WO2014087241A2 - Methods of detecting biofilms from the palmitoylation of lipopolysaccharides - Google Patents
Methods of detecting biofilms from the palmitoylation of lipopolysaccharides Download PDFInfo
- Publication number
- WO2014087241A2 WO2014087241A2 PCT/IB2013/003113 IB2013003113W WO2014087241A2 WO 2014087241 A2 WO2014087241 A2 WO 2014087241A2 IB 2013003113 W IB2013003113 W IB 2013003113W WO 2014087241 A2 WO2014087241 A2 WO 2014087241A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- biofilm
- lipid
- biological sample
- gram negative
- lps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2400/00—Assays, e.g. immunoassays or enzyme assays, involving carbohydrates
- G01N2400/10—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
- G01N2400/50—Lipopolysaccharides; LPS
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2440/00—Post-translational modifications [PTMs] in chemical analysis of biological material
- G01N2440/10—Post-translational modifications [PTMs] in chemical analysis of biological material acylation, e.g. acetylation, formylation, lipoylation, myristoylation, palmitoylation
Definitions
- Biofilms can elicit local inflammation and cause mechanical hindrance and local damages. They also constitute a recurrent source of nosocomial infections since bacteria released from these biofilms may cause systemic infections leading to septicemia and fever. Biofilm-associated infections thus represent a significant health-care concern.
- the present technology relates generally to an apparatus and methods for detecting Gram negative bacteria biofilm.
- the present technology provides a method for detecting Gram negative bacteria biofilm in a biological sample including: isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; detecting the level of palmitoylated lipid A in isolated or extracted
- LPS bacterial lipopolysaccharides
- lipopolysaccharides and comparing this level with a reference level; where an increase in the level of palmitoylated lipid A with respect to the reference level indicates the presence of a Gram negative bacteria biofilm in the biological sample.
- the present technology provides an apparatus for carrying out the method according to any of the methods described herein, where the method includes: a technical device for detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides, and a calculating or computer device connected to the technical device, wherein the calculating or computer device compares palmitoylated lipid A with a reference level.
- the detecting device is operably linked to the calculating or computer device.
- the present technology provides a method for detecting the presence or the absence of Gram negative bacteria in a biofilm of a biological sample including: isolating or extracting bacterial
- LPS lipopolysaccharides
- the present technology provides a method for treating a patient infected with Gram negative bacteria: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample
- LPS bacterial lipopolysaccharides
- palmitoylated lipid A is detected.
- the present technology provides a method for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection, including: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample palmitoylated lipid A is detected.
- the presence or absence of palmitoylated lipid A is detected after administering a treatment.
- the treatment can be optimized or modified based on the continued, increased, or decreased presence or absence of palmitoylated lipid A following treatment.
- the present technology provides a method of treatment, including administering an antibiotic treatment specific for Gram negative bacteria to a patient identified as harboring a biological sample comprising palmitoylated lipid A.
- the present technology provides a method for detecting palmitoylated lipid A in a biological sample, including obtaining a biological sample; isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; and detecting palmitoylated lipid A in isolated or extracted lipopolysaccharides.
- LPS bacterial lipopolysaccharides
- FIG. 1 illustrates, in accordance with one embodiment, the modification by E. coli of its LPS in biofilm, in a ag -dependent manner.
- FIG. 2 illustrates, in accordance with one embodiment, the addition by Gram-negative bacteria of a palmitate chain to its lipid A in biofilm.
- FIG. 3 illustrates, in accordance with one embodiment, that biofilm-related palmitoylation is conserved among Gram-negative bacteria.
- FIG. 4 illustrates, in accordance with one embodiment, that lipid A palmitoylation is transcriptionally regulated by H-NS and SlyA.
- FIG. 5 illustrates, in accordance with one embodiment, that the pagP gene is important for evasion of innate immunity.
- FIG. 6 illustrates, in accordance with one embodiment, that the pagP gene is important for biofilm formation in vivo.
- FIG. 7 illustrates, in accordance with one embodiment, that lipid A palmitoylation is a marker of mature cultures.
- FIG. 8 illustrates, in accordance with one embodiment, the egulation of lipid A palmitoylation in mature planktonic culture.
- FIG. 9 illustrates, in accordance with one embodiment, the progression from a planktonic to a to biofilm lifestyle for bacteria.
- FIG. 10 illustrates, in accordance with several embodiments, reasons for the study of biofilms.
- FIGS. 1 1-14 illustrate, in accordance with several embodiments, reasons for the study of biofilm-associated infections.
- FIG. 15 illustrates, in accordance with several embodiments, reasons for the study of LPS as candidate biomakers for gram-negative bacterial biofilms.
- FIGS. 16-17 illustrate, in accordance with several embodiments, evidence for LPS modification in pathogenic E. coli biofilms
- FIG. 18 illustrates, in accordance with several embodiments, evidence that LPS modifications correspond to lipid A palmitoylation.
- FIG. 19 illustrates, in accordance with several embodiments, the regulation of lipid A palmitoylation in mature E. coli biofilms
- FIG. 20 illustrates, in accordance with several embodiments, evidence that lipid A palmitoylation is conserved in many gram-negative bacteria.
- FIG. 21 illustrates, in accordance with several embodiments, evidence that lipid A palmitoylation occurs in vivo.
- FIGs. 22-23 illustrate, in accordance with several embodiments, catheter- associated biofilm infections.
- FIG. 24 illustrates, in accordance with several embodiments, that lipid A palmitoylation occurs in vivo in biofilms.
- FIG. 25 illustrates, in accordance with several embodiments, that lipid A palmitoylation increases the survival of bacterial biofilm.
- FIGS. 26-27 illustrate, in accordance with several embodiments, a relationship between fundamental research and medical progress related to biofilms.
- E. coli modifies its LPS in biofilm, in a ag -dependent manner.
- E. coli strain K-12 BW25113 was grown in planktonic culture overnight (Pk) or in biofilm culture (Bf) over 96 h. LPS were extracted and analyzed by Tricine SDS-PAGE / periodate-silver staining. Arrows indicate a modified LPS. To assess the reversibility of the modification, bacteria grown for 96 h were recultured overnight in planktonic conditions (Bf -» Pk).
- B E.
- coli strains 55989, 536, 042, and CFT073 were grown in planktonic cultures overnight (Pk) or in biofilm for 96 h (Bf). LPS were extracted and analyzed by Tricine SDS-PAGE / periodate-silver staining.
- C LPS structure of E. coli K-12 BW25113, AwaaC mutant, and complemented mutant ApagP pPagP.
- D LPS analysis of 24 h planktonic (Pk) or 96 h biofilm (Bf) cultures from pathogenic E. coli K-12 strains wild-type, AwaaC, ApagP, and ApagP pPagP.
- E Mature biofilm formation ofE. coli K-12 BW25113 after 24, 48, 72, and 96 h of growth on glass slides inserted into continuous-flow microfermentors.
- A Tricine SDS-PAGE analysis of LPS from .E ' . coli BW25113 and BW25113 PcL-pagP, which constitutively expresses pagP gene, grown in planktonic cultures overnight (Pk) or in biofilm for 96 h (Bf).
- B The promoter region of the pagP gene, showing putative SlyA-binding sites (boxes).
- C E. coli BW25113 pagP-lacZ strains deleted for phoP, evgA, hns or slyA genes (left panel), and E.
- E LPS from E. coli BW25113 slyA-lacZ strain (right panel) were grown overnight in planktonic conditions (Pk) or in biofilm for 96 h (Bf). ⁇ -galactosidase activity was measured.
- E LPS from E. coli BW251 13 strains deleted for phoP, evgA, hns, slyA, surA and ompR genes were analyzed by Tricine SDS-PAGE.
- BW251 13 pBAD33, BW25113 Ahns pagP-lacZ pBAD33 , and BW251 13 Ahns pagP-lacZ pBAD33 -hns were grown to log-phase in M63B 1 0.4% glucose, then induced in M63B1 0.4% glycerol 0.2% arabinose, and after 2 h induction, expression oipagP was assessed by measuring ⁇ -galactosidase activity (miller units).
- BW251 13 pCA24N, BW25113 AslyA pagP-lacZ pCA24N and BW25113 AslyA pagP-lacZ pCA2 N-slyA were grown in planktonic cultures overnight in M63B1 0.4% glucose (Pk) or in biofilm for 96 h (Bf) in M63B1 0.4% glucose 0.1 mM isopropyl- -d-thiogalactopyranoside (IPTG).
- FIG. 5 in accordance with one embodiment, data is provided which demonstrates that the pagP gene is important for evasion of innate immunity.
- A Biofilms of E. coli 55989 wild-type, ApagP and PcL-pagP were grown in continuous-flow micro fermentors for 96 h, and images are provided of the biofilm formed in the microfermentor and on an internal glass slide.
- B Biofilms formed in the microfermentor and on the internal glass slide were resuspended and optical density at 600 nm was measured.
- C 24 h biofilm of E. coli BW251 13 and BW251 13 PcL-pagP were exposed to various concentrations of CAMP PG-1 for 2 h.
- FIG. 6 data is provided which demonstrates that the pagP gene is important for biofilm formation in vivo.
- A TIVAP implanted in rats were inoculated with bioluminescent E. coli 55989 wild- type, 55989 ApagP, or 55989 PcL-pagP. The bioluminescent signal was monitored for 7 days after inoculation.
- B E. coli 55989 was grown in 24 h planktonic cultures (Pk), in 96 h biofilm culture on glass spatula (Bf in vitro), or in TIVAP implanted in rat for 7 days (Bf in vivo). LPS were analyzed by Tricine SDS-PAGE.
- TIVAPs implanted in rats were inoculated with bioluminescent is. coli 55989, 55989 ApagP, or 55989 PcL-pagP. Three hours after inoculation, TIVAPs were surgically removed and the biofilm biomass was assessed by CFU count.
- D Seven days after inoculation, TIVAPs were flushed, rats were sacrificed 2 h after flushing, and TIVAPs were removed.
- E The biofilm biomass was assessed by bioluminescence measurement and
- Lipid A palmitoylation is a marker of mature cultures.
- E.coli strain K-12 were grown in biofilm (A) and planktonic (B) conditions during different times and LPS were extracted and analyzed by Tricine SDS- PAGE/periodate-silver staining.
- C Kinetics of LPS modification in aging planktonic culture ofE. coli K-12 BW251 13.
- E. coli K12 pagP-lacZ and E. coli K12 pagP-lacZ strains deleted for phoP, evgA, hns, or slyA genes were grown overnight and for 4 days in planktonic conditions, ⁇ -galactosidase activity was measured (A) and LPS were analyzed by Tricine SDS-PAGE / periodate-silver staining (B).
- the present technology relates generally to an apparatus and methods for detecting Gram negative bacteria biofilm, where the methods include extracting bacterial lipopolysaccharides (LPS) from the biological sample and detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides.
- LPS bacterial lipopolysaccharides
- the present technology further relates generally to related methods for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection.
- Some of the embodiments and examples described herein relate to the occurrence of LPS remodeling in Escherichia coli biofilms. It is demonstrated herein that in mature biofilm lipid A is heptaacylated, the PagP enzyme incorporating a palmitate acyl chain to lipid A. Contrary to what has been observed with previously described lipid A palmitoylation, the biofilm-associated lipid A palmitoylation was PhoPQ-independent, as described herein. The regulators involved in this modification were H-NS and SlyA, the latter inducing pagP expression by alleviating H-NS repression. Lipid A palmitoylation was also observed in an in vivo model of catheter- associated biofilm. The findings herein provide the first description of lipid A palmitoylation in biofilms.
- LPS lipopolysaccharide
- TLR Toll-like receptor 4-mediated innate immune responses, leading to Gram-negative septic shock.
- Escherichia coli bacteria synthesize a lipid A consist of a hexaacylated diphosphoryl diglucosamine. This structure can be modified in response to various stimuli such as low Mg 2+ , high Fe 3+ , or low pH.
- Electrostatic charge can be changed by addition or removal of phosphate group, while hydrophobicity can be modified by addition or removal of acyl chain from lipid A (for a review, see (Trent et ah, 2006)). These modifications are regulated by the two-component systems PhoPQ and PmrAB. While the LPS structure of a large number of bacteria, grown in planktonic conditions, has been documented, very few studies have focused on LPS structures in biofilm.
- the present technology provides a method for detecting Gram negative bacteria biofilm in a biological sample including: isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; detecting the level of palmitoylated lipid A in isolated or extracted
- LPS bacterial lipopolysaccharides
- lipopolysaccharides and comparing this level with a reference level; where an increase in the level of palmitoylated lipid A with respect to the reference level indicates the presence of a Gram negative bacteria biofilm in the biological sample.
- the reference level is the level of palmitoylated lipid A in the lipopolysaccharides of a planktonic culture of Gram negative bacteria, where the culture is at least 24 hours old ⁇ i.e., grown for at least 24 hours).
- the Gram negative bacteria biofilm is at least 2 days old ⁇ i.e., grown for at least 2 days).
- the Gram negative bacteria include a pagP gene homolog in their genome; or an outer membrane lipid A palmitoyl transferase PagP.
- the Gram negative bacteria include Escherichia coli, Serratia marcescens, Citrobacter koseri, Kiebsieiiia pneumonia, or Pseudomonas aeruginosa.
- the Gram-negative bacteria include Proteobacteria, such as ⁇ - and ⁇ - proteobacteria.
- the level of palmitoylated lipid A is determined by carrying out a mass spectrometry technique.
- the mass spectrometry technique is a technique including electrospray ionisation (ESI) or a matrix-assisted laser desorption ionisation (MALDI).
- the level of palmitoylated lipid A is determined by carrying out an immunological technique.
- the immunological technique may include the use of monoclonal or polyclonal antibodies specific for Gram negative bacteria palmitoylated LPS, an ELISA technique, an immunoenzymatic technique, an immunofluorescence technique, radio-immunological technique, or a chemo-immunological technique.
- the biological sample is collected from a human patient suspected of being infected by a Gram negative bacteria biofilm.
- the biological sample includes a blood sample, a urine sample, a biopsy collected at a suspected infection site, a liquid sample collected in a medical implant.
- the suspected infection site may be a wound site.
- the medical implant is a short term catheter, dialysis catheter, or a totally implantable venous access port (TIVAP).
- the method further includes administrating to the human patient an antibiotic treatment specific for the detected Gram negative bacteria biofilm.
- the reference level is the level of lipid A in the isolated or extracted lipopolysaccharides of the biological sample.
- an increase of at least about 50% in the level of palmitoylated lipid A, compared with the reference level is indicative of the presence of a Gram negative bacteria biofilm in the biological sample.
- an increase of at least about 60%, 70%, 80%, or 90% in the level of palmitoylated lipid A, compared with the reference level is indicative of the presence of a Gram negative bacteria biofilm in the biological sample.
- the present technology provides an apparatus for carrying out the method according to any of the methods described herein, where the method includes: a technical device for detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides, and a calculating or computer device for comparing the level with a reference level.
- the present technology provides a method for detecting the presence or the absence of Gram negative bacteria in a biofilm of a biological sample including: isolating or extracting bacterial
- the present technology provides a method for treating a patient infected with Gram negative bacteria: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample
- palmitoylated lipid A is detected.
- the biological sample is a biofilm formed in suspected infection sites, such as a wound site, a liquid sample collected in a medical implant, short term catheter, dialysis catheter, or a totally implantable venous access port (TTVAP).
- suspected infection sites such as a wound site, a liquid sample collected in a medical implant, short term catheter, dialysis catheter, or a totally implantable venous access port (TTVAP).
- TTVAP totally implantable venous access port
- the present technology provides a method for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection, including: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample palmitoylated lipid A is detected.
- LPS bacterial lipopolysaccharides
- the biological sample is a biofilm formed in suspected infection sites, such as a wound site, a liquid sample collected in a medical implant, preferably short term catheter, dialysis catheter, totally implantable venous access port (TIVAP).
- the method further includes administrating to the human patient an antibiotic treatment specific for the detected Gram negative bacteria biofilm.
- the patient population comprises a patient with one or more of an infection site, a wound site, or a medical implant, such as a short term catheter, a dialysis catheter, or a TIVAP.
- the biological sample is from a patient with a disease or condition, such as cystic fibrosis, associated with biofilm formation.
- the present technology provides a method of treatment, including administering an antibiotic treatment specific for Gram negative bacteria to a patient identified as harboring a biological sample comprising palmitoylated lipid A.
- the present technology provides a method for detecting palmitoylated lipid A in a biological sample, including obtaining a biological sample; isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; and detecting palmitoylated lipid A in isolated or extracted lipopolysaccharides.
- said detecting occurs by a mass spectrometry technique or an immunological technique.
- LPS lipopolysaccharides
- polysaccharide linked to lipid A a glucosamine-based phospholipid, which anchors LPS into the membrane.
- Escherichia coli LPS was compared from 6 days biofilm with E. coli LPS from 24 h planktonic cultures. SDS-PAGE analysis was used to identify the LPS modifications specific to biofilm lifestyle in E. coli.
- E. coli strains Five E. coli strains were tested: enteroaggregative strains 55989 and 042, uropathogenic strains 536 and CFT073, and the laboratory strain K-12. SDS-PAGE analyses revealed that the LPS banding pattern was different in biofilms compared to planktonic conditions for the five E. coli strains tested. Some LPS with a higher molecular weights appeared in biofilm only. This result indicated that biofilm- specific modifications occur in E. coli LPS. The modification is reversible, as biofilm bacteria re-cultured in planktonic conditions (Bf ⁇ Pk) and lost their higher molecular weight LPS.
- LPS palmitoylation is not strictly biofilm-specific, it may occur in very late stationary phase state characteristic of mature biofilm environment.
- Palmitoylation of E. coli LPS in biofilm conditions could be used as a biomarker for the detection of biofilm contamination on medical implant but also in chronic infection implicating biofilm (e.g., urinary tract infection, wound infection).
- Detection of a palmitoylated LPS can be used as a biofilm biomarker and a signature of the biofilm lifestyle.
- identification of circulating antibodies against palmitoylated Lipid A could be used as an indication of chronic biofilm infection using bedside detection kit.
- mutant strains originated from the Keio Collection, ⁇ -red linear DNA gene
- kanamycin 50 ⁇ g/ml
- chloramphenicol 25 ⁇ g/ml
- tetracycline 15 ⁇ g/ml
- ampicillin 100 ⁇ g/ml
- BW251 13 E. coli K- 12 derivative Keio collection BW251 13 AwaaC AwaaC::KrnFRT, Km K Keio collection BW251 13 ApagP ApagP .FRT, flipping from BW25113 This study
- ApagP :KmFRT from Keio collection
- TnSC189 mariner-based transposon of E. coli pagP-lacZ was performed.
- deletion of the pagP gene were performed using the ⁇ -Red recombinase gene
- pagP.ampPcLrbs.L-5 cattaaagaggagaaaggtaccgcatgaacgtgagtaaatatgtcgct pagP.ampPcLrbs.L-3 gtgagaattactaacttgagcgaattgtgaccataaaacatttatcaa inspagP.500-3 ggtcatctgaaaagtcactg
- pagP.CmFRT.L-5 taggaacttcggaataggaactaagacaaatgaagttttagtaacttct pagP.CmFRT.L-3 ttcgaagcagctccagcctacacattgtgaccataaaacatttatcaa pagP.500-3 caaccttctggggtcttttg
- Bacteria were lyophilized. Dried bacteria (10-12 mg) were obtained from one glass slide. The reproducibility of the SDS-PAGE profiles and lipid A structures was checked on several independent biofilm preparations, and then usually four preparations from the same experiment were pooled to obtain 40 mg of dried bacteria. Lipopolysaccharide was extracted from lyophilized bacterial cells by a new method developed in our laboratory (Caroff M. Novel method for isolating endotoxins, Patent, 2004) using mixtures of isobutyric acid and ammonium hydroxide solution as extracting agents. Briefly, 40 mg of dried bacteria were extracted with an appropriate mixture of solvents. The extracts were then diluted with twice as much water and lyophilized.
- the samples containing extracted LPS were washed twice with 600 ⁇ of methanol (centrifugation: 7000 g, 14°C, 10 min), dried, suspended in water and again lyophilized. These samples were dispersed in water and treated first with DNAse and RNAse (2 ⁇ g of each enzyme/mg LPS, 37°C, 3 h from Sigma-Aldrich (St Louis, MO, USA) then with proteinase K (4 mg/mg LPS, 48°C, 3 h; Sigma-Aldrich).
- the LPS suspensions were ultracentrifuged (300,000 g, 4°C, 45 min), the supernatants were discarded and the pellets dispersed in water and lyophilized.
- the amount of recovered, purified LPS was 1.3 mg for the planktonic culture and 1.1 mg for the bacteria grown in biofilm (3.3% and 2.8% yields, respectively).
- a micro LPS extraction procedure was used for SDS-PAGE characterization of the LPS from different strains produced by different culture types.
- Lyophilized extracts obtained from ⁇ 3 mg of dried bacteria were taken in 50 ⁇ of lysis buffer (2% SDS, 4% 2-mercaptoethanol, 10% glycerol, 1M Tris, pH 7.2) and treated with 30 ⁇ g of proteinase K for 2 h at 54°C to obtain gel loading samples.
- lysis buffer 2% SDS, 4% 2-mercaptoethanol, 10% glycerol, 1M Tris, pH 7.2
- lipid A isolation from bacterial cells [0081] For matrix-assisted laser desorption/ionisation mass spectrometry (MALDI- MS) analysis, lipid A was isolated directly by hydrolysis of bacterial cells. (El Hamidi A, Tirsoaga A, Novikov A et al. Microextraction of bacterial lipid A: easy and rapid method for mass spectrometric characterization. J Lipid Res 2005; 46: 1773-1778 ; Tirsoaga A, Novikov A, Adib-ConquyM et al. Simple method for repurification of endotoxins for biological use. Appl Environ Microbiol 2007; 73: 1803-1808).
- MALDI- MS matrix-assisted laser desorption/ionisation mass spectrometry
- lyophilized bacterial cells (6 mg) were suspended in 200 ⁇ of isobutyric acid +1M ammonium hydroxide mixture (5 : 3, v : v) and kept for 2 h at 100°C in a screw-cap test tube under magnetic stirring. The suspension was cooled in ice water and centrifuged (2000 g, 10 min). The recovered supernatant was diluted with 2 volumes of water and lyophilized. The sample was then washed once with 200 ml of methanol (centrifugation 2000 g for 10 min). Finally, lipid A was extracted from the pellet in 100 ⁇ of a mixture of chloroform, methanol and water (3 : 1.5 : 0.25, v : v : v).
- Lipopolysaccharide was analyzed by SDS-PAGE, (Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227: 680-685) employing separating and stacking gels containing 15% and 4% of acrylamide, respectively. Gels were loaded with 0.5-1 ⁇ g of purified LPS or with 0.5-1 ⁇ of proteinase K treated LPS containing lysis buffer solutions and
- Tumor necrosis factor-alpha content was measured in culture supernatants using specific mouse ELISA kits (DuoSet; R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions.
- ⁇ -galactosidase activity assay
- TIVAPs were surgically implanted in CD/SD (IGS:Crl) rats (Charles River) as described in Chauhan et al, PloS one 7: e37281. Briefly, the port was implanted at dorsal midline towards the lower end of the thoracic vertebrae, and the catheter was inserted into the jugular vein. Prior to inoculation of clinical strains, all rats were checked for the absence of infection by plating 100 ⁇ ⁇ blood as well as monitoring rats for the absence of luminescence signals. TIVAP contamination in rats and in vivo biofilm formation. The inoculum dose of 10 4 cells for overnight grown cultures of E.
- coli 55989 pAT881 WT, ApagP or PcL-pagP were injected into the port in a 50 ⁇ ⁇ volume. Planktonic bacteria were removed after 3 h of injection. Progression of colonization was monitored using an IVIS100 imaging system. Rats were sacrificed either 3 h or 7 days post-injection and TIVAPs were harvested. Serial dilutions from samples were plated on LB agar media for enumerating CFU/mL.
- In vivo inflammatory response To estimate the host inflammatory response due to LPS palmitoylation, E.
- coli 55989 WT, ApagP or VcL-pagP grown in a microfermentor for 4 days were adjusted to 10 9 cells per 500 and injected into rats intravenously. Rats were sacrificed 2 h after injection and blood harvested aseptically and analyzed for IL-6 cytokine release in serum using ELISA.
- EAEC Enteroaggregative
- UPEC uropathogenic
- the biofilm-specific LPS modification corresponds to a lipid A palmitoylation
- coli enzymes known to add a chemical group to the lipid A-Kdo 2 portion, 4 of them are common to 55989, 042, 536, CFT073 and K-12 strains: ArnT (aminoarabinose addition to lipid A), EptA (phosphoethanolamine addition to lipid A), EptB
- Biofllm-associated lipid A palmitoylation is conserved in Gram-negative bacteria
- the phosphorylation level was determined as the peak area of the major palmitoylated species, normalized by the peak area of the corresponding non- palmitoylated species ( Figures 3C-J)
- the anti H-NS factor SlyA activates pagP transcription in mature biofllms
- coli including cpxR, baeR, rpoE, rcsB and pspF (Rowley, 2006) all displayed wild type phenotype regarding lipid A palmitoylation and Bf-band production in biofilm conditions only. Similar results were obtained with other regulators usually associated with biofilm or stationary phase conditions, including rpoS, relA, luxS, soxR, oxyR, arcA, crp, phoB.
- Lipid A palmitoylation increases resistance to antimicrobial peptide PG-1 and decreases inflammatory response to biofilm bacteria
- coli was previously shown to decrease inflammatory activity of lipid A and the inventors observed that macrophage activation in J774A.1 cell line showed a 3 -fold reduction in release of TNF-a pro-inflammatory cytokine when brought in contact with bacteria producing palmitoylated lipid A (planktonic BW25113 PcL-pagP and E. coli BW25113 96 hours biofilm bacteria) compared to bacteria without palmitoylated lipid A (planktonic BW251 13 and BW251 13 ApagP bacteria) (Figure 5E).
- E. coli 55989 wild-type ApagP and PcL-pagP biofilm bacteria were injected intravenously into rats. Two hours after injection, rat serum ELISA was used to measure the amount of IL-6 pro-inflammatory cytokine and observed a significant increase in the IL-6 level induced by 55989 ApagP biofilm bacteria compared to wild-type and PcL-pagP bacteria ( Figure 5F).
- Lipid A palmitoylation increases biofilm in vivo survival of biofilm bacteria
- the inventors then compared the extent of in vivo biofilm development after inoculation of implanted TIVAP by bioluminescent wild type E. coli 55989, and ApagP or PcL- pagP E. coli 55989 derivatives. While no significant difference in adhesion to TIVAP in vitro or in vivo 5 hours after inoculation (Figure 6C), non-invasive monitoring of bioluminescent biofilm biomass formed in implanted TIVAP over 9 days of the experiment showed decrease in luminescence in TIVAP colonized by 55989 ApagP compared to the parent strain and Pcl-PagP ( Figure 6D, 6E).
- Lipid A palmitoylation also occurs in late stationary phase
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Toxicology (AREA)
- General Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Polysaccharides And Polysaccharide Derivatives (AREA)
Abstract
The present technology provides an apparatus and methods for detecting Gram negative bacteria biofilm, where the methods include extracting bacterial lipopolysaccharides (LPS) from the biological sample and detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides. The present technology further relates to methods for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection.
Description
METHODS OF DETECTING BIOFILMS FROM THE PALMITOYLATION
OF LIPOPOLYSACCHARIDES
[0001] Medical devices such as peripheral or central venous catheters, urinary catheters and prostheses are fundamental tools of modern medicine. However, it is estimated that as many as 15% of implanted patients suffer from complications including surgical site contamination and blood stream infections originating from these devices. These infections are frequently due to colonization of bacteria of various origins (e.g., from patients, floors, linens, dressings, etc.) onto the surface of implants, followed by the formation of self-structured communities called biofilms. Biofilms can elicit local inflammation and cause mechanical hindrance and local damages. They also constitute a recurrent source of nosocomial infections since bacteria released from these biofilms may cause systemic infections leading to septicemia and fever. Biofilm-associated infections thus represent a significant health-care concern.
[0002] Preventing biofilm formation in clinical settings is difficult, even in facilities with meticulous infection control programs. Indeed, there is currently no efficient method for preventing or eradicating biofilms, besides the traumatic and costly removal or replacement of contaminated devices from patients to reduce infection.
[0003] Needed are convenient methods for detecting the presence of biofilms on implanted devices suspected or prone to bacterial contamination. Such techniques would avoid the suffering and costs associated with unnecessary surgical procedures and could potentially allow preventive therapy to be applied at early stages of biofilm development on a device, when pathogenic bacteria are still sensitive to such treatments.
[0004] However, due to the lack of biological markers for biofilms, such contaminations of devices are generally only detected afterwards, following the removal of these devices from contaminated patients and the use of classical culturing techniques.
SUMMARY
[0005] The present technology relates generally to an apparatus and methods for detecting Gram negative bacteria biofilm.
[0006] According to one exemplary embodiment, the present technology provides a method for detecting Gram negative bacteria biofilm in a biological sample including: isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; detecting the level of palmitoylated lipid A in isolated or extracted
lipopolysaccharides; and comparing this level with a reference level; where an increase in the level of palmitoylated lipid A with respect to the reference level indicates the presence of a Gram negative bacteria biofilm in the biological sample.
[0007] According to another exemplary embodiment, the present technology provides an apparatus for carrying out the method according to any of the methods described herein, where the method includes: a technical device for detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides, and a calculating or computer device connected to the technical device, wherein the calculating or computer device compares palmitoylated lipid A with a reference level. In some embodiments, the detecting device is operably linked to the calculating or computer device.
[0008] According to another exemplary embodiment, the present technology provides a method for detecting the presence or the absence of Gram negative bacteria in a biofilm of a biological sample including: isolating or extracting bacterial
lipopolysaccharides (LPS) from the biofilm of the biological sample; and detecting the presence or absence of palmitoylated lipid A in isolated or extracted LPS; where the detection of palmitoylated lipid A is indicative of Gram negative bacteria in the biofilm of the sample.
[0009] According to another exemplary embodiment, the present technology provides a method for treating a patient infected with Gram negative bacteria: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic
treatment specific for Gram negative bacteria to patients in which sample
palmitoylated lipid A is detected.
[0010] According to another exemplary embodiment, the present technology provides a method for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection, including: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample palmitoylated lipid A is detected. In some embodiments, the presence or absence of palmitoylated lipid A is detected after administering a treatment. In some embodiments, the treatment can be optimized or modified based on the continued, increased, or decreased presence or absence of palmitoylated lipid A following treatment.
[0011] According to another exemplary embodiment, the present technology provides a method of treatment, including administering an antibiotic treatment specific for Gram negative bacteria to a patient identified as harboring a biological sample comprising palmitoylated lipid A.
[0012] According to yet another exemplary embodiment, the present technology provides a method for detecting palmitoylated lipid A in a biological sample, including obtaining a biological sample; isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; and detecting palmitoylated lipid A in isolated or extracted lipopolysaccharides.
[0013] The foregoing is a summary and thus by necessity contains simplifications, generalizations and omissions of detail. Consequently, those skilled in the art will appreciate that the summary is illustrative only and is not intended to be in any way limiting. Other aspects, inventive features, and advantages of the devices and/or processes described herein, as defined solely by the claims, will become apparent in the detailed description set forth herein and taken in conjunction with the
accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The skilled artisan will understand that the drawings primarily are for illustrative purposes and are not intended to limit the scope of the inventive subject matter described herein.
[0015] FIG. 1 illustrates, in accordance with one embodiment, the modification by E. coli of its LPS in biofilm, in a ag -dependent manner.
[0016] FIG. 2 illustrates, in accordance with one embodiment, the addition by Gram-negative bacteria of a palmitate chain to its lipid A in biofilm.
[0017] FIG. 3 illustrates, in accordance with one embodiment, that biofilm-related palmitoylation is conserved among Gram-negative bacteria.
[0018] FIG. 4 illustrates, in accordance with one embodiment, that lipid A palmitoylation is transcriptionally regulated by H-NS and SlyA.
[0019] FIG. 5 illustrates, in accordance with one embodiment, that the pagP gene is important for evasion of innate immunity.
[0020] FIG. 6 illustrates, in accordance with one embodiment, that the pagP gene is important for biofilm formation in vivo.
[0021] FIG. 7 illustrates, in accordance with one embodiment, that lipid A palmitoylation is a marker of mature cultures.
[0022] FIG. 8 illustrates, in accordance with one embodiment, the egulation of lipid A palmitoylation in mature planktonic culture.
[0023] FIG. 9 illustrates, in accordance with one embodiment, the progression from a planktonic to a to biofilm lifestyle for bacteria.
[0024] FIG. 10 illustrates, in accordance with several embodiments, reasons for the study of biofilms.
[0025] FIGS. 1 1-14 illustrate, in accordance with several embodiments, reasons for the study of biofilm-associated infections.
[0026] FIG. 15 illustrates, in accordance with several embodiments, reasons for the study of LPS as candidate biomakers for gram-negative bacterial biofilms.
[0027] FIGS. 16-17 illustrate, in accordance with several embodiments, evidence for LPS modification in pathogenic E. coli biofilms
[0028] FIG. 18 illustrates, in accordance with several embodiments, evidence that LPS modifications correspond to lipid A palmitoylation.
[0029] FIG. 19 illustrates, in accordance with several embodiments, the regulation of lipid A palmitoylation in mature E. coli biofilms
[0030] FIG. 20 illustrates, in accordance with several embodiments, evidence that lipid A palmitoylation is conserved in many gram-negative bacteria.
[0031] FIG. 21 illustrates, in accordance with several embodiments, evidence that lipid A palmitoylation occurs in vivo.
[0032] FIGs. 22-23 illustrate, in accordance with several embodiments, catheter- associated biofilm infections.
[0033] FIG. 24 illustrates, in accordance with several embodiments, that lipid A palmitoylation occurs in vivo in biofilms.
[0034] FIG. 25 illustrates, in accordance with several embodiments, that lipid A palmitoylation increases the survival of bacterial biofilm.
[0035] FIGS. 26-27 illustrate, in accordance with several embodiments, a relationship between fundamental research and medical progress related to biofilms.
DETAILED DESCRIPTION
[0036] The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented here.
[0037] Referring to FIG. 1, in accordance with one embodiment, data is provided which demonstrates that E. coli modifies its LPS in biofilm, in a ag -dependent manner. (A) E. coli strain K-12 BW25113 was grown in planktonic culture overnight (Pk) or in biofilm culture (Bf) over 96 h. LPS were extracted and analyzed by Tricine
SDS-PAGE / periodate-silver staining. Arrows indicate a modified LPS. To assess the reversibility of the modification, bacteria grown for 96 h were recultured overnight in planktonic conditions (Bf -» Pk). (B) E. coli strains 55989, 536, 042, and CFT073 were grown in planktonic cultures overnight (Pk) or in biofilm for 96 h (Bf). LPS were extracted and analyzed by Tricine SDS-PAGE / periodate-silver staining. (C) LPS structure of E. coli K-12 BW25113, AwaaC mutant, and complemented mutant ApagP pPagP. (D) LPS analysis of 24 h planktonic (Pk) or 96 h biofilm (Bf) cultures from pathogenic E. coli K-12 strains wild-type, AwaaC, ApagP, and ApagP pPagP. (E) Mature biofilm formation ofE. coli K-12 BW25113 after 24, 48, 72, and 96 h of growth on glass slides inserted into continuous-flow microfermentors.
[0038] Referring to FIG. 2, in accordance with one embodiment, data is provided which shows that E. coli adds a palmitate chain to its lipid A in biofilm. (A) Proposed structures corresponding to major peaks detected by MALDI-TOF mass spectrometry. Lipid A extracted from (B) E. coli K-12 BW251 13 grown in 24 h planktonic (Pk) or (C) 96 h biofilm (Bf) cultures, (D) BW251 13 ApagP mutant grown in 96 h biofilm, (E) BW25113 ApagP pPagP complemented mutant grown in 96 h biofilm, and (F) BW25113 ApagP pPagP -complemented mutant grown in 96 h planktonic bacteria were analyzed by MALDI-TOF MS. Lipid A extracted from is. coli K-12 AwaaC deep rough mutant grown (G) under 24 h planktonic conditions or (H) in 96 h biofilm were analyzed by MALDI-TOF MS.
[0039] Referring to FIG. 3, in accordance with one embodiment, data is provided which demonstrates that biofilm-related palmitoylation is conserved among Gram- negative bacteria. (A) E. coli 55989 and (B) Citrobacter koseri were grown in planktonic cultures overnight (Pk) or in biofilm for 96 h (Bf). Their lipid A were extracted and analyzed by MALDI-TOF MS. Lipid A extracted from (C) E. coli 55989, (D) E. coli CFT073, (E) Klebsiella pneumonia LM21, (F) Klebsiella pneumonia CH994, (G) Pseudomonas aeruginosa PA 14, (H) Pseudomonas aeruginosa ΒΓΝ8, (I) Citrobacter koseri and (J) Serratia marcescens 365 grown under planktonic (Pk 24 h) conditions or in biofilm (Bf 96 h) were analyzed by MALDI-TOF MS.
[0040] Referring to FIG. 4, in accordance with one embodiment, data is provided which demonstrates that lipid A palmitoylation is transcriptionally regulated by H-NS and SlyA. (A) Tricine SDS-PAGE analysis of LPS from .E'. coli BW25113 and BW25113 PcL-pagP, which constitutively expresses pagP gene, grown in planktonic cultures overnight (Pk) or in biofilm for 96 h (Bf). (B) The promoter region of the pagP gene, showing putative SlyA-binding sites (boxes). (C, D) E. coli BW25113 pagP-lacZ strains deleted for phoP, evgA, hns or slyA genes (left panel), and E. coli BW25113 slyA-lacZ strain (right panel) were grown overnight in planktonic conditions (Pk) or in biofilm for 96 h (Bf). β-galactosidase activity was measured. (E) LPS from E. coli BW251 13 strains deleted for phoP, evgA, hns, slyA, surA and ompR genes were analyzed by Tricine SDS-PAGE. (F) LPS from BW25113 strains deleted for phoP, evgA, hns, and slyA were grown under planktonic conditions for 24 and 96 h, and under biofilm conditions for 96 h, were analyzed by SDS-PAGE/periodate silver staining. (G) LPS from BW251 13 strains deleted for stress membrane regulators cpxR, baeR, rcsB, and pspF were grown under planktonic conditions for 24 h, and under biofilm conditions for 96 h, and were analyzed by SDS-PAGE/periodate- silver staining. (K) E. co/ί BW251 13 pBAD33, BW25113 Ahns pagP-lacZ pBAD33 , and BW251 13 Ahns pagP-lacZ pBAD33 -hns were grown to log-phase in M63B 1 0.4% glucose, then induced in M63B1 0.4% glycerol 0.2% arabinose, and after 2 h induction, expression oipagP was assessed by measuring β-galactosidase activity (miller units). (I) BW251 13 pCA24N, BW25113 AslyA pagP-lacZ pCA24N and BW25113 AslyA pagP-lacZ pCA2 N-slyA were grown in planktonic cultures overnight in M63B1 0.4% glucose (Pk) or in biofilm for 96 h (Bf) in M63B1 0.4% glucose 0.1 mM isopropyl- -d-thiogalactopyranoside (IPTG).
[0041] Referring to FIG. 5, in accordance with one embodiment, data is provided which demonstrates that the pagP gene is important for evasion of innate immunity. (A) Biofilms of E. coli 55989 wild-type, ApagP and PcL-pagP were grown in continuous-flow micro fermentors for 96 h, and images are provided of the biofilm formed in the microfermentor and on an internal glass slide. (B) Biofilms formed in the microfermentor and on the internal glass slide were resuspended and optical density at 600 nm was measured. (C) 24 h biofilm of E. coli BW251 13 and BW251 13 PcL-pagP were exposed to various concentrations of CAMP PG-1 for 2 h. Survival
was measured by CFU plating. (D) 24 h biofilms of E. coli 55989 wild-type and PcL- pagP were exposed to 20 μg/ml PG-1 for 24 h. Survival was measured by CFU plating (n = 3). (E) J774A.1 macrophage-like cell line was incubated for 2 h with E. coli strains K-12, K-12 ApagP, or K-12 PcL-pagP, grown overnight in planktonic conditions (Pk) or for 4 days in biofilm (Bf). TNF-a released in supernatant was measured by ELISA, and LPS were analyzed by Tricine SDS-PAGE. (F) Biofilms of E. coli 55989 derivatives were grown on a glass spatula for 96 h and injected intravenously in rats (6.5x l08 wild-type bacteria, 4* 108 ApagP bacteria, 4* 108 PcL- pagP bacteria). Sera were collected 2 h after injection and the IL-6 amount was measured by ELISA (mean + SD; n = 4). (G) J774A.1 macrophage-like cells were infected at m.o.i of 0.3 for 2 h with E. coli 55989 derivatives grown on a glass spatula for 96 h. The IL-6 amount in the supernatants was measured by ELISA (mean + SD; n = 3). Statistical significance was assessed using an unpaired ?-test (* p < 0.05; ** p < 0.01).
[0042] Referring to FIG. 6, in accordance with one embodiment, data is provided which demonstrates that the pagP gene is important for biofilm formation in vivo. (A) TIVAP implanted in rats were inoculated with bioluminescent E. coli 55989 wild- type, 55989 ApagP, or 55989 PcL-pagP. The bioluminescent signal was monitored for 7 days after inoculation. (B) E. coli 55989 was grown in 24 h planktonic cultures (Pk), in 96 h biofilm culture on glass spatula (Bf in vitro), or in TIVAP implanted in rat for 7 days (Bf in vivo). LPS were analyzed by Tricine SDS-PAGE. (C) TIVAPs implanted in rats were inoculated with bioluminescent is. coli 55989, 55989 ApagP, or 55989 PcL-pagP. Three hours after inoculation, TIVAPs were surgically removed and the biofilm biomass was assessed by CFU count. (D) Seven days after inoculation, TIVAPs were flushed, rats were sacrificed 2 h after flushing, and TIVAPs were removed. (E) The biofilm biomass was assessed by bioluminescence measurement and (F) the biofilm was extracted and the number of bacteria was measured by plating (CFU count) (n = 4).
[0043] Referring to FIG. 7, in accordance with one embodiment, data is provided which demonstrate that the Lipid A palmitoylation is a marker of mature cultures. E.coli strain K-12 were grown in biofilm (A) and planktonic (B) conditions during
different times and LPS were extracted and analyzed by Tricine SDS- PAGE/periodate-silver staining. (C) Kinetics of LPS modification in aging planktonic culture ofE. coli K-12 BW251 13.
[0044] Referring to FIG. 8, in accordance with one embodiment, data is provided which demonstrates the regulation of the lipid A palmitoylation in mature planktonic culture. E. coli K12 pagP-lacZ and E. coli K12 pagP-lacZ strains deleted for phoP, evgA, hns, or slyA genes were grown overnight and for 4 days in planktonic conditions, β-galactosidase activity was measured (A) and LPS were analyzed by Tricine SDS-PAGE / periodate-silver staining (B).
[0045] The technology is described herein using several definitions, as set forth throughout the specification.
[0046] As used herein, "about" will be understood by persons of ordinary skill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art, given the context in which it is used, "about" will mean up to plus or minus 10% of the particular term.
[0047] The present technology relates generally to an apparatus and methods for detecting Gram negative bacteria biofilm, where the methods include extracting bacterial lipopolysaccharides (LPS) from the biological sample and detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides. The present technology further relates generally to related methods for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection.
[0048] Some of the embodiments and examples described herein relate to the occurrence of LPS remodeling in Escherichia coli biofilms. It is demonstrated herein that in mature biofilm lipid A is heptaacylated, the PagP enzyme incorporating a palmitate acyl chain to lipid A. Contrary to what has been observed with previously described lipid A palmitoylation, the biofilm-associated lipid A palmitoylation was PhoPQ-independent, as described herein. The regulators involved in this modification were H-NS and SlyA, the latter inducing pagP expression by alleviating H-NS repression. Lipid A palmitoylation was also observed in an in vivo model of catheter-
associated biofilm. The findings herein provide the first description of lipid A palmitoylation in biofilms.
[0049] Most of our knowledge in bacteriology derives from studies on bacteria cultured in planktonic conditions, where cells are dispersed and independent from each other. However, it is now appreciated that, in their natural environment, bacteria form structured aggregates known as biofilms, in which they behave differently than in planktonic conditions. Their transcriptional profiles are different (Whiteley et ah, 2001; Schembri et ah, 2003; Beenken et ah, 2004; Beloin et ah, 2004), they produce an extracellular matrix, and they are more tolerant to stress, biocides and host immunological responses (Mah and O'Toole, 2001). Because of these differences, in part, studies based on planktonic cultures may not be relevant to health problems involving biofilm-specific behavior, such as the eradication of biofilms formed on medical devices. Therefore a better understanding of biofilms, especially how they differ from planktonic cultures, may help us to cope with their deleterious effects on human activities.
[0050] The lipopolysaccharide (LPS), the major component of Gram-negative bacterial outer membranes, plays an important role in the interaction of a bacterium with its environment. In particular, lipid A, which anchors the LPS into the membrane, is a powerful stimulant of Toll-like receptor (TLR) 4-mediated innate immune responses, leading to Gram-negative septic shock (Galanos et ah, 1985; Raetz and Whitfield, 2002). In planktonic conditions Escherichia coli bacteria synthesize a lipid A consist of a hexaacylated diphosphoryl diglucosamine. This structure can be modified in response to various stimuli such as low Mg2+, high Fe3+, or low pH. Electrostatic charge can be changed by addition or removal of phosphate group, while hydrophobicity can be modified by addition or removal of acyl chain from lipid A (for a review, see (Trent et ah, 2006)). These modifications are regulated by the two-component systems PhoPQ and PmrAB. While the LPS structure of a large number of bacteria, grown in planktonic conditions, has been documented, very few studies have focused on LPS structures in biofilm. Several studies have reported the loss of O-antigen when Pseudomonas aeruginosa (Beveridge et ah, 1997; Ciornei et ah, 2010) or Pseudomonas putida (Hansen et ah, 2007) bacteria were cultured in
biofilm. Alteration of lipid A has also been observed in P. aeruginosa biofilm: acyl chains are hydroxylated in planktonic conditions, non-hydroxylated in biofilm conditions (Ciornei et ah, 2010).
[0051] According to one exemplary embodiment, the present technology provides a method for detecting Gram negative bacteria biofilm in a biological sample including: isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; detecting the level of palmitoylated lipid A in isolated or extracted
lipopolysaccharides; and comparing this level with a reference level; where an increase in the level of palmitoylated lipid A with respect to the reference level indicates the presence of a Gram negative bacteria biofilm in the biological sample.
[0052] In some embodiments, the reference level is the level of palmitoylated lipid A in the lipopolysaccharides of a planktonic culture of Gram negative bacteria, where the culture is at least 24 hours old {i.e., grown for at least 24 hours). In some embodiments, the Gram negative bacteria biofilm is at least 2 days old {i.e., grown for at least 2 days).
[0053] In some embodiments, the Gram negative bacteria include a pagP gene homolog in their genome; or an outer membrane lipid A palmitoyl transferase PagP. In other embodiments, the Gram negative bacteria include Escherichia coli, Serratia marcescens, Citrobacter koseri, Kiebsieiiia pneumonia, or Pseudomonas aeruginosa. In some embodiments, the Gram-negative bacteria include Proteobacteria, such as β- and γ- proteobacteria.
[0054] In some embodiments, the level of palmitoylated lipid A is determined by carrying out a mass spectrometry technique. In other embodiments, the mass spectrometry technique is a technique including electrospray ionisation (ESI) or a matrix-assisted laser desorption ionisation (MALDI). In some embodiments, the level of palmitoylated lipid A is determined by carrying out an immunological technique. For example, the immunological technique may include the use of monoclonal or polyclonal antibodies specific for Gram negative bacteria palmitoylated LPS, an ELISA technique, an immunoenzymatic technique, an immunofluorescence technique, radio-immunological technique, or a chemo-immunological technique.
[0055] In other embodiments, the biological sample is collected from a human patient suspected of being infected by a Gram negative bacteria biofilm. In some embodiments, the biological sample includes a blood sample, a urine sample, a biopsy collected at a suspected infection site, a liquid sample collected in a medical implant. In some embodiments, the suspected infection site may be a wound site. In some embodiments, the medical implant is a short term catheter, dialysis catheter, or a totally implantable venous access port (TIVAP).
[0056] In some embodiments, the method further includes administrating to the human patient an antibiotic treatment specific for the detected Gram negative bacteria biofilm. In other embodiments, the reference level is the level of lipid A in the isolated or extracted lipopolysaccharides of the biological sample. In some embodiments, an increase of at least about 50% in the level of palmitoylated lipid A, compared with the reference level, is indicative of the presence of a Gram negative bacteria biofilm in the biological sample. In some embodiments, an increase of at least about 60%, 70%, 80%, or 90% in the level of palmitoylated lipid A, compared with the reference level, is indicative of the presence of a Gram negative bacteria biofilm in the biological sample.
[0057] According to another exemplary embodiment, the present technology provides an apparatus for carrying out the method according to any of the methods described herein, where the method includes: a technical device for detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides, and a calculating or computer device for comparing the level with a reference level.
[0058] According to another exemplary embodiment, the present technology provides a method for detecting the presence or the absence of Gram negative bacteria in a biofilm of a biological sample including: isolating or extracting bacterial
lipopolysaccharides (LPS) from the biofilm of the biological sample; and detecting the presence or absence of palmitoylated lipid A in isolated or extracted LPS; where the detection of palmitoylated lipid A is indicative of Gram negative bacteria in the biofilm of the sample.
[0059] According to another exemplary embodiment, the present technology provides a method for treating a patient infected with Gram negative bacteria: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample
palmitoylated lipid A is detected.
[0060] In some embodiments, the biological sample is a biofilm formed in suspected infection sites, such as a wound site, a liquid sample collected in a medical implant, short term catheter, dialysis catheter, or a totally implantable venous access port (TTVAP).
[0061] According to another exemplary embodiment, the present technology provides a method for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection, including: isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient; detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administrating an antibiotic treatment specific for Gram negative bacteria to patients in which sample palmitoylated lipid A is detected.
[0062] In some embodiments, the biological sample is a biofilm formed in suspected infection sites, such as a wound site, a liquid sample collected in a medical implant, preferably short term catheter, dialysis catheter, totally implantable venous access port (TIVAP). In some embodiments, the method further includes administrating to the human patient an antibiotic treatment specific for the detected Gram negative bacteria biofilm. In some embodiments the patient population comprises a patient with one or more of an infection site, a wound site, or a medical implant, such as a short term catheter, a dialysis catheter, or a TIVAP.
[0063] In some embodiments, the biological sample is from a patient with a disease or condition, such as cystic fibrosis, associated with biofilm formation.
[0064] According to another exemplary embodiment, the present technology provides a method of treatment, including administering an antibiotic treatment specific for Gram
negative bacteria to a patient identified as harboring a biological sample comprising palmitoylated lipid A.
[0065] According to yet another exemplary embodiment, the present technology provides a method for detecting palmitoylated lipid A in a biological sample, including obtaining a biological sample; isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; and detecting palmitoylated lipid A in isolated or extracted lipopolysaccharides. In some embodiments, said detecting occurs by a mass spectrometry technique or an immunological technique.
[0066] The present disclosure is not to be limited in terms of the particular embodiments described in this application, which are intended as illustrations of various aspects. Many modifications and variations can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent compositions, apparatuses, and methods within the scope of the disclosure, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. It is to be understood that this disclosure is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0067] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0068] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and
enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as 'up to,' 'at least,' 'greater than,' 'less than,' and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member.
EXAMPLES
Introduction
[0069] Global transcriptome analyses were undertaken to compare surface-attached and planktonic culture conditions. These studies revealed that the biofilm lifestyle triggers extensive modifications in gene expression that are proposed to correspond to biofilm-specific physiological changes. Therefore, new biofilm biomarkers were sought that are absent form or found in low levels in isolated, liquid-culture bacteria.
[0070] These studies focused on lipopolysaccharides (LPS). LPS, is a major component of Gram-negative bacterial outer membranes composed of a
polysaccharide linked to lipid A, a glucosamine-based phospholipid, which anchors LPS into the membrane.
[0071] Escherichia coli LPS was compared from 6 days biofilm with E. coli LPS from 24 h planktonic cultures. SDS-PAGE analysis was used to identify the LPS modifications specific to biofilm lifestyle in E. coli.
[0072] Five E. coli strains were tested: enteroaggregative strains 55989 and 042, uropathogenic strains 536 and CFT073, and the laboratory strain K-12. SDS-PAGE analyses revealed that the LPS banding pattern was different in biofilms compared to planktonic conditions for the five E. coli strains tested. Some LPS with a higher molecular weights appeared in biofilm only. This result indicated that biofilm- specific modifications occur in E. coli LPS. The modification is reversible, as biofilm bacteria re-cultured in planktonic conditions (Bf→ Pk) and lost their higher molecular weight LPS.
[0073] To identify the LPS modifications observed in biofilm, several K-12 mutants deleted for known LPS modification genes were tested for their ability to modify their LPS. One of these mutants, ApagP, was unable to make the modification in biofilm. The pagP gene codes for a palmitoyl transferase, which transfers a palmitate to lipid A. To confirm that the LPS modification was due to pagP, a pagP+ strain was constructed which constitutively expresses the pagP gene. The modified LPS, absent in wild-type planktonic bacteria, was present in pagP+ planktonic bacteria.
[0074] These data demonstrate that the higher and biofilm-specific molecular weight LPS is palmitoylated. This hypothesis was confirmed by MALDI-TOF mass spectrometry analysis of lipid A from planktonic and biofilm bacteria. The species at m/z 2035.6, fitting with a palmitoylated lipid A, was abundant in biofilm, not in planktonic bacteria.
[0075] The kinetic of LPS palmitoylation was then characterized during biofilm maturation. LPS from E. coli K-12 biofilm grown for 1 to 4 days were analyzed by SDS-PAGE. Palmitoylation appeared after 2 days of growth, indicating that it is characteristic of mature biofilms, not young biofilms. This result prompted us to test whether palmitoylation occurs in mature planktonic cultures. SDS-PAGE analysis showed that palmitoylation appears in 2-day old planktonic culture.
[0076] Hence, whereas LPS palmitoylation is not strictly biofilm-specific, it may occur in very late stationary phase state characteristic of mature biofilm environment.
[0077] This findings opens up to the possibility of a non-invasive methodology to monitor presence of palmitoylated LPS in bacteria at suspected infection sites or in collected blood samples containing biofilm bacteria potentially released from potentially infected devices.
Applications:
Palmitoylation of E. coli LPS in biofilm conditions could be used as a biomarker for the detection of biofilm contamination on medical implant but also in chronic infection implicating biofilm (e.g., urinary tract infection, wound infection).
Detection of a palmitoylated LPS (e.g., antibody, mass spectrometry) can be used as a
biofilm biomarker and a signature of the biofilm lifestyle. Alternatively, identification of circulating antibodies against palmitoylated Lipid A could be used as an indication of chronic biofilm infection using bedside detection kit.
Materials and Methods
Bacterial strains and growth conditions
[0078] Bacterial strains and plasmids used are listed in Table 1. Most E. coli K12
mutant strains originated from the Keio Collection, λ-red linear DNA gene
inactivation method and P 1 phage transduction were used to construct all other E. coli mutants. When required, kanamycin resistance markers flanked by two FRT sites
were removed using Flp recombinase. All mutations were confirmed by PCR and
sequencing analysis. Antibiotics were used as indicated, or as follows: kanamycin (50 μg/ml); chloramphenicol (25 μg/ml); tetracycline (15 μg/ml); ampicillin (100 μg/ml).
All experiments were performed in lysogeny broth (LB) medium or M63B1 medium supplemented with 0.4% glucose and incubated at 37°C. Biofilm formation on an
internal glass slide in continuous-flow microfermentors was performed as previously described in Ghigo, Nature 412: 442-445. Dilutions of a 2 M ammonia solution
dissolved in ethanol were used as source of ammonia (Sigma-Aldrich, Reference
392685). All chemicals were purchased from Sigma-Aldrich.
Table 1. Strains and plasmids used in this study.
Strains and plasmids Relevant characteristics Reference / source
Strains
Escherichia coli
BW251 13 E. coli K- 12 derivative Keio collection BW251 13 AwaaC AwaaC::KrnFRT, KmK Keio collection BW251 13 ApagP ApagP .FRT, flipping from BW25113 This study
ApagP: :KmFRT from Keio collection
BW25 l l3 PcL-pagP pagP with its own RBS sequence placed under the This study
control of the ampPch cassette pR promoter; AmpR
BW251 13 pagP-lacZ lacZzeo cassette inserted on the chromosome This study
downstream ofpagP gene; ZeoR
BW251 13 AphoP pagP-lacZ AphoP: :KmFRT in BW251 13 pagP-lacZ; KmR ZeoR This study BW251 13 AevgA pagP-lacZ Aev^::KmFRT in BW25113 pagP-lacZ; KmRZeoR This study BW251 13 Ahns pagP-lacZ Aftns::KmFRT in BW25113 pagP-lacZ; KmR ZeoR This study BW251 13 AslyA pagP-lacZ AslyA : :KmFRT in BW251 13 pagP-lacZ; KmR ZeoR This study BW251 13 slyA-lacZ lacZzeo cassette inserted on the chromosome This study
downstream of slyA gene; ZeoR
55989 In vitro and in vivo biofilm-forming Infect. Immun., Enteroaggregative i. coli 70:4302-431 1
PloS one S: e61628 Antimicrobial Agents & Chemotherapy, 56:6310-6318
55989 ApagP Apag : :KmFRT, Km This study 55989 PcL-pagP pagP with its own RBS sequence placed under the This study
control of the ampVcL cassette pR promoter; Amp1
042 Enteroaggregative i. coli J. Infect. Disease,
171:465-468
536 Uropathogenic E. coli J. Bacteriol,
152: 1241-1247
CFT073 Uropathogenic E. coli Infection &
Immunity, 58: 1281-
1289
Citrobacter koseri U5 Clinical isolate Lab. collection Serratia marcescens SM365 Environmental isolate V. Braun
Klebsiella pneumoniae LM21 Clinicate isolate; serogroup 025; ApR Infection &
Immunity, 67:554- 561
Klebsiella pneumoniae CH994 Clinical strain isolated from bronchial sampling C. Forestier Klebsiella pneumoniae CH995 Clinical strain isolated from flat surgical drain C. Forestier Klebsiella pneumoniae CH996 Clinical strain isolated from urinary catheter C. Forestier Pseudomonas aeruginosa PA 14 Clinical isolate Lab. collection Pseudomonas aeruginosa B JN8 Clinical strain isolated from catheter— related V.Leflon
infection
Pseudomonas aeruginosa BJN33 Clinical strain isolated from catheter— related V.Leflon
infection
Pseudomonas aeruginosa B JN53 Clinical strain isolated from catheter— related V.Leflon
infection
Plasmids
pSC189 Plasmid bearing the mariner transposon TnSC 189; Gene, 296: 179-185
R6Kon; AmpR KmR
pKOBEG pSClOl ts (replicates at 30°C); araC, arabinose- Nucleic Acid Res. , inducible λτβάγβα operon; CmR 28:E97 pKOBEGA Like pKOBEG, but AmpR
pCP20 Plasmid bearing the flp recombinase gene; 30°C Gene, 158:9-14 replication; CmR AmpR
pAT881 pGB2QPamiluxABCDE Applied & Env.
Microbiology,
76:264-274 pAC24N R
IPTG-inducible pT5 -lac promoter; Cm DNA Research,
12:291-299 pPagP pCA24N vT5-lac--pagP; Cm' Id.
pSlyA pCA24N pT5-lac.:sfyA; CmK Id.
pBAD33 R
Arabinose-inducible pBAD promoter; Cm J. Bacteriology,
177:4121-4130 pBAD33-A Arabinose-inducible hns Cm
Molecular
Microbiology,
48: 1401-1416
Transposon mutagenesis, strain construction and molecular techniques
[0079] TnSC189 mariner-based transposon of E. coli pagP-lacZ was performed.
Transposon insertion sites were determined as described in Ferrieres et al, J.
Bacteriology, 192: 6418-6427. Constitutive expression of the pagP gene was carried out by insertion of the previously described ampVcL genetic element in front oipagP at its native chromosomal location. Insertion of the ampPcL cassette as well as
deletion of the pagP gene were performed using the λ-Red recombinase gene
replacement system and a three-step PCR procedure. The primers used are listed in
Table 2. When necessary, the antibiotic resistance marker of the inserted cassette was removed using the flipase-encoding pCP20 plasmid. For construction of pagP-lacZ and slyA-lacZ fusions, the same principle was used. The lacZ-zeo cassette was
inserted downstream of the stop codon of the target gene. To construct pagP-lacZ
derivatives, mutations were transferred by P lvir transduction from Keio collection
mutants JWl 116 (AphoP), JW2366 (AevgA), JW1225 (Anns) and JW5267 (AslyA) into the BW251 13 pagP-lacZ strain. All constructs were confirmed by PCR and
sequencing.
Table 2. Primers used in this study.
Target gene Primer name Sequence (5'- 3 ')
Primers used to generate ampFcL cassette insertions
pagP pagP.500-5 caagaaaaactgccattaag
pagP.ampPcLrbs.L-5 cattaaagaggagaaaggtaccgcatgaacgtgagtaaatatgtcgct pagP.ampPcLrbs.L-3 gtgagaattactaacttgagcgaattgtgaccataaaacatttatcaa inspagP.500-3 ggtcatctgaaaagtcactg
Primers used to generate lacZ fusions
pagP endpagP.lacZzeo.Lg-5 tactttgcctggatgcgctttcagttttgagacaaatgaaatttcacacaggaaacagctatga endpagP . lacZzeo . Lg- 3 tacttatttagctattgattttaaagaagttactaaaactcagtcctgctcctcggccacgaa slyA endslyA.lacZzeo.Lg-5 aatatcattgagttacaggccaaagggtgagacaaatgaaatttcacacaggaaacagctatga endslyA.lacZzeo.Lg-3 ttgcgtgtggtcaggttactgaccacacgcccccttcatttcagtcctgctcctcggccacgaa Primers used to generate deletion mutants
pagP.500-5 caagaaaaactgccattaagac
pagP.CmFRT.L-5 taggaacttcggaataggaactaagacaaatgaagttttagtaacttct
pagP.CmFRT.L-3 ttcgaagcagctccagcctacacattgtgaccataaaacatttatcaa pagP.500-3 caaccttctggggtcttttg
pagP559g9 pagP.500-5 caagaaaaactgccattaagac
pagP55989.KmFRT.L-5 gaacttcggaataggaactaagacaaatgaagttttagtaacttctttaa pagP55989.KmFRT.L-3 gaagcagctccagcctacacacatttgtgaccataaaacatttatcaaaa pagP55989.500-3 aaccttctggggtcttttgc
Lipopolysaccharide isolation and purification
[0080] Bacteria were lyophilized. Dried bacteria (10-12 mg) were obtained from one glass slide. The reproducibility of the SDS-PAGE profiles and lipid A structures was checked on several independent biofilm preparations, and then usually four preparations from the same experiment were pooled to obtain 40 mg of dried bacteria. Lipopolysaccharide was extracted from lyophilized bacterial cells by a new method developed in our laboratory (Caroff M. Novel method for isolating endotoxins, Patent, 2004) using mixtures of isobutyric acid and ammonium hydroxide solution as extracting agents. Briefly, 40 mg of dried bacteria were extracted with an appropriate mixture of solvents. The extracts were then diluted with twice as much water and lyophilized. After lyophilization, the samples containing extracted LPS were washed twice with 600 μΐ of methanol (centrifugation: 7000 g, 14°C, 10 min), dried, suspended in water and again lyophilized. These samples were dispersed in water and treated first with DNAse and RNAse (2 μg of each enzyme/mg LPS, 37°C, 3 h from Sigma-Aldrich (St Louis, MO, USA) then with proteinase K (4 mg/mg LPS, 48°C, 3 h; Sigma-Aldrich). After this treatment, the LPS suspensions were ultracentrifuged (300,000 g, 4°C, 45 min), the supernatants were discarded and the pellets dispersed in water and lyophilized. The amount of recovered, purified LPS was 1.3 mg for the planktonic culture and 1.1 mg for the bacteria grown in biofilm (3.3% and 2.8% yields, respectively). A micro LPS extraction procedure was used for SDS-PAGE characterization of the LPS from different strains produced by different culture types. Lyophilized extracts obtained from ~3 mg of dried bacteria were taken in 50 μΐ of lysis buffer (2% SDS, 4% 2-mercaptoethanol, 10% glycerol, 1M Tris, pH 7.2) and treated with 30 μg of proteinase K for 2 h at 54°C to obtain gel loading samples.
Direct lipid A isolation from bacterial cells
[0081] For matrix-assisted laser desorption/ionisation mass spectrometry (MALDI- MS) analysis, lipid A was isolated directly by hydrolysis of bacterial cells. (El Hamidi A, Tirsoaga A, Novikov A et al. Microextraction of bacterial lipid A: easy and rapid method for mass spectrometric characterization. J Lipid Res 2005; 46: 1773-1778 ; Tirsoaga A, Novikov A, Adib-ConquyM et al. Simple method for repurification of endotoxins for biological use. Appl Environ Microbiol 2007; 73: 1803-1808). Briefly, lyophilized bacterial cells (6 mg) were suspended in 200 μΐ of isobutyric acid +1M ammonium hydroxide mixture (5 : 3, v : v) and kept for 2 h at 100°C in a screw-cap test tube under magnetic stirring. The suspension was cooled in ice water and centrifuged (2000 g, 10 min). The recovered supernatant was diluted with 2 volumes of water and lyophilized. The sample was then washed once with 200 ml of methanol (centrifugation 2000 g for 10 min). Finally, lipid A was extracted from the pellet in 100 μΐ of a mixture of chloroform, methanol and water (3 : 1.5 : 0.25, v : v : v).
Lipopolysaccharide analysis by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE)
[0082] Lipopolysaccharide was analyzed by SDS-PAGE, (Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 227: 680-685) employing separating and stacking gels containing 15% and 4% of acrylamide, respectively. Gels were loaded with 0.5-1 μg of purified LPS or with 0.5-1 μΐ of proteinase K treated LPS containing lysis buffer solutions and
electrophoresis was carried out in Trisglycine-SDS buffer at a constant current of 20mA for stacking and 25mA for separating gels. Gels were then fixed and stained with silver nitrate. (Tsai CM, Frasch CE. A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal Biochem 1982; 119: 115-1 19)
Matrix-assisted laser desorption/ionisation mass spectrometry
[0083] Analyses were performed on a PerSeptive Voyager-DE STR time-of-flight mass spectrometer (Applied Biosystems) in linear or reflectron mode with delayed extraction. Negative-ion mass-spectra were recorded. The ion-accelerating voltage was set at -20 kV. A few microlitres of chloroform-methanol-water extracts containing lipid A were desalted with a few beads of ion-exchange resin Dowex 50W-
X8 (H ). Aliquots (0.5-1 μΐ) of the solution were deposited on the target and covered with the matrix, dihydroxybenzoic acid (DHB) (Sigma-Aldrich), dissolved at 10 mg/ml in the same solvent. Different analyte/matrix ratios (1 : 2, 1 : 1, 2 : 1, v : v) were tested to obtain the best spectra. Lipid A from Bordetella pertussis and E. coli were used as external standards for mass calibration. Although MALDI-MS is not considered to be a quantitative technique, it can be used for qualitative comparisons when analyses are performed on strictly identical and parallel preparations showing highly reproducible data. In this work, special attention was given to the
reproducibility of MALDI mass spectra. For each combination, strain and culture type, the experiment was performed on three independent bacterial preparations and lipid A isolates. Only reproducible and significant changes in compared spectra (appearance or disappearance of peaks) were taken into account to draw qualitative conclusions.
Cytokine measurement by ELISA
[0084] Tumor necrosis factor-alpha content was measured in culture supernatants using specific mouse ELISA kits (DuoSet; R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions. β-galactosidase activity assay
[0085] To determine the level of β-galactosidase enzyme activity, bacteria were grown in M63B 1 minimal medium supplemented with 0.4 % glucose for 24 h under planktonic conditions, or for 96 h under continuous-flow biofilm conditions, β- galactosidase activity was assayed in triplicate as described previously (Miller, A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria (1992)) and expressed in Miller units.
Animal model
[0086] Catheter placement: TIVAPs were surgically implanted in CD/SD (IGS:Crl) rats (Charles River) as described in Chauhan et al, PloS one 7: e37281. Briefly, the port was implanted at dorsal midline towards the lower end of the thoracic vertebrae, and the catheter was inserted into the jugular vein. Prior to inoculation of clinical
strains, all rats were checked for the absence of infection by plating 100 μί^ blood as well as monitoring rats for the absence of luminescence signals. TIVAP contamination in rats and in vivo biofilm formation. The inoculum dose of 104 cells for overnight grown cultures of E. coli 55989 pAT881 WT, ApagP or PcL-pagP were injected into the port in a 50 μϊ^ volume. Planktonic bacteria were removed after 3 h of injection. Progression of colonization was monitored using an IVIS100 imaging system. Rats were sacrificed either 3 h or 7 days post-injection and TIVAPs were harvested. Serial dilutions from samples were plated on LB agar media for enumerating CFU/mL. In vivo inflammatory response: To estimate the host inflammatory response due to LPS palmitoylation, E. coli 55989 WT, ApagP or VcL-pagP grown in a microfermentor for 4 days were adjusted to 109 cells per 500 and injected into rats intravenously. Rats were sacrificed 2 h after injection and blood harvested aseptically and analyzed for IL-6 cytokine release in serum using ELISA.
Statistical analysis
[0087] One-tailed unpaired Student t-test analyses were performed using Prism 5.0 for Mac OS X (GraphPad Software, Inc.). Each experiment was performed at least 3 times. * p<0.05; ** p<0.01 ; *** pO.001.
Results
Evidence for biofilm-associated LPS modification in Escherichia coli biofilm
[0088] To investigate potential LPS modification in Escherichia coli biofilms, we used Tricine SDS-PAGE analysis to compare patterns of rough LPS (Ra, with no O- antigen) produced in biofilm and planktonic E. coli K-12 BW251 13 bacteria. This approach showed that LPS extracted from 96 h biofilm grown in continuous-flow microfermentors displayed an additional band, compared to 24 h stationary phase planktonic culture (Figure 1A, IE). Interestingly, this additional band progressively appeared starting from 48 h biofilms and disappeared when 96 h biofilm bacteria were re-cultivated in planktonic conditions, indicative of a reversible LPS modification specifically occurring within aging biofilms (Figure 1A). We then compared planktonic and biofilm LPS patterns in various commensal and pathogenic E. coli strains and we also observed the presence of an additional LPS band in biofilms formed by all tested commensal and pathogenic strains, including Enteroaggregative (EAEC) strains 55989 and 042 and uropathogenic (UPEC) strains 536 and CFT073 (Figure IB).
The biofilm-specific LPS modification corresponds to a lipid A palmitoylation
[0089] To determine which portion of E. coli LPS was modified in biofilm, we analyzed LPS extracted from 96 h biofilms formed by E. coli K12 BW25113 waaC deep rough mutant, which synthesizes a truncated LPS only containing a lipid A bound to a Kdo disaccharide (Figure 1C). Since the studied biofilm-specific band, hereafter referred to as Bf-band, appeared in mature biofilm formed by the waaC mutant (Figure ID), this suggested that the modification corresponding to the Bf-band is localized in the lipid A-Kdo2 part of the LPS (Figure 1C). Among the E. coli enzymes known to add a chemical group to the lipid A-Kdo2 portion, 4 of them are common to 55989, 042, 536, CFT073 and K-12 strains: ArnT (aminoarabinose addition to lipid A), EptA (phosphoethanolamine addition to lipid A), EptB
(phosphoethanolamine addition to Kdo), and PagP (palmitate addition to lipid A) [3]. We analyzed LPS of AarnT, AeptA, AeptB, and ApagP E. coli BW251 13 mutants extracted from 24h planktonic cultures and in 96 h biofilm cultures and we showed
that the Bf-band appeared in biofilm LPS oiAarnT, AeptA, and AeptB mutants (data not shown), but not in the LPS of a biofilm formed by ApagP mutant (Figure ID). By contrast, in a complemented BW251 13 ApagP pPagP strain, the Bf-band appears in both 24h planktonic and 96 h biofilm cultures (Figure ID). Since these results suggested that biofilm-specific Bf-band could correspond to palmitoylated lipid A, we purified lipid A from E. coli BW251 13 planktonic and 96 h biofilm cultures and analyzed the samples using MALDI-TOF mass spectrometry. This analysis showed that a peak at m/z = 2035.6 corresponding to a palmitoylated lipid A in biofilm extract almost disappears in planktonic conditions (Figures 2A, 2B, 2C). Consistently, we did not detect any palmitoylated lipid A in E. coli BW251 13 ApagP biofilm cultures (Figure 2D), while production of palmitoylated lipid A was restored upon
complementation by pPagP in planktonic and biofilm conditions (Figure 2E, 2F).
[0090] MALDI-TOF MS analysis of LPS extracted from E. coli waaC deep rough mutant grown under planktonic condition already showed significant lipid A palmitoylation, potentially due to increased membrane stress-dependent pagP expression. However, comparison between planktonic and biofilm bacteria showed that the only detected modification occurring in biofilm is a difference at m/z = 2035 and m/z = 2475 peaks, corresponding to palmitoylated lipid A and palmitoylated lipid A-Kdo2, respectively (Figure 2G, 2H).
Biofllm-associated lipid A palmitoylation is conserved in Gram-negative bacteria
[0091] To determine whether formation of biofilm is also associated with lipid A palmitoylation in non-K12 E. coli strains and in other Gram-negative bacteria, we extracted lipid A from biofilms and planktonic cultures of EAEC strains 55989 and 042 and UPEC strains 536 and CFT073, as well as from biofilms of Serratia marcescens, Klebsiella pneumoniae, Citrobacter koseri, and Proteus mirabilis species and subjected the samples to MALDI-TOF MS analysis. Determination of the lipid A palmitoylation rate as the ratio of the peak area at m/z = 2064 (corresponding to palmitoylated lipid A) over the peak area at m/z = 1826 (non-palmitoylated lipid A) showed that production of palmitoylated lipid A increased in biofilms compared to planktonic cultures in all tested bacteria (Figure 3 and Table 3). Moreover, MALDI- TOF mass spectrometry analysis of lipid A extracted from biofilms formed by several
pathogenic E. coli as well as various Gram-negative bacteria including Serratia marcescens, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Citrobacter koseri species, consistently showed increased levels of lipid A palmitoylation compared to corresponding planktonic cultures (Figures 3C - 3J). These results therefore indicate that, while biofilm-associated increase of lipid A palmitoylation is not restricted to E. coli K-12, it also corresponds to general phenomenon among Gram-negative bacteria, including prevalent species in biofilm-associated infections.
Table 3. Lipid A palmitoylation rate in 24-h planktonic and 96-h biofilm cultures of different Gram negative species.
Bacterial strain Palmitoylation level'
Bf/Pk Pk Bf Ratio
E. coli K-12 BW251 13 0.1 0.6 6
E. co/i K-12 BW251 13 AwaaC 0.94 1.35 1.4
E. coli 55989 0.3 1.1 3.7
E. coli 042 0.62 1.3 2.1
E. coli 536 1 1.35 1.35
E. coli CFT073 0.96 1.72 1.8
Citrobacter koseri 1.2 2.7 2.3
Serratia marcescens SM365 2.4 4.3 1.8
Klebsiella pneumoniae LM21 0.6 1.4 2.3
Klebsiella pneumoniae CH994 0.9 1.5 2.3
Klebsiella pneumoniae CH995 0.6 1.4 1.6
Klebsiella pneumoniae CH996 0.6 1.2 2.3
Pseudomonas aeruginosa ^ 'A 14 0.12 0.16 1.3
Pseudomonas aeruginosa B JN8 0.23 0.5 2.17
Pseudomonas aeruginosa B J 33 0.6 1.1 1.83
Pseudomonas aeruginosa B J 53 0.1 0.34 3.4
a The phosphorylation level was determined as the peak area of the major palmitoylated species, normalized by the peak area of the corresponding non- palmitoylated species (Figures 3C-J)
b Ratio of palmitoylation level in biofilm to palmitoylation level in planktonic conditions, all conditions being equal for the analysis.
H-NS represses pagP transcription in planktonic cultures
[0092] To investigate the regulation of reversible lipid A palmitoylation in mature biofilms of E. coli, we first placed pagP under the control of a constitutive promoter in E. coli BW25113 PcL-pagP and showed that this strain constitutively display the Bf-band both in planktonic and biofilm conditions (Figure 4A). This result suggested that lipid A palmitoylation is regulated at the transcriptional level. Consistently, use of a transcription pagP-lacZ fusion in E. coli BW25113 pagP-lacZ showed a 3 -fold increase in β-galactosidase activity in 96 h biofilm compared to planktonic culture (Figure 4C). While previous studies involved phoP or evgA as positive regulators of pagP expression, deletion in these 2 genes had no effect on pagP expression nor on the LPS profile in E. coli biofilm (Figure 4C, 4D). Moreover, LPS extracted from E. coli K-12 BW251 13 phoP or evgA mutants cultures still showed the presence of the Bf-band in biofilm cultures only (Figure 4E), demonstrating that biofilm-related palmitoylation is PhoPQ- and EvgAS-independent. Interestingly, the emergence of the additional LPS band under very late stationary phase conditions (96 h of planktonic culture) is also PhoPQ- and EvgAS-independent and is not inhibited upon supplementation with excess magnesium in the culture medium (Figure 4F).
Additionally, inactivation of various stress response regulators, including cpxR, rcsB, pspF, oxyR, soxR, arcA, rpoS, relA and luxS, had no impact on lipid A palmitoylation (Figure 4G).
[0093] To identify regulators oipagP expression in E. coli, we took advantage of the white color displayed by E. coli BW251 13 pagP-lacZ colonies on X-gal agar plates to screen for mutants derepressed for pagP biofilm-specific expression. Use of B W25113 pagP-lacZ TnSC 189 mariner-based transposon mutant library enabled us to identify 7 dark blue colonies corresponding either to trivial TnSC 189 insertion upstream of the pagP-lacZ fusion or to insertions into the hns gene, which encodes the global silencing protein repressor H-NS (Dorman, 2004). To confirm the role of H-NS on pagP expression, we monitored pagP expression in E. coli BW25113 Ahns pagP-lacZ planktonic cultures and observed a 18-fold increased pagP expression in the hns deletion mutant compared to the parental strain (Figure 4C). Consistent with this result, analysis of BW25113 Ahns pagP-lacZ LPS showed the presence of the Bf- band in planktonic and biofilm conditions (Figure 4E). Complementation of the Ahns pagP-lacZ mutant with plasmid pBAD33-/zws decreased expression oipagP (Figure
4H), therefore demonstrating that H-NS represses lipid A palmitoylation in E. coli planktonic bacteria.
The anti H-NS factor SlyA activates pagP transcription in mature biofllms
[0094] Increased pagP expression in mature biofilm condition suggested alleviation of H-NS repression by another E. coli regulator. Analysis of the pagP promoter region actually revealed three sequences that closely match the proposed consensus binding site for SlyA ((t/g)T(g/a)GCAA(g/t)C(a/t)AA), an anti-H-NS factor that antagonizes H-NS binding on a number of cell envelope E. coli genes (Stapleton, 2002; McVicker; 201 1; Corbett, 2007) (Figure 4B). We therefore tested the contribution of SlyA to pagP regulation and compared pagP expression in E. coli BW25113 pagP-lacZ and B W251 13 AslyA pagP-lacZ both in planktonic and 96 h biofilm and observed no pagP induction in the slyA background (Figure 4C).
Consistent with this result, analysis of LPS extracted from AslyA mutant showed no Bf-band in planktonic nor in biofilm cultures (Figure 4E). However, complementation of the slyA mutation in E. coli AslyA pagP-lacZ mutant with plasmid pCA24N-s y^ partially restored biofilm-associated induction oipagP expression (Figure 41). While these results demonstrated the role of SlyA in biofilm-associated pagP expression, it also suggested that slyA expression itself could be up-regulated in biofilm conditions. To test this, we compared slyA expression in E. coli BW251 13 slyA-lacZ in planktonic and 96-h biofilm. We observed a 1.7 fold induction of slyA expression in biofilm (Figure 4D).
[0095] The low expresion of E. coli BW25113 slyA-lacZ strain enabled us to search for regulators of slyA expression in biofilm by screening an E. coli BW251 13 slyA-ac TnSC189 transposon library on X-Gal agar plates. We found several blue colonies corresponding to insertion mutant in surA and degP genes. Consistent with the hypothesis that lack oisurA or degP could lead to SlyA overexpression, leading to relieve of H-NS repression and pagP expression, analysis of LPS extracted from E. coli AsurA mutants showed a Bf-band in both planktonic and biofilm cultures (Figure 4C). Whereas both SurA and DegP have periplasmic chaperone activity involved in outer membrane proteins assembly (Rouviere, 1996 ; Spiess, 1999), the DegP protease is involved in degradation of abnormal proteins in the periplasm, often
rescuing proteins falling off of the SurA pathway (Strauch, 1989). These results suggested that biofilm-associated envelop stress or perturbations of outer membrane assembly could elicit lipid A palmitoylation. Consistently, deletion in ompR, which codes for a regulator of porins expression, also led to apparition of the Bf-band in both planktonic and biofilm cultures (Figure 4C). However, mutant in genes coding for regulator of envelope stress response in E. coli, including cpxR, baeR, rpoE, rcsB and pspF (Rowley, 2006) all displayed wild type phenotype regarding lipid A palmitoylation and Bf-band production in biofilm conditions only. Similar results were obtained with other regulators usually associated with biofilm or stationary phase conditions, including rpoS, relA, luxS, soxR, oxyR, arcA, crp, phoB.
Lipid A palmitoylation increases resistance to antimicrobial peptide PG-1 and decreases inflammatory response to biofilm bacteria
[0096] The inventors observed that constitutive lipid A palmitoylation in BW251 13 PcL-pagP did not modify adhesion or biofilm formation in microtiter plates or dynamic flow microfermentors as compared with strains BW251 13 or BW251 13 ApagP, indicating that pagP is not important for biofilm formation in vitro (Figures 5A, 5B). However, previous studies performed in planktonic conditions in Salmonella enterica, Legionella pneumophila and Yersinia enterocolitica showed that incorporation of palmitate into lipid A promotes resistance to cationic antimicrobial peptides (CAMPs). The inventors observed that BW251 13 VcL-pagP 24h biofilm bacteria exposed to PG-1 for 2 h displayed increased resistance to cationic antimicrobial peptide (CAMP) PG- 1 as compared to unpalmitoylated wild type BW25113 24h biofilm bacteria (Figure 5C). Additionally, the inventors observed that E. coli 55989 VcL-pagP 24 h biofilm bacteria bacteria exposed to PG-1 for 24 h displayed increased resistance to PG-1 as compared to unpalmitoylated wild type 55989 biofilm bacteria (Figure 5D). Moreover, lipid A palmitoylation in E. coli was previously shown to decrease inflammatory activity of lipid A and the inventors observed that macrophage activation in J774A.1 cell line showed a 3 -fold reduction in release of TNF-a pro-inflammatory cytokine when brought in contact with bacteria producing palmitoylated lipid A (planktonic BW25113 PcL-pagP and E. coli
BW25113 96 hours biofilm bacteria) compared to bacteria without palmitoylated lipid A (planktonic BW251 13 and BW251 13 ApagP bacteria) (Figure 5E).
[0097] To test in a controlled manner whether non-palmitoylated 55989 ApagP lipid A triggers a higher inflammatory response than palmitoylated biofilm bacteria, E. coli 55989 wild-type ApagP and PcL-pagP biofilm bacteria were injected intravenously into rats. Two hours after injection, rat serum ELISA was used to measure the amount of IL-6 pro-inflammatory cytokine and observed a significant increase in the IL-6 level induced by 55989 ApagP biofilm bacteria compared to wild-type and PcL-pagP bacteria (Figure 5F). Consistently, we observed a 2-fold reduction in release of IL-6 by the macrophage when brought into contact with bacteria producing palmitoylated lipid A (Figure 5G). Taken together, these results demonstrate that biofilm-associated lipid A palmitoylation increases E. coli biofilm resistance to CAMP and decreases inflammatory response triggered by biofilm bacteria.
Lipid A palmitoylation increases biofilm in vivo survival of biofilm bacteria
[0098] Our results suggested that lipid A palmitoylation constitutes an adaptation to the biofilm environment contributing to biofilm bacteria resistance to host immune responses. To test this, we used a previously described clinically relevant in vivo rat model of biofilm-associated infection in totally implanted venous access port (TIVAP) (Chauhan et ah, Plos ONE 2012; Chauhan et a , Antimicrobial Agents and Chemotherapy 2012). We inoculated implanted rats with bioluminescent derivative strains(carrying plasmid pAT881) of E. coli 55989, 55989 ApagP and PcL-pagP 55989 leading to formation of bioluminescent biofilm in the chamber and catheter section of the implanted device. The biofilm biomass formed in the TIVAP was monitored everyday by bioluminescence imaging. A significant decrease in luminescence was observed in TIVAP colonized with 55989 ApagP bacteria, compared to the parent strain (Figure 6A). Seven days after inoculation of E. coli 55989, TIVAP were removed from rats, the intraluminal biofilms were extracted from the port and the catheter, and LPS were analyzed by Tricine SDS-PAGE, therefore demonstrating that lipid A palmitoylation also occurs in vivo (Figure 6B). The inventors then compared the extent of in vivo biofilm development after inoculation of implanted TIVAP by bioluminescent wild type E. coli 55989, and ApagP or PcL-
pagP E. coli 55989 derivatives. While no significant difference in adhesion to TIVAP in vitro or in vivo 5 hours after inoculation (Figure 6C), non-invasive monitoring of bioluminescent biofilm biomass formed in implanted TIVAP over 9 days of the experiment showed decrease in luminescence in TIVAP colonized by 55989 ApagP compared to the parent strain and Pcl-PagP (Figure 6D, 6E). After 9 days, rats were sacrificed and cfu quantification of bacteria recovered from implanted TIVAPs showed a significant decrease in bacterial number (Figure 6F) in 55989 ApagP compared to TIVAP colonized with wild type 55989 or 55989 PcL-pagP bacteria. These results suggested a potential contribution of lipid A palmitoylation to the control of biofilm- infection dynamics by the host.
[0099] Taken together these results show that lipid A palmitoylation increase biofilm bacteria survival in vivo, potentially by damping inflammatory responses and host immune defenses against biofilm bacteria.
Lipid A palmitoylation also occurs in late stationary phase
[0100] The biofilm lifestyle shares similarities with the planktonic stationary phase, while also exhibiting specific traits (Beloin, 2004). To determine whether lipid A palmitoylation was biofilm-specific or associated with late stationary phase conditions, we analyzed the lipid A of E. coli BW25113 grown in planktonic culture. Lipid A palmitoylation appeared after 2 days of growth (Figure 7B, arrows). Like in 4-day old biofilms, palmitoylation in 4-day old planktonic culture was regulated by H-NS/SlyA, and was independent of PhoPQ and EvgAS two-component systems (Figure 8). These results indicate that the stimuli that induce lipid A palmitoylation are present both in aging biofilm and in aging planktonic cultures.
REFERENCES
1. Beveridge, T.J., et al, Interactions between biofilms and the environment. FEMS microbiology reviews, 1997. 20(3-4): p. 291-303.
2. Ciornei, CD., et al, Biofilm-forming Pseudomonas aeruginosa bacteria undergo lipopolysaccharide structural modifications and induce enhanced
inflammatory cytokine response in human monocytes. Innate immunity, 2010. 16(5): p. 288-301.
3. Trent, M.S., et al, Diversity of endotoxin and its impact on pathogenesis. Journal of endotoxin research, 2006. 12(4): p. 205-23.
4. Eguchi, Y., et al, Signal transduction cascade between EvgA/EvgS and PhoP/PhoQ two-component systems of Escherichia coli. Journal of bacteriology, 2004. 186(10): p. 3006-14.
5. Jia, W., et al, Lipid trafficking controls endotoxin acylation in outer membranes of Escherichia coli. The Journal of biological chemistry, 2004. 279(43): p. 44966-75.
6. Chiang, S.L. and E.J. Rubin, Construction of a mariner-based transposon for epitope-tagging and genomic targeting. Gene, 2002. 296(1-2): p. 179-85.
7. Kawasaki, K., R.K. Ernst, and S.I. Miller, Deacylation and palmitoylation of lipid A by Salmonellae outer membrane enzymes modulate host signaling through Toll-like receptor 4. Journal of endotoxin research, 2004. 10(6): p. 439-44.
[0101] While certain embodiments have been illustrated and described, it should be understood that changes and modifications can be made therein in accordance with ordinary skill in the art without departing from the technology in its broader aspects as defined in the following claims.
Claims
1. A method for detecting Gram negative bacteria biofilm in a biological sample comprising:
isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample;
detecting the level of palmitoylated lipid A in the isolated or extracted lipopolysaccharides;
comparing this level with a reference level; and
determining that the Gram negative biofilm is present in the biological sample when the level of palmitoylayed lipid A in the isolated or extracted polysaccharides is higher than the reference level.
2. The method according to claim I, wherein the reference level is the level of palmitoylated lipid A in the lipopolysaccharides of a planktonic culture of Gram negative bacteria that has been grown for at least 24 hours.
3. The method according to claim 1 , wherein the Gram negative bacteria biofilm has been grown for at least 2 days.
4. The method according to claim I, wherein the Gram negative bacteria comprise a pagP gene homolog in their genome; or
an outer membrane lipid A palmitoyl transferase PagP.
5. The method according to claim 4, wherein the Gram negative bacteria comprise
Escherichia coii, Serratia marcescens, Citrobacter koseri, Klebsiellia pneumonia, or Pseudomonas aeruginosa.
6. The method according to claim 1, wherein the level of palmitoylated lipid A is determined by mass spectrometry.
7. The method according to claim 6, wherein the mass spectrometry is
electrospray ionisation (ESI) or a matrix-assisted laser desorption ionisation (MALDI).
8. The method according to claim 1, wherein the level of palmitoylated lipid A is determined by carrying out an immunological technique.
9. The method according to claim 8, wherein the immunological technique
comprises the use of monoclonal or polyclonal antibodies specific for Gram negative bacteria palmitoylated LPS, an ELISA technique, an
immunoenzymatic technique, an immunofluorescence technique, a radio- immunological technique, or a chemo-immunological technique.
10. The method according to claim 1, wherein the biological sample is collected from a human patient suspected of being infected by a Gram negative bacteria biofilm.
11. The method according to claim 10, wherein the biological sample comprises a blood sample, a urine sample, a biopsy collected at a suspected infection site, or a liquid sample collected in a medical implant.
12. The method according to claim 1 1, wherein the suspected infection site is a wound site.
13. The method according to claim 1 1, wherein the medical implant is a short term catheter, dialysis catheter, or a totally implantable venous access port (TIVAP).
14. The method according to claim 10, further comprising administering to the human patient an antibiotic treatment specific for the detected Gram negative bacteria biofilm.
15. The method according to claim 1, further comprising detecting a level of lipid A in the isolated or extracted lipopolysaccharides, wherein the reference level is the level of lipid A in the isolated or extracted lipopolysaccharides of the biological sample.
16. The method according to claim 1, wherein an increase of at least 50% in the level of palmitoylated lipid A, compared with the reference level, is indicative of the presence of a Gram negative bacteria biofilm in the biological sample.
An apparatus for carrying out the method according to claim 1, comprising: a technical device for detecting the level of palmitoylated lipid A in isolated or extracted lipopolysaccharides, and
a calculating or computer device for comparing the level with a
reference level.
A method for detecting the presence or the absence of Gram negative bacteria in a biofilm of a biological sample comprising:
isolating or extracting bacterial lipopolysaccharides (LPS) from the biofilm of the biological sample; and
detecting the presence or absence of palmitoylated lipid A in isolated or extracted LPS;
determining that Gram negative bacteria in the biofilm is present in the biological sample when the presence of palmitoylated lipid A is detected.
A method for treating a patient infected with Gram negative bacteria, comprising
isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from the patient;
detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administering an antibiotic treatment specific for Gram negative
bacteria to the patient when the presence of palmitoylated lipid
A is detected.
The method according to claim 19, wherein the biological sample is a biofilm formed in a wound site, a liquid sample collected in a medical implant, a short term catheter, a dialysis catheter, or a totally implantable venous access port (TIVAP).
A method for optimizing therapeutic efficacy for treatment of a Gram negative bacterial infection, comprising:
isolating or extracting bacterial lipopolysaccharides (LPS) from a biological sample collected from a patient;
detecting the presence or absence of palmitoylated lipid A in isolated or extracted lipopolysaccharides in the sample; and administering an antibiotic treatment specific for Gram negative
bacteria to the patient when the presence of palmitoylated lipid
A is detected.
The method according to claim 21 , wherein the biological sample is a biofilm formed in a wound site, a liquid sample collected in a medical implant, a short term catheter, a dialysis catheter, or a totally implantable venous access port (TIVAP).
The method according to claim 21, wherein the patient is a human patient.
A method of treatment, comprising administering an antibiotic treatment specific for Gram negative bacteria to a patient identified as harboring a biological sample comprising palmitoylated lipid A.
A method for detecting palmitoylated lipid A in a biological sample, comprising
obtaining a biological sample;
isolating or extracting bacterial lipopolysaccharides (LPS) from the biological sample; and
detecting the presence of palmitoylated lipid A in the isolated or extracted
lipopolysaccharides.
The method of claim 25, wherein said detecting occurs by a mass spectrometry technique or an immunological technique.
A method of treating a patient that has a biological sample determined to have a Gram negative bacteria biofilm according to claim 1, comprising administering an antibiotic treatment to the patient.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261733861P | 2012-12-05 | 2012-12-05 | |
| US61/733,861 | 2012-12-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014087241A2 true WO2014087241A2 (en) | 2014-06-12 |
| WO2014087241A3 WO2014087241A3 (en) | 2014-11-20 |
Family
ID=50280434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2013/003113 Ceased WO2014087241A2 (en) | 2012-12-05 | 2013-12-04 | Methods of detecting biofilms from the palmitoylation of lipopolysaccharides |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014087241A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116413367A (en) * | 2021-12-30 | 2023-07-11 | 复旦大学 | A high-throughput method for analyzing intact S-palmitoylated proteins/peptides and its application |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022508A (en) * | 2017-04-21 | 2017-08-08 | 华东理工大学 | A kind of Escherichia coli O 157:The cultural method of H7 mycoderms |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103108643B (en) * | 2010-01-22 | 2016-10-26 | 希普罗特克有限公司 | Comprise the antibacterial of peroxide, alcohol and chelating agen |
-
2013
- 2013-12-04 WO PCT/IB2013/003113 patent/WO2014087241A2/en not_active Ceased
Non-Patent Citations (16)
| Title |
|---|
| BEVERIDGE, T.J. ET AL.: "Interactions between biofilms and the environment", FEMS MICROBIOLOGY REVIEWS, vol. 20, no. 3-4, 1997, pages 291 - 303 |
| CHAUHAN ET AL., ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, 2012 |
| CHAUHAN ET AL., PLOS ONE, 2012 |
| CHAUHAN ET AL., PLOS ONE, vol. 7, pages E37281 |
| CHIANG, S.L.; E.J. RUBIN: "Construction of a mariner-based transposon for epitope-tagging and genomic targeting", GENE, vol. 296, no. 1-2, 2002, pages 179 - 85, XP004386954, DOI: doi:10.1016/S0378-1119(02)00856-9 |
| CIORNEI, C.D. ET AL.: "Biofilm-forming Pseudomonas aeruginosa bacteria undergo lipopolysaccharide structural modifications and induce enhanced inflammatory cytokine response in human monocytes", INNATE IMMUNITY, vol. 16, no. 5, 2010, pages 288 - 301, XP008169548, DOI: doi:10.1177/1753425909341807 |
| EGUCHI, Y. ET AL.: "Signal transduction cascade between EvgAlEvgS and PhoP/PhoQ two-component systems ofEscherichia coli", JOURNAL OF BACTERIOLOGY, vol. 186, no. 10, 2004, pages 3006 - 14 |
| EL HAMIDI A; TIRSOAGA A; NOVIKOV A ET AL.: "Microextraction of bacterial lipid A: easy and rapid method for mass spectrometric characterization", J LIPID RES, vol. 46, 2005, pages 1773 - 1778 |
| FERRIERES ET AL., J. BACTERIOLOGY, vol. 192, pages 6418 - 6427 |
| GHIGO, NATURE, vol. 412, pages 442 - 445 |
| JIA, W. ET AL.: "Lipid trafficking controls endotoxin acylation in outer membranes ofEscherichia coli", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 279, no. 43, 2004, pages 44966 - 75 |
| KAWASAKI, K.; R.K. ERNST; S.I. MILLER: "Deacylation and palmitoylation of lipid A by Salmonellae outer membrane enzymes modulate host signaling through Toll-like receptor 4", JOURNAL OF ENDOTOXIN RESEARCH, vol. 10, no. 6, 2004, pages 439 - 44, XP008169564, DOI: doi:10.1177/09680519040100061001 |
| LAEMMLI UK: "Cleavage of structural proteins during the assembly of the head of bacteriophage T4", NATURE, vol. 227, 1970, pages 680 - 685, XP055108426, DOI: doi:10.1038/227680a0 |
| TIRSOAGA A; NOVIKOV A; ADIB-CONQUYM ET AL.: "Simple method for repurification of endotoxins for biological use", APPL ENVIRON MICROBIOL, vol. 73, 2007, pages 1803 - 1808 |
| TRENT, M.S. ET AL.: "Diversity of endotoxin and its impact on pathogenesis", JOURNAL OF ENDOTOXIN RESEARCH, vol. 12, no. 4, 2006, pages 205 - 23, XP008169569, DOI: doi:10.1177/09680519060120040201 |
| TSAI CM; FRASCH CE: "A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels", ANAL BIOCHEM, vol. 119, 1982, pages 115 - 119, XP024820963, DOI: doi:10.1016/0003-2697(82)90673-X |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116413367A (en) * | 2021-12-30 | 2023-07-11 | 复旦大学 | A high-throughput method for analyzing intact S-palmitoylated proteins/peptides and its application |
| CN116413367B (en) * | 2021-12-30 | 2025-11-28 | 复旦大学 | High-throughput method for analyzing complete S-palmitoylation modified protein/peptide fragment and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014087241A3 (en) | 2014-11-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chalabaev et al. | Biofilms formed by gram-negative bacteria undergo increased lipid a palmitoylation, enhancing in vivo survival | |
| Sevrin et al. | Adaptation of adherent-invasive E. coli to gut environment: Impact on flagellum expression and bacterial colonization ability | |
| Prudent et al. | The Crohn’s disease-related bacterial strain LF82 assembles biofilm-like communities to protect itself from phagolysosomal attack | |
| Lin et al. | Virulence and stress responses of Shigella flexneri regulated by PhoP/PhoQ | |
| Zhang et al. | TssB is essential for virulence and required for type VI secretion system in Ralstonia solanacearum | |
| Crouzet et al. | Pseudomonas aeruginosa cells attached to a surface display a typical proteome early as 20 minutes of incubation | |
| Marshall et al. | The O-antigen capsule of Salmonella enterica serovar Typhimurium facilitates serum resistance and surface expression of FliC | |
| Bontemps‐Gallo et al. | Concentration of osmoregulated periplasmic glucans (OPGs) modulates the activation level of the RcsCD RcsB phosphorelay in the phytopathogen bacteria D ickeya dadantii | |
| Saha et al. | Lipid A heterogeneity and its role in the host interactions with pathogenic and commensal bacteria | |
| Meyer et al. | The role of the galU gene of uropathogenic Escherichia coli in modulating macrophage TNF-α response | |
| Bai et al. | TssL2 of T6SS2 is required for mobility, biofilm formation, wrinkly phenotype formation, and virulence of Vibrio parahaemolyticus SH112 | |
| EP2008105A2 (en) | Methods of detecting and controlling mucoid pseudomonas biofilm production | |
| ES2885830T3 (en) | Compositions for the inhibition of Giardia lamblia | |
| WO2014087241A2 (en) | Methods of detecting biofilms from the palmitoylation of lipopolysaccharides | |
| Crépin et al. | The UDP‐GalNAcA biosynthesis genes gna‐gne2 are required to maintain cell envelope integrity and in vivo fitness in multi‐drug resistant Acinetobacter baumannii | |
| Nair et al. | Spermidine facilitates the adhesion and subsequent invasion of Salmonella Typhimurium into epithelial cells via the regulation of surface adhesive structures and the SPI-1 | |
| Al-Feghali | Contribution of Growth Modes and Environmental Signals to PmrAB and PhoPQ-Dependent Regulation of Colistin Resistance in Pseudomonas aeruginosa | |
| Sharma et al. | Clustered Regularly Interspaced Short Palindromic Repeats-Cas system regulates Salmonella virulence | |
| Ramesh | Investigation of molecular mechanisms of biofilm dispersal and attempts to create an inducible gene expression system in Campylobacter | |
| Lopez | Evaluation of Escherichia coli Specialized Metabolites Implicated in Inflammatory Bowel Disease Complications | |
| Crépin et al. | resistant Acinetobacter baumannii | |
| Trespidi | Molecular study of the Burkholderia cenocepacia division cell wall operon and FtsZ interactome as targets for new drugs | |
| Cotten | Role of s2U tRNA modification and ribosomal protein expression in antibiotic tolerance of Yersinia pseudotuberculosis | |
| Gwozdzinski | Macromolecular modification of the cell wall of Gram-negative bacteria leading to antibiotic resistance and formation of outer membrane vesicles | |
| Clark | Investigating predation by the predatory bacterium Bdellovibrio bacteriovorus at the interface between predatory bacteria, pathogenic prey, and the host immune response |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13838049 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13838049 Country of ref document: EP Kind code of ref document: A2 |