016-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2013188612A1 (en) | Genetic loci associated with soybean cyst nematode resistance and methods of use | |
| US9994920B2 (en) | Genetic loci associated with soybean cyst nematode resistance and methods of use | |
| US20170022575A1 (en) | Genetic loci associated with phytophthora tolerance in soybean and methods of use | |
| US11319599B2 (en) | Genetic loci associated with reproductive growth phenotypes in soybean and methods of use | |
| US20120174246A1 (en) | Methods of identifying aphid resistant soybeans | |
| US20160376668A1 (en) | Genetic loci associated with soybean cyst nematode resistance and methods of use | |
| US10017829B2 (en) | Genetic loci associated with Frogeye Leaf Spot resistance and Brown Stem Rot resistance and methods of use | |
| CA2845522C (en) | Molecular markers associated with soybean root-knot nematode tolerance and methods of their use | |
| US11357185B2 (en) | Polynucleotides and kits associated with soybean iron deficiency tolerance and methods of detection and breeding | |
| US20160150749A1 (en) | Rag-based selection methods for improving aphid resistance in soybeans | |
| US20170298452A1 (en) | Carlavirus tolerant soybeans and methods of use | |
| US20160272997A1 (en) | Stem canker tolerant soybeans and methods of use | |
| US20130061347A1 (en) | Qtl associated with aphid resistance in soybeans and methods of their use | |
| CA2893847C (en) | Genetic loci associated with soybean cyst nematode resistance and methods of use | |
| US20140162250A1 (en) | Marker-assisted selection of tolerance to chloride salt stress |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13866225 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2893847 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13866225 Country of ref document: EP Kind code of ref document: A1 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112015014632 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112015014632 Country of ref document: BR Kind code of ref document: A2 Effective date: 20150618 |


























