WO2014100222A2 - Genetic loci associated with phytophthora tolerance in soybean and methods of use - Google Patents

Genetic loci associated with phytophthora tolerance in soybean and methods of use Download PDF

Info

Publication number
WO2014100222A2
WO2014100222A2 PCT/US2013/076206 US2013076206W WO2014100222A2 WO 2014100222 A2 WO2014100222 A2 WO 2014100222A2 US 2013076206 W US2013076206 W US 2013076206W WO 2014100222 A2 WO2014100222 A2 WO 2014100222A2
Authority
WO
WIPO (PCT)
Prior art keywords
rpslk
seq
kingwa
marker
nos
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/076206
Other languages
French (fr)
Other versions
WO2014100222A3 (en
Inventor
Julian M. Chaky
Holly Jessen
Joshua M. Shendelman
Paul A. Stephens
David M. Webb
John B. Woodward
Meizhu Yang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
Original Assignee
Pioneer Hi Bred International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi Bred International Inc filed Critical Pioneer Hi Bred International Inc
Priority to BR112015014884A priority Critical patent/BR112015014884A2/en
Priority to CA2894712A priority patent/CA2894712C/en
Publication of WO2014100222A2 publication Critical patent/WO2014100222A2/en
Publication of WO2014100222A3 publication Critical patent/WO2014100222A3/en
Priority to ZA2015/02853A priority patent/ZA201502853B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10Seeds
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/54Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
    • A01H6/542Glycine max [soybean]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display tolerance or improved tolerance to Phytophthora infection.
  • sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 429546seqlist.txt, a creation date of February 18, 2013 and a size of 785 KB.
  • ASCII American Standard Code for Information Interchange
  • sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
  • Soybeans ⁇ Glycine max L. Merr. are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
  • Phytophthora is a major soybean fungal pathogen that induces stem and root rot in infected plants, causing severe losses in soybean viability and overall yield.
  • Phytophthora root rot is caused by a pathogenic infection of Phytophthora sojae.
  • Resistance to Phytophthora infection is conditioned by naturally occurring variation at the Resistance to Phytophthora sojae (Rps) loci. As races of Phytophthora in the fields shift, previously effective resistance sources are breaking down, causing damage and compromised yields in grower fields. There remains a need for soybean plants with tolerance or improved tolerance to Phytophthora infection and methods for identifying and selecting such plants.
  • the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
  • Figure 1 A-C provides a genetic map for loci on linkage group (LG) N.
  • Figure 2 A-D provides a genetic map for loci on LG F.
  • Figure 3 A-C provides a genetic map for loci on LG J.
  • Figure 4 A-E provides a genetic map for loci on LG G.
  • reference to “plant,” “the plant,” or “a plant” also includes a plurality of plants; also, depending on the context, use of the term “plant” can also include genetically similar or identical progeny of that plant; use of the term “a nucleic acid” optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term “probe” optionally (and typically) encompasses many similar or identical probe molecules.
  • kits comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers.
  • the term “comprising” is intended to include examples encompassed by the terms “consisting essentially of and “consisting of.” Similarly, the term “consisting essentially of is intended to include examples encompassed by the term “consisting of.”
  • Agronomics refers to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season.
  • Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
  • Allele means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy
  • allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
  • amplifying in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced.
  • An “amp licon” is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method.
  • An “ancestral line” is a parent line used as a source of genes, e.g., for the development of elite lines.
  • An "ancestral population” is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
  • Backcrossing is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
  • chromosome segment designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome.
  • Chrosome interval refers to a chromosome segment defined by specific flanking marker loci.
  • Crop and “variety” are used synonymously and mean a group of plants within a species ⁇ e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
  • An "elite line” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
  • An "elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
  • an “exotic soybean strain” or an “exotic soybean germplasm” is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm.
  • an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
  • a “genetic map” is a description of genetic association or linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form. "Genotype” is a description of the allelic state at one or more loci.
  • Germplasm means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
  • An individual is "homozygous” if the individual has only one type of allele at a given locus (e.g. , a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes).
  • An individual is "heterozygous” if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles).
  • the term “homogeneity” indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term “heterogeneity” is used to indicate that individuals within the group differ in genotype at one or more specific loci.
  • “Introgression” means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
  • label or “detectable label” refer to a molecule capable of detection.
  • a detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqManTM probes.
  • reporter refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher.
  • the detectable signal of the reporter is, e.g., fluorescence in the detectable range.
  • quencher refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter.
  • quenching and
  • fluorescence energy transfer refers to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter.
  • a “line” or “strain” is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic).
  • a "subline” refers to an inbred subset of
  • a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are "fixed” or homozygous across most or all loci.
  • Commercial soybean varieties (or lines) are typically produced by aggregating ("bulking") the self- pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self- pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was
  • Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant.
  • the seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample.
  • seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, tolerance, etc.).
  • Linkage refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage.
  • Linkage disequilibrium is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage.
  • Linkage group (LG) refers to traits or markers that generally co-segregate. A linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
  • Locus is a defined segment of DNA.
  • a “map location” or “map position” is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968.
  • a “physical position” or “physical location” or “physical map location” is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463: 178- 183, available from the Phytozome website (phytozome-dot-net/soybean).
  • Mapping is the process of defining the association and relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
  • Marker or “molecular marker” or “marker locus” is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
  • Marker assisted selection refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
  • Haplotype refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-N are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
  • a "marker profile” means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes.
  • a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
  • plant includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
  • Plant parts means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
  • Polymorphism means a change or difference between two related nucleic acids.
  • nucleotide polymorphism refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
  • Polynucleotide “polynucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleic acid fragment,” and “oligonucleotide” are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi- stranded, that optionally contains synthetic, non-natural, or altered R A or DNA nucleotide bases.
  • a DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
  • Primer refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase.
  • primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed.
  • Primers may be provided in double-stranded form, though the single-stranded form is more typically used.
  • a primer can further contain a detectable label, for example a 5' end label.
  • Probe refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
  • probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed.
  • a probe can further contain a detectable label.
  • Quantitative trait loci or “QTL” refer to the genetic elements controlling a quantitative trait.
  • Recombination frequency is the frequency of a crossing over event
  • Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
  • Tolerance and “improved tolerance” are used interchangeably herein and refer to any type of increase in resistance or tolerance to, or any type of decrease in susceptibility.
  • a "tolerant plant” or “tolerant plant variety” need not possess absolute or complete tolerance. Instead, a “tolerant plant,” “tolerant plant variety,” or a plant or plant variety with “improved tolerance” will have a level of resistance or tolerance which is higher than that of a comparable susceptible plant or variety.
  • Self-crossing or “self-pollination” or “selfmg” is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
  • SNP single nucleotide polymorphism
  • A, T, C, or G single nucleotide sequence
  • SNP markers exist when SNPs are mapped to sites on the soybean genome.
  • yield refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
  • an "isolated” or “purified” polynucleotide or polypeptide, or biologically active portion thereof is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment.
  • an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived.
  • the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived.
  • a polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%, 10%), 5%o, or l%o (by dry weight) of contaminating protein culture media or other chemical components.
  • Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook”).
  • Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection.
  • the method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with tolerance to Phytophthora infection.
  • isolated polynucleotides and kits for use in identifying and/or detecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved tolerance to Phytophthora.
  • marker loci associated with tolerance to Phytophthora infection have been identified and mapped to genomic loci on linkage groups F, G, J and N.
  • the marker loci provided herein are associated with various Phytophthora multi- race resistance genes.
  • the marker loci are associated with the Rpsla, Rpslc, Rpsld or Rpslk loci on linkage group N.
  • the marker loci are associated with the Rps2 locus on linkage group J.
  • the marker loci are associated with the Rps3a or Rps3c loci on linkage group F.
  • the marker loci are associated with the Rps6 loci on linkage group G.
  • Marker loci, haplotypes and marker profiles associated with tolerance or improved tolerance to Phytophthora infection are provided. Further provided are genomic loci that are associated with soybean tolerance or improved tolerance to
  • soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with tolerance or improved tolerance to Phytophthora infection.
  • it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with tolerance for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rpsla, Rpslc or Rpsld loci on linkage group N.
  • the marker locus comprises one or more of S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rpslk locus on linkage group N.
  • the marker locus comprises one or more of S07963-2, S07372-1, S00009- 01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps2 locus on linkage group J.
  • the marker locus comprises one or more of S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps3a or Rps3c loci on linkage group F.
  • the marker locus comprises one or more of S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
  • marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps6 locus on linkage group G.
  • the marker locus comprises one or more of S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
  • Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Tables 1A and IB and in Figure 1 A-C, Figure 2 A- D, Figure 3 A-C and Figure 4 A-D .
  • Table 1 Marker Positions For Marker Loci Associated With Tolerance to Phytophthora. Table 1A
  • Phytophthora tolerance haplotype of interest are investigated.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a
  • the haplotype comprises: (a) two or more marker loci associated with the Rpsla, Rpslc, Rpsld or Rpslk loci found on linkage group N; (b) two or more marker loci comprising S08291-1, S07292-1, S08242- 1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB , or a closely linked marker on linkage group N; (c) two or more marker loci associated with the Rps2 locus found on linkage group J; (d) two or more marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (e) two or more marker loci associated with the Rps3a or Rps3c loci
  • the method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the tolerance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
  • two or more marker loci or haplotypes can collectively make up a marker profile.
  • the marker profile can comprise any two or more marker loci comprising: (a) any marker loci associated with the Rpsla, Rpslc, Rpsld or Rpslk loci found on linkage group N; (b) marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB, or a closely linked marker on linkage group N; (c) any marker loci associated with the Rps2 locus found on linkage group J; (d) marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (e) any marker loci associated with the Rps3a or R
  • any marker loci associated with Phytophthora tolerance can be combined in the marker profile with any of the marker loci disclosed herein.
  • the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with tolerance to Phytophthora infection provided herein (i.e. the various marker loci provided in Tables 1A and IB and in Figures 1-4).
  • a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the tolerance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein.
  • the marker profile comprises any combination of two or more marker loci from any of the various Rps loci, for example, Rpsl, Rps2, Rps3, Rps4, Rps5, Rps6, Rps7 or Rps8.
  • soybean markers In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org.
  • identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with tolerance (or susceptibility) is determined for the particular germplasm under study.
  • methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention.
  • Various methods are provided to identify soybean plants and/or germplasm with tolerance or improved tolerance to Phytophthora infection.
  • the method of identifying comprises detecting at least one marker locus associated with tolerance to Phytophthora.
  • the term "associated with” in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype.
  • an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
  • Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. Any one marker locus or any combination of the markers set forth in Table 1 , or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
  • a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with tolerance.
  • the at least one marker locus can be associated with the Rpsla, Rpslc, Rpsld or Rpslk loci found on linkage group N; (b) can comprise one or more of the marker loci S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB, or a closely linked marker on linkage group N; (c) can be associated with the Rps2 locus found on linkage group J; (d) can comprise one or more of the marker loci S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (e) can be associated with the Rps3a or Rps3c loci found on linkage group F; (f) can comprise one or more of the
  • two or more marker loci are detected in the method.
  • the germplasm is a soybean variety.
  • the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
  • the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
  • the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated Phytophthora tolerance alleles encompassed by the methods provided herein include, for example, those listed in Table 1.
  • the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon.
  • amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is
  • the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rpsla, Rpslc, Rpsld, or Rpslk loci comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 240
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 1 and SEQ ID NO:2; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 20 and SEQ ID NO:21; SEQ ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 24 and SEQ ID NO: 25; SEQ ID NO: 36 and SEQ ID NO: 37; SEQ ID NO: 38 and SEQ ID NO: 39; or SEQ ID NO: 1339 and SEQ ID NO: 1340.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps2 locus comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 40 and SEQ ID NO: 41; SEQ ID NO: 46 and SEQ ID NO: 47; SEQ ID NO: 52 and SEQ ID NO: 53; SEQ ID NO: 58 and SEQ ID NO: 59; SEQ ID NO: 64 and SEQ ID NO: 65; or SEQ ID NO: 75 and SEQ ID NO: 76.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps3a or Rps3c loci comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 89 and SEQ ID NO: 90; or SEQ ID NO: 91 and SEQ ID NO: 92.
  • the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps6 locus comprising SEQ ID NOS: 187, 188, 189, 190 or variants or fragments thereof.
  • the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof.
  • the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
  • the primer pair comprises SEQ ID NO: 95 and SEQ ID NO: 96; or SEQ ID NO: 101 and SEQ ID NO: 102.
  • the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
  • the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rpsla, Rpslc, Rpsld or Rpslk loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390,
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341, 1342 or variants or fragments thereof.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps2 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or variants or fragments thereof.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps3a or Rps3c loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or variants or fragments thereof.
  • the labeled nucleic acid probe can comprise a sequence associated with the Rps6 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof.
  • the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 150, 151, 152, 153, 154 or variants or fragments thereof.
  • Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4 and 5, respectively.
  • Table 2 Non-Limiting Examples of Primer Sequences.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Engineering & Computer Science (AREA)
  • Environmental Sciences (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Physiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.

Description

GENETIC LOCI ASSOCIATED WITH PHYTOPHTHORA TOLERANCE IN SOYBEAN AND METHODS OF USE
FIELD OF THE INVENTION
This invention relates to methods of identifying and/or selecting soybean plants or germplasm that display tolerance or improved tolerance to Phytophthora infection.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA EFS-WEB
The official copy of the sequence listing is submitted concurrently with the specification as a text file via EFS-Web, in compliance with the American Standard Code for Information Interchange (ASCII), with a file name of 429546seqlist.txt, a creation date of February 18, 2013 and a size of 785 KB. The sequence listing filed via EFS-Web is part of the specification and is hereby incorporated in its entirety by reference herein.
BACKGROUND
Soybeans {Glycine max L. Merr.) are a major cash crop and investment commodity in North America and elsewhere. Soybean oil is one of the most widely used edible oils, and soybeans are used worldwide both in animal feed and in human food production. Additionally, soybean utilization is expanding to industrial, manufacturing, and pharmaceutical applications.
Phytophthora is a major soybean fungal pathogen that induces stem and root rot in infected plants, causing severe losses in soybean viability and overall yield.
Phytophthora root rot is caused by a pathogenic infection of Phytophthora sojae.
Resistance to Phytophthora infection is conditioned by naturally occurring variation at the Resistance to Phytophthora sojae (Rps) loci. As races of Phytophthora in the fields shift, previously effective resistance sources are breaking down, causing damage and compromised yields in grower fields. There remains a need for soybean plants with tolerance or improved tolerance to Phytophthora infection and methods for identifying and selecting such plants.
SUMMARY
Various methods and compositions are provided for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to
Phytophthora infection. In certain embodiments, the method comprises detecting at least one marker locus that is associated with tolerance to Phytophthora infection. In other embodiments, the method further comprises detecting at least one marker profile or haplotype associated with tolerance to Phytophthora infection. In further embodiments, the method comprises crossing a selected soybean plant with a second soybean plant. Further provided are markers, primers, probes and kits useful for identifying and/or selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 A-C provides a genetic map for loci on linkage group (LG) N.
Figure 2 A-D provides a genetic map for loci on LG F.
Figure 3 A-C provides a genetic map for loci on LG J.
Figure 4 A-E provides a genetic map for loci on LG G.
DETAILED DESCRIPTION
Before describing the present invention in detail, it is to be understood that this invention is not limited to particular embodiments, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
Certain definitions used in the specification and claims are provided below. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided: As used in this specification and the appended claims, terms in the singular and the singular forms "a," "an," and "the," for example, include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "plant," "the plant," or "a plant" also includes a plurality of plants; also, depending on the context, use of the term "plant" can also include genetically similar or identical progeny of that plant; use of the term "a nucleic acid" optionally includes, as a practical matter, many copies of that nucleic acid molecule; similarly, the term "probe" optionally (and typically) encompasses many similar or identical probe molecules.
Additionally, as used herein, "comprising" is to be interpreted as specifying the presence of the stated features, integers, steps, or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps, or components, or groups thereof. Thus, for example, a kit comprising one pair of oligonucleotide primers may have two or more pairs of oligonucleotide primers. Additionally, the term "comprising" is intended to include examples encompassed by the terms "consisting essentially of and "consisting of." Similarly, the term "consisting essentially of is intended to include examples encompassed by the term "consisting of."
"Agronomics," "agronomic traits," and "agronomic performance" refer to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of a growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance or tolerance, insect resistance or tolerance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability, and the like.
"Allele" means any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence typically occupy
corresponding loci on a pair of homologous chromosomes. With regard to a SNP marker, allele refers to the specific nucleotide base present at that SNP locus in that individual plant.
The term "amplifying" in the context of nucleic acid amplification is any process whereby additional copies of a selected nucleic acid (or a transcribed form thereof) are produced. . An "amp licon" is an amplified nucleic acid, e.g., a nucleic acid that is produced by amplifying a template nucleic acid by any available amplification method. An "ancestral line" is a parent line used as a source of genes, e.g., for the development of elite lines.
An "ancestral population" is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines.
"Backcrossing" is a process in which a breeder crosses a progeny variety back to one of the parental genotypes one or more times.
The term "chromosome segment" designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome. "Chromosome interval" refers to a chromosome segment defined by specific flanking marker loci.
"Cultivar" and "variety" are used synonymously and mean a group of plants within a species {e.g., Glycine max) that share certain genetic traits that separate them from other possible varieties within that species. Soybean cultivars are inbred lines produced after several generations of self-pollinations. Individuals within a soybean cultivar are homogeneous, nearly genetically identical, with most loci in the homozygous state.
An "elite line" is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding.
An "elite population" is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean.
An "exotic soybean strain" or an "exotic soybean germplasm" is a strain or germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm. In the context of a cross between two soybean plants or strains of germplasm, an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.
A "genetic map" is a description of genetic association or linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form. "Genotype" is a description of the allelic state at one or more loci.
"Germplasm" means the genetic material that comprises the physical foundation of the hereditary qualities of an organism. As used herein, germplasm includes seeds and living tissue from which new plants may be grown; or, another plant part, such as leaf, stem, pollen, or cells, that may be cultured into a whole plant. Germplasm resources provide sources of genetic traits used by plant breeders to improve commercial cultivars.
An individual is "homozygous" if the individual has only one type of allele at a given locus (e.g. , a diploid individual has a copy of the same allele at a locus for each of two homologous chromosomes). An individual is "heterozygous" if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). The term "homogeneity" indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that individuals within the group differ in genotype at one or more specific loci.
"Introgression" means the entry or introduction of a gene, QTL, haplotype, marker profile, trait, or trait locus from the genome of one plant into the genome of another plant.
The terms "label" or "detectable label" refer to a molecule capable of detection. A detectable label can also include a combination of a reporter and a quencher, such as are employed in FRET probes or TaqMan™ probes. The term "reporter" refers to a substance or a portion thereof which is capable of exhibiting a detectable signal, which signal can be suppressed by a quencher. The detectable signal of the reporter is, e.g., fluorescence in the detectable range. The term "quencher" refers to a substance or portion thereof which is capable of suppressing, reducing, inhibiting, etc., the detectable signal produced by the reporter. As used herein, the terms "quenching" and
"fluorescence energy transfer" refer to the process whereby, when a reporter and a quencher are in close proximity, and the reporter is excited by an energy source, a substantial portion of the energy of the excited state non-radiatively transfers to the quencher where it either dissipates non-radiatively or is emitted at a different emission wavelength than that of the reporter. A "line" or "strain" is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic). A "subline" refers to an inbred subset of
descendants that are genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a subline has been derived by inbreeding the seed from an individual soybean plant selected at the F3 to F5 generation until the residual segregating loci are "fixed" or homozygous across most or all loci. Commercial soybean varieties (or lines) are typically produced by aggregating ("bulking") the self- pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self- pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was
heterozygous in the originally selected F3 to F5 plant. Marker-based sublines that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant. The seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample. Optionally, seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for a trait of interest (e.g., yield, tolerance, etc.).
"Linkage" refers to the tendency for alleles to segregate together more often than expected by chance if their transmission was independent. Typically, linkage refers to alleles on the same chromosome. Genetic recombination occurs with an assumed random frequency over the entire genome. Genetic maps are constructed by measuring the frequency of recombination between pairs of traits or markers, the lower the frequency of recombination, and the greater the degree of linkage.
"Linkage disequilibrium" is a non-random association of alleles at two or more loci and can occur between unlinked markers. It is based on allele frequencies within a population and is influenced by but not dependent on linkage. "Linkage group" (LG) refers to traits or markers that generally co-segregate. A linkage group generally corresponds to a chromosomal region containing genetic material that encodes the traits or markers.
"Locus" is a defined segment of DNA.
A "map location" or "map position" is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species. Map positions are generally provided in centimorgans (cM), unless otherwise indicated, genetic positions provided are based on the Glycine max consensus map v 4.0 as provided by Hyten et al. (2010) Crop Sci 50:960-968. A "physical position" or "physical location" or "physical map location" is the position, typically in nucleotides bases, of a particular nucleotide, such as a SNP nucleotide, on a chromosome. Unless otherwise indicated, the physical position within the soybean genome provided is based on the Glyma 1.0 genome sequence described in Schmutz et al. (2010) Nature 463: 178- 183, available from the Phytozome website (phytozome-dot-net/soybean).
"Mapping" is the process of defining the association and relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency.
"Marker" or "molecular marker" or "marker locus" is a term used to denote a nucleic acid or amino acid sequence that is sufficiently unique to characterize a specific locus on the genome. Any detectable polymorphic trait can be used as a marker so long as it is inherited differentially and exhibits linkage disequilibrium with a phenotypic trait of interest.
"Marker assisted selection" refers to the process of selecting a desired trait or traits in a plant or plants by detecting one or more nucleic acids from the plant, where the nucleic acid is linked to the desired trait, and then selecting the plant or germplasm possessing those one or more nucleic acids.
"Haplotype" refers to a combination of particular alleles present within a particular plant's genome at two or more linked marker loci, for instance at two or more loci on a particular linkage group. For instance, in one example, two specific marker loci on LG-N are used to define a haplotype for a particular plant. In still further examples, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more linked marker loci are used to define a haplotype for a particular plant.
As used herein, a "marker profile" means a combination of particular alleles present within a particular plant's genome at two or more marker loci which are not linked, for instance two or more loci on two or more different linkage groups or two or more chromosomes. For instance, in one example, a particular combination of marker loci or a particular combination of haplotypes define the marker profile of a particular plant.
The term "plant" includes reference to an immature or mature whole plant, including a plant from which seed or grain or anthers have been removed. Seed or embryo that will produce the plant is also considered to be the plant.
"Plant parts" means any portion or piece of a plant, including leaves, stems, buds, roots, root tips, anthers, seed, grain, embryo, pollen, ovules, flowers, cotyledons, hypocotyls, pods, flowers, shoots, stalks, tissues, tissue cultures, cells and the like.
"Polymorphism" means a change or difference between two related nucleic acids.
A "nucleotide polymorphism" refers to a nucleotide that is different in one sequence when compared to a related sequence when the two nucleic acids are aligned for maximal correspondence.
"Polynucleotide," "polynucleotide sequence," "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "nucleic acid fragment," and "oligonucleotide" are used interchangeably herein to indicate a polymer of nucleotides that is single- or multi- stranded, that optionally contains synthetic, non-natural, or altered R A or DNA nucleotide bases. A DNA polynucleotide may be comprised of one or more strands of cDNA, genomic DNA, synthetic DNA, or mixtures thereof.
"Primer" refers to an oligonucleotide which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a complementary strand when placed under conditions in which synthesis of a complementary strand is catalyzed by a polymerase. Typically, primers are about 10 to 30 nucleotides in length, but longer or shorter sequences can be employed. Primers may be provided in double-stranded form, though the single-stranded form is more typically used. A primer can further contain a detectable label, for example a 5' end label. "Probe" refers to an oligonucleotide that is complementary (though not necessarily fully complementary) to a polynucleotide of interest and forms a duplexed structure by hybridization with at least one strand of the polynucleotide of interest.
Typically, probes are oligonucleotides from 10 to 50 nucleotides in length, but longer or shorter sequences can be employed. A probe can further contain a detectable label.
"Quantitative trait loci" or "QTL" refer to the genetic elements controlling a quantitative trait.
"Recombination frequency" is the frequency of a crossing over event
(recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits during meiosis.
"Tolerance and "improved tolerance" are used interchangeably herein and refer to any type of increase in resistance or tolerance to, or any type of decrease in susceptibility. A "tolerant plant" or "tolerant plant variety" need not possess absolute or complete tolerance. Instead, a "tolerant plant," "tolerant plant variety," or a plant or plant variety with "improved tolerance" will have a level of resistance or tolerance which is higher than that of a comparable susceptible plant or variety.
"Self-crossing" or "self-pollination" or "selfmg" is a process through which a breeder crosses a plant with itself; for example, a second generation hybrid F2 with itself to yield progeny designated F2:3.
"SNP" or "single nucleotide polymorphism" means a sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome sequence is altered or variable. "SNP markers" exist when SNPs are mapped to sites on the soybean genome.
The term "yield" refers to the productivity per unit area of a particular plant product of commercial value. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors.
As used herein, an "isolated" or "purified" polynucleotide or polypeptide, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or polypeptide as found in its naturally occurring environment. Typically, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A polypeptide that is substantially free of cellular material includes preparations of polypeptides having less than about 30%, 20%, 10%), 5%o, or l%o (by dry weight) of contaminating protein culture media or other chemical components.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook").
Methods are provided for identifying and/or selecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. The method comprises detecting in the soybean plant or germplasm, or a part thereof, at least one marker locus associated with tolerance to Phytophthora infection. Also provided are isolated polynucleotides and kits for use in identifying and/or detecting a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, and soybean plants, cells, and/or seeds comprising at least one marker locus conferring improved tolerance to Phytophthora.
Provided herein, marker loci associated with tolerance to Phytophthora infection have been identified and mapped to genomic loci on linkage groups F, G, J and N.
The marker loci provided herein are associated with various Phytophthora multi- race resistance genes. In some embodiments, the marker loci are associated with the Rpsla, Rpslc, Rpsld or Rpslk loci on linkage group N. In another embodiment, the marker loci are associated with the Rps2 locus on linkage group J. In other embodiments, the marker loci are associated with the Rps3a or Rps3c loci on linkage group F. In yet another embodiment, the marker loci are associated with the Rps6 loci on linkage group G. These findings have important implications for soybean production, as identifying markers that can be used for selection of Phytophthora tolerance will greatly expedite the development of Phytophthora tolerance into elite cultivars.
Marker loci, haplotypes and marker profiles associated with tolerance or improved tolerance to Phytophthora infection, are provided. Further provided are genomic loci that are associated with soybean tolerance or improved tolerance to
Phytophthora.
In certain embodiments, soybean plants or germplasm are identified that have at least one favorable allele, marker locus, haplotype or marker profile that positively correlates with tolerance or improved tolerance to Phytophthora infection. However, in other embodiments, it is useful for exclusionary purposes during breeding to identify alleles, marker loci, haplotypes, or marker profiles that negatively correlate with tolerance, for example, to eliminate such plants or germplasm from subsequent rounds of breeding.
In one embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rpsla, Rpslc or Rpsld loci on linkage group N. In a specific embodiment, the marker locus comprises one or more of S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rpslk locus on linkage group N. In a specific embodiment, the marker locus comprises one or more of S07963-2, S07372-1, S00009- 01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps2 locus on linkage group J. In a specific
embodiment, the marker locus comprises one or more of S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J. In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps3a or Rps3c loci on linkage group F. In a specific embodiment, the marker locus comprises one or more of S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
In another embodiment, marker loci useful for identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection are associated with the Rps6 locus on linkage group G. In a specific
embodiment, the marker locus comprises one or more of S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
Non-limiting examples of marker loci located within, linked to, or closely linked to these genomic loci are provided in Tables 1A and IB and in Figure 1 A-C, Figure 2 A- D, Figure 3 A-C and Figure 4 A-D .
Table 1 : Marker Positions For Marker Loci Associated With Tolerance to Phytophthora. Table 1A
Figure imgf000014_0001
Figure imgf000015_0001
Rps6 102.27 60777851 [G/T] Archer
Table IB
Figure imgf000015_0002
Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:3934964 Rpslk N 3934964 [G/A] Kingwa
Gm03:3935036 Rpslk N 3935036 [G/A] Kingwa
Gm03:3935832 Rpslk N 3935832 [G/A] Kingwa
Gm03:3935884 Rpslk N 3935884 [T/C] Kingwa
Gm03:3939831 Rpslk N 3939831 [C/G] Kingwa
Gm03:3939836 Rpslk N 3939836 [G/A] Kingwa
Gm03:3939936 Rpslk N 3939936 [T/A] Kingwa
Gm03:3939939 Rpslk N 3939939 [G/T] Kingwa
Gm03:3940174 Rpslk N 3940174 [T/C] Kingwa
Gm03:3940396 Rpslk N 3940396 [C/T] Kingwa
Gm03:3940836 Rpslk N 3940836 [T/C] Kingwa
Gm03:3941262 Rpslk N 3941262 [A/G] Kingwa
Gm03:3941484 Rpslk N 3941484 [A/G] Kingwa
Gm03:3941769 Rpslk N 3941769 [T/G] Kingwa
Gm03:3942973 Rpslk N 3942973 [C/G] Kingwa
Gm03:3943092 Rpslk N 3943092 [A/G] Kingwa
Gm03:3944671 Rpslk N 3944671 [T/C] Kingwa
Gm03:3944738 Rpslk N 3944738 [C/A] Kingwa
Gm03:3945112 Rpslk N 3945112 [A/T] Kingwa
Gm03:3945208 Rpslk N 3945208 [T/C] Kingwa
Gm03:3947836 Rpslk N 3947836 [T/C] Kingwa
Gm03:3947860 Rpslk N 3947860 [G/T] Kingwa
Gm03:3949250 Rpslk N 3949250 [C/T] Kingwa
Gm03:3949680 Rpslk N 3949680 [A/C] Kingwa
Gm03:3951187 Rpslk N 3951187 [G/A] Kingwa
Gm03:3951201 Rpslk N 3951201 [G/A] Kingwa
Gm03:3951485 Rpslk N 3951485 [C/G] Kingwa
Gm03:3951603 Rpslk N 3951603 [C/T] Kingwa
Gm03:3951705 Rpslk N 3951705 [A/G] Kingwa
Gm03:3951715 Rpslk N 3951715 [G/C] Kingwa
Gm03:3952778 Rpslk N 3952778 [T/A] Kingwa
Gm03:3952811 Rpslk N 3952811 [T/A] Kingwa
Gm03:3955716 Rpslk N 3955716 [T/A] Kingwa
Gm03:3956414 Rpslk N 3956414 [T/C] Kingwa
Gm03:3958402 Rpslk N 3958402 [A/G] Kingwa
Gm03:3960626 Rpslk N 3960626 [T/C] Kingwa
Gm03:3962904 Rpslk N 3962904 [A/G] Kingwa
Gm03:3967880 Rpslk N 3967880 [T/G] Kingwa
Gm03:3968334 Rpslk N 3968334 [G/A] Kingwa
Gm03:3971607 Rpslk N 3971607 [C/T] Kingwa
Gm03:3971640 Rpslk N 3971640 [C/A] Kingwa
Gm03:3971692 Rpslk N 3971692 [T/C] Kingwa
Gm03:3975817 Rpslk N 3975817 [T/C] Kingwa
Gm03:3975824 Rpslk N 3975824 [T/A] Kingwa
Gm03:3976645 Rpslk N 3976645 [T/C] Kingwa
Gm03:3980566 Rpslk N 3980566 [T/A] Kingwa
Gm03:3981623 Rpslk N 3981623 [A/G] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:3981822 Rpslk N 3981822 [A/G] Kingwa
Gm03:3982138 Rpslk N 3982138 [C/T] Kingwa
Gm03:3982678 Rpslk N 3982678 [A/C] Kingwa
Gm03:3984554 Rpslk N 3984554 [C/T] Kingwa
Gm03:3986094 Rpslk N 3986094 [T/C] Kingwa
Gm03:3987393 Rpslk N 3987393 [C/T] Kingwa
Gm03:3990954 Rpslk N 3990954 [T/G] Kingwa
Gm03:3992071 Rpslk N 3992071 [C/A] Kingwa
Gm03:3995556 Rpslk N 3995556 [C/T] Kingwa
Gm03:3996269 Rpslk N 3996269 [C/A] Kingwa
Gm03:3996600 Rpslk N 3996600 [T/A] Kingwa
Gm03:3997028 Rpslk N 3997028 [C/T] Kingwa
Gm03:3998157 Rpslk N 3998157 [G/C] Kingwa
Gm03:3998162 Rpslk N 3998162 [G/A] Kingwa
Gm03:3998381 Rpslk N 3998381 [T/C] Kingwa
Gm03:3998421 Rpslk N 3998421 [T/C] Kingwa
Gm03:3999241 Rpslk N 3999241 [T/G] Kingwa
Gm03:3999386 Rpslk N 3999386 [C/A] Kingwa
Gm03:3999666 Rpslk N 3999666 [A/G] Kingwa
Gm03:4000684 Rpslk N 4000684 [C/G] Kingwa
Gm03:4001327 Rpslk N 4001327 [A/G] Kingwa
Gm03:4001783 Rpslk N 4001783 [A/T] Kingwa
Gm03:4002016 Rpslk N 4002016 [C/T] Kingwa
Gm03:4005770 Rpslk N 4005770 [T/C] Kingwa
Gm03:4008187 Rpslk N 4008187 [G/A] Kingwa
Gm03:4008673 Rpslk N 4008673 [A/G] Kingwa
Gm03:4008687 Rpslk N 4008687 [A/G] Kingwa
Gm03:4010191 Rpslk N 4010191 [C/T] Kingwa
Gm03:4018588 Rpslk N 4018588 [A/G] Kingwa
Gm03:4019384 Rpslk N 4019384 [T/C] Kingwa
Gm03:4019896 Rpslk N 4019896 [A/G] Kingwa
Gm03:4020751 Rpslk N 4020751 [T/C] Kingwa
Gm03:4021281 Rpslk N 4021281 [G/A] Kingwa
Gm03:4021291 Rpslk N 4021291 [A/G] Kingwa
Gm03:4022234 Rpslk N 4022234 [T/A] Kingwa
Gm03:4022275 Rpslk N 4022275 [T/C] Kingwa
Gm03:4022530 Rpslk N 4022530 [A/T] Kingwa
Gm03:4022872 Rpslk N 4022872 [A/G] Kingwa
Gm03:4022934 Rpslk N 4022934 [A/G] Kingwa
Gm03:4023283 Rpslk N 4023283 [T/C] Kingwa
Gm03:4023522 Rpslk N 4023522 [C/T] Kingwa
Gm03:4024184 Rpslk N 4024184 [C/A] Kingwa
Gm03:4024294 Rpslk N 4024294 [T/C] Kingwa
Gm03:4024485 Rpslk N 4024485 [A/G] Kingwa
Gm03:4024630 Rpslk N 4024630 [T/C] Kingwa
Gm03:4024844 Rpslk N 4024844 [T/C] Kingwa
Gm03:4025056 Rpslk N 4025056 [A/G] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4026652 Rpslk N 4026652 [T/A] Kingwa
Gm03:4028481 Rpslk N 4028481 [G/T] Kingwa
Gm03:4028849 Rpslk N 4028849 [A/G] Kingwa
Gm03:4028961 Rpslk N 4028961 [A/G] Kingwa
Gm03:4029068 Rpslk N 4029068 [A/G] Kingwa
Gm03:4029809 Rpslk N 4029809 [T/G] Kingwa
Gm03:4031277 Rpslk N 4031277 [G/T] Kingwa
Gm03:4031983 Rpslk N 4031983 [C/A] Kingwa
Gm03:4031997 Rpslk N 4031997 [G/C] Kingwa
Gm03:4032705 Rpslk N 4032705 [T/C] Kingwa
Gm03:4035600 Rpslk N 4035600 [T/C] Kingwa
Gm03:4035918 Rpslk N 4035918 [A/G] Kingwa
Gm03:4036376 Rpslk N 4036376 [A/C] Kingwa
Gm03:4040874 Rpslk N 4040874 [A/G] Kingwa
Gm03:4041301 Rpslk N 4041301 [T/C] Kingwa
Gm03:4041795 Rpslk N 4041795 [A/G] Kingwa
Gm03:4042572 Rpslk N 4042572 [G/A] Kingwa
Gm03:4042679 Rpslk N 4042679 [T/C] Kingwa
Gm03:4042697 Rpslk N 4042697 [A/G] Kingwa
Gm03:4043007 Rpslk N 4043007 [A/G] Kingwa
Gm03:4043140 Rpslk N 4043140 [A/G] Kingwa
Gm03:4043823 Rpslk N 4043823 [T/G] Kingwa
Gm03:4043978 Rpslk N 4043978 [C/T] Kingwa
Gm03:4044534 Rpslk N 4044534 [T/C] Kingwa
Gm03:4044555 Rpslk N 4044555 [T/C] Kingwa
Gm03:4044972 Rpslk N 4044972 [A/G] Kingwa
Gm03:4045630 Rpslk N 4045630 [A/G] Kingwa
Gm03:4046313 Rpslk N 4046313 [C/A] Kingwa
Gm03:4049555 Rpslk N 4049555 [T/C] Kingwa
Gm03:4049791 Rpslk N 4049791 [T/C] Kingwa
Gm03:4049877 Rpslk N 4049877 [T/C] Kingwa
Gm03:4050197 Rpslk N 4050197 [A/G] Kingwa
Gm03:4053685 Rpslk N 4053685 [T/C] Kingwa
Gm03:4053838 Rpslk N 4053838 [T/C] Kingwa
Gm03:4054927 Rpslk N 4054927 [T/C] Kingwa
Gm03:4055100 Rpslk N 4055100 [A/G] Kingwa
Gm03:4055384 Rpslk N 4055384 [A/G] Kingwa
Gm03:4055427 Rpslk N 4055427 [T/C] Kingwa
Gm03:4055483 Rpslk N 4055483 [A/G] Kingwa
Gm03:4062751 Rpslk N 4062751 [A/C] Kingwa
Gm03:4062885 Rpslk N 4062885 [A/T] Kingwa
Gm03:4064351 Rpslk N 4064351 [T/C] Kingwa
Gm03:4064592 Rpslk N 4064592 [A/G] Kingwa
Gm03:4064759 Rpslk N 4064759 [T/G] Kingwa
Gm03:4064811 Rpslk N 4064811 [T/C] Kingwa
Gm03:4064957 Rpslk N 4064957 [C/T] Kingwa
Gm03:4065083 Rpslk N 4065083 [T/C] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4066234 Rpslk N 4066234 [A/T] Kingwa
Gm03:4066331 Rpslk N 4066331 [A/T] Kingwa
Gm03:4067099 Rpslk N 4067099 [A/T] Kingwa
Gm03:4067514 Rpslk N 4067514 [T/A] Kingwa
Gm03:4069037 Rpslk N 4069037 [T/G] Kingwa
Gm03:4069603 Rpslk N 4069603 [T/A] Kingwa
Gm03:4070422 Rpslk N 4070422 [G/A] Kingwa
Gm03:4072567 Rpslk N 4072567 [T/C] Kingwa
Gm03:4074190 Rpslk N 4074190 [T/C] Kingwa
Gm03:4075232 Rpslk N 4075232 [G/A] Kingwa
Gm03:4076404 Rpslk N 4076404 [T/A] Kingwa
Gm03:4078299 Rpslk N 4078299 [T/C] Kingwa
Gm03:4078902 Rpslk N 4078902 [C/T] Kingwa
Gm03:4080136 Rpslk N 4080136 [A/T] Kingwa
Gm03:4081056 Rpslk N 4081056 [T/A] Kingwa
Gm03:4081889 Rpslk N 4081889 [A/G] Kingwa
Gm03:4082200 Rpslk N 4082200 [G/A] Kingwa
Gm03:4082590 Rpslk N 4082590 [C/G] Kingwa
Gm03:4082701 Rpslk N 4082701 [A/C] Kingwa
Gm03:4082781 Rpslk N 4082781 [G/C] Kingwa
Gm03:4082871 Rpslk N 4082871 [A/G] Kingwa
Gm03:4083114 Rpslk N 4083114 [T/C] Kingwa
Gm03:4084001 Rpslk N 4084001 [G/T] Kingwa
Gm03:4084095 Rpslk N 4084095 [A/G] Kingwa
Gm03:4085042 Rpslk N 4085042 [T/A] Kingwa
Gm03:4085524 Rpslk N 4085524 [T/G] Kingwa
Gm03:4086286 Rpslk N 4086286 [A/T] Kingwa
Gm03:4086887 Rpslk N 4086887 [T/C] Kingwa
Gm03:4087383 Rpslk N 4087383 [T/C] Kingwa
Gm03:4088310 Rpslk N 4088310 [T/G] Kingwa
Gm03:4090188 Rpslk N 4090188 [C/T] Kingwa
Gm03:4092799 Rpslk N 4092799 [A/C] Kingwa
Gm03:4092928 Rpslk N 4092928 [T/C] Kingwa
Gm03:4093195 Rpslk N 4093195 [G/A] Kingwa
Gm03:4093240 Rpslk N 4093240 [T/C] Kingwa
Gm03:4097291 Rpslk N 4097291 [T/A] Kingwa
Gm03:4097563 Rpslk N 4097563 [A/G] Kingwa
Gm03:4097729 Rpslk N 4097729 [A/G] Kingwa
Gm03:4098328 Rpslk N 4098328 [A/T] Kingwa
Gm03:4100831 Rpslk N 4100831 [A/T] Kingwa
Gm03:4101257 Rpslk N 4101257 [A/T] Kingwa
Gm03:4103342 Rpslk N 4103342 [C/T] Kingwa
Gm03:4103449 Rpslk N 4103449 [T/C] Kingwa
Gm03:4103450 Rpslk N 4103450 [G/C] Kingwa
Gm03:4103515 Rpslk N 4103515 [T/C] Kingwa
Gm03:4103547 Rpslk N 4103547 [T/C] Kingwa
Gm03:4103633 Rpslk N 4103633 [T/C] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4104502 Rpslk N 4104502 [T/C] Kingwa
Gm03:4106406 Rpslk N 4106406 [C/A] Kingwa
Gm03:4109228 Rpslk N 4109228 [A/C] Kingwa
Gm03:4110012 Rpslk N 4110012 [C/T] Kingwa
Gm03:4110449 Rpslk N 4110449 [A/G] Kingwa
Gm03:4110821 Rpslk N 4110821 [G/A] Kingwa
Gm03:4111538 Rpslk N 4111538 [T/C] Kingwa
Gm03:4113757 Rpslk N 4113757 [A/G] Kingwa
Gm03:4116726 Rpslk N 4116726 [T/A] Kingwa
Gm03:4117330 Rpslk N 4117330 [T/G] Kingwa
Gm03:4117375 Rpslk N 4117375 [G/A] Kingwa
Gm03:4117779 Rpslk N 4117779 [C/G] Kingwa
Gm03:4117890 Rpslk N 4117890 [C/G] Kingwa
Gm03:4117986 Rpslk N 4117986 [G/A] Kingwa
Gm03:4120433 Rpslk N 4120433 [T/C] Kingwa
Gm03:4120705 Rpslk N 4120705 [G/A] Kingwa
Gm03:4122180 Rpslk N 4122180 [C/T] Kingwa
Gm03:4129251 Rpslk N 4129251 [T/C] Kingwa
Gm03:4129479 Rpslk N 4129479 [T/C] Kingwa
Gm03:4129635 Rpslk N 4129635 [T/C] Kingwa
Gm03:4130393 Rpslk N 4130393 [T/C] Kingwa
Gm03:4131257 Rpslk N 4131257 [T/G] Kingwa
Gm03:4132032 Rpslk N 4132032 [C/A] Kingwa
Gm03:4132192 Rpslk N 4132192 [A/G] Kingwa
Gm03:4133520 Rpslk N 4133520 [C/T] Kingwa
Gm03:4134606 Rpslk N 4134606 [A/G] Kingwa
Gm03:4134679 Rpslk N 4134679 [A/G] Kingwa
Gm03:4136487 Rpslk N 4136487 [T/C] Kingwa
Gm03:4136724 Rpslk N 4136724 [T/G] Kingwa
Gm03:4136742 Rpslk N 4136742 [T/C] Kingwa
Gm03:4136791 Rpslk N 4136791 [A/T] Kingwa
Gm03:4136972 Rpslk N 4136972 [T/A] Kingwa
Gm03:4137137 Rpslk N 4137137 [T/G] Kingwa
Gm03:4137521 Rpslk N 4137521 [C/T] Kingwa
Gm03:4137540 Rpslk N 4137540 [G/A] Kingwa
Gm03:4137645 Rpslk N 4137645 [A/G] Kingwa
Gm03:4138435 Rpslk N 4138435 [T/C] Kingwa
Gm03:4138980 Rpslk N 4138980 [A/G] Kingwa
Gm03:4139156 Rpslk N 4139156 [A/G] Kingwa
Gm03:4139395 Rpslk N 4139395 [C/A] Kingwa
Gm03:4140035 Rpslk N 4140035 [C/T] Kingwa
Gm03:4140071 Rpslk N 4140071 [T/G] Kingwa
Gm03:4140976 Rpslk N 4140976 [A/G] Kingwa
Gm03:4141074 Rpslk N 4141074 [T/C] Kingwa
Gm03:4141090 Rpslk N 4141090 [A/T] Kingwa
Gm03:4141251 Rpslk N 4141251 [T/C] Kingwa
Gm03:4141363 Rpslk N 4141363 [T/C] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4141488 Rpslk N 4141488 [A/G] Kingwa
Gm03:4142353 Rpslk N 4142353 [A/G] Kingwa
Gm03:4142380 Rpslk N 4142380 [C/T] Kingwa
Gm03:4142693 Rpslk N 4142693 [T/C] Kingwa
Gm03:4142800 Rpslk N 4142800 [T/C] Kingwa
Gm03:4142810 Rpslk N 4142810 [T/C] Kingwa
Gm03:4143060 Rpslk N 4143060 [A/C] Kingwa
Gm03:4143112 Rpslk N 4143112 [A/T] Kingwa
Gm03:4143113 Rpslk N 4143113 [T/G] Kingwa
Gm03:4144137 Rpslk N 4144137 [T/C] Kingwa
Gm03:4144350 Rpslk N 4144350 [T/C] Kingwa
Gm03:4144639 Rpslk N 4144639 [T/C] Kingwa
Gm03:4145737 Rpslk N 4145737 [A/G] Kingwa
Gm03:4145959 Rpslk N 4145959 [C/G] Kingwa
Gm03:4145974 Rpslk N 4145974 [G/C] Kingwa
Gm03:4146284 Rpslk N 4146284 [A/G] Kingwa
Gm03:4147289 Rpslk N 4147289 [C/G] Kingwa
Gm03:4147425 Rpslk N 4147425 [C/T] Kingwa
Gm03:4148248 Rpslk N 4148248 [A/G] Kingwa
Gm03:4148643 Rpslk N 4148643 [C/T] Kingwa
Gm03:4148732 Rpslk N 4148732 [A/G] Kingwa
Gm03:4149880 Rpslk N 4149880 [A/G] Kingwa
Gm03:4149919 Rpslk N 4149919 [A/G] Kingwa
Gm03:4150189 Rpslk N 4150189 [C/T] Kingwa
Gm03:4150330 Rpslk N 4150330 [T/C] Kingwa
Gm03:4151366 Rpslk N 4151366 [A/G] Kingwa
Gm03:4152106 Rpslk N 4152106 [T/C] Kingwa
Gm03:4153221 Rpslk N 4153221 [A/T] Kingwa
Gm03:4153413 Rpslk N 4153413 [A/T] Kingwa
Gm03:4153505 Rpslk N 4153505 [C/T] Kingwa
Gm03:4153885 Rpslk N 4153885 [C/T] Kingwa
Gm03:4154059 Rpslk N 4154059 [A/C] Kingwa
Gm03:4156891 Rpslk N 4156891 [A/G] Kingwa
Gm03:4158622 Rpslk N 4158622 [G/T] Kingwa
Gm03:4159661 Rpslk N 4159661 [C/G] Kingwa
Gm03:4160698 Rpslk N 4160698 [C/T] Kingwa
Gm03:4162268 Rpslk N 4162268 [A/G] Kingwa
Gm03:4163423 Rpslk N 4163423 [G/A] Kingwa
Gm03:4164061 Rpslk N 4164061 [T/C] Kingwa
Gm03:4164065 Rpslk N 4164065 [T/C] Kingwa
Gm03:4164142 Rpslk N 4164142 [A/G] Kingwa
Gm03:4164401 Rpslk N 4164401 [A/G] Kingwa
Gm03:4164507 Rpslk N 4164507 [T/C] Kingwa
Gm03:4164719 Rpslk N 4164719 [A/G] Kingwa
Gm03:4164807 Rpslk N 4164807 [A/G] Kingwa
Gm03:4166307 Rpslk N 4166307 [C/A] Kingwa
Gm03:4166432 Rpslk N 4166432 [G/A] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4167439 Rpslk N 4167439 [C/T] Kingwa
Gm03:4167591 Rpslk N 4167591 [C/T] Kingwa
Gm03:4167701 Rpslk N 4167701 [A/G] Kingwa
Gm03:4168907 Rpslk N 4168907 [T/A] Kingwa
Gm03:4169729 Rpslk N 4169729 [A/G] Kingwa
Gm03:4169784 Rpslk N 4169784 [A/G] Kingwa
Gm03:4169863 Rpslk N 4169863 [G/A] Kingwa
Gm03:4169950 Rpslk N 4169950 [T/C] Kingwa
Gm03:4169995 Rpslk N 4169995 [G/C] Kingwa
Gm03:4171393 Rpslk N 4171393 [C/T] Kingwa
Gm03:4171766 Rpslk N 4171766 [A/T] Kingwa
Gm03:4172171 Rpslk N 4172171 [A/C] Kingwa
Gm03:4173195 Rpslk N 4173195 [A/G] Kingwa
Gm03:4173316 Rpslk N 4173316 [A/G] Kingwa
Gm03:4173405 Rpslk N 4173405 [T/C] Kingwa
Gm03:4173524 Rpslk N 4173524 [A/C] Kingwa
Gm03:4175127 Rpslk N 4175127 [A/G] Kingwa
Gm03:4177056 Rpslk N 4177056 [A/T] Kingwa
Gm03:4177689 Rpslk N 4177689 [A/G] Kingwa
Gm03:4177690 Rpslk N 4177690 [G/A] Kingwa
Gm03:4178958 Rpslk N 4178958 [A/G] Kingwa
Gm03:4179972 Rpslk N 4179972 [T/C] Kingwa
Gm03:4180458 Rpslk N 4180458 [A/G] Kingwa
Gm03:4182337 Rpslk N 4182337 [G/A] Kingwa
Gm03:4184380 Rpslk N 4184380 [T/G] Kingwa
Gm03:4184951 Rpslk N 4184951 [T/G] Kingwa
Gm03:4184971 Rpslk N 4184971 [T/A] Kingwa
Gm03:4185234 Rpslk N 4185234 [A/G] Kingwa
Gm03:4185400 Rpslk N 4185400 [G/A] Kingwa
Gm03:4185863 Rpslk N 4185863 [T/C] Kingwa
Gm03:4187256 Rpslk N 4187256 [A/G] Kingwa
Gm03:4188732 Rpslk N 4188732 [T/C] Kingwa
Gm03:4189845 Rpslk N 4189845 [C/T] Kingwa
Gm03:4189964 Rpslk N 4189964 [T/C] Kingwa
Gm03:4190679 Rpslk N 4190679 [G/C] Kingwa
Gm03:4191313 Rpslk N 4191313 [A/G] Kingwa
Gm03:4191519 Rpslk N 4191519 [T/C] Kingwa
Gm03:4192359 Rpslk N 4192359 [T/C] Kingwa
Gm03:4192478 Rpslk N 4192478 [A/G] Kingwa
Gm03:4192513 Rpslk N 4192513 [T/C] Kingwa
Gm03:4192621 Rpslk N 4192621 [C/T] Kingwa
Gm03:4192738 Rpslk N 4192738 [G/A] Kingwa
Gm03:4193009 Rpslk N 4193009 [T/C] Kingwa
Gm03:4193030 Rpslk N 4193030 [G/T] Kingwa
Gm03:4193039 Rpslk N 4193039 [G/T] Kingwa
Gm03:4193483 Rpslk N 4193483 [T/C] Kingwa
Gm03:4196188 Rpslk N 4196188 [T/C] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4196542 Rpslk N 4196542 [T/C] Kingwa
Gm03:4197697 Rpslk N 4197697 [T/A] Kingwa
Gm03:4197774 Rpslk N 4197774 [A/T] Kingwa
Gm03:4198285 Rpslk N 4198285 [A/G] Kingwa
Gm03:4198508 Rpslk N 4198508 [C/A] Kingwa
Gm03:4198711 Rpslk N 4198711 [A/C] Kingwa
Gm03:4198914 Rpslk N 4198914 [A/G] Kingwa
Gm03:4199748 Rpslk N 4199748 [G/A] Kingwa
Gm03:4200094 Rpslk N 4200094 [A/C] Kingwa
Gm03:4203253 Rpslk N 4203253 [G/C] Kingwa
Gm03:4203462 Rpslk N 4203462 [G/A] Kingwa
Gm03:4203594 Rpslk N 4203594 [C/T] Kingwa
Gm03:4203626 Rpslk N 4203626 [C/G] Kingwa
Gm03:4204747 Rpslk N 4204747 [A/G] Kingwa
Gm03:4204867 Rpslk N 4204867 [A/G] Kingwa
Gm03:4205828 Rpslk N 4205828 [C/G] Kingwa
Gm03:4205953 Rpslk N 4205953 [T/C] Kingwa
Gm03:4206870 Rpslk N 4206870 [G/A] Kingwa
Gm03:4207703 Rpslk N 4207703 [G/A] Kingwa
Gm03:4215115 Rpslk N 4215115 [C/T] Kingwa
Gm03:4215690 Rpslk N 4215690 [T/G] Kingwa
Gm03:4215950 Rpslk N 4215950 [A/G] Kingwa
Gm03:4217736 Rpslk N 4217736 [G/T] Kingwa
Gm03:4218032 Rpslk N 4218032 [C/A] Kingwa
Gm03:4218527 Rpslk N 4218527 [C/A] Kingwa
Gm03:4218716 Rpslk N 4218716 [G/A] Kingwa
Gm03:4218990 Rpslk N 4218990 [G/T] Kingwa
Gm03:4219539 Rpslk N 4219539 [A/T] Kingwa
Gm03:4219667 Rpslk N 4219667 [A/G] Kingwa
Gm03:4221288 Rpslk N 4221288 [T/C] Kingwa
Gm03:4222312 Rpslk N 4222312 [A/C] Kingwa
Gm03:4223122 Rpslk N 4223122 [A/G] Kingwa
Gm03:4223821 Rpslk N 4223821 [T/C] Kingwa
Gm03:4224501 Rpslk N 4224501 [T/C] Kingwa
Gm03:4225137 Rpslk N 4225137 [G/A] Kingwa
Gm03:4225960 Rpslk N 4225960 [A/C] Kingwa
Gm03:4226471 Rpslk N 4226471 [T/A] Kingwa
Gm03:4227488 Rpslk N 4227488 [C/G] Kingwa
Gm03:4228931 Rpslk N 4228931 [A/G] Kingwa
Gm03:4229006 Rpslk N 4229006 [C/T] Kingwa
Gm03:4229247 Rpslk N 4229247 [A/C] Kingwa
Gm03:4230412 Rpslk N 4230412 [A/G] Kingwa
Gm03:4230665 Rpslk N 4230665 [A/G] Kingwa
Gm03:4230768 Rpslk N 4230768 [C/T] Kingwa
Gm03:4231904 Rpslk N 4231904 [G/A] Kingwa
Gm03:4231979 Rpslk N 4231979 [G/A] Kingwa
Gm03:4233068 Rpslk N 4233068 [T/C] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4233431 Rpslk N 4233431 [G/C] Kingwa
Gm03:4233493 Rpslk N 4233493 [G/C] Kingwa
Gm03:4233550 Rpslk N 4233550 [T/C] Kingwa
Gm03:4234109 Rpslk N 4234109 [C/T] Kingwa
Gm03:4234194 Rpslk N 4234194 [A/G] Kingwa
Gm03:4234277 Rpslk N 4234277 [A/G] Kingwa
Gm03:4234310 Rpslk N 4234310 [T/A] Kingwa
Gm03:4235089 Rpslk N 4235089 [G/A] Kingwa
Gm03:4235183 Rpslk N 4235183 [T/C] Kingwa
Gm03:4235519 Rpslk N 4235519 [T/C] Kingwa
Gm03:4235634 Rpslk N 4235634 [A/C] Kingwa
Gm03:4235844 Rpslk N 4235844 [G/A] Kingwa
Gm03:4236123 Rpslk N 4236123 [T/C] Kingwa
Gm03:4236298 Rpslk N 4236298 [C/T] Kingwa
Gm03:4239026 Rpslk N 4239026 [T/C] Kingwa
Gm03:4242434 Rpslk N 4242434 [G/T] Kingwa
Gm03:4243529 Rpslk N 4243529 [C/T] Kingwa
Gm03:4244201 Rpslk N 4244201 [T/C] Kingwa
Gm03:4244338 Rpslk N 4244338 [A/C] Kingwa
Gm03:4244497 Rpslk N 4244497 [T/G] Kingwa
Gm03:4245348 Rpslk N 4245348 [G/A] Kingwa
Gm03:4245390 Rpslk N 4245390 [T/C] Kingwa
Gm03:4245678 Rpslk N 4245678 [A/G] Kingwa
Gm03:4246770 Rpslk N 4246770 [A/G] Kingwa
Gm03:4246837 Rpslk N 4246837 [T/G] Kingwa
Gm03:4247592 Rpslk N 4247592 [A/G] Kingwa
Gm03:4247726 Rpslk N 4247726 [C/T] Kingwa
Gm03:4252413 Rpslk N 4252413 [A/T] Kingwa
Gm03:4252569 Rpslk N 4252569 [G/A] Kingwa
Gm03:4252894 Rpslk N 4252894 [G/A] Kingwa
Gm03:4252928 Rpslk N 4252928 [G/A] Kingwa
Gm03:4253518 Rpslk N 4253518 [T/C] Kingwa
Gm03:4257596 Rpslk N 4257596 [A/C] Kingwa
Gm03:4257995 Rpslk N 4257995 [G/C] Kingwa
Gm03:4258161 Rpslk N 4258161 [T/G] Kingwa
Gm03:4258545 Rpslk N 4258545 [T/C] Kingwa
Gm03:4260785 Rpslk N 4260785 [A/G] Kingwa
Gm03:4260901 Rpslk N 4260901 [C/T] Kingwa
Gm03:4261372 Rpslk N 4261372 [T/A] Kingwa
Gm03:4261626 Rpslk N 4261626 [A/T] Kingwa
Gm03:4262516 Rpslk N 4262516 [C/G] Kingwa
Gm03:4262869 Rpslk N 4262869 [G/A] Kingwa
Gm03:4263876 Rpslk N 4263876 [A/G] Kingwa
Gm03:4264709 Rpslk N 4264709 [C/T] Kingwa
Gm03:4265916 Rpslk N 4265916 [A/G] Kingwa
Gm03:4266927 Rpslk N 4266927 [A/G] Kingwa
Gm03:4267296 Rpslk N 4267296 [A/G] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4268640 Rpslk N 4268640 [C/G] Kingwa
Gm03:4268852 Rpslk N 4268852 [G/A] Kingwa
Gm03:4295832 Rpslk N 4295832 [A/G] Kingwa
Gm03:4302907 Rpslk N 4302907 [G/C] Kingwa
Gm03:4302936 Rpslk N 4302936 [A/T] Kingwa
Gm03:4306709 Rpslk N 4306709 [T/C] Kingwa
Gm03:4307835 Rpslk N 4307835 [C/A] Kingwa
Gm03:4307996 Rpslk N 4307996 [G/A] Kingwa
Gm03:4308161 Rpslk N 4308161 [T/A] Kingwa
Gm03:4308286 Rpslk N 4308286 [C/T] Kingwa
Gm03:4308323 Rpslk N 4308323 [G/T] Kingwa
Gm03:4308522 Rpslk N 4308522 [T/A] Kingwa
Gm03:4313900 Rpslk N 4313900 [C/T] Kingwa
Gm03:4314212 Rpslk N 4314212 [G/T] Kingwa
Gm03:4314464 Rpslk N 4314464 [G/C] Kingwa
Gm03:4315256 Rpslk N 4315256 [A/G] Kingwa
Gm03:4317574 Rpslk N 4317574 [G/C] Kingwa
Gm03:4318530 Rpslk N 4318530 [A/G] Kingwa
Gm03:4319271 Rpslk N 4319271 [C/G] Kingwa
Gm03:4320841 Rpslk N 4320841 [A/G] Kingwa
Gm03:4321243 Rpslk N 4321243 [C/T] Kingwa
Gm03:4321515 Rpslk N 4321515 [T/G] Kingwa
Gm03:4328502 Rpslk N 4328502 [G/T] Kingwa
Gm03:4329219 Rpslk N 4329219 [C/G] Kingwa
Gm03:4329504 Rpslk N 4329504 [T/C] Kingwa
Gm03:4330121 Rpslk N 4330121 [A/G] Kingwa
Gm03:4330318 Rpslk N 4330318 [T/C] Kingwa
Gm03:4331246 Rpslk N 4331246 [A/G] Kingwa
Gm03:4331889 Rpslk N 4331889 [A/G] Kingwa
Gm03:4337173 Rpslk N 4337173 [G/A] Kingwa
Gm03:4338377 Rpslk N 4338377 [G/C] Kingwa
Gm03:4338505 Rpslk N 4338505 [A/G] Kingwa
Gm03:4338559 Rpslk N 4338559 [T/A] Kingwa
Gm03:4339885 Rpslk N 4339885 [T/A] Kingwa
Gm03:4341064 Rpslk N 4341064 [A/G] Kingwa
Gm03:4342692 Rpslk N 4342692 [T/C] Kingwa
Gm03:4342727 Rpslk N 4342727 [A/T] Kingwa
Gm03:4343201 Rpslk N 4343201 [A/G] Kingwa
Gm03:4343212 Rpslk N 4343212 [T/C] Kingwa
Gm03:4348211 Rpslk N 4348211 [T/C] Kingwa
Gm03:4350556 Rpslk N 4350556 [A/T] Kingwa
Gm03:4350658 Rpslk N 4350658 [A/G] Kingwa
Gm03:4350767 Rpslk N 4350767 [G/A] Kingwa
Gm03:4351326 Rpslk N 4351326 [T/G] Kingwa
Gm03:4351612 Rpslk N 4351612 [T/G] Kingwa
Gm03:4351617 Rpslk N 4351617 [T/G] Kingwa
Gm03:4351674 Rpslk N 4351674 [A/C] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4352353 Rpslk N 4352353 [T/G] Kingwa
Gm03:4353932 Rpslk N 4353932 [T/C] Kingwa
Gm03:4354036 Rpslk N 4354036 [C/G] Kingwa
Gm03:4355046 Rpslk N 4355046 [C/G] Kingwa
Gm03:4362 11 Rpslk N 4362911 [A/G] Kingwa
Gm03:4363385 Rpslk N 4363385 [A/T] Kingwa
Gm03:4363855 Rpslk N 4363855 [T/C] Kingwa
Gm03:4364133 Rpslk N 4364133 [A/G] Kingwa
Gm03:4364176 Rpslk N 4364176 [G/T] Kingwa
Gm03:4364200 Rpslk N 4364200 [A/C] Kingwa
Gm03:4364469 Rpslk N 4364469 [A/G] Kingwa
Gm03:4385480 Rpslk N 4385480 [G/A] Kingwa
Gm03:4385781 Rpslk N 4385781 [A/G] Kingwa
Gm03:4386327 Rpslk N 4386327 [A/G] Kingwa
Gm03:4386398 Rpslk N 4386398 [G/C] Kingwa
Gm03:4386633 Rpslk N 4386633 [G/A] Kingwa
Gm03:4386927 Rpslk N 4386927 [C/T] Kingwa
Gm03:4387264 Rpslk N 4387264 [T/C] Kingwa
Gm03:4388736 Rpslk N 4388736 [A/T] Kingwa
Gm03:4388954 Rpslk N 4388954 [T/C] Kingwa
Gm03:4388982 Rpslk N 4388982 [A/G] Kingwa
Gm03:4389208 Rpslk N 4389208 [T/C] Kingwa
Gm03:4389211 Rpslk N 4389211 [A/G] Kingwa
Gm03:4389280 Rpslk N 4389280 [A/C] Kingwa
Gm03:4389696 Rpslk N 4389696 [T/A] Kingwa
Gm03:4390074 Rpslk N 4390074 [G/A] Kingwa
Gm03:4390738 Rpslk N 4390738 [A/T] Kingwa
Gm03:4390827 Rpslk N 4390827 [C/T] Kingwa
Gm03:4390979 Rpslk N 4390979 [C/A] Kingwa
Gm03:4392217 Rpslk N 4392217 [A/T] Kingwa
Gm03:4392314 Rpslk N 4392314 [C/G] Kingwa
Gm03:4392891 Rpslk N 4392891 [G/A] Kingwa
Gm03:4392913 Rpslk N 4392913 [G/T] Kingwa
Gm03:4394477 Rpslk N 4394477 [C/G] Kingwa
Gm03:4394831 Rpslk N 4394831 [A/G] Kingwa
Gm03:4395386 Rpslk N 4395386 [T/C] Kingwa
Gm03:4395962 Rpslk N 4395962 [A/C] Kingwa
Gm03:4397872 Rpslk N 4397872 [A/G] Kingwa
Gm03:4398299 Rpslk N 4398299 [A/T] Kingwa
Gm03:4398919 Rpslk N 4398919 [T/C] Kingwa
Gm03:4399399 Rpslk N 4399399 [G/A] Kingwa
Gm03:4400461 Rpslk N 4400461 [C/G] Kingwa
Gm03:4404444 Rpslk N 4404444 [C/T] Kingwa
Gm03:4410393 Rpslk N 4410393 [A/G] Kingwa
Gm03:4410565 Rpslk N 4410565 [T/C] Kingwa
Gm03:4411187 Rpslk N 4411187 [T/C] Kingwa
Gm03:4412149 Rpslk N 4412149 [A/T] Kingwa Marker ID Locus LG Physical Allele Source
Position [R/S]
Gm03:4412417 Rpslk N 4412417 [A/G] Kingwa
Gm03:4412774 Rpslk N 4412774 [A/G] Kingwa
Gm03:4413415 Rpslk N 4413415 [C/T] Kingwa
Gm03:4446891 Rpslk N 4446891 [T/C] Kingwa
Gm03:4447988 Rpslk N 4447988 [A/C] Kingwa
Gm03:4448825 Rpslk N 4448825 [C/A] Kingwa
Gm03:4449634 Rpslk N 4449634 [T/A] Kingwa
Gm03:4449956 Rpslk N 4449956 [T/G] Kingwa
Gm03:4450328 Rpslk N 4450328 [C/T] Kingwa
Gm03:4450331 Rpslk N 4450331 [G/A] Kingwa
Gm03:4450888 Rpslk N 4450888 [T/A] Kingwa
Gm03:4451295 Rpslk N 4451295 [A/T] Kingwa
Gm03:4451491 Rpslk N 4451491 [A/C] Kingwa
Gm03:4451503 Rpslk N 4451503 [T/G] Kingwa
Gm03:4451847 Rpslk N 4451847 [T/A] Kingwa
Gm03:4452060 Rpslk N 4452060 [A/G] Kingwa
Gm03:4452118 Rpslk N 4452118 [A/G] Kingwa
Gm03:4452820 Rpslk N 4452820 [T/A] Kingwa
Gm03:4456305 Rpslk N 4456305 [T/C] Kingwa
Gm03:4458273 Rpslk N 4458273 [G/A] Kingwa
Gm03:4458399 Rpslk N 4458399 [A/T] Kingwa
Gm03:4461465 Rpslk N 4461465 [T/A] Kingwa
Gm03:4462225 Rpslk N 4462225 [A/C] Kingwa
Gm03:4471412 Rpslk N 4471412 [T/C] Kingwa
Gm03:4474352 Rpslk N 4474352 [A/G] Kingwa
Gm03:4477946 Rpslk N 4477946 [A/G] Kingwa
Gm03:4477947 Rpslk N 4477947 [C/G] Kingwa
Gm03:4478247 Rpslk N 4478247 [C/T] Kingwa
Gm03:4478479 Rpslk N 4478479 [G/C] Kingwa
Gm03:4478554 Rpslk N 4478554 [A/T] Kingwa
Gm03:4478921 Rpslk N 4478921 [A/G] Kingwa
Gm03:4479127 Rpslk N 4479127 [T/A] Kingwa
Gm03:4506056 Rpslk N 4506056 [A/G] Kingwa
Gm03:4506139 Rpslk N 4506139 [A/G] Kingwa
Gm03:4506147 Rpslk N 4506147 [T/C] Kingwa
Gm03:4507198 Rpslk N 4507198 [A/T] Kingwa
Gm03:4525141 Rpslk N 4525141 [A/G] Kingwa
Gm03:4525736 Rpslk N 4525736 [C/T] Kingwa
Gm03:4526278 Rpslk N 4526278 [C/T] Kingwa
Gm03:4526393 Rpslk N 4526393 [C/T] Kingwa
Gm03:4526446 Rpslk N 4526446 [G/C] Kingwa
Gm03:4527054 Rpslk N 4527054 [A/T] Kingwa
Gm03:4533559 Rpslk N 4533559 [A/T] Kingwa
Gm03:4539866 Rpslk N 4539866 [A/G] Kingwa
Gm03:4541294 Rpslk N 4541294 [A/G] Kingwa
:Gm composite 2003 Genetic Map
:* Physical positions are based on Public JGI Glymal Williams82 reference. In certain embodiments, multiple marker loci that collectively make up a
Phytophthora tolerance haplotype of interest are investigated. For example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the various marker loci provided herein can comprise a
Phytophthora tolerance haplotype. In some embodiments, the haplotype comprises: (a) two or more marker loci associated with the Rpsla, Rpslc, Rpsld or Rpslk loci found on linkage group N; (b) two or more marker loci comprising S08291-1, S07292-1, S08242- 1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB , or a closely linked marker on linkage group N; (c) two or more marker loci associated with the Rps2 locus found on linkage group J; (d) two or more marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (e) two or more marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) two or more marker loci comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) two or more marker loci associated with the Rps6 locus found on linkage group G; or (h) two or more marker loci comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
In one embodiment, the method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one haplotype that is associated with the tolerance, wherein the at least one haplotype comprises at least two of the various marker loci provided herein.
In certain embodiments, two or more marker loci or haplotypes can collectively make up a marker profile. The marker profile can comprise any two or more marker loci comprising: (a) any marker loci associated with the Rpsla, Rpslc, Rpsld or Rpslk loci found on linkage group N; (b) marker loci comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB, or a closely linked marker on linkage group N; (c) any marker loci associated with the Rps2 locus found on linkage group J; (d) marker loci comprising S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (e) any marker loci associated with the Rps3a or Rps3c loci found on linkage group F; (f) marker loci comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) any marker loci associated with the Rps6 locus found on linkage group G; and/or (h) marker loci comprising S08442-1, S08341-l or a marker closely linked thereto on linkage group G .
Any marker loci associated with Phytophthora tolerance can be combined in the marker profile with any of the marker loci disclosed herein. For example, the marker profile can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more marker loci or haplotypes associated with tolerance to Phytophthora infection provided herein (i.e. the various marker loci provided in Tables 1A and IB and in Figures 1-4).
In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection comprises detecting in the genome of the first soybean plant or in the genome of the first soybean germplasm at least one marker profile that is associated with the tolerance, wherein the at least one marker profile comprises at least two of the various marker loci provided herein. In some embodiments, the marker profile comprises any combination of two or more marker loci from any of the various Rps loci, for example, Rpsl, Rps2, Rps3, Rps4, Rps5, Rps6, Rps7 or Rps8.
Not only can one detect the various markers provided herein, it is recognized that one could detect any markers that are closely linked to the various markers discussed herein. Non-limiting examples of markers closely linked the various markers discussed herein are provided in Tables 1A and IB and in Figures 1-4.
In addition to the markers discussed herein, information regarding useful soybean markers can be found, for example, on the USDA's Soybase website, available at www.soybase.org. One of skill in the art will recognize that the identification of favorable marker alleles may be germplasm-specific. The determination of which marker alleles correlate with tolerance (or susceptibility) is determined for the particular germplasm under study. One of skill will also recognize that methods for identifying the favorable alleles are routine and well known in the art, and furthermore, that the identification and use of such favorable alleles is well within the scope of the invention. Various methods are provided to identify soybean plants and/or germplasm with tolerance or improved tolerance to Phytophthora infection. In one embodiment, the method of identifying comprises detecting at least one marker locus associated with tolerance to Phytophthora. The term "associated with" in connection with a relationship between a marker locus and a phenotype refers to a statistically significant dependence of marker frequency with respect to a quantitative scale or qualitative gradation of the phenotype. Thus, an allele of a marker is associated with a trait of interest when the allele of the marker locus and the trait phenotypes are found together in the progeny of an organism more often than if the marker genotypes and trait phenotypes segregated separately.
Any combination of the marker loci provided herein can be used in the methods to identify a soybean plant or soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection. Any one marker locus or any combination of the markers set forth in Table 1 , or any closely linked marker can be used to aid in identifying and selecting soybean plants or soybean germplasm with tolerance or improved tolerance to Phytophthora infection.
In one embodiment, a method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection is provided. The method comprises detecting in the genome of the first soybean plant or first soybean germplasm at least one marker locus that is associated with tolerance. In such a method, the at least one marker locus: (a) can be associated with the Rpsla, Rpslc, Rpsld or Rpslk loci found on linkage group N; (b) can comprise one or more of the marker loci S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB, or a closely linked marker on linkage group N; (c) can be associated with the Rps2 locus found on linkage group J; (d) can comprise one or more of the marker loci S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (e) can be associated with the Rps3a or Rps3c loci found on linkage group F; (f) can comprise one or more of the marker loci S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; (g) can be associated with the Rps6 locus found on linkage group G; and/or (h) can comprise one or more of the marker loci S08442-1, S08341-1 or a marker closely linked thereto on linkage group G .
In other embodiments, two or more marker loci are detected in the method. In a specific embodiment, the germplasm is a soybean variety.
In other embodiments, the method further comprises crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm. In a further embodiment of the method, the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
In specific embodiments, the first soybean plant or first soybean germplasm comprises a soybean variety. Any soybean line known to the art or disclosed herein may be used. Non-limiting examples of soybean varieties and their associated Phytophthora tolerance alleles encompassed by the methods provided herein include, for example, those listed in Table 1.
In another embodiment, the detection method comprises amplifying at least one marker locus and detecting the resulting amplified marker amplicon. In such a method, amplifying comprises (a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm such that the primer or primer pair is
complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and (b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon. In such a method, the primer or primer pair can comprise a variant or fragment of one or more of the genomic loci provided herein.
In one embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rpsla, Rpslc, Rpsld, or Rpslk loci comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260,
261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278,
279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296,
297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314,
315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332,
333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350,
351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368,
369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386,
387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404,
405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422,
423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440,
441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458,
459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476,
477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494,
495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512,
513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530,
531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548,
549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566,
567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584,
585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602,
603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620,
621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638,
639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656,
657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674,
675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692,
693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710,
711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728,
729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746,
747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764,
765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782,
783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805 806, 807, 808, 809, 810 811, 812, 813, 814, 815 816, 817, 818, 819, 820, 821, 822, 823 824, 825, 826, 827, 828 829, 830, 831, 832, 833 834, 835, 836, 837, 838, 839, 840, 841 842, 843, 844, 845, 846 847, 848, 849, 850, 851 852, 853, 854, 855, 856, 857, 858, 859 860, 861, 862, 863, 864 865, 866, 867, 868, 869 870, 871, 872, 873, 874, 875, 876, 877 , 878, 879, 880, 881, 882 , 883, 884, 885, 886, 887 , 888, 889, 890, 891, 892, 893, 894, 895 , 896, 897, 898, 899, 900 , 901, 902, 903, 904, 905 , 906, 907, 908, 909, 910, 911, 912, 913 , 914, 915, 916, 917, 918 , 919, 920, 921, 922, 923 , 924, 925, 926, 927, 928, 929, 930, 931 , 932, 933, 934, 935, 936 , 937, 938, 939, 940, 941 , 942, 943, 944, 945, 946, 947, 948, 949 , 950, 951, 952, 953, 954 , 955, 956, 957, 958, 959 , 960, 961, 962, 963, 964, 965, 966, 967 , 968, 969, 970, 971, 972 , 973, 974, 975, 976, 977 , 978, 979, 980, 981, 982, 983, 984, 985 , 986, 987, 988, 989, 990 , 991, 992, 993, 994, 995 , 996, 997, 998, 999, 1000, 1001, 1002 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010, 1011, 1012, 1013, 1014, 1015, 1016 , 1017, 1018, 1019, 1020 , 1021, 1022, 1023, 1024 , 1025, 1026, 1027, 1028, 1029, 1030 , 1031, 1032, 1033, 1034 , 1035, 1036, 1037, 1038 , 1039, 1040, 1041, 1042, 1043, 1044 , 1045, 1046, 1047, 1048 , 1049, 1050, 1051, 1052 , 1053, 1054, 1055, 1056, 1057, 1058 , 1059, 1060, 1061, 1062 , 1063, 1064, 1065, 1066 , 1067, 1068, 1069, 1070, 1071, 1072 , 1073, 1074, 1075, 1076 , 1077, 1078, 1079, 1080 , 1081, 1082, 1083, 1084, 1085, 1086 , 1087, 1088, 1089, 1090 , 1091, 1092, 1093, 1094 , 1095, 1096, 1097, 1098, 1099, 1100 , 1101, 1102, 1103, 1104 , 1105, 1106, 1107, 1108 , 1109, 1110, 1111, 1112, 1113, 1114 , 1115, 1116, 1117, 1118 , 1119, 1120, 1121, 1122 , 1123, 1124, 1125, 1126, 1127, 1128 1129, 1130, 1131, 1132 1133, 1134, 1135, 1136 1137, 1138, 1139, 1140, 1141, 1142 1143, 1144, 1145, 1146 1147, 1148, 1149, 1150 1151, 1152, 1153, 1154, 1155, 1156 1157, 1158, 1159, 1160 1161, 1162, 1163, 1164 1165, 1166, 1167, 1168, 1169, 1170 1171, 1172, 1173, 1174 1175, 1176, 1177, 1178 1179, 1180, 1181, 1182, 1183, 1184 1185, 1186, 1187, 1188 1189, 1190, 1191, 1192 1193, 1194, 1195, 1196, 1197, 1198 1199, 1200, 1201, 1202 1203, 1204, 1205, 1206 1207, 1208, 1209, 1210, 1211, 1212 1213, 1214, 1215, 1216 1217, 1218, 1219, 1220 1221, 1222, 1223, 1224, 1225, 1226 1227, 1228, 1229, 1230 1231, 1232, 1233, 1234 1235, 1236, 1237, 1238, 1239, 1240 1241, 1242, 1243, 1244 1245, 1246, 1247, 1248 1249, 1250, 1251, 1252, 1253, 1254 1255, 1256, 1257, 1258 1259, 1260, 1261, 1262 1263, 1264, 1265, 1266, 1267, 1268 1269, 1270, 1271, 1272 1273, 1274, 1275, 1276 1277, 1278, 1279, 1280, 1281, 1282, 1283, 1284, 1285, 1286, 1287, 1288, 1289, 1290, 1291, 1292, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1301, 1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or variants or fragments thereof. It is recognized that reference to any one of SEQ ID NOS: 191-1302 explicitly denotes each of the SEQ ID NOS recited above.
In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 1 and SEQ ID NO:2; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 20 and SEQ ID NO:21; SEQ ID NO: 22 and SEQ ID NO: 23; SEQ ID NO: 24 and SEQ ID NO: 25; SEQ ID NO: 36 and SEQ ID NO: 37; SEQ ID NO: 38 and SEQ ID NO: 39; or SEQ ID NO: 1339 and SEQ ID NO: 1340.
In another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps2 locus comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 40 and SEQ ID NO: 41; SEQ ID NO: 46 and SEQ ID NO: 47; SEQ ID NO: 52 and SEQ ID NO: 53; SEQ ID NO: 58 and SEQ ID NO: 59; SEQ ID NO: 64 and SEQ ID NO: 65; or SEQ ID NO: 75 and SEQ ID NO: 76.
In another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps3a or Rps3c loci comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more
polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 89 and SEQ ID NO: 90; or SEQ ID NO: 91 and SEQ ID NO: 92.
In yet another embodiment, the method involves amplifying a variant or fragment of one or more polynucleotides associated with the Rps6 locus comprising SEQ ID NOS: 187, 188, 189, 190 or variants or fragments thereof. In one embodiment, the primer or primer pair can comprise a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof. In specific embodiments, the primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOS: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof. In a further embodiment, the primer pair comprises SEQ ID NO: 95 and SEQ ID NO: 96; or SEQ ID NO: 101 and SEQ ID NO: 102.
The method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified. In such a method, the labeled nucleic acid probe can comprise a sequence comprising a variant or fragment of one or more of the genomic loci provided herein.
In one embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rpsla, Rpslc, Rpsld or Rpslk loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341, 1342 or variants or fragments thereof.
In another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps2 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or variants or fragments thereof.
In another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps3a or Rps3c loci comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 181, 182, 183, 184, 185, 186 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or variants or fragments thereof.
In yet another embodiment, the labeled nucleic acid probe can comprise a sequence associated with the Rps6 locus comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOS: 187, 188, 189, 190 or complements thereof. In specific embodiments, the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOS: 150, 151, 152, 153, 154 or variants or fragments thereof.
Non-limiting examples of primers, probes, genomic loci and amplicons that can be used in the methods and compositions provided herein are summarized in Tables 2, 3, 4 and 5, respectively. Table 2: Non-Limiting Examples of Primer Sequences.
Figure imgf000037_0001
TaqMan SEQ
Marker Gene/ Primer Allele
LG Locus Assay ID Primer Sequence
position* Locus Name (R/S)
Name NO
S08242- Primer C/T
4343399 Rpslc N 20 CTTGCATTCTGGAGGTGCTA
1 1
Primer C/T
21 CCATCCCCTATTCTTTGGTG
2
S16592- S1659 GGGAAGAATCCCAGTTGGAG A/T
3904033 Rpsld N 1339
001 2-F001
CAAACAAACTTGCGTTGCAG A/T
S1659
1340
2-R001
S07963- S07963 T/C
3951705 Rpslk N Qi 22 ATGAGGACACAATGCCATGA
2 -F2
S07963 T/C
Qi 23 TGAGAAGGCCAATCCTATGC
-R2
S07372- Ql l, Q6, S07372 C/T
5227883 Rpslk N 24 ATTTTGGGCAAATGATGAAGC
1 Q8, Q12 -F5
Ql l, Q8, S07372 CTCAGCTAAAGACACCCTGCA C/T
25
Q12 -R4 AT
S07372 C/T
Q2,Q7 26 TTGGGCAAATGATGAAGCTA
-Fl
Q2, Q3, S07372 C/T
27 GAGGGCTCATCAGCACAAA
Q4 -R2
S07372 AAATGGTTTGTGGGAGGTTAG C/T
Q3 28
-F2 A
S07372 C/T
Q4 29 AGAATAAATGGTTTGTGGGAG
-F3 GTTA
S07372 TGAAGATATGCAAATTCTTTTC C/T
Q5 30
-F4 AAATTA
S07372 C/T
Q5 31 ACCATGGAGGGCTCATCA
-R3
S07372 CTCAGCTAAAGACACCCTGCA C/T
Q6 32
-R4 AT
S07372 C/T
Q7 33 CAAAAGGGCATCCTCAAAAG
-Rl TaqMan SEQ
Marker Gene/ Primer Allele
LG Locus Assay ID Primer Sequence
position* Locus Name (R/S)
Name NO
TGGGAGGTTAGATTTTCTGAA C/T
86061 34
CGAAGA
CATCAGCACAAAAGGGCATCC C/T
82582 35
TCA
S00009- Primer TGACACGTGGTGCGTTAGGAA C/T
3927056 Rpslk N 36
01 1 TTTT
Primer TGAAACGCATTAGTTCAGGTG C/T
37
2 GTAACTTCT
S08013- S08013 GAAAACGAAAATTGTAAGAGC
4458273 Rpslk N Qi 38 C/T
1 -Fl AACTT
S08013
Qi 39 ATGGAATGAGTTTGGGATGG C/T -Rl
3608513 S06862- S06862
Rps2 J 40 CCAAAGCTGTCTTGGAGGAA T/G 0 1 Qi -1-QlF
S06862 CAAAACAGATGCTTTTAACAT
Qi 41 T/G -1-QlR GAAC
S06862
Q2 42 GCTGTCTTGGAGGAACTTGAA T/G -1-Q2F
S06862
Q2 43 TTTCACAACACGAGGCTGTC T/G -1-Q2R
S06862
Q3 44 GTTGCCAAAGCTGTCTTGGA T/G -1-Q3F
S06862 CACGAGGCTGTCTACTCTCTTC
Q3 45 T/G -1-Q3R A
3669221 S06863- S06863 TCACACAAGGAAATTTAACAC
Rps2 J 46 G/A 7 1 Qi -1-QlF TACAT
S06863 TTCTCACCTTCTGTTGTATTGG
Qi 47 G/A -1-QlR A
S06863
Q2 48 CGCCAAATGGCTTACTTCTC G/A -1-Q2F
S06863 ACCAATGAATCACACAAGGAA
Q2 49 G/A -1-Q2R A
S06863
Q3 50 GGCGCCAAATGGCTTACT G/A -1-Q3F TaqMan SEQ
Marker Gene/ Primer Allele
LG Locus Assay ID Primer Sequence
position* Locus Name (R/S)
Name NO
S06863 TGAATCACACAAGGAAATTTA
Q3 51 G/A -1-Q3R ACACT
3726281 S06864- S06864
Rps2 J Ql 52 AACCATGCCCTTGAACAGTC T/C 3 1 -1-QlF
S06864 TTTGTGAAGGACATTTTGATTT
Qi 53 T/C -1-QlR G
S06864
Q2 54 TGAACAGTCTGCCCTCAGAA T/C -1-Q2F
S06864
Q2 55 TCTCAAAATCGGCATGAGGT T/C -1-Q2R
S06864
Q3 56 CCTTGAACAGTCTGCCCTCA T/C -1-Q3F
S06864 TGAACTTTGTGAAGGACATTTT
Q3 57 T/C -1-Q3R GA
3737716 S06865- S06865
Rps2 J 58 59 G/A 1 1 Ql -1-QlF
S06865
Ql 59 TTTGTGCAATTCTCCCATCA G/A -1-QlR
S06865 TGTTTACACGTTCTCCAATCAA
Q2 60 G/A -1-Q2F A
S06865
Q2 61 TGTGCAATTCTCCCATCAAA G/A -1-Q2R
S06865 CAAGTGTTGTTTACACGTTCTC
Q3 62 G/A -1-Q3F CA
S06865
Q3 63 TTCCATAGGTGCTGTTTGTGC G/A -1-Q3R
3677597 SI 1652- SI 1652
Rps2 J 64 TTTCACTGCAAGAGGGAAGG G/T 3 1 Ql -Fl
SI 1652
Q1.Q4 65 ATTCCTGCAGCTTCTCCATC G/T
-Rl
SI 1652
Q2 66 GAAGGGCTGTTGGTTATACCG G/T -F2
SI 1652 CATCTTATCTTTGAACCTTTCC
Q2 67 G/T -R2 TGA
SI 1652
Q3 68 AGGGAAGGGCTGTTGGTT G/T -F3
SI 1652 TCCATCTTATCTTTGAACCTTT
Q3 69 G/T -R3 CC
SI 1652
Q4 70 GCAAGAGGGAAGGGCTGTT G/T -F4 TaqMan SEQ
Marker Gene/ Primer Allele
LG Locus Assay ID Primer Sequence
position* Locus Name (R/S)
Name NO
3656306 SI 1682- SI 1682
Rps2 J 71 ACAACACCTCCAGAGCATCC G/T 4 1 Qi -Fl
SI 1682 GCTTGTCAACATCATCTAAAA
Qi 72 G/T -Rl TCAA
SI 1682
Q2 73 GGTTACAACACCTCCAGAGCA G/T -F2
SI 1682 TGCTTGTCAACATCATCTAAA
Q2 74 G/T -R2 ATCA
SI 1682
Q3 75 CTCCAGAGCATCCTTCTTCG G/T -F3
SI 1682 TCATGCTTGTCAACATCATCTA
Q3 76 G/T -R3 AA
SI 1682
Q4 77 CAACACCTCCAGAGCATCC G/T -F4
SI 1682 GATGATGACTCTACTGCCTGG
Q4 78 G/T -R4 A
291 1064 S09018- S09018
Rps3a F 79 AAGTGGCAGAGTGAACAGCA C/G 1 1 Qi -Fl
S09018
Qi 80 TAAGCGCATTTTCAAAGCTG C/G -Rl
S09018
Q2 81 GACCGTAGAGAAAGTGGCAGA C/G -F2
S09018 AATAAGCGCATTTTCAAAGCT
Q2 82 C/G -R2 G
S09018 GGAGGAAAGGACCGTAGAGA
Q3 83 C/G -F3 A
S09018
Q3 84 AGCGCATTTTCAAAGCTGA C/G -R3
S09018 TGTTGCTCTTCCAAAAGATGA
Q4 85 C/G -F4 C
S09018 TGCATAACGTTTCAGAAGGAA
Q4 86 C/G -R4 A
S09018 CCAGTGAACTATGTTGCTCTTC
Q5 87 C/G -F5 C
S09018 CCAAATTTACAATGCATAACG
Q5 88 C/G -R5 TTTC
[T/A]/
2904915 S08342- Primer AAAGAAGTTTAATTTGCAAAT
Rps3a F 89 [T/C]/ 0 1 1 AGCTTGAATTTTTCAAA
[C/A] TaqMan SEQ
Marker Gene/ Primer Allele
LG Locus Assay ID Primer Sequence
position* Locus Name (R/S)
Name NO
[T/A]/
Primer TACTCCAATCAGAGTTTCCATG
90 [T/C]/ 2 GCAAAGTTAG
[C/A]
2904918 S07163- S07163 CAGGAAAGTTGAATTGCTTTA
Rps3c F Q1-Q4 91 T/C 4 1 -1-Fl TCC
S07163 CAGAGTTTCCATGGCAAAGTT
Q1-Q4 92 T/C
-1-Rl A
6074555 S08442- S08442
Rps6 G 93 GGCCTTTTGTTATTTCTTCAGC T/C 6 1 Q5 -F3
S08442
Q5 94 GAGTATGGAGACAGCCCACAA T/C -R4
S08442
Q4 95 CACATTATAGGGGCCTTTTGTT T/C -Fl
A
S08442
Q4 96 T/C -R3 TTGCATATTTTCTCCCACCTG
S08442
Ql 97 CACATTATAGGGGCCTTTTGTT T/C -Fl
A
S08442
Ql 98 TTAGCTTGTGTAGAGTATGGA T/C -Rl
GACAG
S08442
Q2 99 T/C -F2
AGGGGCCTTTTGTTATTTCTTC
S08442
Q2 100 T/C -R2 TTTCTCCCACCTGTGCATTT
6077785 S08341- pi 0792 [A/T]/
Rps6 G 101 CGTCCGAGATTGGAAATTGT 1 1 -6-F2 [G/T] pi 0792 [A/T]/
102 TGGACTTTGGAATTGAACCAG -6-R4 [G/T] pi 0792 TGTGAGACAAACTCCTGCATA [A/T]/
103
-6-R2 AA [G/T] pi 0792 TTATTGTGAGACAAACTCCTG [A/T]/
104
-6-R3 CAT [G/T]
Physical positions are based on Public JGI Glymal Williams82 reference. Table 3: Non-Limiting Examples of Probe Sequences.
Figure imgf000043_0001
Probe 1 Probe 2
Marker Gene/ Marker Probe 1 Probe 1 Probe 2 Probe 2
LG SEQ ID SEQ ID
Position* Locus Name Name Sequence Name Sequence
NO NO
6FAM- VIC- CACTCCTT CACTCCT
5227883 Rpslk N S07372-1 102408 121 102409 122
AAGGTAA TAAGAT T AAT
6FAM- VIC-
S07372- CTCCTTAA AGCACTC
5227883 Rpslk N S07372-1 U S 148644 123
1-PB5 GGTAATT CTTAAGA
AA TAA
VIC-
6FAM-
S00009- CATGTGG
3927056 Rpslk N Probe 1 124 CATGTGG Probe 2 125
01 CTTAATT
CTCAATTT T
TCATCTTT ATCTTTT
S08013- S08013-
4458273 Rpslk N S08013-1 126 TCATCCA 127 CATTCAG
1-PBl 1-PB2
GTGC TGCAT
6FAM- VIC-
S06862- CTTACTTT S06862- TAGCTTG
36085130 Rps2 S06862-1 128 129
1-FAM TGCACAT 1-VIC TTGGTTG
GTA CAC
6FAM- VIC-
S06863- TTTGGAA S06863- TTTGGAA
36692217 Rps2 S06863-1 130 131
1-FAM CTGCACC 1-VIC TTGCACC
TC TCA
6FAM- VIC-
S06864- CTGCTGT S06864- CTGCTGT
S06864-1 132 133
1-FAM ACTAATC 1-VIC ACTAGTC
37262813 Rps2 ATAT ATAT
VI C-
6FAM- ATGCAAAT
S06865- ATGCAAATT S06865- TTTTATCTT
37377161 Rps2 S06865-1 1-FAM 134 TCTATCTTG 1-VIC 135 GC
VI C-
6FAM- CTTTTACAA
S11652- CAAAGTCGA S11652- AGTAGATC
36775973 Rps2 S11652-1 1-PBl 136 TCCTTC 1-PB2 137 CT
6FAM- VI C-
S11682- CAACATCGG S11682- ACAACATA
36563064 Rps2 S11682-1 1-PBl 138 CTTCA 1-PB2 139 GGCTTCA
6FAM- VI C- CTAATTTGA CTAATTTG
S09018- CTCCTGAAT S09018- ACTCGTGA
29110641 Rps3a S09018-1 1-PBl 140 C 1-PB2 141 ATC Probe 1 Probe 2
Marker Gene/ Marker Probe 1 Probe 1 Probe 2 Probe 2
LG SEQ ED SEQ ID
Position* Locus Name Name Sequence Name Sequence
NO NO
6FAM- VI c-
ACCATACTA ACCATACT
29049150 Rps3a F S08342-1 Probe 1 142 AAAAATT Probe 2 143 CAAAAAT
6FAM- VI C-
S07163- GGAACGTTA S07163- TGGAACAT
29049184 Rps3c F S07163-1 1-Pl 144 CCGGA 1-P2 145 TACCGGAC
6FAM- VI C-
S07163- TGGGTCCGG S07163- TCCGGTAA
29049184 Rps3c F S07163-1 1-PBl 146 TAACGT 1-PB2 147 TGTTCC
6FAM- VI C-
S07163- TGGAACGTT S07163- CGTGGAAC
29049184 Rps3c F S07163-1 1-PB3 148 ACCGGAC 1-PB4 149 ATTACC
VI C-
6FAM- CAAATTAA
S08442- CAAATTAAC S08442- CACGTCAA
60745556 Rps6 G S08442-1 1-PBl 150 ACATCAACA 1-PB2 151 CA
VI C-
102379 6FAM- 102380 T I I I I I GG
(allele ATC I 1 1 1 I GG (allele A AG AT ATA
60777851 Rps6 G S08341-1 1 ) 152 AAGTTATAC 2) 153 C
6FAM- CATC M I N G
102381 GAATATATA
60777851 Rps6 G S08341-1 (allele 3) 154 C
*Physical positions are based on Public JGI Glymal Williams82 reference. Table 4: Non-Limiting Examples of Genomic Loci Comprising the Various Marker Loci Provided Herein.*
Figure imgf000045_0001
Ref. Seq. Reference Sequence
Marker Gene/
LG SEQ ID
Name Locus
NO (R/S)
ATTGKTKGTSTGKKCCTVSMYRTTTGAAGCTGAATTTGTTTGCTGC
TCTGTTATCAAGCTAGTAAGGCCATTTTGCTTCAGRTAGGTCTCCA
GCGGGAGATTTGCTTCTTCAAGAAGACTYGTCATGCTCAAGCTGTT
CGGCCCAGCTTGCACATCTTCTC[T/G]ATCAGGTTGGCAATTCAAG
TCTAATTGTCCCTTGGCAGCTTCAGCCACCGCATCGTCTGGACTCC
TTGAATCTAATTCATTTTGCACCCTTACTTCATTCTCCAAACCGTCA
ACTGGAGTTAAATGGCGAGAGGTGCTATCTACTTCTGATTCATCTT
S07292-1 Rpslc N 157/158 TCGTCCGCCATGATAACTGATTTCTCTGAGCAATCTCTGCTTCACG
TTCRGATTGCYGCTTCTYCTTTCGCAKCATCAGGGTTTTAAACCGA
CGTTTAACTGTCATGCACACATTGCAGGTGCATGTAGGTTTGTGTT
TGCCCTTCCCACTTGGTGGCTGGATACARACAATGCAAGAGCACC
CAGGTCTATGCCGAGGATGTTTTGTGGTGGTAACAACTGGTGTTCT
GCCAGAGTCACTTGCATCATCTCCCAGTATTGCTGCATTTGCCATG
GTCATAG
GCAAGCCTGCTTCAAGGACTTGCGTGGTGCACGTATGAAGAATAG
TGGCGTGAATGGGAGCTAACCTGGATTGTGAAAATGGAATACAAA
TTGCAAAATCATCAATGATTTYTAGAATATTTCCTTTATACAAAAT
GACAAATTCTATTATTAGGGAAGTGGTATAAATAAAAGCATTTGT
AAACCATTGAGGGATATGAATGAACAAAATACAAGCTTCCTTTCC
TTCRGTGCCTTTTTCTCTCTTCTTCTTCCTTGCATTCTGGAGGTGCT
AGTCCCGAATCC AGC AATTTCCCTG [C/T] GTTTGCACGTAACATAG
S08242-1 Rpslc N 159/160 TTTCTAGTATTAGTTAAAGGGCAAAACTAAAAAATATGTGCACCA
AAGAATAGGGGATGGTTAGTTTTTATGTTAGAATCTTACGACAATT
TGAACCTACTATCTCTTCTACTTTTTCTTTTAACACTTAATTTTTTTT
TYKATCATTAAATTAATTTTATATCTTTGGATATTTTATTTATTATT
ATTAATTATTAAAAGAAAGWGCAGAGAGTATTGTTAGCATTTCTA
TTATAATTAATCTGAAATTGAACAATGTATGTATTCAACAAAACAG
TGAAGCAGTGAATTTGAAGATGGAAGGAATCAAGAAAGTACAAG
TG
CRCCGGAGTGTCCAYKGGTGTTGAGTCCTAATATTTCTTTGTGSCT CTAGGTCATGATTTAAATACTTAAAGACCCTTGAAAATTTACAAAC AAACTTGCGTTGCAGATATATTTCAAAACCCTAGCATACRTCTAGC ATGGGAGGGGTGCAACCAGTCACTACAAAAATCATTTGAAAAAAT
S16592-
Rpsld N 1343 TAATTGCGGATCGGGACWGATGACAACTGTGCGTACCTTAAAGGG 001
AAYCAGCRAATGAGAGGGTACATATAAAATTGAAGGTGTGAAACT CCTAGCCTCCAACTGGGATTCTTCCCRCAAGTGTCGTTTGAAGTTA AGCCGCAAAAGAAGCTATGACTGGCTATGGYTGGCTATGGGGGGT TGTGCACGTTGTCCTGGGTTAGGGTATATATTGTATA
CTTTCTYYTTNGCTTTTcnGAGAAGAAGAGATAAGATCAACCAAAG
AATGAAGGAATTGCAAAAGCTGGTCCCAAATTCCAGTAAGGTAAA
GAAAGAATGGTTGTAACTTAGCCAAGTTTTTGGTATAAAATTATGT
TCCCAATCTTTTTTCAAATTCTCTATTATGTAAGAAAGTGGCCATA
CGTAACATGATAAAGCTGCAACATTGATCCTCTCTTTAATTTCTTT
CCCTGTTCACCAATTAATCGGTTCAGTGGTCCCATGAGGACACAAT
GCCATGAASCCCAGATCA[T/C]ATATCGCATCTCCWTATAGTATAT
GTTTCATTTTGTGTCTGCATAGGATTGGCCTTCTCATAAAGCAAAC
S07963-2 Rpslk N 161/162 GCATTTCAGAAATCAATTGGAATCCTTTTATRTCTCTTTGAAGAAC
TTCTTAAAGGAATATGTGCCTAAATGACAAAATTCAGTTTCAATCT
TTAAGTTTGYTCGAAATAAAAAGGTTTCACTTTTGATTAATAATTG
AGTTACTAACASAAAGACAATTAGACTCTATGTCTACACATCTTGG
TGAGAATCCTCTACTGACTACTGATAAGATAATACTTTTAGATCCG
ATTGATACATTGTTGTAGTTTAATTATCATTCTCGAGTTTAAGTTTT
TGATATGAATTACATTATATTGCAAAGWAAATTTTGTCTAGTATTA
TATGATTACTCGAWAATATTAATATTGGAGAGAAAATTGCCYYTC
ACATGGTCATA Ref. Seq. Reference Sequence
Marker Gene/
LG SEQ ID
Name Locus
NO (R/S)
CTGCAGTGTTGTCTCTCGGAGTTGCTTCAATTGCTCATACTCTTTGG
GATAACCACTCATTTCAAAGATGTACTAGTTTAAAACATGCAAAA
AGA:TAAAGTTAATGTGTATTTTGTATGTTGTAGGGAAGCACAAAG
TATCTTGATTGAATTAGGAAGATTACACGAGCCGTATGCATCAGA
ATAAATGGTTTGTGGGAGGTTAGATTTTCTGAACGAAGATGAAGA
TATGCAAATTCTTTTCAAATTAATTTTGGGCAAATGATGAAGCTAG
ACTGATAATTGATTAATTTTGGGCAAATAATATTATATTACATGTA
TGAGATTGATTTTAAGTGTATATGCATACATGAAGCAATAGACTTA
ATTTAATTA[C/T]CTTAAGGAGTGCTGGACTTTTGAGGATGCCCTTT
S07372-1 Rpslk N 163/164 TGTGCTGATGAGCCCTCCATGGTTGACATACAAAGCAAATTGCAG
GGTGTCTTTAGCTGAGGTTTTTGCTGCTTCGAAGTGGCAATTGAAT
CAGCTCCGTTGGACAGTGACATGGTGATGGTGGTGATAATTAATTC
GGCTTAAGGGTAAGTACAACTTCTTAGCTCTGTAAGCAAAGGATG
CCTTGTGGAGTTGGTTCATCTAATCCACGTATATATAGGGCTGAAC
GAGGGAACAAGAGTTTTCAATCAATGATTACAATTCCACACTCTC
GCCTCTAAAGTGCATCCCTCACATTGAAGCATCCTCCAAATCCCAA
AATATTATTATTACCACTTAAAGCTATTACAAATCAGAAAACACTG
CAG
TCAAAGTANNNNAAGTTATTAGACATGAAATTGTTTAWGATAAAT
AATCTATTGTAATTAAGCAAGCCATGTTGGGCTAGGAACACTATC
AACTAGTAGGATTTAAGTCTAGTCTCTTTAAGCGAATTTACAAGTT
TATGGATAGCATTCAATGTATTTCTTAAGGTGGTATCACCCTCGWT
GATMATTTTCACAAATTGACACGTGGTGCGTTAGGAATTTTGTTTT
TAATAATTTTCCACAYTAAAAAGTGATTTTCATGTGGCT[C/T]AATT
S00009- TTTTTTTAAAAAAAAAATTGAATTAACACTMATGTGACATTTTTAT
Rpslk N 165/166
01 GTGGAACATGTCAACCTATATAAGTAATAATTTAGAAGTTACCAC
CTGAACTAATGCGTTTCAAATTCAAATGATAATATATGATTTATGT
GACTGYTAGTTCATTTTATTTAAAAAATATTMAMAARATCACWAG
AMAYTRKMAATTGTCAATTCACKATTTGATAATGATATGACAAAT
AATTCCATATTAGTAAATTWTTTCAAAATAATTCCCTTGTAATATT
TCAAAATAGGATAAAYTACCATATTTGAGTCATTAATTGTGTAAGC
GTGGTCGCATTAATCC
YYCTNANANTTGTTTACATCTTATACAGAACTTGAGTTTGAAAACG
AAAATTGTAAGAGCAACTTTTAATCATCTTTTCAT[C/T]CAGTGCAT
GCTTGAAAACTTTGTCAGAAGACAAATTAGTGKAAGCATATATAT
TAATTTCAATAATTTATTATGGAATTATCATATGATACCATCCCAA
ACTCATTCCATGTTTCCCAAACAGAATGAATAATGATATTASGCAC
CGTTCAAATTCAACATGATTTTGACAATARAAATCCAGCCAGATTA
S08013-1 Rpslk N 167/168 AATTTTTGTTCCACTATATCTCACACAAGCTTTACAATCGGACAAA
CTGGTTACTATACAACTACTATGTTTTTTCTTTTCTTTTCTTTTAATC
TCTGTTCCCATTTTATCACAAGTATTTCTTTTTTGTCATTTATWAAA
AAAAANGTAAGRAAAATTAATACTGTAAATTATAAAYACATGCCA
TATAAAANTTGTGTAAAAAAANNAAATAAACGCATNGCCATATNN
AAAAACACATGTCATAAANCAANCGTTTTAAATTGTGGTNCTCTN
GGTCAGCAGCCACWTGG Ref. Seq. Reference Sequence
Marker Gene/
LG SEQ ID
Name Locus
NO (R/S)
TGTTTTGTTACGCTTCTTTTTTGTACACAGTTATGCCAATTTTGATT
TCTTGTTTTAATTATGTGTTGTGTGGCTTGGTTTTGTGTTTCAGTGA
CTCGTGCTATTGTTCCGAGAATGAACTTGGACGAGCTGTTTGAGCA
GAAGGGTGAGGTTGCCAAAGCTGTCTTGGAGGAACTTGAAAAGGT
ATCTTACTTCTTTTATTTAAGTAAGTTCTGGCATTCTTGAATTAAAT
ATGTAAGAAAAGTGAAGAGAAGCTTAGTATTAGTTGTTGTTCACA
S06862-1 Rps2 J 169/170 AAATATCAAATTATTTCATTTCCTTTTAAAATTATACTAGCTTGTTG
[T/G]TTGCACATGTAAAAGAGTTCATGTTAAAAGCATCTGTTTTGA
AGTACTGGTGAAGAGAGTAGACAGCCTCGTGTTGTGAAAAGGGTT
GGGGGAGGGGGGGGTGGACTAAGAAGGACTTTGGAGGAAATTGT
TAAAAGGGACCTCGTCTTAANTNNTNTTCCNGAAANTTGGNNNTN
NCNTNNCNCANNGATNTCNNGTGNNTNNNGNNNNTGG
GCGGCAGATGGGCGTCTAGAGATATGTGGTATGATATATATATAA
ATATATAATATGTAGCCCCGAAATAACTTCACTTGATTTTTATCCC
ATTCACGAGAGTAGCTAGATTGAAACAACATTGTCCGTTGGCCTA
AGTTCAAATAGTCAACCAGAATAAAATGCAGGCTGATCATATCTA
TTTTTGATTTTGACTATTTACCAAAACCAATCAAATGGAAGTTGTC
TAGCTAGTCTATTCTGGCGCCAAATGGCTTACTTCTCACCTTCTGTT
GTATTGGAGTAAGTATGAGGTGCA[G/A]TTCCAAATCTCATAGAAG
TGAGAAAAAAAACATATAAAATGAGTAAAAGATTCATAAACCTAA
S06863-1 Rps2 J 171/172 TCTTTGAAGTTTTGAATTAAAATGTAGTGTTAAATTTCCTTGTGTG
ATTCATTGGTATAAATCTTTAGTTCAGTGAAATGGGACCAGGGTTA
TGATGTTACTGCTCATTTTCTTGACTATTAGCAGATGAGGGATGGT
TACAGTGATCAACTCTTTGTTCAGTTACTGGGAAAAGCAGTTTATC
AGCTTTGGCAAGACTACAAGGCTAAGTATGGCACCAGTTAAGAGG
CTATGAGAGCTTTGCATGTTATTTTTTAAAAATATAAGCGAGTATA
TATGTCGCAATCTATTTGTATATAGGTTAATTTGTATTAATTCTATG
TTTATTCAGCGGAATGGCATGGTCATAGCCTGTT
GTACACTTTGCTTAACCAACTCAACTCAACTTTTTAGTGCCTTTAA
AAGTAGAAAAAGGAAGTCGTGTTTGAGAGAAAAAGATAAACTTG
AAACTGAAGAAAAAGCTAAGAGCTTAACCTCTCTCCTAAAAGCTA
ACTAAAACTAACAGAATGTGCACCCTCGCATGTGGCAACCCCACT
AAGCTCCTACATGTCAGTTCCCTCCTAACCAACTCCCTGCTCATCA
GGGTTGATTTTCTTCTCTTTCAAAGGCTTTCAGCCTTTGTTCTGACT
AAACTAAGCCCAATTTCTATCTGCTAGCCTGGTCTAACAGAAGGG
S06864-1 Rps2 J 173/174 GATATGATWTAACATCGTATTCTCAAAATTGGCACGGATAGATCC
TATTATTTAATCTTAAACTTGTTAAAGGATATAATCTTATATTCTCA
AAATCGGCATGAGGTGGTCCTATTATTTACACTTGAACTTTGTGAA
GGACATTTTGATTTGTATCTTTGAACTTTATAATATGA[T/C]TAGTA
CAGCAGTATGGAATTTGTGAAGATATTTTCTGAGGGCAGACTGTTC
AAGGGCATGGTTTTAATTTTTTTATGTATGAACCCCATAGTTTCTGT
CCACATCATCATGCCCATGGTCATAGCYKKTT
Ref. Seq. Reference Sequence
Marker Gene/
LG SEQ ID
Name Locus
NO (R/S)
TATCGTACCTGATAAWTGTCAAAAACCTTTCCAACTCCATGGTATA
GACATCAACAGCTTGTTCCAAGACGGTGATTTGTTCCATTTTTCTA
TCAAATTATACCCAGAGAGAGAAGATAAAGTGTTACAAAAATCCT
CCATGTTCTAAAAGACTACCAAAACACCACATCTTCCATGGAAGG
AAATTAAAAAGCCTCTCAATCTCTCTAAAAAATAGAACAAGTCCC
ATAAACAGCTTGTGAGCTGACACCAAATGGAAGCAAGATGTCCAA
TTCTGTATCATGATAAAATGATGGGCAAAACTTATATAAGGTTCCA
S06865-1 Rps2 J 175/176 TAGGTGCTGTTTGTGCAATTCTCCCATCAAAATTGGAGTTTTAACT
TGGCAATTTGCAAGATA[G/A]AAATTTGCATTAAAGGATTATGCAA
ATTACCTTGGTGAAACTCCAATTTTGATTGGAGAACGTGTAAACAA
CACTTGAGGAACTGTAAACAAGTTATTTCCTAAAATAACCTTCTAG
CTCAAATGAGTTCTAAAACATCACTTAACCGAAGCGCCAAATAAA
AGAAAACAAGGAACATCTCAACAAGACGACCCTTGTTCTCAGTTC
CATGATATGCACACGATTCCATGGTCATAGCYKKKT
TCCYYGACATAYTYCCAATAAACTYGTATTCATATGMRYCTCTGTT
TCAAACAAACAAAAAAGTTCTGATGAAGTCAGCCTAAAATCCTTG
CATCCATGTCTTGATAGGTACATTAATTGTCAAGGTTAACAAGAGC
ATTTCTTTTCTATTTAAATTTKACTAGTTAAATCAATMGACAAGTA
AAACCTAATCCAATAAAAACCATAAAGTAAAWTATATTAGTATGA
TTGTATACCCATCTTTGAAATGAGAGCCAGACAAGTCAGCTACTTG
TTTCAAAGCCATCCTCCATTCCTGCAGCTTCTCCATCTTATCTTTGA
SI 1652-1 Rps2 J 177/178 ACCTTTCCTGATGCTTAGTCATTGCTTCTCCATAACTACCTTTCTGG
TGTCTGACATAAGAAGGATC[G/T]ACTTTGTAAAAGACCGGTATAA
CCAACAGCCCTTCCCTCTTGCAGTGAAAGATGGTTACAAGTTCATC
TAAACAAAATGAGGAAAAAGCATAGTTTTCAGAAAGCACAATAAT
AGCAACCCTGGAATCTTGAATTGCCTTCAAAAGTGCAGGTGTTATT
TCCTCTCCGCTGTGAAGCTTGTCTTCGTCAAAGAAGGTATGAAATC
CCTTGTCACAAAGAGCCTTGTAGAGATWGCCAGTAAAACCATAGC
GTGTGTCTGTCCCTCTGA
TKGGACCTATCACTTCCAAAGCTAATGGAAGGCCAGAAGCATAAA
TWACTACATCATTCAAGACCTCCTTATAACTTGGATCAACCTTTTC
GGTTTTAAAAGATTTCCATGTAAGCAATTGAAGAGCATTGTTCTCA
TTCAATAGTTCCACTTCATATGTTCTTTTAACCCCATGAGATGCTA
GCAGTTGTTTGTCCCGAGTGGTGATGATGACTCTACTGCCTGGACC
AAACCAACAAGGTCTTCCAACAATAGCCTGTAATTGTTCATGCTTG
TCAACATCATCTAAAATCAAGAGAACCTTCTTTCGCTGAAGCC[G/T
SI 1682-1 Rps2 J 179/180 ]ATGTTGTATAATTGAAGCTCCTTGTTCAACACTTGCTAAGTTGATT
TCCTTCTCTCCAAKTATTTCCCGAAGAAGGATGCTCTGGAGGTGTT
GTAACCCCTTCTTGTTTGATTTTTCTCTCAAATCTTTAAGAAAACAT
GAACCATCAAAATGRCAAGCAATCAAATTATAAACTGCTATAGCA
AGTGTTGATTTTCCTATCCCACCAATTCCATGGATCCCTATCATGT
AGACACCAWCATCAGATTCAACATCCAAAAGCTTTGTTACTTCTA
GKAATCTTGATTCTAGTCCAACCGGGTAATCCCATGGTCAWAGCY
KKTT Ref. Seq. Reference Sequence
Marker Gene/
LG SEQ ID
Name Locus
NO (R/S)
TTTTTGGTTcaGGTCTGCAACAAAAAAGCCTCTGGGTCAGAGCACT
CATGCTAACACCATACTTGGGACACCAACTGGGCGTCGAATGCTTT
CGACGCCTTCTGGCCGCCATGGAAACTCAGGAGGAAAGGACCGTA
GAGAAAGTGGCAGAGTGAACAGCATAATTCCAGTGAACTATGTTG
CTCTTCCAAAAGATGACTMTGTTTCTAGGGGGAATTAAGGGCTGC
CCTCT AATTTG ACTC [C/G] TG AATC AGTC AGCTTTG AAAATGCGCTT
S09018-1 Rps3a F 181/182 ATTSTACAAGCTCTATTATGTTTCCTTCTGAAACGTTATGCATTGTA
AATTTGGTAAATGACAAATGAATGACCCATTCTAGGCTTGATATA
GAAGATTGTACAAGTCACGGGCTAAATAGATTACAAATATAAAAA
GAAGTCATTCTTGTTCTTTCATGTGTGTAAGTTGTCTGATTTGATTC
TTCAAAAATGAGGTGTACTTTAGAGAATAAAGGGTACTTATAATT
AATTTATCAGAAAATTAATAGTTGAGAAGTTTGATAAAATTAGAT
ACATATATGRCAATTTAGAKWTRAYRWTYTARWKTWWAW
TTAAGTGACTTTAAAATATGACACATTGAAATGACCTGTTTGGATA
TTAAATTTAAAGAATTTTCAAAAATGATGAGAAATTTATTGGAATT
TTTTTTTAAAATAAAATAGAATTACAAAACGCTGACAAGGTGTTTT
GGTAGGGAGAGATTCTTTTCAATTTCTTAGAAATCTTGGAAGTGTT
AAATTCCTATATTTGATATAACTATTTTAATGATCATTTTCATAAAT
CTAAAATTCACAAGAATCATTTTTGAATAAGTCTTCTACTAAACGT
GGTTCGGTGGAGAGACTCTACAAAATGAGGTCAGACATCGTAGGA
TGTTAGTCAAGCATCGGCCAAACCAGTAAATACTTCATATCATATC
AATCATATGATGATAAAAAAACGCTTTCTTAAGACACCGTGAACT
S08342-1 Rps3a F 183/184 CTAGAAAACACATAAAATGAAATCTGCACAAGCTTAAAGCACATG
ACTAAATAACTTTATCAAAATAAAAAACTAAAATACAGGAAAGTT
GAATTGCTTTATCCAAATAAAATTTAAAAAACGAAAGAAGTTTAA
TTTGCAAATAGCTTGAATTTTTCAAATACCATAC[T/C][C/A]AAAAA
TTACCTTGATTTTTCTGGGTCCGGTAA[C/T]GTTCCACGTTGGGCTT
AAACTAACTTTGCCATGGAAACTCTGATTGGAGTAACGGAGGATG
CACACATCATACCATAGGATAGCGGTAACACTGTCAGGACACAGC
CGAGAGATTTCATTGACAGCAGTGGTGAGACAGAACTGGCAGAAG
TATCCTGTGATGTCGTATCTGCAG
GAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCTCTAGAT
GCATGCTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCG
CCCTTCAGGAAAGTTGAATTGCTTTATCCAAATAAAATTTAAAAAA
CGAAAGAAGTTTAATTTGCAAATAGCTTGAATTTTTCAAATACCAT
S07163-1 Rps3c F 185/186 ACTCAAAAATTACCTTGATTTTTCTGGGTCCGGTAA[T/C]GTTCCAC
GTTGGGCTTAAACTAACTTTGCCATGGAAACTCTGAAGGGCGAAT
TCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACC
AAGCTTGGCGTAAT
KTKRATTGGCTACTAAAACAAATGCTATATTTGTAAATATATACCA
ATATAGCAATACAGGGGTAATTGAAAATTCTGATTAACTGTTRATC
TACAGGTTAACAGTCTTCGGCAGGAACTACAACTTCTTGCTAGAG
ATAGATCAATCACTATTGTAAATGCAAGTGGAACAGGTACTGGTT
AGCTACTTTCTTATACACATTATAGGGGCCTTTTGTTATTTCTTCAG
CAATTTAATAAATGTTGA[T/C]GTGTTAATTTGCAAACCCATGATA
ACTGGTTTTAATTGTGGGCTGTCTCCATACTCTRCACAAGCTAAMC
S08442-1 Rps6 G 187/188
AATGTTTCCTTATTATTTTTTACTCCTKTTTTATTTTCTGACTTGTTT
GGGAAATGCACAGGTGGGAGAAAATATGCAACAGTGATTGTTATT
GTTGTGGTAGGATATGGATACGTTTGGTGGAAGGTAATGYCTTTTC
TCTCTCAATTKTTGATTTAAGTAACAGGATGCTGTAGTGATACATT
CTTRTTGGAAGCTTTATGGCTAATTTGAATTTRAATATTGGTGCTT
WTAACGAGTGCCATCTGCTCTTTGCACAYGGATACTCTCCACTTAA
Figure imgf000051_0001
Table 5: Non-limiting Examples of Amplicons Comprising the Various Marker Loci
Provided Herein.
Figure imgf000051_0002
Figure imgf000052_0001
Figure imgf000053_0001
In another embodiment, the method of detecting comprises DNA sequencing of at least one of the marker loci provided herein. As used herein, "sequencing" refers to sequencing methods for determining the order of nucleotides in a molecule of DNA. Any DNA sequencing method known in the art can be used in the methods provided herein. Non-limiting examples of DNA sequencing methods useful in the methods provided herein include Next Generation Sequencing (NGS) technologies, for example, as described in Egan, A.N, et al. (2012) American Journal of Botany 99(2): 175- 185;
genotyping by sequencing (GBS) methods, for example, as described in Elshire, R.J., et al. (2011) PLoS ONE 6(5):el9379; Molecular Inversion Probe (MIP) genotyping, as described, for example, in Hardenbol, P., et al. (2003) Nature Biotechnology 21(6):673- 678; or high throughput genotyping by whole-genome resequencing, as described, for example in Huang, X et al., (2009) Genome Research 19: 1068-1076. Each of the above references is incorporated by reference in their entirety herein. An active variant of any one of SEQ ID NOS: 1-1394 can comprise a
polynucleotide having at least 75%, 80% 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest. By "fragment" is intended a portion of the polynucleotide. A fragment or portion can comprise at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 75, 100, 150, 200, 250, 300, 350, 400 contiguous nucleotides of SEQ ID NOS: 1-1394 as long as it is capable of amplifying and/or detecting the marker locus of interest.
Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
Traits or markers are considered to be linked if they co-segregate. A 1/100 probability of recombination per generation is defined as a map distance of 1.0 centiMorgan (1.0 cM). Genetic elements or genes located on a single chromosome segment are physically linked. Two loci can be located in close proximity such that recombination between homologous chromosome pairs does not occur between the two loci during meiosis with high frequency, e.g. , such that linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time. Genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 50 centimorgans (cM), e.g., about 49, 40, 30, 20, 10, 5, 4, 3, 2, 1, 0.75, 0.5, or 0.25 cM or less. That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 50%, e.g., about 49%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1%, 0.75%), 0.5%), or 0.25%> or less. Closely linked markers display a cross over frequency with a given marker of about 10% or less (the given marker is within about lOcM of a closely linked marker). In specific embodiments, a closely linked marker is with lOcM, 9cM, 8cM, 7cM, 6cM, 5cM, 4cM, 3cM, 2cM or lcM of any given marker disclosed herein. In further embodiments, a marker associated with one of the markers disclosed herein can be within 75Kb, 60Kb, 50Kb, 40Kb, 30Kb, 20K, 10Kb, 5Kb or less of the disclosed marker. Put another way, closely linked loci co-segregate at least about 90% of the time. Genetic linkage as evaluated by recombination frequency is impacted by the chromatin structure of the region comprising the loci. Typically, the region is assumed to have a euchromatin structure during initial evaluations. However, some regions, such are regions closer to centrosomes, have a heterochromatin structure. Without further information, the predicted physical distance between genetic map positions is based on the assumption that the region is euchromatic, however if the region comprises heterochromatin the markers may be physically closer together. With regard to physical position on a chromosome, closely linked markers can be separated, for example, by about 1 megabase (Mb; 1 million nucleotides), about 500 kilobases (Kb; 1000
nucleotides), about 400 Kb, about 300 Kb, about 200 Kb, about 100 Kb, about 50 Kb, about 25 Kb, about 10 Kb, about 5 Kb, about 2 Kb, about 1 Kb, about 500 nucleotides, about 250 nucleotides, or less.
When referring to the relationship between two genetic elements, such as a genetic element contributing to tolerance and a proximal marker, "coupling" phase linkage indicates the state where the "favorable" allele at the tolerance locus is physically associated on the same chromosome strand as the "favorable" allele of the respective linked marker locus. In coupling phase, both favorable alleles are inherited together by progeny that inherit that chromosome strand. In "repulsion" phase linkage, the
"favorable" allele at the locus of interest (e.g., a QTL for tolerance) is physically linked with an "unfavorable" allele at the proximal marker locus, and the two "favorable" alleles are not inherited together (i.e., the two loci are "out of phase" with each other).
Markers are used to define a specific locus on the soybean genome. Each marker is therefore an indicator of a specific segment of DNA, having a unique nucleotide sequence. Map positions provide a measure of the relative positions of particular markers with respect to one another. When a trait is stated to be linked to a given marker it will be understood that the actual DNA segment whose sequence affects the trait generally co- segregates with the marker. More precise and definite localization of a trait can be obtained if markers are identified on both sides of the trait. By measuring the appearance of the marker(s) in progeny of crosses, the existence of the trait can be detected by relatively simple molecular tests without actually evaluating the appearance of the trait itself, which can be difficult and time-consuming because the actual evaluation of the trait requires growing plants to a stage and/or under environmental conditions where the trait can be expressed. Molecular markers have been widely used to determine genetic composition in soybeans.
Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies. In some examples one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels, padlock probes, molecular inversion probes, microarrays, sequencing, and the like. In some methods, a target nucleic acid is amplified prior to hybridization with a probe. In other cases, the target nucleic acid is not amplified prior to hybridization, such as methods using molecular inversion probes (see, for example Hardenbol et al. (2003) Nat Biotech 21 :673-678). In some examples, the genotype related to a specific trait is monitored, while in other examples, a genome-wide evaluation including but not limited to one or more of marker panels, library screens, association studies, microarrays, gene chips, expression studies, or sequencing such as whole-genome resequencing and genotyping-by-sequencing (GBS) may be used. In some examples, no target-specific probe is needed, for example by using sequencing technologies, including but not limited to next-generation sequencing methods (see, for example, Metzker (2010) Nat Rev Genet 11 :31-46; and, Egan et al. (2012) Am J Bot 99: 175-185) such as sequencing by synthesis (e.g., Roche 454 pyrosequencing, Illumina Genome Analyzer, and Ion Torrent PGM or Proton systems), sequencing by ligation (e.g., SOLiD from Applied Biosystems, and Polnator system from Azco Biotech), and single molecule sequencing (SMS or third-generation sequencing) which eliminate template amplification (e.g., Helicos system, and PacBio RS system from Pacific Biosciences). Further technologies include optical sequencing systems (e.g., Starlight from Life Technologies), and nanopore sequencing (e.g., GridlON from Oxford Nanopore Technologies). Each of these may be coupled with one or more enrichment strategies for organellar or nuclear genomes in order to reduce the complexity of the genome under investigation via PCR, hybridization, restriction enzyme (see, e.g., Elshire et al. (2011) PLoS ONE 6:el9379), and expression methods. In some examples, no reference genome sequence is needed in order to complete the analysis.
The use of marker assisted selection (MAS) to select a soybean plant or germplasm which has a certain marker locus, haplotype or marker profile is provided. For instance, in certain examples a soybean plant or germplasm possessing a certain predetermined favorable marker locus or haplotype will be selected via MAS. In certain other examples, a soybean plant or germplasm possessing a certain predetermined favorable marker profile will be selected via MAS.
Using MAS, soybean plants or germplasm can be selected for markers or marker alleles that positively correlate with Phytophthora tolerance, without actually raising soybean and measuring for tolerance (or, contrawise, soybean plants can be selected against if they possess markers that negatively correlate with tolerance). MAS is a powerful tool to select for desired phenotypes and for introgressing desired traits into cultivars of soybean (e.g., introgressing desired traits into elite lines). MAS is easily adapted to high throughput molecular analysis methods that can quickly screen large numbers of plant or germplasm genetic material for the markers of interest and is much more cost effective than raising and observing plants for visible traits.
In some embodiments, the molecular markers or marker loci are detected using a suitable amplification-based detection method. In these types of methods, nucleic acid primers are typically hybridized to the conserved regions flanking the polymorphic marker region. In certain methods, nucleic acid probes that bind to the amplified region are also employed. In general, synthetic methods for making oligonucleotides, including primers and probes, are well known in the art. For example, oligonucleotides can be synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Letts 22: 1859-1862, e.g., using a commercially available automated synthesizer, e.g., as described in Needham- VanDevanter, et al. (1984) Nucleic Acids Res. 12:6159-6168. Oligonucleotides, including modified oligonucleotides, can also be ordered from a variety of commercial sources known to persons of skill in the art. It will be appreciated that suitable primers and probes to be used can be designed using any suitable method. It is not intended that the invention be limited to any particular primer, primer pair or probe. For example, primers can be designed using any suitable software program, such as LASERGENE® or Primer3.
It is not intended that the primers be limited to generating an amplicon of any particular size. For example, the primers used to amplify the marker loci and alleles herein are not limited to amplifying the entire region of the relevant locus. In some embodiments, marker amplification produces an amplicon at least 20 nucleotides in length, or alternatively, at least 50 nucleotides in length, or alternatively, at least 100 nucleotides in length, or alternatively, at least 200 nucleotides in length.
Non-limiting examples of polynucleotide primers useful for detecting the marker loci provided herein are provided in Table 2 and include, for example, SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339, 1340 or variants or fragments thereof.
PCR, RT-PCR, and LCR are in particularly broad use as amplification and amplification-detection methods for amplifying nucleic acids of interest (e.g. , those comprising marker loci), facilitating detection of the markers. Details regarding the use of these and other amplification methods are well known in the art and can be found in any of a variety of standard texts. Details for these techniques can also be found in numerous journal and patent references, such as Mullis, et al (1987) U.S. Patent No. 4,683,202; Arnheim & Levinson (October 1, 1990) C&EN 36-47; Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173; Guatelli, et al, (1990) Proc. Natl. Acad. Sci.
USA87: 1874; Lomell, et al, (1989) J. Clin. Chem. 35: 1826; Landegren, et al, (1988) Science 241 : 1077-1080; Van Brunt, (1990) Biotechnology 8:291-294; Wu and Wallace, (1989) Gene 4:560; Barringer, et al, (1990) Gene 89: 117, and Sooknanan and Malek, (1995) Biotechnology 13:563-564.
Such nucleic acid amplification techniques can be applied to amplify and/or detect nucleic acids of interest, such as nucleic acids comprising marker loci. Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided. For example, exemplary primers and probes are provided in SEQ ID NOS: 1-154, 1339-1342 and in Tables 2 and 3, and the genomic loci comprising the various marker loci provided herein are provided in SEQ ID NOS: 155-1302, 1343, 1345-1394 and in Table 4. Non-limiting examples of amplicon sequences comprising the marker loci provided herein are provided in SEQ ID NOS: 1303-1338, 1344 and in Table 5. However, one of skill will immediately recognize that other primer and probe sequences could also be used. For instance primers to either side of the given primers can be used in place of the given primers, so long as the primers can amplify a region that includes the allele to be detected, as can primers and probes directed to other SNP marker loci. Further, it will be appreciated that the precise probe to be used for detection can vary, e.g., any probe that can identify the region of a marker amplicon to be detected can be substituted for those examples provided herein. Further, the configuration of the amplification primers and detection probes can, of course, vary. Thus, the compositions and methods are not limited to the primers and probes specifically recited herein.
In certain examples, probes will possess a detectable label. Any suitable label can be used with a probe. Detectable labels suitable for use with nucleic acid probes include, for example, any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels. Other labels include ligands, which bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes. A probe can also constitute radiolabeled PCR primers that are used to generate a radiolabeled amplicon. Labeling strategies for labeling nucleic acids and corresponding detection strategies can be found, e.g., in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals Sixth Edition by Molecular Probes, Inc. (Eugene OR); or Haugland (2001) Handbook of Fluorescent Probes and Research Chemicals Eighth Edition by Molecular Probes, Inc. (Eugene OR).
Detectable labels may also include reporter-quencher pairs, such as are employed in Molecular Beacon and TaqMan™ probes. The reporter may be a fluorescent organic dye modified with a suitable linking group for attachment to the oligonucleotide, such as to the terminal 3' carbon or terminal 5' carbon. The quencher may also be an organic dye, which may or may not be fluorescent, depending on the embodiment. Generally, whether the quencher is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should at least substantially overlap the fluorescent emission band of the reporter to optimize the quenching. Non- fluorescent quenchers or dark quenchers typically function by absorbing energy from excited reporters, but do not release the energy radiatively.
Selection of appropriate reporter-quencher pairs for particular probes may be undertaken in accordance with known techniques. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs may be selected are listed and described, for example, in Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd ed., Academic Press, New York, 1971 , the content of which is incorporated herein by reference. Examples of modifying reporters and quenchers for covalent attachment via common reactive groups that can be added to an oligonucleotide in the present invention may be found, for example, in Haugland,
Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes of Eugene, Oreg., 1992, the content of which is incorporated herein by reference.
In certain examples, reporter-quencher pairs are selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another useful group of fluorescent compounds for use as reporters are the
naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are l-dimethylaminonaphthyl-5 sulfonate, l-anilino-8- naphthalene sulfonate and 2-p-touidinyl-6-naphthalene sulfonate. Other dyes include 3- phenyl-7-isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2- benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like. In certain other examples, the reporters and quenchers are selected from fluorescein and rhodamine dyes. These dyes and appropriate linking methodologies for attachment to oligonucleotides are well known in the art. Suitable examples of reporters may be selected from dyes such as SYBR green, 5- carboxyfluorescein (5-FAM™ available from Applied Biosystems of Foster City, Calif), 6-carboxyfluorescein (6-FAM), tetrachloro-6-carboxyfluorescein (TET), 2,7-dimethoxy- 4,5-dichloro-6-carboxyfluorescein, hexachloro-6-carboxyfluorescein (HEX), 6-carboxy- 2',4,7,7'-tetrachlorofluorescein (6-TET™ available from Applied Biosystems), carboxy- X-rhodamine (ROX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (6-JOE™ available from Applied Biosystems), VIC™ dye products available from Molecular Probes, Inc., NED™ dye products available from Applied Biosystems, and the like. Suitable examples of quenchers may be selected from 6-carboxy-tetramethyl-rhodamine, 4-(4-dimethylaminophenylazo) benzoic acid (DABYL), tetramethylrhodamine
(TAMRA), BHQ-0™, BHQ-1™, BHQ-2™, and BHQ-3™, each of which are available from Biosearch Technologies, Inc. of Novato, Calif, QSY-7™, QSY-9™, QSY-21™ and QSY-35™, each of which are available from Molecular Probes, Inc., and the like.
In one aspect, real time PCR or LCR is performed on the amplification mixtures described herein, e.g., using molecular beacons or TaqMan™ probes. A molecular beacon (MB) is an oligonucleotide which, under appropriate hybridization conditions, self-hybridizes to form a stem and loop structure. The MB has a label and a quencher at the termini of the oligonucleotide; thus, under conditions that permit intra-molecular hybridization, the label is typically quenched (or at least altered in its fluorescence) by the quencher. Under conditions where the MB does not display intra-molecular hybridization (e.g. , when bound to a target nucleic acid, such as to a region of an amplicon during amplification), the MB label is unquenched. Details regarding standard methods of making and using MBs are well established in the literature and MBs are available from a number of commercial reagent sources. See also, e.g., Leone, et al., (1995) Molecular beacon probes combined with amplification by NASBA enable homogenous real-time detection of RNA, Nucleic Acids Res. 26:2150-2155; Tyagi and Kramer, (1996) Molecular beacons: probes that fluoresce upon hybridization, Nature Biotechnology 14:303-308; Blok and Kramer, (1997) Amplifiable hybridization probes containing a molecular switch, Mol Cell Probes 11 : 187- 194; Hsuih. et al., (1997) Novel, ligation-dependent PCR assay for detection of hepatitis C in serum, J Clin Microbiol 34:501-507; Kostrikis, et al., (1998) Molecular beacons: spectral genotyping of human alleles, Science 279: 1228-1229; Sokol, et al, (1998) Real time detection of DNA:RNA hybridization in living cells, Proc. Natl. Acad. Sci. U.S.A. 95: 11538-11543; Tyagi, et al, (1998) Multicolor molecular beacons for allele discrimination, Nature Biotechnology 16:49-53; Bonnet, et al., (1999) Thermodynamic basis of the chemical specificity of structured DNA probes, Proc. Natl. Acad. Sci. U.S.A. 96:6171-6176; Fang, et al. (1999) Designing a novel molecular beacon for surface-immobilized DNA hybridization studies, J. Am. Chem. Soc. 121 :2921-2922; Marras, et al, (1999) Multiplex detection of single- nucleotide variation using molecular beacons, Genet. Anal. Biomol. Eng. 14: 151-156; and Vet, et al, (1999) Multiplex detection of four pathogenic retroviruses using molecular beacons, Proc. Natl. Acad. Sci. U.S.A. 96:6394-6399. Additional details regarding MB construction and use is found in the patent literature, e.g., U.S. Patent Nos. 5,925,517; 6,150,097; and 6,037,130.
Another real-time detection method is the 5'-exonuclease detection method, also called the TaqMan™ assay, as set forth in U.S. Patent Nos. 5,804,375; 5,538,848;
5 ,487,972; and 5 ,210,015 , each of which is hereby incorporated by reference in its entirety. In the TaqMan™ assay, a modified probe, typically 10-25 nucleic acids in length, is employed during PCR which binds intermediate to or between the two members of the amplification primer pair. The modified probe possesses a reporter and a quencher and is designed to generate a detectable signal to indicate that it has hybridized with the target nucleic acid sequence during PCR. As long as both the reporter and the quencher are on the probe, the quencher stops the reporter from emitting a detectable signal. However, as the polymerase extends the primer during amplification, the intrinsic 5' to 3' nuclease activity of the polymerase degrades the probe, separating the reporter from the quencher, and enabling the detectable signal to be emitted. Generally, the amount of detectable signal generated during the amplification cycle is proportional to the amount of product generated in each cycle.
It is well known that the efficiency of quenching is a strong function of the proximity of the reporter and the quencher, i.e., as the two molecules get closer, the quenching efficiency increases. As quenching is strongly dependent on the physical proximity of the reporter and quencher, the reporter and the quencher are preferably attached to the probe within a few nucleotides of one another, usually within 30 nucleotides of one another, more preferably with a separation of from about 6 to 16 nucleotides. Typically, this separation is achieved by attaching one member of a reporter- quencher pair to the 5' end of the probe and the other member to a nucleotide about 6 to 16 nucleotides away, in some cases at the 3' end of the probe.
Separate detection probes can also be omitted in amplification/detection methods, e.g., by performing a real time amplification reaction that detects product formation by modification of the relevant amplification primer upon incorporation into a product, incorporation of labeled nucleotides into an amplicon, or by monitoring changes in molecular rotation properties of amplicons as compared to unamp lifted precursors (e.g., by fluorescence polarization).
Further, it will be appreciated that amplification is not a requirement for marker detection— for example, one can directly detect unamplified genomic DNA simply by performing a Southern blot on a sample of genomic DNA. Procedures for performing Southern blotting, amplification e.g., (PCR, LCR, or the like), and many other nucleic acid detection methods are well established and are taught, e.g., in Sambrook, et al., Molecular Cloning - A Laboratory Manual (3d ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2000 ("Sambrook"); Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2002) ("Ausubel")) and PCR Protocols A Guide to Methods and Applications (Innis, et al., eds) Academic Press Inc. San Diego, CA (1990) (Innis). Additional details regarding detection of nucleic acids in plants can also be found, e.g. , in Plant Molecular Biology (1993) Croy (ed.) BIOS Scientific Publishers, Inc.
Other techniques for detecting SNPs can also be employed, such as allele specific hybridization (ASH). ASH technology is based on the stable annealing of a short, single- stranded, oligonucleotide probe to a completely complementary single-stranded target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe. For each polymorphism, two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides. Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences. Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization.
Real-time amplification assays, including MB or TaqMan™ based assays, are especially useful for detecting SNP alleles. In such cases, probes are typically designed to bind to the amplicon region that includes the SNP locus, with one allele-specific probe being designed for each possible SNP allele. For instance, if there are two known SNP alleles for a particular SNP locus, "A" or "C," then one probe is designed with an "A" at the SNP position, while a separate probe is designed with a "C" at the SNP position. While the probes are typically identical to one another other than at the SNP position, they need not be. For instance, the two allele-specific probes could be shifted upstream or downstream relative to one another by one or more bases. However, if the probes are not otherwise identical, they should be designed such that they bind with approximately equal efficiencies, which can be accomplished by designing under a strict set of parameters that restrict the chemical properties of the probes. Further, a different detectable label, for instance a different reporter-quencher pair, is typically employed on each different allele-specific probe to permit differential detection of each probe. In certain examples, each allele-specific probe for a certain SNP locus is 11-20 nucleotides in length, dual-labeled with a florescence quencher at the 3' end and either the 6-FAM (6- carboxyfluorescein) or VIC (4,7,2'-trichloro-7'-phenyl-6-carboxyfluorescein) fluorophore at the 5 ' end.
To effectuate SNP allele detection, a real-time PCR reaction can be performed using primers that amplify the region including the SNP locus, for instance the sequences listed in Table 4, the reaction being performed in the presence of all allele-specific probes for the given SNP locus. By then detecting signal for each detectable label employed and determining which detectable label(s) demonstrated an increased signal, a determination can be made of which allele-specific probe(s) bound to the amplicon and, thus, which SNP allele(s) the amplicon possessed. For instance, when 6-FAM- and VIC-labeled probes are employed, the distinct emission wavelengths of 6-FAM (518 nm) and VIC (554 nm) can be captured. A sample that is homozygous for one allele will have fluorescence from only the respective 6-FAM or VIC fluorophore, while a sample that is heterozygous at the analyzed locus will have both 6-FAM and VIC fluorescence. The KASPar® and Illumina® Detection Systems are additional examples of commercially-available marker detection systems. KASPar® is a homogeneous fluorescent genotyping system which utilizes allele specific hybridization and a unique form of allele specific PCR (primer extension) in order to identify genetic markers (e.g. a particular SNP locus associated with Phytophthora tolerance). Illumina® detection systems utilize similar technology in a fixed platform format. The fixed platform utilizes a physical plate that can be created with up to 384 markers. The Illumina® system is created with a single set of markers that cannot be changed and utilizes dyes to indicate marker detection.
These systems and methods represent a wide variety of available detection methods which can be utilized to detect markers associated with tolerance or improved tolerance to Phytophthora, but any other suitable method could also be used.
Introgression of Phytophthora tolerance into non-tolerant or less-tolerant soybean germplasm is provided. Any method for introgressing one or more marker loci into soybean plants known to one of skill in the art can be used. Typically, a first soybean germplasm that contains Phytophthora tolerance derived from a particular marker locus, haplotype or marker profile and a second soybean germplasm that lacks such tolerance derived from the marker locus, haplotype or marker profile are provided. The first soybean germplasm may be crossed with the second soybean germplasm to provide progeny soybean germplasm. These progeny germplasm are screened to determine the presence of Phytophthora tolerance derived from the marker locus, haplotype or marker profile, and progeny that tests positive for the presence of tolerance derived from the marker locus, haplotype or marker profile are selected as being soybean germplasm into which the marker locus, haplotype or marker profile has been introgressed. Methods for performing such screening are well known in the art and any suitable method can be used.
One application of MAS is to use the tolerance markers, haplotypes or marker profiles to increase the efficiency of an introgression or backcrossing effort aimed at introducing a tolerance trait into a desired (typically high yielding) background. In marker assisted backcrossing of specific markers from a donor source, e.g., to an elite genetic background, one selects among backcross progeny for the donor trait and then uses repeated backcrossing to the elite line to reconstitute as much of the elite
background's genome as possible.
Thus, the markers and methods can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (set) of allelic forms of chromosome segments associated with superior agronomic performance (tolerance, along with any other available markers for yield, disease tolerance, etc.). Any of the disclosed marker loci, marker alleles, haplotypes, or marker profiles can be introduced into a soybean line via introgression, by traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance. The number of alleles associated with tolerance that can be introduced or be present in a soybean plant ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.
The markers and methods provided herein can also be utilized to guide marker assisted selection or breeding of soybean varieties comprising other Phytophthora tolerance markers or alleles to create a molecular stack for Phytophthora tolerance. Any of the marker loci provided herein can be introduced into a soybean line having one or more of the Phytophthora tolerance alleles rpsl, rpsl, rps3, rps4, rps5, rps6, rpsl or rps&. For example, the stacked combinations can include Rpslc and Rps3; Rpslk and Rps6; Rpslk and Rps3; Rpslc, Rpslk and Rps3; or Rpslc, Rpslk and Rps6. Rpslc, Rpslk and Rps6; Rpslc and Rpslk; or any combination of one or more of Rpsla, Rpslb, Rpslc, Rpsld, Rpslk, Rps2, Rps3a, Rps3b, Rps3c, Rps4, Rps5, Rps6, Rps7, Rps8 and Rps Yu25. The Rps loci are described, for example, in Sugimoto, Takuma, et al.
"Pathogenic diversity of Phytophthora sojae and breeding strategies to develop
Phytophthora-resistant soybeans." Breeding Science 61.5 (2012): 511-522; Sun, S., et al. 2011. Characterization and mapping of RpsYu25, a novel resistance gene to
Phytophthora sojae. Plant Breed. 30: 139-143; and Gordon, S.G., et al. 2007. Molecular marker analysis of soybean plant introductions with resistance to Phytophthora sojae. Phytopathology 97: 113-118; each of which is herein incorporated by reference in their entirety.
In one embodiment, any one or more of the marker loci provided herein can be stacked with the rpsl allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps2 allele. In another embodiment, any one or more of the marker loci provided herein can be stacked with the rps3 allele. In yet another embodiment, any one or more of the marker loci provided herein can be stacked with the rps6 allele.
This also provides a method of making a progeny soybean plant and these progeny soybean plants, per se. The method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art. Such soybean plant progeny can be assayed for alleles associated with tolerance and, thereby, the desired progeny selected. Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding. At least one of the first or second soybean plants is a soybean plant in that it comprises at least one of the marker loci or marker profiles, such that the progeny are capable of inheriting the marker locus or marker profile.
Often, a method is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired tolerance can be traced. The number of generations separating the soybean plants being subject to the methods provided herein will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).
Genetic diversity is important for long term genetic gain in any breeding program. With limited diversity, genetic gain will eventually plateau when all of the favorable alleles have been fixed within the elite population. One objective is to incorporate diversity into an elite pool without losing the genetic gain that has already been made and with the minimum possible investment. MAS provides an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.
For example, the markers, haplotypes, primers, probes, and marker profiles can be used for MAS in crosses involving elite x exotic soybean lines by subjecting the segregating progeny to MAS to maintain major yield alleles, along with the tolerance marker alleles herein.
As an alternative to standard breeding methods of introducing traits of interest into soybean (e.g., introgression), transgenic approaches can also be used to create transgenic plants with the desired traits. In these methods, exogenous nucleic acids that encode a desired marker loci, marker profile or haplotype are introduced into target plants or germplasm. For example, a nucleic acid that codes for a tolerance trait is cloned, e.g., via positional cloning, and introduced into a target plant or germplasm.
Experienced plant breeders can recognize tolerant soybean plants in the field, and can select the tolerant individuals or populations for breeding purposes or for
propagation. In this context, the plant breeder recognizes "tolerant" and "non-tolerant" or "susceptible" soybean plants. However, plant tolerance is a phenotypic spectrum consisting of extremes in tolerance and susceptibility, as well as a continuum of intermediate tolerance phenotypes. Evaluation of these intermediate pheno types using reproducible assays are of value to scientists who seek to identify genetic loci that impart tolerance, to conduct marker assisted selection for tolerant populations, and to use introgression techniques to breed a tolerance trait into an elite soybean line, for example.
By "improved tolerance" is intended that the plants show a decrease in the disease symptoms that are the outcome of plant exposure to Phytophthora. That is, the damage caused by Phytophthora infection is prevented, or alternatively, the disease symptoms caused by Phytophthora infection is minimized or lessened. Thus, improved tolerance to Phytophthora can result in reduction of the disease symptoms by at least about 2% to at least about 6%, at least about 5% to about 50%, at least about 10% to about 60%, at least about 30% to about 70%, at least about 40% to about 80%, or at least about 50% to about 90% or greater. Hence, the methods provided herein can be utilized to protect plants from Phytophthora infection. Screening and selection of Phytophthora tolerant soybean plants may be performed, for example, by exposing plants to Phytophthora and selecting those plants showing tolerance to Phytophthora. Various assays can be used to measure tolerance or improved tolerance to Phytophthora. For example, Phytophthora tolerance can be determined by visual observations after plant exposure to a particular race of
Phytophthora.
Non-limiting examples of Phytophthora tolerance phenotypic screening are described in detail below.
PHYTOPHTHORA FIELD TOLERANCE. Tolerance to Phytophthora root rot is rated on a scale of 1 to 9, with a score of 1 indicating the plants have no tolerance to
Phytophthora, ranging to a score of 9 being the best or highest tolerance. PRTLAB indicates the tolerance was scored using plants in lab assay experiments. Preliminary scores are reported as double digits, for example '55' indicates a preliminary score of 5 on the scale of 1 to 9.
PHYTOPHTHORA RESISTANCE GENE (Rps). Various Phytophthora resistance genes are known and include but are not limited to: Rpsl-a = resistance to races 1-2, 10-11, 13- 8, 24; Rpsl-c = resistance to races 1-3, 6-11, 13, 15, 17, 21, 23, 24, 26, 28-30, 32, 34, 36; Rpsl-k = resistance to races 1-11, 13-15, 17, 18, 21-24, 26, 36, 37; Rps3-a = resistance to races 1-5, 8, 9, 11, 13, 14, 16, 18, 23, 25, 28, 29, 31-35, 39-41, 43-45, 47-52, 54; Rps 3 -c = resistance to races 1-4, 10-16, 18-36, 38-54; Rps6 = resistance to races 1-4, 10, 12, 14- 16, 18-21, 25, 28, 33-35; and, Rps8 = resistance to races 1-5, 9, 13-15, 21, 25, 29, 32. RESISTANCE. As used herein, resistance is synonymous with tolerance and is used to describe the ability of a plant to withstand exposure to an insect, disease, herbicide, environmental stress, or other condition. A resistant plant variety will be able to better withstand the insect, disease pathogen, herbicide, environmental stress, or other condition as compared to a non-resistant or wild-type variety.
Genes that confer resistance to Phytophthora Root Rot, such as Rpsl, Rpsl-a, Rpsl-b, Rpsl-c, Rpsl-d, Rpsl-e, Rpsl-k, Rps2, Rps3-a, Rps3-b, Rps3-c, Rps4, Rps5, Rps6, Rps 7, Rps8, and other Rps genes. See, for example, Shoemaker et al.
Phytophthora Root Rot Resistance Gene Mapping in Soybean", Plant Genome IV Conference, San Diego, CA (1995). Phytophthora sojae is maintained by refrigeration on agar. It is transferred to fresh agar plates to make inoculum for the test.
Test and check lines are grown in growth chambers under controlled light and controlled temperature conditions. The lines are inoculated at the seedling stage by injecting mycelium into the hypocotyl. The unclassified lines are incubated in conditions conducive for Phytophthora infection, and then evaluated when the known susceptible controls die. The plants can be inoculated with at least one of: Phytophthora race 4 (PMG04); Phytophthora race 7 (PMG07); and/or Phytophthora race 25 (PMG25).
Experiments are scored 2-3 days following inoculation, depending on the reaction of susceptible and resistant checks. Infection phenotypes are classified based on the number of seedlings alive divided by the total number of seedlings inoculated. For example, 9 = 9 of 9 plants alive and healthy
5 = 5 of 9 plants alive and healthy
1 = 1 or 0 of 9 plants alive and healthy
M = no or poor germ (<5 seeds germinate)
The level of tolerance of soybean varieties to Phytophthora Root Rot can be evaluated and characterized in the field. Phytophthora Root Rot is well known to those skilled in the art (see, e.g., Schmitthenner and Walker, Tolerance versus resistance for control of Phytophthora root rot of soybeans, p. 35-44 In H. D. Loden and D. Wilkenson (ed.) Proceedings of the 9th Soybean Seed Research Conference, Chicago, IL 13-14 Dec. 1979. American Seed Trade Association, Washington, DC; Walker and Schmitthenner (1984) Crop Science 24:487-489; and, Schmitthenner and Bhat. 1994. Useful methods for studying Phytophthora in the laboratory. Department of Plant Pathology. Ohio Agricultural Research and Development Center. Circular 143).
For testing, seed samples from experimental and check lines are not treated with any seed treatment. A known set of differential checks is used. One or more races of Phytophthora are chosen. Normally, at least Race 25 Phytophthora sojae is used.
Experimental lines and checks are sown in vermiculite in trays that are inoculated with mycelium. The trays are moved outside to a location covered with 30% sunlight block netting. Differential checks with low tolerance show symptoms 1-2 weeks after planting. Experimental lines are scored approximately three weeks after planting by removing the plants and root mass intact from the vermiculite. The vermiculite is removed by tapping the roots, without damaging the roots. All experimental entries are scored relative to the appearance of the root system of one or more check variety(s) and the known
performance chart score of each check. Scores are assigned on a scale of 1-9, and are relative to the differential checks and based upon total root mass, general appearance of plants and roots, and extent of necrosis.
1 = all plants die after emerging
2 = 50% less root mass than 9306
3 = equal to 9306
4 = 50% less root mass than Conrad, 25% more than 9306
5 = 25% less root mass than Conrad
6 = equal to Conrad
7 = equal to 92B38 and/or 93B67
8 = equal to 93B45
9 = equal to 9242
In some examples, a kit or an automated system for detecting marker loci, haplotypes, and marker profiles, and/or correlating the marker loci, haplotypes, and marker profiles with a desired phenotype (e.g., Phytophthora tolerance) are provided. As used herein, "kit" refers to a set of reagents for the purpose of performing the various methods of detecting or identifying herein, more particularly, the identification and/or the detection of a soybean plant or germplasm having tolerance or improved tolerance to Phytophthora.
In one embodiment, a kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection is provided. Such a kit comprises (a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein at least one of the primers and probes in the kit are capable of detecting a marker locus, wherein the marker locus is: (i) associated with the Rpsla, Rsplc, Rpsld or Rpslk loci on linkage group N; (ii) associated with Rps2 locus on linkage group J; (iii) associated with the Rps3a or Rps3c loci on linkage group F; or (iv) associated with the Rps6 locus on linkage group G; and (b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
In a specific embodiment, the primers and probes of the kit are capable of detecting a marker locus comprising: (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-1, the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N, such as, for example, the markers provided in Figure 1 A-C; (c) S06862- 1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J, such as, for example, the markers provided in Figure 3 A-C; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F, such as, for example, those markers provided in Figure 2 A-D; or (e) S08442-1, S08341- 1 or a marker closely linked thereto on linkage group G, such as, for example, the markers provided in Figure 4 A-E.
Thus, a typical kit or system can include a set of marker probes or primers configured to detect at least one favorable allele of one or more marker loci associated with tolerance to Phytophthora infection, for instance a favorable marker locus, haplotype or marker profile. These probes or primers can be configured, for example, to detect the marker loci noted in the tables and examples herein, e.g. , using any available allele detection format, such as solid or liquid phase array based detection, microfluidic- based sample detection, etc. The systems and kits can further include packaging materials for packaging the probes, primers, or instructions, controls such as control amplification reactions that include probes, primers or template nucleic acids for amplifications, molecular size markers, or the like.
A typical system can also include a detector that is configured to detect one or more signal outputs from the set of marker probes or primers, or amplicon thereof, thereby identifying the presence or absence of the allele. A wide variety of signal detection apparatus are available, including photo multiplier tubes, spectrophotometers, CCD arrays, scanning detectors, phototubes and photodiodes, microscope stations, galvo- scans, microfluidic nucleic acid amplification detection appliances and the like. The precise configuration of the detector will depend, in part, on the type of label used to detect the marker allele, as well as the instrumentation that is most conveniently obtained for the user. Detectors that detect fluorescence, phosphorescence, radioactivity, pH, charge, absorbance, luminescence, temperature, magnetism or the like can be used. Typical detector examples include light (e.g., fluorescence) detectors or radioactivity detectors. For example, detection of a light emission (e.g., a fluorescence emission) or other probe label is indicative of the presence or absence of a marker allele. Fluorescent detection is generally used for detection of amplified nucleic acids (however, upstream and/or downstream operations can also be performed on amplicons, which can involve other detection methods). In general, the detector detects one or more label (e.g., light) emission from a probe label, which is indicative of the presence or absence of a marker allele. The detector(s) optionally monitors one or a plurality of signals from an amplification reaction. For example, the detector can monitor optical signals which correspond to "real time" amplification assay results.
System or kit instructions that describe how to use the system or kit or that correlate the presence or absence of the favorable allele with the predicted tolerance are also provided. For example, the instructions can include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles, haplotypes, or marker profiles and the predicted tolerance. The precise form of the instructions can vary depending on the components of the system, e.g. , they can be present as system software in one or more integrated unit of the system (e.g. , a microprocessor, computer or computer readable medium), or can be present in one or more units (e.g. , computers or computer readable media) operably coupled to the detector. As noted, in one typical example, the system instructions include at least one look-up table that includes a correlation between the presence or absence of the favorable alleles and predicted tolerance. The instructions also typically include instructions providing a user interface with the system, e.g., to permit a user to view results of a sample analysis and to input parameters into the system.
Isolated polynucleotides comprising the nucleic acid sequences of the primers and probes provided herein are also encompassed herein. In one embodiment, the isolated polynucleotide comprises a polynucleotide capable of detecting a marker locus of the soybean genome comprising (a) S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N; (b) S07963-2, S07372-1, S00009-01, S08013-
I, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N; (c) S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J; (d) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or (e) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
In specific embodiments, the isolated polynucleotide comprises: (a) a
polynucleotide comprising SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 1339 or 1340; (b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113,
114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1341 or 1342; (c) a polynucleotide having at least 90% sequence identity to SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342; or (d) a polynucleotide comprising at least 10 contiguous nucleotides of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 1339, 1340, 1341 or 1342.
In certain embodiments, the isolated nucleic acids are capable of hybridizing under stringent conditions to nucleic acids of a soybean cultivar tolerant to Phytophthora, for instance to particular SNPs that comprise a marker locus, haplotype or marker profile.
As used herein, a substantially identical or complementary sequence is a polynucleotide that will specifically hybridize to the complement of the nucleic acid molecule to which it is being compared under high stringency conditions. A
polynucleotide is said to be the "complement" of another polynucleotide if they exhibit complementarity. As used herein, molecules are said to exhibit "complete
complementarity" when every nucleotide of one of the polynucleotide molecules is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low-stringency" conditions. Similarly, the molecules are said to be "complementary" if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency" conditions.
Appropriate stringency conditions which promote DNA hybridization, for example, 6Xsodium chloride/sodium citrate (SSC) at about 45° C, followed by a wash of 2XSSC at 50° C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS.
Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium. Non-limiting examples of methods and compositions disclosed herein are as follows:
1. A method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
(a) the at least one marker locus comprises S08291-1, S07292-1,
S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(b) the at least one marker locus comprises S07963-2, S07372-1,
S00009-01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N;
(c) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J;
(d) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(e) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
2. The method of embodiment 1, wherein at least two marker loci are detected.
3. The method of embodiment 2, wherein the at least two marker loci comprise a haplotype that is associated with said tolerance. 4. The method of embodiment 2, wherein the at least two marker loci comprise a marker profile that is associated with said tolerance.
5. The method of any one of embodiments 1-4, wherein the germplasm is a soybean variety.
6. The method of any one of embodiments 1-5, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
7. The method of embodiment 6, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
8. The method of embodiment 7, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
9. The method of any one of embodiments 1-8, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
10. The method of any one of embodiments 1-8, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
11. The method of embodiment 10, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
12. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394.
13. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
14. The method of embodiment 13, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15. 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof.
15. The method of embodiment 14, wherein said primer pair comprises:
a) SEQ ID NO: 1 and SEQ ID NO:2;
b) SEQ ID NO: 9 and SEQ ID NO: 10;
c) SEQ ID NO: 20 and SEQ ID NO:21;
d) SEQ ID NO: 22 and SEQ ID NO: 23;
e) SEQ ID NO : 24 and SEQ ID NO : 25 ;
f) SEQ ID NO: 36 and SEQ ID NO: 37;
g) SEQ ID NO: 38 and SEQ ID NO: 39; or
h) SEQ ID NO: 1339 and SEQ ID NO: 1340.
16. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179 or 180.
17. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
18. The method of embodiment 17, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof.
19. The method of embodiment 18, wherein said primer pair comprises:
a) SEQ ID NO: 40 and SEQ ID NO: 41;
b) SEQ ID NO: 46 and SEQ ID NO: 47;
c) SEQ ID NO: 52 and SEQ ID NO: 53;
d) SEQ ID NO: 58 and SEQ ID NO: 59;
e) SEQ ID NO: 64 and SEQ ID NO: 65;or
f) SEQ ID NO: 75 and SEQ ID NO: 76.
20. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185 or 186.
21. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
22. The method of embodiment 21, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof.
23. The method of embodiment 22, wherein said primer pair comprises:
a) SEQ ID NO: 81 and SEQ ID NO: 82;
b) SEQ ID NO: 89 and SEQ ID NO: 90; or
c) SEQ ID NO: 91 and SEQ ID NO: 92.
24. The method of embodiment 11, wherein said method comprises amplifying a variant or fragment of SEQ ID NOs: 187, 188, 189 or 190.
25. The method of embodiment 11, wherein said primer or primer pair comprises a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
26. The method of embodiment 25, wherein said primer or primer pair comprises a nucleic acid sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
27. The method of embodiment 26, wherein said primer pair comprises:
a) SEQ ID NO: 95 and SEQ ID NO: 96; or
b) SEQ ID NO: 101 and SEQ ID NO: 102. 28. The method of embodiment 11, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
29. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394 or complements thereof.
30. The method of embodiment 29, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342. 31. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof.
32. The method of embodiment 31, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139.
33. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof.
34. The method of embodiment 33, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147,
148 or 149.
35. The method of embodiment 28, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising a variant or fragment of SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
36. The method of embodiment 35, wherein the labeled nucleic acid probe comprises a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152, 153 or 154. 37. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372-1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N.
38. The isolated polynucleotide of embodiment 37, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339 or 1340;
(b) a polynucleotide comprising SEQ ID NOs: 105, 106, 107, 108,
109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b).
39. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J.
40. The isolated polynucleotide of embodiment 39, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77 or 78;
(b) a polynucleotide comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134,
135, 136, 137, 138 or 139;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b). 41. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F.
42. The isolated polynucleotide of embodiment 41, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 or 92;
(b) a polynucleotide comprising SEQ ID NOs: 140, 141, 142, 143,
144, 145, 146, 147, 148 or 149;
(c) a polynucleotide having at least 90% sequence identity to the
polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of
the polynucleotides set forth in parts (a) or (b).
43. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
44. The isolated polynucleotide of embodiment 43, wherein the polynucleotide comprises:
(a) a polynucleotide comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104;
(b) a polynucleotide comprising SEQ ID NOs: 150, 151, 152, 153 or
154;
(c) a polynucleotide having at least 90% sequence identity to the
polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of
the polynucleotides set forth in parts (a) or (b).
45. A kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection, the kit comprising:
(a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein the primers or probes are capable of detecting a marker locus, wherein: (i) the at least one marker locus comprises S08291-1, S07292-
1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(ii) the at least one marker locus comprises S07963-2, S07372-
1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N;
(iii) the at least one marker locus comprises S06862-1, S06863-1, S06864- 1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J;
(iv) the at least one marker locus comprises S09018-1, S08342-1, S07163- 1 or a marker closely linked thereto on linkage group F; or
(v) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
(b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to
Phytophthora infection.
EXPERIMENTAL
The following examples are offered to illustrate, but not to limit the claimed invention. It is understood that the examples and embodiments described herein are for illustrative purposes only, and persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.
Example 1 : Marker Loci Associated With Phytophthora Tolerance At Rpsl Loci
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rpsl locus on linkage group N (ch 3). Markers were screened against various known resistant and susceptible parents.
A. Rpsl a
A marker to locus S08291-1 was developed to identify alleles associated with the phytophthora resistance phenotype, this marker detects a G/A polymorphism associated with Rpsl a. A panel of lines used for development for markers to identify Rpslc included lines with Rpslk and Rpsla, and provided information for alleles in the Rpsla genomic region. During development, this marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize the marker system for high throughput analysis of soybean. From this testing, S08291-1-Q5 was chosen for high throughput analysis needs, but other versions can be used to detect the polymorphism. This marker was used to fingerprint about 2000 lines.
Genomic DNA was extracted for testing using a standard CTAB protocol and exemplary amplification conditions are described below.
Cycle settings: Taqman™ assay
94°C 2 min 1 cycle
94°C 30 sec 40 cycles
60°C 60 sec
Amplification Mix (in microliters):
H20 3.625
hottub buffer 0.5
dNTP (2.5 mM each) 0.375
primer 1 +primer2 ( 1 OuM each) 0.15
primer3+primer4 (lOuM each) 0.15
probe 1 (lOuM) 0.05
Probe 2 (1 OuM) 0.05
hottub enzyme 0.025
Invitrogen rox dye (50X) 0.075
DNA 0.05
Total 5.05
B. Rpslc
Several populations were developed in order to identify and characterize
Phytophthora resistance loci and polymorphisms for marker development. The following biparental crosses were made and phenotyped for the Phytophthora races (PMG Race) indicated, as shown in Table 6. Table 6.
Figure imgf000085_0001
Markers to the S07292-1 locus and the S08242 locus were developed to identify alleles associated with the Phytophthora resistance phenotype associated with Rpslc. During development, these markers were validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
C. Rpsld
Rpsld was mapped near Rpslk and may be an alternate allele of the Rpsl locus (Sugimoto et al., 2008. Identification of SSR markers linked to the Phytophthora resistance gene Rpsl-d in soybean (2008) Plant Breeding, 127 (2): 154-159). SNPs that could be used for marker assisted selection of Rpsld were identified near the Rpslk region through sequencing of amplicons generated using extracted DNA from EX23U07, a progeny of the Rpsld donor PI103091. EX23U07 has the minor allele at SNP, S16592- 001, which was found to be at low allele frequency across a diverse set of germplasm (-6.2%, see table below). The Taqman assay SI 6592-001 -QOOl was designed to assay this SNP and will be useful for MAS of Rpsld.
Table 7: The following lines were genotyped using the Taqman marker S16592-001- Q001. Column three indicates the predicted allele at the Rpsl locus within the respective line based on phenotypic screens of phytophthora resistance.
Figure imgf000085_0002
91Y41 A Rpslc
91Y92 A Rpslc
92M81 A Rpslc
93M14 A Rpslc
93Y80 A Rpslc
ARKSOY A Rpslc
Ralsoy A Rpslc
Sheyenne A
92B38 T None
92M33 T None
92M61 T None
92Y70 T None
93Y23 T None
93Y30 T None
93Y70 T None
93Y72 T None
93Y92 T None
94M80 T None
94Y50 T None
94Y70 T None
94Y80 T None
94Y90 T None
95M50 T None
95Y01 T None
95Y20 T None
95Y30 T None
95Y31 T None
90M01 T Rpslk
90M02 T Rpslk
90M91 T Rpslk
90M92 T Rpslk
90Y21 T Rpslk
90Y41 T Rpslk
90Y42 T Rpslk
90Y50 T Rpslk 90Y70 T Rpslk
91B42 T Rpslk
91M01 Τ Rpslk
91M13 Τ Rpslk
91M30 Τ Rpslk
91M41 Τ Rpslk
91M51 Τ Rpslk
91M61 Τ Rpslk
91Y20 Τ Rpslk
91Y21 Τ Rpslk
91Y70 Τ Rpslk
91Y72 Τ Rpslk
91Y80 Τ Rpslk
92B12 Τ Rpslk
92M02 Τ Rpslk
92M11 Τ Rpslk
92M21 Τ Rpslk
92M72 Τ Rpslk
92M76 Τ Rpslk
92M91 Τ Rpslk
92Y10 Τ Rpslk
92Y20 Τ Rpslk
92Y21 Τ Rpslk
92Y30 Τ Rpslk
92Y51 Τ Rpslk
92Y52 τ Rpslk
92Y54 τ Rpslk
92Y60 τ Rpslk
92Y61 τ Rpslk
92Y72 τ Rpslk
92Y80 τ Rpslk
92Y82 τ Rpslk
92Y90 τ Rpslk
92Y91 τ Rpslk
93B82 τ Rpslk 93B86 T Rpslk
93M11 T Rpslk
93M82 T Rpslk
93M92 T Rpslk
93M96 T Rpslk
93Y02 T Rpslk
93Y04 T Rpslk
93Y05 T Rpslk
93Y10 T Rpslk
93Y11 T Rpslk
93Y15 T Rpslk
93Y20 T Rpslk
93Y21 T Rpslk
93Y40 T Rpslk
93Y50 T Rpslk
93Y51 T Rpslk
93Y60 T Rpslk
93Y81 T Rpslk
93Y90 T Rpslk
93Y91 T Rpslk
93Y93 T Rpslk
94B73 T Rpslk
94M30 T Rpslk
94Y01 T Rpslk
94Y10 T Rpslk
94Y20 T Rpslk
94Y30 T Rpslk
94Y40 T Rpslk
94Y60 T Rpslk
94Y91 T Rpslk
95Y40 T Rpslk
93M42 T 1A
93Y82 T 1A
95Y10 T 1A
KINGWA T Rpslk 9071 T Rpslc
9181 T Rpslc
900Y71 T Rpslc
90B43 T Rpslc
90B51 T Rpslc
90M60 T Rpslc
90M80 T Rpslc
90Y90 T Rpslc
94Y21 T Rpslc
A1564 T
A2943 T
A3127 T
A3733 T
A4715 T
A5979 T
A6297 T
ADAMS T
BAVENDERSPECIALA T
BLACKHAWK T
Capital T
CLARK T
CLARK63 T
CNS T
DORMAN T
Dunfield T
ESSEX T
FC31745 T
FOWLER T
Haberlandt T
HAROSOY T
HAWKEYE T
Illini T
JACKSON T
Kanro T
KS3406 T L15 T
LEE T
Lincoln T
LP14575198 T
MT95-123720 T
Mukden T
OGDEN T
P2981 T
Palmetto T
Patoka T
Peking T
PERRY T
PI084674 T
PI171442 T
PI180501 T
PI248404 T
PI391589 T
PI424195B T
PI437151 T
PI54610 T
PI605891B T
PI81041 T
PI84946-2 T
PI88788 T
PI91110-1 T
Pintado T
Richland T
S-100 T
SENECA T
ST2250 T
ST2660 T
Tokyo T
WAYNE T
Williams T D. Rpslk
Markers to loci S00009-1, S07963-2, and S08013 were developed in order to characterize and identify lines having a Rpslk resistance allele. It was observed that over time marker S00009-01-A did not always identify lines known to have Rpslk. It was hypothesized that this could be due to a recombination event in the region. A new target region was selected near the Rpslk locus and sequenced. Markers S07963-2-Q1 and S08013-1Q were designed based on the SNP profile of the sequenced region. These markers were tested on a panel of public and proprietary lines which included known Rpslk lines, susceptible lines, and other test lines. The allele and haplotype data are summarized below in Table 8.
Table 8.
Figure imgf000091_0002
Markers S07963-2-Q1 and S08013-1Q were further evaluated and validated against four F3 mapping populations using the following amplification conditions.
PCR cycle settings
94°C lO min 1 cycle
94°C 30 sec 40 cycles
60°C 60 sec 40 cycles
TAQMAN™ Amplification Mix (Volumes in microliters)
DNA (dried down) 16ng
Water 2.42
KlearKall Mastermix 2.5
Forward Primer (ΙΟΟμιη) 0.0375
Reverse Primer (100 μιη) 0.0375
Probe 1 (ΙΟΟμπι) 0.005
Figure imgf000091_0001
Total 5 Case control Association Analysis
Using a case-control association analysis, the Rpslk locus which conditions variation in phytophthora root rot resistance, was fine-mapped between 3915646- 4533559 bp on Gm03 (Lg N). A set of 581 SNPs were identified in this region that perfectly differentiate resistant from susceptible lines. These markers are ideal candidates for marker-assisted selection of resistance to phytophthora root rot from the Rpslk locus.
Phenotypic data from lab screening for Phytophthora resistance was used in the study. DNA was prepped using standard Illumina TruSeq Chemistry. Selected resistant and susceptible lines formed the case groups and were sequenced to ~0.5-40x genome coverage on an Illumina HiSeq2000. SNPs were called using a proprietary software to automate the process, missing data was imputed using a separate proprietary software. Haploview was used to conduct a case-control association analysis on a set of 15537 SNPs identified in the region from 34000026-5085535 bp on Gm03. The case group comprised 57 proprietary soybean lines resistant to phytophthora and the control group comprised 9 proprietary susceptible lines. Following Haploview filtering using the settings noted below, 7491 SNPs remained in the analysis. Nine SNPs had all missing values in the control group and were removed from additional analysis.
Haploview Settings:
· Do Association Test
• Case/Control Data
• Ignore Pairwise comparisons of markers >10 kb apart
• Exclude individuals with >50% missing genotypes
• HW p-value cutoff: 0.0
· Min genotype % 50
• Max # mendel errors: 1
• Minimum minor allele freq. 0.05
The presence of haplotypes were also observed in a panel of lines not included in the association study.
A plot of chi square values from case-control analysis versus physical position of 7482 SNPs reveals a peak of SNP to trait association between 3915646-4533559 bp on Gm03, suggesting that a locus conditioning phytophthora resistance is in this region. A total of 581 SNPs have a perfect association between 9 susceptible (control) and 57 resistant (case) lines (Table 9). These markers are ideal for TaqMan™ assay design or for evaluation by other methods, including sequencing, hybridization, or other technologies. Numerous additional SNPs analyzed here that are linked to region but are not in perfect LD with trait could be very informative markers when used in select germplasm.
Table 9
Figure imgf000093_0001
Gm03:3940174 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 216 772
Gm03:3940396 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 217 773
Gm03:3940836 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 218 774
Gm03:3941262 A 112:0, 0:16 1.000, 0.000 128 1.12E-29 219 775
Gm03:3941484 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 220 776
Gm03:3941769 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 221 777
Gm03:3942973 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 222 778
Gm03:3943092 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 223 779
Gm03:3944671 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 224 780
Gm03:3944738 C 114:0, 0:6 1.000, 0.000 120 6.33E-28 225 781
Gm03:3945112 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 226 782
Gm03:3945208 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 227 783
Gm03:3947836 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 228 784
Gm03:3947860 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 229 785
Gm03:3949250 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 230 786
Gm03:3949680 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 231 787
Gm03:3951187 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 232 788
Gm03:3951201 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 233 789
Gm03:3951485 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 234 790
Gm03:3951603 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 235 791
Gm03:3951705 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 236 792
Gm03:3951715 G 114:0, 0:16 1.000, 0.000 130 4.10E-30 237 793
Gm03:3952778 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 1349 1350
Gm03:3952811 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 1351 1352
Gm03:3955716 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 238 794
Gm03:3956414 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 239 795
Gm03:3958402 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 240 796
Gm03:3960626 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 241 797
Gm03:3962904 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 242 798
Gm03:3967880 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 243 799
Gm03:3968334 G 114:0, 0:14 1.000, 0.000 128 1.12E-29 1353 1354
Gm03:3971607 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 244 800
Gm03:3971640 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 245 801
Gm03:3971692 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 246 802
Gm03:3975817 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 247 803
Gm03:3975824 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 248 804
Gm03:3976645 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 249 805
Gm03:3980566 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 250 806 Gm03:3981623 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 251 807
Gm03:3981822 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 252 808
Gm03:3982138 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 253 809
Gm03:3982678 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 254 810
Gm03:3984554 C 114:0, 0:4 1.000, 0.000 118 1.73E-27 255 811
Gm03:3986094 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 256 812
Gm03:3987393 C 114:0, 0:4 1.000, 0.000 118 1.73E-27 257 813
Gm03:3990954 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 258 814
Gm03:3992071 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 259 815
Gm03:3995556 C 112:0, 0:18 1.000, 0.000 130 4.10E-30 260 816
Gm03:3996269 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 261 817
Gm03:3996600 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 262 818
Gm03:3997028 C 114:0, 0:16 1.000, 0.000 130 4.10E-30 263 819
Gm03:3998157 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 264 820
Gm03:3998162 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 265 821
Gm03:3998381 T 112:0, 0:18 1.000, 0.000 130 4.10E-30 266 822
Gm03:3998421 T 110:0, 0:18 1.000, 0.000 128 1.12E-29 267 823
Gm03:3999241 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 268 824
Gm03:3999386 C 114:0, 0:16 1.000, 0.000 130 4.10E-30 269 825
Gm03:3999666 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 270 826
Gm03:4000684 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 1355 1356
Gm03:4001327 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 271 827
Gm03:4001783 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 272 828
Gm03:4002016 C 112:0, 0:12 1.000, 0.000 124 8.42E-29 273 829
Gm03:4005770 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 274 830
Gm03:4008187 G 114:0, 0:16 1.000, 0.000 130 4.10E-30 275 831
Gm03:4008673 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 276 832
Gm03:4008687 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 277 833
Gm03:4010191 C 114:0, 0:16 1.000, 0.000 130 4.10E-30 278 834
Gm03:4018588 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 279 835
Gm03:4019384 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 280 836
Gm03:4019896 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 281 837
Gm03:4020751 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 282 838
Gm03:4021281 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 283 839
Gm03:4021291 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 284 840
Gm03:4022234 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 285 841
Gm03:4022275 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 286 842
Gm03:4022530 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 287 843 Gm03:4022872 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 288 844
Gm03:4022934 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 289 845
Gm03:4023283 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 290 846
Gm03:4023522 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 291 847
Gm03:4024184 C 114:0, 0:16 1.000, 0.000 130 4.10E-30 292 848
Gm03:4024294 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 293 849
Gm03:4024485 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 294 850
Gm03:4024630 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 295 851
Gm03:4024844 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 296 852
Gm03:4025056 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 297 853
Gm03:4026652 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 298 854
Gm03:4028481 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 299 855
Gm03:4028849 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 300 856
Gm03:4028961 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 301 857
Gm03:4029068 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 302 858
Gm03:4029809 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 303 859
Gm03:4031277 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 304 860
Gm03:4031983 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 305 861
Gm03:4031997 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 306 862
Gm03:4032705 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 307 863
Gm03:4035600 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 308 864
Gm03:4035918 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 1357 1358
Gm03:4036376 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 309 865
Gm03:4040874 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 310 866
Gm03:4041301 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 311 867
Gm03:4041795 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 312 868
Gm03:4042572 G 114:0, 0:18 1.000, 0.000 132 1.50E-30 313 869
Gm03:4042679 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 314 870
Gm03:4042697 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 315 871
Gm03:4043007 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 316 872
Gm03:4043140 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 317 873
Gm03:4043823 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 318 874
Gm03:4043978 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 319 875
Gm03:4044534 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 320 876
Gm03:4044555 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 321 877
Gm03:4044972 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 322 878
Gm03:4045630 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 323 879
Gm03:4046313 C 114:0, 0:18 1.000, 0.000 132 1.50E-30 324 880 Gm03:4049555 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 325 881
Gm03:4049791 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 326 882
Gm03:4049877 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 327 883
Gm03:4050197 A 112:0, 0:16 1.000, 0.000 128 1.12E-29 328 884
Gm03:4053685 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 329 885
Gm03:4053838 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 330 886
Gm03:4054927 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 331 887
Gm03:4055100 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 332 888
Gm03:4055384 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 333 889
Gm03:4055427 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 334 890
Gm03:4055483 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 1359 1360
Gm03:4062751 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 335 891
Gm03:4062885 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 1361 1362
Gm03:4064351 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 336 892
Gm03:4064592 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 337 893
Gm03:4064759 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 338 894
Gm03:4064811 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 339 895
Gm03:4064957 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 340 896
Gm03:4065083 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 341 897
Gm03:4066234 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 342 898
Gm03:4066331 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 343 899
Gm03:4067099 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 344 900
Gm03:4067514 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 345 901
Gm03:4069037 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 346 902
Gm03:4069603 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 347 903
Gm03:4070422 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 348 904
Gm03:4072567 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 349 905
Gm03:4074190 T 112:0, 0:10 1.000, 0.000 122 2.31E-28 350 906
Gm03:4075232 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 351 907
Gm03:4076404 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 352 908
Gm03:4078299 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 353 909
Gm03:4078902 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 354 910
Gm03:4080136 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 355 911
Gm03:4081056 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 356 912
Gm03:4081889 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 357 913
Gm03:4082200 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 358 914
Gm03:4082590 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 359 915
Gm03:4082701 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 360 916 Gm03:4082781 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 361 917
Gm03:4082871 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 362 918
Gm03:4083114 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 363 919
Gm03:4084001 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 364 920
Gm03:4084095 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 365 921
Gm03:4085042 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 366 922
Gm03:4085524 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 367 923
Gm03:4086286 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 368 924
Gm03:4086887 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 369 925
Gm03:4087383 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 370 926
Gm03:4088310 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 371 927
Gm03:4090188 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 372 928
Gm03:4092799 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 373 929
Gm03:4092928 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 374 930
Gm03:4093195 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 375 931
Gm03:4093240 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 376 932
Gm03:4097291 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 377 933
Gm03:4097563 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 378 934
Gm03:4097729 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 379 935
Gm03:4098328 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 380 936
Gm03:4100831 A 114:0, 0:6 1.000, 0.000 120 6.33E-28 1363 1364
Gm03:4101257 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 381 937
Gm03:4103342 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 382 938
Gm03:4103449 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 383 939
Gm03:4103450 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 384 940
Gm03:4103515 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 385 941
Gm03:4103547 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 386 942
Gm03:4103633 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 387 943
Gm03:4104502 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 388 944
Gm03:4106406 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 389 945
Gm03:4109228 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 390 946
Gm03:4110012 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 391 947
Gm03:4110449 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 392 948
Gm03:4110821 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 393 949
Gm03:4111538 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 394 950
Gm03:4113757 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 395 951
Gm03:4116726 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 396 952
Gm03:4117330 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 397 953 Gm03:4117375 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 398 954
Gm03:4117779 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 399 955
Gm03:4117890 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 400 956
Gm03:4117986 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 401 957
Gm03:4120433 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 402 958
Gm03:4120705 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 403 959
Gm03:4122180 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 404 960
Gm03:4129251 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 405 961
Gm03:4129479 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 406 962
Gm03:4129635 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 407 963
Gm03:4130393 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 408 964
Gm03:4131257 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 409 965
Gm03:4132032 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 410 966
Gm03:4132192 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 411 967
Gm03:4133520 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 412 968
Gm03:4134606 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 413 969
Gm03:4134679 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 414 970
Gm03:4136487 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 415 971
Gm03:4136724 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 416 972
Gm03:4136742 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 417 973
Gm03:4136791 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 418 974
Gm03:4136972 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 419 975
Gm03:4137137 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 420 976
Gm03:4137521 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 421 977
Gm03:4137540 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 422 978
Gm03:4137645 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 423 979
Gm03:4138435 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 424 980
Gm03:4138980 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 425 981
Gm03:4139156 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 426 982
Gm03:4139395 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 1365 1366
Gm03:4140035 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 427 983
Gm03:4140071 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 428 984
Gm03:4140976 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 429 985
Gm03:4141074 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 430 986
Gm03:4141090 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 431 987
Gm03:4141251 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 432 988
Gm03:4141363 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 433 989
Gm03:4141488 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 434 990 Gm03:4142353 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 435 991
Gm03:4142380 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 436 992
Gm03:4142693 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 437 993
Gm03:4142800 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 438 994
Gm03:4142810 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 439 995
Gm03:4143060 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 440 996
Gm03:4143112 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 441 997
Gm03:4143113 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 442 998
Gm03:4144137 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 443 999
Gm03:4144350 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 444 1000
Gm03:4144639 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 445 1001
Gm03:4145737 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 446 1002
Gm03:4145959 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 447 1003
Gm03:4145974 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 448 1004
Gm03:4146284 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 449 1005
Gm03:4147289 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 450 1006
Gm03:4147425 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 451 1007
Gm03:4148248 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 452 1008
Gm03:4148643 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 453 1009
Gm03:4148732 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 454 1010
Gm03:4149880 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 1367 1368
Gm03:4149919 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 455 1011
Gm03:4150189 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 456 1012
Gm03:4150330 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 457 1013
Gm03:4151366 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 458 1014
Gm03:4152106 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 459 1015
Gm03:4153221 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 460 1016
Gm03:4153413 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 461 1017
Gm03:4153505 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 462 1018
Gm03:4153885 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 463 1019
Gm03:4154059 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 464 1020
Gm03:4156891 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 465 1021
Gm03:4158622 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 466 1022
Gm03:4159661 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 467 1023
Gm03:4160698 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 468 1024
Gm03:4162268 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 469 1025
Gm03:4163423 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 470 1026
Gm03:4164061 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 471 1027 Gm03:4164065 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 472 1028
Gm03:4164142 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 473 1029
Gm03:4164401 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 474 1030
Gm03:4164507 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 475 1031
Gm03:4164719 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 476 1032
Gm03:4164807 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 477 1033
Gm03:4166307 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 478 1034
Gm03:4166432 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 479 1035
Gm03:4167439 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 480 1036
Gm03:4167591 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 481 1037
Gm03:4167701 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 482 1038
Gm03:4168907 T 112:0, 0:12 1.000, 0.000 124 8.42E-29 483 1039
Gm03:4169729 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 484 1040
Gm03:4169784 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 485 1041
Gm03:4169863 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 1369 1370
Gm03:4169950 T 114:0, 0:4 1.000, 0.000 118 1.73E-27 486 1042
Gm03:4169995 G 112:0, 0:6 1.000, 0.000 118 1.73E-27 487 1043
Gm03:4171393 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 488 1044
Gm03:4171766 A 112:0, 0:10 1.000, 0.000 122 2.31E-28 1371 1372
Gm03:4172171 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 489 1045
Gm03:4173195 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 490 1046
Gm03:4173316 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 491 1047
Gm03:4173405 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 492 1048
Gm03:4173524 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 493 1049
Gm03:4175127 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 494 1050
Gm03:4177056 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 495 1051
Gm03:4177689 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 496 1052
Gm03:4177690 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 497 1053
Gm03:4178958 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 498 1054
Gm03:4179972 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 499 1055
Gm03:4180458 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 500 1056
Gm03:4182337 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 501 1057
Gm03:4184380 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 502 1058
Gm03:4184951 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 503 1059
Gm03:4184971 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 504 1060
Gm03:4185234 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 505 1061
Gm03:4185400 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 506 1062
Gm03:4185863 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 507 1063 Gm03:4187256 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 508 1064
Gm03:4188732 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 509 1065
Gm03:4189845 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 510 1066
Gm03:4189964 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 511 1067
Gm03:4190679 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 512 1068
Gm03:4191313 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 513 1069
Gm03:4191519 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 514 1070
Gm03:4192359 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 515 1071
Gm03:4192478 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 516 1072
Gm03:4192513 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 517 1073
Gm03:4192621 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 518 1074
Gm03:4192738 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 519 1075
Gm03:4193009 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 520 1076
Gm03:4193030 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 1373 1374
Gm03:4193039 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 521 1077
Gm03:4193483 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 522 1078
Gm03:4196188 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 523 1079
Gm03:4196542 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 524 1080
Gm03:4197697 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 1375 1376
Gm03:4197774 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 525 1081
Gm03:4198285 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 526 1082
Gm03:4198508 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 527 1083
Gm03:4198711 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 528 1084
Gm03:4198914 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 529 1085
Gm03:4199748 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 530 1086
Gm03:4200094 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 531 1087
Gm03:4203253 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 532 1088
Gm03:4203462 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 533 1089
Gm03:4203594 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 534 1090
Gm03:4203626 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 535 1091
Gm03:4204747 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 536 1092
Gm03:4204867 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 537 1093
Gm03:4205828 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 538 1094
Gm03:4205953 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 539 1095
Gm03:4206870 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 540 1096
Gm03:4207703 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 541 1097
Gm03:4215115 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 542 1098
Gm03:4215690 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 543 1099 Gm03:4215950 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 544 1100
Gm03:4217736 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 545 1101
Gm03:4218032 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 546 1102
Gm03:4218527 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 547 1103
Gm03:4218716 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 548 1104
Gm03:4218990 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 549 1105
Gm03:4219539 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 550 1106
Gm03:4219667 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 551 1107
Gm03:4221288 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 552 1108
Gm03:4222312 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 553 1109
Gm03:4223122 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 554 1110
Gm03:4223821 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 555 1111
Gm03:4224501 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 556 1112
Gm03:4225137 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 557 1113
Gm03:4225960 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 558 1114
Gm03:4226471 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 559 1115
Gm03:4227488 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 560 1116
Gm03:4228931 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 561 1117
Gm03:4229006 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 562 1118
Gm03:4229247 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 563 1119
Gm03:4230412 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 564 1120
Gm03:4230665 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 565 1121
Gm03:4230768 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 566 1122
Gm03:4231904 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 567 1123
Gm03:4231979 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 568 1124
Gm03:4233068 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 569 1125
Gm03:4233431 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 570 1126
Gm03:4233493 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 571 1127
Gm03:4233550 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 572 1128
Gm03:4234109 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 573 1129
Gm03:4234194 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 574 1130
Gm03:4234277 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 575 1131
Gm03:4234310 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 576 1132
Gm03:4235089 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 577 1133
Gm03:4235183 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 578 1134
Gm03:4235519 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 579 1135
Gm03:4235634 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 580 1136
Gm03:4235844 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 581 1137 Gm03:4236123 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 582 1138
Gm03:4236298 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 583 1139
Gm03:4239026 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 584 1140
Gm03:4242434 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 585 1141
Gm03:4243529 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 586 1142
Gm03:4244201 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 587 1143
Gm03:4244338 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 588 1144
Gm03:4244497 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 589 1145
Gm03:4245348 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 590 1146
Gm03:4245390 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 591 1147
Gm03:4245678 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 592 1148
Gm03:4246770 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 593 1149
Gm03:4246837 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 594 1150
Gm03:4247592 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 595 1151
Gm03:4247726 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 596 1152
Gm03:4252413 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 597 1153
Gm03:4252569 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 598 1154
Gm03:4252894 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 599 1155
Gm03:4252928 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 600 1156
Gm03:4253518 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 601 1157
Gm03:4257596 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 1377 1378
Gm03:4257995 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 602 1158
Gm03:4258161 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 603 1159
Gm03:4258545 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 604 1160
Gm03:4260785 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 605 1161
Gm03:4260901 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 606 1162
Gm03:4261372 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 607 1163
Gm03:4261626 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 608 1164
Gm03:4262516 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 609 1165
Gm03:4262869 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 610 1166
Gm03:4263876 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 611 1167
Gm03:4264709 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 612 1168
Gm03:4265916 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 613 1169
Gm03:4266927 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 614 1170
Gm03:4267296 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 615 1171
Gm03:4268640 C 114:0, 0:14 1.000, 0.000 128 1.12E-29 616 1172
Gm03:4268852 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 617 1173
Gm03:4295832 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 618 1174 Gm03:4302907 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 619 1175
Gm03:4302936 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 620 1176
Gm03:4306709 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 621 1177
Gm03:4307835 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 622 1178
Gm03:4307996 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 623 1179
Gm03:4308161 T 114:0, 0:8 1.000, 0.000 122 2.31E-28 624 1180
Gm03:4308286 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 625 1181
Gm03:4308323 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 626 1182
Gm03:4308522 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 627 1183
Gm03:4313900 C 114:0, 0:14 1.000, 0.000 128 1.12E-29 628 1184
Gm03:4314212 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 629 1185
Gm03:4314464 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 630 1186
Gm03:4315256 A 114:0, 0:6 1.000, 0.000 120 6.33E-28 631 1187
Gm03:4317574 G 114:0, 0:16 1.000, 0.000 130 4.10E-30 632 1188
Gm03:4318530 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 633 1189
Gm03:4319271 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 634 1190
Gm03:4320841 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 635 1191
Gm03:4321243 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 636 1192
Gm03:4321515 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 637 1193
Gm03:4328502 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 638 1194
Gm03:4329219 C 112:0, 0:6 1.000, 0.000 118 1.73E-27 639 1195
Gm03:4329504 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 640 1196
Gm03:4330121 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 641 1197
Gm03:4330318 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 642 1198
Gm03:4331246 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 643 1199
Gm03:4331889 A 110:0, 0:12 1.000, 0.000 122 2.31E-28 644 1200
Gm03:4337173 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 645 1201
Gm03:4338377 G 112:0, 0:6 1.000, 0.000 118 1.73E-27 646 1202
Gm03:4338505 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 647 1203
Gm03:4338559 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 648 1204
Gm03:4339885 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 649 1205
Gm03:4341064 A 112:0, 0:14 1.000, 0.000 126 3.07E-29 650 1206
Gm03:4342692 T 110:0, 0:8 1.000, 0.000 118 1.73E-27 651 1207
Gm03:4342727 A 112:0, 0:12 1.000, 0.000 124 8.42E-29 652 1208
Gm03:4343201 A 112:0, 0:12 1.000, 0.000 124 8.42E-29 653 1209
Gm03:4343212 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 654 1210
Gm03:4348211 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 655 1211
Gm03:4350556 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 656 1212 Gm03:4350658 A 110:0, 0:10 1.000, 0.000 120 6.33E-28 657 1213
Gm03:4350767 G 114:0, 0:10 1.000, 0.000 124 8.42E-29 658 1214
Gm03:4351326 T 110:0, 0:10 1.000, 0.000 120 6.33E-28 659 1215
Gm03:4351612 T 112:0, 0:12 1.000, 0.000 124 8.42E-29 660 1216
Gm03:4351617 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 661 1217
Gm03:4351674 A 114:0, 0:6 1.000, 0.000 120 6.33E-28 662 1218
Gm03:4352353 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 663 1219
Gm03:4353932 T 112:0, 0:8 1.000, 0.000 120 6.33E-28 664 1220
Gm03:4354036 C 112:0, 0:6 1.000, 0.000 118 1.73E-27 665 1221
Gm03:4355046 C 112:0, 0:8 1.000, 0.000 120 6.33E-28 666 1222
Gm03:4362911 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 667 1223
Gm03:4363385 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 668 1224
Gm03:4363855 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 669 1225
Gm03:4364133 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 670 1226
Gm03:4364176 G 114:0, 0:18 1.000, 0.000 132 1.50E-30 671 1227
Gm03:4364200 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 672 1228
Gm03:4364469 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 673 1229
Gm03:4385480 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 674 1230
Gm03:4385781 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 675 1231
Gm03:4386327 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 676 1232
Gm03:4386398 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 677 1233
Gm03:4386633 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 678 1234
Gm03:4386927 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 679 1235
Gm03:4387264 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 680 1236
Gm03:4388736 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 681 1237
Gm03:4388954 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 682 1238
Gm03:4388982 A 114:0, 0:16 1.000, 0.000 130 4.10E-30 683 1239
Gm03:4389208 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 684 1240
Gm03:4389211 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 685 1241
Gm03:4389280 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 686 1242
Gm03:4389696 T 114:0, 0:12 1.000, 0.000 126 3.07E-29 687 1243
Gm03:4390074 G 114:0, 0:4 1.000, 0.000 118 1.73E-27 1379 1380
Gm03:4390738 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 688 1244
Gm03:4390827 C 114:0, 0:8 1.000, 0.000 122 2.31E-28 689 1245
Gm03:4390979 C 114:0, 0:4 1.000, 0.000 118 1.73E-27 690 1246
Gm03:4392217 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 1381 1382
Gm03:4392314 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 691 1247
Gm03:4392891 G 114:0, 0:12 1.000, 0.000 126 3.07E-29 692 1248 Gm03:4392913 G 114:0, 0:8 1.000, 0.000 122 2.31E-28 693 1249
Gm03:4394477 C 114:0, 0:12 1.000, 0.000 126 3.07E-29 1383 1384
Gm03:4394831 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 694 1250
Gm03:4395386 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 695 1251
Gm03:4395962 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 696 1252
Gm03:4397872 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 697 1253
Gm03:4398299 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 698 1254
Gm03:4398919 T 114:0, 0:6 1.000, 0.000 120 6.33E-28 699 1255
Gm03:4399399 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 700 1256
Gm03:4400461 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 701 1257
Gm03:4404444 C 114:0, 0:14 1.000, 0.000 128 1.12E-29 702 1258
Gm03:4410393 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 703 1259
Gm03:4410565 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 704 1260
Gm03:4411187 T 114:0, 0:10 1.000, 0.000 124 8.42E-29 705 1261
Gm03:4412149 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 706 1262
Gm03:4412417 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 707 1263
Gm03:4412774 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 708 1264
Gm03:4413415 C 114:0, 0:10 1.000, 0.000 124 8.42E-29 709 1265
Gm03:4446891 T 112:0, 0:6 1.000, 0.000 118 1.73E-27 710 1266
Gm03:4447988 A 112:0, 0:6 1.000, 0.000 118 1.73E-27 711 1267
Gm03:4448825 C 114:0, 0:6 1.000, 0.000 120 6.33E-28 712 1268
Gm03:4449634 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 713 1269
Gm03:4449956 T 112:0, 0:18 1.000, 0.000 130 4.10E-30 714 1270
Gm03:4450328 C 114:0, 0:6 1.000, 0.000 120 6.33E-28 715 1271
Gm03:4450331 G 114:0, 0:6 1.000, 0.000 120 6.33E-28 716 1272
Gm03:4450888 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 717 1273
Gm03:4451295 A 114:0, 0:14 1.000, 0.000 128 1.12E-29 1385 1386
Gm03:4451491 A 114:0, 0:8 1.000, 0.000 122 2.31E-28 718 1274
Gm03:4451503 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 719 1275
Gm03:4451847 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 1387 1388
Gm03:4452060 A 114:0, 0:12 1.000, 0.000 126 3.07E-29 720 1276
Gm03:4452118 A 114:0, 0:10 1.000, 0.000 124 8.42E-29 721 1277
Gm03:4452820 T 114:0, 0:14 1.000, 0.000 128 1.12E-29 1389 1390
Gm03:4456305 T 114:0, 0:16 1.000, 0.000 130 4.10E-30 722 1278
Gm03:4458273 G 114:0, 0:18 1.000, 0.000 132 1.50E-30 723 1279
Gm03:4458399 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 724 1280
Gm03:4461465 T 114:0, 0:18 1.000, 0.000 132 1.50E-30 725 1281
Gm03:4462225 A 114:0, 0:18 1.000, 0.000 132 1.50E-30 726 1282 Gm03:4471412 T 1 12:0, 0:8 1.000, 0.000 120 6.33E-28 1391 1392
Gm03:4474352 A 1 12:0, 0:8 1.000, 0.000 120 6.33E-28 1393 1394
Gm03:4477946 A 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 727 1283
Gm03:4477947 C 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 728 1284
Gm03:4478247 C 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 729 1285
Gm03:4478479 G 1 12:0, 0:8 1.000, 0.000 120 6.33E-28 730 1286
Gm03:4478554 A 1 12:0, 0: 10 1.000, 0.000 122 2.31E-28 731 1287
Gm03:4478921 A 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 732 1288
Gm03:4479127 T 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 733 1289
Gm03:4506056 A 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 734 1290
Gm03:4506139 A 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 735 1291
Gm03:4506147 T 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 736 1292
Gm03:4507198 A 1 12:0, 0:8 1.000, 0.000 120 6.33E-28 737 1293
Gm03:4525141 A 1 12:0, 0: 16 1.000, 0.000 128 1.12E-29 738 1294
Gm03:4525736 C 1 12:0, 0: 14 1.000, 0.000 126 3.07E-29 739 1295
Gm03:4526278 C 1 10:0, 0: 14 1.000, 0.000 124 8.42E-29 740 1296
Gm03:4526393 C 1 12:0, 0: 16 1.000, 0.000 128 1.12E-29 741 1297
Gm03:4526446 G 1 12:0, 0: 16 1.000, 0.000 128 1.12E-29 742 1298
Gm03:4527054 A 1 12:0, 0: 16 1.000, 0.000 128 1.12E-29 743 1299
Gm03:4533559 A 1 12:0, 0: 14 1.000, 0.000 126 3.07E-29 744 1300
Gm03:4539866 A 1 12:0, 0: 12 1.000, 0.000 124 8.42E-29 745 1301
Gm03:4541294 A 1 12:0, 0:6 1.000, 0.000 1 18 1.73E-27 746 1302
Example 2: Marker Loci Associated With Phvtophthora Tolerance - Rps2 Locus
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps2 locus on linkage group J (ch 16). Markers were screened against various known resistant and susceptible parents.
Markers to loci S06862, S06863, S06864, S06865, SI 1652-1 and SI 1682-1 were developed and validated for their ability to identify the allele(s) associated with resistance at Rps2, for example alleles derived from resistant line L76-1988. Marker S06862 appeared to be within a region which is deleted in some lines, and did not amplify in several geneotypes. Therefore, genomic regions outside of the apparent deletion were targeted for marker development by sequencing 1588 regions in 25 soybean lines to develop a SNP profile. Markers to SI 1652 and SI 1682 were made based on the SNP profile and were screened and verified in known resistant and susceptible varieties.
Further development and testing was done to optimize markers to these for high throughput analysis of soybean.
An F2 mapping population derived from a cross of L76-1988 X susceptible consisting 256 individuals was used to fine map QTL for Rps2 on LG-J. A total of 9 polymorphic markers were utilized to construct the linkage group and perform QTL analysis. Three Rps2 phenotypic data sets were used: Score 1, Score 2, and an average score. Phenotypic distributions of all 3 datasets were consistent. A major QTL was detected on all the three data sets. The QTL was closely linked with marker SI 1652-1-Ql and flanked by markers to form an interval which explained -69% of phenotypic variation (averaged score).
Initial Map Manager Parameters were set to:
1) Linkage Evaluation: Intercross
2) Search Criteria: P = le"5
3) Map Function: Kosambi
4) Cross Type: Line Cross
The permutation test simulation was done for each score established significance boundaries in order to identify QTLs as follows:
Figure imgf000109_0001
Markers SI 1652-1-Ql, S0683-1-Q1, and SI 1682-1-Ql on LG J were identified as highly significant using Map ManagerQTX (Manly et al. (2001) Mammalian Genome 12:930-932) marker regression analysis of each of the 3 phenotypic datasets. Each had a p value of 0.00000, a % values from 56-68%, and stat values from 152.2 - 242.7 across the 3 regressions.
Example 3 : Marker Loci Associated With Phvtophthora Tolerance In Rps3 Loci
Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps3 locus on linkage group F (ch 13). Markers were screened against various known resistant and susceptible varieties. A marker to loci S07361-1, S08342-1, S09081-1 was developed to identify alleles associated with the phytophthora phenotype. Markers to S08342-1, S09081-1 detect res/sus polymorphisms for Rps3a, and markers to S07361-1 detect res/sus
polymorphisms for Rps3c. During development, each marker was validated and confirmed against a panel of about 30 resistant and susceptible varieties which included proprietary experimental lines, proprietary commercial lines, and public lines . Further development and testing was done to optimize each marker system for high throughput analysis of soybean.
An F2:3 population 95Y40xExpSUS, segregating for phytophthora root rot response, was used for Rps3c marker refinement. Parental line 95Y40 carries both the Rps3c and Rpslk phytophthora resistance alleles, ExpSUS is a proprietary experimental line susceptible to Phytophthora. No significant QTLs were detected in this study. One suggestive QTL was found on each chromosome F_(13) and chromosome N_(3), however there was no significant association between the resistant phenotype and the Rps3c (S07163-1-Q3) and Rpslk (S00009-01-A) MAS markers located on the chromosomes, respectively.
The F2:3 population consisted of 90 progeny. Genomic DNA was extracted using a standard CTAB method and used for genotyping. Eight polymorphic markers were selected from LG-F, as well as 6 polymorphic markers selected from LG-N flanking and including the MAS markers S07163-1-Q1 and S00009-01-A and used to genotype the population. Phenotypic scores categorized the progeny as Resistant, Susceptible, and Heterozygous. The classes were assigned numbers 9, 1, and 5, respectively for QTL analysis. Map Manager QTX.b20 was used to construct the linkage map with the following parameters:
1) Linkage Evaluation: Intercross
2) Search Criteria: P = le"5
3) Map Function: Kosambi
4) Cross Type: Line Cross
Marker regression (p=.001) and interval mapping were executed using Map Manager QTX.b20 and the results were confirmed using single marker analysis and composite interval mapping in QTL Cartographer 2.5. A permutation test was run in Map Manager 1000 times (free model), and in QTL Cartographer 500 times (p=0.5) to establish the threshold for statistical significance. Preliminary analysis indicated all 14 markers showed severe segregation distortion (chi square test statistic p=.001) using the expected F2 segregation ratios. Instead, the observed genotypic ratios fit an F3 model well. In addition, three progeny matched parental calls across all 14 markers and were removed from subsequent analysis. The allele calls were converted to the A (maternal), B
(paternal), H (heterozygous) convention for mapping analysis.
The phenotypic distribution of the 87 progeny employed in this analysis was evaluated using both percent dead scores, and the distribution after grouping into classes. In each case, the distributions were essentially normal. The resistant parent's average phenotypic score was 66% dead, placing the value near the mid-point of the population phenotypic distribution rather than the tail.
In the mapping analysis markers formed two linkage groups on LG F and LG N, with one marker remaining unlinked. Marker regression (Map Manager) and single marker analysis (QTL Cartographer) were performed, each indicating two suggestive regions of interest, a region on LG F comprising S07163-1-Q3, and a region on LG N comprising S00009-01-A. Neither reached the LRS cutoff for significance in this study.
Example 4: Marker Loci Associated With Phvtophthora Tolerance In the Rps6 Locus Markers were developed to characterize, identify, and/or select resistant or susceptible alleles at the Rps6 locus on linkage group G (ch 18). Markers were screened against various known resistant and susceptible parents.
A marker to locus S08442 was developed to identify alleles associated with the phytophthora phenotype. Sequencing was done to develop a SNP profile for marker development. During development, this marker was validated against Phytophthora resistant line Archer, and a susceptible line. The marker was further validated and confirmed against a panel of about 30 varieties which included proprietary experimental lines, proprietary commercial lines, and public lines. This marker was additionally used to fingerprint approximately 2000 soybean lines. All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED
1. A method of identifying a first soybean plant or a first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance, wherein:
(a) the at least one marker locus comprises S08291-1, S07292-1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(b) the at least one marker locus comprises S07963-2, S07372-1,
S00009-01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N;
(c) the at least one marker locus comprises S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J;
(d) the at least one marker locus comprises S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(e) the at least one marker locus comprises S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
2. The method of claim 1, wherein at least two marker loci are detected.
3. The method of claim 2, wherein the at least two marker loci comprise a haplotype or a marker profile that is associated with said tolerance.
4. The method of claim 1, wherein the germplasm is a soybean variety.
5. The method of claim 1, wherein the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus.
I ll
6. The method of claim 5, further comprising crossing the selected first soybean plant or first soybean germplasm with a second soybean plant or second soybean germplasm.
7. The method of claim 6, wherein the second soybean plant or second soybean germplasm comprises an exotic soybean strain or an elite soybean strain.
8. The method of claim 1, wherein the detecting comprises DNA sequencing of at least one of said marker loci.
9. The method of claim 1, wherein the detecting comprises amplifying at least one of said marker loci and detecting the resulting amplified marker amplicon.
10. The method of claim 9, wherein the amplifying comprises:
a) admixing an amplification primer or amplification primer pair for each marker locus being amplified with a nucleic acid isolated from the first soybean plant or the first soybean germplasm, wherein the primer or primer pair is complementary or partially complementary to a variant or fragment of the genomic locus comprising the marker locus, and is capable of initiating DNA polymerization by a DNA polymerase using the soybean nucleic acid as a template; and
b) extending the primer or primer pair in a DNA polymerization reaction comprising a DNA polymerase and a template nucleic acid to generate at least one amplicon.
11. The method of claim 10, wherein said method comprises
(a) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,
165, 166, 167, 168, 191-1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393 or 1394; (b) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179 or 180;
(c) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185 or 186; or
(d) amplifying a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189 or 190.
12. The method of claim 10, wherein said primer or primer pair comprises
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191- 1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising
SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or complements thereof.
13. The method of claim 12, wherein said primer or primer pair comprises a nucleic acid sequence comprising
(a) a nucleic acid sequence comprising SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 1339, 1340 or variants or fragments thereof;
(b) a nucleic acid sequence comprising SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or variants or fragments thereof;
(c) a nucleic acid sequence comprising SEQ ID NOs: 79, 80, 81, 82,
83, 84, 85, 86, 87, 88, 89, 90, 91, 92 or variants or fragments thereof; or (d) a nucleic acid sequence comprising SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 or variants or fragments thereof.
14. The method of claim 13, wherein said primer pair comprises:
a) SEQ ID NO: 1 and SEQ ID NO:2, SEQ ID NO: 9 and SEQ ID
NO: 10, SEQ ID NO: 20 and SEQ ID NO:21, SEQ ID NO: 22 and SEQ ID NO: 23, SEQ ID NO: 24 and SEQ ID NO: 25, SEQ ID NO: 36 and SEQ ID NO: 37, SEQ ID NO: 38 and SEQ ID NO: 39 or SEQ ID NO: 1339 and SEQ ID NO: 1340;
(b) SEQ ID NO: 40 and SEQ ID NO: 41, SEQ ID NO: 46 and SEQ ID NO: 47, SEQ ID NO: 52 and SEQ ID NO: 53, SEQ ID NO: 58 and SEQ ID NO: 59, SEQ
ID NO: 64 and SEQ ID NO: 65 or SEQ ID NO: 75 and SEQ ID NO: 76;
(c) SEQ ID NO: 81 and SEQ ID NO: 82, SEQ ID NO: 89 and SEQ ID NO: 90 or SEQ ID NO: 91 and SEQ ID NO: 92; or
(d) SEQ ID NO: 95 and SEQ ID NO: 96 or SEQ ID NO: 101 and SEQ ID NO: 102.
15. The method of claim 10, wherein the method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified.
16. The method of claim 15, wherein said labeled nucleic acid probe comprises a nucleic acid sequence comprising:
(a) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 191- 1302, 1343, 1345, 1346, 1347, 1348, 1349, 1350, 1351, 1352, 1353, 1354, 1355, 1356, 1357, 1358, 1359, 1360, 1361, 1362, 1363, 1364, 1365, 1366, 1367, 1368, 1369, 1370, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394 or complements thereof;
(b) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 173, 174, 175, 176, 177, 178, 179, 180 or complements thereof;
(c) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 181, 182, 183, 184, 185, 186 or complements thereof; or
(d) a variant or fragment of one or more polynucleotides comprising SEQ ID NOs: 187, 188, 189, 190 or complements thereof
17. The method of claim 16, wherein the labeled nucleic acid probe comprises:
(a) a nucleic acid sequence comprising SEQ ID NOs: 105, 106, 107, 108, 109, 110, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(b) a nucleic acid sequence comprising SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(c) a nucleic acid sequence comprising SEQ ID NOs: 140, 141, 142, 143, 144, 145, 146, 147, 148 or 149; or
(d) a nucleic acid sequence comprising SEQ ID NOs: 150, 151, 152,
153 or 154.
18. An isolated polynucleotide capable of detecting a marker locus of the soybean genome comprising:
(a) S08291-1, S07292-1, S08242-1, S16592-001, S07963-2, S07372- 1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N;
(b) S06862-1, S06863-1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J;
(c) S09018-1, S08342-1, S07163-1 or a marker closely linked thereto on linkage group F; or
(d) S08442-1, S08341-1 or a marker closely linked thereto on linkage group G.
19 The isolated polynucleotide of claim 18, wherein the polynucleotide comprises
(a) a polynucleotide comprising: (i) SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 1339 or 1340;
(ii) SEQ ID NOs: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,
76, 77 or 78;
(iii) SEQ ID NOs: 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,
91 or 92; or
(iv) SEQ ID NOs: 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104;
(b) a polynucleotide comprising:
(i) SEQ ID NOs: 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 1341 or 1342;
(ii) SEQ ID NOs: 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138 or 139;
(iii) SEQ ID NOs: 140, 141, 142, 143,
144, 145, 146, 147, 148 or 149; or
(iv) SEQ ID NOs: 150, 151, 152, 153 or
154;
(c) a polynucleotide having at least 90% sequence identity to the polynucleotides set forth in parts (a) or (b); or
(d) a polynucleotide comprising at least 10 contiguous nucleotides of the polynucleotides set forth in parts (a) or (b). 20. A kit for detecting or selecting at least one soybean plant or soybean germplasm with tolerance or improved tolerance to Phytophthora infection, the kit comprising:
(a) primers or probes for detecting one or more marker loci associated with tolerance to Phytophthora infection, wherein the primers or probes are capable of detecting a marker locus, wherein:
(i) the at least one marker locus comprises S08291-1, S07292- 1, S08242-1, S16592-001 or a marker closely linked thereto on linkage group N;
(ii) the at least one marker locus comprises S07963-2, S07372- 1, S00009-01, S08013-1, any of the Rpslk marker loci in Table IB or a marker closely linked thereto on linkage group N;
(iii) the at least one marker locus comprises S06862-1, S06863- 1, S06864-1, S06865-1, SI 1652-1, SI 1682-1 or a marker closely linked thereto on linkage group J;
(iv) the at least one marker locus comprises S09018-1, S08342- 1, S07163-1 or a marker closely linked thereto on linkage group F; or
(v) the at least one marker locus comprises S08442-1, S08341- 1 or a marker closely linked thereto on linkage group G; and
(b) instructions for using the primers or probes for detecting the one or more marker loci and correlating the detected marker loci with predicted tolerance to Phytophthora infection.
PCT/US2013/076206 2012-12-20 2013-12-18 Genetic loci associated with phytophthora tolerance in soybean and methods of use Ceased WO2014100222A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
BR112015014884A BR112015014884A2 (en) 2012-12-20 2013-12-18 method to identify, isolated polynucleotide and kit
CA2894712A CA2894712C (en) 2012-12-20 2013-12-18 Genetic loci associated with phytophthora tolerance in soybean and methods of use
ZA2015/02853A ZA201502853B (en) 2012-12-20 2015-04-24 Genetic loci associated with phytophthora tolerance in soybean and methods of use

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261740262P 2012-12-20 2012-12-20
US61/740,262 2012-12-20
US13/782,013 US9493843B2 (en) 2012-12-20 2013-03-01 Genetic loci associated with Phytophthora tolerance in soybean and methods of use
US13/782,013 2013-03-01

Publications (2)

Publication Number Publication Date
WO2014100222A2 true WO2014100222A2 (en) 2014-06-26
WO2014100222A3 WO2014100222A3 (en) 2014-09-04

Family

ID=50975042

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/076206 Ceased WO2014100222A2 (en) 2012-12-20 2013-12-18 Genetic loci associated with phytophthora tolerance in soybean and methods of use

Country Status (6)

Country Link
US (2) US9493843B2 (en)
AR (1) AR094233A1 (en)
BR (1) BR112015014884A2 (en)
CA (1) CA2894712C (en)
WO (1) WO2014100222A2 (en)
ZA (1) ZA201502853B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9493843B2 (en) 2012-12-20 2016-11-15 Pioneer Hi-Bred International, Inc. Genetic loci associated with Phytophthora tolerance in soybean and methods of use
CN108366539A (en) * 2015-06-03 2018-08-03 美国陶氏益农公司 Genetic loci associated with the phytophthora root rot of soybean

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10253379B1 (en) 2016-03-04 2019-04-09 Syngenta Participations Ag Disease resistance alleles in soybean
US20220056470A1 (en) 2020-08-18 2022-02-24 Pioneer Hi-Bred International, Inc. Multiple disease resistance genes and genomic stacks thereof
CN111996282B (en) * 2020-09-18 2022-07-15 南京农业大学 A kind of SSR marker CH0211 for identifying soybean Mosaic virus SC3 resistant strain and its detection method and application
BR112023010472A2 (en) 2020-12-16 2024-02-06 Corteva Agriscience Llc COMPOSITIONS AND METHODS FOR INCREASING RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEANS

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6162967A (en) 1994-01-26 2000-12-19 Pioneer Hi-Bred International, Inc. Positional cloning of soybean cyst nematode resistance genes
US5574210A (en) 1995-06-06 1996-11-12 Zeneca Limited Gray leaf spot resistant corn and the production thereof
WO1998049887A1 (en) 1997-05-02 1998-11-12 The University Of Utah Soybean having epistatic genes affecting yield
AR017917A1 (en) 1997-12-19 2001-10-24 Jessen Holly METHOD FOR SELECTING A FIRST PLANT BY SELECTION ASSISTED BY MARKERS OF A NUCLEOTIED POLYMORPHISM, METHOD FOR DETECTING A GENETIC POLYMORPHYSMONUCLEOTIDIC IN A BIOLOGICAL SAMPLE OF A SOY PLANT, METHOD OF SEPARATION OF TWO ACID ACID, ACID
BR0310076A (en) 2002-05-10 2005-02-22 Univ Ohio State Res Found Identification of soybean having resistance to phytophthora soye
US7435873B2 (en) 2002-05-10 2008-10-14 The Ohio State University Research Foundation Identification of soybeans having resistance to Phytophthora sojae
US6953877B2 (en) 2004-01-30 2005-10-11 Pioneer Hi-Bred International Inc. Soybean variety XB04D04
AR050112A1 (en) * 2004-08-06 2006-09-27 Pioneer Hi Bred Int GENETIC LOCI ASSOCIATED WITH TOLERANCE TO PHYTOPHTHORA IN SOJA
CA3088958C (en) * 2007-04-20 2023-07-25 Monsanto Technology Llc Methods and compositions for selecting soybean plants resistant to phytophthora root rot
US9493843B2 (en) 2012-12-20 2016-11-15 Pioneer Hi-Bred International, Inc. Genetic loci associated with Phytophthora tolerance in soybean and methods of use

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9493843B2 (en) 2012-12-20 2016-11-15 Pioneer Hi-Bred International, Inc. Genetic loci associated with Phytophthora tolerance in soybean and methods of use
CN108366539A (en) * 2015-06-03 2018-08-03 美国陶氏益农公司 Genetic loci associated with the phytophthora root rot of soybean
CN108366539B (en) * 2015-06-03 2022-04-19 美国陶氏益农公司 Genetic loci associated with phytophthora root rot in soybean

Also Published As

Publication number Publication date
AR094233A1 (en) 2015-07-22
US20170022575A1 (en) 2017-01-26
CA2894712A1 (en) 2014-06-26
BR112015014884A2 (en) 2017-07-11
US9493843B2 (en) 2016-11-15
CA2894712C (en) 2022-08-16
WO2014100222A3 (en) 2014-09-04
US20140178867A1 (en) 2014-06-26
ZA201502853B (en) 2016-04-28

Similar Documents

Publication Publication Date Title
US20170022575A1 (en) Genetic loci associated with phytophthora tolerance in soybean and methods of use
WO2013188612A1 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US9994920B2 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
AU2016270918B2 (en) Genetic locus associated with phytophthora root and stem rot in soybean
US9675071B2 (en) Methods and compositions for PPO inhibitor tolerance in soybeans
AU2025226701A1 (en) Sorghum cytoplasmic male sterility markers and loci
US20160376668A1 (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
CA2903101C (en) Genetic loci associated with frogeye leaf spot resistance and brown stem rot resistance and methods of use
CA2845522C (en) Molecular markers associated with soybean root-knot nematode tolerance and methods of their use
US11357185B2 (en) Polynucleotides and kits associated with soybean iron deficiency tolerance and methods of detection and breeding
US20160272997A1 (en) Stem canker tolerant soybeans and methods of use
CA2893847C (en) Genetic loci associated with soybean cyst nematode resistance and methods of use
US20140162250A1 (en) Marker-assisted selection of tolerance to chloride salt stress
BR122023007756B1 (en) METHOD FOR IDENTIFYING A SOYBEAN PLANT OR SOYBEAN GERMPLASM THAT EXHIBITS ENHANCED RESISTANCE TO FROG&#39;S EYE LEAF SPOT OR ENHANCED RESISTANCE TO BROWN STEAM ROT (BSR)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13865196

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2894712

Country of ref document: CA

122 Ep: pct application non-entry in european phase

Ref document number: 13865196

Country of ref document: EP

Kind code of ref document: A2

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112015014884

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112015014884

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20150619