WO2014099700A1 - Uv-resistant microbes and uv-blocking microbial extract - Google Patents

Uv-resistant microbes and uv-blocking microbial extract Download PDF

Info

Publication number
WO2014099700A1
WO2014099700A1 PCT/US2013/075238 US2013075238W WO2014099700A1 WO 2014099700 A1 WO2014099700 A1 WO 2014099700A1 US 2013075238 W US2013075238 W US 2013075238W WO 2014099700 A1 WO2014099700 A1 WO 2014099700A1
Authority
WO
WIPO (PCT)
Prior art keywords
radiation
yeast
extract
composition
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/075238
Other languages
French (fr)
Inventor
Raul G. Cuero
David S. MCKAY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Texas A&M University System
Original Assignee
Texas A&M University System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Texas A&M University System filed Critical Texas A&M University System
Publication of WO2014099700A1 publication Critical patent/WO2014099700A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9728Fungi, e.g. yeasts
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20Bacteria; Substances produced thereby or obtained therefrom
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/30Microbial fungi; Substances produced thereby or obtained therefrom
    • A01N63/32Yeast
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A61Q17/04Topical preparations for affording protection against sunlight or other radiation; Topical sun tanning preparations

Definitions

  • the present disclosure relates to engineered microbes, such as bacteria and yeast, that are resistant to ultraviolet (UV) radiation damage.
  • the present disclosure also relates to UV- protective microbial extracts that may be prepared from such engineered microbes or from microbes exposed to UV radiation.
  • the disclosure further relates to methods using these microbes or extracts, such as fermentation processes and methods of protecting agricultural plants or other materials from UV radiation.
  • Exposure to U V radiation causes harmful effects in a wide variety of things, both living and non-living. For example, exposure of human skin to UV radiation can cause sever sunburn and skin cancer and exposure of beneficial microorganisms to UV radiation can kill them. UV radiation can also cause materials to degrade prematurely and thus suffer mechanical failure or otherwise become unable to serve their intended purpose.
  • UV radiation can generally be prevented to lessened through the simple step of absorbing all or a portion of UV radiaiion before it reaches the thing it may harm,
  • chemicals in sunscreen absorb a portion of the UV radiation that would normally reach die skin and. as a result, help protect the skin from sunburn and skin cancer.
  • the present disclosure relates to a composition including an extract from an Acidithiob cill s bacteria or a yeast extracted after exposure of the bacteria to IJ radiation.
  • the disclosure further relates to a method of preparing a UV-blocking composition by exposing a culture of Acidithiobacillus or yeast to UV radiation and extracting UV-blocking cellular material produced in response to the UV radiation from the A cidilhiobacillus or yeast.
  • the disclosure further relates to a method of protecting an item from UV radiation damage by extracting UV-biocking cellular material from Acidithio bacillus or yeast exposed to UV radiation and covering the item with the UV -blocking cellular material.
  • the disclosure further relates to a UV -resistant yeast cell including a plasmid comprising a nucleic acid encoding at least one of a Msn4pn, a ruvB, a heat shock protein, an alcohol dehydrogenase (ADH) protein, a NADH-cytoehrome b5 reductase 2, a NADP-specific glutamate dehydrogenase, a superoxide dismutase, a hexokinase protein, or a phosphate glycerate mutase under control of a constitutive or inducible promoter.
  • ADH alcohol dehydrogenase
  • NADH-cytoehrome b5 reductase 2 a NADP-specific glutamate dehydrogenase
  • superoxide dismutase a superoxide dismutase
  • hexokinase protein or a phosphate glycerate mutase under control of a
  • the disclosure further relates to a UV-resistant bacterial cell including a plasmid comprising a nucleic acid encoding at least one of a major outer membrane protein, a RuBi.sCO large subunit 1 or 2, a phosphoribul okinase, a Ketol-acid reductoisonierase, a pyridine nucleotide-disulfide oxoreductase, a methionine synthase, or a methyitransfer&se under control of a constitutive or inducible promoter.
  • a plasmid comprising a nucleic acid encoding at least one of a major outer membrane protein, a RuBi.sCO large subunit 1 or 2, a phosphoribul okinase, a Ketol-acid reductoisonierase, a pyridine nucleotide-disulfide oxoreductase, a methi
  • FIGURE 1 illustrates a plasmid that may be used to produce and located in a UV- resistant yeast.
  • the present disclosure relates to engineered microbes, such as bacteria and yeast, that are resistant to ultraviolet (UV) radiation damage.
  • the present disclosure also relates to UV- protective microbial extracts that may be prepared from such engineered microbes or from microbes exposed to UV radiation.
  • the disclosure further relates to methods using these microbes or extracts, such as fermentation processes and methods of protecting agricultural plants or other materials from UV radiation.
  • UV-protective microbial extracts of the present disclosure may be able to wholly or partially block the passage of UV radiation.
  • the extent to which UV-radiation is blocked may depend on a variety of factors including the microbial source, the amount of extract applied, and the formulation of the extracts.
  • the UV-protective extract may be prepared by exposing a microbe culture, such as a bacteria or yeast culture, to UV radiation, then extracting components from the culture via centrifugation.
  • the U V radiation may be of any wavelength, but in specific embodiments it may be short wave (254 nm), long wave (365 nm), or a combination of both, in one embodiment, a bacterial extract may be derived from Acidithiobacillus, particularly A. ferroxida , after exposure of bacteria culture to UV radiation, foe example for at least 72 hours, In another embodiment, a yeast extract may be derived from S. cerevisiae or other yeast after exposure of yeast culture to UV radiation, for example for at least 48 hours.
  • the extract may be prepared by cuituring an engineered UV-resistant bacteria or yeast, such s a bacteria or yeast of the type described below, then extracting components from the culture via centrifugation.
  • extracts of the present disclosure may be prepared by culturing an A cidithiobacillus, such as A, ferroxidans or by culturing S, cerevisiae or other yeast. Culture may proceed until dense, but not so dense as to trigger deleterious responses such as those triggered by lack of a food source, The culture may also not be so dense as to prevent UV radiation from reaching a substantial portion of bacteria or yeast in the culture. The culture may then be irradiated with UV radiation.
  • the culture Prior to irradiation, the culture may be transferred to one or move vessels designed to allow a substantial portion of the bacteria or yeast to be irradiated.
  • the wavelength of UV radiation may be any wavelength, hut in particular embodiments may be selected to induce a radiation response in the bacteria or yeast.
  • the length of exposure to the U V radiation may be any length from the minimal amount needed to induce a radiation response in at least some bacteria or yeast of the culture up to a Iength of time at which a substantial portion of the bacteria or yeast in the culture are fatally irradiated.
  • the bacteria or yeast may continue to be cultured for a time at least sufficient to allow some radiation response in the bacteria or yeast. If the bacteria or yeast were irradiated in a manner that causes death of a substantial portion of the bacteria or yeast, culture may cease after the majority of this bacterial or yeast death has occurred. Alternatively, if the bacteria or yeast were not. irradiated in such a manner as to cause death of a substantial portion of the bacteria or yeast, culture may continue until such time as the radiation response has ceased in a substantial portion of the bacteria or yeast.
  • Radiation response may include may include up-reguiation in a yeast of at least one of the following: a M.sn4pn, a ruvB, a heat, shock, protein, such as a heat shock protein SSB 1 , an alcohol dehydrogenase (ADH) protein, a NADH-cytochrorne b5 reductase 2, a NADP-specific glutamate dehydrogenase, a superoxide dismutase, a hexokinase protein, such as hexokinase 1 , or a phosphate glycerate muiase.
  • ADH alcohol dehydrogenase
  • NADH-cytochrorne b5 reductase 2 a NADP-specific glutamate dehydrogenase
  • superoxide dismutase a hexokinase protein, such as hexokinase 1 , or a phosphate gly
  • Radiation response may include may include up-regulation in a bacterium of at least one of the following: a major outer membrane protein, such as inajor outer membrane protein 40, a RuBisCO large subunit 1 or 2, a phosphoribulokinase, a Ketol-acid reductoi somerase, a pyridine nucleotide-disulfide oxoreductase, a methionine synthase, a hydromethyltransferase. a ribosoma! protein s2, or a methyl transferase.
  • a major outer membrane protein such as inajor outer membrane protein 40, a RuBisCO large subunit 1 or 2
  • a phosphoribulokinase such as inajor outer membrane protein 40
  • RuBisCO large subunit 1 or 2 a phosphoribulokinase
  • Ketol-acid reductoi somerase a phosphoribulokinase
  • Radiation response may additionally or alternatively include down-regulation in a yeast of at least one of die following: a protein disulfide isomerase, an alpha-glucosidase MALI 2, a methyl tetrabydropteroyi triglutamate, a fructose-bisphosphate aldolase, or a glucokinase 1.
  • Radiation response may additional iy or alternatively include down-regulation in a bacterium of at least one of the following; a Hsp 20, a eaperonin, ehaperone protein Dnak, or a Hsp 70,
  • up-regulation or down-regulation of one or more of these proteins may not be directly responsible for UV-protective properties, such that increased or decreased amounts of these proteins in the extract may have little or no effect on its UV- protective properties. Rather, up-regulation or down-regulation of one of these proteins may have downstream effects that ultimately produce a IJV -protective extract.
  • the extract may be prepared in manner able to isolate at least one UV-protective component,
  • the extract may include centrifuged bacterial components.
  • the extract may be formulated at a variety of concentrations in any acceptable carrier to allow its use for a particular purpose.
  • the extract may be formulated in an evaporable carrier, such as water or alcohol, to allow the extract to dry on the surface of the material to be protected from UV radiation.
  • the extract may be prepared by centrifuging the bacteria or yeast culture in a manner able to precipitate most proteins, then discarding the supernatant while retaining the pellet as the extract.
  • the pellet may then be used as is or dried.
  • the pelleted material may be diluted to a given concentration using any acceptable earner, such as water or alcohol.
  • the carrier may be non-denaturing.
  • the carrier may also include materials to inhibit further bacterial growth and/or protein degradation.
  • the bacteria or yeast may not be pelletized but may instead be killed, for example by lysis or exposure to lethal levels of UV radiation, and the bacterial or yeast culture medium may be used as is or in an evaporated form.
  • the bacterial or yeast culture medium may be used as is or in an evaporated form.
  • materials to inhibit further bacterial or yeast growth and/or protein degradation may also be introduced.
  • isolated proteins from the bacteria or yeast culture may be used in place of a more general extract to produce the UV-protective effect.
  • Such proteins may be isolated by further chemical extraction, Use of UV-Protective Extract
  • the extract may be applied to any material that may benefit from a reduction in UV radiation.
  • the exact formulation of the extract plus any carriers may he adjusted based on the desired use, For example, the extract may be formulated with only non-toxic components if it is to he used on a human or animal or with another microorganism, such as in a fermentation process or on an agricultural product,
  • the extract may be mixed with other substances provide UV-protective properties to the overall composition.
  • the extract may itself be covered with a further protective coating to protect, for example, against mechanical wear and damage.
  • the extract may be formulated or applied in such a manner as to block approximately 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the UV radiation that encounters the extract.
  • the extract may also be formulated to block these percentages of particular UV wavelengths, or. more generally, to block these percentages of longwave UV radiation or shortwave UV radiation.
  • Extracts according to the present disclosure may be used for a variety of purposes, These purposes include, but are not limited to die following:
  • an extract according to the present disclosure may be applied to a fruit or vegetable, such as a watermelon or a tomato, during at least a part of its growth to increase the amounts of one or more nutrients of the fruit or vegetable, such as a vitamin, mineral, or other recommended dietary component.
  • the amount of lyeopene may be increased (which may be accompanied by a decrease in carotene or other less-valuable nutrients formed by competing pathways).
  • the amount of a flavor-enhancing component, such as glucose may be increased.
  • a component beneficial to the plant may be increased. For example, an increase in glucose helps protect against water loss.
  • the extract may be applied for approximately 25%, 50%, 75%, 90% or 99% of the fruit, or vegetable's on-plant life, where the on-pUxnt. hie includes the time span from the formation of a separate body that will constitute the fruit or vegetable (excepting flowers) until the fruit or vegetable is harvested, in a specific embodiment, the extract may be first applied when the fruit or vegetable is sufficiently large to no longer be substantially protected from UV radiation by leaves, in another specific embodiment, the extract may first be applied live days, one week, or two weeks prior to harvest. This embodiment may be particularly useful with fruits or vegetables in which an increase in a nutrient or flavor-enhancing component may be obtained by protecting the fruit or vegetable from UV radiation later in its on-plant life.
  • the extract may be applied once or multiple times to each fruit or vegetable. For example, it may be applied weekly, or it may be reapplied after the fruit or vegetable is exposed to rain or after a turning process.
  • Application may be accomplished with a commercial sprayer. Application may be only- one the upper portions of the fruit or vegetable, which, are exposed to substantially greater amounts of UV radiation than lower portions of the fruit or vegetable,
  • a yeast or bacteria may be engineered to be UV-resistant by transforming or transfecting the yeast or bacteria with a nucleic acid able to express a protein up- regulated by UV-exposure or with a nucleic acid able to ultimately cause a decrease in expression of a. protein down-regulated by UV-exposure.
  • These nucleic acids may be under the control of a constitutive promoter or under control of a UV-inducible promoter.
  • the nucleic acids may be under control of UV-inducible promoter so as not to impeded the other function when UV protection is not required.
  • a yeast may be transfected with a nucleic acid encoding at least one of the following: a Msn4pn, a. ruvB, a beat shock protein, such as a heat shock protein SSB1 , an alcohol dehydrogenase (ADH) protein, a NADH-cytochrome b5 reductase 2, a NADP- specific glutamate dehydrogenase, a superoxide d smutase, a hexok ase protein, such as hexokinase L or a phosphate g!ycerate mutase.
  • ADH alcohol dehydrogenase
  • NADH-cytochrome b5 reductase 2 a NADP- specific glutamate dehydrogenase
  • a superoxide d smutase a hexok ase protein, such as hexokinase L or a phosphate g!ycerate
  • a bacterium may be transformed with a nucleic acid encoding at least one of the following: a major outer membrane protein, such as major outer membrane protein 40, a RuBisCO large subunit 1 or 2, a phosphoribulokinase, a Keiol-acid reductoisomerase. a pyridine nucleotide-disulfide oxoreduetase, a methionine synthase, or a methyltransferase.
  • UV-resistant microbes may be used in fermentation processes, such as in the production of alcohol or fuel ethanol, or in the production of chemical and pharmaceutical products, including biological drug products.
  • A. ferroxidans (ATCC 13598) was grown in ATCC liquid medium # 2039 Brown, following the ATCC recommendations.
  • ATCC liquid medium # 2039 Brown contains different ingredients including minerals salts such as Fe (II or HI), g (Tl), Zn (II), Mn (II), €a ( ⁇ ), Co (II), Cu (II), and other solutions such as Nai.3 ⁇ 4, Nitrilotriacetico acid, (NH 4 ) 2 S0 4 , A1K(S0 4 3 ⁇ 4, H3BO3, ⁇ 3 ⁇ 4 ⁇ 0 4 , The medium was prepared based on 1 liter volume. Fifty mL of A.
  • ferroxidans stock culture (1 month old) was transferred into 5 liters of ATCC liquid medium # 2039, as above described, in a 6 liter flask, Two types of media were prepared, one containing Fe (11) and the other containing Fe (III), in addition to the other ingredients, as mentioned above.
  • the flasks containing the A. ferroxidans cultures were covered with a spongy stopper, thus allowing oxygen penetration, and incubated at room temperature for 12 days.
  • A. ferroxidans cultures were transferred into OJO-sterilized glass trays (200 mL per each tray), asepticaily.
  • the trays containing the A. ferroxidans cultures were exposed to UV radiation at a short wavelength, 254 nm or a long wavelength, 365 nm for 0, 12, 24, 48, 72, 96 or 120 hours.
  • Different trays were used per different type of iron (Fe II or Fe III) and for different lengths of time, as above described. Only- two trays containing the A. ferroxidans cultures were used at a time.
  • An ultraviolet fluorescent analysis cabinet 50 cm x 50 cm x 20 cm) (Spectroline model ce-80) was used for the UV irradiation.
  • TABLE 1 indicates the effect of the short wave UV irradiation (254 nm) on growth of the bacterium A ferroxidans.
  • the results show that growth of the bacterium A ferroxidans was not significantly affected by the UV radiation, even after 48 hours of exposure.
  • the biomass of A. ferroxidans although showing an initial decrease, rebounded and was not significantly decreased as compared to the initial biomass after 24 hours of exposure to UV radiation.
  • This biphasic growth is a typical growth pattern for A. ferroxidans. When growth is slower new medium and. additional oxygen is typically requried for growth to continue.
  • the weight (mg/L) was obtained as a pellet from the bacterium.
  • the A. ferroxidans culture samples exposed to UV radiation were taken and subjected to eentrif ligation at approximately 10,000 xg (13,000 RPM) for 5 minutes at 4 °C, The centrifugal! on process was repeated three times for each sample. The supernatant was discharged and the pellet was saved to be used immediately; otherwise, the pellet was kept at -25 °C, until use,
  • the pellet was dried under vacuum in a lyophilizer at -40 °C and pulverized.
  • the pulverized pellet was mixed with sterilized de-ionized water in order to obtain different concentrations of pellet material (0.05 g/mL, 0,1 0 g/mL, 0.15 g/mL, 0.20 g/mL, and 0.25 g/mL).
  • 0,25 g mL or higher concentrations of the extract may be preferable because more extract material generally provides a greater protective effect. However, increases in protective effect may be negligible in some uses above certain concentrations. Further, smaller concentrations may be desirable in some uses, particularly if the extract has negative side-effects in that use.
  • Example 3 UV Protection Testing
  • UV radiation is know to kill prokaryolic and simple eukaryotic cells. Accordingly, a decrease in ceil death for these cells when exposed to UV radiation in the presence of a material indicates that the material is a UV protectant and blocks UV radiation.
  • Cell death tests were performed using prokaryotic cells such as Bacillus subdiis (wild type isolated from the Prairie View A& University farm), Staphylococcus aureus (ATCC 6538), Salmonella typhimur (ATCC 14(528), and eukaryote cells such as Saccharornyces cerevisiae (ATCC 66348).
  • the bacterial cells were grown in nutrient broth and/or nutrient agar plates (Difco, Detroit, MI) and the yeast ceils were grown in yeast extract nutrient broth and/or agar plates.
  • the microbial cultures were incubated at 30 °C, and used after 24 hours for bacteria and after 48 hours for yeast. Microbial cells were used during exponential growth, and their population was measured by optical density reading (O.D.) at 600 ran. Different O.D. were used (0.3. 0.5, 0,8, and 1.0), however, 0.5 was preferred because ceils were in exponential growth at this OD and not near the end of it.
  • Shortwave UV radiation is known to be more lethal to most organisms than longwave UV radiation
  • Bacterial or yeast cultures were exposed alone (control) or in mixture with the pulverized A, Jerroxidans pellet extract from Example 2 (treatment), Different concentrations of the extract (0, 150, 200, or 250 mg/ ' mL) were used, However, 250 mg/.rnL was preferred and was used to obtain the data presented in TABLES 2-4. The mixture was always well stirred in order to ensure complete mixing of the bacterial or yeast cells with the extract. In addition to control (bacteria or yeast alone), different types of extract treatments were used;
  • Salmonellas typhimurum (ATCC 14028)
  • UV- irradiated microbial dilutions 10,000 cells/mL
  • agar media nutrieni agar for bacterial cultures or yeast extract agar for yeast
  • the microbial cultures were immediately incubated at 30 °C. Microbial growth was determined and counted after 24, 48, 60, and 72 hours and after one week. Microbial growth was determined by using the standard counting of the number of colony forming units (CPU) of the UV- irradiated or non- irradiated microbial cultures.
  • CPU colony forming units
  • FIGURE 4 show the protective effect A. ferroxidans extract against UV radiation in a different yeast, C. albicans.
  • the A, ferroxidans extract gave full protection to C. albicans growing at 30 °C for 72 hours.
  • C. albicans with A. ferroxidans extract was exposed to UV radiation for 1 hour, then incubated at 30 °C for 72 hours and no UV radiation.
  • the yeast grew as much (95-100%) as the non-UV treated yeast cultures.
  • all UV-treated cultures without the protective A. ferroxidans extract showed no growth at all. This corroborates the protective effect of the A. ferroxidans extract against UV radiation in a different eukaryotic cell, C. albicans.
  • TABLE 3 Protection Against UV Radiation by A. Ferroxidans Extract in Cultures o f C,
  • TABLE 4 shows the marked protective effect of A. ferroxidans extract against UV radiation in a prokaryote cell such as Bacillus subtilis.
  • the results show great growth of the bacterium fully covering the plates in those cultures treated with the A. ferroxidans extract, as compared to those plates that were not treated and which showed no bacterial growth. All plates were exposed to UV irradiation for 1 hour and then incubated without UV radiation for 72 hours. These results indicate the efficacy of A. ferroxidans extract, in protecting bacterial ceils as well.
  • Example 4 Effects of VV Protective Agent, cm. S, Cerevisiae Stress Response Gene Expression
  • the effects of the A. ferroxidans extract to protect yeast against UV damage were further confirmed by evaluating the expression of five genes, which encode zinc finger proteins, known to be involved in chromosomes repair, after exposure to damage by different stressing factors including UV radiation.
  • the genes were expressed in S. cerevisiae (ATCC 66348).
  • the semiquantitative real time polymerase chain reaction (qRT-PCR) was used for analysis,
  • the quantity and quality of the totai RNA was determined by UV spectroscopy, using the a NanoDropTM spectrophotometer, cDNA was synthesized from total RNA with a combination of random hexamers and oligo dT and Superscript III®, cDNA was also synthesized with oligo dT only and Superscript II®, After cDNA synthesis, the RNA was digested with R ase H. SYBR green was used for real time detection of the PCR products in the 7900HT Sequence Detection System.
  • PCR amplification primers were designed for each gene of interest, as follows: S.cerevisiae gene primers (listed S to .) ) Amplicon Size dnaX-F TGGAAGCTGAAGCCGGG
  • GAPDH-F AACACCCATGACGAACATTGG (SEQ ID NO.9) 81
  • a melting curve analysis was performed by heating the samples at 95 °C for 1 5 se , and 95 a C at 1 C/min. After PGR amplification and melting curve analysis, a Ct value was calculated for each sample. The relative amount of RNA was determined comparing the Ct value of the test samples to the control sample after normalization with GAPDH. Ct values for any given sample were only used if their value fell within the standard curve for each gene. Otherwise, the assay was repeated and the test sample (i.e. cDNA) was diluted.
  • RNAeasy Mini KitTM Qiagen
  • Till ReagentTM Sigma
  • Master Pure Complete DNA and RNA Purification KitTM Epicentre Biotechnologies nc.
  • hot phenol xhlorofor.nr.isoamy! Sigma
  • RNA protectTM Qiagen
  • Frozen cellular pellets were thawed, thoroughly mixed with 2-3 volumes RNA protectTM (Qiagen) and incubated for 10 min. at 23 °C. Cells were centrifuged at 5,000 xg for 10 min at 23 °C. Supernatant was decanted and discarded. Cell pellets were resuspended in 200 ul .15 mg/mL iysozyme and 1.5 mg/mL proteinase K in 10 niM TRIS-HCI (pH 7.4) and 1 mM EDT ' A. Ceils were incubated for 1 0 min. at 23 °C, Seven hundred ,uL RLT buffer were added and mixed by vortexing. Samples were sonicated for 1 min.
  • Yeast cultures were then exposed to UV radiation for 48 hours an incubated at 28 °C, then samples were taken to determine protein expression. Samples were taken and mixed with phosphate buffer saline solution (PBS), phi 7.4 following standard procedures (Sambrook,F,, and Maniatis. 1989. Molecular cloning: A laboratory manual. 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Volume 3, appendix B. 12; Medieago AB.2009.) The mixture of yeast culture and PBS were subjected to centrifugation at 4 °C at 1 500 RPM for 5 minutes three times, and the supernatants were discarded each time.
  • PBS phosphate buffer saline solution
  • Example is: identification of Protein Expression Changes in A. ferroxidans in Response to UV Radiation
  • Rihosomal protein S2 ACK79803.1 Increased
  • HSP70 B5ENA3 j Decreased
  • Example 7 Identification of cDNA Changes in A. ferr x idaas in Response to UV Radiation
  • cDNA levels for ccbL2 ribulose bisphosphate carboxylase, large subunit 2. abbreviated RuBisCO sumunit 2
  • metE methy (transferase)
  • cD A levels for dnak chaperone protein Dnak
  • giyA serine hydromethyliransferase
  • rpsB ribosomal protein s2
  • S. Cerevisiaea were iransfected with the plasmid shown in FIGURE. 1 (3 genes), with a similar plasmid containing only HSP70, ADH, or hesokinase, or with an identical plasmid lacking the riboswitch component (3 genes -).
  • Iransfected yeast cells were grown in yeast extract agar plates at 28-30 °C, overnight. Culture solutions were made and inoculated into 250 ml yeast extract liquid media contained in a 1 liter sterile glass bowl. Thus, the initial working concentration of the yeast cells cultures were equivalent to an optical density ( ⁇ . ⁇ ) of 0.07 at 600 nrn, pH of cultures were adjusted to 4 - 4,5; the experiments were set up in triplicates.
  • yeast cultures were incubated under alternate regimes of 1 2 hours of no-UV radiation and 48 hours of UV-radiation (254 nm), and continued shake (300 RPM), a total of 60 hours incubation at 28-30 °C. incubation was completely covered and protected against any kind of light from outside. Markers of cell growth were measured and results are reported in TABLE 8. Control yeast were not iransfected.
  • An extract was prepared from an A. ferroxidans culture previously exposed to UV- radialion for 72 hours. Sans Pepins wateremelon fruits were cleaned in sterile water and dried with a paper towel. The watermelons were then coated with different concentrations of bacterial extract (0.1 , 0.2, 0.5, 0.7 and 1 %) using a small brush or by spraying until their entire surfaces were covered. Watermelons were then placed in a Percival environmentally-controlled chamber (Percival Scientific, Perry, 1A) and exposed to 254 nm or 360 urn IJ V radiation at a temperature of 27-29 °C and 85% relative humidity for two weeks. Control watermelons coated with water were also tested.
  • Percival Scientific, Perry, 1A Percival Scientific, Perry, 1A
  • Glucose, carotene, and lycopene content were determined using HPLC.
  • Example 11 Protection of Fibroblasts from UV Damage by S, Cerevisiaea Extract S, Cerevisiae cells were iransfeeied with the plasmid of FIGURE 1. Exiracis of these yeast were applied to fibroblast cultures (which are indicative of skin protection), which were then exposed to UV radiation. Fibroblast cells were then stained for indicators of apoptosis (staining method differentiates between live and dead cells) and cell numbers were counted using microscopy. Control samples were not treated or were treated with extract from non-transfected yeast. Results are presented in TABLE 12,
  • Extracts from S. Cerevisiae and A. ferroxkkins were tested to determine their solubility water and their toxicity. Results are presented in TABLE 13.
  • Water solubility may be important for various reasons depending on the use. For example, in methods where the extract is applied to a fruit or vegetable, good water solubility means that the extraet should be largely removed when the fruit or vegetable is washed, decreasing the risk of any safety hazards for consumers. Good water solubility also indicates that keeping the extract in solution and thereby benefiting from its protective effects during a fermentation process may be easier,
  • Toxicity is significant because it indicates the likelihood of any adverse effects from the extracts if they are consumed.
  • a high LD50 value indicates that more of the extract may be consimied without adverse effects.
  • the extract may be used so that the amount present on a fruit or vegetable or in portion of a fermentation product typically consumed is less than the LD5 .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Environmental Sciences (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Dermatology (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Botany (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cosmetics (AREA)

Abstract

The present disclosure relates to a composition including an extract from an Acidithiobacillus bacteria or a yeast extracted after exposure of the bacteria to UV radiation, The disclosure further relates to a method of preparing a UV-blocking composition by exposing a culture of Acidithiobacillus or yeast to UV radiation and extracting UV-blocking cellular material produced in response to the UV radiation from the Acidithiobacillus or yeast. The disclosure further relates to a method of protecting an item from UV radiation damage by extracting UV-blocking cellular material from Acidithiobacillus or yeast exposed to U V radiation and covering the item with the UV-blocking cellular material, lite disclosure further relates to a UV -resistant yeast cell and a U V-resistant bacterial cell,

Description

UV-RESISTANT MICROBES AND UV-BLOC ING MICROBIAL EXTRACT
IIAXE ENT OF GOT
Portions of the current invention were developed using US government funding provided under NASA-NAG 9-1241 and SynBERC-NSF-University of California-Berkeley- 1385638, and by the USDA under Evans-Alien-Prairie View grant 201 1-33100-8916. Accordingly, the US govermneni has certain rights in the invention. The invention described herein was also made by an employee of the United States Government and may be manufactured and used by or for the Government of the United States of America for governmental purposes without the payment of any royalties thereon or therefor.
Ί h(.:H iC/\i ;j !_ _j)
The present disclosure relates to engineered microbes, such as bacteria and yeast, that are resistant to ultraviolet (UV) radiation damage. The present disclosure also relates to UV- protective microbial extracts that may be prepared from such engineered microbes or from microbes exposed to UV radiation. The disclosure further relates to methods using these microbes or extracts, such as fermentation processes and methods of protecting agricultural plants or other materials from UV radiation.
BACKGROUND
Exposure to U V radiation causes harmful effects in a wide variety of things, both living and non-living. For example, exposure of human skin to UV radiation can cause sever sunburn and skin cancer and exposure of beneficial microorganisms to UV radiation can kill them. UV radiation can also cause materials to degrade prematurely and thus suffer mechanical failure or otherwise become unable to serve their intended purpose.
The harmful effects of UV radiation can generally be prevented to lessened through the simple step of absorbing all or a portion of UV radiaiion before it reaches the thing it may harm, For, example, chemicals in sunscreen absorb a portion of the UV radiation that would normally reach die skin and. as a result, help protect the skin from sunburn and skin cancer.
Although numerous substances able to absorb UV radiation are known, not all of them are suitable for all possible uses. Further, some substances may be expensive to produce or may have harmful side effects, such as toxicity or undesired chemical reactions with a protected material. Other substances simply do not last long enough in the environment in which they are used or last too long.
Accordingly, there is a demand for new substances able to absorb UV radiation, particularly if those substances are biocompatible,
SUMMARY
The present disclosure relates to a composition including an extract from an Acidithiob cill s bacteria or a yeast extracted after exposure of the bacteria to IJ radiation.
The disclosure further relates to a method of preparing a UV-blocking composition by exposing a culture of Acidithiobacillus or yeast to UV radiation and extracting UV-blocking cellular material produced in response to the UV radiation from the A cidilhiobacillus or yeast. The disclosure further relates to a method of protecting an item from UV radiation damage by extracting UV-biocking cellular material from Acidithio bacillus or yeast exposed to UV radiation and covering the item with the UV -blocking cellular material.
The disclosure further relates to a UV -resistant yeast cell including a plasmid comprising a nucleic acid encoding at least one of a Msn4pn, a ruvB, a heat shock protein, an alcohol dehydrogenase (ADH) protein, a NADH-cytoehrome b5 reductase 2, a NADP-specific glutamate dehydrogenase, a superoxide dismutase, a hexokinase protein, or a phosphate glycerate mutase under control of a constitutive or inducible promoter.
The disclosure further relates to a UV-resistant bacterial cell including a plasmid comprising a nucleic acid encoding at least one of a major outer membrane protein, a RuBi.sCO large subunit 1 or 2, a phosphoribul okinase, a Ketol-acid reductoisonierase, a pyridine nucleotide-disulfide oxoreductase, a methionine synthase, or a methyitransfer&se under control of a constitutive or inducible promoter.
BRi ί i :.se R s ;rios.iji- Ti A W \ N .< js
Einbodimenis of the present invention may be better understood througii reference to the following figures in which;
FIGURE 1 illustrates a plasmid that may be used to produce and located in a UV- resistant yeast.
DETAILED. E)E„SCRJiniQM
'The present disclosure relates to engineered microbes, such as bacteria and yeast, that are resistant to ultraviolet (UV) radiation damage. The present disclosure also relates to UV- protective microbial extracts that may be prepared from such engineered microbes or from microbes exposed to UV radiation. The disclosure further relates to methods using these microbes or extracts, such as fermentation processes and methods of protecting agricultural plants or other materials from UV radiation.
11 V- Protective Extracts
UV-protective microbial extracts of the present disclosure may be able to wholly or partially block the passage of UV radiation. The extent to which UV-radiation is blocked may depend on a variety of factors including the microbial source, the amount of extract applied, and the formulation of the extracts.
The UV-protective extract may be prepared by exposing a microbe culture, such as a bacteria or yeast culture, to UV radiation, then extracting components from the culture via centrifugation. 'The U V radiation may be of any wavelength, but in specific embodiments it may be short wave (254 nm), long wave (365 nm), or a combination of both, in one embodiment, a bacterial extract may be derived from Acidithiobacillus, particularly A. ferroxida , after exposure of bacteria culture to UV radiation, foe example for at least 72 hours, In another embodiment, a yeast extract may be derived from S. cerevisiae or other yeast after exposure of yeast culture to UV radiation, for example for at least 48 hours. In still another embodiment, the extract may be prepared by cuituring an engineered UV-resistant bacteria or yeast, such s a bacteria or yeast of the type described below, then extracting components from the culture via centrifugation. According to one embodiment, extracts of the present disclosure may be prepared by culturing an A cidithiobacillus, such as A, ferroxidans or by culturing S, cerevisiae or other yeast. Culture may proceed until dense, but not so dense as to trigger deleterious responses such as those triggered by lack of a food source, The culture may also not be so dense as to prevent UV radiation from reaching a substantial portion of bacteria or yeast in the culture. The culture may then be irradiated with UV radiation. Prior to irradiation, the culture may be transferred to one or move vessels designed to allow a substantial portion of the bacteria or yeast to be irradiated. The wavelength of UV radiation may be any wavelength, hut in particular embodiments may be selected to induce a radiation response in the bacteria or yeast. Similarly, the length of exposure to the U V radiation may be any length from the minimal amount needed to induce a radiation response in at least some bacteria or yeast of the culture up to a Iength of time at which a substantial portion of the bacteria or yeast in the culture are fatally irradiated.
After irradiation, the bacteria or yeast may continue to be cultured for a time at least sufficient to allow some radiation response in the bacteria or yeast. If the bacteria or yeast were irradiated in a manner that causes death of a substantial portion of the bacteria or yeast, culture may cease after the majority of this bacterial or yeast death has occurred. Alternatively, if the bacteria or yeast were not. irradiated in such a manner as to cause death of a substantial portion of the bacteria or yeast, culture may continue until such time as the radiation response has ceased in a substantial portion of the bacteria or yeast.
Radiation response may include may include up-reguiation in a yeast of at least one of the following: a M.sn4pn, a ruvB, a heat, shock, protein, such as a heat shock protein SSB 1 , an alcohol dehydrogenase (ADH) protein, a NADH-cytochrorne b5 reductase 2, a NADP-specific glutamate dehydrogenase, a superoxide dismutase, a hexokinase protein, such as hexokinase 1 , or a phosphate glycerate muiase. Radiation response may include may include up-regulation in a bacterium of at least one of the following: a major outer membrane protein, such as inajor outer membrane protein 40, a RuBisCO large subunit 1 or 2, a phosphoribulokinase, a Ketol-acid reductoi somerase, a pyridine nucleotide-disulfide oxoreductase, a methionine synthase, a hydromethyltransferase. a ribosoma! protein s2, or a methyl transferase. Radiation response may additionally or alternatively include down-regulation in a yeast of at least one of die following: a protein disulfide isomerase, an alpha-glucosidase MALI 2, a methyl tetrabydropteroyi triglutamate, a fructose-bisphosphate aldolase, or a glucokinase 1. Radiation response may additional iy or alternatively include down-regulation in a bacterium of at least one of the following; a Hsp 20, a eaperonin, ehaperone protein Dnak, or a Hsp 70,
it will be understood that up-regulation or down-regulation of one or more of these proteins may not be directly responsible for UV-protective properties, such that increased or decreased amounts of these proteins in the extract may have little or no effect on its UV- protective properties. Rather, up-regulation or down-regulation of one of these proteins may have downstream effects that ultimately produce a IJV -protective extract.
The extract may be prepared in manner able to isolate at least one UV-protective component, In particular embodiments, the extract may include centrifuged bacterial components. The extract may be formulated at a variety of concentrations in any acceptable carrier to allow its use for a particular purpose. In particular embodiments, the extract may be formulated in an evaporable carrier, such as water or alcohol, to allow the extract to dry on the surface of the material to be protected from UV radiation. in one example, the extract may be prepared by centrifuging the bacteria or yeast culture in a manner able to precipitate most proteins, then discarding the supernatant while retaining the pellet as the extract. The pellet may then be used as is or dried. The pelleted material may be diluted to a given concentration using any acceptable earner, such as water or alcohol. The carrier may be non-denaturing. The carrier may also include materials to inhibit further bacterial growth and/or protein degradation.
In an alternative example, the bacteria or yeast may not be pelletized but may instead be killed, for example by lysis or exposure to lethal levels of UV radiation, and the bacterial or yeast culture medium may be used as is or in an evaporated form. In this example materials to inhibit further bacterial or yeast growth and/or protein degradation may also be introduced.
In a further embodiment, isolated proteins from the bacteria or yeast culture may be used in place of a more general extract to produce the UV-protective effect. Such proteins may be isolated by further chemical extraction, Use of UV-Protective Extract
The extract may be applied to any material that may benefit from a reduction in UV radiation. The exact formulation of the extract plus any carriers may he adjusted based on the desired use, For example, the extract may be formulated with only non-toxic components if it is to he used on a human or animal or with another microorganism, such as in a fermentation process or on an agricultural product, The extract may be mixed with other substances provide UV-protective properties to the overall composition. Further, if coated on the material to be protected, the extract may itself be covered with a further protective coating to protect, for example, against mechanical wear and damage.
The extract may be formulated or applied in such a manner as to block approximately 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the UV radiation that encounters the extract. The extract may also be formulated to block these percentages of particular UV wavelengths, or. more generally, to block these percentages of longwave UV radiation or shortwave UV radiation.
Extracts according to the present disclosure may be used for a variety of purposes, These purposes include, but are not limited to die following:
1 ) blocking UV radiation or other types of radiation;
2) protecting human skin against damage and/or skin cancer induced by UV radiation or other t es of radiation;
3) protecting against side-effects of radiation used in cancer treatments;
4) protecting animals from deleterious effects of UV radiation or other radiation;
5) protecting plastic, glass, or other solid surfaces from UV radiation or other radiation; 6) providing a UV radiation screen or screen for other types of radiation;
7) protecting astronauts and or other persons or organisms as well as equipment during space trips;
S) enhancement of industrial fermentation processes or other processes requiring energy by allowing the use of UV radiation in connection with the process to supply additional energy and thus to increase the ultimate energ -requiring output of the ceils, such, as alcohol or a drug, without substantially killing the fermenting organism; 9) protection of experimentation, fermentation, biochemical, and/or biological processes under the presence of UV radiation, for example in extraterrestrial conditions such as on the Moon or Mars; and
10) protection of agricultural plants, particularly agricultural plants in which the revenue- producing product is located above-ground, such as fruits, vine-vegetables, beans and peas, and leaf vegetables.
In one particular embodiment, an extract according to the present disclosure, particularly an A. ferroxidans extract, may be applied to a fruit or vegetable, such as a watermelon or a tomato, during at least a part of its growth to increase the amounts of one or more nutrients of the fruit or vegetable, such as a vitamin, mineral, or other recommended dietary component. In one specific example, the amount of lyeopene may be increased (which may be accompanied by a decrease in carotene or other less-valuable nutrients formed by competing pathways). In another specific embodiment, the amount of a flavor-enhancing component, such as glucose, may be increased. In another specific embodiment, a component beneficial to the plant may be increased. For example, an increase in glucose helps protect against water loss.
The extract may be applied for approximately 25%, 50%, 75%, 90% or 99% of the fruit, or vegetable's on-plant life, where the on-pUxnt. hie includes the time span from the formation of a separate body that will constitute the fruit or vegetable (excepting flowers) until the fruit or vegetable is harvested, in a specific embodiment, the extract may be first applied when the fruit or vegetable is sufficiently large to no longer be substantially protected from UV radiation by leaves, in another specific embodiment, the extract may first be applied live days, one week, or two weeks prior to harvest. This embodiment may be particularly useful with fruits or vegetables in which an increase in a nutrient or flavor-enhancing component may be obtained by protecting the fruit or vegetable from UV radiation later in its on-plant life.
The extract, may be applied once or multiple times to each fruit or vegetable. For example, it may be applied weekly, or it may be reapplied after the fruit or vegetable is exposed to rain or after a turning process.
Application may be accomplished with a commercial sprayer. Application may be only- one the upper portions of the fruit or vegetable, which, are exposed to substantially greater amounts of UV radiation than lower portions of the fruit or vegetable,
UV-Resist nt Microbes
According to another embodiment, a yeast or bacteria, particularly a beneficial yeast or bacteria such as one used in a fermentation process, may be engineered to be UV-resistant by transforming or transfecting the yeast or bacteria with a nucleic acid able to express a protein up- regulated by UV-exposure or with a nucleic acid able to ultimately cause a decrease in expression of a. protein down-regulated by UV-exposure. These nucleic acids may be under the control of a constitutive promoter or under control of a UV-inducible promoter. Particularly in embodiments in which the yeast or bacteria needs to perform another function, such as fermentation, the nucleic acids may be under control of UV-inducible promoter so as not to impeded the other function when UV protection is not required.
In one specific embodiment, a yeast may be transfected with a nucleic acid encoding at least one of the following: a Msn4pn, a. ruvB, a beat shock protein, such as a heat shock protein SSB1 , an alcohol dehydrogenase (ADH) protein, a NADH-cytochrome b5 reductase 2, a NADP- specific glutamate dehydrogenase, a superoxide d smutase, a hexok ase protein, such as hexokinase L or a phosphate g!ycerate mutase. In another embodiment, a bacterium may be transformed with a nucleic acid encoding at least one of the following: a major outer membrane protein, such as major outer membrane protein 40, a RuBisCO large subunit 1 or 2, a phosphoribulokinase, a Keiol-acid reductoisomerase. a pyridine nucleotide-disulfide oxoreduetase, a methionine synthase, or a methyltransferase.
Methods Using UV-Resistant Microbes
UV-resistant microbes may be used in fermentation processes, such as in the production of alcohol or fuel ethanol, or in the production of chemical and pharmaceutical products, including biological drug products.
EXAMPLES
The present disclosure may be better understood through reference to the following examples, These examples are included to describe exemplary embodiments only and should not he interpreted to encompass the entire breadth of the invention.
Example 1; Bacteria Culture and UV Exposure
A. ferroxidans (ATCC 13598) was grown in ATCC liquid medium # 2039 Brown, following the ATCC recommendations. ATCC liquid medium # 2039 Brown contains different ingredients including minerals salts such as Fe (II or HI), g (Tl), Zn (II), Mn (II),€a (Π), Co (II), Cu (II), and other solutions such as Nai.¾, Nitrilotriacetico acid, (NH4)2S04, A1K(S04¾, H3BO3, Κ¾Μο04, The medium was prepared based on 1 liter volume. Fifty mL of A. ferroxidans stock culture (1 month old) was transferred into 5 liters of ATCC liquid medium # 2039, as above described, in a 6 liter flask, Two types of media were prepared, one containing Fe (11) and the other containing Fe (III), in addition to the other ingredients, as mentioned above. The flasks containing the A. ferroxidans cultures were covered with a spongy stopper, thus allowing oxygen penetration, and incubated at room temperature for 12 days.
After 12 days of incubation, two liters of A. ferroxidans cultures were transferred into OJO-sterilized glass trays (200 mL per each tray), asepticaily. The trays containing the A. ferroxidans cultures were exposed to UV radiation at a short wavelength, 254 nm or a long wavelength, 365 nm for 0, 12, 24, 48, 72, 96 or 120 hours. Different trays were used per different type of iron (Fe II or Fe III) and for different lengths of time, as above described. Only- two trays containing the A. ferroxidans cultures were used at a time. An ultraviolet fluorescent analysis cabinet (50 cm x 50 cm x 20 cm) (Spectroline model ce-80) was used for the UV irradiation.
TABLE 1 indicates the effect of the short wave UV irradiation (254 nm) on growth of the bacterium A ferroxidans. The results show that growth of the bacterium A ferroxidans was not significantly affected by the UV radiation, even after 48 hours of exposure. In fact, the biomass of A. ferroxidans, although showing an initial decrease, rebounded and was not significantly decreased as compared to the initial biomass after 24 hours of exposure to UV radiation. This biphasic growth is a typical growth pattern for A. ferroxidans. When growth is slower new medium and. additional oxygen is typically requried for growth to continue. The overall higher levels of biomass at 0.5 and 48 hours in the UV'-exposed bacteria as compared to non-U V- exposed bacteria shows that the UV light can in fact provide additional energy to the fermentation process, al lowing the bacteria to grow without the need for new medium or additional oxygen, or with less frequent addition of ne w medium or additional oxygen,
TABLE 1 : Growth of Bacterium A, Ferroxidans (ATCC 13598) Under Exposure to UV Irradiation for U To 2 Days
Figure imgf000014_0001
1 - Three different trials were carried out.
2 - A 254 nm λ UV radiation source was used.
3 - The weight (mg/L) was obtained as a pellet from the bacterium.
Example 2; Extract Preparation
After the relevant period of time for each sample, the A. ferroxidans culture samples exposed to UV radiation were taken and subjected to eentrif ligation at approximately 10,000 xg (13,000 RPM) for 5 minutes at 4 °C, The centrifugal! on process was repeated three times for each sample. The supernatant was discharged and the pellet was saved to be used immediately; otherwise, the pellet was kept at -25 °C, until use,
The pellet was dried under vacuum in a lyophilizer at -40 °C and pulverized. The pulverized pellet was mixed with sterilized de-ionized water in order to obtain different concentrations of pellet material (0.05 g/mL, 0,1 0 g/mL, 0.15 g/mL, 0.20 g/mL, and 0.25 g/mL). 0,25 g mL or higher concentrations of the extract may be preferable because more extract material generally provides a greater protective effect. However, increases in protective effect may be negligible in some uses above certain concentrations. Further, smaller concentrations may be desirable in some uses, particularly if the extract has negative side-effects in that use. Example 3; UV Protection Testing
UV radiation is know to kill prokaryolic and simple eukaryotic cells. Accordingly, a decrease in ceil death for these cells when exposed to UV radiation in the presence of a material indicates that the material is a UV protectant and blocks UV radiation. Cell death tests were performed using prokaryotic cells such as Bacillus subdiis (wild type isolated from the Prairie View A& University farm), Staphylococcus aureus (ATCC 6538), Salmonella typhimur (ATCC 14(528), and eukaryote cells such as Saccharornyces cerevisiae (ATCC 66348).
The bacterial cells were grown in nutrient broth and/or nutrient agar plates (Difco, Detroit, MI) and the yeast ceils were grown in yeast extract nutrient broth and/or agar plates. The microbial cultures were incubated at 30 °C, and used after 24 hours for bacteria and after 48 hours for yeast. Microbial cells were used during exponential growth, and their population was measured by optical density reading (O.D.) at 600 ran. Different O.D. were used (0.3. 0.5, 0,8, and 1.0), however, 0.5 was preferred because ceils were in exponential growth at this OD and not near the end of it.
From each bacterial solution, different fresh dilutions (1 , 100, 1 ,000. 10,000, and 1 ,000,000 cells/mL) were prepared, but 10,000 ceils/ml, dilution was preferred because it assured sufficient cell density, but did not reach non-exponentiai growth stages too early. Twenty ml, from each dilution were separately transferred to sterile 9 cm Petri plates. Three replicates for each bacterial or yeast dilution were exposed to shortwave (254 nm) or longwave (350 nm) UV radiation for different lengths of time (15, 30 or 60 minutes), However, bacterial or yeast exposure to shortwave UV radiation for 60 minutes was preferred because it represents harsher conditions that longwave radiation and shorter time periods. Shortwave UV radiation is known to be more lethal to most organisms than longwave UV radiation, Bacterial or yeast cultures were exposed alone (control) or in mixture with the pulverized A, Jerroxidans pellet extract from Example 2 (treatment), Different concentrations of the extract (0, 150, 200, or 250 mg/'mL) were used, However, 250 mg/.rnL was preferred and was used to obtain the data presented in TABLES 2-4. The mixture was always well stirred in order to ensure complete mixing of the bacterial or yeast cells with the extract. In addition to control (bacteria or yeast alone), different types of extract treatments were used;
1) Bacillus subtilis (wild type)
2) B. subtilis -·'- Extract of A. ferroxidans (from 4- week-old culture)
3) B. subtilis + Extract of A. ferroxidans (from 2-week-old culture)
4) Salmonellas typhimurum (ATCC 14028)
5) S. typhimurwn (ATCC 14028) + Extract of A. ferroxidans (from 4 week-old culture)
6) S. typhimurwn ATCC 14028 + Extract of A. jerroxidans (from 2 week-old culture) 7} Staphylococcus aureus (ATCC 6538)
8) S, aureus (ATCC 6538) + Extract of A. ferroxidans (from 4-week-old culture)
9) S, aureus (ATCC 6538) + Extract of A. ferroxidans (from 2 -week-old culture)
10) Saccharomyces cerevisiae (ATCC 66348)
1 1 ) 5'. cerevisiae (ATCC 66348) + Extract of A. ferroxidans (from 4 week-old culture) 12} S. cerevisiae (ATCC 66348) + Extract of A. ferroxidcms (from 2 week-old culture)
13) C. albicans
14) C. albicans + Extract of A, ferroxidcms
After exposure of the liquid microbial cultures to UV irradiation, 1 mL of the UV- irradiated microbial dilutions (10,000 cells/mL) was placed into the center of a sterile Petri dish, and agar media (nutrieni agar for bacterial cultures or yeast extract agar for yeast) was poured into the Petri dish, thus following the standard pour plates technique. Two different size of Petri dishes were used: 1) standard plain 9 em diameter, and 2) a 9 cm diameter Petri dish divided into three equal areas. A minimum of six replicates per dilution were made. The microbial cultures were immediately incubated at 30 °C. Microbial growth was determined and counted after 24, 48, 60, and 72 hours and after one week. Microbial growth was determined by using the standard counting of the number of colony forming units (CPU) of the UV- irradiated or non- irradiated microbial cultures.
The results as indicated in TABLES 2-4 clearly demonstrate the UV protection that A. ferroxidcms extract provides to S, cerevisiae, C. albicans, and B. suhtiiis. Similar results were obtained using the other organisms in the list above.
TABLE 2 shows prolific growth of 5'. cerevisiae in all the plates with yeast culture that were also previously treated with the extract of A, ferroxidcms, and exposed to U V radiation for 1 hour, and later incubated at 30 °C for 72 hours. All plates were fully covered by die yeast. n contrast, yeast cultures that were not treated with the extract of A. ferroxidans did not show substantial growth at all, thus indicating that the ceils were not protected from the UV radiation and were killed. This indicates that the extract οΐ A. ferroxidans is able to protect eukaryote cells such as yeasl cells from UV damage. Therefore, die extract of A. ferroxidans should be effective to protect other eukaryote ceils such as mammalian cells against UV radiation,
TABLE 2: Protection Against UV Radiation by A. Ferroxidans Extract in Cultures of S,
Cerevisiae
Figure imgf000018_0001
- FC ::: Agar plates fully covered by microbial growth.
2 - EAF = Extract from Acidithiohacillus ferroxidans.
3 - SAC = Sac char amy ces cerevisiae.
TABLE 3 and FIGURE 4 show the protective effect A. ferroxidans extract against UV radiation in a different yeast, C. albicans. The A, ferroxidans extract gave full protection to C. albicans growing at 30 °C for 72 hours. C. albicans with A. ferroxidans extract was exposed to UV radiation for 1 hour, then incubated at 30 °C for 72 hours and no UV radiation. The yeast grew as much (95-100%) as the non-UV treated yeast cultures. However, all UV-treated cultures without the protective A. ferroxidans extract showed no growth at all. This corroborates the protective effect of the A. ferroxidans extract against UV radiation in a different eukaryotic cell, C. albicans. TABLE 3: Protection Against UV Radiation by A. Ferroxidans Extract in Cultures o f C,
Albi ns
Figure imgf000019_0001
1 - CA = Candida albicans.
2 - EAF = Extract from Acidithiobacili s ferroxidans.
TABLE 4 shows the marked protective effect of A. ferroxidans extract against UV radiation in a prokaryote cell such as Bacillus subtilis. The results show great growth of the bacterium fully covering the plates in those cultures treated with the A. ferroxidans extract, as compared to those plates that were not treated and which showed no bacterial growth. All plates were exposed to UV irradiation for 1 hour and then incubated without UV radiation for 72 hours. These results indicate the efficacy of A. ferroxidans extract, in protecting bacterial ceils as well.
TABLE 4: Protection A ainst LJV Radiation by A. Ferroxidans Extract in Cultures ofB. Subtilis
Figure imgf000019_0003
2- BS = Bacillus si
3 - EAF :::: Extract from Acidithiobacilius ferroxidan , Example 4: Effects of VV Protective Agent, cm. S, Cerevisiae Stress Response Gene Expression The effects of the A. ferroxidans extract to protect yeast against UV damage were further confirmed by evaluating the expression of five genes, which encode zinc finger proteins, known to be involved in chromosomes repair, after exposure to damage by different stressing factors including UV radiation. The genes were expressed in S. cerevisiae (ATCC 66348). The semiquantitative real time polymerase chain reaction (qRT-PCR) was used for analysis,
S. cerevisiae previously treated with the A. ferroxidans extract were grown for 2-4 days in liquid cultures at 26-30 °C see as described above. Control cell were not treated with the A, ferroxidans extract, Two hundred niL of yeast cultures were grown in 500 ml flasks, each, under shaking conditions (350 RPM). Six replicates were used for each yeast culture. After 2-4 days incubation, cells were harvested and subjected to centrifugaiion to obtain a pellet. Fifty rnL of yeast culture sample were used in four replicates each, Cells were eentrifuged three times at 15,000 RPM, under refrigeration (4 °C) for 10 minutes three times. Cells were harvested as pellets, and the pellets were kept under freezing conditions (-80 °C) or used immediately for further analysis.
For each pellet, the quantity and quality of the totai RNA was determined by UV spectroscopy, using the a NanoDrop™ spectrophotometer, cDNA was synthesized from total RNA with a combination of random hexamers and oligo dT and Superscript III®, cDNA was also synthesized with oligo dT only and Superscript II®, After cDNA synthesis, the RNA was digested with R ase H. SYBR green was used for real time detection of the PCR products in the 7900HT Sequence Detection System.
PCR amplification primers were designed for each gene of interest, as follows: S.cerevisiae gene primers (listed S to .) ) Amplicon Size dnaX-F TGGAAGCTGAAGCCGGG
dna — R AGAAACAAGAGCAATTTTTCCCC (SEQ ID O.2)
Msn4p-F CGAAAGTGGCGACTACAGGC (SEQ ID NO.3) 1 1 1
Msn4p-R ATATTCATTTGATGATGATGGAAAGATCG (SEQ ID NO.4) recA-F TACGGATTTTTCTGGTGG (SEQ ID NO.5) 101 recA-R CTGCAACACCAAATIGGTCG (SEQ ID NO.6)
ruvB-F GCAGTTACGAGAACTGCGGC (SEQ ID NO.7) 91
ravB-R CAACAAACCCTCC1TCAACCC (SEQ ID NO.8)
GAPDH-F AACACCCATGACGAACATTGG (SEQ ID NO.9) 81
GAPDH-R CAAAAGCACATTGACGCTGG (SEQ ID NO.10)
Conditions were developed for the amplification of each target gene by RT-PCR using genomic DNA as a template. The expression level of each gene including GAPDH was determined from each sample in triplicate. A reference standard curve for each gene was generated and each point was measured in triplicate. Positive controls using genomic DNA and negative controls with cDNA synthesis reactions where the reverse transcriptase was omitted and water only were included in assays. Samples were amplified in the 7900HT Sequence Detection System at. 95 °C for 10 mm. followed by 50 cycles at 95 °C for 30 sec, 60 °C for 30 se , and 72 ':'C for 30 sec. Fluorescence measures were made at the end of each extension cycle. Following PGR amplification, a melting curve analysis was performed by heating the samples at 95 °C for 1 5 se , and 95 aC at 1 C/min. After PGR amplification and melting curve analysis, a Ct value was calculated for each sample. The relative amount of RNA was determined comparing the Ct value of the test samples to the control sample after normalization with GAPDH. Ct values for any given sample were only used if their value fell within the standard curve for each gene. Otherwise, the assay was repeated and the test sample (i.e. cDNA) was diluted.
Several methods were tested for isolating and purifying total RNA from 5. cerevisiae. These methods include the RNAeasy Mini Kit™ (Qiagen), Till Reagent™ (Sigma), Master Pure Complete DNA and RNA Purification Kit™ (Epicentre Biotechnologies nc.), hot phenol xhlorofor.nr.isoamy! (Sigma) and modifications of some of these protocols. The following modified RNAeasy™ protocol was successfully used to isolate total RNA from 5. cerevisiae.
Frozen cellular pellets were thawed, thoroughly mixed with 2-3 volumes RNA protect™ (Qiagen) and incubated for 10 min. at 23 °C. Cells were centrifuged at 5,000 xg for 10 min at 23 °C. Supernatant was decanted and discarded. Cell pellets were resuspended in 200 ul .15 mg/mL iysozyme and 1.5 mg/mL proteinase K in 10 niM TRIS-HCI (pH 7.4) and 1 mM EDT'A. Ceils were incubated for 1 0 min. at 23 °C, Seven hundred ,uL RLT buffer were added and mixed by vortexing. Samples were sonicated for 1 min. Four hundred seventy pL ethanol were added and mixed by vortexing. The solution ws applied to a resin spin-column. The spin-column was centrifuged at 8,000xg for 10 sec, at 23 °C. Flow-through was discarded, and the remaining solutionwas added and centrifuged as above. Eighty μί, of DNase solution was applied (70 μΐ, RDD buffer and. 10 pL DNase) to the spin-column and incubated for 15 min. at 23 °C. Three hundred and fifty pL RW1 buffer was applied to the spin-column solution. The spin-column solution was centrifuged at 8,00()xg for 1 min. at 2.3 °C, Flow-through was discarded. Five hundred μί, RW1 was applied to the spin-column, The spin-column was centrifuged at 8,0()()xg for 1 min. at 23 °C. Plow-through was discarded. Use of the spin-column was repeated. The spin-column was transferred into a new collection tube and centrifuged at 8,000xg for 1 min. at 23 °C, The spin-column was transferred into a new collection tube- Fifty μΐ, of Nase-, DNase- free water was added to the center of the spin-column and left at 23 °C for 1-2 min. The spin- column was centrifuged at 8,000xg for 1 min, at 23 °C. The flow-through was saved, because it contained the RNA. The quantity and quality of the RNA was evaluated by ahsorbance spectroscopy and agarose gel electrophoresis.
After RNA was isolated from the cells, the samples were analyzed for gene expression by RT-PCR, as described above. cDNA was synthesized with oligo dT, as described above. A Northern Blot showed that stress response genes were not significantly up-regulaied after IJ V exposure in S. cerevisiae previously exposed to the A. f rroxidans extract. No significant differences were seen in the total RNA for the cells,
Differences in expression for Msn4pn and ruvB, which are involved in chromosome repair after stress-related damage, were observed between samples of 5'. cerevisiae treated with the A. ferroxidans extract and those not treated after the samples were exposed to UV radiation as described above.
Results of further experiments regarding stress-response gene expression in S. cerevisiae are shown in TABLE 5. in TABLE 5. "SA" designates control S. cerevisiae that were not treated with bacterial extract and not exposed to IJV radiation. "S5" designates S. cerevisiae treated with bacterial extract and exposed to UV radiation for 48 hours. "S6" designates S. cerevisi e treated with bacterial extract and exposed to UV radiation for 72 hours.
Will. !· 5: Sire ss-Response Gene Expression i "i S. cerevisiae
Msn4p (Ct| recA fCt) ruvB <Ct) GAPDH (Ctl
SA (1:50 cDNA) - 1 35,015858 31.099762 34.97601 25.63601
SA (1:50 cD A) -2 34.558225 31.193922 34.43322 25.67667
SA (1 :50 cDNA) -3 34.81304 31.48071 33.99135 25.86641
SA (1:50 CDNA) - Mean 34.7 31.3 34.S 2S.7
SA (1.:50 cDNA) - Std. Dev. 0,25 0.20 0.49 0.12
S (1:50 cD A) - Std. Error 0.14 0.11 0.28 0.07
S5(1:50 cDNA) - 1 48.143795 36.857708 39.42146 33.32396
S5(1:50cDNA) -2 38.14609 37.113995 40.3668 32.55367
S§ (1 50 cDNA) -3 39.83437 36.967648 39.43715 33.174426
S5(1:50 cDNA) - Mean 42.0 37.0 39.7 33.0
S5 (1:50 cDNA) - Sid. Dev. 5.35 0,13 0.54 0.41
S5(1:50 cDNA) - Sid. Error 3,09 0.07 0.31 0.24
S8 (1:50 cDNA) - 1 34.409473 31.552845 34.38703 25.48201
S8(1;5Q cD A) -2 34.430233 31.288467 34.8099 25.45857
88(1:50 cDNA) -3 35.021397 31.782907 34.67211 25.69369
S8(1:50 cDNA) - Mean 34.S 31.5 34.8 25.5
S6 (1:50 cDNA) - Std. Dev. 0.35 0.25 0.22 0.13
S6 (1:50 cDNA) - Std. Error 0.20 0.14 0.12 0.07
S5 (1 5 cDNA) - 1 38.55734 32.21721 37.2342 30968388
S5 (1 5 cDNA) - 2 37.911972 32.550484 37.835094 30.854069
SS (1 5 cDNA) - 3 37,23461 33.667084 40.251022 30.989134
SS (1 5 cDNA) - Mean 37.9 32.8 38.4 30.9
S5(1 5 cDNA) - Std. Dev. 0.66 0.76 1.60 0.07
SS (1 5 cDNA) - Std. Error 0.38 0.44 0.92 0.04
S6(1;5cDNA)- 1 35,528088 32.005764 35.446632 26.329565
S8 (1 5 cDNA) - 2 35.120403 31.908882 36.131447 26.248236
S8 (t 5 cDNA) - 35.390247 31,860.25 35.302666 26.37515
SS (1 5 cDNA) - Mean 35.3 31.9 3S.8 26.3
SS (1:5 cDNA) - Std. Dev. 0.21 0.07 0.44 0.06
S8 (1. 5 cDNA) - Std. Error 0.12 0.04 0.26 0.04 Example 5: Identification of Protein Expression Changes in S, Cerevisiaea in Response to UV Radiation
Yeast cells were grown in yeast extract agar media at 28-30 °C, overnight, following microbiological standard procedures. The best grown colonies were selected to make culture dilutions, which were used as a source of inoculum in liquid culture. Different yeast dilutions were then made, and their concentrations were measured according to the absorbance (optical density = O.D) at 550-600 rim wavelength). Different dilutions were used: 0.05. 0.02, 0.01. 0,0005 O.D. However, dilution 0.01 O.D was preferable.
Yeast cultures were then exposed to UV radiation for 48 hours an incubated at 28 °C, then samples were taken to determine protein expression. Samples were taken and mixed with phosphate buffer saline solution (PBS), phi 7.4 following standard procedures (Sambrook,F,, and Maniatis. 1989. Molecular cloning: A laboratory manual. 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Volume 3, appendix B. 12; Medieago AB.2009.) The mixture of yeast culture and PBS were subjected to centrifugation at 4 °C at 1 500 RPM for 5 minutes three times, and the supernatants were discarded each time. One gram of final pellets were stored at -80 °C until use, otherwise, the pellets were used immediately. Two samples were used for analysis by two-dimensional difference gel electrophoresis (2D DiGE) and protein identification by liquid chromatography tandem mass spectrometry (LC- MS/MS), Six proteins with increased or decreased expression are identified in TABLE 6. TABLE 6 S. Cerevisiaea Proteins Up-Regulated or Down-regulated by UV Exposure
Figure imgf000026_0001
Example is: identification of Protein Expression Changes in A. ferroxidans in Response to UV Radiation
A culture of A. ferroxidam was exposed to UV radiation for 72 hours. Samples were taken and analyzed for protein as described in Example 5, Results are presented in TABLE 7,
TABLE 7 A. ferroxidans Proteins Up-Regulated or Down-regulated by UV Exposure
Protein Accession #
Major outer m mbrane protein 40 CAA 10107.1 Increased
RuBisCQ la ge subiinit 1 P0C916.1 Increased
RuBisCQ large siibunii 2 P0C917.1 Increased
Pho s ph ori hu 1 o ki nase AC 78673. 1 Increased
Rihosomal protein S2 ACK79803.1 Increased
etol-acid reductoisomerase Β5ΕΡ52. Ϊ Increased
Pyridine nucleotide-disulfide AC 80497.1 Increased
Hsp20 AC 78444.1 Decreased
M e h ion in ε s y n thase B5ELU7.1 Increased
Serine hydro xymeihyltransferase AC 78912.1 increased
Chaperonin ACK77997.1 Decreased
HSP70 B5ENA3 j Decreased Example 7: Identification of cDNA Changes in A. ferr x idaas in Response to UV Radiation
A culture of A. jerroxidam was exposed to UV radiation for 72 hours. Samples were cenirifuged to prepare pellets, which were frozen. Pellets were subject to Real Time PGR, Primers and series thus identified were as follows:
Figure imgf000027_0001
cDNA levels for ccbL2 (ribulose bisphosphate carboxylase, large subunit 2. abbreviated RuBisCO sumunit 2) and metE (methy (transferase), increased by 20% following UV -exposure. cD A levels for dnak (chaperone protein Dnak). giyA (serine hydromethyliransferase) and rpsB (ribosomal protein s2) decreased by between 60% and 70%. Example 8; Transfection o/S. Cerevisiaea to increase UV-Resistance
S. Cerevisiaea were iransfected with the plasmid shown in FIGURE. 1 (3 genes), with a similar plasmid containing only HSP70, ADH, or hesokinase, or with an identical plasmid lacking the riboswitch component (3 genes -). Iransfected yeast cells were grown in yeast extract agar plates at 28-30 °C, overnight. Culture solutions were made and inoculated into 250 ml yeast extract liquid media contained in a 1 liter sterile glass bowl. Thus, the initial working concentration of the yeast cells cultures were equivalent to an optical density (Ο.Ό) of 0.07 at 600 nrn, pH of cultures were adjusted to 4 - 4,5; the experiments were set up in triplicates. The yeast cultures were incubated under alternate regimes of 1 2 hours of no-UV radiation and 48 hours of UV-radiation (254 nm), and continued shake (300 RPM), a total of 60 hours incubation at 28-30 °C. incubation was completely covered and protected against any kind of light from outside. Markers of cell growth were measured and results are reported in TABLE 8. Control yeast were not iransfected.
TABLE 8 Growth Markers in UV-Resistant 3. Cerevisiaea
Sample uv OD 1 DI A (ng/μΐ RNA (ng μΙ)* ATP (RLU)
3 genes N 0.580 [ 53,5 ± 2.8 19.4 . 1.1 1 15 ± 20
3 genes - Y 1. 17 1 85.5 ± 1.2 60.8 ± 3.1 89 1 : 17
. 3 genes - I N 0.571 ! 19,7 1.5 5.5 ± 1 .2 97± 12
¾P70 1 Ϋ 1.1 19 j 98.5 ± 0.2 1 17.2 ± 2,3 105 ± 1 3
HSP70 N 0.564 9.7 ± 0.85 15,8 ± .92 120 ±- 17
ADH Y 1 , 109 1 126 ; 5. Ϊ 1 10.2 ± 3, 1 121 ± 14
ADH N 0.601 J 5.7 ± 1 .2 24,5 ± 0.5 155 ± 12
Hexokinase Y 1 .098 84 ±4.2 80.5 t 1 .5 81 ± 22 {
Hexokinase N 0.519 1 7.2 ± 1 7.8 ± 1.15 ^7 ! !
Control Ϋ 0.532 I 80.2 ± 2.5 42.3 ± 1.4 87.9 ± 12.1
Control N 0,435 1 8.9 ; 1.4 14.3 ± 1 ,7 102 ± 1 5
- ean +/- standard deviation OD - Optical density; ATP - Adenosine triphosphate: RLU - Relative luminescence units
Example 9: Fermentation Using UV~Resistant 5, Cerevisiaea
S. Cerevisiaea were transfecied with the plasmid similar to that of FIGURE 1 , containing only HSP. Yeasi were cultured and then exposed to UV radiation for 48 hours. Fermentation products in the yeast were then measured using HPLC. Results for glucose production are shown in TABLE. 9.
TABLE 9 Glucose Production in UV-Resist nt S. Cerevisiaea
Sample LV Gluc e ig L) I
HSP+ Yeasi Ϋ 63.92 ! /·· 7.VJ
HSP+ Yeast ] N 60632 +/- 72.10 j
Control 1 Y 0 S
Control zzzii:: 0 j
Increased inositol production was also observed.
Example 10: Protection of Watermelons from UV Damage by A, f rroxidasis Extract
An extract was prepared from an A. ferroxidans culture previously exposed to UV- radialion for 72 hours. Sans Pepins wateremelon fruits were cleaned in sterile water and dried with a paper towel. The watermelons were then coated with different concentrations of bacterial extract (0.1 , 0.2, 0.5, 0.7 and 1 %) using a small brush or by spraying until their entire surfaces were covered. Watermelons were then placed in a Percival environmentally-controlled chamber (Percival Scientific, Perry, 1A) and exposed to 254 nm or 360 urn IJ V radiation at a temperature of 27-29 °C and 85% relative humidity for two weeks. Control watermelons coated with water were also tested. Watermelons were assed for color and shape of the fruit rind, blistering of the watermelon fruit, color and ripening (texture) of the flesh of the fruit, and content of glucose, carotene, and lycopene, flesh color was assigned the following values: l=paie, 2=paie red, 3::::rnedium red, 4=dark red.
Firmness (textures) was assigned the following values; l::::hard, 2=medium hard, 3::::soft, 4=very soft,
Blistering was assigned the following values: 0 =no blistering, 1::::10% blistering, 2-25% blistering, 3-50% blistering, 4-75-100% blistering. Rind color was assigned the following values: l:::;very dull green, 2=dull light green,
3=medium green, 4:::very (bright) green
Glucose, carotene, and lycopene content were determined using HPLC.
Results are presented in TABLES 10 and 1 1.
TABLE 10 Effects of Extract on Watermelon Color, Blistering, Flesh Color, and Flesh Texture
Sample j Rio Color Blistering Flesh Color 1 Flesh Texture
Extract + UV ! 4 6
Water ·· UV j 2 2 4
TABLE 1 1 E ects of Extract on Watermelon Glucose, Lycopene, and Carotene Content
Figure imgf000030_0001
Example 11: Protection of Fibroblasts from UV Damage by S, Cerevisiaea Extract S, Cerevisiae cells were iransfeeied with the plasmid of FIGURE 1. Exiracis of these yeast were applied to fibroblast cultures (which are indicative of skin protection), which were then exposed to UV radiation. Fibroblast cells were then stained for indicators of apoptosis (staining method differentiates between live and dead cells) and cell numbers were counted using microscopy. Control samples were not treated or were treated with extract from non-transfected yeast. Results are presented in TABLE 12,
TABLE 12 Effects of Extract on Fibroblast Resistance to IJV-R diation
Figure imgf000031_0001
Example 12: Solubility and Toxicity Data
Extracts from S. Cerevisiae and A. ferroxkkins were tested to determine their solubility water and their toxicity. Results are presented in TABLE 13.
TABLE 13 Solubility and Toxicity Data
Figure imgf000031_0002
Water solubility may be important for various reasons depending on the use. For example, in methods where the extract is applied to a fruit or vegetable, good water solubility means that the extraet should be largely removed when the fruit or vegetable is washed, decreasing the risk of any safety hazards for consumers. Good water solubility also indicates that keeping the extract in solution and thereby benefiting from its protective effects during a fermentation process may be easier,
Toxicity is significant because it indicates the likelihood of any adverse effects from the extracts if they are consumed. A high LD50 value indicates that more of the extract may be consimied without adverse effects. In general, the extract may be used so that the amount present on a fruit or vegetable or in portion of a fermentation product typically consumed is less than the LD5 .
Although only exemplary embodiments of the invention are specifically described above, it will be appreciated that modifications and variations of these examples are possible without departing from the spirit and intended scope of the invention. For example, throughout the specification particular measurements are given, it would be understood by one of ordinary skill in the art thai in many instances particularly outside of the examples other values similar 10, but not exactly the same as the given measurements may be equivalent and may also be encompassed by the present invention. As another example, although only monocultures of particular microbes are described herein for extract production, it will be understood that co- cultures are possible and may provide the benefit of different sources of UV-blocking components in the same extract.

Claims

j 2 CLAIMS
1. A composition comprising an extract from an A cidithiobaciilus bacteria or a yeast extracted after exposure of the bacteria to IJY radiation.
2. The composition of Claim 1, wherein the Acidithiobacillus bacteria comprises A. ferroxidans,
3. The composition of Claim 1 , wherein the yeast comprises S. Cerevisiaea.
4. The composition of Claim 1 , wherein the extract blocks at least approximately 50% of UV radiation..
5. The composition of Claim 1 , wherein the extract blocks ai least approximately 50% of longwave UV radiation,
6. The composition of Claim 1 , wherein the extract blocks at least approximately 50% of shortwave UV radiation.
7. The composition of Claim L wherein the concentration of the extract is between approximately 0.05 g/mL and 0.025 g/'mL,
8. The composition of Claim 1 further comprising a carrier.
9, The composition of Claim 7. wherein the carrier comprises water.
10. A method of preparing a UV-blocking composition comprising;
exposing a culture of AcidiihiobaciUus or yeast io UV radiation; and extracting UV-blocking cellular material produced in response to the UV radiation from the Acidithi bacill s or yeast.
1 1 . The method of Claim 10, wherein the AcidiihiobaciUus comprises A, ferroxidans.
12. The method of Claim 10, wherein the yeast comprises S. Cerevisiaea.
13. The method of Claim 10, wherein the culture of AcidithiohaciUus or yeast is exposed to UV radiation for a length of time not sufficient to substantially kill the Acidiihiobacilkis or yeasi in the culture.
14. The method of Claim 10, wherein extracting comprises centrifnging the AcidiihiobaciUus or yeast culture under conditions sufficient to precipitate UV-blocking cellular proteins.
15. A method of protecting an item from UV radiation damage comprising: extracting UV-blocking cellular material from Acidithiobacillus or yeast exposed to UV radiation; and
covering the item with the UV-blocking cellular material.
16. The method of Claim 1 5, wherein covering comprises applying a liquid containing the UV-blocking cellular material to the item,
17. The method of Claim 15, wherein covering comprises mixing the UV-blocking cellular material with the item.
18. The method of Claim 15, wherein covering comprised placing a solid material containing the UV-blocking cellular material over the item.
19. The method of Claim 16, wherein the item comprises an agricultural product.
20. The method of Claim 16, wherein the item comprises human skin,
21. A UV -resistant yeast ceil comprising:
a plasmid comprising a nucleic acid encoding at least one of a Msn4pn, a ruvB, a heat shock protein, an alcohol dehydrogenase (AD.H) protein, a NADH-cytochron e bS reductase 2, a NADP-speeifie glutarnate dehydrogenase, a superoxide dismuiase, a hex.oki.nase protein, or a phosphate glycerate mutase under control of a constitutive or inducible promoter.
22. The UV-resistant yeast cell comprising a nucleic acid encoding at least a heat shock protein, an ADH protein, and a hexokinae protein,
23. A UV-resistant bacterial cell comprising:
a piasmid comprising a nucleic acid encoding at least one of a major outer membrane protein, a RuBisCO large subunit 1 or 2, a phosphoribulokinase, a etol-acid reductoisoxnerase, a pyridine nucleotide-disul fide oxoreductase, a methionine synthase, hydromethyltransferase, a ribosomal protein s2, or a methyltransferase under control of a constitutive or inducible promoter.
PCT/US2013/075238 2012-12-17 2013-12-16 Uv-resistant microbes and uv-blocking microbial extract Ceased WO2014099700A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261738117P 2012-12-17 2012-12-17
US61/738,117 2012-12-17
US14/105,543 2013-12-13
US14/105,543 US20140170087A1 (en) 2012-12-17 2013-12-13 Uv-resistant microbes and uv-blocking microbial extract

Publications (1)

Publication Number Publication Date
WO2014099700A1 true WO2014099700A1 (en) 2014-06-26

Family

ID=50931137

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/075238 Ceased WO2014099700A1 (en) 2012-12-17 2013-12-16 Uv-resistant microbes and uv-blocking microbial extract

Country Status (2)

Country Link
US (3) US20140170087A1 (en)
WO (1) WO2014099700A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021087404A1 (en) * 2019-10-30 2021-05-06 Future Fields Cellular Agriculture and Research LTD. Method for producing recombinant proteins in insects

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020508357A (en) * 2017-02-27 2020-03-19 コンティニュアム グループ エルエルシー Sunscreen
WO2018213526A2 (en) * 2017-05-18 2018-11-22 Biocapital Holdings, Llc Uv-resistant biological devices and extracts and methods for producing and using the same
WO2020257524A1 (en) * 2019-06-21 2020-12-24 Bio Capital Holdings, LLC Uv-resistant biological devices and extracts and methods for producing and using the same
WO2021046364A1 (en) 2019-09-06 2021-03-11 Bio Capital Holdings, LLC Genelight cultures and extracts and applications thereof
CA3205229A1 (en) * 2020-12-18 2022-06-23 Liberty Biosecurity, Llc Compositions from a bacterial organism and uses thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6379964B1 (en) * 1997-01-17 2002-04-30 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US20100192261A1 (en) * 2006-07-10 2010-07-29 Ceres, Inc. Increasing uv-b tolerance in plants
US20120263690A1 (en) * 2009-08-17 2012-10-18 De Crecy Eudes Biocontrol microorganisms

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5643587A (en) * 1996-02-15 1997-07-01 Avon Products, Inc. Composition and method for under-eye skin lightening
US20060234365A1 (en) * 2001-04-02 2006-10-19 Alison Ward Methods of purification of cytochrome P450 proteins
US7858363B2 (en) 2006-07-22 2010-12-28 Zymo Research Corporation Plasmid DNA isolation
BRPI0806029A2 (en) 2007-07-19 2009-11-10 Biosigma Sa plasmids for transformation of bacteria of the genus aciditiobacillus spp. and transformation method
JP2012034233A (en) 2010-07-30 2012-02-16 Toshiba Corp Interpolation frame generation apparatus and interpolation frame generation method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6379964B1 (en) * 1997-01-17 2002-04-30 Maxygen, Inc. Evolution of whole cells and organisms by recursive sequence recombination
US20100192261A1 (en) * 2006-07-10 2010-07-29 Ceres, Inc. Increasing uv-b tolerance in plants
US20120263690A1 (en) * 2009-08-17 2012-10-18 De Crecy Eudes Biocontrol microorganisms

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BHATTACHARYYA, SWAPAN ET AL.: "Enhanced UV sensitivity of Thiobacillus ferrooxidans resulting from caffeine and acriflavine treatment of irradiated cells.", CURRENT MICROBIOLOGY, vol. 43.3, 2001, pages 149 - 153 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021087404A1 (en) * 2019-10-30 2021-05-06 Future Fields Cellular Agriculture and Research LTD. Method for producing recombinant proteins in insects
US11991994B2 (en) 2019-10-30 2024-05-28 Future Fields Cellular Agriculture and Research LTD. Method for producing recombinant proteins in insects

Also Published As

Publication number Publication date
US20170360695A1 (en) 2017-12-21
US20140170087A1 (en) 2014-06-19
US20170239170A1 (en) 2017-08-24
US9987219B2 (en) 2018-06-05

Similar Documents

Publication Publication Date Title
US9987219B2 (en) UV-resistant microbes and UV-blocking microbial extract
Kumar et al. Evidences showing ultraviolet-B radiation-induced damage of DNA in cyanobacteria and its detection by PCR assay
Gunes et al. Determination of superoxide dismutase activities in different cyanobacteria for scavenging of reactive oxygen species
Hipol et al. Antioxidant activities of fungal endophytes isolated from strawberry Fragaria× ananassa fruit
Song et al. A novel endophytic bacterial strain improves potato storage characteristics by degrading glycoalkaloids and regulating microbiota
US20260002164A1 (en) Genelight cultures and extracts and applications thereof
Hartung et al. A stress physiological role for abscisic acid (ABA) in lower plants
JP2020524522A (en) Inhibitory ability of raspberry and strawberry extracts against secondary metabolic stimulator Bacillus amyloliquefaciens QV15 and metabolic syndrome-related enzymes for secondary metabolism of phenolic compounds
Villavicencio et al. Detection of Phakopsora pachyrhizi by polymerase chain reaction (PCR) and use of germination test and DNA comet assay after e-beam processing in soybean
WO2020257524A1 (en) Uv-resistant biological devices and extracts and methods for producing and using the same
US11781157B2 (en) Biological devices for producing oxidized zinc and applications thereof
Ražná et al. Antioxidant properties of cumin (Bunium persicum Boiss.) extract and its protective role against ultrasound-induced oxidative stress tested by microRNA based markers.
Almalki et al. In vitro Antibiosis of Chlorella vulgaris Extract against the Phytopathogen, Stenotrophomonas maltophilia.
Jantaro et al. Short-term UV-B and UV-C radiations preferentially decrease spermidine contents and arginine decarboxylase transcript levels of Synechocystis sp. PCC 6803
CN109055507B (en) Primer and method for detecting EF gene expression characteristics of agasicles hygrophila
Hamed et al. Transformation and expression of HvDRF1 drought tolerant gene from barley in two Alfalfa cultivars.
ABD BURGAL et al. Biological control of microbial contamination associated with plant tissue culture of date palm (Phoenix dactylifera)
Eczacioglu et al. Biochemical and Molecular Characterization of Wheat Genotypes Under Drought Stress: Implications for Antioxidant Defense Mechanisms and Genomic Analysis
US20250230449A1 (en) Genelight cultures and extracts and applications thereof
CN105296651B (en) The method that chalcid fly Hsp90 gene expressions are nibbled using fluorescent RT-PCR technology detection Zhou Shi
Hamawi Diversity of UV Resistance in the Halophilic Archaea
Mohammed et al. Effect of the Phytase Enzyme Extracted from Saccharomyces Cerevisiae on Biofilm Formation by Pathogenic Bacteria
Hamed et al. Transformation and Expression of HvDRF1 Drought Tolerant Gene in Two Medicago sativa Cultivars
Reshetnikov et al. Bacteria-antagonists of the agents of soryz bacterial diseases
Shanmugam et al. Understanding the role of uncharacterized and hypothetical pathogenicity genes of Colletotrichum orbiculare to oxidative stress and phenolics of cucumber plant in anthracnose development

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13865648

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13865648

Country of ref document: EP

Kind code of ref document: A1