US20170022575A1 - Genetic loci associated with phytophthora tolerance in soybean and methods of use - Google Patents

Genetic loci associated with phytophthora tolerance in soybean and methods of use Download PDF

Info

Publication number
US20170022575A1
US20170022575A1 US15/287,940 US201615287940A US2017022575A1 US 20170022575 A1 US20170022575 A1 US 20170022575A1 US 201615287940 A US201615287940 A US 201615287940A US 2017022575 A1 US2017022575 A1 US 2017022575A1
Authority
US
United States
Prior art keywords
rps1k
kingwa
seq
marker
nos
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/287,940
Inventor
Julian M Chaky
Holly J. Jessen
Joshua M. Shendelman
Paul A. Stephens
David M. Webb
John B. Woodward
Meizhu Yang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
Original Assignee
Pioneer Hi Bred International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi Bred International Inc filed Critical Pioneer Hi Bred International Inc
Priority to US15/287,940 priority Critical patent/US20170022575A1/en
Publication of US20170022575A1 publication Critical patent/US20170022575A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/54—Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
    • A01H6/542—Glycine max [soybean]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display tolerance or improved tolerance to Phytophthora infection.
  • sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 20161006_3170USDIV_SeqLst.txt, a creation date of Oct. 6, 2016 and a size of 785 KB.
  • ASCII American Standard Code for Information Interchange
  • sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
  • Soybeans Glycine max L. Merr.
  • Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
  • Phytophthora is a major soybean fungal pathogen that induces stem and root rot in infected plants, causing severe losses in soybean viability and overall yield.
  • Phytophthora root rot is caused by a pathogenic infection of Phytophthora sojae. Resistance to Phytophthora infection is conditioned by naturally occurring variation at the Resistance to Phytophthora sojae (Rps) loci. As races of Phytophthora in the fields shift, previously effective resistance sources are breaking down, causing damage and compromised yields in grower fields.
  • the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
  • FIG. 1 A-C provides a genetic map for loci on linkage group (LG) N.
  • FIG. 2 A-D provides a genetic map for loci on LG F.
  • FIG. 3 A-C provides a genetic map for loci on LG J.
  • FIG. 4 A-E provides a genetic map for loci on LG G.
  • kits comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers.
  • the term “comprising” is intended to include examples encompassed by the terms “consisting essentially of” and “consisting of.” Similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of.”
  • Agronomics refers to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season.
  • Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
  • Allele means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy corresponding loci on a pair of homologous chromosomes. With regard to a SNP marker, allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
  • amplifying in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced.
  • An “amplicon” is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method.
  • An “ancestral line” is a parent line used as a source of genes, e.g., for the development of elite lines.
  • An “ancestral population” is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
  • Backcrossing is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
  • chromosome segment designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome.
  • Chrosome interval refers to a chromosome segment defined by specific flanking marker loci.
  • Crop and “variety” are used synonymously and mean a group of plants within a species (e.g., Glycine max ) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
  • An “elite line” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
  • An “elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
  • an “exotic soybean strain” or an “exotic soybean germplasm” is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm.
  • an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
  • a “genetic map” is a description of genetic association or linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form.
  • Gene is a description of the allelic state at one or more loci.
  • Germplasm means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
  • An individual is “homozygous” if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes).
  • An individual is “heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles).
  • the term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
  • “Introgression” means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
  • label or “detectable label” refer to a molecule capable of detection.
  • a detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqManTM probes.
  • reporter refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher.
  • the detectable signal of the reporter is, e.g., fluorescence in the detectable range.
  • quencher refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter.
  • quenching and “fluorescence energy transfer” refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
  • a “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic).
  • a “subline” refers to an inbred subset of descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are “fixed” or homozygous across most or all loci.
  • soybean varieties are typically produced by aggregating (“bulking”) the self-pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self-pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was heterozygous in the originally selected F3 to F5 plant.
  • Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant.
  • the seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample.
  • seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, tolerance, etc.).
  • Linkage refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage.
  • Linkage disequilibrium is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
  • Linkage group refers to traits or markers that generally co-segregate.
  • a linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
  • “Locus” is a defined segment of DNA.
  • a “map location” or “map position” is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968.
  • a “physical position” or “physical location” or “physical map location” is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463:178-183, available from the Phytozome website (phytozome-dot-net/soybean).
  • Mapping is the process of defining the association and relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
  • Marker or “molecular marker” or “marker locus” is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
  • Marker assisted selection refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
  • Haplotype refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-N are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
  • a “marker profile” means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes.
  • a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
  • plant includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
  • Plant parts means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
  • Polymorphism means a change or difference between two related nucleic acids.
  • a “nucleotide polymorphism” refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
  • Polynucleotide “polynucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” and “oligonucleotide” are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi-stranded, that optionally contains synthetic, non-natural, or altered RNA or DNA nucleotide bases.
  • a DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
  • Primer refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase.
  • primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed.
  • Primers may be provided in double-stranded form, though the single-stranded form is more typically used.
  • a primer can further contain a detectable label, for example a 5′ end label.
  • Probe refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
  • probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed.
  • a probe can further contain a detectable label.
  • Quantitative trait loci or “QTL” refer to the genetic elements controlling a quantitative trait.
  • Recombination frequency is the frequency of a crossing over event (recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
  • tolerant plant and tolerant plant variety are used interchangeably herein and refer to any type of increase in resistance or tolerance to, or any type of decrease in susceptibility.
  • a “tolerant plant” or “tolerant plant variety” need not possess absolute or complete tolerance. Instead, a “tolerant plant,” “tolerant plant variety,” or a plant or plant variety with “improved tolerance” will have a level of resistance or tolerance which is higher than that of a comparable susceptible plant or variety.
  • Self-crossing or “self-pollination” or “selfing” is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
  • SNP single nucleotide polymorphism
  • yield refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
  • an “isolated” or “purified” polynucleotide or polypeptide, or biologically active portion thereof is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment.
  • an “isolated” polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5′ and 3′ ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived.
  • the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived.
  • a polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein culture media or other chemical components.
  • Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter “Sambrook”).
  • Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection.
  • the method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with tolerance to Phytophthora infection.
  • isolated polynucleotides and kits for use in identifying and/or detecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved tolerance to Phytophthora.
  • marker loci associated with tolerance to Phytophthora infection have been identified and mapped to genomic loci on linkage groups F, G, J and N.
  • the marker loci provided herein are associated with various Phytophthora multi-race resistance genes.
  • the marker loci are associated with the Rps1a, Rps1c, Rps1d or Rps1k loci on linkage group N.
  • the marker loci are associated with the Rps2 locus on linkage group J.
  • the marker loci are associated with the Rps3a or Rps3c loci on linkage group F.
  • the marker loci are associated with the Rps6 loci on linkage group G.
  • Marker loci, haplotypes and marker profiles associated with tolerance or improved tolerance to Phytophthora infection are provided. Further provided are genomic loci that are associated with soybean tolerance or improved tolerance to Phytophthora.
  • soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with tolerance or improved tolerance to Phytophthora infection.
  • it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with tolerance for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps1a, Rps1c or Rps1d loci on linkage group N.
  • the marker locus comprises one or more of S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps1k locus on linkage group N.
  • the marker locus comprises one or more of S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps2 locus on linkage group J.
  • the marker locus comprises one or more of S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps3a or Rps3c loci on linkage group F.
  • the marker locus comprises one or more of S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps6 locus on linkage group G.
  • the marker locus comprises one or more of S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Tables 1A and 1B and in FIG. 1 A-C, FIG. 2 A-D, FIG. 3 A-C and FIG. 4 A-D.
  • Table 1 Marker Positions for Marker Loci Associated with Tolerance to Phytophthora .
  • multiple marker loci that collectively make up a Phytophthora tolerance haplotype of interest are investigated.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a Phytophthora tolerance haplotype.
  • the haplotype comprises: (a) two or more marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) two or more marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) two or more marker loci associated with the Rps2 locus found on linkage group J; (d) two or more marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) two or more marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) two or more marker loc
  • the method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the tolerance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
  • two or more marker loci or haplotypes can collectively make up a marker profile.
  • the marker profile can comprise any two or more marker loci comprising: (a) any marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) any marker loci associated with the Rps2 locus found on linkage group J; (d) marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) any marker loci associated with the Rps3a or
  • any marker loci associated with Phytophthora tolerance can be combined in the marker profile with any of the marker loci disclosed herein.
  • the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with tolerance to Phytophthora infection provided herein (i.e. the various marker loci provided in Tables 1A and 1B and in FIGS. 1-4 ).
  • a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the tolerance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein.
  • the marker profile comprises any combination of two or more marker loci from any of the various Rps loci, for example, Rps1, Rps2, Rps3, Rps4, Rps5, Rps6, Rps7 or Rps8.
  • soybean markers In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org.
  • identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with tolerance (or susceptibility) is determined for the particular germplasm under study.
  • methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
  • the method of identifying comprises detecting at least one marker locus associated with tolerance to Phytophthora .
  • the term “associated with” in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype.
  • an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
  • Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. Any one marker locus or any combination of the markers set forth in Table 1, or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with tolerance.
  • the at least one marker locus can be associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) can comprise one or more of the marker loci S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) can be associated with the Rps2 locus found on linkage group J; (d) can comprise one or more of the marker loci S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) can be associated with the Rps3a or Rps3c loci found on linkage group F; (f) can comprise one or more of
  • two or more marker loci are detected in the method.
  • the germplasm is a soybean variety.
  • the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
  • the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
  • the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated Phytophthora tolerance alleles encompassed by the methods provided herein include, for example, those listed in Table 1.
  • the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon.
  • amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and (b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
  • the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps1a, Rps1c, Rps1d, or Rps1k loci comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 2
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 1 and SEQ ID NO:2; SEQ ID NO: 9 and SEQ ID NO:10; SEQ ID NO: 20 and SEQ ID NO:21; SEQ ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 24 and SEQ ID NO: 25; SEQ ID NO: 36 and SEQ ID NO: 37; SEQ ID NO: 38 and SEQ ID NO: 39; or SEQ ID NO: 1339 and SEQ ID NO: 1340.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps2 locus comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 40 and SEQ ID NO: 41; SEQ ID NO: 46 and SEQ ID NO: 47; SEQ ID NO: 52 and SEQ ID NO: 53; SEQ ID NO: 58 and SEQ ID NO: 59; SEQ ID NO: 64 and SEQ ID NO: 65; or SEQ ID NO: 75 and SEQ ID NO: 76.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps3a or Rps3c loci comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 89 and SEQ ID NO: 90; or SEQ ID NO: 91 and SEQ ID NO: 92.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps6 locus comprising SEQ ID NOS: 187, 188, 189, 190 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 95 and SEQ ID NO: 96; or SEQ ID NO: 101 and SEQ ID NO: 102.
  • the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
  • the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps1a, Rps1c, Rps1d or Rps1k loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341, 1342 or variants or fragments thereof.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps2 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or variants or fragments thereof.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps3a or Rps3c loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or variants or fragments thereof.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps6 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 150, 151, 152, 153, 154 or variants or fragments thereof.
  • Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4 and 5, respectively.
  • Probe 1 Probe 2 Marker Gene/ Marker Probe 1 SEQ ID Probe 1
  • Probe 2 SEQ ID Probe 2 Position* Locus LG Name Name NO Sequence Name NO Sequence 3905604 Rps1a N S08291-1 S08291- 105 6FAM- S08291- 106 VIC- 1-PB1 CCTCACA 1-PB2 CCTCACA TACACAT TACACAT CAG TAG 3905604 Rps1a N S08291-1 S08291- 107 6FAM- S08291- 108 VIC- 1-PB3 ACATACA 1-PB4 ACACATT CATCAGC AGCAAC AAC CC 3905604 Rps1a N S08291-1 S08291- 109 6FAM- S08291- 110 VIC- 1-PB5 TCACATA 1-PB6 TCACATA CACATCA CACATTA GCA GCA 4464524 Rps1c N S07292-1 S07292- 111 6FAM
  • Genomic Loci Comprising the Various Marker Loci Provided Herein.* Ref. Seq. Marker Gene/ SEQ ID Name Locus LG NO (R/S) Reference Sequence S08291-1 Rps1a N 155/156 TYSRWAATGGGGCCACCCATATTATTTTGCTACCGAAATAGAATA CGAAAATGGGGGTAGTGACCTTRTGGCCATAGAGTTGAAGCAAGC TAATTCTGACWCGTGGCTTCCCATGCAGCGTTCATGGGGTGCAAG GTGGGCTTTGAATTTAGGTTTACAATTACAAGCACCATTATCTAT TAAGCTCACAGAACAAGGCAAGGGCTATTACAAGACAATTGTGGC TGATAGTGTAATTCCACATGGCTGGCAACCTGGCCAAGTTTATCG ATCTGTTGTTAATTTTTAAACTCTGTTTAAAATCATGACATCAAT CGAGAAAATATGTAAAAGAAGAACTGCCAGATTATATAAATAAGT TTATCCTTGTCAG
  • the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein.
  • sequencing refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A. N, et al. (2012) American Journal of Botany 99(2):175-185; genotyping by sequencing (GB S) methods, for example, as described in Elshire, R. J., et al.
  • NGS Next Generation Sequencing
  • An active variant of any one of SEQ ID NOS: 1-1394 can comprise a polynucleotide having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest.
  • fragment is intended a portion of the polynucleotide.
  • a fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest.
  • sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof.
  • equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
  • Traits or markers are considered to be linked if they co-segregate.
  • a 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM).
  • Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g., such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93, 94, 95, 96%, 97, 98%, 99, 99.5%, 99.75%, or more of the time.
  • Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less.
  • cM centimorgans
  • Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about 10 cM of a closely linked marker).
  • a closely linked marker is with 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM or 1 cM of any given marker disclosed herein.
  • a marker associated with one of the markers disclosed herein can be within 75 Kb, 60 Kb, 50 Kb, 40 Kb, 30 Kb, 20K, 10 Kb, 5 Kb or less of the disclosed marker. Put another way, closely linked loci co-segregate at least about 90% of the time.
  • Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci.
  • the region is assumed to have a euchromatin structure during initial evaluations.
  • some regions such are regions closer to centrosomes, have a heterochromatin structure.
  • the predicted physical distance between genetic map positions is based on the assumption that the region is Vietnamese, however if the region comprises heterochromatin the markers may be physically closer together.
  • closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000 nucleotides), about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
  • Mb megabase
  • Kb 500 kilobases
  • “coupling” phase linkage indicates the state where the “favorable” allele at the tolerance locus is physically associated on the same chromosome strand as the “favorable” allele of the respective linked marker locus.
  • both favorable alleles are inherited together by progeny that inherit that chromosome strand.
  • the “favorable” allele at the locus of interest e.g., a QTL for tolerance
  • the two “favorable” alleles are not inherited together (i.e., the two loci are “out of phase” with each other).
  • Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co-segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait.
  • Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies.
  • one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like.
  • a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21:673-678).
  • the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GB S) may be used.
  • a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GB S) may be used.
  • no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11:31-46; and, Egan et al.
  • Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:e19379), and expression methods.
  • no reference genome sequence is needed in order to complete the analysis.
  • MAS marker assisted selection
  • soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with Phytophthora tolerance, without actually raising soybean and measuring for tolerance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with tolerance).
  • MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines).
  • MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
  • the molecular markers or marker loci are detected using a suitable amplification-based detection method.
  • nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region.
  • nucleic acid probes that bind to the amplified region are also employed.
  • synthetic methods for making oligonucleotides, including primers and probes are well known in the art.
  • oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22:1859-1862, e.g., using a commercially available automated synthesizer, e.g., as described in Needham-VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168.
  • Oligonucleotides, including modified oligonucleotides can also be ordered from a variety of commercial sources known to persons of skill in the art.
  • primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe.
  • primers can be designed using any suitable software program, such as LASERGENE® or Primer3.
  • primers be limited to generating an amplicon of any particular size.
  • the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus.
  • marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
  • Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104,
  • PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g., those comprising marker loci), facilitating detection of the markers.
  • nucleic acids of interest e.g., those comprising marker loci
  • Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al. (1987) U.S. Pat. No. 4,683,202; Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci.
  • nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci.
  • Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided.
  • exemplary primers and probes are provided in SEQ ID NOS: 1-154, 1339-1342 and in Tables 2 and 3, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 155-1302, 1343, 1345-1394 and in Table 4.
  • Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in SEQ ID NOS: 1303-1338, 1344 and in Table 5.
  • primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci.
  • the precise probe to be used for detection can vary, e.g., any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein.
  • the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
  • probes will possess a detectable label. Any suitable label can be used with a probe.
  • Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means.
  • Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels.
  • Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes.
  • a probe can also constitute radiolabelled PCR primers that are used to generate a radiolabelled amplicon.
  • Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene Oreg.); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene Oreg.).
  • Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqManTM probes.
  • the reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3′ carbon or terminal 5′ carbon.
  • the quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching.
  • Non-fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
  • reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971, the content of which is incorporated herein by reference.
  • modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland, Handbook of Fluorescent Probes and Research Chemicals , Molecular Probes of Eugene, Oreg., 1992, the content of which is incorporated herein by reference.
  • reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the naphthylamines, having an amino group in the alpha or beta position.
  • naphthylamino compounds include 1-dimethylaminonaphthyl-5 sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate.
  • Other dyes include 3-phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like.
  • the reporters and quenchers are selected from fluorescein and rhodamine dyes.
  • Suitable examples of reporters may be selected from dyes such as SYBR green, 5-carboxyfluorescein (5-FAMTM available from Applied Biosystems of Foster City, Calif.), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy-2′,4,7,7′-tetrachlorofluorescein (6-TETTM available from Applied Biosystems), carboxy-X-rhodamine (ROX), 6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein (6-JOETM available from Applied Biosystems), VICTM dye products available from Molecular Probes, Inc., NEDTM dye products available from Applied Biosystems, and the like.
  • dyes such as SYBR green
  • Suitable examples of quenchers may be selected from 6-carboxy-tetramethyl-rhodamine, 4-(4-dimethylaminophenylazo) benzoic acid (DABYL), tetramethylrhodamine (TAMRA), BHQ-0TM, BHQ-1TM, BHQ-2TM, and BHQ-3TM, each of which are available from Biosearch Technologies, Inc. of Novato, Calif., QSY-7TM, QSY-9TM, QSY-21TM and QSY-35TM, each of which are available from Molecular Probes, Inc., and the like.
  • DABYL 4-(4-dimethylaminophenylazo) benzoic acid
  • TAMRA tetramethylrhodamine
  • a molecular beacon is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure.
  • the MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher.
  • the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res.
  • TaqManTM assay Another real-time detection method is the 5′-exonuclease detection method, also called the TaqManTM assay, as set forth in U.S. Pat. Nos. 5,804,375; 5,538,848; 5,487,972; and 5,210,015, each of which is hereby incorporated by reference in its entirety.
  • a modified probe typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair.
  • the modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR.
  • the quencher stops the reporter from emitting a detectable signal.
  • the polymerase extends the primer during amplification, the intrinsic 5′ to 3′ nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted.
  • the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
  • the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases.
  • the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter-quencher pair to the 5′ end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3′ end of the probe.
  • Separate detection probes can also be omitted in amplification/detection methods, e.g., by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamplified precursors (e.g., by fluorescence polarization).
  • amplification is not a requirement for marker detection—for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA.
  • Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular Cloning—A Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 (“Sambrook”); Current Protocols in Molecular Biology , F. M.
  • ASH allele specific hybridization
  • ASH technology is based on the stable annealing of a short, single-stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe.
  • two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences.
  • Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
  • Real-time amplification assays including MB or TaqManTM based assays, are especially useful for detecting SNP alleles.
  • probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, “A” or “C,” then one probe is designed with an “A” at the SNP position, while a separate probe is designed with a “C” at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be.
  • the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases.
  • the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes.
  • a different detectable label for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe.
  • each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3′ end and either the 6-FAM (6-carboxyfluorescein) or VIC (4,7,2′-trichloro-7′-phenyl-6-carboxyfluorescein) fluorophore at the 5′ end.
  • a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus.
  • detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed.
  • 6-FAM- and VIC-labeled probes the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured.
  • a sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence.
  • KASPar® and Illumina® Detection Systems are additional examples of commercially-available marker detection systems.
  • KASPar® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with Phytophthora tolerance).
  • Illumina® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The Illumina® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
  • Introgression of Phytophthora tolerance into non-tolerant or less-tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains Phytophthora tolerance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such tolerance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm.
  • progeny germplasm are screened to determine the presence of Phytophthora tolerance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of tolerance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
  • MAS One application of MAS is to use the tolerance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a tolerance trait into a desired (typically high yielding) background.
  • marker assisted backcrossing of specific markers from a donor source e.g., to an elite genetic background
  • the markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (tolerance, along with any other available markers for yield, disease tolerance, etc.).
  • Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance.
  • the number of alleles associated with tolerance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
  • markers and methods provided herein can also be utilized to guide marker assisted selection or breeding of soybean varieties comprising other Phytophthora tolerance markers or alleles to create a molecular stack for Phytophthora tolerance. Any of the marker loci provided herein can be introduced into a soybean line having one or more of the Phytophthora tolerance alleles rps1, rps2, rps3, rps4, rps5, rps6, rps7 or rps8.
  • the stacked combinations can include Rps1c and Rps3; Rps1k and Rps6; Rps1k and Rps3; Rps1c, Rps1k and Rps3; or Rps1c, Rps1k and Rps6.
  • the Rps loci are described, for example, in Sugimoto, Takuma, et al.
  • any one or more of the marker loci provided herein can be stacked with the rps1 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps2 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps3 allele. In yet another embodiment, any one or more of the marker loci provided herein can be stacked with the rps6 allele.
  • This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se.
  • the method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art.
  • Such soybean plant progeny can be assayed for alleles associated with tolerance and, thereby, the desired progeny selected.
  • Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding.
  • At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
  • a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired tolerance can be traced.
  • the number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
  • MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
  • markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving elite ⁇ exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the tolerance marker alleles herein.
  • transgenic approaches can also be used to create transgenic plants with the desired traits.
  • exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm.
  • a nucleic acid that codes for a tolerance trait is cloned, e.g., via positional cloning, and introduced into a target plant or germplasm.
  • tolerant soybean plants can recognize tolerant soybean plants in the field, and can select the tolerant individuals or populations for breeding purposes or for propagation.
  • the plant breeder recognizes “tolerant” and “non-tolerant” or “susceptible” soybean plants.
  • plant tolerance is a phenotypic spectrum consisting of extremes in tolerance and susceptibility, as well as a continuum of intermediate tolerance phenotypes. Evaluation of these intermediate phenotypes using reproducible assays are of value to scientists who seek to identify genetic loci that impart tolerance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a tolerance trait into an elite soybean line, for example.
  • improved tolerance is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to Phytophthora . That is, the damage caused by Phytophthora infection is prevented, or alternatively, the disease symptoms caused by Phytophthora infection is minimized or lessened.
  • improved tolerance to Phytophthora can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%, or at least about 50% to about 90% or greater.
  • the methods provided herein can be utilized to protect plants from Phytophthora infection.
  • Phytophthora tolerant soybean plants may be performed, for example, by exposing plants to Phytophthora and selecting those plants showing tolerance to Phytophthora .
  • Various assays can be used to measure tolerance or improved tolerance to Phytophthora .
  • Phytophthora tolerance can be determined by visual observations after plant exposure to a particular race of Phytophthora.
  • Non-limiting examples of Phytophthora tolerance phenotypic screening are described in detail below.
  • PHYTOPHTHORA FIELD TOLERANCE Tolerance to Phytophthora root rot is rated on a scale of 1 to 9, with a score of 1 indicating the plants have no tolerance to Phytophthora , ranging to a score of 9 being the best or highest tolerance.
  • PRTLAB indicates the tolerance was scored using plants in lab assay experiments. Preliminary scores are reported as double digits, for example ‘55’ indicates a preliminary score of 5 on the scale of 1 to 9.
  • RESISTANCE As used herein, resistance is synonymous with tolerance and is used to describe the ability of a plant to withstand exposure to an insect, disease, herbicide, environmental stress, or other condition. A resistant plant variety will be able to better withstand the insect, disease pathogen, herbicide, environmental stress, or other condition as compared to a non-resistant or wild-type variety.
  • Phytophthora sojae is maintained by refrigeration on agar. It is transferred to fresh agar plates to make inoculum for the test.
  • Test and check lines are grown in growth chambers under controlled light and controlled temperature conditions.
  • the lines are inoculated at the seedling stage by injecting mycelium into the hypocotyl.
  • the unclassified lines are incubated in conditions conducive for Phytophthora infection, and then evaluated when the known susceptible controls die.
  • the plants can be inoculated with at least one of: Phytophthora race 4 (PMG04); Phytophthora race 7 (PMG07); and/or Phytophthora race 25 (PMG25).
  • Experiments are scored 2-3 days following inoculation, depending on the reaction of susceptible and resistant checks. Infection phenotypes are classified based on the number of seedlings alive divided by the total number of seedlings inoculated. For example,
  • Phytophthora Root Rot The level of tolerance of soybean varieties to Phytophthora Root Rot can be evaluated and characterized in the field.
  • Phytophthora Root Rot is well known to those skilled in the art (see, e.g., Schmitthenner and Walker, Tolerance versus resistance for control of Phytophthora root rot of soybeans. p. 35-44 In H. D. Loden and D. Wilkenson (ed.) Proceedings of the 9 th Soybean Seed Research Conference, Chicago, Ill. 13-14 Dec. 1979. American Seed Trade Association, Washington, D.C.; Walker and Schmitthenner (1984) Crop Science 24:487-489; and, Schmitthenner and Bhat. 1994. Useful methods for studying Phytophthora in the laboratory. Department of Plant Pathology. Ohio Agricultural Research and Development Center. Circular 143).
  • test lines seed samples from experimental and check lines are not treated with any seed treatment.
  • a known set of differential checks is used.
  • One or more races of Phytophthora are chosen. Normally, at least Race 25 Phytophthora sojae is used.
  • Experimental lines and checks are sown in vermiculite in trays that are inoculated with mycelium. The trays are moved outside to a location covered with 30% sunlight block netting.
  • kit refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the identification and/or the detection of a soybean plant or germplasm having tolerance or improved tolerance to Phytophthora.
  • a kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection comprises (a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) associated with the Rps1a, Rsp1c, Rps1d or Rps1k loci on linkage group N; (ii) associated with Rps2 locus on linkage group J; (iii) associated with the Rps3a or Rps3c loci on linkage group F; or (iv) associated with the Rps6 locus on linkage group G; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
  • the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N, such as, for example, the markers provided in FIG.
  • a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with tolerance to Phytophthora infection, for instance a favorable marker locus, haplotype or marker profile.
  • These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g., using any available allele detection format, such as solid or liquid phase array based detection, microfluidic-based sample detection, etc.
  • the systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
  • a typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
  • a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele.
  • signal detection apparatus including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo-scans, microfluidic nucleic acid amplification detection appliances and the like.
  • the precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user.
  • Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used.
  • Typical detector examples include light (e.g., fluorescence) detectors or radioactivity detectors.
  • detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele.
  • Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods).
  • the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele.
  • the detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to “real time” amplification assay results.
  • System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted tolerance are also provided.
  • the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted tolerance.
  • the precise form of the instructions can vary depending on the components of the system, e.g., they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g., computers or computer readable media) operably coupled to the detector.
  • the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted tolerance.
  • the instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
  • the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N; (c) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or (e) S0844
  • the isolated polynucleotide comprises: (a) a polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339 or 1340; (a) a
  • the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to Phytophthora , for instance to particular SNPs that comprise a marker locus, haplotype or marker profile.
  • a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions.
  • a polynucleotide is said to be the “complement” of another polynucleotide if they exhibit complementarity.
  • molecules are said to exhibit “complete complementarity” when every nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other.
  • Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions.
  • the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions.
  • Appropriate stringency conditions which promote DNA hybridization for example, 6 ⁇ sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2 ⁇ SSC at 50° C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology , John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C.
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37° C., and a wash in 0.5 ⁇ to 1 ⁇ SSC at 55 to 60° C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1 ⁇ SSC at 60 to 65° C.
  • wash buffers may comprise about 0.1% to about 1% SDS.
  • Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
  • the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
  • the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
  • the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
  • the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F;
  • the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
  • the detecting comprises DNA sequencing of at least one of said marker loci.
  • the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
  • the amplifying comprises:
  • amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template;
  • said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
  • said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof.
  • said primer pair comprises:
  • said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof.
  • said primer pair comprises:
  • the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
  • said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 13
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342.
  • said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139.
  • said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
  • 34 wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149. 35.
  • said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152, 153 or 154. 37.
  • An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N. 38.
  • a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
  • An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J. 40.
  • a polynucleotide comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78;
  • kits for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection comprising:
  • primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection wherein the primers or probes are capable of detecting a marker locus, wherein:
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps1 locus on linkage group N (ch 3). Markers were screened against various known resistant and susceptible parents.
  • a marker to locus S08291-1 was developed to identify alleles associated with the phytophthora resistance phenotype, this marker detects a G/A polymorphism associated with Rps1a.
  • a panel of lines used for development for markers to identify Rps1c included lines with Rps1k and Rps1a, and provided information for alleles in the Rps1a genomic region.
  • this marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize the marker system for high throughput analysis of soybean. From this testing, S08291-1-Q5 was chosen for high throughput analysis needs, but other versions can be used to detect the polymorphism. This marker was used to fingerprint about 2000 lines.
  • Genomic DNA was extracted for testing using a standard CTAB protocol and exemplary amplification conditions are described below.
  • markers to the S07292-1 locus and the S08242 locus were developed to identify alleles associated with the Phytophthora resistance phenotype associated with Rps1c. During development, these markers were validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
  • Rps1d was mapped near Rps1k and may be an alternate allele of the Rps1 locus (Sugimoto et al., 2008. Identification of SSR markers linked to the Phytophthora resistance gene Rps1-d in soybean (2008) Plant Breeding, 127 (2): 154-159). SNPs that could be used for marker assisted selection of Rps1d were identified near the Rps1k region through sequencing of amplicons generated using extracted DNA from EX23U07, a progeny of the Rps1d donor PI103091. EX23U07 has the minor allele at SNP, S16592-001, which was found to be at low allele frequency across a diverse set of germplasm ( ⁇ 6.2%, see table below). The Taqman assay S16592-001-Q001 was designed to assay this SNP and will be useful for MAS of Rps1d.
  • Markers to loci S00009-1, S07963-2, and S08013 were developed in order to characterize and identify lines having a Rps1k resistance allele. It was observed that over time marker S00009-01-A did not always identify lines known to have Rps1k. It was hypothesized that this could be due to a recombination event in the region. A new target region was selected near the Rps1k locus and sequenced. Markers S07963-2-Q1 and S08013-1Q were designed based on the SNP profile of the sequenced region. These markers were tested on a panel of public and proprietary lines which included known Rps1k lines, susceptible lines, and other test lines. The allele and haplotype data are summarized below in Table 8.
  • Markers S07963-2-Q1 and S08013-1Q were further evaluated and validated against four F3 mapping populations using the following amplification conditions.
  • the Rps1k locus which conditions variation in phytophthora root rot resistance, was fine-mapped between 3915646-4533559 bp on Gm03 (Lg N). A set of 581 SNPs were identified in this region that perfectly differentiate resistant from susceptible lines. These markers are ideal candidates for marker-assisted selection of resistance to phytophthora root rot from the Rps1k locus.
  • Phenotypic data from lab screening for Phytophthora resistance was used in the study.
  • DNA was prepped using standard Illumina TruSeq Chemistry.
  • Selected resistant and susceptible lines formed the case groups and were sequenced to ⁇ 0.5-40x genome coverage on an Illumina HiSeq2000.
  • SNPs were called using a proprietary software to automate the process, missing data was imputed using a separate proprietary software.
  • Haploview was used to conduct a case-control association analysis on a set of 15537 SNPs identified in the region from 34000026-5085535 bp on Gm03.
  • the case group comprised 57 proprietary soybean lines resistant to phytophthora and the control group comprised 9 proprietary susceptible lines. Following Haploview filtering using the settings noted below, 7491 SNPs remained in the analysis. Nine SNPs had all missing values in the control group and were removed from additional analysis.
  • haplotypes were also observed in a panel of lines not included in the association study.
  • a plot of chi square values from case-control analysis versus physical position of 7482 SNPs reveals a peak of SNP to trait association between 3915646-4533559 bp on Gm03, suggesting that a locus conditioning phytophthora resistance is in this region.
  • a total of 581 SNPs have a perfect association between 9 susceptible (control) and 57 resistant (case) lines (Table 9). These markers are ideal for TaqManTM assay design or for evaluation by other methods, including sequencing, hybridization, or other technologies. Numerous additional SNPs analyzed here that are linked to region but are not in perfect LD with trait could be very informative markers when used in select germplasm.
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps2 locus on linkage group J (ch 16). Markers were screened against various known resistant and susceptible parents.
  • Markers to loci S06862, S06863, S06864, S06865, S11652-1 and S11682-1 were developed and validated for their ability to identify the allele(s) associated with resistance at Rps2, for example alleles derived from resistant line L76-1988.
  • Marker S06862 appeared to be within a region which is deleted in some lines, and did not amplify in several geneotypes. Therefore, genomic regions outside of the apparent deletion were targeted for marker development by sequencing 1588 regions in 25 soybean lines to develop a SNP profile. Markers to S11652 and S11682 were made based on the SNP profile and were screened and verified in known resistant and susceptible varieties. Further development and testing was done to optimize markers to these for high throughput analysis of soybean.
  • Markers 511652-1-Q1, 50683-1-Q1, and 511682-1-Q1 on LG J were identified as highly significant using Map ManagerQTX (Manly et al. (2001) Mammalian Genome 12:930-932) marker regression analysis of each of the 3 phenotypic datasets. Each had a p value of 0.00000, a % values from 56-68%, and stat values from 152.2-242.7 across the 3 regressions.
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps3 locus on linkage group F (ch 13). Markers were screened against various known resistant and susceptible varieties.
  • a marker to loci S07361-1, S08342-1, S09081-1 was developed to identify alleles associated with the phytophthora phenotype. Markers to S08342-1, S09081-1 detect res/sus polymorphisms for Rps3a, and markers to S07361-1 detect res/sus polymorphisms for Rps3c. During development, each marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
  • Parental line 95Y40 carries both the Rps3c and Rps1k phytophthora resistance alleles
  • ExpSUS is a proprietary experimental line susceptible to Phytophthora . No significant QTLs were detected in this study.
  • One suggestive QTL was found on each chromosome F_(13) and chromosome N_(3), however there was no significant association between the resistant phenotype and the Rps3c (S07163-1-Q3) and Rps1k (S00009-01-A) MAS markers located on the chromosomes, respectively.
  • the F2:3 population consisted of 90 progeny. Genomic DNA was extracted using a standard CTAB method and used for genotyping. Eight polymorphic markers were selected from LG-F, as well as 6 polymorphic markers selected from LG-N flanking and including the MAS markers S07163-1-Q1 and S00009-01-A and used to genotype the population. Phenotypic scores categorized the progeny as Resistant, Susceptible, and Heterozygous. The classes were assigned numbers 9, 1, and 5, respectively for QTL analysis. Map Manager QTX.b20 was used to construct the linkage map with the following parameters:
  • the phenotypic distribution of the 87 progeny employed in this analysis was evaluated using both percent dead scores, and the distribution after grouping into classes. In each case, the distributions were essentially normal.
  • the resistant parent's average phenotypic score was 66% dead, placing the value near the mid-point of the population phenotypic distribution rather than the tail.
  • mapping analysis markers formed two linkage groups on LG F and LG N, with one marker remaining unlinked. Marker regression (Map Manager) and single marker analysis (QTL Cartographer) were performed, each indicating two suggestive regions of interest, a region on LG F comprising S07163-1-Q3, and a region on LG N comprising S00009-01-A. Neither reached the LRS cutoff for significance in this study.
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps6 locus on linkage group G (ch 18). Markers were screened against various known resistant and susceptible parents.
  • a marker to locus S08442 was developed to identify alleles associated with the phytophthora phenotype. Sequencing was done to develop a SNP profile for marker development. During development, this marker was validated against Phytophthora resistant line Archer, and a susceptible line. The marker was further validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. This marker was additionally used to fingerprint approximately 2000 soybean lines.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Engineering & Computer Science (AREA)
  • Environmental Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Physiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a Divisional of U.S. application Ser. No. 13/782,013, filed Mar. 1, 2013, which claims the benefit of U.S. Provisional Application No. 61/740,262, filed Dec. 20, 2012, all of which are hereby incorporated herein in its entirety by reference.
    • FIELD OF THE INVENTION
  • This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display tolerance or improved tolerance to Phytophthora infection.
    • REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS-WEB
  • The official copy of the sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 20161006_3170USDIV_SeqLst.txt, a creation date of Oct. 6, 2016 and a size of 785 KB. The sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
    • BACKGROUND
  • Soybeans (Glycine max L. Merr.) are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
  • Phytophthora is a major soybean fungal pathogen that induces stem and root rot in infected plants, causing severe losses in soybean viability and overall yield. Phytophthora root rot is caused by a pathogenic infection of Phytophthora sojae. Resistance to Phytophthora infection is conditioned by naturally occurring variation at the Resistance to Phytophthora sojae (Rps) loci. As races of Phytophthora in the fields shift, previously effective resistance sources are breaking down, causing damage and compromised yields in grower fields.
  • There remains a need for soybean plants with tolerance or improved tolerance to Phytophthora infection and methods for identifying and selecting such plants.
    • SUMMARY
  • Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
    • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1 A-C provides a genetic map for loci on linkage group (LG) N.
  • FIG. 2 A-D provides a genetic map for loci on LG F.
  • FIG. 3 A-C provides a genetic map for loci on LG J.
  • FIG. 4 A-E provides a genetic map for loci on LG G.
    •  DETAILED DESCRIPTION
  • Before describing the present invention in detail, it is to be understood that this invention is not limited to particular embodiments, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
  • Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:
  • As used in this specification and the appended claims, terms in the singular and the singular forms “a,” “an,” and “the,” for example, include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “plant,” “the plant,” or “a plant” also includes a plurality of plants; also, depending on the context, use of the term “plant” can also include genetically similar or identical progeny of that plant; use of the term “a nucleic acid” optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term “probe” optionally (and typically) encompasses many similar or identical probe molecules.
  • Additionally, as used herein, “comprising” is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Thus, for example, a kit comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers. Additionally, the term “comprising” is intended to include examples encompassed by the terms “consisting essentially of” and “consisting of.” Similarly, the term “consisting essentially of” is intended to include examples encompassed by the term “consisting of.”
  • “Agronomics,” “agronomic traits,” and “agronomic performance” refer to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
  • “Allele” means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy corresponding loci on a pair of homologous chromosomes. With regard to a SNP marker, allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
  • The term “amplifying” in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. An “amplicon” is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method.
  • An “ancestral line” is a parent line used as a source of genes, e.g., for the development of elite lines.
  • An “ancestral population” is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
  • “Backcrossing” is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
  • The term “chromosome segment” designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome. “Chromosome interval” refers to a chromosome segment defined by specific flanking marker loci.
  • “Cultivar” and “variety” are used synonymously and mean a group of plants within a species (e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
  • An “elite line” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
  • An “elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
  • An “exotic soybean strain” or an “exotic soybean germplasm” is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm. In the context of a cross between two soybean plants or strains of germplasm, an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
  • A “genetic map” is a description of genetic association or linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form.
  • “Genotype” is a description of the allelic state at one or more loci.
  • “Germplasm” means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
  • An individual is “homozygous” if the individual has only one type of allele at a given locus (e.g., a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes). An individual is “heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). The term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
  • “Introgression” means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
  • The terms “label” or “detectable label” refer to a molecule capable of detection. A detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqMan™ probes. The term “reporter” refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher. The detectable signal of the reporter is, e.g., fluorescence in the detectable range. The term “quencher” refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter. As used herein, the terms “quenching” and “fluorescence energy transfer” refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
  • A “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic). A “subline” refers to an inbred subset of descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are “fixed” or homozygous across most or all loci. Commercial soybean varieties (or lines) are typically produced by aggregating (“bulking”) the self-pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self-pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was heterozygous in the originally selected F3 to F5 plant. Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant. The seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample. Optionally, seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, tolerance, etc.).
  • “Linkage” refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage.
  • “Linkage disequilibrium” is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
  • “Linkage group” (LG) refers to traits or markers that generally co-segregate. A linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
  • “Locus” is a defined segment of DNA.
  • A “map location” or “map position” is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968. A “physical position” or “physical location” or “physical map location” is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463:178-183, available from the Phytozome website (phytozome-dot-net/soybean).
  • “Mapping” is the process of defining the association and relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
  • “Marker” or “molecular marker” or “marker locus” is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
  • “Marker assisted selection” refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
  • “Haplotype” refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-N are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
  • As used herein, a “marker profile” means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes. For instance, in one example, a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
  • The term “plant” includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
  • “Plant parts” means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
  • “Polymorphism” means a change or difference between two related nucleic acids. A “nucleotide polymorphism” refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
  • “Polynucleotide,” “polynucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” and “oligonucleotide” are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi-stranded, that optionally contains synthetic, non-natural, or altered RNA or DNA nucleotide bases. A DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
  • “Primer” refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase. Typically, primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed. Primers may be provided in double-stranded form, though the single-stranded form is more typically used. A primer can further contain a detectable label, for example a 5′ end label.
  • “Probe” refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest. Typically, probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed. A probe can further contain a detectable label.
  • “Quantitative trait loci” or “QTL” refer to the genetic elements controlling a quantitative trait.
  • “Recombination frequency” is the frequency of a crossing over event (recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
  • “Tolerance and “improved tolerance” are used interchangeably herein and refer to any type of increase in resistance or tolerance to, or any type of decrease in susceptibility. A “tolerant plant” or “tolerant plant variety” need not possess absolute or complete tolerance. Instead, a “tolerant plant,” “tolerant plant variety,” or a plant or plant variety with “improved tolerance” will have a level of resistance or tolerance which is higher than that of a comparable susceptible plant or variety.
  • “Self-crossing” or “self-pollination” or “selfing” is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
  • “SNP” or “single nucleotide polymorphism” means a sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or variable. “SNP markers” exist when SNPs are mapped to sites on the soybean genome.
  • The term “yield” refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
  • As used herein, an “isolated” or “purified” polynucleotide or polypeptide, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment. Typically, an “isolated” polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5′ and 3′ ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein culture media or other chemical components.
  • Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter “Sambrook”).
  • Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. The method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with tolerance to Phytophthora infection. Also provided are isolated polynucleotides and kits for use in identifying and/or detecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved tolerance to Phytophthora.
  • Provided herein, marker loci associated with tolerance to Phytophthora infection have been identified and mapped to genomic loci on linkage groups F, G, J and N.
  • The marker loci provided herein are associated with various Phytophthora multi-race resistance genes. In some embodiments, the marker loci are associated with the Rps1a, Rps1c, Rps1d or Rps1k loci on linkage group N. In another embodiment, the marker loci are associated with the Rps2 locus on linkage group J. In other embodiments, the marker loci are associated with the Rps3a or Rps3c loci on linkage group F. In yet another embodiment, the marker loci are associated with the Rps6 loci on linkage group G.
  • These findings have important implications for soybean production, as identifying markers that can be used for selection of Phytophthora tolerance will greatly expedite the development of Phytophthora tolerance into elite cultivars.
  • Marker loci, haplotypes and marker profiles associated with tolerance or improved tolerance to Phytophthora infection, are provided. Further provided are genomic loci that are associated with soybean tolerance or improved tolerance to Phytophthora.
  • In certain embodiments, soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with tolerance or improved tolerance to Phytophthora infection. However, in other embodiments, it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with tolerance, for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
  • In one embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps1a, Rps1c or Rps1d loci on linkage group N. In a specific embodiment, the marker locus comprises one or more of S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N.
  • In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps1k locus on linkage group N. In a specific embodiment, the marker locus comprises one or more of S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N.
  • In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps2 locus on linkage group J. In a specific embodiment, the marker locus comprises one or more of S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J.
  • In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps3a or Rps3c loci on linkage group F. In a specific embodiment, the marker locus comprises one or more of S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
  • In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps6 locus on linkage group G. In a specific embodiment, the marker locus comprises one or more of S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Tables 1A and 1B and in FIG. 1 A-C, FIG. 2 A-D, FIG. 3 A-C and FIG. 4 A-D.
  • Table 1: Marker Positions for Marker Loci Associated with Tolerance to Phytophthora.
  • TABLE 1A
    Flanking Physical
    Gene/ Linkage Public Region Genetic Position Physical Allele
    Marker ID Locus Group Markers* (CM)* (cM)* Region** Position** (R/S) Source
    S08291-1 Rps1a N satt009 22.58 3905604 G/A
    S07292-1 Rps1c N satt641 23.17 4464524 T/G
    S08242-1 Rps1c N 23.05 4343399 C/T Arksoy
    S16592-001 Rps1d N 22.58  3927035-37377161 3904033 A/T
    S07963-2 Rps1k N satt009 22.63 3951705 T/C
    S07372-1 Rps1k N satt530 24.46 5227883 C/T
    S00009-01 Rps1k N satt009 22.61 3927056 C/T Kingwa
    S08013-1 Rps1k N 23.17 4458273 C/T
    S06862-1 Rps2 J satt431 81-90 83.71 36085130-37377161 36085130 T/G CNS, L76-
    1988
    S06863-1 Rps2 J 81-90 86.53 36085130-37377161 36692217 G/A CNS, L76-
    1988
    S06864-1 Rps2 J 81-90 88.83 36085130-37377161 37262813 T/C CNS, L76-
    1988
    S06865-1 Rps2 J 81-90 89.27 36085130-37377161 37377161 G/A CNS, L76-
    1988
    S11652-1 Rps2 J sat_395 81-90 86.95 36085130-37377161 36775973 G/T CNS, L76-
    1988
    S11682-1 Rps2 J sat_395 81-90 85.69 36085130-37377161 36563064 G/T CNS, L76-
    1988
    S09018-1 Rps3a F satt334 51.85 29110641 C/G PI171442
    S08342-1 Rps3a F 51.79 29049150 [T/A]/ PI171442
    [T/C]/
    [C/A]
    S07163-1 Rps3c F satt334 51.79 29049184 T/C PI340046
    S08442-1 Rps6 G sat_064 102.18 60745556 T/C Archer
    S08341-1 Rps6 G 102.27 60777851 [A/T]/ Archer
    [G/T]
  • TABLE 1B
    Physical Allele
    Marker ID Locus LG Position [R/S] Source
    Gm03:3915646 Rps1k N 3915646 [A/T] Kingwa
    Gm03:3917778 Rps1k N 3917778 [A/C] Kingwa
    Gm03:3918853 Rps1k N 3918853 [T/C] Kingwa
    Gm03:3920367 Rps1k N 3920367 [A/G] Kingwa
    Gm03:3926721 Rps1k N 3926721 [T/G] Kingwa
    Gm03:3926775 Rps1k N 3926775 [A/G] Kingwa
    Gm03:3927474 Rps1k N 3927474 [T/A] Kingwa
    Gm03:3927724 Rps1k N 3927724 [G/T] Kingwa
    Gm03:3929330 Rps1k N 3929330 [A/G] Kingwa
    Gm03:3929383 Rps1k N 3929383 [A/G] Kingwa
    Gm03:3930408 Rps1k N 3930408 [A/C] Kingwa
    Gm03:3930551 Rps1k N 3930551 [T/C] Kingwa
    Gm03:3930806 Rps1k N 3930806 [T/C] Kingwa
    Gm03:3932629 Rps1k N 3932629 [T/G] Kingwa
    Gm03:3932974 Rps1k N 3932974 [T/C] Kingwa
    Gm03:3933370 Rps1k N 3933370 [A/T] Kingwa
    Gm03:3933900 Rps1k N 3933900 [G/A] Kingwa
    Gm03:3933945 Rps1k N 3933945 [C/T] Kingwa
    Gm03:3934403 Rps1k N 3934403 [G/A] Kingwa
    Gm03:3934964 Rps1k N 3934964 [G/A] Kingwa
    Gm03:3935036 Rps1k N 3935036 [G/A] Kingwa
    Gm03:3935832 Rps1k N 3935832 [G/A] Kingwa
    Gm03:3935884 Rps1k N 3935884 [T/C] Kingwa
    Gm03:3939831 Rps1k N 3939831 [C/G] Kingwa
    Gm03:3939836 Rps1k N 3939836 [G/A] Kingwa
    Gm03:3939936 Rps1k N 3939936 [T/A] Kingwa
    Gm03:3939939 Rps1k N 3939939 [G/T] Kingwa
    Gm03:3940174 Rps1k N 3940174 [T/C] Kingwa
    Gm03:3940396 Rps1k N 3940396 [C/T] Kingwa
    Gm03:3940836 Rps1k N 3940836 [T/C] Kingwa
    Gm03:3941262 Rps1k N 3941262 [A/G] Kingwa
    Gm03:3941484 Rps1k N 3941484 [A/G] Kingwa
    Gm03:3941769 Rps1k N 3941769 [T/G] Kingwa
    Gm03:3942973 Rps1k N 3942973 [C/G] Kingwa
    Gm03:3943092 Rps1k N 3943092 [A/G] Kingwa
    Gm03:3944671 Rps1k N 3944671 [T/C] Kingwa
    Gm03:3944738 Rps1k N 3944738 [C/A] Kingwa
    Gm03:3945112 Rps1k N 3945112 [A/T] Kingwa
    Gm03:3945208 Rps1k N 3945208 [T/C] Kingwa
    Gm03:3947836 Rps1k N 3947836 [T/C] Kingwa
    Gm03:3947860 Rps1k N 3947860 [G/T] Kingwa
    Gm03:3949250 Rps1k N 3949250 [C/T] Kingwa
    Gm03:3949680 Rps1k N 3949680 [A/C] Kingwa
    Gm03:3951187 Rps1k N 3951187 [G/A] Kingwa
    Gm03:3951201 Rps1k N 3951201 [G/A] Kingwa
    Gm03:3951485 Rps1k N 3951485 [C/G] Kingwa
    Gm03:3951603 Rps1k N 3951603 [C/T] Kingwa
    Gm03:3951705 Rps1k N 3951705 [A/G] Kingwa
    Gm03:3951715 Rps1k N 3951715 [G/C] Kingwa
    Gm03:3952778 Rps1k N 3952778 [T/A] Kingwa
    Gm03:3952811 Rps1k N 3952811 [T/A] Kingwa
    Gm03:3955716 Rps1k N 3955716 [T/A] Kingwa
    Gm03:3956414 Rps1k N 3956414 [T/C] Kingwa
    Gm03:3958402 Rps1k N 3958402 [A/G] Kingwa
    Gm03:3960626 Rps1k N 3960626 [T/C] Kingwa
    Gm03:3962904 Rps1k N 3962904 [A/G] Kingwa
    Gm03:3967880 Rps1k N 3967880 [T/G] Kingwa
    Gm03:3968334 Rps1k N 3968334 [G/A] Kingwa
    Gm03:3971607 Rps1k N 3971607 [C/T] Kingwa
    Gm03:3971640 Rps1k N 3971640 [C/A] Kingwa
    Gm03:3971692 Rps1k N 3971692 [T/C] Kingwa
    Gm03:3975817 Rps1k N 3975817 [T/C] Kingwa
    Gm03:3975824 Rps1k N 3975824 [T/A] Kingwa
    Gm03:3976645 Rps1k N 3976645 [T/C] Kingwa
    Gm03:3980566 Rps1k N 3980566 [T/A] Kingwa
    Gm03:3981623 Rps1k N 3981623 [A/G] Kingwa
    Gm03:3981822 Rps1k N 3981822 [A/G] Kingwa
    Gm03:3982138 Rps1k N 3982138 [C/T] Kingwa
    Gm03:3982678 Rps1k N 3982678 [A/C] Kingwa
    Gm03:3984554 Rps1k N 3984554 [C/T] Kingwa
    Gm03:3986094 Rps1k N 3986094 [T/C] Kingwa
    Gm03:3987393 Rps1k N 3987393 [C/T] Kingwa
    Gm03:3990954 Rps1k N 3990954 [T/G] Kingwa
    Gm03:3992071 Rps1k N 3992071 [C/A] Kingwa
    Gm03:3995556 Rps1k N 3995556 [C/T] Kingwa
    Gm03:3996269 Rps1k N 3996269 [C/A] Kingwa
    Gm03:3996600 Rps1k N 3996600 [T/A] Kingwa
    Gm03:3997028 Rps1k N 3997028 [C/T] Kingwa
    Gm03:3998157 Rps1k N 3998157 [G/C] Kingwa
    Gm03:3998162 Rps1k N 3998162 [G/A] Kingwa
    Gm03:3998381 Rps1k N 3998381 [T/C] Kingwa
    Gm03:3998421 Rps1k N 3998421 [T/C] Kingwa
    Gm03:3999241 Rps1k N 3999241 [T/G] Kingwa
    Gm03:3999386 Rps1k N 3999386 [C/A] Kingwa
    Gm03:3999666 Rps1k N 3999666 [A/G] Kingwa
    Gm03:4000684 Rps1k N 4000684 [C/G] Kingwa
    Gm03:4001327 Rps1k N 4001327 [A/G] Kingwa
    Gm03:4001783 Rps1k N 4001783 [A/T] Kingwa
    Gm03:4002016 Rps1k N 4002016 [C/T] Kingwa
    Gm03:4005770 Rps1k N 4005770 [T/C] Kingwa
    Gm03:4008187 Rps1k N 4008187 [G/A] Kingwa
    Gm03:4008673 Rps1k N 4008673 [A/G] Kingwa
    Gm03:4008687 Rps1k N 4008687 [A/G] Kingwa
    Gm03:4010191 Rps1k N 4010191 [C/T] Kingwa
    Gm03:4018588 Rps1k N 4018588 [A/G] Kingwa
    Gm03:4019384 Rps1k N 4019384 [T/C] Kingwa
    Gm03:4019896 Rps1k N 4019896 [A/G] Kingwa
    Gm03:4020751 Rps1k N 4020751 [T/C] Kingwa
    Gm03:4021281 Rps1k N 4021281 [G/A] Kingwa
    Gm03:4021291 Rps1k N 4021291 [A/G] Kingwa
    Gm03:4022234 Rps1k N 4022234 [T/A] Kingwa
    Gm03:4022275 Rps1k N 4022275 [T/C] Kingwa
    Gm03:4022530 Rps1k N 4022530 [A/T] Kingwa
    Gm03:4022872 Rps1k N 4022872 [A/G] Kingwa
    Gm03:4022934 Rps1k N 4022934 [A/G] Kingwa
    Gm03:4023283 Rps1k N 4023283 [T/C] Kingwa
    Gm03:4023522 Rps1k N 4023522 [C/T] Kingwa
    Gm03:4024184 Rps1k N 4024184 [C/A] Kingwa
    Gm03:4024294 Rps1k N 4024294 [T/C] Kingwa
    Gm03:4024485 Rps1k N 4024485 [A/G] Kingwa
    Gm03:4024630 Rps1k N 4024630 [T/C] Kingwa
    Gm03:4024844 Rps1k N 4024844 [T/C] Kingwa
    Gm03:4025056 Rps1k N 4025056 [A/G] Kingwa
    Gm03:4026652 Rps1k N 4026652 [T/A] Kingwa
    Gm03:4028481 Rps1k N 4028481 [G/T] Kingwa
    Gm03:4028849 Rps1k N 4028849 [A/G] Kingwa
    Gm03:4028961 Rps1k N 4028961 [A/G] Kingwa
    Gm03:4029068 Rps1k N 4029068 [A/G] Kingwa
    Gm03:4029809 Rps1k N 4029809 [T/G] Kingwa
    Gm03:4031277 Rps1k N 4031277 [G/T] Kingwa
    Gm03:4031983 Rps1k N 4031983 [C/A] Kingwa
    Gm03:4031997 Rps1k N 4031997 [G/C] Kingwa
    Gm03:4032705 Rps1k N 4032705 [T/C] Kingwa
    Gm03:4035600 Rps1k N 4035600 [T/C] Kingwa
    Gm03:4035918 Rps1k N 4035918 [A/G] Kingwa
    Gm03:4036376 Rps1k N 4036376 [A/C] Kingwa
    Gm03:4040874 Rps1k N 4040874 [A/G] Kingwa
    Gm03:4041301 Rps1k N 4041301 [T/C] Kingwa
    Gm03:4041795 Rps1k N 4041795 [A/G] Kingwa
    Gm03:4042572 Rps1k N 4042572 [G/A] Kingwa
    Gm03:4042679 Rps1k N 4042679 [T/C] Kingwa
    Gm03:4042697 Rps1k N 4042697 [A/G] Kingwa
    Gm03:4043007 Rps1k N 4043007 [A/G] Kingwa
    Gm03:4043140 Rps1k N 4043140 [A/G] Kingwa
    Gm03:4043823 Rps1k N 4043823 [T/G] Kingwa
    Gm03:4043978 Rps1k N 4043978 [C/T] Kingwa
    Gm03:4044534 Rps1k N 4044534 [T/C] Kingwa
    Gm03:4044555 Rps1k N 4044555 [T/C] Kingwa
    Gm03:4044972 Rps1k N 4044972 [A/G] Kingwa
    Gm03:4045630 Rps1k N 4045630 [A/G] Kingwa
    Gm03:4046313 Rps1k N 4046313 [C/A] Kingwa
    Gm03:4049555 Rps1k N 4049555 [T/C] Kingwa
    Gm03:4049791 Rps1k N 4049791 [T/C] Kingwa
    Gm03:4049877 Rps1k N 4049877 [T/C] Kingwa
    Gm03:4050197 Rps1k N 4050197 [A/G] Kingwa
    Gm03:4053685 Rps1k N 4053685 [T/C] Kingwa
    Gm03:4053838 Rps1k N 4053838 [T/C] Kingwa
    Gm03:4054927 Rps1k N 4054927 [T/C] Kingwa
    Gm03:4055100 Rps1k N 4055100 [A/G] Kingwa
    Gm03:4055384 Rps1k N 4055384 [A/G] Kingwa
    Gm03:4055427 Rps1k N 4055427 [T/C] Kingwa
    Gm03:4055483 Rps1k N 4055483 [A/G] Kingwa
    Gm03:4062751 Rps1k N 4062751 [A/C] Kingwa
    Gm03:4062885 Rps1k N 4062885 [A/T] Kingwa
    Gm03:4064351 Rps1k N 4064351 [T/C] Kingwa
    Gm03:4064592 Rps1k N 4064592 [A/G] Kingwa
    Gm03:4064759 Rps1k N 4064759 [T/G] Kingwa
    Gm03:4064811 Rps1k N 4064811 [T/C] Kingwa
    Gm03:4064957 Rps1k N 4064957 [C/T] Kingwa
    Gm03:4065083 Rps1k N 4065083 [T/C] Kingwa
    Gm03:4066234 Rps1k N 4066234 [A/T] Kingwa
    Gm03:4066331 Rps1k N 4066331 [A/T] Kingwa
    Gm03:4067099 Rps1k N 4067099 [A/T] Kingwa
    Gm03:4067514 Rps1k N 4067514 [T/A] Kingwa
    Gm03:4069037 Rps1k N 4069037 [T/G] Kingwa
    Gm03:4069603 Rps1k N 4069603 [T/A] Kingwa
    Gm03:4070422 Rps1k N 4070422 [G/A] Kingwa
    Gm03:4072567 Rps1k N 4072567 [T/C] Kingwa
    Gm03:4074190 Rps1k N 4074190 [T/C] Kingwa
    Gm03:4075232 Rps1k N 4075232 [G/A] Kingwa
    Gm03:4076404 Rps1k N 4076404 [T/A] Kingwa
    Gm03:4078299 Rps1k N 4078299 [T/C] Kingwa
    Gm03:4078902 Rps1k N 4078902 [C/T] Kingwa
    Gm03:4080136 Rps1k N 4080136 [A/T] Kingwa
    Gm03:4081056 Rps1k N 4081056 [T/A] Kingwa
    Gm03:4081889 Rps1k N 4081889 [A/G] Kingwa
    Gm03:4082200 Rps1k N 4082200 [G/A] Kingwa
    Gm03:4082590 Rps1k N 4082590 [C/G] Kingwa
    Gm03:4082701 Rps1k N 4082701 [A/C] Kingwa
    Gm03:4082781 Rps1k N 4082781 [G/C] Kingwa
    Gm03:4082871 Rps1k N 4082871 [A/G] Kingwa
    Gm03:4083114 Rps1k N 4083114 [T/C] Kingwa
    Gm03:4084001 Rps1k N 4084001 [G/T] Kingwa
    Gm03:4084095 Rps1k N 4084095 [A/G] Kingwa
    Gm03:4085042 Rps1k N 4085042 [T/A] Kingwa
    Gm03:4085524 Rps1k N 4085524 [T/G] Kingwa
    Gm03:4086286 Rps1k N 4086286 [A/T] Kingwa
    Gm03:4086887 Rps1k N 4086887 [T/C] Kingwa
    Gm03:4087383 Rps1k N 4087383 [T/C] Kingwa
    Gm03:4088310 Rps1k N 4088310 [T/G] Kingwa
    Gm03:4090188 Rps1k N 4090188 [C/T] Kingwa
    Gm03:4092799 Rps1k N 4092799 [A/C] Kingwa
    Gm03:4092928 Rps1k N 4092928 [T/C] Kingwa
    Gm03:4093195 Rps1k N 4093195 [G/A] Kingwa
    Gm03:4093240 Rps1k N 4093240 [T/C] Kingwa
    Gm03:4097291 Rps1k N 4097291 [T/A] Kingwa
    Gm03:4097563 Rps1k N 4097563 [A/G] Kingwa
    Gm03:4097729 Rps1k N 4097729 [A/G] Kingwa
    Gm03:4098328 Rps1k N 4098328 [A/T] Kingwa
    Gm03:4100831 Rps1k N 4100831 [A/T] Kingwa
    Gm03:4101257 Rps1k N 4101257 [A/T] Kingwa
    Gm03:4103342 Rps1k N 4103342 [C/T] Kingwa
    Gm03:4103449 Rps1k N 4103449 [T/C] Kingwa
    Gm03:4103450 Rps1k N 4103450 [G/C] Kingwa
    Gm03:4103515 Rps1k N 4103515 [T/C] Kingwa
    Gm03:4103547 Rps1k N 4103547 [T/C] Kingwa
    Gm03:4103633 Rps1k N 4103633 [T/C] Kingwa
    Gm03:4104502 Rps1k N 4104502 [T/C] Kingwa
    Gm03:4106406 Rps1k N 4106406 [C/A] Kingwa
    Gm03:4109228 Rps1k N 4109228 [A/C] Kingwa
    Gm03:4110012 Rps1k N 4110012 [C/T] Kingwa
    Gm03:4110449 Rps1k N 4110449 [A/G] Kingwa
    Gm03:4110821 Rps1k N 4110821 [G/A] Kingwa
    Gm03:4111538 Rps1k N 4111538 [T/C] Kingwa
    Gm03:4113757 Rps1k N 4113757 [A/G] Kingwa
    Gm03:4116726 Rps1k N 4116726 [T/A] Kingwa
    Gm03:4117330 Rps1k N 4117330 [T/G] Kingwa
    Gm03:4117375 Rps1k N 4117375 [G/A] Kingwa
    Gm03:4117779 Rps1k N 4117779 [C/G] Kingwa
    Gm03:4117890 Rps1k N 4117890 [C/G] Kingwa
    Gm03:4117986 Rps1k N 4117986 [G/A] Kingwa
    Gm03:4120433 Rps1k N 4120433 [T/C] Kingwa
    Gm03:4120705 Rps1k N 4120705 [G/A] Kingwa
    Gm03:4122180 Rps1k N 4122180 [C/T] Kingwa
    Gm03:4129251 Rps1k N 4129251 [T/C] Kingwa
    Gm03:4129479 Rps1k N 4129479 [T/C] Kingwa
    Gm03:4129635 Rps1k N 4129635 [T/C] Kingwa
    Gm03:4130393 Rps1k N 4130393 [T/C] Kingwa
    Gm03:4131257 Rps1k N 4131257 [T/G] Kingwa
    Gm03:4132032 Rps1k N 4132032 [C/A] Kingwa
    Gm03:4132192 Rps1k N 4132192 [A/G] Kingwa
    Gm03:4133520 Rps1k N 4133520 [C/T] Kingwa
    Gm03:4134606 Rps1k N 4134606 [A/G] Kingwa
    Gm03:4134679 Rps1k N 4134679 [A/G] Kingwa
    Gm03:4136487 Rps1k N 4136487 [T/C] Kingwa
    Gm03:4136724 Rps1k N 4136724 [T/G] Kingwa
    Gm03:4136742 Rps1k N 4136742 [T/C] Kingwa
    Gm03:4136791 Rps1k N 4136791 [A/T] Kingwa
    Gm03:4136972 Rps1k N 4136972 [T/A] Kingwa
    Gm03:4137137 Rps1k N 4137137 [T/G] Kingwa
    Gm03:4137521 Rps1k N 4137521 [C/T] Kingwa
    Gm03:4137540 Rps1k N 4137540 [G/A] Kingwa
    Gm03:4137645 Rps1k N 4137645 [A/G] Kingwa
    Gm03:4138435 Rps1k N 4138435 [T/C] Kingwa
    Gm03:4138980 Rps1k N 4138980 [A/G] Kingwa
    Gm03:4139156 Rps1k N 4139156 [A/G] Kingwa
    Gm03:4139395 Rps1k N 4139395 [C/A] Kingwa
    Gm03:4140035 Rps1k N 4140035 [C/T] Kingwa
    Gm03:4140071 Rps1k N 4140071 [T/G] Kingwa
    Gm03:4140976 Rps1k N 4140976 [A/G] Kingwa
    Gm03:4141074 Rps1k N 4141074 [T/C] Kingwa
    Gm03:4141090 Rps1k N 4141090 [A/T] Kingwa
    Gm03:4141251 Rps1k N 4141251 [T/C] Kingwa
    Gm03:4141363 Rps1k N 4141363 [T/C] Kingwa
    Gm03:4141488 Rps1k N 4141488 [A/G] Kingwa
    Gm03:4142353 Rps1k N 4142353 [A/G] Kingwa
    Gm03:4142380 Rps1k N 4142380 [C/T] Kingwa
    Gm03:4142693 Rps1k N 4142693 [T/C] Kingwa
    Gm03:4142800 Rps1k N 4142800 [T/C] Kingwa
    Gm03:4142810 Rps1k N 4142810 [T/C] Kingwa
    Gm03:4143060 Rps1k N 4143060 [A/C] Kingwa
    Gm03:4143112 Rps1k N 4143112 [A/T] Kingwa
    Gm03:4143113 Rps1k N 4143113 [T/G] Kingwa
    Gm03:4144137 Rps1k N 4144137 [T/C] Kingwa
    Gm03:4144350 Rps1k N 4144350 [T/C] Kingwa
    Gm03:4144639 Rps1k N 4144639 [T/C] Kingwa
    Gm03:4145737 Rps1k N 4145737 [A/G] Kingwa
    Gm03:4145959 Rps1k N 4145959 [C/G] Kingwa
    Gm03:4145974 Rps1k N 4145974 [G/C] Kingwa
    Gm03:4146284 Rps1k N 4146284 [A/G] Kingwa
    Gm03:4147289 Rps1k N 4147289 [C/G] Kingwa
    Gm03:4147425 Rps1k N 4147425 [C/T] Kingwa
    Gm03:4148248 Rps1k N 4148248 [A/G] Kingwa
    Gm03:4148643 Rps1k N 4148643 [C/T] Kingwa
    Gm03:4148732 Rps1k N 4148732 [A/G] Kingwa
    Gm03:4149880 Rps1k N 4149880 [A/G] Kingwa
    Gm03:4149919 Rps1k N 4149919 [A/G] Kingwa
    Gm03:4150189 Rps1k N 4150189 [C/T] Kingwa
    Gm03:4150330 Rps1k N 4150330 [T/C] Kingwa
    Gm03:4151366 Rps1k N 4151366 [A/G] Kingwa
    Gm03:4152106 Rps1k N 4152106 [T/C] Kingwa
    Gm03:4153221 Rps1k N 4153221 [A/T] Kingwa
    Gm03:4153413 Rps1k N 4153413 [A/T] Kingwa
    Gm03:4153505 Rps1k N 4153505 [C/T] Kingwa
    Gm03:4153885 Rps1k N 4153885 [C/T] Kingwa
    Gm03:4154059 Rps1k N 4154059 [A/C] Kingwa
    Gm03:4156891 Rps1k N 4156891 [A/G] Kingwa
    Gm03:4158622 Rps1k N 4158622 [G/T] Kingwa
    Gm03:4159661 Rps1k N 4159661 [C/G] Kingwa
    Gm03:4160698 Rps1k N 4160698 [C/T] Kingwa
    Gm03:4162268 Rps1k N 4162268 [A/G] Kingwa
    Gm03:4163423 Rps1k N 4163423 [G/A] Kingwa
    Gm03:4164061 Rps1k N 4164061 [T/C] Kingwa
    Gm03:4164065 Rps1k N 4164065 [T/C] Kingwa
    Gm03:4164142 Rps1k N 4164142 [A/G] Kingwa
    Gm03:4164401 Rps1k N 4164401 [A/G] Kingwa
    Gm03:4164507 Rps1k N 4164507 [T/C] Kingwa
    Gm03:4164719 Rps1k N 4164719 [A/G] Kingwa
    Gm03:4164807 Rps1k N 4164807 [A/G] Kingwa
    Gm03:4166307 Rps1k N 4166307 [C/A] Kingwa
    Gm03:4166432 Rps1k N 4166432 [G/A] Kingwa
    Gm03:4167439 Rps1k N 4167439 [C/T] Kingwa
    Gm03:4167591 Rps1k N 4167591 [C/T] Kingwa
    Gm03:4167701 Rps1k N 4167701 [A/G] Kingwa
    Gm03:4168907 Rps1k N 4168907 [T/A] Kingwa
    Gm03:4169729 Rps1k N 4169729 [A/G] Kingwa
    Gm03:4169784 Rps1k N 4169784 [A/G] Kingwa
    Gm03:4169863 Rps1k N 4169863 [G/A] Kingwa
    Gm03:4169950 Rps1k N 4169950 [T/C] Kingwa
    Gm03:4169995 Rps1k N 4169995 [G/C] Kingwa
    Gm03:4171393 Rps1k N 4171393 [C/T] Kingwa
    Gm03:4171766 Rps1k N 4171766 [A/T] Kingwa
    Gm03:4172171 Rps1k N 4172171 [A/C] Kingwa
    Gm03:4173195 Rps1k N 4173195 [A/G] Kingwa
    Gm03:4173316 Rps1k N 4173316 [A/G] Kingwa
    Gm03:4173405 Rps1k N 4173405 [T/C] Kingwa
    Gm03:4173524 Rps1k N 4173524 [A/C] Kingwa
    Gm03:4175127 Rps1k N 4175127 [A/G] Kingwa
    Gm03:4177056 Rps1k N 4177056 [A/T] Kingwa
    Gm03:4177689 Rps1k N 4177689 [A/G] Kingwa
    Gm03:4177690 Rps1k N 4177690 [G/A] Kingwa
    Gm03:4178958 Rps1k N 4178958 [A/G] Kingwa
    Gm03:4179972 Rps1k N 4179972 [T/C] Kingwa
    Gm03:4180458 Rps1k N 4180458 [A/G] Kingwa
    Gm03:4182337 Rps1k N 4182337 [G/A] Kingwa
    Gm03:4184380 Rps1k N 4184380 [T/G] Kingwa
    Gm03:4184951 Rps1k N 4184951 [T/G] Kingwa
    Gm03:4184971 Rps1k N 4184971 [T/A] Kingwa
    Gm03:4185234 Rps1k N 4185234 [A/G] Kingwa
    Gm03:4185400 Rps1k N 4185400 [G/A] Kingwa
    Gm03:4185863 Rps1k N 4185863 [T/C] Kingwa
    Gm03:4187256 Rps1k N 4187256 [A/G] Kingwa
    Gm03:4188732 Rps1k N 4188732 [T/C] Kingwa
    Gm03:4189845 Rps1k N 4189845 [C/T] Kingwa
    Gm03:4189964 Rps1k N 4189964 [T/C] Kingwa
    Gm03:4190679 Rps1k N 4190679 [G/C] Kingwa
    Gm03:4191313 Rps1k N 4191313 [A/G] Kingwa
    Gm03:4191519 Rps1k N 4191519 [T/C] Kingwa
    Gm03:4192359 Rps1k N 4192359 [T/C] Kingwa
    Gm03:4192478 Rps1k N 4192478 [A/G] Kingwa
    Gm03:4192513 Rps1k N 4192513 [T/C] Kingwa
    Gm03:4192621 Rps1k N 4192621 [C/T] Kingwa
    Gm03:4192738 Rps1k N 4192738 [G/A] Kingwa
    Gm03:4193009 Rps1k N 4193009 [T/C] Kingwa
    Gm03:4193030 Rps1k N 4193030 [G/T] Kingwa
    Gm03:4193039 Rps1k N 4193039 [G/T] Kingwa
    Gm03:4193483 Rps1k N 4193483 [T/C] Kingwa
    Gm03:4196188 Rps1k N 4196188 [T/C] Kingwa
    Gm03:4196542 Rps1k N 4196542 [T/C] Kingwa
    Gm03:4197697 Rps1k N 4197697 [T/A] Kingwa
    Gm03:4197774 Rps1k N 4197774 [A/T] Kingwa
    Gm03:4198285 Rps1k N 4198285 [A/G] Kingwa
    Gm03:4198508 Rps1k N 4198508 [C/A] Kingwa
    Gm03:4198711 Rps1k N 4198711 [A/C] Kingwa
    Gm03:4198914 Rps1k N 4198914 [A/G] Kingwa
    Gm03:4199748 Rps1k N 4199748 [G/A] Kingwa
    Gm03:4200094 Rps1k N 4200094 [A/C] Kingwa
    Gm03:4203253 Rps1k N 4203253 [G/C] Kingwa
    Gm03:4203462 Rps1k N 4203462 [G/A] Kingwa
    Gm03:4203594 Rps1k N 4203594 [C/T] Kingwa
    Gm03:4203626 Rps1k N 4203626 [C/G] Kingwa
    Gm03:4204747 Rps1k N 4204747 [A/G] Kingwa
    Gm03:4204867 Rps1k N 4204867 [A/G] Kingwa
    Gm03:4205828 Rps1k N 4205828 [C/G] Kingwa
    Gm03:4205953 Rps1k N 4205953 [T/C] Kingwa
    Gm03:4206870 Rps1k N 4206870 [G/A] Kingwa
    Gm03:4207703 Rps1k N 4207703 [G/A] Kingwa
    Gm03:4215115 Rps1k N 4215115 [C/T] Kingwa
    Gm03:4215690 Rps1k N 4215690 [T/G] Kingwa
    Gm03:4215950 Rps1k N 4215950 [A/G] Kingwa
    Gm03:4217736 Rps1k N 4217736 [G/T] Kingwa
    Gm03:4218032 Rps1k N 4218032 [C/A] Kingwa
    Gm03:4218527 Rps1k N 4218527 [C/A] Kingwa
    Gm03:4218716 Rps1k N 4218716 [G/A] Kingwa
    Gm03:4218990 Rps1k N 4218990 [G/T] Kingwa
    Gm03:4219539 Rps1k N 4219539 [A/T] Kingwa
    Gm03:4219667 Rps1k N 4219667 [A/G] Kingwa
    Gm03:4221288 Rps1k N 4221288 [T/C] Kingwa
    Gm03:4222312 Rps1k N 4222312 [A/C] Kingwa
    Gm03:4223122 Rps1k N 4223122 [A/G] Kingwa
    Gm03:4223821 Rps1k N 4223821 [T/C] Kingwa
    Gm03:4224501 Rps1k N 4224501 [T/C] Kingwa
    Gm03:4225137 Rps1k N 4225137 [G/A] Kingwa
    Gm03:4225960 Rps1k N 4225960 [A/C] Kingwa
    Gm03:4226471 Rps1k N 4226471 [T/A] Kingwa
    Gm03:4227488 Rps1k N 4227488 [C/G] Kingwa
    Gm03:4228931 Rps1k N 4228931 [A/G] Kingwa
    Gm03:4229006 Rps1k N 4229006 [C/T] Kingwa
    Gm03:4229247 Rps1k N 4229247 [A/C] Kingwa
    Gm03:4230412 Rps1k N 4230412 [A/G] Kingwa
    Gm03:4230665 Rps1k N 4230665 [A/G] Kingwa
    Gm03:4230768 Rps1k N 4230768 [C/T] Kingwa
    Gm03:4231904 Rps1k N 4231904 [G/A] Kingwa
    Gm03:4231979 Rps1k N 4231979 [G/A] Kingwa
    Gm03:4233068 Rps1k N 4233068 [T/C] Kingwa
    Gm03:4233431 Rps1k N 4233431 [G/C] Kingwa
    Gm03:4233493 Rps1k N 4233493 [G/C] Kingwa
    Gm03:4233550 Rps1k N 4233550 [T/C] Kingwa
    Gm03:4234109 Rps1k N 4234109 [C/T] Kingwa
    Gm03:4234194 Rps1k N 4234194 [A/G] Kingwa
    Gm03:4234277 Rps1k N 4234277 [A/G] Kingwa
    Gm03:4234310 Rps1k N 4234310 [T/A] Kingwa
    Gm03:4235089 Rps1k N 4235089 [G/A] Kingwa
    Gm03:4235183 Rps1k N 4235183 [T/C] Kingwa
    Gm03:4235519 Rps1k N 4235519 [T/C] Kingwa
    Gm03:4235634 Rps1k N 4235634 [A/C] Kingwa
    Gm03:4235844 Rps1k N 4235844 [G/A] Kingwa
    Gm03:4236123 Rps1k N 4236123 [T/C] Kingwa
    Gm03:4236298 Rps1k N 4236298 [C/T] Kingwa
    Gm03:4239026 Rps1k N 4239026 [T/C] Kingwa
    Gm03:4242434 Rps1k N 4242434 [G/T] Kingwa
    Gm03:4243529 Rps1k N 4243529 [C/T] Kingwa
    Gm03:4244201 Rps1k N 4244201 [T/C] Kingwa
    Gm03:4244338 Rps1k N 4244338 [A/C] Kingwa
    Gm03:4244497 Rps1k N 4244497 [T/G] Kingwa
    Gm03:4245348 Rps1k N 4245348 [G/A] Kingwa
    Gm03:4245390 Rps1k N 4245390 [T/C] Kingwa
    Gm03:4245678 Rps1k N 4245678 [A/G] Kingwa
    Gm03:4246770 Rps1k N 4246770 [A/G] Kingwa
    Gm03:4246837 Rps1k N 4246837 [T/G] Kingwa
    Gm03:4247592 Rps1k N 4247592 [A/G] Kingwa
    Gm03:4247726 Rps1k N 4247726 [C/T] Kingwa
    Gm03:4252413 Rps1k N 4252413 [A/T] Kingwa
    Gm03:4252569 Rps1k N 4252569 [G/A] Kingwa
    Gm03:4252894 Rps1k N 4252894 [G/A] Kingwa
    Gm03:4252928 Rps1k N 4252928 [G/A] Kingwa
    Gm03:4253518 Rps1k N 4253518 [T/C] Kingwa
    Gm03:4257596 Rps1k N 4257596 [A/C] Kingwa
    Gm03:4257995 Rps1k N 4257995 [G/C] Kingwa
    Gm03:4258161 Rps1k N 4258161 [T/G] Kingwa
    Gm03:4258545 Rps1k N 4258545 [T/C] Kingwa
    Gm03:4260785 Rps1k N 4260785 [A/G] Kingwa
    Gm03:4260901 Rps1k N 4260901 [C/T] Kingwa
    Gm03:4261372 Rps1k N 4261372 [T/A] Kingwa
    Gm03:4261626 Rps1k N 4261626 [A/T] Kingwa
    Gm03:4262516 Rps1k N 4262516 [C/G] Kingwa
    Gm03:4262869 Rps1k N 4262869 [G/A] Kingwa
    Gm03:4263876 Rps1k N 4263876 [A/G] Kingwa
    Gm03:4264709 Rps1k N 4264709 [C/T] Kingwa
    Gm03:4265916 Rps1k N 4265916 [A/G] Kingwa
    Gm03:4266927 Rps1k N 4266927 [A/G] Kingwa
    Gm03:4267296 Rps1k N 4267296 [A/G] Kingwa
    Gm03:4268640 Rps1k N 4268640 [C/G] Kingwa
    Gm03:4268852 Rps1k N 4268852 [G/A] Kingwa
    Gm03:4295832 Rps1k N 4295832 [A/G] Kingwa
    Gm03:4302907 Rps1k N 4302907 [G/C] Kingwa
    Gm03:4302936 Rps1k N 4302936 [A/T] Kingwa
    Gm03:4306709 Rps1k N 4306709 [T/C] Kingwa
    Gm03:4307835 Rps1k N 4307835 [C/A] Kingwa
    Gm03:4307996 Rps1k N 4307996 [G/A] Kingwa
    Gm03:4308161 Rps1k N 4308161 [T/A] Kingwa
    Gm03:4308286 Rps1k N 4308286 [C/T] Kingwa
    Gm03:4308323 Rps1k N 4308323 [G/T] Kingwa
    Gm03:4308522 Rps1k N 4308522 [T/A] Kingwa
    Gm03:4313900 Rps1k N 4313900 [C/T] Kingwa
    Gm03:4314212 Rps1k N 4314212 [G/T] Kingwa
    Gm03:4314464 Rps1k N 4314464 [G/C] Kingwa
    Gm03:4315256 Rps1k N 4315256 [A/G] Kingwa
    Gm03:4317574 Rps1k N 4317574 [G/C] Kingwa
    Gm03:4318530 Rps1k N 4318530 [A/G] Kingwa
    Gm03:4319271 Rps1k N 4319271 [C/G] Kingwa
    Gm03:4320841 Rps1k N 4320841 [A/G] Kingwa
    Gm03:4321243 Rps1k N 4321243 [C/T] Kingwa
    Gm03:4321515 Rps1k N 4321515 [T/G] Kingwa
    Gm03:4328502 Rps1k N 4328502 [G/T] Kingwa
    Gm03:4329219 Rps1k N 4329219 [C/G] Kingwa
    Gm03:4329504 Rps1k N 4329504 [T/C] Kingwa
    Gm03:4330121 Rps1k N 4330121 [A/G] Kingwa
    Gm03:4330318 Rps1k N 4330318 [T/C] Kingwa
    Gm03:4331246 Rps1k N 4331246 [A/G] Kingwa
    Gm03:4331889 Rps1k N 4331889 [A/G] Kingwa
    Gm03:4337173 Rps1k N 4337173 [G/A] Kingwa
    Gm03:4338377 Rps1k N 4338377 [G/C] Kingwa
    Gm03:4338505 Rps1k N 4338505 [A/G] Kingwa
    Gm03:4338559 Rps1k N 4338559 [T/A] Kingwa
    Gm03:4339885 Rps1k N 4339885 [T/A] Kingwa
    Gm03:4341064 Rps1k N 4341064 [A/G] Kingwa
    Gm03:4342692 Rps1k N 4342692 [T/C] Kingwa
    Gm03:4342727 Rps1k N 4342727 [A/T] Kingwa
    Gm03:4343201 Rps1k N 4343201 [A/G] Kingwa
    Gm03:4343212 Rps1k N 4343212 [T/C] Kingwa
    Gm03:4348211 Rps1k N 4348211 [T/C] Kingwa
    Gm03:4350556 Rps1k N 4350556 [A/T] Kingwa
    Gm03:4350658 Rps1k N 4350658 [A/G] Kingwa
    Gm03:4350767 Rps1k N 4350767 [G/A] Kingwa
    Gm03:4351326 Rps1k N 4351326 [T/G] Kingwa
    Gm03:4351612 Rps1k N 4351612 [T/G] Kingwa
    Gm03:4351617 Rps1k N 4351617 [T/G] Kingwa
    Gm03:4351674 Rps1k N 4351674 [A/C] Kingwa
    Gm03:4352353 Rps1k N 4352353 [T/G] Kingwa
    Gm03:4353932 Rps1k N 4353932 [T/C] Kingwa
    Gm03:4354036 Rps1k N 4354036 [C/G] Kingwa
    Gm03:4355046 Rps1k N 4355046 [C/G] Kingwa
    Gm03:4362911 Rps1k N 4362911 [A/G] Kingwa
    Gm03:4363385 Rps1k N 4363385 [A/T] Kingwa
    Gm03:4363855 Rps1k N 4363855 [T/C] Kingwa
    Gm03:4364133 Rps1k N 4364133 [A/G] Kingwa
    Gm03:4364176 Rps1k N 4364176 [G/T] Kingwa
    Gm03:4364200 Rps1k N 4364200 [A/C] Kingwa
    Gm03:4364469 Rps1k N 4364469 [A/G] Kingwa
    Gm03:4385480 Rps1k N 4385480 [G/A] Kingwa
    Gm03:4385781 Rps1k N 4385781 [A/G] Kingwa
    Gm03:4386327 Rps1k N 4386327 [A/G] Kingwa
    Gm03:4386398 Rps1k N 4386398 [G/C] Kingwa
    Gm03:4386633 Rps1k N 4386633 [G/A] Kingwa
    Gm03:4386927 Rps1k N 4386927 [C/T] Kingwa
    Gm03:4387264 Rps1k N 4387264 [T/C] Kingwa
    Gm03:4388736 Rps1k N 4388736 [A/T] Kingwa
    Gm03:4388954 Rps1k N 4388954 [T/C] Kingwa
    Gm03:4388982 Rps1k N 4388982 [A/G] Kingwa
    Gm03:4389208 Rps1k N 4389208 [T/C] Kingwa
    Gm03:4389211 Rps1k N 4389211 [A/G] Kingwa
    Gm03:4389280 Rps1k N 4389280 [A/C] Kingwa
    Gm03:4389696 Rps1k N 4389696 [T/A] Kingwa
    Gm03:4390074 Rps1k N 4390074 [G/A] Kingwa
    Gm03:4390738 Rps1k N 4390738 [A/T] Kingwa
    Gm03:4390827 Rps1k N 4390827 [C/T] Kingwa
    Gm03:4390979 Rps1k N 4390979 [C/A] Kingwa
    Gm03:4392217 Rps1k N 4392217 [A/T] Kingwa
    Gm03:4392314 Rps1k N 4392314 [C/G] Kingwa
    Gm03:4392891 Rps1k N 4392891 [G/A] Kingwa
    Gm03:4392913 Rps1k N 4392913 [G/T] Kingwa
    Gm03:4394477 Rps1k N 4394477 [C/G] Kingwa
    Gm03:4394831 Rps1k N 4394831 [A/G] Kingwa
    Gm03:4395386 Rps1k N 4395386 [T/C] Kingwa
    Gm03:4395962 Rps1k N 4395962 [A/C] Kingwa
    Gm03:4397872 Rps1k N 4397872 [A/G] Kingwa
    Gm03:4398299 Rps1k N 4398299 [A/T] Kingwa
    Gm03:4398919 Rps1k N 4398919 [T/C] Kingwa
    Gm03:4399399 Rps1k N 4399399 [G/A] Kingwa
    Gm03:4400461 Rps1k N 4400461 [C/G] Kingwa
    Gm03:4404444 Rps1k N 4404444 [C/T] Kingwa
    Gm03:4410393 Rps1k N 4410393 [A/G] Kingwa
    Gm03:4410565 Rps1k N 4410565 [T/C] Kingwa
    Gm03:4411187 Rps1k N 4411187 [T/C] Kingwa
    Gm03:4412149 Rps1k N 4412149 [A/T] Kingwa
    Gm03:4412417 Rps1k N 4412417 [A/G] Kingwa
    Gm03:4412774 Rps1k N 4412774 [A/G] Kingwa
    Gm03:4413415 Rps1k N 4413415 [C/T] Kingwa
    Gm03:4446891 Rps1k N 4446891 [T/C] Kingwa
    Gm03:4447988 Rps1k N 4447988 [A/C] Kingwa
    Gm03:4448825 Rps1k N 4448825 [C/A] Kingwa
    Gm03:4449634 Rps1k N 4449634 [T/A] Kingwa
    Gm03:4449956 Rps1k N 4449956 [T/G] Kingwa
    Gm03:4450328 Rps1k N 4450328 [C/T] Kingwa
    Gm03:4450331 Rps1k N 4450331 [G/A] Kingwa
    Gm03:4450888 Rps1k N 4450888 [T/A] Kingwa
    Gm03:4451295 Rps1k N 4451295 [A/T] Kingwa
    Gm03:4451491 Rps1k N 4451491 [A/C] Kingwa
    Gm03:4451503 Rps1k N 4451503 [T/G] Kingwa
    Gm03:4451847 Rps1k N 4451847 [T/A] Kingwa
    Gm03:4452060 Rps1k N 4452060 [A/G] Kingwa
    Gm03:4452118 Rps1k N 4452118 [A/G] Kingwa
    Gm03:4452820 Rps1k N 4452820 [T/A] Kingwa
    Gm03:4456305 Rps1k N 4456305 [T/C] Kingwa
    Gm03:4458273 Rps1k N 4458273 [G/A] Kingwa
    Gm03:4458399 Rps1k N 4458399 [A/T] Kingwa
    Gm03:4461465 Rps1k N 4461465 [T/A] Kingwa
    Gm03:4462225 Rps1k N 4462225 [A/C] Kingwa
    Gm03:4471412 Rps1k N 4471412 [T/C] Kingwa
    Gm03:4474352 Rps1k N 4474352 [A/G] Kingwa
    Gm03:4477946 Rps1k N 4477946 [A/G] Kingwa
    Gm03:4477947 Rps1k N 4477947 [C/G] Kingwa
    Gm03:4478247 Rps1k N 4478247 [C/T] Kingwa
    Gm03:4478479 Rps1k N 4478479 [G/C] Kingwa
    Gm03:4478554 Rps1k N 4478554 [A/T] Kingwa
    Gm03:4478921 Rps1k N 4478921 [A/G] Kingwa
    Gm03:4479127 Rps1k N 4479127 [T/A] Kingwa
    Gm03:4506056 Rps1k N 4506056 [A/G] Kingwa
    Gm03:4506139 Rps1k N 4506139 [A/G] Kingwa
    Gm03:4506147 Rps1k N 4506147 [T/C] Kingwa
    Gm03:4507198 Rps1k N 4507198 [A/T] Kingwa
    Gm03:4525141 Rps1k N 4525141 [A/G] Kingwa
    Gm03:4525736 Rps1k N 4525736 [C/T] Kingwa
    Gm03:4526278 Rps1k N 4526278 [C/T] Kingwa
    Gm03:4526393 Rps1k N 4526393 [C/T] Kingwa
    Gm03:4526446 Rps1k N 4526446 [G/C] Kingwa
    Gm03:4527054 Rps1k N 4527054 [A/T] Kingwa
    Gm03:4533559 Rps1k N 4533559 [A/T] Kingwa
    Gm03:4539866 Rps1k N 4539866 [A/G] Kingwa
    Gm03:4541294 Rps1k N 4541294 [A/G] Kingwa
    *Gm composite 2003 Genetic Map
    ** Physical positions are based on Public JGI Glyma1 Williams82 reference.
  • In certain embodiments, multiple marker loci that collectively make up a Phytophthora tolerance haplotype of interest are investigated. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a Phytophthora tolerance haplotype. In some embodiments, the haplotype comprises: (a) two or more marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) two or more marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) two or more marker loci associated with the Rps2 locus found on linkage group J; (d) two or more marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) two or more marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) two or more marker loci comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) two or more marker loci associated with the Rps6 locus found on linkage group G; or (h) two or more marker loci comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • In one embodiment, the method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the tolerance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
  • In certain embodiments, two or more marker loci or haplotypes can collectively make up a marker profile. The marker profile can comprise any two or more marker loci comprising: (a) any marker loci associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) any marker loci associated with the Rps2 locus found on linkage group J; (d) marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) any marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) marker loci comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) any marker loci associated with the Rps6 locus found on linkage group G; and/or (h) marker loci comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • Any marker loci associated with Phytophthora tolerance can be combined in the marker profile with any of the marker loci disclosed herein. For example, the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with tolerance to Phytophthora infection provided herein (i.e. the various marker loci provided in Tables 1A and 1B and in FIGS. 1-4).
  • In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the tolerance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein. In some embodiments, the marker profile comprises any combination of two or more marker loci from any of the various Rps loci, for example, Rps1, Rps2, Rps3, Rps4, Rps5, Rps6, Rps7 or Rps8.
  • Not only can one detect the various markers provided herein, it is recognized that one could detect any markers that are closely linked to the various markers discussed herein. Non-limiting examples of markers closely linked the various markers discussed herein are provided in Tables 1A and 1B and in FIGS. 1-4.
  • In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org. One of skill in the art will recognize that the identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with tolerance (or susceptibility) is determined for the particular germplasm under study. One of skill will also recognize that methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
  • Various methods are provided to identify soybean plants and/or germplasm with tolerance or improved tolerance to Phytophthora infection. In one embodiment, the method of identifying comprises detecting at least one marker locus associated with tolerance to Phytophthora. The term “associated with” in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype. Thus, an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
  • Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. Any one marker locus or any combination of the markers set forth in Table 1, or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
  • In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection is provided. The method comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with tolerance. In such a method, the at least one marker locus: (a) can be associated with the Rps1a, Rps1c, Rps1d or Rps1k loci found on linkage group N; (b) can comprise one or more of the marker loci S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B, or a closely linked marker on linkage group N; (c) can be associated with the Rps2 locus found on linkage group J; (d) can comprise one or more of the marker loci S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (e) can be associated with the Rps3a or Rps3c loci found on linkage group F; (f) can comprise one or more of the marker loci S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) can be associated with the Rps6 locus found on linkage group G; and/or (h) can comprise one or more of the marker loci S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • In other embodiments, two or more marker loci are detected in the method. In a specific embodiment, the germplasm is a soybean variety.
  • In other embodiments, the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm. In a further embodiment of the method, the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
  • In specific embodiments, the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated Phytophthora tolerance alleles encompassed by the methods provided herein include, for example, those listed in Table 1.
  • In another embodiment, the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon. In such a method, amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and (b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon. In such a method, the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
  • In one embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps1a, Rps1c, Rps1d, or Rps1k loci comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, 1039, 1040, 1041, 1042, 1043, 1044, 1045, 1046, 1047, 1048, 1049, 1050, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095, 1096, 1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108, 1109, 1110, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1119, 1120, 1121, 1122, 1123, 1124, 1125, 1126, 1127, 1128, 1129, 1130, 1131, 1132, 1133, 1134, 1135, 1136, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 1168, 1169, 1170, 1171, 1172, 1173, 1174, 1175, 1176, 1177, 1178, 1179, 1180, 1181, 1182, 1183, 1184, 1185, 1186, 1187, 1188, 1189, 1190, 1191, 1192, 1193, 1194, 1195, 1196, 1197, 1198, 1199, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, 1210, 1211, 1212, 1213, 1214, 1215, 1216, 1217, 1218, 1219, 1220, 1221, 1222, 1223, 1224, 1225, 1226, 1227, 1228, 1229, 1230, 1231, 1232, 1233, 1234, 1235, 1236, 1237, 1238, 1239, 1240, 1241, 1242, 1243, 1244, 1245, 1246, 1247, 1248, 1249, 1250, 1251, 1252, 1253, 1254, 1255, 1256, 1257, 1258, 1259, 1260, 1261, 1262, 1263, 1264, 1265, 1266, 1267, 1268, 1269, 1270, 1271, 1272, 1273, 1274, 1275, 1276, 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or variants or fragments thereof. It is recognized that reference to any one of SEQ ID NOS: 191-1302 explicitly denotes each of the SEQ ID NOS recited above.
  • In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 1 and SEQ ID NO:2; SEQ ID NO: 9 and SEQ ID NO:10; SEQ ID NO: 20 and SEQ ID NO:21; SEQ ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 24 and SEQ ID NO: 25; SEQ ID NO: 36 and SEQ ID NO: 37; SEQ ID NO: 38 and SEQ ID NO: 39; or SEQ ID NO: 1339 and SEQ ID NO: 1340.
  • In another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps2 locus comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 40 and SEQ ID NO: 41; SEQ ID NO: 46 and SEQ ID NO: 47; SEQ ID NO: 52 and SEQ ID NO: 53; SEQ ID NO: 58 and SEQ ID NO: 59; SEQ ID NO: 64 and SEQ ID NO: 65; or SEQ ID NO: 75 and SEQ ID NO: 76.
  • In another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps3a or Rps3c loci comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 89 and SEQ ID NO: 90; or SEQ ID NO: 91 and SEQ ID NO: 92.
  • In yet another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps6 locus comprising SEQ ID NOS: 187, 188, 189, 190 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 95 and SEQ ID NO: 96; or SEQ ID NO: 101 and SEQ ID NO: 102.
  • The method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified. In such a method, the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
  • In one embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps1a, Rps1c, Rps1d or Rps1k loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341, 1342 or variants or fragments thereof.
  • In another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps2 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or variants or fragments thereof.
  • In another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps3a or Rps3c loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or variants or fragments thereof.
  • In yet another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps6 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 150, 151, 152, 153, 154 or variants or fragments thereof.
  • Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4 and 5, respectively.
  • TABLE 2
    Non-Limiting Examples of Primer Sequences.
    TaqMan
    Marker Gene/ Assay Primer SEQ Allele
    position* Locus LG Locus Name Name ID NO Primer Sequence (R/S)
    3905604 Rps1a N S08291-1 Q5 S08291-F3 1 AAAAATGCCTCGTGGAGAGA G/A
    Q5 S08291-R3 2 GAAAATATGTAAAAGAAGAACTGCCAGA G/A
    Q1 S08291-F1 3 TGGAGAGACAAAACAGGAGATTT G/A
    Q1 S08291-R1 4 ATACACAATGGAAGATTGTTTAGCA G/A
    Q4 S08291-F2 5 GAAAGAGAAACTGGGATTCTGG G/A
    Q4 S08291-R2 6 TATACACAATGGAAGATTGTTTAGCA G/A
    Q6 S08291-F4 7 CCTCGTGGAGAGACAAAACAG G/A
    Q6 S08291-R4 8 CGAGAAAATATGTAAAAGAAGAACTGC G/A
    4464524 Rps1c N S07292-1 Q7 S07292-F5 9 AGATTCAAGGAGTCCAGACGAT T/G
    Q7 S07292-R6 10 CTCCAGCGGGAGATTTGC T/G
    Q1, Q2 S07292-F1 11 TCAAGGAGTCCAGACGATGC T/G
    Q1, Q2 S07292-R1 12 YGTCATGCTCAAGCTGTTCG T/G
    Q3, Q4 S07292-F2 13 AAGCTGCCAAGGGACAATTA T/G
    Q3 S07292-R2 14 CGGGAGATTTGCTTCTTCAA T/G
    Q4 S07292-R3 15 CAAGCTAGTAAGGCCATTTTGC T/G
    Q5 S07292-F3 16 CTGCCAAGGGACAATTAGACTT T/G
    Q5 S07292-R4 17 CCAGCGGGAGATTTGCTT T/G
    Q6 S07292-F4 18 ATTCAAGGAGTCCAGACGATG T/G
    Q6 S07292-R5 19 CTAGTAAGGCCATTTTGCTTCAG T/G
    4343399 Rps1c N S08242-1 Primer 1 20 CTTGCATTCTGGAGGTGCTA C/T
    Primer 2 21 CCATCCCCTATTCTTTGGTG C/T
    3904033 Rps1d N S16592-001 S16592-F001 1339 GGGAAGAATCCCAGTTGGAG A/T
    S16592-R001 1340 CAAACAAACTTGCGTTGCAG A/T
    3951705 Rps1k N S07963-2 Q1 S07963-F2 22 ATGAGGACACAATGCCATGA T/C
    Q1 S07963-R2 23 TGAGAAGGCCAATCCTATGC T/C
    5227883 Rps1k N S07372-1 Q11, Q6, S07372-F5 24 ATTTTGGGCAAATGATGAAGC C/T
    Q8, Q12
    Q11, Q8, S07372-R4 25 CTCAGCTAAAGACACCCTGCAAT C/T
    Q12
    Q2, Q7 S07372-F1 26 TTGGGCAAATGATGAAGCTA C/T
    Q2, Q3, S07372-R2 27 GAGGGCTCATCAGCACAAA C/T
    Q4
    Q3 S07372-F2 28 AAATGGTTTGTGGGAGGTTAGA C/T
    Q4 S07372-F3 29 AGAATAAATGGTTTGTGGGAGGTTA C/T
    Q5 S07372-F4 30 TGAAGATATGCAAATTCTTTTCAAATTA C/T
    Q5 S07372-R3 31 ACCATGGAGGGCTCATCA C/T
    Q6 S07372-R4 32 CTCAGCTAAAGACACCCTGCAAT C/T
    Q7 S07372-R1 33 CAAAAGGGCATCCTCAAAAG C/T
    86061 34 TGGGAGGTTAGATTTTCTGAACGAAGA C/T
    82582 35 CATCAGCACAAAAGGGCATCCTCA C/T
    3927056 Rps1k N S00009-01 Primer 1 36 TGACACGTGGTGCGTTAGGAATTTT C/T
    Primer 2 37 TGAAACGCATTAGTTCAGGTGGTAACTTCT C/T
    4458273 Rps1k N S08013-1 Q1 S08013-F1 38 GAAAACGAAAATTGTAAGAGCAACTT C/T
    Q1 S08013-R1 39 ATGGAATGAGTTTGGGATGG C/T
    36085130 Rps2 J S06862-1 Q1 S06862-1-Q1F 40 CCAAAGCTGTCTTGGAGGAA T/G
    Q1 S06862-1-Q1R 41 CAAAACAGATGCTTTTAACATGAAC T/G
    Q2 S06862-1-Q2F 42 GCTGTCTTGGAGGAACTTGAA T/G
    Q2 S06862-1-Q2R 43 TTTCACAACACGAGGCTGTC T/G
    Q3 S06862-1-Q3F 44 GTTGCCAAAGCTGTCTTGGA T/G
    Q3 S06862-1-Q3R 45 CACGAGGCTGTCTACTCTCTTCA T/G
    36692217 Rps2 J S06863-1 Q1 S06863-1-Q1F 46 TCACACAAGGAAATTTAACACTACAT G/A
    Q1 S06863-1-Q1R 47 TTCTCACCTTCTGTTGTATTGGA G/A
    Q2 S06863-1-Q2F 48 CGCCAAATGGCTTACTTCTC G/A
    Q2 S06863-1-Q2R 49 ACCAATGAATCACACAAGGAAA G/A
    Q3 S06863-1-Q3F 50 GGCGCCAAATGGCTTACT G/A
    Q3 S06863-1-Q3R 51 TGAATCACACAAGGAAATTTAACACT G/A
    37262813 Rps2 J S06864-1 Q1 S06864-1-Q1F 52 AACCATGCCCTTGAACAGTC T/C
    Q1 S06864-1-Q1R 53 TTTGTGAAGGACATTTTGATTTG T/C
    Q2 S06864-1-Q2F 54 TGAACAGTCTGCCCTCAGAA T/C
    Q2 S06864-1-Q2R 55 TCTCAAAATCGGCATGAGGT T/C
    Q3 S06864-1-Q3F 56 CCTTGAACAGTCTGCCCTCA T/C
    Q3 S06864-1-Q3R 57 TGAACTTTGTGAAGGACATTTTGA T/C
    37377161 Rps2 J S06865-1 Q1 S06865-1-Q1F 58 59 G/A
    Q1 S06865-1-Q1R 59 TTTGTGCAATTCTCCCATCA G/A
    Q2 S06865-1-Q2F 60 TGTTTACACGTTCTCCAATCAAA G/A
    Q2 S06865-1-Q2R 61 TGTGCAATTCTCCCATCAAA G/A
    Q3 S06865-1-Q3F 62 CAAGTGTTGTTTACACGTTCTCCA G/A
    Q3 S06865-1-Q3R 63 TTCCATAGGTGCTGTTTGTGC G/A
    36775973 Rps2 J S11652-1 Q1 S11652-F1 64 TTTCACTGCAAGAGGGAAGG G/T
    Q1, Q4 S11652-R1 65 ATTCCTGCAGCTTCTCCATC G/T
    Q2 S11652-F2 66 GAAGGGCTGTTGGTTATACCG G/T
    Q2 S11652-R2 67 CATCTTATCTTTGAACCTTTCCTGA G/T
    Q3 S11652-F3 68 AGGGAAGGGCTGTTGGTT G/T
    Q3 S11652-R3 69 TCCATCTTATCTTTGAACCTTTCC G/T
    Q4 S11652-F4 70 GCAAGAGGGAAGGGCTGTT G/T
    36563064 Rps2 J S11682-1 Q1 S11682-F1 71 ACAACACCTCCAGAGCATCC G/T
    Q1 S11682-R1 72 GCTTGTCAACATCATCTAAAATCAA G/T
    Q2 S11682-F2 73 GGTTACAACACCTCCAGAGCA G/T
    Q2 S11682-R2 74 TGCTTGTCAACATCATCTAAAATCA G/T
    Q3 S11682-F3 75 CTCCAGAGCATCCTTCTTCG G/T
    Q3 S11682-R3 76 TCATGCTTGTCAACATCATCTAAA G/T
    Q4 S11682-F4 77 CAACACCTCCAGAGCATCC G/T
    Q4 S11682-R4 78 GATGATGACTCTACTGCCTGGA G/T
    29110641 Rps3a F S09018-1 Q1 S09018-F1 79 AAGTGGCAGAGTGAACAGCA C/G
    Q1 S09018-R1 80 TAAGCGCATTTTCAAAGCTG C/G
    Q2 S09018-F2 81 GACCGTAGAGAAAGTGGCAGA C/G
    Q2 S09018-R2 82 AATAAGCGCATTTTCAAAGCTG C/G
    Q3 S09018-F3 83 GGAGGAAAGGACCGTAGAGAA C/G
    Q3 S09018-R3 84 AGCGCATTTTCAAAGCTGA C/G
    Q4 S09018-F4 85 TGTTGCTCTTCCAAAAGATGAC C/G
    Q4 S09018-R4 86 TGCATAACGTTTCAGAAGGAAA C/G
    Q5 S09018-F5 87 CCAGTGAACTATGTTGCTCTTCC C/G
    Q5 S09018-R5 88 CCAAATTTACAATGCATAACGTTTC C/G
    29049150 Rps3a F S08342-1 Primer 1 89 AAAGAAGTTTAATTTGCAAATAGCTTGAAT [T/A]/
    TTTTCAAA [T/C]/[C/A]
    Primer 2 90 TACTCCAATCAGAGTTTCCATGGCAAAGTT [T/A]/
    AG [T/C]/[C/A]
    29049184 Rps3c F S07163-1 Q1-Q4 S07163-1-F1 91 CAGGAAAGTTGAATTGCTTTATCC T/C
    Q1-Q4 S07163-1-R1 92 CAGAGTTTCCATGGCAAAGTTA T/C
    60745556 Rps6 G S08442-1 Q5 S08442-F3 93 GGCCTTTTGTTATTTCTTCAGC T/C
    Q5 S08442-R4 94 GAGTATGGAGACAGCCCACAA T/C
    Q4 S08442-F1 95 CACATTATAGGGGCCTTTTGTTA T/C
    Q4 S08442-R3 96 TTGCATATTTTCTCCCACCTG T/C
    Q1 S08442-F1 97 CACATTATAGGGGCCTTTTGTTA T/C
    Q1 S08442-R1 98 TTAGCTTGTGTAGAGTATGGAGACAG T/C
    Q2 S08442-F2 99 AGGGGCCTTTTGTTATTTCTTC T/C
    Q2 S08442-R2 100 TTTCTCCCACCTGTGCATTT T/C
    60777851 Rps6 G S08341-1 p10792-6-F2 101 CGTCCGAGATTGGAAATTGT [A/T]/[G/T]
    p10792-6-R4 102 TGGACTTTGGAATTGAACCAG [A/T]/[G/T]
    p10792-6-R2 103 TGTGAGACAAACTCCTGCATAAA [A/T]/[G/T]
    p10792-6-R3 104 TTATTGTGAGACAAACTCCTGCAT [A/T]/[G/T]
    * Physical positions are based on Public JGI Glyma1 Williams82 reference.
  • TABLE 3
    Non-Limiting Examples of Probe Sequences.
    Probe 1 Probe 2
    Marker Gene/ Marker Probe 1 SEQ ID Probe 1 Probe 2 SEQ ID Probe 2
    Position* Locus LG Name Name NO Sequence Name NO Sequence
    3905604 Rps1a N S08291-1 S08291- 105 6FAM- S08291- 106 VIC-
    1-PB1 CCTCACA 1-PB2 CCTCACA
    TACACAT TACACAT
    CAG TAG
    3905604 Rps1a N S08291-1 S08291- 107 6FAM- S08291- 108 VIC-
    1-PB3 ACATACA 1-PB4 ACACATT
    CATCAGC AGCAAC
    AAC CC
    3905604 Rps1a N S08291-1 S08291- 109 6FAM- S08291- 110 VIC-
    1-PB5 TCACATA 1-PB6 TCACATA
    CACATCA CACATTA
    GCA GCA
    4464524 Rps1c N S07292-1 S07292- 111 6FAM- S07292- 112 VIC-
    1-PB1 TTGCCAA 1-PB2 CCAACCT
    CCTGATA GATCGA
    GA GA
    4464524 Rps1c N S07292-1 S07292- 113 6FAM- S07292- 114 VIC-
    1-PB3 TTCTCTAT 1-PB4 TTGCACA
    CAGGTTG TCTTCTC
    GC GAT
    4343399 Rps1c N S08242-1 Probe 1 115 6FAM- Probe 2 116 VIC-
    TTCCCTGT TTCCCTG
    GTTTGC CGTTTGC
    3904033 Rps1d N S16592- S16592- 1341 6FAM- S16592- 1342 VIC-
    001 001- tcatcTgt 001- tcatcAg
    X001 cccgatcc X002 tcccgat
    cc
    3951705 Rps1k N S07963-2 S07963- 117 CCAGATC S07963- 118 CAGATC
    2-PB1 ATATATC 2-PB2 ACATATC
    GC GC
    5227883 Rps1k N S07372-1 S07372- 119 6FAM- S07372- 120 VIC-
    1-PBS CTCCTTAA 1-PB4 AGCACTC
    GGTAATT CTTAAGA
    AA TAA
    5227883 Rps1k N S07372-1 102408 121 6FAM- 102409 122 VIC-
    CACTCCTT CACTCCT
    AAGGTAA TAAGAT
    T AAT
    5227883 Rps1k N S07372-1 S07372- 119 6FAM- 148644 123 VIC-
    1-PBS CTCCTTAA AGCACTC
    GGTAATT CTTAAGA
    AA TAA
    3927056 Rps1k N S00009- Probe 1 124 6FAM- Probe 2 125 VIC-
    01 CATGTGG CATGTGG
    CTCAATTT CTTAATT
    T
    4458273 Rps1k N S08013-1 S08013- 126 TCATCTTT S08013- 127 ATCTTTT
    1-PB1 TCATCCA 1-PB2 CATTCAG
    GTGC TGCAT
    36085130 Rps2 J S06862-1 S06862- 128 6FAM- S06862- 129 VIC-
    1-FAM CTTACTTT 1-VIC TAGCTTG
    TGCACAT TTGGTTG
    GTA CAC
    36692217 Rps2 J S06863-1 S06863- 130 6FAM- S06863- 131 VIC-
    1-FAM TTTGGAA 1-VIC TTTGGAA
    CTGCACC TTGCACC
    TC TCA
    37262813 Rps2 J S06864-1 S06864- 132 6FAM- S06864- 133 VIC-
    1-FAM CTGCTGT 1-VIC CTGCTGT
    ACTAATC ACTAGTC
    ATAT ATAT
    37377161 Rps2 J S06865-1 S06865- 134 6FAM- S06865- 135 VIC-
    1-FAM ATGCAAATT 1-VIC ATGCAAAT
    TCTATCTTG TTTTATCTT
    GC
    36775973 Rps2 J S11652-1 S11652- 136 6FAM- S11652- 137 VIC-
    1-PB1 CAAAGTCGA 1-PB2 CTTTTACAA
    TCCTTC AGTAGATC
    CT
    36563064 Rps2 J S11682-1 S11682- 138 6FAM- S11682- 139 VIC-
    1-PB1 CAACATCGG 1-PB2 ACAACATA
    CTTCA GGCTTCA
    29110641 Rps3a F S09018-1 S09018- 140 6FAM- S09018- 141 VIC-
    1-PB1 CTAATTTGA 1-PB2 CTAATTTG
    CTCCTGAAT ACTCGTGA
    C ATC
    29049150 Rps3a F S08342-1 Probe 1 142 6FAM- Probe 2 143 VIC-
    ACCATACTA ACCATACT
    AAAAATT CAAAAAT
    29049184 Rps3c F S07163-1 S07163- 144 6FAM- S07163- 145 VIC-
    1-P1 GGAACGTTA 1-P2 TGGAACAT
    CCGGA TACCGGAC
    29049184 Rps3c F S07163-1 S07163- 146 6FAM- S07163- 147 VIC-
    1-PB1 TGGGTCCGG 1-PB2 TCCGGTAA
    TAACGT TGTTCC
    29049184 Rps3c F S07163-1 S07163- 148 6FAM- S07163- 149 VIC-
    1-PB3 TGGAACGTT 1-PB4 CGTGGAAC
    ACCGGAC ATTACC
    60745556 Rps6 G S08442-1 S08442- 150 6FAM- S08442- 151 VIC-
    1-PB1 CAAATTAAC 1-PB2 CAAATTAA
    ACATCAACA CACGTCAA
    CA
    60777851 Rps6 G S08341-1 102379 152 6FAM- 102380 153 VIC-
    (allele 1) ATCTTTTTGG (allele 2) TCTTTTTGG
    AAGTTATAC AAGATATA
    C
    60777851 Rps6 G S08341-1 102381 154 6FAM-
    (allele 3) CATCTTTTTG
    GAATATATA
    C
    *Physical positions are based on Public JGI Glyma1 Williams82 reference.
  • TABLE 4
    Non-Limiting Examples of Genomic
    Loci Comprising the Various Marker Loci
    Provided Herein.*
    Ref. Seq.
    Marker Gene/ SEQ ID
    Name Locus LG NO (R/S) Reference Sequence
    S08291-1 Rps1a N 155/156 TYSRWAATGGGGCCACCCATATTATTTTGCTACCGAAATAGAATA
    CGAAAATGGGGGTAGTGACCTTRTGGCCATAGAGTTGAAGCAAGC
    TAATTCTGACWCGTGGCTTCCCATGCAGCGTTCATGGGGTGCAAG
    GTGGGCTTTGAATTTAGGTTTACAATTACAAGCACCATTATCTAT
    TAAGCTCACAGAACAAGGCAAGGGCTATTACAAGACAATTGTGGC
    TGATAGTGTAATTCCACATGGCTGGCAACCTGGCCAAGTTTATCG
    ATCTGTTGTTAATTTTTAAACTCTGTTTAAAATCATGACATCAAT
    CGAGAAAATATGTAAAAGAAGAACTGCCAGATTATATAAATAAGT
    TTATCCTTGTCAGTTCATATATATATACACAATGGAAGATTGTTT
    AGCAATAWTTCTTTGCATTTCTTTTATGTGATAAAAAGTATGTGT
    AATAATATGGGGGTTGCT[G/A]ATGTGTATGTGAGGTTGTGAAA
    CTTTGTTTTTAAATAAAAATAATTCAAATCTCCTGTTTTGTCTCT
    CCACGAGGCATTTTTTCCTAATAAYCCAGAATCCCAGTTTCTCTT
    TCCCRTGAACACTTCCTTCTTCTTGGTTTGCAGTTTTTTAAAATA
    AAAGGTTATTATTTTCTATAAAAAAAATGAAAAGCAATCACCTGC
    AAGACATGGTCATAGCCKKTT
    S07292-1 Rps1c N 157/158 ATTGKTKGTSTGKKCCTVSMYRTTTGAAGCTGAATTTGTTTGCTG
    CTCTGTTATCAAGCTAGTAAGGCCATTTTGCTTCAGRTAGGTCTC
    CAGCGGGAGATTTGCTTCTTCAAGAAGACTYGTCATGCTCAAGCT
    GTTCGGCCCAGCTTGCACATCTTCTC[T/G]ATCAGGTTGGCAAT
    TCAAGTCTAATTGTCCCTTGGCAGCTTCAGCCACCGCATCGTCTG
    GACTCCTTGAATCTAATTCATTTTGCACCCTTACTTCATTCTCCA
    AACCGTCAACTGGAGTTAAATGGCGAGAGGTGCTATCTACTTCTG
    ATTCATCTTTCGTCCGCCATGATAACTGATTTCTCTGAGCAATCT
    CTGCTTCACGTTCRGATTGCYGCTTCTYCTTTCGCAKCATCAGGG
    TTTTAAACCGACGTTTAACTGTCATGCACACATTGCAGGTGCATG
    TAGGTTTGTGTTTGCCCTTCCCACTTGGTGGCTGGATACARACAA
    TGCAAGAGCACCCAGGTCTATGCCGAGGATGTTTTGTGGTGGTAA
    CAACTGGTGTTCTGCCAGAGTCACTTGCATCATCTCCCAGTATTG
    CTGCATTTGCCATGGTCATAG
    S08242-1 Rps1c N 159/160 GCAAGCCTGCTTCAAGGACTTGCGTGGTGCACGTATGAAGAATAG
    TGGCGTGAATGGGAGCTAACCTGGATTGTGAAAATGGAATACAAA
    TTGCAAAATCATCAATGATTTYTAGAATATTTCCTTTATACAAAA
    TGACAAATTCTATTATTAGGGAAGTGGTATAAATAAAAGCATTTG
    TAAACCATTGAGGGATATGAATGAACAAAATACAAGCTTCCTTTC
    CTTCRGTGCCTTTTTCTCTCTTCTTCTTCCTTGCATTCTGGAGGT
    GCTAGTCCCGAATCCAGCAATTTCCCTG[C/T]GTTTGCACGTAA
    CATAGTTTCTAGTATTAGTTAAAGGGCAAAACTAAAAAATATGTG
    CACCAAAGAATAGGGGATGGTTAGTTTTTATGTTAGAATCTTACG
    ACAATTTGAACCTACTATCTCTTCTACTTTTTCTTTTAACACTTA
    ATTTTTTTTTYKATCATTAAATTAATTTTATATCTTTGGATATTT
    TATTTATTATTATTAATTATTAAAAGAAAGWGCAGAGAGTATTGT
    TAGCATTTCTATTATAATTAATCTGAAATTGAACAATGTATGTAT
    TCAACAAAACAGTGAAGCAGTGAATTTGAAGATGGAAGGAATCAA
    GAAAGTACAAGTG
    S16592-001 Rps1d N 1343 CRCCGGAGTGTCCAYKGGTGTTGAGTCCTAATATTTCTTTGTGSC
    TCTAGGTCATGATTTAAATACTTAAAGACCCTTGAAAATTTACAA
    ACAAACTTGCGTTGCAGATATATTTCAAAACCCTAGCATACRTCT
    AGCATGGGAGGGGTGCAACCAGTCACTACAAAAATCATTTGAAAA
    AATTAATTGCGGATCGGGACWGATGACAACTGTGCGTACCTTAAA
    GGGAAYCAGCRAATGAGAGGGTACATATAAAATTGAAGGTGTGAA
    ACTCCTAGCCTCCAACTGGGATTCTTCCCRCAAGTGTCGTTTGAA
    GTTAAGCCGCAAAAGAAGCTATGACTGGCTATGGYTGGCTATGGG
    GGGTTGTGCACGTTGTCCTGGGTTAGGGTATATATTGTATA
    S07963-2 Rps1k N 161/162 CTTTCTYYTTNGCTTTTcnGAGAAGAAGAGATAAGATCAACCAAA
    GAATGAAGGAATTGCAAAAGCTGGTCCCAAATTCCAGTAAGGTAA
    AGAAAGAATGGTTGTAACTTAGCCAAGTTTTTGGTATAAAATTAT
    GTTCCCAATCTTTTTTCAAATTCTCTATTATGTAAGAAAGTGGCC
    ATACGTAACATGATAAAGCTGCAACATTGATCCTCTCTTTAATTT
    CTTTCCCTGTTCACCAATTAATCGGTTCAGTGGTCCCATGAGGAC
    ACAATGCCATGAASCCCAGATCA[T/C]ATATCGCATCTCCWTAT
    AGTATATGTTTCATTTTGTGTCTGCATAGGATTGGCCTTCTCATA
    AAGCAAACGCATTTCAGAAATCAATTGGAATCCTTTTATRTCTCT
    TTGAAGAACTTCTTAAAGGAATATGTGCCTAAATGACAAAATTCA
    GTTTCAATCTTTAAGTTTGYTCGAAATAAAAAGGTTTCACTTTTG
    ATTAATAATTGAGTTACTAACASAAAGACAATTAGACTCTATGTC
    TACACATCTTGGTGAGAATCCTCTACTGACTACTGATAAGATAAT
    ACTTTTAGATCCGATTGATACATTGTTGTAGTTTAATTATCATTC
    TCGAGTTTAAGTTTTTGATATGAATTACATTATATTGCAAAGWAA
    ATTTTGTCTAGTATTATATGATTACTCGAWAATATTAATATTGGA
    GAGAAAATTGCCYYTCACATGGTCATA
    S07372-1 Rps1k N 163/164 CTGCAGTGTTGTCTCTCGGAGTTGCTTCAATTGCTCATACTCTTT
    GGGATAACCACTCATTTCAAAGATGTACTAGTTTAAAACATGCAA
    AAAGA:TAAAGTTAATGTGTATTTTGTATGTTGTAGGGAAGCACA
    AAGTATCTTGATTGAATTAGGAAGATTACACGAGCCGTATGCATC
    AGAATAAATGGTTTGTGGGAGGTTAGATTTTCTGAACGAAGATGA
    AGATATGCAAATTCTTTTCAAATTAATTTTGGGCAAATGATGAAG
    CTAGACTGATAATTGATTAATTTTGGGCAAATAATATTATATTAC
    ATGTATGAGATTGATTTTAAGTGTATATGCATACATGAAGCAATA
    GACTTAATTTAATTA[C/T]CTTAAGGAGTGCTGGACTTTTGAGG
    ATGCCCTTTTGTGCTGATGAGCCCTCCATGGTTGACATACAAAGC
    AAATTGCAGGGTGTCTTTAGCTGAGGTTTTTGCTGCTTCGAAGTG
    GCAATTGAATCAGCTCCGTTGGACAGTGACATGGTGATGGTGGTG
    ATAATTAATTCGGCTTAAGGGTAAGTACAACTTCTTAGCTCTGTA
    AGCAAAGGATGCCTTGTGGAGTTGGTTCATCTAATCCACGTATAT
    ATAGGGCTGAACGAGGGAACAAGAGTTTTCAATCAATGATTACAA
    TTCCACACTCTCGCCTCTAAAGTGCATCCCTCACATTGAAGCATC
    CTCCAAATCCCAAAATATTATTATTACCACTTAAAGCTATTACAA
    ATCAGAAAACACTGCAG
    S00009-01 Rps1k N 165/166 TCAAAGTANNNNAAGTTATTAGACATGAAATTGTTTAWGATAAAT
    AATCTATTGTAATTAAGCAAGCCATGTTGGGCTAGGAACACTATC
    AACTAGTAGGATTTAAGTCTAGTCTCTTTAAGCGAATTTACAAGT
    TTATGGATAGCATTCAATGTATTTCTTAAGGTGGTATCACCCTCG
    WTGATMATTTTCACAAATTGACACGTGGTGCGTTAGGAATTTTGT
    TTTTAATAATTTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/
    T]AATTTTTTTTTAAAAAAAAAATTGAATTAACACTMATGTGACA
    TTTTTATGTGGAACATGTCAACCTATATAAGTAATAATTTAGAAG
    TTACCACCTGAACTAATGCGTTTCAAATTCAAATGATAATATATG
    ATTTATGTGACTGYTAGTTCATTTTATTTAAAAAATATTMAMAAR
    ATCACWAGAMAYTRKMAATTGTCAATTCACKATTTGATAATGATA
    TGACAAATAATTCCATATTAGTAAATTWTTTCAAAATAATTCCCT
    TGTAATATTTCAAAATAGGATAAAYTACCATATTTGAGTCATTAA
    TTGTGTAAGCGTGGTCGCATTAATCC
    S08013-1 Rps1k N 167/168 YYCTNANANTTGTTTACATCTTATACAGAACTTGAGTTTGAAAAC
    GAAAATTGTAAGAGCAACTTTTAATCATCTTTTCAT[C/T]CAGT
    GCATGCTTGAAAACTTTGTCAGAAGACAAATTAGTGKAAGCATAT
    ATATTAATTTCAATAATTTATTATGGAATTATCATATGATACCAT
    CCCAAACTCATTCCATGTTTCCCAAACAGAATGAATAATGATATT
    ASGCACCGTTCAAATTCAACATGATTTTGACAATARAAATCCAGC
    CAGATTAAATTTTTGTTCCACTATATCTCACACAAGCTTTACAAT
    CGGACAAACTGGTTACTATACAACTACTATGTTTTTTCTTTTCTT
    TTCTTTTAATCTCTGTTCCCATTTTATCACAAGTATTTCTTTTTT
    GTCATTTATWAAAAAAAANGTAAGRAAAATTAATACTGTAAATTA
    TAAAYACATGCCATATAAAANTTGTGTAAAAAAANNAAATAAACG
    CATNGCCATATNNAAAAACACATGTCATAAANCAANCGTTTTAAA
    TTGTGGTNCTCTNGGTCAGCAGCCACWTGG
    S06862-1 Rps2 J 169/170 TGTTTTGTTACGCTTCTTTTTTGTACACAGTTATGCCAATTTTGA
    TTTCTTGTTTTAATTATGTGTTGTGTGGCTTGGTTTTGTGTTTCA
    GTGACTCGTGCTATTGTTCCGAGAATGAACTTGGACGAGCTGTTT
    GAGCAGAAGGGTGAGGTTGCCAAAGCTGTCTTGGAGGAACTTGAA
    AAGGTATCTTACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGA
    ATTAAATATGTAAGAAAAGTGAAGAGAAGCTTAGTATTAGTTGTT
    GTTCACAAAATATCAAATTATTTCATTTCCTTTTAAAATTATACT
    AGCTTGTTGAGTACTGGTGAAGAGAGTAGACAGCCTCGTGTTGTG
    AAAAGGGTTGGGGGAGGGGGGGGTGGACTAAGAAGGACTTTGGAG
    GAAATTGTTAAAAGGGACCTCGTCTTAANTNNTNTTCCNGAAANT
    TGGNNNTNNCNTNNCNCANNGATNTCNNGTGNNTNNNGNNNNTGG
    S06863-1 Rps2 J 171/172 GCGGCAGATGGGCGTCTAGAGATATGTGGTATGATATATATATAA
    ATATATAATATGTAGCCCCGAAATAACTTCACTTGATTTTTATCC
    CATTCACGAGAGTAGCTAGATTGAAACAACATTGTCCGTTGGCCT
    AAGTTCAAATAGTCAACCAGAATAAAATGCAGGCTGATCATATCT
    ATTTTTGATTTTGACTATTTACCAAAACCAATCAAATGGAAGTTG
    TCTAGCTAGTCTATTCTGGCGCCAAATGGCTTACTTCTCACCTTC
    TGTTGTATTGGAGTAAGTATGAGGTGCA[G/A]TTCCAAATCTCA
    TAGAAGTGAGAAAAAAAACATATAAAATGAGTAAAAGATTCATAA
    ACCTAATCTTTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCC
    TTGTGTGATTCATTGGTATAAATCTTTAGTTCAGTGAAATGGGAC
    CAGGGTTATGATGTTACTGCTCATTTTCTTGACTATTAGCAGATG
    AGGGATGGTTACAGTGATCAACTCTTTGTTCAGTTACTGGGAAAA
    GCAGTTTATCAGCTTTGGCAAGACTACAAGGCTAAGTATGGCACC
    AGTTAAGAGGCTATGAGAGCTTTGCATGTTATTTTTTAAAAATAT
    AAGCGAGTATATATGTCGCAATCTATTTGTATATAGGTTAATTTG
    TATTAATTCTATGTTTATTCAGCGGAATGGCATGGTCATAGCCTG
    TT
    S06864-1 Rps2 J 173/174 GTACACTTTGCTTAACCAACTCAACTCAACTTTTTAGTGCCTTTA
    AAAGTAGAAAAAGGAAGTCGTGTTTGAGAGAAAAAGATAAACTTG
    AAACTGAAGAAAAAGCTAAGAGCTTAACCTCTCTCCTAAAAGCTA
    ACTAAAACTAACAGAATGTGCACCCTCGCATGTGGCAACCCCACT
    AAGCTCCTACATGTCAGTTCCCTCCTAACCAACTCCCTGCTCATC
    AGGGTTGATTTTCTTCTCTTTCAAAGGCTTTCAGCCTTTGTTCTG
    ACTAAACTAAGCCCAATTTCTATCTGCTAGCCTGGTCTAACAGAA
    GGGGATATGATWTAACATCGTATTCTCAAAATTGGCACGGATAGA
    TCCTATTATTTAATCTTAAACTTGTTAAAGGATATAATCTTATAT
    TCTCAAAATCGGCATGAGGTGGTCCTATTATTTACACTTGAACTT
    TGTGAAGGACATTTTGATTTGTATCTTTGAACTTTATAATATGA
    [T/C]TAGTACAGCAGTATGGAATTTGTGAAGATATTTTCTGAGG
    GCAGACTGTTCAAGGGCATGGTTTTAATTTTTTTATGTATGAACC
    CCATAGTTTCTGTCCACATCATCATGCCCATGGTCATAGCYKKTT
    S06865-1 Rps2 J 175/176 TATCGTACCTGATAAWTGTCAAAAACCTTTCCAACTCCATGGTAT
    AGACATCAACAGCTTGTTCCAAGACGGTGATTTGTTCCATTTTTC
    TATCAAATTATACCCAGAGAGAGAAGATAAAGTGTTACAAAAATC
    CTCCATGTTCTAAAAGACTACCAAAACACCACATCTTCCATGGAA
    GGAAATTAAAAAGCCTCTCAATCTCTCTAAAAAATAGAACAAGTC
    CCATAAACAGCTTGTGAGCTGACACCAAATGGAAGCAAGATGTCC
    AATTCTGTATCATGATAAAATGATGGGCAAAACTTATATAAGGTT
    CCATAGGTGCTGTTTGTGCAATTCTCCCATCAAAATTGGAGTTTT
    AACTTGGCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGATT
    ATGCAAATTACCTTGGTGAAACTCCAATTTTGATTGGAGAACGTG
    TAAACAACACTTGAGGAACTGTAAACAAGTTATTTCCTAAAATAA
    CCTTCTAGCTCAAATGAGTTCTAAAACATCACTTAACCGAAGCGC
    CAAATAAAAGAAAACAAGGAACATCTCAACAAGACGACCCTTGTT
    CTCAGTTCCATGATATGCACACGATTCCATGGTCATAGCYKKKT
    S11652-1 Rps2 J 177/178 TCCYYGACATAYTYCCAATAAACTYGTATTCATATGMRYCTCTGT
    TTCAAACAAACAAAAAAGTTCTGATGAAGTCAGCCTAAAATCCTT
    GCATCCATGTCTTGATAGGTACATTAATTGTCAAGGTTAACAAGA
    GCATTTCTTTTCTATTTAAATTTKACTAGTTAAATCAATMGACAA
    GTAAAACCTAATCCAATAAAAACCATAAAGTAAAWTATATTAGTA
    TGATTGTATACCCATCTTTGAAATGAGAGCCAGACAAGTCAGCTA
    CTTGTTTCAAAGCCATCCTCCATTCCTGCAGCTTCTCCATCTTAT
    CTTTGAACCTTTCCTGATGCTTAGTCATTGCTTCTCCATAACTAC
    CTTTCTGGTGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAAAG
    ACCGGTATAACCAACAGCCCTTCCCTCTTGCAGTGAAAGATGGTT
    ACAAGTTCATCTAAACAAAATGAGGAAAAAGCATAGTTTTCAGAA
    AGCACAATAATAGCAACCCTGGAATCTTGAATTGCCTTCAAAAGT
    GCAGGTGTTATTTCCTCTCCGCTGTGAAGCTTGTCTTCGTCAAAG
    AAGGTATGAAATCCCTTGTCACAAAGAGCCTTGTAGAGATWGCCA
    GTAAAACCATAGCGTGTGTCTGTCCCTCTGA
    S11682-1 Rps2 J 179/180 TKGGACCTATCACTTCCAAAGCTAATGGAAGGCCAGAAGCATAAA
    TWACTACATCATTCAAGACCTCCTTATAACTTGGATCAACCTTTT
    CGGTTTTAAAAGATTTCCATGTAAGCAATTGAAGAGCATTGTTCT
    CATTCAATAGTTCCACTTCATATGTTCTTTTAACCCCATGAGATG
    CTAGCAGTTGTTTGTCCCGAGTGGTGATGATGACTCTACTGCCTG
    GACCAAACCAACAAGGTCTTCCAACAATAGCCTGTAATTGTTCAT
    GCTTGTCAACATCATCTAAAATCAAGAGAACCTTCTTTCGCTGAA
    GCC[G/T]ATGTTGTATAATTGAAGCTCCTTGTTCAACACTTGCT
    AAGTTGATTTCCTTCTCTCCAAKTATTTCCCGAAGAAGGATGCTC
    TGGAGGTGTTGTAACCCCTTCTTGTTTGATTTTTCTCTCAAATCT
    TTAAGAAAACATGAACCATCAAAATGRCAAGCAATCAAATTATAA
    ACTGCTATAGCAAGTGTTGATTTTCCTATCCCACCAATTCCATGG
    ATCCCTATCATGTAGACACCAWCATCAGATTCAACATCCAAAAGC
    TTTGTTACTTCTAGKAATCTTGATTCTAGTCCAACCGGGTAATCC
    CATGGTCAWAGCYKKTT
    S09018-1 Rps3a F 181/182 TTTTTGGTTcaGGTCTGCAACAAAAAAGCCTCTGGGTCAGAGCAC
    TCATGCTAACACCATACTTGGGACACCAACTGGGCGTCGAATGCT
    TTCGACGCCTTCTGGCCGCCATGGAAACTCAGGAGGAAAGGACCG
    TAGAGAAAGTGGCAGAGTGAACAGCATAATTCCAGTGAACTATGT
    TGCTCTTCCAAAAGATGACTMTGTTTCTAGGGGGAATTAAGGGCT
    GCCCTCTAATTTGACTC[C/G]TGAATCAGTCAGCTTTGAAAATG
    CGCTTATTSTACAAGCTCTATTATGTTTCCTTCTGAAACGTTATG
    CATTGTAAATTTGGTAAATGACAAATGAATGACCCATTCTAGGCT
    TGATATAGAAGATTGTACAAGTCACGGGCTAAATAGATTACAAAT
    ATAAAAAGAAGTCATTCTTGTTCTTTCATGTGTGTAAGTTGTCTG
    ATTTGATTCTTCAAAAATGAGGTGTACTTTAGAGAATAAAGGGTA
    CTTATAATTAATTTATCAGAAAATTAATAGTTGAGAAGTTTGATA
    AAATTAGATACATATATGRCAATTTAGAKWTRAYRWTYTARWKTW
    WAW
    S08342-1 Rps3a F 183/184 TTAAGTGACTTTAAAATATGACACATTGAAATGACCTGTTTGGAT
    ATTAAATTTAAAGAATTTTCAAAAATGATGAGAAATTTATTGGAA
    TTTTTTTTTAAAATAAAATAGAATTACAAAACGCTGACAAGGTGT
    TTTGGTAGGGAGAGATTCTTTTCAATTTCTTAGAAATCTTGGAAG
    TGTTAAATTCCTATATTTGATATAACTATTTTAATGATCATTTTC
    ATAAATCTAAAATTCACAAGAATCATTTTTGAATAAGTCTTCTAC
    TAAACGTGGTTCGGTGGAGAGACTCTACAAAATGAGGTCAGACAT
    CGTAGGATGTTAGTCAAGCATCGGCCAAACCAGTAAATACTTCAT
    ATCATATCAATCATATGATGATAAAAAAACGCTTTCTTAAGACAC
    CGTGAACTCTAGAAAACACATAAAATGAAATCTGCACAAGCTTAA
    AGCACATGACTAAATAACTTTATCAAAATAAAAAACTAAAATACA
    GGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAAACGAAAG
    AAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACCATAC[T/
    C][C/A]AAAAATTACCTTGATTTTTCTGGGTCCGGTAA[C/T]G
    TTCCACGTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGATTG
    GAGTAACGGAGGATGCACACATCATACCATAGGATAGCGGTAACA
    CTGTCAGGACACAGCCGAGAGATTTCATTGACAGCAGTGGTGAGA
    CAGAACTGGCAGAAGTATCCTGTGATGTCGTATCTGCAG
    S07163-1 Rps3c F 185/186 GAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGAT
    GCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCG
    CCCTTCAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAA
    ACGAAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACC
    ATACTCAAAAATTACCTTGATTTTTCTGGGTCCGGTAA[T/C]GT
    TCCACGTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGAAGGG
    CGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCG
    GTACCAAGCTTGGCGTAAT
    S08442-1 Rps6 G 187/188 KTKRATTGGCTACTAAAACAAATGCTATATTTGTAAATATATACC
    AATATAGCAATACAGGGGTAATTGAAAATTCTGATTAACTGTTRA
    TCTACAGGTTAACAGTCTTCGGCAGGAACTACAACTTCTTGCTAG
    AGATAGATCAATCACTATTGTAAATGCAAGTGGAACAGGTACTGG
    TTAGCTACTTTCTTATACACATTATAGGGGCCTTTTGTTATTTCT
    TCAGCAATTTAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCC
    ATGATAACTGGTTTTAATTGTGGGCTGTCTCCATACTCTRCACAA
    GCTAAMCAATGTTTCCTTATTATTTTTTACTCCTKTTTTATTTTC
    TGACTTGTTTGGGAAATGCACAGGTGGGAGAAAATATGCAACAGT
    GATTGTTATTGTTGTGGTAGGATATGGATACGTTTGGTGGAAGGT
    AATGYCTTTTCTCTCTCAATTKTTGATTTAAGTAACAGGATGCTG
    TAGTGATACATTCTTRTTGGAAGCTTTATGGCTAATTTGAATTTR
    AATATTGGTGCTTWTAACGAGTGCCATCTGCTCTTTGCACAYGGA
    TACTCTCCACTTAA
    S08341-1 Rps6 G 189/190 TTGATGGAAATTCATTTGAAGGGAATATTCCGTCCGAGATTGGAA
    ATTGTAGCTCTCTTTACTTGCTGTATGCATCCTATTTCTCAAGCT
    CTAGTGTCATTTCTYTTAACACATCTTTTTGGA[A/T][G/T]AT
    ATACTAATTCCTATCTATTTTATGCAGGAGTTTGTCTCACAATAA
    TTTGACTGGTTCAATTCCAAAGTCCATGTCAAAGCTAAACAAGCT
    CAAAATCCTCAAGCTGGAATTCAATGAACTAAGTGGANANATACC
    AATGGAGCTTGGAATGCTTCAGAGTCTTCTTGCTGTAAACATATC
    ATACAACAGGCTCACAGGAAGGCTTCCTACAAGTAGCATATTTCA
    GAACTTGGACAAAAGTTCCTTGGAAGGAAACCTGGGTCTTTGTTC
    ACCCTTGTTGAAGGGTCCATGTAANATGAATGTCCCCAAACCACT
    WGTGCTTGACCCAAATGCCTATAACAACCAAATAAGTCCTCAAAG
    GCAAACAAACNAATCATCTGAGTCTGGCCCAGTCCATCGCCACAG
    GTTCCTTAGTGTATCTGCTATTGTAGCAATATCTGCATCCTTTGT
    CATTGTATTAGGAGTGATTGCTGTTAGCCTACTTAATGTTTCTGT
    AAGGANAAGCTAACATTTTTGGATAATG
    *The reference sequences for the remaining Rps1k markers are summarized in Table 8.
  • TABLE 5
    Non-limiting Examples of Amplicons
    Comprising the Various Marker Loci
    Provided Herein
    Amplicon
    Marker Gene/ SEQ ID NO
    Name Locus LG (R/S) Amplicon Sequence
    S08291-1 Rps1a N 1303/1304 GAAAATATGTAAAAGAAGAACTGCCAGATTATATA
    AATAAGTTTATCCTTGTCAGTTCATATATATATACAC
    AATGGAAGATTGTTTAGCAATATTTCTTTGCATTTCT
    TTTATGTGATAAAAAGTATGTGTAATAATATGGGGG
    TTGCT[G/A]ATGTGTATGTGAGGTTGTGAAACTTTGT
    TTTTAAATAAAAATAATTCAAATCTCCTGTTTTGTCT
    CTCCACGAGGCATTTTT
    S07292-1 Rps1c N 1305/1306 CTCCAGCGGGAGATTTGCTTCTTCAAGAAGACTCGT
    CATGCTCAAGCTGTTCGGCCCAGCTTGCACATCTTCT
    C[T/G]ATCAGGTTGGCAATTCAAGTCTAATTGTCCCT
    TGGCAGCTTCAGCCACCGCATCGTCTGGACTCCTTG
    AATCT
    S08242-1 Rps1c N 1307/1308 CTTGCATTCTGGAGGTGCTAGTCCCGAATCCAGCAA
    TTTCCCTG[C/T]GTTTGCACGTAACATAGTTTCTAGT
    ATTAGTTAAAGGGCAAAACTAAAAAATATGTGCACC
    AAAGAATAGGGGATGG
    S16592-001 Rps1d N 1344 CAAACAAACTTGCGTTGCAGATATATTTCAAAACCC
    TAGCATACRTCTAGCATGGGAGGGGTGCAACCAGTC
    ACTACAAAAATCATTTGAAAAAATTAATTGCGGATC
    GGGACWGATGACAACTGTGCGTACCTTAAAGGGAA
    YCAGCRAATGAGAGGGTACATATAAAATTGAAGGT
    GTGAAACTCCTAGCCTCCAACTGGGATTCTTCCC
    S07963-2 Rps1k N 1309/1310 ATGAGGACACAATGCCATGAACCCCAGATCA[T/C]A
    TATCGCATCTCCTTATAGTATATGTTTCATTTTGTGT
    CTGCATAGGATTGGCCTTCTCA
    S07372-1 Rps1k N 1311/1312 ATTTTGGGCAAATGATGAAGCTAGACTGATAATTGA
    TTAATTTTGGGCAAATAATATTATATTACATGTATGA
    GATTGATTTTAAGTGTATATGCATACATGAAGCAAT
    AGACTTAATTTAATTA[C/T]CTTAAGGAGTGCTGGAC
    TTTTGAGGATGCCCTTTTGTGCTGATGAGCCCTCCAT
    GGTTGACATACAAAGCAAATTGCAGGGTGTCTTTAG
    CTGAG
    S00009-01 Rps1k N 1313/1314 TGACACGTGGTGCGTTAGGAATTTTGTTTTTAATAAT
    TTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/T]A
    ATTTTTTTTTAAAAAAAAAATTGAATTAACACTMAT
    GTGACATTTTTATGTGGAACATGTCAACCTATATAA
    GTAATAATTTAGAAGTTACCACCTGAACTAATGCGT
    TTCA
    S08013-1 Rps1k N 1315/1316 GAAAACGAAAATTGTAAGAGCAACTTTTAATCATCT
    TTTCAT[C/T]CAGTGCATGCTTGAAAACTTTGTCAGA
    AGACAAATTAGTGKAAGCATATATATTAATTTCAAT
    AATTTATTATGGAATTATCATATGATACCATCCCAA
    ACTCATTCCAT
    S06862-1 Rps2 J 1317/1318 CCAAAGCTGTCTTGGAGGAACTTGAAAAGGTATCTT
    ACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGAAT
    TAAATATGTAAGAAAAGTGAAGAGAAGCTTAGTATT
    AGTTGTTGTTCACAAAATATCAAATTATTTCATTTCC
    TTTTAAAATTATACTAGCTTGTTG[T/G]TTGCACATG
    TAAAAGAGTTCATGTTAAAAGCATCTGTTTTG
    S06863-1 Rps2 J 1319/1320 TTCTCACCTTCTGTTGTATTGGAGTAAGTATGAGGTG
    CA[G/A]TTCCAAATCTCATAGAAGTGAGAAAAAAAA
    CATATAAAATGAGTAAAAGATTCATAAACCTAATCT
    TTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCCT
    TGTGTGA
    S06864-1 Rps2 J 1321/1322 TGAACTTTGTGAAGGACATTTTGATTTGTATCTTTGA
    ACTTTATAATATGA[T/C]TAGTACAGCAGTATGGAAT
    TTGTGAAGATATTTTCTGAGGGCAGACTGTTCAAGG
    S06865-1 Rps2 J 1323/1324 TGTGCAATTCTCCCATCAAAATTGGAGTTTTAACTTG
    GCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGA
    TTATGCAAATTACCTTGGTGAAACTCCAATTTTGATT
    GGAGAACGTGTAAACA
    S11652-1 Rps2 J 1325/1326 ATTCCTGCAGCTTCTCCATCTTATCTTTGAACCTTTC
    CTGATGCTTAGTCATTGCTTCTCCATAACTACCTTTC
    TGGTGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAA
    AGACCGGTATAACCAACAGCCCTTCCCTCTTGCAGT
    GAAA
    S11682-1 Rps2 J 1327/1328 TCATGCTTGTCAACATCATCTAAAATCAAGAGAACC
    TTCTTTCGCTGAAGCC[G/T]ATGTTGTATAATTGAAG
    CTCCTTGTTCAACACTTGCTAAGTTGATTTCCTTCTC
    TCCAAGTATTTCCCGAAGAAGGATGCTCTGGAG
    S09018-1 Rps3a F 1329/1330 GACCGTAGAGAAAGTGGCAGAGTGAACAGCATAAT
    TCCAGTGAACTATGTTGCTCTTCCAAAAGATGACTCT
    GTTTCTAGGGGGAATTAAGGGCTGCCCTCTAATTTG
    ACTC[C/G]TGAATCAGTCAGCTTTGAAAATGCGCTTA
    TT
    S08342-1 Rps3a F 1331/1332 AAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCA
    AATACCATAC[T/C][C/A]AAAAATTACCGATTTTTCT
    GGGTCCGGTAA[C/T]GTTCCACGTTGGGCTTAAACTA
    ACTTTGCCATGGAAACTCATTGGAGTA
    S07163-1 Rps3c F 1333/1334 CAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTA
    AAAAACGAAAGAAGTTTAATTTGCAAATAGCTTGAA
    TTTTTCAAATACCATACTCAAAAATTACCTTGATTTT
    TCTGGGTCCGGTAA[T/C]GTTCCACGTTGGGCTTAAA
    CTAACTTTGCCATGGAAACTCTG
    S08442-1 Rps6 G 1335/1336 CACATTATAGGGGCCTTTTGTTATTTCTTCAGCAATT
    TAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCCAT
    GATAACTGGTTTTAATTGTGGGCTGTCTCCATACTCT
    ACACAAGCTAAACAATGTTTCCTTATTATTTTTTACT
    CCTGTTTTATTTTCTGACTTGTTTGGGAAATGCACAG
    GTGGGAGAAAATATGCAA
    S08341-1 Rps6 G 1337/1338 CGTCCGAGATTGGAAATTGTAGCTCTCTTTACTTGCT
    GTATGCATCCTATTTCTCAAGCTCTAGTGTCATTTCT
    YTTAACACATCTTTTTGGA[A/T][G/T]ATATACTAA
    TTCCTATCTATTTTATGCGGAGTTTGTCTCACA
  • In another embodiment, the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein. As used herein, “sequencing” refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A. N, et al. (2012) American Journal of Botany 99(2):175-185; genotyping by sequencing (GB S) methods, for example, as described in Elshire, R. J., et al. (2011) PLoS ONE 6(5):e19379; Molecular Inversion Probe (MIP) genotyping, as described, for example, in Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673-678; or high throughput genotyping by whole-genome resequencing, as described, for example in Huang, X et al., (2009) Genome Research 19:1068-1076. Each of the above references is incorporated by reference in their entirety herein.
  • An active variant of any one of SEQ ID NOS: 1-1394 can comprise a polynucleotide having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest. By “fragment” is intended a portion of the polynucleotide. A fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest.
  • Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof. By “equivalent program” is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
  • Traits or markers are considered to be linked if they co-segregate. A 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM). Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g., such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93, 94, 95, 96%, 97, 98%, 99, 99.5%, 99.75%, or more of the time. Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less. Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about 10 cM of a closely linked marker). In specific embodiments, a closely linked marker is with 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM or 1 cM of any given marker disclosed herein. In further embodiments, a marker associated with one of the markers disclosed herein can be within 75 Kb, 60 Kb, 50 Kb, 40 Kb, 30 Kb, 20K, 10 Kb, 5 Kb or less of the disclosed marker. Put another way, closely linked loci co-segregate at least about 90% of the time. Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci. Typically, the region is assumed to have a euchromatin structure during initial evaluations. However, some regions, such are regions closer to centrosomes, have a heterochromatin structure. Without further information, the predicted physical distance between genetic map positions is based on the assumption that the region is euchromatic, however if the region comprises heterochromatin the markers may be physically closer together. With regard to physical position on a chromosome, closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000 nucleotides), about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
  • When referring to the relationship between two genetic elements, such as a genetic element contributing to tolerance and a proximal marker, “coupling” phase linkage indicates the state where the “favorable” allele at the tolerance locus is physically associated on the same chromosome strand as the “favorable” allele of the respective linked marker locus. In coupling phase, both favorable alleles are inherited together by progeny that inherit that chromosome strand. In “repulsion” phase linkage, the “favorable” allele at the locus of interest (e.g., a QTL for tolerance) is physically linked with an “unfavorable” allele at the proximal marker locus, and the two “favorable” alleles are not inherited together (i.e., the two loci are “out of phase” with each other).
  • Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co-segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait. By measuring the appearance of the marker(s) in progeny of crosses, the existence of the trait can be detected by relatively simple molecular tests without actually evaluating the appearance of the trait itself, which can be difficult and time-consuming because the actual evaluation of the trait requires growing plants to a stage and/or under environmental conditions where the trait can be expressed. Molecular markers have been widely used to determine genetic composition in soybeans.
  • Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies. In some examples one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like. In some methods, a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21:673-678). In some examples, the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GB S) may be used. In some examples, no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11:31-46; and, Egan et al. (2012) Am J Bot 99:175-185) such as sequencing by synthesis (e.g., Roche 454 pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or Proton systems), sequencing by ligation (e.g., SOLiD from Applied Biosystems, and Polnator system from Azco Biotech), and single molecule sequencing (SMS or third-generation sequencing) which eliminate template amplification (e.g., Helicos system, and PacBio RS system from Pacific BioSciences). Further technologies include optical sequencing systems (e.g., Starlight from Life Technologies), and nanopore sequencing (e.g., GridION from Oxford Nanopore Technologies). Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:e19379), and expression methods. In some examples, no reference genome sequence is needed in order to complete the analysis.
  • The use of marker assisted selection (MAS) to select a soybean plant or germplasm which has a certain marker locus, haplotype or marker profile is provided. For instance, in certain examples a soybean plant or germplasm possessing a certain predetermined favorable marker locus or haplotype will be selected via MAS. In certain other examples, a soybean plant or germplasm possessing a certain predetermined favorable marker profile will be selected via MAS.
  • Using MAS, soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with Phytophthora tolerance, without actually raising soybean and measuring for tolerance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with tolerance). MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines). MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
  • In some embodiments, the molecular markers or marker loci are detected using a suitable amplification-based detection method. In these types of methods, nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region. In certain methods, nucleic acid probes that bind to the amplified region are also employed. In general, synthetic methods for making oligonucleotides, including primers and probes, are well known in the art. For example, oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22:1859-1862, e.g., using a commercially available automated synthesizer, e.g., as described in Needham-VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168. Oligonucleotides, including modified oligonucleotides, can also be ordered from a variety of commercial sources known to persons of skill in the art.
  • It will be appreciated that suitable primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe. For example, primers can be designed using any suitable software program, such as LASERGENE® or Primer3.
  • It is not intended that the primers be limited to generating an amplicon of any particular size. For example, the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus. In some embodiments, marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
  • Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339, 1340 or variants or fragments thereof.
  • PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g., those comprising marker loci), facilitating detection of the markers. Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al. (1987) U.S. Pat. No. 4,683,202; Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173; Guatelli, et al., (1990) Proc. Natl. Acad. Sci. USA87:1874; Lomell, et al., (1989) J. Clin. Chem. 35:1826; Landegren, et al., (1988) Science 241:1077-1080; Van Brunt, (1990) Biotechnology 8:291-294; Wu and Wallace, (1989) Gene 4:560; Barringer, et al., (1990) Gene 89:117, and Sooknanan and Malek, (1995) Biotechnology 13:563-564.
  • Such nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci. Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided. For example, exemplary primers and probes are provided in SEQ ID NOS: 1-154, 1339-1342 and in Tables 2 and 3, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 155-1302, 1343, 1345-1394 and in Table 4. Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in SEQ ID NOS: 1303-1338, 1344 and in Table 5. However, one of skill will immediately recognize that other primer and probe sequences could also be used. For instance primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci. Further, it will be appreciated that the precise probe to be used for detection can vary, e.g., any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein. Further, the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
  • In certain examples, probes will possess a detectable label. Any suitable label can be used with a probe. Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels. Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes. A probe can also constitute radiolabelled PCR primers that are used to generate a radiolabelled amplicon. Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene Oreg.); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene Oreg.).
  • Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqMan™ probes. The reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3′ carbon or terminal 5′ carbon. The quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching. Non-fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
  • Selection of appropriate reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971, the content of which is incorporated herein by reference. Examples of modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland, Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes of Eugene, Oreg., 1992, the content of which is incorporated herein by reference.
  • In certain examples, reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are 1-dimethylaminonaphthyl-5 sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate. Other dyes include 3-phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like. In certain other examples, the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art.
  • Suitable examples of reporters may be selected from dyes such as SYBR green, 5-carboxyfluorescein (5-FAM™ available from Applied Biosystems of Foster City, Calif.), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy-2′,4,7,7′-tetrachlorofluorescein (6-TET™ available from Applied Biosystems), carboxy-X-rhodamine (ROX), 6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein (6-JOE™ available from Applied Biosystems), VIC™ dye products available from Molecular Probes, Inc., NED™ dye products available from Applied Biosystems, and the like. Suitable examples of quenchers may be selected from 6-carboxy-tetramethyl-rhodamine, 4-(4-dimethylaminophenylazo) benzoic acid (DABYL), tetramethylrhodamine (TAMRA), BHQ-0™, BHQ-1™, BHQ-2™, and BHQ-3™, each of which are available from Biosearch Technologies, Inc. of Novato, Calif., QSY-7™, QSY-9™, QSY-21™ and QSY-35™, each of which are available from Molecular Probes, Inc., and the like.
  • In one aspect, real time PCR or LCR is performed on the amplification mixtures described herein, e.g., using molecular beacons or TaqMan™ probes. A molecular beacon (MB) is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure. The MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher. Under conditions where the MB does not display intra-molecular hybridization (e.g., when bound to a target nucleic acid, such as to a region of an amplicon during amplification), the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res. 26:2150-2155; Tyagi and Kramer, (1996) Molecular beacons: probes that fluoresce upon hybridization, Nature Biotechnology 14:303-308; Blok and Kramer, (1997) Amplifiable hybridization probes containing a molecular switch, Mol Cell Probes 11:187-194; Hsuih. et al., (1997) Novel, ligation-dependent PCR assay for detection of hepatitis C in serum, J Clin Microbiol 34:501-507; Kostrikis, et al., (1998) Molecular beacons: spectral genotyping of human alleles, Science 279:1228-1229; Sokol, et al., (1998) Real time detection of DNA:RNA hybridization in living cells, Proc. Natl. Acad. Sci. U.S.A. 95:11538-11543; Tyagi, et al., (1998) Multicolor molecular beacons for allele discrimination, Nature Biotechnology 16:49-53; Bonnet, et al., (1999) Thermodynamic basis of the chemical specificity of structured DNA probes, Proc. Natl. Acad. Sci. U.S.A. 96:6171-6176; Fang, et al. (1999) Designing a novel molecular beacon for surface-immobilized DNA hybridization studies, J. Am. Chem. Soc. 121:2921-2922; Marras, et al., (1999) Multiplex detection of single-nucleotide variation using molecular beacons, Genet. Anal. Biomol. Eng. 14:151-156; and Vet, et al., (1999) Multiplex detection of four pathogenic retroviruses using molecular beacons, Proc. Natl. Acad. Sci. U.S.A. 96:6394-6399. Additional details regarding MB construction and use is found in the patent literature, e.g., U.S. Pat. Nos. 5,925,517; 6,150,097; and 6,037,130.
  • Another real-time detection method is the 5′-exonuclease detection method, also called the TaqMan™ assay, as set forth in U.S. Pat. Nos. 5,804,375; 5,538,848; 5,487,972; and 5,210,015, each of which is hereby incorporated by reference in its entirety. In the TaqMan™ assay, a modified probe, typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair. The modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal. However, as the polymerase extends the primer during amplification, the intrinsic 5′ to 3′ nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted. Generally, the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
  • It is well known that the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases. As quenching is strongly dependent on the physical proximity of the reporter and quencher, the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter-quencher pair to the 5′ end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3′ end of the probe.
  • Separate detection probes can also be omitted in amplification/detection methods, e.g., by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamplified precursors (e.g., by fluorescence polarization).
  • Further, it will be appreciated that amplification is not a requirement for marker detection—for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA. Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular Cloning—A Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 (“Sambrook”); Current Protocols in Molecular Biology, F. M. Ausubel, et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2002) (“Ausubel”)) and PCR Protocols A Guide to Methods and Applications (Innis, et al., eds) Academic Press Inc. San Diego, Calif. (1990) (Innis). Additional details regarding detection of nucleic acids in plants can also be found, e.g., in Plant Molecular Biology (1993) Croy (ed.) BIOS Scientific Publishers, Inc.
  • Other techniques for detecting SNPs can also be employed, such as allele specific hybridization (ASH). ASH technology is based on the stable annealing of a short, single-stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe. For each polymorphism, two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences. Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
  • Real-time amplification assays, including MB or TaqMan™ based assays, are especially useful for detecting SNP alleles. In such cases, probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, “A” or “C,” then one probe is designed with an “A” at the SNP position, while a separate probe is designed with a “C” at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be. For instance, the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases. However, if the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes. Further, a different detectable label, for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe. In certain examples, each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3′ end and either the 6-FAM (6-carboxyfluorescein) or VIC (4,7,2′-trichloro-7′-phenyl-6-carboxyfluorescein) fluorophore at the 5′ end.
  • To effectuate SNP allele detection, a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus. By then detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal, a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed. For instance, when 6-FAM- and VIC-labeled probes are employed, the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured. A sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence.
  • The KASPar® and Illumina® Detection Systems are additional examples of commercially-available marker detection systems. KASPar® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with Phytophthora tolerance). Illumina® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The Illumina® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
  • These systems and methods represent a wide variety of available detection methods which can be utilized to detect markers associated with tolerance or improved tolerance to Phytophthora, but any other suitable method could also be used.
  • Introgression of Phytophthora tolerance into non-tolerant or less-tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains Phytophthora tolerance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such tolerance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm. These progeny germplasm are screened to determine the presence of Phytophthora tolerance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of tolerance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
  • One application of MAS is to use the tolerance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a tolerance trait into a desired (typically high yielding) background. In marker assisted backcrossing of specific markers from a donor source, e.g., to an elite genetic background, one selects among backcross progeny for the donor trait and then uses repeated backcrossing to the elite line to reconstitute as much of the elite background's genome as possible.
  • Thus, the markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (tolerance, along with any other available markers for yield, disease tolerance, etc.). Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance. The number of alleles associated with tolerance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
  • The markers and methods provided herein can also be utilized to guide marker assisted selection or breeding of soybean varieties comprising other Phytophthora tolerance markers or alleles to create a molecular stack for Phytophthora tolerance. Any of the marker loci provided herein can be introduced into a soybean line having one or more of the Phytophthora tolerance alleles rps1, rps2, rps3, rps4, rps5, rps6, rps7 or rps8. For example, the stacked combinations can include Rps1c and Rps3; Rps1k and Rps6; Rps1k and Rps3; Rps1c, Rps1k and Rps3; or Rps1c, Rps1k and Rps6. Rps1c, Rps1k and Rps6; Rps1c and Rps1k; or any combination of one or more of Rps1a, Rps1b, Rps1c, Rps1d, Rps1k, Rps2, Rps3a, Rps3b, Rps3c, Rps4, Rps5, Rps6, Rps7, Rps8 and Rps Yu25. The Rps loci are described, for example, in Sugimoto, Takuma, et al. “Pathogenic diversity of Phytophthora sojae and breeding strategies to develop Phytophthora-resistant soybeans.” Breeding Science 61.5 (2012): 511-522; Sun, S., et al. 2011. Characterization and mapping of RpsYu25, a novel resistance gene to Phytophthora sojae. Plant Breed. 30:139-143; and Gordon, S. G., et al. 2007. Molecular marker analysis of soybean plant introductions with resistance to Phytophthora sojae. Phytopathology 97:113-118; each of which is herein incorporated by reference in their entirety.
  • In one embodiment, any one or more of the marker loci provided herein can be stacked with the rps1 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps2 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps3 allele. In yet another embodiment, any one or more of the marker loci provided herein can be stacked with the rps6 allele.
  • This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se. The method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art. Such soybean plant progeny can be assayed for alleles associated with tolerance and, thereby, the desired progeny selected. Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding. At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
  • Often, a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired tolerance can be traced. The number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
  • Genetic diversity is important for long term genetic gain in any breeding program. With limited diversity, genetic gain will eventually plateau when all of the favorable alleles have been fixed within the elite population. One objective is to incorporate diversity into an elite pool without losing the genetic gain that has already been made and with the minimum possible investment. MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
  • For example, the markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving elite×exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the tolerance marker alleles herein.
  • As an alternative to standard breeding methods of introducing traits of interest into soybean (e.g., introgression), transgenic approaches can also be used to create transgenic plants with the desired traits. In these methods, exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm. For example, a nucleic acid that codes for a tolerance trait is cloned, e.g., via positional cloning, and introduced into a target plant or germplasm.
  • Experienced plant breeders can recognize tolerant soybean plants in the field, and can select the tolerant individuals or populations for breeding purposes or for propagation. In this context, the plant breeder recognizes “tolerant” and “non-tolerant” or “susceptible” soybean plants. However, plant tolerance is a phenotypic spectrum consisting of extremes in tolerance and susceptibility, as well as a continuum of intermediate tolerance phenotypes. Evaluation of these intermediate phenotypes using reproducible assays are of value to scientists who seek to identify genetic loci that impart tolerance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a tolerance trait into an elite soybean line, for example.
  • By “improved tolerance” is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to Phytophthora. That is, the damage caused by Phytophthora infection is prevented, or alternatively, the disease symptoms caused by Phytophthora infection is minimized or lessened. Thus, improved tolerance to Phytophthora can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%, or at least about 50% to about 90% or greater. Hence, the methods provided herein can be utilized to protect plants from Phytophthora infection.
  • Screening and selection of Phytophthora tolerant soybean plants may be performed, for example, by exposing plants to Phytophthora and selecting those plants showing tolerance to Phytophthora. Various assays can be used to measure tolerance or improved tolerance to Phytophthora. For example, Phytophthora tolerance can be determined by visual observations after plant exposure to a particular race of Phytophthora.
  • Non-limiting examples of Phytophthora tolerance phenotypic screening are described in detail below.
  • PHYTOPHTHORA FIELD TOLERANCE. Tolerance to Phytophthora root rot is rated on a scale of 1 to 9, with a score of 1 indicating the plants have no tolerance to Phytophthora, ranging to a score of 9 being the best or highest tolerance. PRTLAB indicates the tolerance was scored using plants in lab assay experiments. Preliminary scores are reported as double digits, for example ‘55’ indicates a preliminary score of 5 on the scale of 1 to 9.
    PHYTOPHTHORA RESISTANCE GENE (Rps). Various Phytophthora resistance genes are known and include but are not limited to: Rps1-a=resistance to races 1-2, 10-11, 13-8, 24; Rps1-c=resistance to races 1-3, 6-11, 13, 15, 17, 21, 23, 24, 26, 28-30, 32, 34, 36; Rps1-k=resistance to races 1-11, 13-15, 17, 18, 21-24, 26, 36, 37; Rps3-a=resistance to races 1-5, 8, 9, 11, 13, 14, 16, 18, 23, 25, 28, 29, 31-35, 39-41, 43-45, 47-52, 54; Rps3-c=resistance to races 1-4, 10-16, 18-36, 38-54; Rps6=resistance to races 1-4, 10, 12, 14-16, 18-21, 25, 28, 33-35; and, Rps8=resistance to races 1-5, 9, 13-15, 21, 25, 29, 32. RESISTANCE. As used herein, resistance is synonymous with tolerance and is used to describe the ability of a plant to withstand exposure to an insect, disease, herbicide, environmental stress, or other condition. A resistant plant variety will be able to better withstand the insect, disease pathogen, herbicide, environmental stress, or other condition as compared to a non-resistant or wild-type variety.
  • Genes that confer resistance to Phytophthora Root Rot, such as Rps1, Rps1-a, Rps1-b, Rps1-c, Rps1-d, Rps1-e, Rps1-k, Rps2, Rps3-a, Rps3-b, Rps3-c, Rps4, Rps5, Rps6, Rps7, Rps8, and other Rps genes. See, for example, Shoemaker et al. “Phytophthora Root Rot Resistance Gene Mapping in Soybean”, Plant Genome IV Conference, San Diego, Calif. (1995).
  • Phytophthora sojae is maintained by refrigeration on agar. It is transferred to fresh agar plates to make inoculum for the test.
  • Test and check lines are grown in growth chambers under controlled light and controlled temperature conditions. The lines are inoculated at the seedling stage by injecting mycelium into the hypocotyl. The unclassified lines are incubated in conditions conducive for Phytophthora infection, and then evaluated when the known susceptible controls die. The plants can be inoculated with at least one of: Phytophthora race 4 (PMG04); Phytophthora race 7 (PMG07); and/or Phytophthora race 25 (PMG25). Experiments are scored 2-3 days following inoculation, depending on the reaction of susceptible and resistant checks. Infection phenotypes are classified based on the number of seedlings alive divided by the total number of seedlings inoculated. For example,
  • 9=9 of 9 plants alive and healthy
    5=5 of 9 plants alive and healthy
    1=1 or 0 of 9 plants alive and healthy
    M=no or poor germ (<5 seeds germinate)
  • The level of tolerance of soybean varieties to Phytophthora Root Rot can be evaluated and characterized in the field. Phytophthora Root Rot is well known to those skilled in the art (see, e.g., Schmitthenner and Walker, Tolerance versus resistance for control of Phytophthora root rot of soybeans. p. 35-44 In H. D. Loden and D. Wilkenson (ed.) Proceedings of the 9th Soybean Seed Research Conference, Chicago, Ill. 13-14 Dec. 1979. American Seed Trade Association, Washington, D.C.; Walker and Schmitthenner (1984) Crop Science 24:487-489; and, Schmitthenner and Bhat. 1994. Useful methods for studying Phytophthora in the laboratory. Department of Plant Pathology. Ohio Agricultural Research and Development Center. Circular 143).
  • For testing, seed samples from experimental and check lines are not treated with any seed treatment. A known set of differential checks is used. One or more races of Phytophthora are chosen. Normally, at least Race 25 Phytophthora sojae is used. Experimental lines and checks are sown in vermiculite in trays that are inoculated with mycelium. The trays are moved outside to a location covered with 30% sunlight block netting.
  • Differential checks with low tolerance show symptoms 1-2 weeks after planting. Experimental lines are scored approximately three weeks after planting by removing the plants and root mass intact from the vermiculite. The vermiculite is removed by tapping the roots, without damaging the roots. All experimental entries are scored relative to the appearance of the root system of one or more check variety(s) and the known performance chart score of each check. Scores are assigned on a scale of 1-9, and are relative to the differential checks and based upon total root mass, general appearance of plants and roots, and extent of necrosis.
  • 1=all plants die after emerging
    2=50% less root mass than 9306
    3=equal to 9306
    4=50% less root mass than Conrad, 25% more than 9306
    5=25% less root mass than Conrad
    6=equal to Conrad
    7=equal to 92B38 and/or 93B67
    8=equal to 93B45
    9=equal to 9242
  • In some examples, a kit or an automated system for detecting marker loci, haplotypes, and marker profiles, and/or correlating the marker loci, haplotypes, and marker profiles with a desired phenotype (e.g., Phytophthora tolerance) are provided. As used herein, “kit” refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the identification and/or the detection of a soybean plant or germplasm having tolerance or improved tolerance to Phytophthora.
  • In one embodiment, a kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection is provided. Such a kit comprises (a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) associated with the Rps1a, Rsp1c, Rps1d or Rps1k loci on linkage group N; (ii) associated with Rps2 locus on linkage group J; (iii) associated with the Rps3a or Rps3c loci on linkage group F; or (iv) associated with the Rps6 locus on linkage group G; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
  • In a specific embodiment, the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N, such as, for example, the markers provided in FIG. 1A-C; (c) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J, such as, for example, the markers provided in FIG. 3 A-C; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F, such as, for example, those markers provided in FIG. 2 A-D; or (e) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G, such as, for example, the markers provided in FIG. 4 A-E.
  • Thus, a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with tolerance to Phytophthora infection, for instance a favorable marker locus, haplotype or marker profile. These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g., using any available allele detection format, such as solid or liquid phase array based detection, microfluidic-based sample detection, etc. The systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
  • A typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele. A wide variety of signal detection apparatus are available, including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo-scans, microfluidic nucleic acid amplification detection appliances and the like. The precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used. Typical detector examples include light (e.g., fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele. The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to “real time” amplification assay results.
  • System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted tolerance are also provided. For example, the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted tolerance. The precise form of the instructions can vary depending on the components of the system, e.g., they can be present as system software in one or more integrated unit of the system (e.g., a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g., computers or computer readable media) operably coupled to the detector. As noted, in one typical example, the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted tolerance. The instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
  • Isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein. In one embodiment, the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N; (c) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or (e) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • In specific embodiments, the isolated polynucleotide comprises: (a) a polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339 or 1340; (b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1341 or 1342; (c) a polynucleotide having at least 90% sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342; or (d) a polynucleotide comprising at least 10 contiguous nucleotides of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342.
  • In certain embodiments, the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to Phytophthora, for instance to particular SNPs that comprise a marker locus, haplotype or marker profile.
  • As used herein, a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions. A polynucleotide is said to be the “complement” of another polynucleotide if they exhibit complementarity. As used herein, molecules are said to exhibit “complete complementarity” when every nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other. Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions. Similarly, the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions.
  • Appropriate stringency conditions which promote DNA hybridization, for example, 6×sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2×SSC at 50° C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
  • Non-limiting examples of methods and compositions disclosed herein are as follows:
  • 1. A method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
  • (a) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
  • (b) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
  • (c) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
  • (d) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
  • (e) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • 2. The method of embodiment 1, wherein at least two marker loci are detected.
    3. The method of embodiment 2, wherein the at least two marker loci comprise a haplotype that is associated with said tolerance.
    4. The method of embodiment 2, wherein the at least two marker loci comprise a marker profile that is associated with said tolerance.
    5. The method of any one of embodiments 1-4, wherein the germplasm is a soybean variety.
    6. The method of any one of embodiments 1-5, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
    7. The method of embodiment 6, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
    8. The method of embodiment 7, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
    9. The method of any one of embodiments 1-8, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
    10. The method of any one of embodiments 1-8, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
    11. The method of embodiment 10, wherein the amplifying comprises:
  • a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
  • b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
  • 12. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs:155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394.
    13. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
    14. The method of embodiment 13, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof.
    15. The method of embodiment 14, wherein said primer pair comprises:
  • a) SEQ ID NO: 1 and SEQ ID NO:2;
  • b) SEQ ID NO: 9 and SEQ ID NO:10;
  • c) SEQ ID NO: 20 and SEQ ID NO:21;
  • d) SEQ ID NO: 22 and SEQ ID NO: 23;
  • e) SEQ ID NO: 24 and SEQ ID NO: 25;
  • f) SEQ ID NO: 36 and SEQ ID NO: 37;
  • g) SEQ ID NO: 38 and SEQ ID NO: 39; or
  • h) SEQ ID NO: 1339 and SEQ ID NO: 1340.
  • 16. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179 or 180.
    17. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
    18. The method of embodiment 17, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof.
    19. The method of embodiment 18, wherein said primer pair comprises:
  • a) SEQ ID NO: 40 and SEQ ID NO: 41;
  • b) SEQ ID NO: 46 and SEQ ID NO: 47;
  • c) SEQ ID NO: 52 and SEQ ID NO: 53;
  • d) SEQ ID NO: 58 and SEQ ID NO: 59;
  • e) SEQ ID NO: 64 and SEQ ID NO: 65; or
  • f) SEQ ID NO: 75 and SEQ ID NO: 76.
  • 20. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185 or 186.
    21. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
    22. The method of embodiment 21, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof.
    23. The method of embodiment 22, wherein said primer pair comprises:
  • a) SEQ ID NO: 81 and SEQ ID NO: 82;
  • b) SEQ ID NO: 89 and SEQ ID NO: 90; or
  • c) SEQ ID NO: 91 and SEQ ID NO: 92.
  • 24. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 187, 188, 189 or 190.
    25. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
    26. The method of embodiment 25, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
    27. The method of embodiment 26, wherein said primer pair comprises:
  • a) SEQ ID NO: 95 and SEQ ID NO: 96; or
  • b) SEQ ID NO: 101 and SEQ ID NO: 102.
  • 28. The method of embodiment 11, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
    29. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
    30. The method of embodiment 29, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342.
    31. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
    32. The method of embodiment 31, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139.
    33. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
    34. The method of embodiment 33, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149.
    35. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
    36. The method of embodiment 35, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152, 153 or 154.
    37. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N.
    38. The isolated polynucleotide of embodiment 37, wherein the polynucleotide comprises:
  • (a) a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339 or 1340;
  • (b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
  • (c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
  • (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
  • 39. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J.
    40. The isolated polynucleotide of embodiment 39, wherein the polynucleotide comprises:
  • (a) a polynucleotide comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78;
  • (b) a polynucleotide comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
  • (c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
  • (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
  • 41. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
    42. The isolated polynucleotide of embodiment 41, wherein the polynucleotide comprises:
  • (a) a polynucleotide comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 or 92;
  • (b) a polynucleotide comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149;
  • (c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
  • (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
  • 43. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
    44. The isolated polynucleotide of embodiment 43, wherein the polynucleotide comprises:
  • (a) a polynucleotide comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104;
  • (b) a polynucleotide comprising SEQ ID NOs: 150, 151, 152, 153 or 154;
  • (c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
  • (d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
  • 45. A kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection, the kit comprising:
  • (a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein the primers or probes are capable of detecting a marker locus, wherein:
      • (i) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
      • (ii) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
      • (iii) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
      • (iv) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
      • (v) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
    • EXPERIMENTAL
  • The following examples are offered to illustrate, but not to limit the claimed invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.
    • Example 1 Marker Loci Associated with Phytophthora Tolerance at Rps1 Loci
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps1 locus on linkage group N (ch 3). Markers were screened against various known resistant and susceptible parents.
    • A. Rps1a
  • A marker to locus S08291-1 was developed to identify alleles associated with the phytophthora resistance phenotype, this marker detects a G/A polymorphism associated with Rps1a. A panel of lines used for development for markers to identify Rps1c included lines with Rps1k and Rps1a, and provided information for alleles in the Rps1a genomic region. During development, this marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize the marker system for high throughput analysis of soybean. From this testing, S08291-1-Q5 was chosen for high throughput analysis needs, but other versions can be used to detect the polymorphism. This marker was used to fingerprint about 2000 lines.
  • Genomic DNA was extracted for testing using a standard CTAB protocol and exemplary amplification conditions are described below.
  • Cycle settings: Taqman™ assay
  •
    94° C.  2 min  1 cycle
    94° C. 30 sec 40 cycles
    60° C. 60 sec

    Amplification Mix (in microliters):
  • H2O 3.625
    hottub buffer 0.5
    dNTP (2.5 mM each) 0.375
    primer1 + primer2 (10 uM each) 0.15
    primer3 + primer4 (10 uM each) 0.15
    probe 1 (10 uM) 0.05
    Probe 2 (10 uM) 0.05
    hottub enzyme 0.025
    Invitrogen rox dye (50X) 0.075
    DNA 0.05
    Total 5.05
    • B. Rps1c
  • Several populations were developed in order to identify and characterize Phytophthora resistance loci and polymorphisms for marker development. The following biparental crosses were made and phenotyped for the Phytophthora races (PMG Race) indicated, as shown in Table 6.
  • TABLE 6
    Parent 1 Parent 2 Gene Entries PMG Race(s)
    92M61 93Y13 Deletion/Rps1c 120 7
    91Y20 93Y13 Rps1k/Rps1c 92 7 & 4
    93M42 XB18S09 Rps1a/Rps1c 92 7 & 1
    92M61 XB18S09 Deletion/Rps1c 92 7
  • Markers to the S07292-1 locus and the S08242 locus were developed to identify alleles associated with the Phytophthora resistance phenotype associated with Rps1c. During development, these markers were validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
    • C. Rps1d
  • Rps1d was mapped near Rps1k and may be an alternate allele of the Rps1 locus (Sugimoto et al., 2008. Identification of SSR markers linked to the Phytophthora resistance gene Rps1-d in soybean (2008) Plant Breeding, 127 (2): 154-159). SNPs that could be used for marker assisted selection of Rps1d were identified near the Rps1k region through sequencing of amplicons generated using extracted DNA from EX23U07, a progeny of the Rps1d donor PI103091. EX23U07 has the minor allele at SNP, S16592-001, which was found to be at low allele frequency across a diverse set of germplasm (˜6.2%, see table below). The Taqman assay S16592-001-Q001 was designed to assay this SNP and will be useful for MAS of Rps1d.
  • TABLE 7
    The following lines were genotyped using the Taqman marker
    S16592-001-Q001. Column three indicates the predicted allele
    at the Rps1 locus within the respective line based on
    phenotypic screens of phytophthora resistance.
    S16592-
    Sample Name 001 Trait
    EX23U07 A Rps1d
    ARKSOY A Rps1c
    Ralsoy A Rps1c
    91Y41 A Rps1c
    91Y92 A Rps1c
    92M81 A Rps1c
    93M14 A Rps1c
    93Y80 A Rps1c
    ARKSOY A Rps1c
    Ralsoy A Rps1c
    Sheyenne A —
    92B38 T None
    92M33 T None
    92M61 T None
    92Y70 T None
    93Y23 T None
    93Y30 T None
    93Y70 T None
    93Y72 T None
    93Y92 T None
    94M80 T None
    94Y50 T None
    94Y70 T None
    94Y80 T None
    94Y90 T None
    95M50 T None
    95Y01 T None
    95Y20 T None
    95Y30 T None
    95Y31 T None
    90M01 T Rps1k
    90M02 T Rps1k
    90M91 T Rps1k
    90M92 T Rps1k
    90Y21 T Rps1k
    90Y41 T Rps1k
    90Y42 T Rps1k
    90Y50 T Rps1k
    90Y70 T Rps1k
    91B42 T Rps1k
    91M01 T Rps1k
    91M13 T Rps1k
    91M30 T Rps1k
    91M41 T Rps1k
    91M51 T Rps1k
    91M61 T Rps1k
    91Y20 T Rps1k
    91Y21 T Rps1k
    91Y70 T Rps1k
    91Y72 T Rps1k
    91Y80 T Rps1k
    92B12 T Rps1k
    92M02 T Rps1k
    92M11 T Rps1k
    92M21 T Rps1k
    92M72 T Rps1k
    92M76 T Rps1k
    92M91 T Rps1k
    92Y10 T Rps1k
    92Y20 T Rps1k
    92Y21 T Rps1k
    92Y30 T Rps1k
    92Y51 T Rps1k
    92Y52 T Rps1k
    92Y54 T Rps1k
    92Y60 T Rps1k
    92Y61 T Rps1k
    92Y72 T Rps1k
    92Y80 T Rps1k
    92Y82 T Rps1k
    92Y90 T Rps1k
    92Y91 T Rps1k
    93B82 T Rps1k
    93B86 T Rps1k
    93M11 T Rps1k
    93M82 T Rps1k
    93M92 T Rps1k
    93M96 T Rps1k
    93Y02 T Rps1k
    93Y04 T Rps1k
    93Y05 T Rps1k
    93Y10 T Rps1k
    93Y11 T Rps1k
    93Y15 T Rps1k
    93Y20 T Rps1k
    93Y21 T Rps1k
    93Y40 T Rps1k
    93Y50 T Rps1k
    93Y51 T Rps1k
    93Y60 T Rps1k
    93Y81 T Rps1k
    93Y90 T Rps1k
    93Y91 T Rps1k
    93Y93 T Rps1k
    94B73 T Rps1k
    94M30 T Rps1k
    94Y01 T Rps1k
    94Y10 T Rps1k
    94Y20 T Rps1k
    94Y30 T Rps1k
    94Y40 T Rps1k
    94Y60 T Rps1k
    94Y91 T Rps1k
    95Y40 T Rps1k
    93M42 T 1A
    93Y82 T 1A
    95Y10 T 1A
    KINGWA T Rps1k
    9071 T Rps1c
    9181 T Rps1c
    900Y71 T Rps1c
    90B43 T Rps1c
    90B51 T Rps1c
    90M60 T Rps1c
    90M80 T Rps1c
    90Y90 T Rps1c
    94Y21 T Rps1c
    A1564 T —
    A2943 T —
    A3127 T —
    A3733 T —
    A4715 T —
    A5979 T —
    A6297 T —
    ADAMS T —
    BAVENDERSPECIALA T —
    BLACKHAWK T —
    Capital T —
    CLARK T —
    CLARK63 T —
    CNS T —
    DORMAN T —
    Dunfield T —
    ESSEX T —
    FC31745 T —
    FOWLER T —
    Haberlandt T —
    HAROSOY T —
    HAWKEYE T —
    Illini T —
    JACKSON T —
    Kanro T —
    KS3406 T —
    L15 T —
    LEE T —
    Lincoln T —
    LP14575198 T —
    MT95-123720 T —
    Mukden T —
    OGDEN T —
    P2981 T —
    Palmetto T —
    Patoka T —
    Peking T —
    PERRY T —
    PI084674 T —
    PI171442 T —
    PI180501 T —
    PI248404 T —
    PI391589 T —
    PI424195B T —
    PI437151 T —
    PI54610 T —
    PI605891B T —
    PI81041 T —
    PI84946-2 T —
    PI88788 T —
    PI91110-1 T —
    Pintado T —
    Richland T —
    S-100 T —
    SENECA T —
    ST2250 T —
    ST2660 T —
    Tokyo T —
    WAYNE T —
    Williams T —
    • D. Rps1k
  • Markers to loci S00009-1, S07963-2, and S08013 were developed in order to characterize and identify lines having a Rps1k resistance allele. It was observed that over time marker S00009-01-A did not always identify lines known to have Rps1k. It was hypothesized that this could be due to a recombination event in the region. A new target region was selected near the Rps1k locus and sequenced. Markers S07963-2-Q1 and S08013-1Q were designed based on the SNP profile of the sequenced region. These markers were tested on a panel of public and proprietary lines which included known Rps1k lines, susceptible lines, and other test lines. The allele and haplotype data are summarized below in Table 8.
  • TABLE 8
    #
    Phenotype lines S00009-01-A S07963-2-Q1 S08013-1-Q1
    1k 5 C T C
    SUS 17 T C T
    1k + 3a C T C
    1k 1 — — —
    1k + unknown 1 C T C
    Unknown 5 T C T
    1k 1 T T C
    SUS 3 C C T
  • Markers S07963-2-Q1 and S08013-1Q were further evaluated and validated against four F3 mapping populations using the following amplification conditions.
    • PCR Cycle Settings
  • 94° C. 10 min  1 cycle
    94° C. 30 sec 40 cycles
    60° C. 60 sec 40 cycles
    • TAQMAN™ Amplification Mix (Volumes in Microliters)
  • DNA (dried down) 16 ng
    Water 2.42
    KlearKall Mastermix 2.5
    Forward Primer (100 μm) 0.0375
    Reverse Primer (100 μm) 0.0375
    Probe 1 (100 μm) 0.005
    Probe 2 (100 μm) 0.005
    Total 5
    • Case Control Association Analysis
  • Using a case-control association analysis, the Rps1k locus which conditions variation in phytophthora root rot resistance, was fine-mapped between 3915646-4533559 bp on Gm03 (Lg N). A set of 581 SNPs were identified in this region that perfectly differentiate resistant from susceptible lines. These markers are ideal candidates for marker-assisted selection of resistance to phytophthora root rot from the Rps1k locus.
  • Phenotypic data from lab screening for Phytophthora resistance was used in the study. DNA was prepped using standard Illumina TruSeq Chemistry. Selected resistant and susceptible lines formed the case groups and were sequenced to ˜0.5-40x genome coverage on an Illumina HiSeq2000. SNPs were called using a proprietary software to automate the process, missing data was imputed using a separate proprietary software. Haploview was used to conduct a case-control association analysis on a set of 15537 SNPs identified in the region from 34000026-5085535 bp on Gm03. The case group comprised 57 proprietary soybean lines resistant to phytophthora and the control group comprised 9 proprietary susceptible lines. Following Haploview filtering using the settings noted below, 7491 SNPs remained in the analysis. Nine SNPs had all missing values in the control group and were removed from additional analysis.
    • Haploview Settings:
      • Do Association Test
      • Case/Control Data
      • Ignore Pairwise comparisons of markers>10 kb apart
      • Exclude individuals with >50% missing genotypes
      • HW p-value cutoff: 0.0
      • Min genotype % 50
      • Max # mendel errors: 1
      • Minimum minor allele freq. 0.05
  • The presence of haplotypes were also observed in a panel of lines not included in the association study.
  • A plot of chi square values from case-control analysis versus physical position of 7482 SNPs reveals a peak of SNP to trait association between 3915646-4533559 bp on Gm03, suggesting that a locus conditioning phytophthora resistance is in this region. A total of 581 SNPs have a perfect association between 9 susceptible (control) and 57 resistant (case) lines (Table 9). These markers are ideal for TaqMan™ assay design or for evaluation by other methods, including sequencing, hybridization, or other technologies. Numerous additional SNPs analyzed here that are linked to region but are not in perfect LD with trait could be very informative markers when used in select germplasm.
  • TABLE 9
    Ref. Ref.
    Sequence Sequence
    Assoc Case, Control Case, Control Chi SEQ ID NO SEQ ID NO
    Name Allele Ratio Counts Frequencies Square P-value (Res.) (Sus.)
    Gm03:3915646 A 112:0, 0:8 1.000, 0.000 120 6.33E−28 1345 1346
    Gm03:3917778 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 191 747
    Gm03:3918853 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 192 748
    Gm03:3920367 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 193 749
    Gm03:3926721 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 194 750
    Gm03:3926775 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 195 751
    Gm03:3927474 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 196 752
    Gm03:3927724 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 197 753
    Gm03:3929330 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 198 754
    Gm03:3929383 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 199 755
    Gm03:3930408 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 200 756
    Gm03:3930551 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 201 757
    Gm03:3930806 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 202 758
    Gm03:3932629 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 203 759
    Gm03:3932974 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 204 760
    Gm03:3933370 A 112:0, 0:8 1.000, 0.000 120 6.33E−28 1347 1348
    Gm03:3933900 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 205 761
    Gm03:3933945 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 206 762
    Gm03:3934403 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 207 763
    Gm03:3934964 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 208 764
    Gm03:3935036 G 114:0, 0:16 1.000, 0.000 130 4.10E−30 209 765
    Gm03:3935832 G 114:0, 0:16 1.000, 0.000 130 4.10E−30 210 766
    Gm03:3935884 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 211 767
    Gm03:3939831 C 112:0, 0:18 1.000, 0.000 130 4.10E−30 212 768
    Gm03:3939836 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 213 769
    Gm03:3939936 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 214 770
    Gm03:3939939 G 114:0, 0:6 1.000, 0.000 120 6.33E−28 215 771
    Gm03:3940174 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 216 772
    Gm03:3940396 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 217 773
    Gm03:3940836 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 218 774
    Gm03:3941262 A 112:0, 0:16 1.000, 0.000 128 1.12E−29 219 775
    Gm03:3941484 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 220 776
    Gm03:3941769 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 221 777
    Gm03:3942973 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 222 778
    Gm03:3943092 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 223 779
    Gm03:3944671 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 224 780
    Gm03:3944738 C 114:0, 0:6 1.000, 0.000 120 6.33E−28 225 781
    Gm03:3945112 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 226 782
    Gm03:3945208 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 227 783
    Gm03:3947836 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 228 784
    Gm03:3947860 G 114:0, 0:6 1.000, 0.000 120 6.33E−28 229 785
    Gm03:3949250 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 230 786
    Gm03:3949680 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 231 787
    Gm03:3951187 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 232 788
    Gm03:3951201 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 233 789
    Gm03:3951485 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 234 790
    Gm03:3951603 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 235 791
    Gm03:3951705 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 236 792
    Gm03:3951715 G 114:0, 0:16 1.000, 0.000 130 4.10E−30 237 793
    Gm03:3952778 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 1349 1350
    Gm03:3952811 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 1351 1352
    Gm03:3955716 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 238 794
    Gm03:3956414 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 239 795
    Gm03:3958402 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 240 796
    Gm03:3960626 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 241 797
    Gm03:3962904 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 242 798
    Gm03:3967880 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 243 799
    Gm03:3968334 G 114:0, 0:14 1.000, 0.000 128 1.12E−29 1353 1354
    Gm03:3971607 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 244 800
    Gm03:3971640 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 245 801
    Gm03:3971692 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 246 802
    Gm03:3975817 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 247 803
    Gm03:3975824 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 248 804
    Gm03:3976645 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 249 805
    Gm03:3980566 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 250 806
    Gm03:3981623 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 251 807
    Gm03:3981822 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 252 808
    Gm03:3982138 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 253 809
    Gm03:3982678 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 254 810
    Gm03:3984554 C 114:0, 0:4 1.000, 0.000 118 1.73E−27 255 811
    Gm03:3986094 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 256 812
    Gm03:3987393 C 114:0, 0:4 1.000, 0.000 118 1.73E−27 257 813
    Gm03:3990954 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 258 814
    Gm03:3992071 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 259 815
    Gm03:3995556 C 112:0, 0:18 1.000, 0.000 130 4.10E−30 260 816
    Gm03:3996269 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 261 817
    Gm03:3996600 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 262 818
    Gm03:3997028 C 114:0, 0:16 1.000, 0.000 130 4.10E−30 263 819
    Gm03:3998157 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 264 820
    Gm03:3998162 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 265 821
    Gm03:3998381 T 112:0, 0:18 1.000, 0.000 130 4.10E−30 266 822
    Gm03:3998421 T 110:0, 0:18 1.000, 0.000 128 1.12E−29 267 823
    Gm03:3999241 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 268 824
    Gm03:3999386 C 114:0, 0:16 1.000, 0.000 130 4.10E−30 269 825
    Gm03:3999666 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 270 826
    Gm03:4000684 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 1355 1356
    Gm03:4001327 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 271 827
    Gm03:4001783 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 272 828
    Gm03:4002016 C 112:0, 0:12 1.000, 0.000 124 8.42E−29 273 829
    Gm03:4005770 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 274 830
    Gm03:4008187 G 114:0, 0:16 1.000, 0.000 130 4.10E−30 275 831
    Gm03:4008673 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 276 832
    Gm03:4008687 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 277 833
    Gm03:4010191 C 114:0, 0:16 1.000, 0.000 130 4.10E−30 278 834
    Gm03:4018588 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 279 835
    Gm03:4019384 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 280 836
    Gm03:4019896 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 281 837
    Gm03:4020751 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 282 838
    Gm03:4021281 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 283 839
    Gm03:4021291 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 284 840
    Gm03:4022234 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 285 841
    Gm03:4022275 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 286 842
    Gm03:4022530 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 287 843
    Gm03:4022872 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 288 844
    Gm03:4022934 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 289 845
    Gm03:4023283 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 290 846
    Gm03:4023522 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 291 847
    Gm03:4024184 C 114:0, 0:16 1.000, 0.000 130 4.10E−30 292 848
    Gm03:4024294 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 293 849
    Gm03:4024485 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 294 850
    Gm03:4024630 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 295 851
    Gm03:4024844 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 296 852
    Gm03:4025056 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 297 853
    Gm03:4026652 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 298 854
    Gm03:4028481 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 299 855
    Gm03:4028849 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 300 856
    Gm03:4028961 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 301 857
    Gm03:4029068 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 302 858
    Gm03:4029809 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 303 859
    Gm03:4031277 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 304 860
    Gm03:4031983 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 305 861
    Gm03:4031997 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 306 862
    Gm03:4032705 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 307 863
    Gm03:4035600 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 308 864
    Gm03:4035918 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 1357 1358
    Gm03:4036376 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 309 865
    Gm03:4040874 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 310 866
    Gm03:4041301 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 311 867
    Gm03:4041795 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 312 868
    Gm03:4042572 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 313 869
    Gm03:4042679 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 314 870
    Gm03:4042697 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 315 871
    Gm03:4043007 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 316 872
    Gm03:4043140 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 317 873
    Gm03:4043823 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 318 874
    Gm03:4043978 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 319 875
    Gm03:4044534 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 320 876
    Gm03:4044555 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 321 877
    Gm03:4044972 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 322 878
    Gm03:4045630 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 323 879
    Gm03:4046313 C 114:0, 0:18 1.000, 0.000 132 1.50E−30 324 880
    Gm03:4049555 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 325 881
    Gm03:4049791 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 326 882
    Gm03:4049877 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 327 883
    Gm03:4050197 A 112:0, 0:16 1.000, 0.000 128 1.12E−29 328 884
    Gm03:4053685 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 329 885
    Gm03:4053838 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 330 886
    Gm03:4054927 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 331 887
    Gm03:4055100 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 332 888
    Gm03:4055384 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 333 889
    Gm03:4055427 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 334 890
    Gm03:4055483 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 1359 1360
    Gm03:4062751 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 335 891
    Gm03:4062885 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 1361 1362
    Gm03:4064351 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 336 892
    Gm03:4064592 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 337 893
    Gm03:4064759 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 338 894
    Gm03:4064811 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 339 895
    Gm03:4064957 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 340 896
    Gm03:4065083 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 341 897
    Gm03:4066234 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 342 898
    Gm03:4066331 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 343 899
    Gm03:4067099 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 344 900
    Gm03:4067514 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 345 901
    Gm03:4069037 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 346 902
    Gm03:4069603 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 347 903
    Gm03:4070422 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 348 904
    Gm03:4072567 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 349 905
    Gm03:4074190 T 112:0, 0:10 1.000, 0.000 122 2.31E−28 350 906
    Gm03:4075232 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 351 907
    Gm03:4076404 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 352 908
    Gm03:4078299 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 353 909
    Gm03:4078902 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 354 910
    Gm03:4080136 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 355 911
    Gm03:4081056 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 356 912
    Gm03:4081889 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 357 913
    Gm03:4082200 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 358 914
    Gm03:4082590 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 359 915
    Gm03:4082701 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 360 916
    Gm03:4082781 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 361 917
    Gm03:4082871 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 362 918
    Gm03:4083114 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 363 919
    Gm03:4084001 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 364 920
    Gm03:4084095 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 365 921
    Gm03:4085042 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 366 922
    Gm03:4085524 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 367 923
    Gm03:4086286 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 368 924
    Gm03:4086887 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 369 925
    Gm03:4087383 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 370 926
    Gm03:4088310 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 371 927
    Gm03:4090188 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 372 928
    Gm03:4092799 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 373 929
    Gm03:4092928 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 374 930
    Gm03:4093195 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 375 931
    Gm03:4093240 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 376 932
    Gm03:4097291 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 377 933
    Gm03:4097563 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 378 934
    Gm03:4097729 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 379 935
    Gm03:4098328 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 380 936
    Gm03:4100831 A 114:0, 0:6 1.000, 0.000 120 6.33E−28 1363 1364
    Gm03:4101257 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 381 937
    Gm03:4103342 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 382 938
    Gm03:4103449 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 383 939
    Gm03:4103450 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 384 940
    Gm03:4103515 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 385 941
    Gm03:4103547 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 386 942
    Gm03:4103633 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 387 943
    Gm03:4104502 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 388 944
    Gm03:4106406 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 389 945
    Gm03:4109228 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 390 946
    Gm03:4110012 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 391 947
    Gm03:4110449 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 392 948
    Gm03:4110821 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 393 949
    Gm03:4111538 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 394 950
    Gm03:4113757 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 395 951
    Gm03:4116726 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 396 952
    Gm03:4117330 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 397 953
    Gm03:4117375 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 398 954
    Gm03:4117779 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 399 955
    Gm03:4117890 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 400 956
    Gm03:4117986 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 401 957
    Gm03:4120433 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 402 958
    Gm03:4120705 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 403 959
    Gm03:4122180 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 404 960
    Gm03:4129251 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 405 961
    Gm03:4129479 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 406 962
    Gm03:4129635 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 407 963
    Gm03:4130393 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 408 964
    Gm03:4131257 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 409 965
    Gm03:4132032 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 410 966
    Gm03:4132192 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 411 967
    Gm03:4133520 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 412 968
    Gm03:4134606 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 413 969
    Gm03:4134679 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 414 970
    Gm03:4136487 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 415 971
    Gm03:4136724 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 416 972
    Gm03:4136742 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 417 973
    Gm03:4136791 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 418 974
    Gm03:4136972 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 419 975
    Gm03:4137137 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 420 976
    Gm03:4137521 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 421 977
    Gm03:4137540 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 422 978
    Gm03:4137645 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 423 979
    Gm03:4138435 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 424 980
    Gm03:4138980 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 425 981
    Gm03:4139156 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 426 982
    Gm03:4139395 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 1365 1366
    Gm03:4140035 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 427 983
    Gm03:4140071 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 428 984
    Gm03:4140976 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 429 985
    Gm03:4141074 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 430 986
    Gm03:4141090 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 431 987
    Gm03:4141251 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 432 988
    Gm03:4141363 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 433 989
    Gm03:4141488 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 434 990
    Gm03:4142353 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 435 991
    Gm03:4142380 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 436 992
    Gm03:4142693 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 437 993
    Gm03:4142800 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 438 994
    Gm03:4142810 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 439 995
    Gm03:4143060 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 440 996
    Gm03:4143112 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 441 997
    Gm03:4143113 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 442 998
    Gm03:4144137 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 443 999
    Gm03:4144350 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 444 1000
    Gm03:4144639 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 445 1001
    Gm03:4145737 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 446 1002
    Gm03:4145959 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 447 1003
    Gm03:4145974 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 448 1004
    Gm03:4146284 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 449 1005
    Gm03:4147289 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 450 1006
    Gm03:4147425 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 451 1007
    Gm03:4148248 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 452 1008
    Gm03:4148643 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 453 1009
    Gm03:4148732 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 454 1010
    Gm03:4149880 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 1367 1368
    Gm03:4149919 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 455 1011
    Gm03:4150189 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 456 1012
    Gm03:4150330 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 457 1013
    Gm03:4151366 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 458 1014
    Gm03:4152106 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 459 1015
    Gm03:4153221 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 460 1016
    Gm03:4153413 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 461 1017
    Gm03:4153505 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 462 1018
    Gm03:4153885 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 463 1019
    Gm03:4154059 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 464 1020
    Gm03:4156891 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 465 1021
    Gm03:4158622 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 466 1022
    Gm03:4159661 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 467 1023
    Gm03:4160698 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 468 1024
    Gm03:4162268 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 469 1025
    Gm03:4163423 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 470 1026
    Gm03:4164061 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 471 1027
    Gm03:4164065 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 472 1028
    Gm03:4164142 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 473 1029
    Gm03:4164401 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 474 1030
    Gm03:4164507 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 475 1031
    Gm03:4164719 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 476 1032
    Gm03:4164807 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 477 1033
    Gm03:4166307 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 478 1034
    Gm03:4166432 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 479 1035
    Gm03:4167439 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 480 1036
    Gm03:4167591 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 481 1037
    Gm03:4167701 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 482 1038
    Gm03:4168907 T 112:0, 0:12 1.000, 0.000 124 8.42E−29 483 1039
    Gm03:4169729 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 484 1040
    Gm03:4169784 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 485 1041
    Gm03:4169863 G 114:0, 0:6 1.000, 0.000 120 6.33E−28 1369 1370
    Gm03:4169950 T 114:0, 0:4 1.000, 0.000 118 1.73E−27 486 1042
    Gm03:4169995 G 112:0, 0:6 1.000, 0.000 118 1.73E−27 487 1043
    Gm03:4171393 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 488 1044
    Gm03:4171766 A 112:0, 0:10 1.000, 0.000 122 2.31E−28 1371 1372
    Gm03:4172171 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 489 1045
    Gm03:4173195 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 490 1046
    Gm03:4173316 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 491 1047
    Gm03:4173405 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 492 1048
    Gm03:4173524 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 493 1049
    Gm03:4175127 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 494 1050
    Gm03:4177056 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 495 1051
    Gm03:4177689 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 496 1052
    Gm03:4177690 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 497 1053
    Gm03:4178958 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 498 1054
    Gm03:4179972 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 499 1055
    Gm03:4180458 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 500 1056
    Gm03:4182337 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 501 1057
    Gm03:4184380 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 502 1058
    Gm03:4184951 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 503 1059
    Gm03:4184971 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 504 1060
    Gm03:4185234 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 505 1061
    Gm03:4185400 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 506 1062
    Gm03:4185863 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 507 1063
    Gm03:4187256 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 508 1064
    Gm03:4188732 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 509 1065
    Gm03:4189845 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 510 1066
    Gm03:4189964 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 511 1067
    Gm03:4190679 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 512 1068
    Gm03:4191313 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 513 1069
    Gm03:4191519 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 514 1070
    Gm03:4192359 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 515 1071
    Gm03:4192478 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 516 1072
    Gm03:4192513 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 517 1073
    Gm03:4192621 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 518 1074
    Gm03:4192738 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 519 1075
    Gm03:4193009 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 520 1076
    Gm03:4193030 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 1373 1374
    Gm03:4193039 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 521 1077
    Gm03:4193483 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 522 1078
    Gm03:4196188 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 523 1079
    Gm03:4196542 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 524 1080
    Gm03:4197697 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 1375 1376
    Gm03:4197774 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 525 1081
    Gm03:4198285 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 526 1082
    Gm03:4198508 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 527 1083
    Gm03:4198711 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 528 1084
    Gm03:4198914 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 529 1085
    Gm03:4199748 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 530 1086
    Gm03:4200094 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 531 1087
    Gm03:4203253 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 532 1088
    Gm03:4203462 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 533 1089
    Gm03:4203594 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 534 1090
    Gm03:4203626 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 535 1091
    Gm03:4204747 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 536 1092
    Gm03:4204867 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 537 1093
    Gm03:4205828 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 538 1094
    Gm03:4205953 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 539 1095
    Gm03:4206870 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 540 1096
    Gm03:4207703 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 541 1097
    Gm03:4215115 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 542 1098
    Gm03:4215690 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 543 1099
    Gm03:4215950 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 544 1100
    Gm03:4217736 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 545 1101
    Gm03:4218032 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 546 1102
    Gm03:4218527 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 547 1103
    Gm03:4218716 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 548 1104
    Gm03:4218990 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 549 1105
    Gm03:4219539 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 550 1106
    Gm03:4219667 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 551 1107
    Gm03:4221288 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 552 1108
    Gm03:4222312 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 553 1109
    Gm03:4223122 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 554 1110
    Gm03:4223821 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 555 1111
    Gm03:4224501 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 556 1112
    Gm03:4225137 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 557 1113
    Gm03:4225960 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 558 1114
    Gm03:4226471 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 559 1115
    Gm03:4227488 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 560 1116
    Gm03:4228931 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 561 1117
    Gm03:4229006 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 562 1118
    Gm03:4229247 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 563 1119
    Gm03:4230412 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 564 1120
    Gm03:4230665 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 565 1121
    Gm03:4230768 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 566 1122
    Gm03:4231904 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 567 1123
    Gm03:4231979 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 568 1124
    Gm03:4233068 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 569 1125
    Gm03:4233431 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 570 1126
    Gm03:4233493 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 571 1127
    Gm03:4233550 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 572 1128
    Gm03:4234109 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 573 1129
    Gm03:4234194 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 574 1130
    Gm03:4234277 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 575 1131
    Gm03:4234310 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 576 1132
    Gm03:4235089 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 577 1133
    Gm03:4235183 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 578 1134
    Gm03:4235519 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 579 1135
    Gm03:4235634 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 580 1136
    Gm03:4235844 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 581 1137
    Gm03:4236123 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 582 1138
    Gm03:4236298 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 583 1139
    Gm03:4239026 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 584 1140
    Gm03:4242434 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 585 1141
    Gm03:4243529 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 586 1142
    Gm03:4244201 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 587 1143
    Gm03:4244338 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 588 1144
    Gm03:4244497 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 589 1145
    Gm03:4245348 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 590 1146
    Gm03:4245390 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 591 1147
    Gm03:4245678 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 592 1148
    Gm03:4246770 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 593 1149
    Gm03:4246837 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 594 1150
    Gm03:4247592 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 595 1151
    Gm03:4247726 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 596 1152
    Gm03:4252413 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 597 1153
    Gm03:4252569 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 598 1154
    Gm03:4252894 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 599 1155
    Gm03:4252928 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 600 1156
    Gm03:4253518 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 601 1157
    Gm03:4257596 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 1377 1378
    Gm03:4257995 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 602 1158
    Gm03:4258161 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 603 1159
    Gm03:4258545 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 604 1160
    Gm03:4260785 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 605 1161
    Gm03:4260901 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 606 1162
    Gm03:4261372 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 607 1163
    Gm03:4261626 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 608 1164
    Gm03:4262516 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 609 1165
    Gm03:4262869 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 610 1166
    Gm03:4263876 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 611 1167
    Gm03:4264709 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 612 1168
    Gm03:4265916 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 613 1169
    Gm03:4266927 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 614 1170
    Gm03:4267296 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 615 1171
    Gm03:4268640 C 114:0, 0:14 1.000, 0.000 128 1.12E−29 616 1172
    Gm03:4268852 G 114:0, 0:6 1.000, 0.000 120 6.33E−28 617 1173
    Gm03:4295832 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 618 1174
    Gm03:4302907 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 619 1175
    Gm03:4302936 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 620 1176
    Gm03:4306709 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 621 1177
    Gm03:4307835 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 622 1178
    Gm03:4307996 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 623 1179
    Gm03:4308161 T 114:0, 0:8 1.000, 0.000 122 2.31E−28 624 1180
    Gm03:4308286 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 625 1181
    Gm03:4308323 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 626 1182
    Gm03:4308522 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 627 1183
    Gm03:4313900 C 114:0, 0:14 1.000, 0.000 128 1.12E−29 628 1184
    Gm03:4314212 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 629 1185
    Gm03:4314464 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 630 1186
    Gm03:4315256 A 114:0, 0:6 1.000, 0.000 120 6.33E−28 631 1187
    Gm03:4317574 G 114:0, 0:16 1.000, 0.000 130 4.10E−30 632 1188
    Gm03:4318530 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 633 1189
    Gm03:4319271 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 634 1190
    Gm03:4320841 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 635 1191
    Gm03:4321243 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 636 1192
    Gm03:4321515 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 637 1193
    Gm03:4328502 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 638 1194
    Gm03:4329219 C 112:0, 0:6 1.000, 0.000 118 1.73E−27 639 1195
    Gm03:4329504 T 112:0, 0:6 1.000, 0.000 118 1.73E−27 640 1196
    Gm03:4330121 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 641 1197
    Gm03:4330318 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 642 1198
    Gm03:4331246 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 643 1199
    Gm03:4331889 A 110:0, 0:12 1.000, 0.000 122 2.31E−28 644 1200
    Gm03:4337173 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 645 1201
    Gm03:4338377 G 112:0, 0:6 1.000, 0.000 118 1.73E−27 646 1202
    Gm03:4338505 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 647 1203
    Gm03:4338559 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 648 1204
    Gm03:4339885 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 649 1205
    Gm03:4341064 A 112:0, 0:14 1.000, 0.000 126 3.07E−29 650 1206
    Gm03:4342692 T 110:0, 0:8 1.000, 0.000 118 1.73E−27 651 1207
    Gm03:4342727 A 112:0, 0:12 1.000, 0.000 124 8.42E−29 652 1208
    Gm03:4343201 A 112:0, 0:12 1.000, 0.000 124 8.42E−29 653 1209
    Gm03:4343212 T 112:0, 0:8 1.000, 0.000 120 6.33E−28 654 1210
    Gm03:4348211 T 112:0, 0:6 1.000, 0.000 118 1.73E−27 655 1211
    Gm03:4350556 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 656 1212
    Gm03:4350658 A 110:0, 0:10 1.000, 0.000 120 6.33E−28 657 1213
    Gm03:4350767 G 114:0, 0:10 1.000, 0.000 124 8.42E−29 658 1214
    Gm03:4351326 T 110:0, 0:10 1.000, 0.000 120 6.33E−28 659 1215
    Gm03:4351612 T 112:0, 0:12 1.000, 0.000 124 8.42E−29 660 1216
    Gm03:4351617 T 112:0, 0:6 1.000, 0.000 118 1.73E−27 661 1217
    Gm03:4351674 A 114:0, 0:6 1.000, 0.000 120 6.33E−28 662 1218
    Gm03:4352353 T 112:0, 0:8 1.000, 0.000 120 6.33E−28 663 1219
    Gm03:4353932 T 112:0, 0:8 1.000, 0.000 120 6.33E−28 664 1220
    Gm03:4354036 C 112:0, 0:6 1.000, 0.000 118 1.73E−27 665 1221
    Gm03:4355046 C 112:0, 0:8 1.000, 0.000 120 6.33E−28 666 1222
    Gm03:4362911 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 667 1223
    Gm03:4363385 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 668 1224
    Gm03:4363855 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 669 1225
    Gm03:4364133 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 670 1226
    Gm03:4364176 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 671 1227
    Gm03:4364200 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 672 1228
    Gm03:4364469 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 673 1229
    Gm03:4385480 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 674 1230
    Gm03:4385781 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 675 1231
    Gm03:4386327 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 676 1232
    Gm03:4386398 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 677 1233
    Gm03:4386633 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 678 1234
    Gm03:4386927 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 679 1235
    Gm03:4387264 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 680 1236
    Gm03:4388736 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 681 1237
    Gm03:4388954 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 682 1238
    Gm03:4388982 A 114:0, 0:16 1.000, 0.000 130 4.10E−30 683 1239
    Gm03:4389208 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 684 1240
    Gm03:4389211 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 685 1241
    Gm03:4389280 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 686 1242
    Gm03:4389696 T 114:0, 0:12 1.000, 0.000 126 3.07E−29 687 1243
    Gm03:4390074 G 114:0, 0:4 1.000, 0.000 118 1.73E−27 1379 1380
    Gm03:4390738 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 688 1244
    Gm03:4390827 C 114:0, 0:8 1.000, 0.000 122 2.31E−28 689 1245
    Gm03:4390979 C 114:0, 0:4 1.000, 0.000 118 1.73E−27 690 1246
    Gm03:4392217 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 1381 1382
    Gm03:4392314 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 691 1247
    Gm03:4392891 G 114:0, 0:12 1.000, 0.000 126 3.07E−29 692 1248
    Gm03:4392913 G 114:0, 0:8 1.000, 0.000 122 2.31E−28 693 1249
    Gm03:4394477 C 114:0, 0:12 1.000, 0.000 126 3.07E−29 1383 1384
    Gm03:4394831 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 694 1250
    Gm03:4395386 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 695 1251
    Gm03:4395962 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 696 1252
    Gm03:4397872 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 697 1253
    Gm03:4398299 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 698 1254
    Gm03:4398919 T 114:0, 0:6 1.000, 0.000 120 6.33E−28 699 1255
    Gm03:4399399 G 114:0, 0:6 1.000, 0.000 120 6.33E−28 700 1256
    Gm03:4400461 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 701 1257
    Gm03:4404444 C 114:0, 0:14 1.000, 0.000 128 1.12E−29 702 1258
    Gm03:4410393 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 703 1259
    Gm03:4410565 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 704 1260
    Gm03:4411187 T 114:0, 0:10 1.000, 0.000 124 8.42E−29 705 1261
    Gm03:4412149 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 706 1262
    Gm03:4412417 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 707 1263
    Gm03:4412774 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 708 1264
    Gm03:4413415 C 114:0, 0:10 1.000, 0.000 124 8.42E−29 709 1265
    Gm03:4446891 T 112:0, 0:6 1.000, 0.000 118 1.73E−27 710 1266
    Gm03:4447988 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 711 1267
    Gm03:4448825 C 114:0, 0:6 1.000, 0.000 120 6.33E−28 712 1268
    Gm03:4449634 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 713 1269
    Gm03:4449956 T 112:0, 0:18 1.000, 0.000 130 4.10E−30 714 1270
    Gm03:4450328 C 114:0, 0:6 1.000, 0.000 120 6.33E−28 715 1271
    Gm03:4450331 G 114:0, 0:6 1.000, 0.000 120 6.33E−28 716 1272
    Gm03:4450888 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 717 1273
    Gm03:4451295 A 114:0, 0:14 1.000, 0.000 128 1.12E−29 1385 1386
    Gm03:4451491 A 114:0, 0:8 1.000, 0.000 122 2.31E−28 718 1274
    Gm03:4451503 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 719 1275
    Gm03:4451847 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 1387 1388
    Gm03:4452060 A 114:0, 0:12 1.000, 0.000 126 3.07E−29 720 1276
    Gm03:4452118 A 114:0, 0:10 1.000, 0.000 124 8.42E−29 721 1277
    Gm03:4452820 T 114:0, 0:14 1.000, 0.000 128 1.12E−29 1389 1390
    Gm03:4456305 T 114:0, 0:16 1.000, 0.000 130 4.10E−30 722 1278
    Gm03:4458273 G 114:0, 0:18 1.000, 0.000 132 1.50E−30 723 1279
    Gm03:4458399 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 724 1280
    Gm03:4461465 T 114:0, 0:18 1.000, 0.000 132 1.50E−30 725 1281
    Gm03:4462225 A 114:0, 0:18 1.000, 0.000 132 1.50E−30 726 1282
    Gm03:4471412 T 112:0, 0:8 1.000, 0.000 120 6.33E−28 1391 1392
    Gm03:4474352 A 112:0, 0:8 1.000, 0.000 120 6.33E−28 1393 1394
    Gm03:4477946 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 727 1283
    Gm03:4477947 C 112:0, 0:6 1.000, 0.000 118 1.73E−27 728 1284
    Gm03:4478247 C 112:0, 0:6 1.000, 0.000 118 1.73E−27 729 1285
    Gm03:4478479 G 112:0, 0:8 1.000, 0.000 120 6.33E−28 730 1286
    Gm03:4478554 A 112:0, 0:10 1.000, 0.000 122 2.31E−28 731 1287
    Gm03:4478921 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 732 1288
    Gm03:4479127 T 112:0, 0:6 1.000, 0.000 118 1.73E−27 733 1289
    Gm03:4506056 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 734 1290
    Gm03:4506139 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 735 1291
    Gm03:4506147 T 112:0, 0:6 1.000, 0.000 118 1.73E−27 736 1292
    Gm03:4507198 A 112:0, 0:8 1.000, 0.000 120 6.33E−28 737 1293
    Gm03:4525141 A 112:0, 0:16 1.000, 0.000 128 1.12E−29 738 1294
    Gm03:4525736 C 112:0, 0:14 1.000, 0.000 126 3.07E−29 739 1295
    Gm03:4526278 C 110:0, 0:14 1.000, 0.000 124 8.42E−29 740 1296
    Gm03:4526393 C 112:0, 0:16 1.000, 0.000 128 1.12E−29 741 1297
    Gm03:4526446 G 112:0, 0:16 1.000, 0.000 128 1.12E−29 742 1298
    Gm03:4527054 A 112:0, 0:16 1.000, 0.000 128 1.12E−29 743 1299
    Gm03:4533559 A 112:0, 0:14 1.000, 0.000 126 3.07E−29 744 1300
    Gm03:4539866 A 112:0, 0:12 1.000, 0.000 124 8.42E−29 745 1301
    Gm03:4541294 A 112:0, 0:6 1.000, 0.000 118 1.73E−27 746 1302
    • Example 2 Marker Loci Associated with Phytophthora Tolerance—Rps2 Locus
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps2 locus on linkage group J (ch 16). Markers were screened against various known resistant and susceptible parents.
  • Markers to loci S06862, S06863, S06864, S06865, S11652-1 and S11682-1 were developed and validated for their ability to identify the allele(s) associated with resistance at Rps2, for example alleles derived from resistant line L76-1988. Marker S06862 appeared to be within a region which is deleted in some lines, and did not amplify in several geneotypes. Therefore, genomic regions outside of the apparent deletion were targeted for marker development by sequencing 1588 regions in 25 soybean lines to develop a SNP profile. Markers to S11652 and S11682 were made based on the SNP profile and were screened and verified in known resistant and susceptible varieties. Further development and testing was done to optimize markers to these for high throughput analysis of soybean.
  • An F2 mapping population derived from a cross of L76-1988 X susceptible consisting 256 individuals was used to fine map QTL for Rps2 on LG-J. A total of 9 polymorphic markers were utilized to construct the linkage group and perform QTL analysis. Three Rps2 phenotypic data sets were used: Score 1, Score 2, and an average score. Phenotypic distributions of all 3 datasets were consistent. A major QTL was detected on all the three data sets. The QTL was closely linked with marker S11652-1-Q1 and flanked by markers to form an interval which explained ˜69% of phenotypic variation (averaged score).
  • Initial Map Manager Parameters were set to:
  • 1) Linkage Evaluation: Intercross
  • 2) Search Criteria: P=1e−5
  • 3) Map Function: Kosambi
  • 4) Cross Type: Line Cross
  • The permutation test simulation was done for each score established significance boundaries in order to identify QTLs as follows:
  • Rps2 Score1 Rps2 Score2 Rps2_Avg
    Suggestive 0.7 0.7 0.7
    Significant 5.3 5.4 5.8
    Highly significant 13.6 11.1 13.7
  • Markers 511652-1-Q1, 50683-1-Q1, and 511682-1-Q1 on LG J were identified as highly significant using Map ManagerQTX (Manly et al. (2001) Mammalian Genome 12:930-932) marker regression analysis of each of the 3 phenotypic datasets. Each had a p value of 0.00000, a % values from 56-68%, and stat values from 152.2-242.7 across the 3 regressions.
    • Example 3 Marker Loci Associated with Phytophthora Tolerance in Rps3 Loci
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps3 locus on linkage group F (ch 13). Markers were screened against various known resistant and susceptible varieties.
  • A marker to loci S07361-1, S08342-1, S09081-1 was developed to identify alleles associated with the phytophthora phenotype. Markers to S08342-1, S09081-1 detect res/sus polymorphisms for Rps3a, and markers to S07361-1 detect res/sus polymorphisms for Rps3c. During development, each marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
  • An F2:3 population 95Y40xExpSUS, segregating for phytophthora root rot response, was used for Rps3c marker refinement. Parental line 95Y40 carries both the Rps3c and Rps1k phytophthora resistance alleles, ExpSUS is a proprietary experimental line susceptible to Phytophthora. No significant QTLs were detected in this study. One suggestive QTL was found on each chromosome F_(13) and chromosome N_(3), however there was no significant association between the resistant phenotype and the Rps3c (S07163-1-Q3) and Rps1k (S00009-01-A) MAS markers located on the chromosomes, respectively.
  • The F2:3 population consisted of 90 progeny. Genomic DNA was extracted using a standard CTAB method and used for genotyping. Eight polymorphic markers were selected from LG-F, as well as 6 polymorphic markers selected from LG-N flanking and including the MAS markers S07163-1-Q1 and S00009-01-A and used to genotype the population. Phenotypic scores categorized the progeny as Resistant, Susceptible, and Heterozygous. The classes were assigned numbers 9, 1, and 5, respectively for QTL analysis. Map Manager QTX.b20 was used to construct the linkage map with the following parameters:
  • 1) Linkage Evaluation: Intercross
  • 2) Search Criteria: P=1e−5
  • 3) Map Function: Kosambi
  • 4) Cross Type: Line Cross
  • Marker regression (p=0.001) and interval mapping were executed using Map Manager QTX.b20 and the results were confirmed using single marker analysis and composite interval mapping in QTL Cartographer 2.5. A permutation test was run in Map Manager 1000 times (free model), and in QTL Cartographer 500 times (p=0.5) to establish the threshold for statistical significance. Preliminary analysis indicated all 14 markers showed severe segregation distortion (chi square test statistic p=0.001) using the expected F2 segregation ratios. Instead, the observed genotypic ratios fit an F3 model well. In addition, three progeny matched parental calls across all 14 markers and were removed from subsequent analysis. The allele calls were converted to the A (maternal), B (paternal), H (heterozygous) convention for mapping analysis.
  • The phenotypic distribution of the 87 progeny employed in this analysis was evaluated using both percent dead scores, and the distribution after grouping into classes. In each case, the distributions were essentially normal. The resistant parent's average phenotypic score was 66% dead, placing the value near the mid-point of the population phenotypic distribution rather than the tail.
  • In the mapping analysis markers formed two linkage groups on LG F and LG N, with one marker remaining unlinked. Marker regression (Map Manager) and single marker analysis (QTL Cartographer) were performed, each indicating two suggestive regions of interest, a region on LG F comprising S07163-1-Q3, and a region on LG N comprising S00009-01-A. Neither reached the LRS cutoff for significance in this study.
    • Example 4 Marker Loci Associated with Phytophthora Tolerance in the Rps6 Locus
  • Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps6 locus on linkage group G (ch 18). Markers were screened against various known resistant and susceptible parents.
  • A marker to locus S08442 was developed to identify alleles associated with the phytophthora phenotype. Sequencing was done to develop a SNP profile for marker development. During development, this marker was validated against Phytophthora resistant line Archer, and a susceptible line. The marker was further validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. This marker was additionally used to fingerprint approximately 2000 soybean lines.
  • All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
  • Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims (20)

That which is claimed:
1. A method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
(a) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(b) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(c) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(d) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(e) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
2. The method of claim 1, wherein at least two marker loci are detected.
3. The method of claim 2, wherein the at least two marker loci comprise a haplotype or a marker profile that is associated with said tolerance.
4. The method of claim 1, wherein the germplasm is a soybean variety.
5. The method of claim 1, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
6. The method of claim 5, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
7. The method of claim 6, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
8. The method of claim 1, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
9. The method of claim 1, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
10. The method of claim 9, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
11. The method of claim 10, wherein said method comprises
(a) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394;
(b) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179 or 180;
(c) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185 or 186; or
(d) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189 or 190.
12. The method of claim 10, wherein said primer or primer pair comprises
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
13. The method of claim 12, wherein said primer or primer pair comprises a nucleic acid sequence comprising
(a) a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof;
(b) a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof;
(c) a nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
14. The method of claim 13, wherein said primer pair comprises:
a) SEQ ID NO: 1 and SEQ ID NO:2, SEQ ID NO: 9 and SEQ ID NO:10, SEQ ID NO: 20 and SEQ ID NO:21, SEQ ID NO: 22 and SEQ ID NO: 23, SEQ ID NO: 24 and SEQ ID NO: 25, SEQ ID NO: 36 and SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO: 39 or SEQ ID NO: 1339 and SEQ ID NO: 1340;
(b) SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 46 and SEQ ID NO: 47, SEQ ID NO: 52 and SEQ ID NO: 53, SEQ ID NO: 58 and SEQ ID NO: 59, SEQ ID NO: 64 and SEQ ID NO: 65 or SEQ ID NO: 75 and SEQ ID NO: 76;
(c) SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 89 and SEQ ID NO: 90 or SEQ ID NO: 91 and SEQ ID NO: 92; or
(d) SEQ ID NO: 95 and SEQ ID NO: 96 or SEQ ID NO: 101 and SEQ ID NO: 102.
15. The method of claim 10, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
16. The method of claim 15, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising:
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
17. The method of claim 16, wherein the labeled nucleic acid probe comprises:
(a) a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(b) a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(c) a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152, 153 or 154.
18. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising:
(a) S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(b) S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(c) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(d) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
19. The isolated polynucleotide of claim 18, wherein the polynucleotide comprises:
(a) a polynucleotide comprising:
(i) SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339 or 1340;
(ii) SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78;
(iii) SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 or 92; or
(iv) SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104;
(b) a polynucleotide comprising:
(i) SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(ii) SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(iii) SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149; or
(iv) SEQ ID NOs: 150, 151, 152, 153 or 154;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
20. A kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection, the kit comprising:
(a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein the primers or probes are capable of detecting a marker locus, wherein:
(i) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(ii) the at least one marker locus comprises S07963-2, S07372-1, S00009-01, S08013-1, any of the Rps1k marker loci in Table 1B or a marker closely linked thereto on linkage group N;
(iii) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, S11652-1, S11682-1 or a marker closely linked thereto on linkage group J;
(iv) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(v) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G; and
(b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
US15/287,940 2012-12-20 2016-10-07 Genetic loci associated with phytophthora tolerance in soybean and methods of use Abandoned US20170022575A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/287,940 US20170022575A1 (en) 2012-12-20 2016-10-07 Genetic loci associated with phytophthora tolerance in soybean and methods of use

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201261740262P 2012-12-20 2012-12-20
US13/782,013 US9493843B2 (en) 2012-12-20 2013-03-01 Genetic loci associated with Phytophthora tolerance in soybean and methods of use
US15/287,940 US20170022575A1 (en) 2012-12-20 2016-10-07 Genetic loci associated with phytophthora tolerance in soybean and methods of use

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US13/782,013 Division US9493843B2 (en) 2012-12-20 2013-03-01 Genetic loci associated with Phytophthora tolerance in soybean and methods of use

Publications (1)

Publication Number Publication Date
US20170022575A1 true US20170022575A1 (en) 2017-01-26

Family

ID=50975042

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/782,013 Active 2034-10-16 US9493843B2 (en) 2012-12-20 2013-03-01 Genetic loci associated with Phytophthora tolerance in soybean and methods of use
US15/287,940 Abandoned US20170022575A1 (en) 2012-12-20 2016-10-07 Genetic loci associated with phytophthora tolerance in soybean and methods of use

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US13/782,013 Active 2034-10-16 US9493843B2 (en) 2012-12-20 2013-03-01 Genetic loci associated with Phytophthora tolerance in soybean and methods of use

Country Status (6)

Country Link
US (2) US9493843B2 (en)
AR (1) AR094233A1 (en)
BR (1) BR112015014884A2 (en)
CA (1) CA2894712C (en)
WO (1) WO2014100222A2 (en)
ZA (1) ZA201502853B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10253379B1 (en) 2016-03-04 2019-04-09 Syngenta Participations Ag Disease resistance alleles in soybean

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9493843B2 (en) 2012-12-20 2016-11-15 Pioneer Hi-Bred International, Inc. Genetic loci associated with Phytophthora tolerance in soybean and methods of use
RU2748688C2 (en) * 2015-06-03 2021-05-28 ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи Genetic locus associated with root and stem rot due to phytophthora in soy
CA3186862A1 (en) 2020-08-18 2022-02-24 Pioneer Hi-Bred International, Inc. Multiple disease resistance genes and genomic stacks thereof
CN111996282B (en) * 2020-09-18 2022-07-15 南京农业大学 SSR marker CH0211 for identifying soybean mosaic virus resistant SC3 strain of soybean as well as detection method and application thereof
BR112023010472A2 (en) 2020-12-16 2024-02-06 Corteva Agriscience Llc COMPOSITIONS AND METHODS FOR INCREASING RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEANS

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6162967A (en) 1994-01-26 2000-12-19 Pioneer Hi-Bred International, Inc. Positional cloning of soybean cyst nematode resistance genes
US5574210A (en) 1995-06-06 1996-11-12 Zeneca Limited Gray leaf spot resistant corn and the production thereof
WO1998049887A1 (en) 1997-05-02 1998-11-12 The University Of Utah Soybean having epistatic genes affecting yield
WO1999031964A1 (en) 1997-12-19 1999-07-01 Pioneer Hi-Bred International, Inc. Nucleotide polymorphisms in soybean
US7435873B2 (en) 2002-05-10 2008-10-14 The Ohio State University Research Foundation Identification of soybeans having resistance to Phytophthora sojae
AU2003239404A1 (en) 2002-05-10 2003-11-11 The Ohio State University Research Foundation Identification of soybeans having resistance to phytophthora sojae
US6953877B2 (en) 2004-01-30 2005-10-11 Pioneer Hi-Bred International Inc. Soybean variety XB04D04
US7507874B2 (en) * 2004-08-06 2009-03-24 Pioneer Hi-Bred International, Inc. Genetic loci associated with phytophthora tolerance in soybean
CA2684271C (en) * 2007-04-20 2020-10-13 Monsanto Technology Llc Methods and compositions for selecting soybean plants resistant to phytophthora root rot
US9493843B2 (en) 2012-12-20 2016-11-15 Pioneer Hi-Bred International, Inc. Genetic loci associated with Phytophthora tolerance in soybean and methods of use

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10253379B1 (en) 2016-03-04 2019-04-09 Syngenta Participations Ag Disease resistance alleles in soybean
US10752964B1 (en) 2016-03-04 2020-08-25 Syngenta Participations Ag Disease resistance alleles in soybean

Also Published As

Publication number Publication date
CA2894712C (en) 2022-08-16
ZA201502853B (en) 2016-04-28
US9493843B2 (en) 2016-11-15
AR094233A1 (en) 2015-07-22
WO2014100222A2 (en) 2014-06-26
BR112015014884A2 (en) 2017-07-11
WO2014100222A3 (en) 2014-09-04
US20140178867A1 (en) 2014-06-26
CA2894712A1 (en) 2014-06-26

Similar Documents

Publication Publication Date Title
US20170022575A1 (en) Genetic loci associated with phytophthora tolerance in soybean and methods of use
US9675071B2 (en) Methods and compositions for PPO inhibitor tolerance in soybeans
US20130337442A1 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US9994920B2 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US20160376668A1 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US10017829B2 (en) Genetic loci associated with Frogeye Leaf Spot resistance and Brown Stem Rot resistance and methods of use
CA2845522C (en) Molecular markers associated with soybean root-knot nematode tolerance and methods of their use
US20220340982A1 (en) Sorghum cytoplasmic male sterility markers and loci
US11357185B2 (en) Polynucleotides and kits associated with soybean iron deficiency tolerance and methods of detection and breeding
US20170298452A1 (en) Carlavirus tolerant soybeans and methods of use
US20180334728A1 (en) Genetic loci associated with brown stem rot resistance in soybean and methods of use
US20160272997A1 (en) Stem canker tolerant soybeans and methods of use
US20140162250A1 (en) Marker-assisted selection of tolerance to chloride salt stress

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: ADVISORY ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION