WO2014075697A1 - Agents for treatment of claudin expressing cancer diseases - Google Patents

Agents for treatment of claudin expressing cancer diseases Download PDF

Info

Publication number
WO2014075697A1
WO2014075697A1 PCT/EP2012/004712 EP2012004712W WO2014075697A1 WO 2014075697 A1 WO2014075697 A1 WO 2014075697A1 EP 2012004712 W EP2012004712 W EP 2012004712W WO 2014075697 A1 WO2014075697 A1 WO 2014075697A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
cells
binding agent
cell
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2012/004712
Other languages
French (fr)
Inventor
Ugur Sahin
Özlem TÜRECI
Christiane STADLER
Julia HOLLAND
Hayat BÄHR-MAHMUD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ganymed Pharmaceuticals GmbH
TRON Translationale Onkologie an der Universitaetsmedizin der Johannes Gutenberg Universitaet Mainz gGmbH
Biontech SE
Original Assignee
Ganymed Pharmaceuticals GmbH
TRON Translationale Onkologie an der Universitaetsmedizin der Johannes Gutenberg Universitaet Mainz gGmbH
Biontech SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ganymed Pharmaceuticals GmbH, TRON Translationale Onkologie an der Universitaetsmedizin der Johannes Gutenberg Universitaet Mainz gGmbH, Biontech SE filed Critical Ganymed Pharmaceuticals GmbH
Priority to PCT/EP2012/004712 priority Critical patent/WO2014075697A1/en
Priority to CA2890438A priority patent/CA2890438C/en
Priority to CA3169263A priority patent/CA3169263A1/en
Priority to MX2015006003A priority patent/MX369276B/en
Priority to RU2015122484A priority patent/RU2678127C2/en
Priority to NZ707831A priority patent/NZ707831A/en
Priority to EP20189087.8A priority patent/EP3766903A3/en
Priority to RU2019100107A priority patent/RU2798990C2/en
Priority to CN201380070299.1A priority patent/CN105073776B/en
Priority to KR1020247006822A priority patent/KR20240033145A/en
Priority to UAA201805270A priority patent/UA128182C2/en
Priority to NZ746691A priority patent/NZ746691A/en
Priority to IL282953A priority patent/IL282953B2/en
Priority to BR122020024124-1A priority patent/BR122020024124B1/en
Priority to SG11201503593UA priority patent/SG11201503593UA/en
Priority to KR1020157015900A priority patent/KR102240664B1/en
Priority to NZ748133A priority patent/NZ748133A/en
Priority to CN201910208606.7A priority patent/CN110144012A/en
Priority to KR1020217010605A priority patent/KR102381936B1/en
Priority to BR112015010740-0A priority patent/BR112015010740B1/en
Priority to AU2013347184A priority patent/AU2013347184B2/en
Priority to PCT/EP2013/003399 priority patent/WO2014075788A1/en
Priority to JP2015542186A priority patent/JP6499079B2/en
Priority to HK15110113.4A priority patent/HK1209434A1/en
Priority to KR1020227010407A priority patent/KR102643443B1/en
Priority to US14/442,445 priority patent/US10093736B2/en
Priority to EP13789492.9A priority patent/EP2920209B1/en
Priority to UAA201505768A priority patent/UA117741C2/en
Publication of WO2014075697A1 publication Critical patent/WO2014075697A1/en
Priority to ZA2015/02737A priority patent/ZA201502737B/en
Priority to IL238464A priority patent/IL238464B/en
Priority to MX2020011710A priority patent/MX2020011710A/en
Priority to MX2019012846A priority patent/MX2019012846A/en
Priority to MX2020011716A priority patent/MX2020011716A/en
Anticipated expiration legal-status Critical
Priority to AU2018211278A priority patent/AU2018211278B2/en
Priority to US16/117,197 priority patent/US10717780B2/en
Priority to JP2019046753A priority patent/JP6799101B2/en
Priority to US16/898,892 priority patent/US20200399370A1/en
Priority to JP2020192368A priority patent/JP2021040641A/en
Priority to US18/051,850 priority patent/US20240228616A1/en
Priority to JP2022193268A priority patent/JP2023022247A/en
Priority to JP2025003505A priority patent/JP2025063140A/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/74—Inducing cell proliferation

Definitions

  • Claudins are integral membrane proteins located within the tight junctions of epithelia and endothelia. Claudins are predicted to have four transmembrane segments with two extracellular loops, and N- and C-termini located in the cytoplasm.
  • the claudin (CLDN) family of transmembrane proteins plays a critical role in the maintenance of epithelial and endothelial tight junctions and might also play a role in the maintenance of the cytoskeleton and in cell signaling.
  • CLDN 18 The claudin 18 (CLDN 18) molecule is an integral transmembrane protein (tetraspanin) having four membrane spanning hydrophobic regions and two extracellular loops (loopl embraced by hydrophobic region 1 and hydrophobic region 2; loop2 embraced by hydrophobic regions 3 and 4). CLDN 18 exists in two different splice variants, which are described in mouse and in human (Niimi, Mol. Cell. Biol. 21 :7380-90, 2001 ).
  • the splice variants (Genbank accession number: splice variant 1 (CLDN 18.1 ): NP_057453, NM_016369, and splice variant 2 (CLDN18.2): NM 001002026, NP 001002026) have a molecular weight of approximately 27,9 / 27,72 kD.
  • the splice variants CLDN 18.1 and CLDN 18.2 differ in the N-terminal portion which comprises the first transmembrane (TM) region and loopl , whereas the primary protein sequence of the C- terminus is identical. In normal tissues, there is no detectable expression of CLDN 18.2 with exception of stomach where CLDN 18.2 is expressed exclusively on short-lived differentiated gastric epithelial cells.
  • CLDN 18.2 is maintained in the course of malignant transformation and thus frequently displayed on the surface of human gastric cancer cells. Moreover, this pan-tumoral antigen is ectopically activated at significant levels in esophageal, pancreatic and lung adenocarcinomas.
  • the CLDN 18.2 protein is also localized in lymph node metastases of gastric cancer adenocarcinomas and in distant metastases especially into the ovary (so-called Krukenberg tumors).
  • CLDN6 is expressed in a series of different human cancer cells while expression in normal tissues is limited to placenta.
  • claudins such as CLDN18.2 and CLDN6 between cancer and normal cells, their membrane localization and their absence from the vast majority of toxicity relevant normal tissues makes these molecules attractive targets for cancer immunotherapy and the use of antibody-based therapeutics for targeting claudins in cancer therapy promises a high level of therapeutic specificity.
  • T cells for the treatment of cancer include vaccination with tumor-derived proteins, RNA or peptide antigen, infusion of tumor-derived, ex-vivo expanded T cells (called adoptive transfer), T cell receptor gene transfer or direct engagement of T cells by bi- or trispecific antibodies.
  • stimulants of T cell responses are clinically tested in combination or as monotherapy, such as ligands for Toll-like receptors, antibodies blocking CTLA-4 on T cells, immune stimulatory cytokines, or antibodies neutralizing molecules involved in immune escape of cancer cells such as TGF-beta or B7-H1.
  • T cell-based therapies is motivated by the observation that patients appear to live significantly longer if their tumors are infiltrated by T cells.
  • numerous mouse models have shown that engagement of T cells by various means can eradicate even large tumors and a number of T cell therapies have recently made significant progress in treating various cancer indications.
  • the solution of the problem underlying the invention is based on the concept of generating a binding agent that contains a binding domain that is specific for a tumor-associated claudin molecule, i.e. cancer cells .
  • the other binding domain is specific for CD3 allowing binding to T cells and allows to pull the T cells into the complex, thus making it possible to target the cytotoxic effect of the T cells to the cancer cells. Formation of this complex can induce signalling in cytotoxic T cells, either on its own or in combination with accessory cells, which leads to the release of cytotoxic mediators.
  • the invention relates to a binding agent comprising at least two binding domains, wherein a first binding domain binds to claudin and a second binding domain binds to CD3.
  • the binding agent of the invention may bind to a cytotoxic cell (by engaging the CD3 receptor) and a cancer cell expressing CLDN to be destroyed as a target.
  • the binding agent is a bispecific molecule such as a bispecific antibody, in particular a bispecific single chain antibody.
  • said claudin is expressed in a cancer cell. In one embodiment said claudin is expressed on the surface of a cancer cell. In one embodiment said claudin is selected from the group consisting of claudin 18.2 and claudin 6.
  • said first binding domain binds to an extracellular domain of said claudin. In one embodiment said first binding domain binds to native epitopes of CLDN present on the surface of living cells. In one embodiment said first binding domain binds to the first extracellular loop of CLDN. In one embodiment said second binding domain binds to the epsilon-chain of CD3.
  • said CD3 is expressed on the surface of a T cell.
  • binding of said binding agent to CD3 on T cells results in proliferation and/or activation of said T cells, wherein said activated T cells preferably release cytotoxic factors, e.g. perforins and granzymes, and initiate cytolysis and apoptosis of cancer cells.
  • said binding to claudin and/or said binding to CD3 is a specific binding.
  • the binding agent is in the format of a full-length antibody or an antibody fragment. In one embodiment the binding agent comprises four antibody variable domains with at least two binding domains, wherein at least one binding domain binds to claudin and at least one binding domain binds to CD3.
  • the binding agent comprises a variable domain of a heavy chain of an immunoglobulin (VH) with a specificity for a claudin antigen (VH(CLDN)), a variable domain of a light chain of an immunoglobulin (VL) with a specificity for a claudin antigen (VL(CLDN)), a variable domain of a heavy chain of an immunoglobulin (VH) with a specificity for CD3 (VH(CD3)), and a variable domain of a light chain of an immunoglobulin (VL) with a specificity for CD3 (VL(CD3)).
  • the binding agent is in the format of a diabody that comprises a heavy chain variable domain connected to a light chain variable domain on the same polypeptide chain such that the two domains do not pair.
  • the diabody comprises two polypeptide chains, wherein one polypeptide comprises VH(CLDN) and VL(CD3) and the other polypeptide chain comprises VH(CD3) and VL(CLDN).
  • the binding agent is in the format of a bispecific single chain antibody that consists of two scFv molecules connected via a linker peptide, wherein the heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are preferably arranged, from N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN) or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN).
  • said heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are connected via a long peptide linker, preferably, a peptide linker comprising the amino acid sequences (GGGGS)3 or VE(GGGGS)2GGVD.
  • said two VH-VL or VL-VH scFv units are connected via a short peptide linker, preferable a peptide linker comprising the amino acid sequence SGGGGS or GGGGS.
  • said CLDN is CLDN18.2 and said VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof or a variant of said amino acid sequence or fragment.
  • said CLDN is CLDN6 and said VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof or a variant of said amino acid sequence or fragment.
  • said VH(CD3) comprises an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CD3) comprises an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof or a variant of said amino acid sequence or fragment.
  • said CLDN is CLDN 18.2 and said binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a fragment or variant thereof.
  • said CLDN is CLDN6 and said binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a fragment or variant thereof.
  • said cancer cells expressing CLDN18.2 are cancer cells of a cancer selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, cancer of the gallbladder and the metastasis thereof, a rukenberg tumor, peritoneal metastasis and/or lymph node metastasis.
  • NSCLC non small cell lung cancer
  • said cancer cells expressing CLDN6 are cancer cells of a cancer selected from the group consisting of urinary bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ile
  • the binding agent has an N-terminal secretion signal and/or a C-terminal histidin epitope tag, preferable a six hisidin epitope tag.
  • the invention relates to a recombinant nucleic acid which encodes a binding agent of the invention.
  • the recombinant nucleic acid is in the form of a vector.
  • the invention relates to a host cell comprising a recombinant nucleic acid of the invention.
  • the invention relates to the binding agent of the invention or the recombinant nucleic acid of the invention for use in therapy, in particular for use in treating or preventing cancer.
  • the invention relates to a pharmaceutical composition comprising the binding agent of the invention or the recombinant nucleic acid of the invention.
  • the invention relates to a method of treating or preventing a cancer disease comprising administering to a patient the pharmaceutical composition of the invention.
  • cells of said cancer express a claudin to which said binding agent is capable of binding.
  • said claudin is CLDN18.2 and said cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer, hepatic cancer, head- neck cancer, cancer of the gallbladder and the metastasis thereof, a Krukenberg tumor, peritoneal metastasis and/or lymph node metastasis.
  • NSCLC non small cell lung cancer
  • breast cancer breast cancer
  • ovarian cancer colon cancer
  • hepatic cancer hepatic cancer
  • head- neck cancer cancer of the gallbladder and the metastasis thereof
  • Krukenberg tumor peritoneal metastasis and/or lymph node metastasis.
  • said claudin is CLDN6 and said cancer is selected from the group consisting of urinary bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum,
  • the invention provides a binding agent or nucleic acid coding therefor as described herein for use in the methods of treatment described herein. In one embodiment, the invention provides a pharmaceutical composition as described herein for use in the methods of treatment described herein.
  • CLDN18.2 preferably has the amino acid sequence according to SEQ ID NO: 1 and CLDN6 preferably has the amino acid sequence according to SEQ ID NO: 2 or 3.
  • FIGURE 1 Modular scheme illustrating the design of recombinant bi-scFv proteins targeting TAA CLDN18.2.
  • Anti-CLDN18.2 VH and VL regions are generated from the sequence of a monoclonal CLDN18.2 antibody (mCLDN18.2ab).
  • Anti-CD3 stands comprehensive for V H and V L regions generated from the sequences of the following monoclonal CD3 antibodies: UCHT1- HU (humanized mAB), UCHT1, CLB-T3, TR66, 145-2C11.
  • Bi-scFv indicates bispecific single chain variable fragment
  • His hexahistidyl-tag
  • HU humanized
  • LL long linker (15-18 amino acids)
  • Sec secretion signal
  • SL short linker (5-6 amino acids)
  • TAA tumor associated antigen
  • V variable region of the heavy (H) and light (L) chain of the antibody.
  • FIGURE 2 Effect of domain orientation and anti-CD3-scFv selection on specific target cell lysis: 5'-mCLDN18.2ab v H "V L _ TR66 V L-3' bi-scFvs IBiMAB and no.15 are the most potent variants.
  • FIGURE 3 Coomassie gel and western blot analysis of bi-scFv protein 1 BiMAB.
  • FIGURE 4 Bi-scFv protein 1 BiMAB binds efficiently and specifically to CLDN18.2- expressing target cells and human T cells.
  • FIGURE 5 Bi-scFv protein IBiMAB leads to T cell clustering on CLDN18.2 positive target cells.
  • CLDN18.2 endogenously expressing NugC4 cells were incubated for 24h with 1 ng/ml and 1 ⁇ g/ml IBiMAB and human T cells in an effector to target ratio of 5:1 in 6- well plates.
  • T cells alone (TL), target cells alone (NugC4) and human T cells with target cells (-Ctrl) were chosen as control samples. After 24h samples were photographed with a Nikon Eclipse Ti microscope with 200x magnification. White arrowheads point to T cell clusters on target cells. TL indicates T lymphocyte.
  • CLDN18.2 endogenously expressing NugC4 cells were incubated for 24h and 48h with escalating concentrations of bi-scFv protein IBiMAB (0.001 - 1000 ng/ml) and human T cells in an effector to target ratio of 5:1 in duplicates in a 24- well format.
  • As control human T cells were incubated with 1-1000 ng/ml IBiMAB without NugC4 target cells to verify the target dependent activation of T cells mediated by IBiMAB.
  • T cells were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC and analyzed by flow cytometry.
  • TL indicates T lymphocyte.
  • FIGURE 7 IBiMAB mediates strictly target dependent T cell activation even after long term incubation with CLDN18.2 high, low, and non-expressing cell lines.
  • (A) RT-PCR data generated from total RNA of six tumor cell lines are shown. Ct-values of CLDN18.2 expression normalized to housekeeping gene HPRT has been calculated from two independent experiments.
  • Breast cancer cell line MCF7 (grey bar) was chosen as negative CLDN18.2-expressing control cell line.
  • T cells were labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC to analyze total T cell population (CD3), early activation (CD69), and late activation (CD25) of T cells by flow cytometry.
  • TL indicates T lymphocyte.
  • FIGURE 8 IBiMAB induces T cell proliferation and Granzyme B upregulation only in the presence of CLDN18.2 positive target cells.
  • Effector to target ratio was of 5: 1 in a 6-well format. After 96h of coincubation T cells were harvested and intracellularly stained with anti-GrB-PE and analyzed by flow cytometry. MFI of anti-GrB-PE signal was calculated by FlowJo software. The signal of unstained sample TL + NugC4 + 5 ng/ml IBiMAB was substracted from all samples. CFSE indicates carboxyfluorescein succinimidyl ester; GrB, Granzyme B; MFI, mean fluorescence intensity; PE, phycoerythrin; TL, T lymphocytes.
  • FIGURE 9 EC50 of IBiMAB for specific target cell lysis after 48h is approximately 10 pg/ml.
  • IBiMAB shows therapeutic in vivo efficacy in an advanced SC tumor model.
  • NOD.Cg-Prkdscid IL2rgtmlWjl/SzJ (NSG) mice were injected SC with l xl O 7 HE 293 stably expressing CLDN18.2.
  • 5 days later 2xl0 7 human PBMC effector cells were injected IP to groups G3 and G4, control groups (Gl and G2) received PBS only.
  • A The tumor volume of single mice and the median per group is shown for treatment days 0 and 15 (upper row), and 3 and 13 days after the end of treatment (bottom row).
  • B The mean tumor volume of the two treatment groups engrafted with human effector cells is shown. Dashes indicate sacrificed animals.
  • C Kaplan- Meier survival curve presenting all groups from the day of tumor inoculation to day 41. Animals were sacrificed as soon as the tumor volume exceeded 500 mm 3 . After day 41 all remaining animals were sacrificed to analyze the engraftment of human effector cells in the spleens of mice.
  • FIGURE 11 Modular scheme illustrating the design of recombinant bi-scFv proteins targeting TAA CLDN6.
  • Bi-scFv indicates bispecific single chain variable fragment; His, hexahistidyl-tag; LL, long linker (15-18 amino acids); Sec, secretion signal; SL, short linker (5 amino acids); TAA, tumor associated antigen; V, variable region of the heavy (H) and light (L) chain of the antibody.
  • FIGURE 12 Bi-scFv proteins 6PHU5 and 6PHU3 lead to T cell clustering on CLDN6 positive target cells.
  • CLDN6 endogenously expressing PA-1 cells were incubated for 24h with 50 ng/ml 6PHU5 or 6PHU3 and human T cells in an effector to target ratio of 5: 1 in 6-well plates.
  • T cells alone (TL), target cells alone (PA-1) and human T cells with target cells (-Ctrl) were chosen as control samples.
  • After 24h samples were photographed with a Nikon Eclipse T; microscope with 200x magnification.
  • White arrowheads point to T cell clusters on target cells.
  • TL indicates T lymphocyte.
  • FIGURE 13 Effect of domain orientation on efficacy: bi-scFv protein 6PHU3 is slightly more efficient in inducing T cell activation than 6PHU5.
  • CLDN6 endogenously expressing PA-1 cells were incubated for 44h with escalating concentrations (5 - 200 ng/ml) of 6PHU5 or 6PHU3 and human T cells in an effector to target ratio of 5: 1 in duplicates in a 6-well format.
  • As control human T cells were incubated with 100 and 200 ng/ml 6PHU5 or 6PHU3 without target cells.
  • After 44h T cells were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC. Dose-dependent T cell activation was analyzed by flow cytometry.
  • Hu indicates human; TL, T lymphocyte.
  • FIGURE 14 Coomassie gel and western blot analysis of 6PHU3 protein.
  • FIGURE 15 Bi-scFv protein 6PHU3 binds efficiently and specifically to CLDN6-expressing target cells and human T cells.
  • mCLDN6ab and g-a-h APC were used to confirm CLDN6 negativity of cells.
  • positive control mCLDN18.2ab and g-a-h APC was used.
  • MFI of APC signal was calculated by Flow Jo software.
  • APC indicates allophycocyanin; g-a-h, goat-anti- human; g-a-m, goat-anti-mouse; mAB, monoclonal antibody; MFI, mean fluorescence intensity; PE, phycoerythrin; TL, T lymphocyte.
  • FIGURE 16 6PHU3 mediates T cell activation in a dose dependent manner.
  • CLDN6 endogenously expressing PA-1 cells were incubated for 24h and 48h with escalating concentrations of bi-scFv protein 6PHU3 (0.001 - 1000 ng/ml) and human T cells in an effector to target ratio of 5: 1 in duplicates in a 24-well format.
  • As control human T cells were incubated with 1 - 1000 ng/ml 6PHU3 without PA-1 target cells to verify the target dependent activation of T cells mediated by 6PHU3.
  • T cells were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC and analyzed by flow cytometry.
  • TL indicates T lymphocyte.
  • FIGURE 17 EC50 of 6PHU3 for specific target cell lysis after 48h is approximately 10 pg/ml.
  • CLDN6 endogenously expressing PA-1 cells which stably express luciferase were incubated for 24h and 48h with 6PHU3 protein in escalating concentrations (0.001 - 1000 ng/ml) with human T cells in an effector to target ratio of 5: 1 in triplicates in a 96-well format.
  • As minimum lysis control (Lmin) effector and target cells were plated without bi-scFv 6PHU3.
  • Maximum lysis (Lmax) for the normalization to spontaneous luminescence counts was achieved by addition of Triton X-100 to control wells containing effector and target cells in the absence of bi-scFv shortly prior to luciferin addition.
  • % specific lysis [1 - (luminescencetest sample - Lmax) / (L m in - Lmax)] x 100. Values were plotted against log 10 of 6PHU3 concentration. EC50 indicates the half maximal effective concentration; L, lysis.
  • A The tumor volume of single mice and the median per group is shown for treatment days 0 and 14 (upper row), and 21 and 25 (bottom row).
  • B The mean tumor volume of all treatment groups is shown. Dashes indicate sacrificed animals.
  • C A Kaplan-Meier survival curve of all groups from the day of tumor inoculation till day 45 is shown. Animals were sacrificed at a tumor volume >1500 mm 3 . After day 45 all remaining animals were sacrificed to analyze the engraftment of human effector cells in the spleens of mice.
  • D Splenocytes of all mice were isolated and stained with anti- CD45-APC and anti-CD3-FITC to detect human T cells by flow cytometry. Median engraftment is shown in a boxplot diagram. IP indicates intraperitoneal; PBMC, peripheral blood mononuclear cells; PBS, phosphate buffered saline; SC, subcutaneous.
  • FIGURE 19 Enhanced T cell infiltration into SC PA-1 tumors in response to 6PHU3 treatment.
  • NSG mice were injected SC with lxl 0 7 PA-1 endogenously expressing CLDN6. 15 days later 2xl 0 7 human PBMC were injected IP to groups G3 and G4, control groups (Gl and G2) received PBS only. Daily IP application of 5 ⁇ g 6PHU3 per animal or control bi-scFv IBiMAB or vehicle alone as control started five days after PBMC injection. Tumors were dissected at a size of 1500 mm3 or at the end of the experiment, and conserved in 4% buffered formaldehyde solution for paraffin embedding.
  • Paraffin embedded tumor tissues of SC PA-1 tumors were subjected to immunohistochemical stainings. Consecutive sections were stained either with polyclonal primary antibody anti- Claudin 6 or anti-human CD3. Primary antibodies were detected using secondary HRP- conjugated anti-rabbit antibodies. Upper rows of A-E show the CLDN6 staining, lower rows the CD3 staining. Images were taken with a Mirax scanner.
  • Claudins are a family of proteins that are the most important components of tight junctions, where they establish the paracellular barrier that controls the flow of molecules in the intercellular space between cells of an epithelium. Claudins are transmembrane proteins spanning the membrane 4 times with the N-terminal and the C-terminal end both located in the cytoplasm.
  • the first extracellular loop, termed ECl or ECL1 consists on average of 53 amino acids
  • the second extracellular loop termed EC2 or ECL2 consists of around 24 amino acids.
  • Cell surface proteins of the claudin family are expressed in tumors of various origins, and are particularly suited as target structures in connection with antibody-mediated cancer immunotherapy due to their selective expression (no expression in a toxicity relevant normal tissue) and localization to the plasma membrane.
  • CLDN6 and CLDN18.2 have been identified as differentially expressed in tumor tissues, with the only normal tissues expressing CLDN18.2 being stomach and the only normal tissue expressing CLDN6 being placenta.
  • CLDN18.2 is selectively expressed in normal tissues in differentiated epithelial cells of the gastric mucosa. CLDN18.2 is expressed in cancers of various origins such as pancreatic carcinoma, esophageal carcinoma, gastric carcinoma, bronchial carcinoma, breast carcinoma, and ENT tumors.
  • CLDN18.2 is a valuable target for the prevention and/or treatment of primary tumors, such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, and cancers of the gallbladder, and metastases thereof, in particular gastric cancer metastasis such as Krukenberg tumors, peritoneal metastasis, and lymph node metastasis.
  • primary tumors such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, and cancers of the gallbladder, and metastases thereof, in particular gastric cancer metastasis such as Krukenberg tumors, peritoneal metastasis, and lymph node metastasis.
  • CLDN6 has been found to be expressed, for example, in ovarian cancer, lung cancer, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, melanomas, head neck cancer, sarcomas, bile duct cancer, renal cell cancer, and urinary bladder cancer.
  • CLDN6 is a particularly preferred target for the prevention and/or treatment of ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum, in particular small bowel adenocar
  • the cancer disease associated with CLDN6 expression is selected from the group consisting of ovarian cancer, lung cancer, metastatic ovarian cancer and metastatic lung cancer.
  • the ovarian cancer is a carcinoma or an adenocarcinoma.
  • the lung cancer is a carcinoma or an adenocarcinoma, and preferably is bronchiolar cancer such as a bronchiolar carcinoma or bronchiolar adenocarcinoma.
  • CLDN as used herein means claudin and includes CLDN18.2 and CLDN6.
  • a claudin is a human claudin.
  • CLDN18 relates to claudin 18 and includes any variants, including claudin 18 splice variant 1 (claudin 18.1 (CLDN18.1)) and claudin 18 splice variant 2 (claudin 18.2 (CLDN18.2)).
  • CLDN18.2 preferably relates to human CLDN18.2, and, in particular, to a protein comprising, preferably consisting of the amino acid sequence according to SEQ ID NO: 1 of the sequence listing or a variant of said amino acid sequence.
  • the first extracellular loop of CLDN18.2 preferably comprises amino acids 27 to 81 , more preferably amino acids 29 to 78 of the amino acid sequence shown in SEQ ID NO: 1.
  • the second extracellular loop of CLDN18.2 preferably comprises amino acids 140 to 180 of the amino acid sequence shown in SEQ ID NO: 1. Said first and second extracellular loops preferably form the extracellular portion of CLDN18.2.
  • CLDN6 preferably relates to human CLDN6, and, in particular, to a protein comprising, preferably consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 of the sequence listing or a variant of said amino acid sequence.
  • the first extracellular loop of CLDN6 preferably comprises amino acids 28 to 80, more preferably amino acids 28 to 76 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3.
  • the second extracellular loop of CLDN6 preferably comprises amino acids 138 to 160, preferably amino acids 141 to 159, more preferably amino acids 145 to 157 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3.
  • Said first and second extracellular loops preferably form the extracellular portion of CLDN6.
  • allelic variant refers, in particular, to mutants, splice variants, conformations, isoforms, allelic variants, species variants and species homologs, in particular those which are naturally present.
  • An allelic variant relates to an alteration in the normal sequence of a gene, the significance of which is often unclear. Complete gene sequencing often identifies numerous allelic variants for a given gene.
  • a species homolog is a nucleic acid or amino acid sequence with a different species of origin from that of a given nucleic acid or amino acid sequence.
  • variant shall encompass any posttranslationally modified variants and conformation variants.
  • the second target molecule of the binding agents described herein is CD3 (cluster of differentiation 3).
  • the CD3 complex denotes an antigen that is expressed on mature human T- cells, thymocytes and a subset of natural killer cells as part of the multimolecular T-cell receptor (TCR) complex.
  • the T-cell co-receptor is a protein complex and is composed of four distinct chains. In mammals, the complex contains a CD3y chain, a CD36 chain, and two CD3e chains. These chains associate with a molecule known as the T-cell receptor (TCR) and the ⁇ -chain to generate an activation signal in T lymphocytes.
  • TCR T-cell receptor
  • ⁇ -chain, and CD3 molecules together comprise the TCR complex.
  • the human CD3 epsilon is indicated in GenBank Accession No. NM_000733 and comprises SEQ ID NO: 4.
  • the human CD3 gamma is indicated in GenBank Accession No. NM 000073.
  • the human CD3 delta is indicated in GenBank Accession No. NM_000732.
  • CD3 is responsible for the signal transduction of the TCR.
  • TCR complex activation results in the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) by Src family kinases, triggering recruitment of further kinases which results in T cell activation including Ca 2+ release.
  • ITAMs immunoreceptor tyrosine-based activation motifs
  • CD3 includes human CD3 and denotes an antigen that is expressed on human T cells as part of the multimolecular T cell receptor complex.
  • the binding agent of the invention preferably recognizes the epsilon-chain of CD3, particular, it recognizes an epitope that corresponds to the first 27 N-terminal amino acids of CD3 epsilon or functional fragments of this 27 amino acid stretch.
  • the term "claudin positive cancer” or similar terms means a cancer involving cancer cells expressing a claudin, preferably on the surface of said cancer cells.
  • Cell surface is used in accordance with its normal meaning in the art, and thus includes the outside of the cell which is accessible to binding by proteins and other molecules
  • a claudin is expressed on the surface of cells if it is located at the surface of said cells and is accessible to binding by claudin-specific antibodies added to the cells.
  • extracellular portion in the context of the present invention refers to a part of a molecule such as a protein that is facing the extracellular space of a cell and preferably is accessible from the outside of said cell, e.g., by antigen-binding molecules such as antibodies located outside the cell.
  • the term refers to one or more extracellular loops or domains or a fragment thereof.
  • a part of a structure such as an amino acid sequence or protein refers to a continuous element of said structure.
  • a portion, a part or a fragment of a structure preferably comprises one or more functional properties of said structure.
  • a portion, a part or a fragment of an epitope or peptide is preferably immunologically equivalent to the epitope or peptide it is derived from.
  • a part or fragment of a protein sequence preferably comprises a sequence of at least 6, in particular at least 8, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids of the protein sequence.
  • CLDN18.2 is not substantially expressed in a cell if the level of expression is lower compared to expression in stomach cells or stomach tissue.
  • the level of expression is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the expression in stomach cells or stomach tissue or even lower.
  • CLDN18.2 is not substantially expressed in a cell if the level of expression exceeds the level of expression in non- cancerous tissue other than stomach by no more than 2-fold, preferably 1.5-fold, and preferably does not exceed the level of expression in said non-cancerous tissue.
  • CLDN18.2 is not substantially expressed in a cell if the level of expression is below the detection limit and/or if the level of expression is too low to allow binding by CLDN18.2-specific antibodies added to the cells.
  • CLDN18.2 is expressed in a cell if the level of expression exceeds the level of expression in non-cancerous tissue other than stomach preferably by more than 2- fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold.
  • CLDN 18.2 is expressed in a cell if the level of expression is above the detection limit and/or if the level of expression is high enough to allow binding by CLDN18.2-specific antibodies added to the cells.
  • CLDN18.2 expressed in a cell is expressed or exposed on the surface of said cell.
  • CLDN6 is not substantially expressed in a cell if the level of expression is lower compared to expression in placenta cells or placenta tissue.
  • the level of expression is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the expression in placenta cells or placenta tissue or even lower.
  • CLDN6 is not substantially expressed in a cell if the level of expression exceeds the level of expression in noncancerous tissue other than placenta by no more than 2-fold, preferably 1.5-fold, and preferably does not exceed the level of expression in said non-cancerous tissue.
  • CLDN6 is not substantially expressed in a cell if the level of expression is below the detection limit and/or if the level of expression is too low to allow binding by CLDN6-specific antibodies added to the cells.
  • CLDN6 is expressed in a cell if the level of expression exceeds the level of expression in non-cancerous tissue other than placenta preferably by more than 2-fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold.
  • CLDN6 is expressed in a cell if the level of expression is above the detection limit and/or if the level of expression is high enough to allow binding by CLDN6-specific antibodies added to the cells.
  • CLDN6 expressed in a cell is expressed or exposed on the surface of said cell.
  • a disease to be treated according to the present application involves cells expressing claudin (CLDN) such as CLDN18.2 and/or CLDN6.
  • CLDN claudin
  • “Diseases associated with cells expressing CLDN” or similar expressions means according to the invention that CLDN is expressed in cells of a diseased tissue or organ.
  • expression of CLDN in cells of a diseased tissue or organ is increased compared to the state in a healthy tissue or organ.
  • An increase refers to an increase by at least 10%, in particular at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more.
  • expression is only found in a diseased tissue, while expression in a healthy tissue is repressed.
  • diseases associated with cells expressing CLDN include cancer diseases.
  • cancer diseases preferably are those wherein the cancer cells express CLDN.
  • a "cancer disease” or “cancer” includes a disease characterized by aberrantly regulated cellular growth, proliferation, differentiation, adhesion, and/or migration.
  • cancer cell is meant an abnormal cell that grows by a rapid, uncontrolled cellular proliferation and continues to grow after the stimuli that initiated the new growth cease.
  • a “cancer disease” is characterized by cells expressing CLDN and a cancer cell expresses CLDN.
  • a cell expressing CLDN preferably is a cancer cell, preferably of the cancers described herein.
  • cancer comprises leukemias, seminomas, melanomas, teratomas, lymphomas, neuroblastomas, gliomas, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, blood cancer, skin cancer, cancer of the brain, cervical cancer, intestinal cancer, liver cancer, colon cancer, stomach cancer, intestine cancer, head and neck cancer, gastrointestinal cancer, lymph node cancer, esophagus cancer, colorectal cancer, pancreas cancer, ear, nose and throat (ENT) cancer, breast cancer, prostate cancer, cancer of the uterus, ovarian cancer and lung cancer and the metastases thereof. Examples thereof are lung carcinomas, mamma carcinomas, prostate carcinomas, colon carcinomas, renal cell carcinomas, cervical carcinomas, or metastases of the cancer types or rum described above.
  • the term cancer according to the invention also comprises cancer metastases.
  • a "carcinoma” is a malignant rumor derived from epithelial cells. This group represents the most common cancers, including the common forms of breast, prostate, lung and colon cancer.
  • Adenocarcinoma is a cancer that originates in glandular tissue. This tissue is also part of a larger tissue category known as epithelial tissue. Epithelial tissue includes skin, glands and a variety of other tissue that lines the cavities and organs of the body. Epithelium is derived embryologically from ectoderm, endoderm and mesoderm. To be classified as adenocarcinoma, the cells do not necessarily need to be part of a gland, as long as they have secretory properties. This form of carcinoma can occur in some higher mammals, including humans. Well differentiated adenocarcinomas tend to resemble the glandular tissue that they are derived from, while poorly differentiated may not.
  • Adenocarcinomas can arise in many tissues of the body due to the ubiquitous nature of glands within the body. While each gland may not be secreting the same substance, as long as there is an exocrine function to the cell, it is considered glandular and its malignant form is therefore named adenocarcinoma. Malignant adenocarcinomas invade other tissues and often metastasize given enough time to do so. Ovarian adenocarcinoma is the most common type of ovarian carcinoma. It includes the serous and mucinous adenocarcinomas, the clear cell adenocarcinoma and the endometrioid adenocarcinoma.
  • metastasis is meant the spread of cancer cells from its original site to another part of the body.
  • the formation of metastasis is a very complex process and depends on detachment of malignant cells from the primary tumor, invasion of the extracellular matrix, penetration of the endothelial basement membranes to enter the body cavity and vessels, and then, after being transported by the blood, infiltration of target organs. Finally, the growth of a new tumor at the target site depends on angiogenesis. Tumor metastasis often occurs even after the removal of the primary tumor because tumor cells or components may remain and develop metastatic potential.
  • the term "metastasis” according to the invention relates to "distant metastasis” which relates to a metastasis which is remote from the primary tumor and the regional lymph node system.
  • the term "metastasis” according to the invention relates to lymph node metastasis.
  • One particular form of metastasis which is treatable using the therapy of the invention is metastasis originating from gastric cancer as primary site.
  • gastric cancer metastasis is Krukenberg tumors, peritoneal metastasis and/or lymph node metastasis.
  • Krukenberg tumor is an uncommon metastatic tumor of the ovary accounting for 1% to 2% of all ovarian tumors. Prognosis of Krukenberg tumor is still very poor and there is no established treatment for Krukenberg tumors.
  • Krukenberg tumor is a metastatic signet ring cell adenocarcinoma of the ovary. Stomach is the primary site in most Krukenberg tumor cases (70%). Carcinomas of colon, appendix, and breast (mainly invasive lobular carcinoma) are the next most common primary sites. Rare cases of Krukenberg tumor originating from carcinomas of the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix, and urinary bladder/urachus have been reported.
  • treat is meant to administer a compound or composition or a combination of compounds or compositions to a subject in order to prevent or eliminate a disease, including reducing the size of a tumor or the number of tumors in a subject; arrest or slow a disease in a subject; inhibit or slow the development of a new disease in a subject; decrease the frequency or severity of symptoms and/or recurrences in a subject who currently has or who previously has had a disease; and/or prolong, i.e. increase the lifespan of the subject.
  • treatment of a disease includes curing, shortening the duration, ameliorating, preventing, slowing down or inhibiting progression or worsening, or preventing or delaying the onset of a disease or the symptoms thereof.
  • terms such as “protect”, “prevent”, “prophylactic”, “preventive”, or “protective” relate to the prevention or treatment or both of the occurrence and/or the propagation of a disease in a subject and, in particular, to minimizing the chance that a subject will develop a disease or to delaying the development of a disease.
  • a person at risk for cancer would be a candidate for therapy to prevent cancer.
  • being at risk is meant a subject that is identified as having a higher than normal chance of developing a disease, in particular cancer, compared to the general population.
  • a subject who has had, or who currently has, a disease, in particular cancer is a subject who has an increased risk for developing a disease, as such a subject may continue to develop a disease.
  • Subjects who currently have, or who have had, a cancer also have an increased risk for cancer metastases.
  • patient means according to the invention a subject for treatment, in particular a diseased subject, including human beings, nonhuman primates or another animals, in particular mammals such as cows, horses, pigs, sheeps, goats, dogs, cats or rodents such as mice and rats.
  • a diseased subject including human beings, nonhuman primates or another animals, in particular mammals such as cows, horses, pigs, sheeps, goats, dogs, cats or rodents such as mice and rats.
  • a patient is a human being.
  • Target cell shall mean any undesirable cell such as a cancer cell.
  • the target cell expresses CLDN.
  • antigen relates to an agent such as a protein or peptide comprising an epitope against which an immune response is directed and/or is to be directed.
  • an antigen is a tumor-associated antigen, such as CLDN18.2 or CLDN6, i.e., a constituent of cancer cells which may be derived from the cytoplasm, the cell surface and the cell nucleus, in particular those antigens which are produced, preferably in large quantity, intracellular or as surface antigens on cancer cells.
  • tumor-associated antigen preferably relates to proteins that are under normal conditions specifically expressed in a limited number of tissues and/or organs or in specific developmental stages and are expressed or aberrantly expressed in one or more tumor or cancer tissues.
  • the tumor-associated antigen is preferably associated with the cell surface of a cancer cell and is preferably not or only rarely expressed in normal tissues.
  • epitope refers to an antigenic determinant in a molecule, i.e., to the part in a molecule that is recognized by the immune system, for example, that is recognized by an antibody.
  • epitopes are the discrete, three-dimensional sites on an antigen, which are recognized by the immune system.
  • Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and non- conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
  • An epitope of a protein preferably comprises a continuous or discontinuous portion of said protein and is preferably between 5 and 100, preferably between 5 and 50, more preferably between 8 and 30, most preferably between 10 and 25 amino acids in length, for example, the epitope may be preferably 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 amino acids in length.
  • antibody refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • antibody includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies and chimeric antibodies.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
  • VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FRl , CDRl , FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • the term "monoclonal antibody” as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody displays a single binding specificity and affinity.
  • the monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a non-human animal, e.g., mouse, fused to an immortalized cell.
  • recombinant antibody includes all antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal with respect to the immunoglobulin genes or a hybridoma prepared therefrom, (b) antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of immunoglobulin gene sequences to other DNA sequences.
  • human antibody is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
  • humanized antibody refers to a molecule having an antigen binding site that is substantially derived from an immunoglobulin from a non-human species, wherein the remaining immunoglobulin structure of the molecule is based upon the structure and/or sequence of a human immunoglobulin.
  • the antigen binding site may either comprise complete variable domains fused onto constant domains or only the complementarity determining regions (CDR) grafted onto appropriate framework regions in the variable domains.
  • Antigen binding sites may be wild-type or modified by one or more amino acid substitutions, e.g. modified to resemble human immunoglobulins more closely.
  • Some forms of humanized antibodies preserve all CDR sequences (for example a humanized mouse antibody which contains all six CDRs from the mouse antibody). Other forms have one or more CDRs which are altered with respect to the original antibody.
  • chimeric antibody refers to those antibodies wherein one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class, while the remaining segment of the chain is homologous to corresponding sequences in another.
  • variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to sequences of antibodies derived from another.
  • One clear advantage to such chimeric forms is that the variable region can conveniently be derived from presently known sources using readily available B-cells or hybridomas from non-human host organisms in combination with constant regions derived from, for example, human cell preparations.
  • variable region has the advantage of ease of preparation and the specificity is not affected by the source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non human source.
  • definition is not limited to this particular example.
  • Antibodies may be derived from different species, including but not limited to mouse, rat, rabbit, guinea pig and human.
  • Antibodies described herein include IgA such as IgAl or IgA2, IgGl, IgG2, IgG3, IgG4, IgE, IgM, and IgD antibodies.
  • the antibody is an IgGl antibody, more particularly an IgGl, kappa or IgGl, lambda isotype (i.e. IgGl, ⁇ , ⁇ ), an IgG2a antibody (e.g. IgG2a, K, ⁇ ), an IgG2b antibody (e.g. IgG2b, ⁇ , ⁇ ), an IgG3 antibody (e.g. IgG3, ⁇ , ⁇ ) or an IgG4 antibody (e.g. IgG4, , ⁇ ).
  • a heterologous antibody is defined in relation to a transgenic organism producing such an antibody. This term refers to an antibody having an amino acid sequence or an encoding nucleic acid sequence corresponding to that found in an organism not consisting of the transgenic organism, and being generally derived from a species other than the transgenic organism.
  • heterohybrid antibody refers to an antibody having light and heavy chains of different organismal origins.
  • an antibody having a human heavy chain associated with a murine light chain is a heterohybrid antibody.
  • the antibodies described herein are preferably isolated.
  • An "isolated antibody” as used herein is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds to CLDN18.2 is substantially free of antibodies that specifically bind antigens other than CLDN18.2).
  • An isolated antibody that specifically binds to an epitope, isoform or variant of human CLDN18.2 may, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., CLDN18.2 species homologs).
  • an isolated antibody may be substantially free of other cellular material and/or chemicals.
  • a combination of "isolated" monoclonal antibodies relates to antibodies having different specificities and being combined in a well defined composition or mixture.
  • antigen-binding portion of an antibody (or simply “binding portion") or "antigen- binding fragment” of an antibody (or simply “binding fragment”) or similar terms refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antigen- binding portion" of an antibody include (i) Fab fragments, monovalent fragments consisting of the VL, VH, CL and CH domains; (ii) F(ab') 2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) Fd fragments consisting of the VH and CH domains; (iv) Fv fragments consisting of the VL and VH domains of a single arm of an antibody, (v) dAb fragments (Ward et al., (1989) Nature 341 : 544-546), which consist of a VH domain; (vi) isolated complementarity determining regions (CDR), and (vii) combinations of two or more isolated CDRs which may optionally be joined by a synthetic linker.
  • Fab fragments monovalent fragments consisting of the VL, VH, CL and CH domains
  • F(ab') 2 fragments bivalent fragments compris
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242: 423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody.
  • a further example is binding-domain immunoglobulin fusion proteins comprising (i) a binding domain polypeptide that is fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an immunoglobulin heavy chain CH3 constant region fused to the CH2 constant region.
  • the binding domain polypeptide can be a heavy chain variable region or a light chain variable region.
  • the binding-domain immunoglobulin fusion proteins are further disclosed in US 2003/01 18592 and US 2003/0133939. These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
  • binding domain characterizes in connection with the present invention a structure, e.g. of an antibody, which binds to/interacts with a given target structure/antigen epitope.
  • binding domain designates an "antigen-interaction-site”.
  • antibody derivatives refers to any modified form of an antibody, e.g., a conjugate of the antibody and another agent or antibody, or an antibody fragment.
  • antibody derivatives refers to any modified form of an antibody, e.g., a conjugate of the antibody and another agent or antibody, or an antibody fragment.
  • the antibodies and derivatives of antibodies as described herein are useful for producing binding agents of the invention such as antibody fragments.
  • Naturally occurring antibodies are generally monospecific, i.e. they bind to a single antigen.
  • the present invention provides binding agents binding to a cytotoxic cell (by engaging the CD3 receptor) and a cancer cell (by engaging CLDN).
  • the binding agents of the present invention are at least bispecific or multispecific such as trispecific, tetraspecific and so on.
  • the binding agent of the invention may be in the format of an antibody molecule or of an antibody-like molecule or of a protein scaffold with antibody-like properties or of a cyclic peptide with at least two binding specificities.
  • the binding agent may comprise one or more antibodies as described herein or fragments thereof.
  • a bispecific molecule in particular a bispecific protein, such as a bispecific antibody is a molecule that has two different binding specificities and thus may bind to two different types of antigen such as CLDN and CD3.
  • bispecific antibody refers to an antibody comprising two antigen-binding sites, a first binding site having affinity for a first antigen or epitope and a second binding site having binding affinity for a second antigen or epitope distinct from the first.
  • a bispecific antibody is an artificial protein that is composed of fragments of two different antibodies (said fragments of two different antibodies forming two binding domains) and consequently binds to two different types of antigen.
  • a bispecific antibody according to the invention is engineered to simultaneously bind to an immune cell, such as an immune effector cell, in particular a T cell such as a cytotoxic cell (by binding to CD3) and a target cell like a cancer cell (by binding to the rumor-associated antigen CLDN) to be destroyed.
  • an immune cell such as an immune effector cell, in particular a T cell such as a cytotoxic cell (by binding to CD3) and a target cell like a cancer cell (by binding to the rumor-associated antigen CLDN) to be destroyed.
  • bispecific antibody also includes diabodies.
  • Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g. , Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444- 6448; Poljak, R. J., et al. (1994) Structure 2: 1 121-1 123).
  • Multispecific binding agents are molecules which have more than two different binding specificities.
  • bispecific antibodies including bispecific antibody fragments, in particular bispecific single chain antibodies including bispecific single chain antibody fragments.
  • bispecific single chain antibody denotes a single polypeptide chain comprising two binding domains.
  • the term "bispecific single chain antibody” or “single chain bispecific antibody” or related terms in accordance with the present invention preferably mean antibody constructs resulting from joining at least two antibody variable regions in a single polypeptide chain devoid of the constant and/or Fc portion(s) present in full immunoglobulins.
  • a bispecific single chain antibody may be a construct with a total of two antibody variable regions, for example two VH regions, each capable of specifically binding to a separate antigen, and connected with one another through a short polypeptide spacer such that the two antibody variable regions with their interposed spacer exist as a single contiguous polypeptide chain.
  • Another example of a bispecific single chain antibody may be a single polypeptide chain with three antibody variable regions.
  • two antibody variable regions for example one VH and one VL, may make up an scFv, wherein the two antibody variable regions are connected to one another via a synthetic polypeptide linker, the latter often being genetically engineered so as to be minimally immunogenic while remaining maximally resistant to proteolysis.
  • This scFv is capable of specifically binding to a particular antigen, and is connected to a further antibody variable region, for example a VH region, capable of binding to a different antigen than that bound by the scFv.
  • a bispecific single chain antibody may be a single polypeptide chain with four antibody variable regions.
  • the first two antibody variable regions for example a VH region and a VL region, may form one scFv capable of binding to one antigen, whereas the second VH region and VL region may form a second scFv capable of binding to another antigen.
  • individual antibody variable regions of one specificity may advantageously be separated by a synthetic polypeptide linker, whereas the respective scFvs may advantageously be separated by a short polypeptide spacer as described above.
  • the first binding domain of the bispecific antibody comprises one antibody variable domain, preferably a VHH domain.
  • the first binding domain of the bispecific antibody comprises two antibody variable domains, preferably a scFv, i.e. VH-VL or VL-VH.
  • the second binding domain of the bispecific antibody comprises one antibody variable domain, preferably a VHH domain.
  • the second binding domain of the bispecific antibody comprises two antibody variable domains, preferably a scFv, i.e. VH-VL or VL-VH. In its minimal form, the total number of antibody variable regions in the bispecific antibody according to the invention is thus only two.
  • such an antibody could comprise two VH or two VHH domains.
  • the first binding domain and the second binding domain of the bispecific antibody each comprise one antibody variable domain, preferably a VHH domain.
  • the first binding domain and the second binding domain of the bispecific antibody each comprise two antibody variable domains, preferably a scFv, i.e. VH-VL or VL-VH.
  • the binding agent of the invention preferably comprises (i) a heavy chain variable domain (VH) of a CLDN antibody, (ii) a light chain variable domain (VL) of a CLDN antibody, (iii) a heavy chain variable domain (VH) of a CD3 antibody and (iv) a light chain variable domain (VL) of a CD3 antibody.
  • Bispecific full-length antibodies may be obtained by covalently linking two monoclonal antibodies or by conventional hybrid-hybridoma techniques. Covalent linking of two monoclonal antibodies is described in Anderson, Blood 80 (1992), 2826-34. In the context of this invention, one of the antibodies is specific for CLDN and the other one for CD3.
  • the bispecific binding agent is in the format of an antibody-like molecule with a heavy chain containing two consecutive N-terminal variable domains with different specificities and a light chain with two consecutive variable domains with different specificities resulting in four binding domains with two different specificities (Wu et al., Nat. Biotechnology, 2007, 25(1 1)), wherein one specificity is CD3 and the other specificity is CLDN.
  • the bispecific binding agent of the invention is in the format of an antibody fragment.
  • the bispecific molecules according to the invention comprises two Fab regions, one being directed against CLDN and the other being directed against CD3.
  • the molecule of the invention is an antigen binding fragment (Fab)2 complex.
  • the Fab2 complex is composed of two Fab fragments, one Fab fragment comprising a Fv domain, i.e. VH and VL domains, specific for a CD3 antigen, and the other Fab fragment comprising a Fv domain specific for CLDN.
  • Each of the Fab fragments may be composed of two single chains, a VL-CL module and a VH-CH module.
  • each of the individual Fab fragments may be arranged in a single chain, preferably, VL-CL-CH-VH, and the individual variable and constant domains may be connected with a peptide linker.
  • the individual single chains and Fab fragments may be connected via disulfide bonds, adhesive domains, chemically linked and/or peptide linker.
  • the bispecific molecule may also comprise more than two Fab fragments, in particular, the molecule may be a Fab3, Fab4, or a multimeric Fab complex with specificity for 2, 3, 4, or more different antigens.
  • the invention also includes chemically linked Fabs.
  • the binding agent according to the invention includes various types of bivalent and trivalent single-chain variable fragments (scFvs), fusion proteins mimicking the variable domains of two antibodies.
  • a single-chain variable fragment (scFv) is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of immunoglobulins, connected with a short linker peptide of ten to about 25 amino acids.
  • the linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility, and can either connect the N-terminus of the VH with the C-terminus of the VL, or vice versa.
  • Divalent (or bivalent) single-chain variable fragments can be engineered by linking two scFvs. This can be done by producing a single peptide chain with two VH and two VL regions, yielding tandem scFvs.
  • the invention also includes multispecific molecules comprising more than two scFvs binding domains. This makes it possible that the molecule comprises either multiple antigen specificities and is a trispecific, tetraspecific, or multispecific molecule, or the molecule is a bispecific molecule comprising more than one scFv binding domain with specificity for the same antigen.
  • the molecule of the invention may be a multispecific single chain Fv.
  • scFvs with linker peptides that are too short for the two variable regions to fold together (about five amino acids), forcing scFvs to dimerize.
  • This type is known as diabodies.
  • Still shorter linkers one or two amino acids lead to the formation of trimers, so-called triabodies or tribodies.
  • Tetrabodies have also been produced. They exhibit an even higher affinity to their targets than diabodies.
  • a particularly preferred example of a bispecific antibody fragment is a diabody (Kipriyanov, Int. J. Cancer 77 (1998), 763-772), which is a small bivalent and bispecific antibody fragment.
  • Diabodies comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) on the same polypeptide chain (VH-VL) connected by a peptide linker that is too short to allow pairing between the two domains on the same chain. This forces pairing with the complementary domains of another chain and promotes the assembly of a dimeric molecule with two functional antigen binding sites.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • VH-VL polypeptide chain
  • the multispecific molecule comprises variable (VH, VL) and constant domains (C) of immunoglobulins.
  • the bispecific molecule is a minibody, preferably, a minibody comprising two single VH-VL-C chains that are connected with each other via the constant domains (C) of each chain.
  • the corresponding variable heavy chain regions (VH), corresponding variable light chain regions (VL) and constant domains (C) are arranged, from N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-(C) and VH(CD3)-VL(CD3)-C, wherein C is preferably a CH3 domain. Pairing of the constant domains results in formation of the minibody.
  • the bispecific binding agent of the invention is in the format of a bispecific single chain antibody construct, whereby said construct comprises or consists of at least two binding domains, whereby one of said domains binds to CLDN and a second domain binds to CD3.
  • Such molecules also termed "bispecific T cell engagers" (BiTEs; the term BiTE only refers to bi-specific molecules of which one arm is specific for CD3) consist of two scFv molecules connected via a linker peptide.
  • a "bispecific single chain antibody” denotes a single polypeptide chain comprising two binding domains.
  • Each binding domain comprises one variable region from an antibody heavy chain ("VH region"), wherein the VH region of the first binding domain specifically binds to the CLDN, and the VH region of the second binding domain specifically binds to CD3.
  • VH region an antibody heavy chain
  • the two binding domains are optionally linked to one another by a short polypeptide spacer.
  • a non-limiting example for a polypeptide spacer is Gly-Gly-Gly-Gly-Ser (G- G-G-G-S) and repeats thereof.
  • Each binding domain may additionally comprise one variable region from an antibody light chain (" VL region"), the VH region and VL region within each of the first and second binding domains being linked to one another via a polypeptide linker long enough to allow the VH region and VL region of the first binding domain and the VH region and VL region of the second binding domain to pair with one another.
  • VL region an antibody light chain
  • variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) are arranged, from N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)- VL(CLDN) or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN).
  • the bispecific single chain antibodies of the invention comprise other domain arrangements, such as VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3), VL(CLDN)-VH(CLDN)-VL(CD3)-VH(CD3), VH(CLDN)-VL(CLDN)-VL(CD3)-VH(CD3), VL(CD3)-VH(CD3)-VH(CLDN)-VL(CLDN), VL(CD3)-VH(CD3)-VL(CLDN)-VH(CLDN).
  • a long linker generally connects the corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) to create a scFv binding domain while a short linker generally connects two scFv binding domains.
  • the linker is generally designed to provide flexibility and protease resistance, and preferably, the linker comprises glycine and/or serine amino acid residues.
  • Short peptide linkers may consist of 12 or less such as 1 1, 10, 9, 8, 7, 6, 5, 4, 3 or 2 amino acids, and preferably, 5 or 6 amino acids.
  • Short peptide linkers preferably comprise the amino acid sequences SGGGGS or GGGGS.
  • Long peptide linkers may consist of 12 or more, such as 15 to 25 or 15 to 20 or 15 to 18 amino acids.
  • Long peptide linkers preferably comprise the amino acid sequences (GGGGS)3 or VE(GGSGGS)2GGVD.
  • Binding agents according to the invention may also comprises an amino acid sequence for facilitating secretion of the molecule, such as a N-terminal secretion signal, and/or one or more epitope tags facilitating binding, purification or detection of the molecule.
  • the secretion signal is a signal sequence (e.g. selected from any one of SEQ ID NOs: 51 , 52, 53, 54, 55) that allows a sufficient passage through the secretory pathway and/or secretion of the binding agent into the extracellular environment.
  • the secretion signal sequence is cleavable and is removed from the mature binding agent.
  • the secretion signal sequence preferably is chosen with respect to the cell or organism wherein the binding agent is produced in.
  • the amino acid sequence of an epitope tag may be introduced to any position within the amino acid sequence of the binding agent, and may take the shape of a loop within the encoded protein structure, or it may be N-terminally or C-terminally fused to the binding agent.
  • the epitope tag is C-terminally fused to the binding agent.
  • the epitope tag may contain a cleavage site that allows a removal of the tag from the binding agent.
  • Said epitope tag can be any kind of epitope tag that is functional under native and/or denaturing conditions, preferable a histidin tag, most preferable a tag comprising six histidins.
  • the bispecific binding agent of the invention may contain, in addition to said first and second binding domain, a further binding domain which serves e.g. to enhance selectivity for tumor cells. This can be achieved e.g. by providing binding domains that bind to other antigens expressed on tumor cells.
  • the binding agents generated are preferably capable of eliciting immune effector functions as described herein.
  • said immune effector functions are directed against cells carrying the tumor-associated antigen CLDN on their surface.
  • the term "immune effector functions" in the context of the present invention includes any functions mediated by components of the immune system that result e.g. in the inhibition of tumor growth and/or inhibition of tumor development, including inhibition of tumor dissemination and metastasis.
  • immune effector functions result in killing of tumor cells.
  • Such functions comprise complement dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), induction of apoptosis in the cells carrying the tumor-associated antigen, cytolysis of the cells carrying the tumor-associated antigen, and/or inhibition of proliferation of the cells carrying the tumor-associated antigen.
  • Binding agents may also exert an effect simply by binding to tumor- associated antigens on the surface of a cancer cell.
  • antibodies may block the function of the tumor-associated antigen or induce apoptosis just by binding to the tumor- associated antigen on the surface of a cancer cell.
  • binding agents described herein may be conjugated to a therapeutic moiety or agent, such as a cytotoxin, a drug (e.g., an immunosuppressant) or a radioisotope.
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to and, in particular, kills cells.
  • Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 -dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • Suitable therapeutic agents for forming conjugates include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabin, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC),
  • the therapeutic agent is a cytotoxic agent or a radiotoxic agent.
  • the therapeutic agent is an immunosuppressant.
  • the therapeutic agent is GM-CSF.
  • the therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide or ricin A.
  • Binding agents also can be conjugated to a radioisotope, e.g., iodine-131 , yttrium-90 or indium- 1 1 1 , to generate cytotoxic radiopharmaceuticals.
  • a radioisotope e.g., iodine-131 , yttrium-90 or indium- 1 1 1 , to generate cytotoxic radiopharmaceuticals.
  • binding preferably relates to a specific binding.
  • an agent such as an antibody is capable of binding to a predetermined target if it has a significant affinity for said predetermined target and binds to said predetermined target in standard assays.
  • "Affinity” or “binding affinity” is often measured by equilibrium dissociation constant ( p).
  • the term "significant affinity” refers to the binding to a predetermined target with a dissociation constant (KD) of 10 "5 M or lower, 10 "6 M or lower, 10 "7 M or lower, 10 “8 M or lower, 10 “9 M or lower, 10 " 10 M or lower, 10 " " M or lower, or 10 "12 M or lower.
  • An agent is not (substantially) capable of binding to a target if it has no significant affinity for said target and does not bind significantly, in particular does not bind detectably, to said target in standard assays.
  • the agent does not detectably bind to said target if present in a concentration of up to 2, preferably 10, more preferably 20, in particular 50 or 100 ⁇ g/ml or higher.
  • an agent has no significant affinity for a target if it binds to said target with a D that is at least 10-fold, 100-fold, 10 3 -fold, 10 4 -fold, 10 5 -fold, or 10 6 -fold higher than the K D for binding to the predetermined target to which the agent is capable of binding.
  • the KD for binding to a target for which the agent has no significant affinity would be at least 10 "6 M, 10 "5 M, 10 ⁇ M, 10 "3 M, 10 "2 M, or 10 " ' M.
  • an agent such as an antibody is specific for a predetermined target if it is capable of binding to said predetermined target while it is not capable of binding to other targets, i.e. has no significant affinity for other targets and does not significantly bind to other targets in standard assays.
  • an agent is specific for CLDN if it is capable of binding to CLDN but is not (substantially) capable of binding to other targets.
  • an agent is specific for CLDN if the affinity for and the binding to such other targets does not significantly exceed the affinity for or binding to CLDN-unrelated proteins such as bovine serum albumin (BSA), casein, human serum albumin (HSA) or non-claudin transmembrane proteins such as MHC molecules or transferrin receptor or any other specified polypeptide.
  • BSA bovine serum albumin
  • HSA human serum albumin
  • non-claudin transmembrane proteins such as MHC molecules or transferrin receptor or any other specified polypeptide.
  • an agent is specific for a predetermined target if it binds to said target with a KD that is at least 10-fold, 100-fold, 10 3 -fold, 10 4 -fold, 10 5 -fold, or 10 6 -fold lower than the KD for binding to a target for which it is not specific.
  • a KD that is at least 10-fold, 100-fold, 10 3 -fold, 10 4 -fold, 10 5 -fold, or 10 6 -fold lower than the KD for binding to a target for which it is not specific.
  • the KD for binding of an agent to the target for which it is specific is 10 " 7 M
  • the KD for binding to a target for which it is not specific would be at least 10 "6 M, 10 "5 M, 10 "4 M, 10 "3 M, 10 "2 M, or 10 " ' M.
  • Binding of an agent to a target can be determined experimentally using any suitable method; see, for example, Berzofsky et al., "Antibody-Antigen Interactions" In Fundamental Immunology, Paul, W. E., Ed., Raven Press New York, N Y (1 84), Kuby, Janis Immunology, W. H. Freeman and Company New York, N Y (1 92), and methods described herein. Affinities may be readily determined using conventional techniques, such as by equilibrium dialysis; by using the BIAcore 2000 instrument, using general procedures outlined by the manufacturer; by radioimmunoassay using radiolabeled target antigen; or by another method known to the skilled artisan.
  • the affinity data may be analyzed, for example, by the method of Scatchard et al., Ann N.Y. Acad. ScL, 51 :660 ( 1949).
  • the measured affinity of a particular antibody-antigen interaction can vary if measured under different conditions, e.g., salt concentration, pH.
  • affinity and other antigen-binding parameters e.g., D, IC 5 O, are preferably made with standardized solutions of antibody and antigen, and a standardized buffer.
  • isotype refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.
  • isotype switching refers to the phenomenon by which the class, or isotype, of an antibody changes from one Ig class to one of the other Ig classes.
  • naturally occurring refers to the fact that an object can be found in nature.
  • a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
  • rearranged refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete VH or VL domain, respectively.
  • a rearranged immunoglobulin (antibody) gene locus can be identified by comparison to germline DNA; a rearranged locus will have at least one recombined heptamer/nonamer homology element.
  • V segment configuration refers to the configuration wherein the V segment is not recombined so as to be immediately adjacent to a D or J segment.
  • a binding agent of the invention has the ability of binding to CLDN18.2, i.e. the ability of binding to an epitope present in CLDN18.2, preferably an epitope located within the extracellular domains of CLDN 18.2, in particular the first extracellular loop, preferably amino acid positions 29 to 78 of CLDN18.2.
  • an agent having the ability of binding to CLDN 1 8.2 binds to an epitope on CLDN 18.2 which is not present on CLDN18.1.
  • An agent having the ability of binding to CLDN18.2 preferably binds to CLDN18.2 but not to CLDN18.1.
  • an agent having the ability of binding to CLDN18.2 is specific for CLDN18.2.
  • an agent having the ability of binding to CLDN18.2 binds to CLDN18.2 expressed on the cell surface.
  • an agent having the ability of binding to CLDN18.2 binds to native epitopes of CLDN18.2 present on the surface of living cells.
  • an agent having the ability of binding to CLDN18.2 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 6, 7, 8, 9, 10, and a fragment thereof.
  • VH heavy chain variable region
  • an agent having the ability of binding to CLDN18.2 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 18, 19, and a fragment thereof.
  • VL light chain variable region
  • an agent having the ability of binding to CLDN18.2 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities (i) to (ix):
  • VH comprises an amino acid sequence represented by SEQ ID NO: 5 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 1 1 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 7 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 9 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 16 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 14 or a fragment thereof
  • VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 17 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 18 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof.
  • an agent having the ability of binding to CLDN18.2 comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof.
  • fragment refers, in particular, to one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
  • said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementarity- determining regions CDR1 , CDR2 and CDR3.
  • fragment refers to the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
  • a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their intervening framework regions.
  • the portion will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region.
  • binding agents made by recombinant DNA techniques may result in the introduction of residues N- or C-terminal to the variable regions encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers to join variable regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the production of diabodies) or protein labels.
  • a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework.
  • a binding agent of the invention has the ability of binding to CLDN6, i.e. the ability of binding to an epitope present in CLDN6, preferably an epitope located within the extracellular domains of CLDN6, in particular the first extracellular loop, preferably amino acid positions 28 to 76 of CLDN6 or the second extracellular loop, preferably amino acid positions 141 to 159 of CLDN6.
  • an agent having the ability of binding to CLDN6 binds to an epitope on CLDN6 which is not present on CLDN9.
  • an agent having the ability of binding to CLDN6 binds to an epitope on CLDN6 which is not present on CLDN4 and/or CLDN3. Most preferably, an agent having the ability of binding to CLDN6 binds to an epitope on CLDN6 which is not present on a CLDN protein other than CLDN6.
  • An agent having the ability of binding to CLDN6 preferably binds to CLDN6 but not to CLDN9 and preferably does not bind to CLDN4 and/or CLDN3.
  • an agent having the ability of binding to CLDN6 is specific for CLDN6.
  • an agent having the ability of binding to CLDN6 binds to CLDN6 expressed on the cell surface. In particular preferred embodiments, an agent having the ability of binding to CLDN6 binds to native epitopes of CLDN6 present on the surface of living cells.
  • an agent having the ability of binding to CLDN6 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 22, 24, 26, and a fragment thereof.
  • VH heavy chain variable region
  • an agent having the ability of binding to CLDN6 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 21 , 23, 25, 27, 28, 29, and a fragment thereof.
  • an agent having the ability of binding to CLDN6 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities (i) to (vii):
  • VH comprises an amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 24 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 25 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 26 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 27 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 28 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 29 or a fragment thereof.
  • an agent having the ability of binding to CLDN6 comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof.
  • fragment refers, in particular, to one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
  • said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementarity- determining regions CDR1 , CDR2 and CDR3.
  • fragment refers to the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
  • a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their intervening framework regions.
  • the portion will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region.
  • binding agents made by recombinant DNA techniques may result in the introduction of residues N- or C-terminal to the variable regions encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers to join variable regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the production of diabodies) or protein labels.
  • a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework.
  • Anti-CD3 antibodies which are useful for providing binding agents according to the invention include but are not limited to UCHT1-HS (humanized mAB), UCHT1-MM (murine mAB), CLB-T3, TR66, 145-2C1 1.
  • UCHT1 is a monoclonal IgGl anti-CD3 monoclonal antibody which detects CD3 in human and primate sample types.
  • CLB-T3 is a mouse monoclonal anti-CD3 antibody which is directed against the CD3 antigen and reacts with 80-90% human peripheral T lymphocytes and medullary thymocytes.
  • TR66 is a mouse IgGl monoclonal anti-CD3 antibody which recognizes the epsilon-chain of human CD3.
  • 145-2C1 1 is an armenian hamster monoclonal anti-mouse CD3 antibody.
  • the VH and VL regions of the CD3 -binding domain are derived from antibodies/antibody molecules and antibody-like molecules which are capable of specifically recognizing the human CD3 in the context of other TCR subunits as present on activated primary human T cells expressing the TCR in its native configuration.
  • the VH and VL regions derived from an antibody specific for the CD3-epsilon chain are most preferred and said (parental) antibodies should be capable of specifically binding epitopes reflecting the native or near-native structure or a conformational epitope of human CD3 presented in the context of the TCR complex.
  • the VH and VL regions of the CD3- binding domain are derived from a CD3 specific antibody selected from the group consisting of UCHT1-HS, UCHT1-MM, CLB-T3 and TR66, preferably TR66.
  • an agent having the ability of binding to CD3 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 32, 34, 36, and a fragment thereof.
  • VH heavy chain variable region
  • an agent having the ability of binding to CD3 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, and a fragment thereof.
  • VL light chain variable region
  • an agent having the ability of binding to CD3 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities (i) to (iv):
  • VH comprises an amino acid sequence represented by SEQ ID NO: 30 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 31 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 32 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 33 or a fragment thereof,
  • the VH comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof,
  • an agent having the ability of binding to CD3 comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):
  • fragment refers, in particular, to one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
  • said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementarity- determining regions CDR1, CDR2 and CDR3.
  • fragment refers to the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
  • a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their intervening framework regions.
  • the portion will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region.
  • binding agents made by recombinant DNA techniques may result in the introduction of residues N- or C-terminal to the variable regions encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers to join variable regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the production of diabodies) or protein labels.
  • a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework.
  • a preferred binding agent targeting CLDN18.2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a variant thereof.
  • a preferred binding agent targeting CLDN6 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a variant thereof.
  • the binding agents described herein may be delivered to a patient by administering a nucleic acid such as RNA encoding the agent.
  • the nucleic acid provided can produce the agent over extended time periods in a sustained manner mitigating the instability at least partially observed for therapeutic antibodies, in particular bispecific antibodies.
  • Nucleic acids to be delivered to a patient can be produced by recombinant means.
  • recombinant in the context of the present invention means "made through genetic engineering".
  • a "recombinant object” such as a recombinant nucleic acid in the context of the present invention is not occurring naturally.
  • naturally occurring refers to the fact that an object can be found in nature.
  • a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
  • nucleic acid as used herein, is intended to include DNA and RNA such as genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules.
  • RNA includes in vitro transcribed RNA (IVT RNA) or synthetic RNA.
  • Nucleic acids may be comprised in a vector.
  • vector includes any vectors known to the skilled person including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as adenoviral or baculoviral vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or PI artificial chromosomes (PAC). Said vectors include expression as well as cloning vectors.
  • Expression vectors comprise plasmids as well as viral vectors and generally contain a desired coding sequence and appropriate DNA sequences necessary for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in in vitro expression systems.
  • Cloning vectors are generally used to engineer and amplify a certain desired DNA fragment and may lack functional sequences needed for expression of the desired DNA fragments.
  • RNA relates to a molecule which comprises ribonucleotide residues and preferably being entirely or substantially composed of ribonucleotide residues.
  • “Ribonucleotide” relates to a nucleotide with a hydroxyl group at the 2'-position of a ⁇ - D-ribofuranosyl group.
  • the term includes double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of a RNA or internally, for example at one or more nucleotides of the RNA.
  • Nucleotides in RNA molecules can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
  • RNA includes and preferably relates to "mRNA” which means “messenger RNA” and relates to a “transcript” which may be produced using DNA as template and encodes a peptide or protein.
  • mRNA typically comprises a 5' non translated region (5'-UTR), a protein or peptide coding region and a 3' non translated region (3 -UTR).
  • mRNA has a limited halftime in cells and in vitro.
  • mRNA is produced by in vitro transcription using a DNA template.
  • the RNA is obtained by in vitro transcription or chemical synthesis.
  • the in vitro transcription methodology is known to the skilled person. For example, there is a variety of in vitro transcription kits commercially available.
  • RNA used according to the present invention may be modified, preferably without altering the sequence of the expressed peptide or protein.
  • modification in the context of RNA as used according to the present invention includes any modification of RNA which is not naturally present in said RNA.
  • the RNA used according to the invention does not have uncapped 5 '-triphosphates. Removal of such uncapped 5'-triphosphates can be achieved by treating RNA with a phosphatase.
  • the term "modification” relates to providing an RNA with a 5 '-cap or 5 '-cap analog.
  • the term “5'-cap” refers to a cap structure found on the 5'-end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via an unusual 5' to 5' triphosphate linkage. In one embodiment, this guanosine is methylated at the 7-position.
  • the term “conventional 5 '-cap” refers to a naturally occurring RNA 5 '-cap, preferably to the 7- methylguanosine cap (m7G).
  • 5 '-cap includes a 5 '-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA if attached thereto, preferably in vivo and/or in a cell.
  • RNA with a 5'-cap or 5'-cap analog may be achieved by in vitro transcription of a DNA template in the presence of said 5'-cap or 5'-cap analog, wherein said 5'-cap is co- transcriptionally incorporated into the generated RNA strand, or the RNA may be generated, for example, by in vitro transcription, and the 5 '-cap may be attached to the RNA post- transcriptionally using capping enzymes, for example, capping enzymes of vaccinia virus.
  • the RNA may comprise further modifications.
  • a further modification of the RNA used in the present invention may be an extension or truncation of the naturally occurring poly(A) tail.
  • RNA if delivered to, i.e. transfected into, a cell, in particular a cell present in vivo, expresses the protein, peptide or antigen it encodes.
  • transfection relates to the introduction of nucleic acids, in particular RNA, into a cell.
  • the term “transfection” also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such cell, wherein the cell may be present in a subject, e.g., a patient.
  • RNA relates to the "half-life" of RNA.
  • "Half-life” relates to the period of time which is needed to eliminate half of the activity, amount, or number of molecules.
  • the half-life of an RNA is indicative for the stability of said RNA.
  • the half-life of RNA may influence the "duration of expression" of the RNA. It can be expected that RNA having a long half-life will be expressed for an extended time period.
  • the term “transcription” relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA may be translated into protein.
  • the term “transcription” comprises "in vitro transcription", wherein the term “in vitro transcription” relates to a process wherein RNA, in particular mRNA, is in vitro synthesized in a cell-free system, preferably using appropriate cell extracts.
  • cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are according to the present invention encompassed by the term "vector".
  • translation relates to the process in the ribosomes of a cell by which a strand of messenger RNA directs the assembly of a sequence of amino acids to make a peptide or protein.
  • expression is used according to the invention in its most general meaning and comprises the production of RNA and/or peptides or proteins, e.g. by transcription and/or translation.
  • expression or “translation” relates in particular to the production of peptides or proteins. It also comprises partial expression of nucleic acids. Moreover, expression can be transient or stable. According to the invention, the term expression also includes an "aberrant expression” or "abnormal expression”.
  • Aberrant expression or abnormal expression means according to the invention that expression is altered, preferably increased, compared to a reference, e.g. a state in a subject not having a disease associated with aberrant or abnormal expression of a certain protein, e.g., a tumor antigen.
  • An increase in expression refers to an increase by at least 10%, in particular at least 20%, at least 50% or at least 100%, or more.
  • expression is only found in a diseased tissue, while expression in a healthy tissue is repressed.
  • specifically expressed means that a protein is essentially only expressed in a specific tissue or organ.
  • RNA encoding means that RNA, if present in the appropriate environment, preferably within a cell, can be expressed to produce a protein or peptide it encodes.
  • CDR regions will be either identical or highly homologous to the regions of antibodies specified herein.
  • highly homologous it is contemplated that from 1 to 5, preferably from 1 to 4, such as 1 to 3 or 1 or 2 substitutions may be made in the CDRs.
  • the hypervariable and variable regions may be modified so that they show substantial homology with the regions of antibodies specifically disclosed herein.
  • variants of an amino acid sequence comprise amino acid insertion variants, amino acid addition variants, amino acid deletion variants and/or amino acid substitution variants.
  • Amino acid deletion variants that comprise the deletion at the N- terminal and/or C-terminal end of the protein are also called N-terminal and/or C-terminal truncation variants.
  • Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence.
  • amino acid sequence variants having an insertion one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible.
  • Amino acid addition variants comprise amino- and/or carboxy-terminal fusions of one or more amino acids, such as 1 , 2, 3, 5, 10, 20, 30, 50, or more amino acids.
  • Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1 , 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein.
  • Amino acid substitution variants are characterized by at least one residue in the sequence being removed and another residue being inserted in its place. Preference is given to the modifications being in positions in the amino acid sequence which are not conserved between homologous proteins or peptides and/or to replacing amino acids with other ones having similar properties.
  • amino acid changes in protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids.
  • a conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains.
  • Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.
  • the degree of similarity, preferably identity between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • the degree of similarity or identity is given preferably for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence.
  • the degree of similarity or identity is given preferably for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, preferably continuous amino acids.
  • the degree of similarity or identity is given for the entire length of the reference amino acid sequence.
  • the alignment for determining sequence similarity, preferably sequence identity can be done with art known tools, preferably using the best sequence alignment, for example, using Align, using standard settings, preferably EMBOSS ::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.
  • Sequence similarity indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions.
  • Sequence identity indicates the percentage of amino acids that are identical between the sequences.
  • the term “percentage identity” is intended to denote a percentage of amino acid residues which are identical between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. Sequence comparisons between two amino acid sequences are conventionally carried out by comparing these sequences after having aligned them optimally, said comparison being carried out by segment or by "window of comparison" in order to identify and compare local regions of sequence similarity.
  • the percentage identity is calculated by determining the number of identical positions between the two sequences being compared, dividing this number by the number of positions compared and multiplying the result obtained by 100 so as to obtain the percentage identity between these two sequences.
  • the binding agents of the invention can be produced either intracellullarly (e.g. in the cytosol, in the periplasma or in inclusion bodies) and then isolated from the host cells and optionally further purified; or they can be produced extracellularly (e.g. in the medium in which the host cells are cultured) and then isolated from the culture medium and optionally further purified.
  • cell or "host cell” preferably relates to an intact cell, i.e. a cell with an intact membrane that has not released its normal intracellular components such as enzymes, organelles, or genetic material.
  • An intact cell preferably is a viable cell, i.e. a living cell capable of carrying out its normal metabolic functions.
  • said term relates according to the invention to any cell which can be transfected with an exogenous nucleic acid.
  • cell includes bacterial cells; other useful cells are yeast cells, fungal cells or mammalian cells.
  • Suitable bacterial cells include cells from gram-negative bacterial strains such as strains of Escherichia coli, Proteus, and Pseudomonas, and gram-positive bacterial strains such as strains of Bacillus, Streptomyces, Staphylococcus, and Lactococcus.
  • Suitable fungal cell include cells from species of Trichoderma, Neurospora, and Aspergillus.
  • Suitable yeast cells include cells from species of Saccharomyces (Tor example Saccharomyces cerevisiae), Schizosaccharomyces (for example Schizo saccharomyces pombe), Pichia (for example Pichia pastoris and Pichia methanolicd), and Hansenula.
  • Suitable mammalian cells include for example CHO cells, BHK cells, HeLa cells, COS cells, 293 HEK and the like.
  • amphibian cells, insect cells, plant cells, and any other cells used in the art for the expression of heterologous proteins can be used as well.
  • Reduce means an overall decrease or the ability to cause an overall decrease, preferably of 5% or greater, 10% or greater, 20% or greater, more preferably of 50% or greater, and most preferably of 75% or greater, in the level, e.g. in the level of expression or in the level of proliferation of cells.
  • Terms such as "increase” or “enhance” preferably relate to an increase or enhancement by about at least 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 80% » and most preferably at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more.
  • ADCC describes the cell-killing ability of effector cells as described herein, in particular lymphocytes, which preferably requires the target cell being marked by an antibody.
  • ADCC preferably occurs when antibodies bind to antigens on tumor cells and the antibody Fc domains engage Fc receptors (FcR) on the surface of immune effector cells.
  • FcR Fc receptors
  • Several families of Fc receptors have been identified, and specific cell populations characteristically express defined Fc receptors.
  • ADCC can be viewed as a mechanism to directly induce a variable degree of immediate tumor destruction that leads to antigen presentation and the induction of tumor- directed T-cell responses.
  • in vivo induction of ADCC will lead to tumor-directed T- cell responses and host-derived antibody responses. Complement-dependent cytotoxicity
  • CDC is another cell-killing method that can be directed by antibodies.
  • IgM is the most effective isotype for complement activation.
  • IgGl and IgG3 are also both very effective at directing CDC via the classical complement-activation pathway.
  • the formation of antigen-antibody complexes results in the uncloaking of multiple Clq binding sites in close proximity on the CH2 domains of participating antibody molecules such as IgG molecules (Clq is one of three subcomponents of complement CI).
  • these uncloaked Clq binding sites convert the previously low-affinity Clq-IgG interaction to one of high avidity, which triggers a cascade of events involving a series of other complement proteins and leads to the proteolytic release of the effector-cell chemotactic/activating agents C3a and C5a.
  • the complement cascade ends in the formation of a membrane attack complex, which creates pores in the cell membrane that facilitate free passage of water and solutes into and out of the cell.
  • Antibodies described herein for e.g. providing VL and VH regions can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibodies can be employed, e.g., viral or oncogenic transformation of B- lymphocytes or phage display techniques using libraries of antibody genes. The preferred animal system for preparing hybridomas that secrete monoclonal antibodies is the murine system. Hybridoma production in the mouse is a very well established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
  • human monoclonal antibodies can be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system.
  • transgenic mice include mice known as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice.”
  • the production of human antibodies in such transgenic mice can be performed as described in detail for CD20 in WO2004 035607
  • mice can be immunized with carrier-conjugated peptides derived from the antigen sequence, i.e.
  • mice can be immunized with DNA encoding the antigen or fragments thereof.
  • mice can also be immunized with cells expressing the antigen, e.g., a cell line, to promote immune responses.
  • the immune response can be monitored over the course of the immunization protocol with plasma and serum samples being obtained by tail vein or retroorbital bleeds. Mice with sufficient titers of immunoglobulin can be used for fusions. Mice can be boosted intraperitonealy or intravenously with antigen expressing cells 3 days before sacrifice and removal of the spleen to increase the rate of specific antibody secreting hybridomas.
  • splenocytes and lymph node cells from immunized mice can be isolated and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line.
  • the resulting hybridomas can then be screened for the production of antigen-specific antibodies.
  • Individual wells can then be screened by ELISA for antibody secreting hybridomas.
  • ELISA Enzyme-Linked Immunosorbent assay for antibody secreting hybridomas.
  • the antibody secreting hybridomas can be replated, screened again, and if still positive for monoclonal antibodies can be subcloned by limiting dilution.
  • the stable subclones can then be cultured in vitro to generate antibody in tissue culture medium for characterization.
  • Antibodies also can be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene transfection methods as are well known in the art (Morrison, S. (1985) Science 229: 1202).
  • the gene(s) of interest e.g., antibody genes
  • an expression vector such as a eukaryotic expression plasmid such as used by the GS gene expression system disclosed in WO 87/04462, WO 89/01036 and EP 338 841 or other expression systems well known in the art.
  • the purified plasmid with the cloned antibody genes can be introduced in eukaryotic host cells such as CHO cells, NS/0 cells, HEK293T cells or HEK293 cells or alternatively other eukaryotic cells like plant derived cells, fungal or yeast cells.
  • the method used to introduce these genes can be methods described in the art such as electroporation, lipofectine, lipofectamine or others. After introduction of these antibody genes in the host cells, cells expressing the antibody can be identified and selected. These cells represent the transfectomas which can then be amplified for their expression level and upscaled to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and/or cells.
  • the cloned antibody genes can be expressed in other expression systems, including prokaryotic cells, such as microorganisms, e.g. E. coli.
  • the antibodies can be produced in transgenic non-human animals, such as in milk from sheep and rabbits or in eggs from hens, or in transgenic plants; see e.g. Verma, R., et al. (1998) J. Immunol. Meth. 216: 165- 181 ; Pollock, et al. (1999) J. Immunol. Meth. 231 : 147-157; and Fischer, R., et al. (1999) Biol. Chem. 380: 825-839.
  • Nonlabeled murine antibodies are highly immunogenic in man when repetitively applied leading to reduction of the therapeutic effect.
  • the main immunogenicity is mediated by the heavy chain constant regions.
  • the immunogenicity of murine antibodies in man can be reduced or completely avoided if respective antibodies are chimerized or humanized.
  • Chimeric antibodies are antibodies, the different portions of which are derived from different animal species, such as those having a variable region derived from a murine antibody and a human immunoglobulin constant region. Chimerisation of antibodies is achieved by joining of the variable regions of the murine antibody heavy and light chain with the constant region of human heavy and light chain (e.g. as described by raus et al., in Methods in Molecular Biology series, Recombinant antibodies for cancer therapy ISBN-0-89603-918-8).
  • chimeric antibodies are generated by joining human kappa-light chain constant region to murine light chain variable region. In an also preferred embodiment chimeric antibodies can be generated by joining human lambda-light chain constant region to murine light chain variable region.
  • the preferred heavy chain constant regions for generation of chimeric antibodies are IgGl, IgG3 and IgG4. Other preferred heavy chain constant regions for generation of chimeric antibodies are IgG2, IgA, IgD and IgM.
  • Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody- antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al. (1998) Nature 332: 323-327; Jones, P. et al. (1986) Nature 321 : 522-525; and Queen, C.
  • Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V (D) J joining during B cell maturation. Germline gene sequences will also differ from the sequences of a high affinity secondary repertoire antibody at individual evenly across the variable region. The ability of antibodies and other binding agents to bind an antigen can be determined using standard binding assays (e.g., ELISA, Western Blot, Immunofluorescence and flow cytometric analysis).
  • selected producer cell lines can be grown in two-liter spinner-flasks for recombinant antibody purification.
  • antibodies can be produced in dialysis based bioreactors. Supematants can be filtered and, if necessary, concentrated before affinity chromatography with protein L-sepharose. Eluted IgG can be checked by gel electrophoresis and high performance liquid chromatography to ensure purity.
  • the buffer solution can be exchanged into PBS, and the concentration can be determined by OD280 using the respective extinction coefficient.
  • the recombinant antibodies can be aliquoted and stored at -80°C.
  • flow cytometry can be used.
  • Cell lines expressing naturally or after transfection antigen and negative controls lacking antigen expression grown under standard growth conditions
  • the APC- or Alexa647-labeled anti IgG antibody can bind to antigen-bound monoclonal antibody under the same conditions as the primary antibody staining.
  • the samples can be analyzed by flow cytometry with a FACS instrument using light and side scatter properties to gate on single, living cells.
  • the method of co-transfection can be employed.
  • Cells transiently transfected with plasmids encoding antigen and a fluorescent marker can be stained as described above.
  • Transfected cells can be detected in a different fluorescence channel than antibody-stained cells.
  • An alternative assay using fluorescence microscopy may be used in addition to or instead of the flow cytometry assay.
  • Cells can be stained exactly as described above and examined by fluorescence microscopy.
  • immunofluorescence microscopy analysis can be used.
  • cell lines expressing either spontaneously or after transfection antigen and negative controls lacking antigen expression are grown in chamber slides under standard growth conditions in DMEM/F12 medium, supplemented with 10 % fetal calf serum (FCS), 2 mM L-glutamine, 100 IU/ml penicillin and 100 ⁇ g ml streptomycin.
  • FCS fetal calf serum
  • Cells can then be fixed with methanol or paraformaldehyde or left untreated.
  • Cells can then be reacted with monoclonal antibodies against the antigen for 30 min. at 25°C. After washing, cells can be reacted with an Alexa555-labelled anti-mouse IgG secondary antibody (Molecular Probes) under the same conditions. Cells can then be examined by fluorescence microscopy.
  • Cell extracts from cells expressing antigen and appropriate negative controls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens will be transferred to nitrocellulose membranes, blocked, and probed with the monoclonal antibodies to be tested. IgG binding can be detected using anti- mouse IgG peroxidase and developed with ECL substrate. Antibodies can be further tested for reactivity with antigen by Immunohistochemistry in a manner well known to the skilled person, e.g.
  • SDS sodium dodecyl sulfate
  • Binding agents described herein also can be tested in an in vivo model (e.g. in immune deficient mice carrying xenografted tumors inoculated with cell lines expressing CLDN to determine their efficacy in controlling growth of CLDN-expressing tumor cells.
  • Binding agents can be administered to tumor free mice followed by injection of tumor cells to measure the effects of the binding agents to prevent formation of tumors or tumor-related symptoms. Binding agents can be administered to tumor-bearing mice to determine the therapeutic efficacy of respective binding agents to reduce tumor growth, metastasis or tumor related symptoms. Application of binding agents can be combined with application of other substances as cystostatic drugs, growth factor inhibitors, cell cycle blockers, angiogenesis inhibitors or antibodies to determine synergistic efficacy and potential toxicity of combinations.
  • binding agents can be inoculated with binding agents or control reagents and thoroughly investigated for symptoms possibly related to CLDN-binding agent therapy. Mapping of epitopes recognized by binding agents can be performed as described in detail in "Epitope Mapping Protocols (Methods in Molecular Biology) by Glenn E. Morris ISBN-089603- 375-9 and in “Epitope Mapping: A Practical Approach” Practical Approach Series, 248 by Olwyn M. R. Wesrwood, Frank C. Hay.
  • the compounds and agents described herein may be administered in the form of any suitable pharmaceutical composition.
  • the pharmaceutical compositions of the invention are preferably sterile and contain an effective amount of the binding agents described herein and optionally of further agents as discussed herein to generate the desired reaction or the desired effect.
  • compositions are usually provided in a uniform dosage form and may be prepared in a manner known per se.
  • a pharmaceutical composition may e.g. be in the form of a solution or suspension.
  • a pharmaceutical composition may comprise salts, buffer substances, preservatives, carriers, diluents and/or excipients all of which are preferably pharmaceutically acceptable.
  • pharmaceutically acceptable refers to the non-toxicity of a material which does not interact with the action of the active component of the pharmaceutical composition.
  • Salts which are not pharmaceutically acceptable may be used for preparing pharmaceutically acceptable salts and are included in the invention.
  • Pharmaceutically acceptable salts of this kind comprise in a non limiting way those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic acids, and the like.
  • Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts or calcium salts.
  • Suitable buffer substances for use in a pharmaceutical composition include acetic acid in a salt, citric acid in a salt, boric acid in a salt and phosphoric acid in a salt.
  • Suitable preservatives for use in a pharmaceutical composition include benzalkonium chloride, chlorobutanol, paraben and thimerosal.
  • An injectible formulation may comprise a pharmaceutically acceptable excipient such as Ringer Lactate.
  • carrier refers to an organic or inorganic component, of a natural or synthetic nature, in which the active component is combined in order to facilitate, enhance or enable application. According to the invention, the term “carrier” also includes one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for administration to a patient.
  • Possible carrier substances for parenteral administration are e.g. sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide/glycolide copolymers or polyoxyethylene/polyoxy- propylene copolymers.
  • excipient when used herein is intended to indicate all substances which may be present in a pharmaceutical composition and which are not active ingredients such as, e.g., carriers, binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, or colorants.
  • the agents and compositions described herein may be administered via any conventional route, such as by parenteral administration including by injection or infusion. Administration is preferably parenterally, e.g. intravenously, intraarterially, subcutaneously, intradermally or intramuscularly.
  • compositions suitable for parenteral administration usually comprise a sterile aqueous or nonaqueous preparation of the active compound, which is preferably isotonic to the blood of the recipient.
  • suitable carriers and solvents are Ringer solution and isotonic sodium chloride solution.
  • sterile, fixed oils are used as solution or suspension medium.
  • an "effective amount” refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses.
  • the desired reaction preferably relates to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease.
  • the desired reaction in a treatment of a disease or of a condition may also be delay of the onset or a prevention of the onset of said disease or said condition.
  • an effective amount of an agent or composition described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration and similar factors. Accordingly, the doses administered of the agents described herein may depend on various of such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.
  • the agents and compositions described herein can be administered to patients, e.g., in vivo, to treat or prevent a variety of disorders such as those described herein.
  • Preferred patients include human patients having disorders that can be corrected or ameliorated by administering the agents and compositions described herein. This includes disorders involving cells characterized by an altered expression pattern of CLDN such as CLDN18.2 and/or CLDN6.
  • agents described herein can be used to treat a patient with a cancer disease, e.g., a cancer disease such as described herein characterized by the presence of cancer cells expressing CLDN.
  • a cancer disease e.g., a cancer disease such as described herein characterized by the presence of cancer cells expressing CLDN.
  • the pharmaceutical compositions and methods of treatment described according to the invention may also be used for immunization or vaccination to prevent a disease described herein.
  • the pharmaceutical composition of the invention may be administered together with supplementing immunity-enhancing substances such as one or more adjuvants and may comprise one or more immunity-enhancing substances to further increase its effectiveness, preferably to achieve a synergistic effect of immunostimulation.
  • immunity-enhancing substances such as one or more adjuvants
  • the term "adjuvant” relates to compounds which prolongs or enhances or accelerates an immune response.
  • Various mechanisms are possible in this respect, depending on the various types of adjuvants.
  • compounds which allow the maturation of the DC e.g. lipopolysaccharides or CD40 ligand, form a first class of suitable adjuvants.
  • any agent which influences the immune system of the type of a "danger signal" (LPS, GP96, dsRNA etc.) or cytokines, such as GM-CSF, can be used as an adjuvant which enables an immune response to be intensified and/or influenced in a controlled manner.
  • CpG oligodeoxynucleotides can optionally also be used in this context, although their side effects which occur under certain circumstances, as explained above, are to be considered.
  • Particularly preferred adjuvants are cytokines, such as monokines, lymphokines, interleukins or chemokines, e.g.
  • Further known adjuvants are aluminium hydroxide, Freund's adjuvant or oil such as Montanide®, most preferred Montanide® IS A51.
  • Lipopeptides, such as Pam3Cys are also suitable for use as adjuvants in the pharmaceutical composition of the present invention.
  • agents and compositions provided herein may be used alone or in combination with conventional therapeutic regimens such as surgery, irradiation, chemotherapy and/or bone marrow transplantation (autologous, syngeneic, allogeneic or unrelated).
  • a cancer treatment which utilizes immune- or vaccination-based mechanisms such as the methods and pharmaceutical compositions of the present invention may be effectively combined with various other drugs and/or methods targeting similar or other specific mechanisms.
  • those are e.g. combinations with conventional tumor therapies, multi-epitope strategies, additional immunotherapy, and treatment approaches targeting angiogenesis or apoptosis (for review see e.g. Andersen et al. 2008: Cancer treatment: the combination of vaccination with other therapies.
  • Chemotherapy is the standard of care for multiple types of cancer.
  • the most common chemotherapy agents act by killing cells that divide rapidly, one of the main properties of cancer cells.
  • conventional chemotherapeutic drugs such as e.g. alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents which either affect cell division or DNA synthesis may significantly improve the therapeutic effects of the present invention by clearing suppressor cells, reboot of the immune system, by rendering tumor cells more susceptible to immune mediated killing, or by additional activation of cells of the immune system.
  • a synergistic anti-cancer action of chemotherapeutic and vaccination-based immunotherapeutic drugs has been demonstrated in multiple studies (see e.g.
  • Quoix et al. 201 1 Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial. Lancet Oncol. 12(12): 1 125-33.; see also Liseth et al. 2010: Combination of intensive chemotherapy and anticancer vaccines in the treatment of human malignancies: the hematological experience. J Biomed Biotechnol. 2010: 6920979; see also Hirooka et al 2009: A combination therapy of gemcitabine with immunotherapy for patients with inoperable locally advanced pancreatic cancer. Pancreas 38(3): e69-74). There are hundreds of chemotherapeutic drugs available which are basically suitable for combination therapies.
  • chemotherapeutic drugs which can be combined with the present invention are carboplatin (Paraplatin), cisplatin (Platinol, Platinol-AQ), cyclophosphamide (Cytoxan, Neosar), docetaxel (Taxotere), doxorubicin (Adriamycin), erlotinib (Tarceva), etoposide (VePesid), fluorouracil (5- FU), gemcitabine (Gemzar), imatinib mesylate (Gleevec), irinotecan (Camptosar), methotrexate (Folex, Mexate, Amethopterin), paclitaxel (Taxol, Abraxane), sorafinib (Nexavar), sunitinib (Sutent), topotecan (Hycamtin), vincristine (Oncovin, Vincasar PFS), and
  • Radiation therapy remains an important component of cancer treatment with approximately 50% of all cancer patients receiving radiation therapy during their course of illness.
  • the main goal of radiation therapy is to deprive cancer cells of their multiplication (cell division) potential.
  • the types of radiation used to treat cancer are photons radiation (x-rays and gamma rays) and particle radiations (electron, proton and neutron beams.)
  • Photons radiation x-rays and gamma rays
  • particle radiations electron, proton and neutron beams.
  • External beam radiation is delivered from outside the body by aiming high-energy rays (photons, protons or particle radiation) to the location of the tumor.
  • Internal radiation or brachytherapy is delivered from inside the body by radioactive sources, sealed in catheters or seeds directly into the tumor site.
  • Radiation therapy techniques which are applicable in combination with the present invention are e.g. fractionation (radiation therapy delivered in a fractionated regime, e.g. daily fractions of 1.5 to 3 Gy given over several weeks), 3D conformal radiotherapy (3DCRT; delivering radiation to the gross tumor volume), intensity modulated radiation therapy (IMRT; computer-controlled intensity modulation of multiple radiation beams), image guided radiotherapy (IGRT; a technique comprising pre-radiotherapy imaging which allows for correction), and stereotactic body radiation therapy (SRBT, delivers very high individual doses of radiation over only a few treatment fractions).
  • fractionation radiation therapy delivered in a fractionated regime, e.g. daily fractions of 1.5 to 3 Gy given over several weeks
  • 3DCRT 3D conformal radiotherapy
  • IMRT intensity modulated radiation therapy
  • IGRT image guided radiotherapy
  • SRBT stereotactic body radiation therapy
  • Antibodies achieve their therapeutic effect against cancer cells through various mechanisms. They can have direct effects in producing apoptosis or programmed cell death. They can block components of signal transduction pathways such as e.g. growth factor receptors, effectively arresting proliferation of tumor cells. In cells that express monoclonal antibodies, they can bring about anti-idiotype antibody formation. Indirect effects include recruiting cells that have cytotoxicity, such as monocytes and macrophages. This type of antibody-mediated cell kill is called antibody-dependent cell mediated cytotoxicity (ADCC). Antibodies also bind complement, leading to direct cell toxicity, known as complement dependent cytotoxicity (CDC). Combining surgical methods with immunotherapeutic drugs or methods is an successful approach, as e.g.
  • Cytokines chemokines, costimulatory molecules, fusion proteins
  • chemokines with C, CC, CXC and CX3C structures might be used.
  • Some of the most promising chemokines are e.g CCR7 and its ligands CCL19 and CCL21, furthermore CCL2, CCL3, CCL5, and CCL16.
  • Other examples are CXCR4, CXCR7 and CXCL12.
  • costimulatory or regulatory molecules such as e.g. B7 ligands (B7.1 and B7.2) are useful.
  • B7 ligands B7.1 and B7.2
  • other cytokines such as e.g. interleukins especially (e.g. IL-1 to IL17), interferons (e.g. IFNalphal to IFNalpha8, IFNalphalO, IFNalphal3, IFNalphal4, IFNalphal6, IFNalphal7, IFNalpha21, IFNbetal, IFNW, IFNE1 and IFNK), hematopoietic factors, TGFs (e.g.
  • TGF-a, TGF- ⁇ , and other members of the TGF family members of the rumor necrosis factor family of receptors and their ligands as well as other stimulatory molecules, comprising but not limited to 4- IBB, 4-1BB-L, CD 137, CD137L, CTLA-4GITR, GITRL, Fas, Fas-L, TNFR1 , TRAIL-R1 , TRAIL-R2, p75NGF-R, DR6, LT.beta.R, RANK, EDAR1 , XEDAR, Fnl 14, Troy/Trade, TAJ, TNFRII, HVEM, CD27, CD30, CD40, 4-1 BB, OX40, GITR, GITRL, TACI, BAFF-R, BCMA, RELT, and CD95 (Fas/APO-1), glucocorticoid-induced TNFR-related protein, TNF receptor-related apoptosis- mediating protein (TRAMP)
  • CD40/CD40L and OX40/OX40L are important targets for combined immunotherapy because of their direct impact on T cell survival and proliferation.
  • kinase inhibitors Another large group of potential targets for complementary cancer therapy comprises kinase inhibitors, because the growth and survival of cancer cells is closely interlocked with the deregulation of kinase activity. To restore normal kinase activity and therefor reduce tumor growth a broad range of inhibitors is in used.
  • the group of targeted kinases comprises receptor tyrosine kinases e.g.
  • Small molecule kinase inhibitors are e.g. PHA-739358, Nilotinib, Dasatinib, and PD166326, NSC 74341 1 , Lapatinib (GW-572016), Canertinib (CI-1033), Semaxinib (SU5416), Vatalanib (PTK787/ZK222584), Sutent (SU11248), Sorafenib (BAY 43-9006) and Leflunomide (SU101).
  • Zhang et al. 2009 Targeting cancer with small molecule kinase inhibitors. Nature Reviews Cancer 9, 28-39. 8. Toll-like receptors
  • TLRs Toll-like receptor
  • angiogenesis inhibitors prevent the extensive growth of blood vessels (angiogenesis) that tumors require to survive.
  • the angiogenesis promoted by tumor cells to meet their increasing nutrient and oxygen demands for example can be blocked by targeting different molecules.
  • Non-limiting examples of angiogenesis-mediating molecules or angiogenesis inhibitors which may be combined with the present invention are soluble VEGF (VEGF isoforms VEGF121 and VEGF 165, receptors VEGFR1, VEGFR2 and co-receptors Neuropilin-1 and Neuropilin-2) 1 and NRP-1, angiopoietin 2, TSP-1 and TSP-2, angiostatin and related molecules, endostatin, vasostatin, calreticulin, platelet factor-4, TIMP and CDAI, Meth-1 and Meth-2, IFN- ⁇ , - ⁇ and - ⁇ , CXCL10, IL-4, -12 and -18, prothrombin (kringle domain-2), antithrombin III fragment, prolactin, VEGI, SPARC, osteopontin, maspin, canstatin, proliferin-related protein, restin and drugs like e.g.
  • soluble VEGF VEGF isoforms VEGF121
  • Small molecule targeted therapy drugs are generally inhibitors of enzymatic domains on mutated, overexpressed, or otherwise critical proteins within the cancer cell.
  • Prominent and non- limiting examples are the tyrosine kinase inhibitors imatinib (Gleevec/Glivec) and gefitinib (Iressa).
  • the use of small molecules e.g. sunitinib malate and/or sorafenib tosylate targeting some kinases in combination with vaccines for cancer therapy is also described in previous patent application US2009004213.
  • virus-based cancer vaccines available or under development which can be used in a combined therapeutic approach together with the formulations of the present invention.
  • One advantage of the use of such viral vectors is their intrinsic ability to initiate immune responses, with inflammatory reactions occurring as a result of the viral infection creating the danger signal necessary for immune activation.
  • An ideal viral vector should be safe and should not introduce an anti-vector immune response to allow for boosting antitumour specific responses.
  • Recombinant viruses such as vaccinia viruses, herpes simplex viruses, adenoviruses, adeno-associated viruses, retroviruses and avipox viruses have been used in animal tumour models and based on their encouraging results, human clinical trials have been initiated.
  • virus-like particles small particles that contain certain proteins from the outer coat of a virus.
  • Virus-like particles do not contain any genetic material from the virus and cannot cause an infection but they can be constructed to present tumor antigens on their coat.
  • VLPs can be derived from various viruses such as e.g. the hepatitis B virus or other virus families including Parvoviridae (e.g. adeno-associated virus), Retroviridae (e.g. HIV), and Flaviviridae (e.g. Hepatitis C virus).
  • Parvoviridae e.g. adeno-associated virus
  • Retroviridae e.g. HIV
  • Flaviviridae e.g. Hepatitis C virus
  • Rapoport et al. 201 1 Combination immunotherapy using adoptive T-cell transfer and tumor antigen vaccination on the basis of hTERT and survivin after ASCT for myeloma. Blood 1 17(3):788-97. 14. Peptide-based target therapies
  • Peptides can bind to cell surface receptors or affected extracellular matrix surrounding the tumor. Radionuclides which are attached to these peptides (e.g. RGDs) eventually kill the cancer cell if the nuclide decays in the vicinity of the cell. Especially oligo- or multimers of these binding motifs are of great interest, since this can lead to enhanced tumor specificity and avidity.
  • Yamada 201 1 Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant glioma. Nihon Rinsho 69(9): 1657-61.
  • cancer therapies which can be combined with the formulations and methods of the present invention in order to create synergistic effects.
  • Non-limiting examples are treatments targeting apoptosis, hyperthermia, hormonal therapy, telomerase therapy, insulin potentiation therapy, gene therapy and photodynamic therapy.
  • the present invention is further illustrated by the following examples which are not be construed as limiting the scope of the invention.
  • Example 1 Generation and testing of bispecific binding agents targeting CLDN18.2 and CP3 a. Sequence origin, design ofbi-scFv constructs, and clonig into expression vectors
  • Bispecific tandem single chain antibody constructs containing binding domains specific for the human T cell receptor component CD3 and human tumor associated antigens (TAA) were prepared.
  • the corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) for each construct were specifically arranged from N- to C-terminus in consecutive order:
  • Table 1 summarizes all bi-scFv constructs specific for the TAA CLDN18.2 and PLAC1 that were generated in the course of the invention.
  • the bi-scFv constructs were generated by gene synthesis by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany) using the V H and VL sequences of the corresponding antibodies. Codon optimizations such as Homo sapiens (HS), Mus musculus (MM), or Chinese Hamster Ovary (CHO) were implemented by GeneArt's GeneOptimizer® software, and are listed in Table 1. Information on specificity, sequence origin from monoclonal antibodies (mAB), codon usage, additional sequence features and references of all applied domains are summarized in Table 2. Variable domain sequence origin of the respective CD3 antibodies are listed in Table 2.
  • the same anti-TAA VH and VL sequences could be used for the generation of bi-scFv constructs for mouse assays, but in combination with the V H , VL sequences of the mouse specific anti-CD3 antibody clone 145-2C1 1.
  • DNA cloning and expression vector construction was carried out according to standard procedures (Green/Sambrook, Molecular Cloning, 2012) well known by the skilled person. Briefly, the leadoff bi-scFv DNA sequences were provided with a 5 ' H/ ' ndlll and a 3' Xhol restriction site (Hwdlll and Xbal in case of bi-scFv I BiMAB) for cloning into expression plasmids. A secretion signal sequence was introduced at the 5' end upstream of the bi-scFv sequence for protein secretion from cellular cytoplasm into the culture medium.
  • a sequence coding for a 15 to 18 amino acid flexible glycine-serine peptide linker was inserted to join the V H and VL domains for the composition of the single chain variable antibody fragments (scFv) of which one binds to CD3 and the other to the TAA.
  • scFv single chain variable antibody fragments
  • the two scFv domain sequences were connected by a sequence coding for a short peptide linker (GGGGS). Together with this linker sequence a BamHl restriction site was introduced for scFv domain exchanges for the cloning of upcoming bi-scFV constructs.
  • 5 'scFv-domains could be exchanged by HmdIII and BamHl restriction and 3 'scFv-domains by BamHl and Xhol restriction.
  • CHO Chinese Hamster Ovary
  • HS Homo sapiens
  • HU humanized
  • MM Muscle
  • CHO indicates Chinese Hamster Ovary; HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus musculus; TAA, tumor associated antigen.
  • lxlO 7 HEK293 cells were plated two days prior to transfection on 14.5 cm tissue culture dishes in 20 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics were added. 20 ⁇ g of linearized DNA of the constructs described under Example l .a were diluted in 0.5 ml plain DMEM/F-12 medium.
  • lxlO 6 CHO- 1 cells were plated one day prior to transfection on 6-well tissue culture plates in 2 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS, without antibiotics; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 1.5 ml of plain DMEM medium without FCS or antibiotics were added. 4 ⁇ g of linearized DNA of the constructs described under Example l .a were diluted in 0.25 ml plain DMEM F-12 medium and mixed gently.
  • transfected cells started 48h after transfection with G418 sulfate (Gibco/Life Technologies GmbH, Darmstadt, Germany) in a final concentration of 0.5 mg/ml. G418 was added permanently to the culture medium for cell culturing. c. Selection of HEK293 as producer cells
  • Example l .b Expression of bi-scFv proteins by stably transfected HEK293 and CHO-K1 cell lines described under Example l .b was characterized by immunofluorescence staining to detect bi-scFv expression according to standard procedures (Current Protocols in Immunology, 2012). Briefly, 2x10 s cells were grown on glass slides for 24h and then permealized with 2% PFA. DPBS supplemented with 5% BSA and 0.2% Saponin was used as blocking buffer. After washing with DPBS and blocking with blocking buffer, cells were incubated with primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1 :500 in blocking buffer for 30 min at RT.
  • Primary antibody Anti-HIS Epitope-Tag Dianova GmbH, Hamburg, Germany
  • HEK293 cells showed an overall better expression of bi-scFv proteins than CHO-K1 cells and were therefore chosen as producer cell line. d. Production and detection of bi-scFv protein IBiMAB with HEK293 clone #28
  • Bi-scFv 1 BiMAB was chosen as first bi-scFv protein to be produced, purified and used for the establishment of various assays.
  • clonal cell lines of HEK293 bulk cells stably expressing IBiMAB were produced by single cell sorting using a F ACS Aria cell sorter (BD Biosciences, Heidelberg, Germany). After expansion of nearly 40 clonal lines, the best producer clone was selected by immunofluorescence as described under Example 1.c.
  • Selected producer clone #28 was expanded and cultured in a 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin- streptomycin and 0.8 mg/ml G418 (all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's guidelines.
  • DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin- streptomycin and 0.8 mg/ml G418 (all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's guidelines.
  • cells were washed with DPBS and medium was changed to DMEM/F-12 medium with antibiotics but without FBS.
  • Cell supernatant containing bi-scFv protein I BiMAB was harvested every 3 - 5 days for up to 4 weeks. Supernatant was filtered with 500 ml Steritop Filter Units (Merck Milli
  • the gels were stained with Coomassie Brilliant Blue solution according to standard procedures to detect bi- scFv protein IBiMAB between 50 and 60 kD and other proteins contained in the cell culture supernatant.
  • Western blot analysis was performed to specifically detect bi-scFc protein 1 BiMAB via its 6xHis-tag. Briefly, after blotting proteins on PVDF membrane and blocking with PBST/3% milk powder, the membrane was incubated for lh at 4°C with primary antibody Anti- HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1 :500 in blocking buffer.
  • Elution was performed by a stepwise gradient. Eluted bi-scFv protein IBiMAB was immediately dialyzed against lx PBS using a Slide- A-Lyzer G2 Dialysis Cassette 10K MWCO (Pierce/Thermo Fisher Scientific, Rockford, IL, USA). After dialysis against lx PBS, bi-scFv was dialyzed against an H 2 0 based 200 mM arginine buffer (L-Arginin-monohydrochloride; Roth, Düsseldorf, Germany).
  • Bi-scFv concentration was determined by measurement at 280 nm with a NanoDrop 2000c under consideration of the extinction coefficient and the molecular weight of bi-scFv protein 1 BiMAB determined via the ProtParam tool (http://web.expasy.org/protparam/). Purified protein was aliquoted and stored at -80°C for long time storage or kept at 4°C for immediate use.
  • purified 1 BiMAB protein was used, diluted in lx PBS within the range of 10 - 500 ng/ml.
  • Supernatants were diluted 1 : 10 in lx PBS.
  • 100 ⁇ of diluted protein or supernatant were transferred to each well and incubated for one hour while shaking.
  • an anti- idiotypic antibody against the V H -V L domains of mCLDN18.2ab was diluted to a final concentration of 0.5 ⁇ g/ml in lx PBS/3 % BSA.
  • 100 ⁇ of the anti-mCLDN18.2ab solution were added per well and incubated for one hour while shaking.
  • an AP-conjugated anti- mouse-Fc antibody (Jackson ImmunoResearch Europe, Suffolk, England) was diluted to a final concentration of 300 ng/ml in lx PBS/3 % BSA. 100 ⁇ of this secondary antibody solution were added per well and incubated for an additional hour while shaking. As negative controls, secondary antibody only, 1 BiMAB plus secondary antibody, and anti-mCLDN18.2ab plus secondary antibody were used. In addition, HEK293 cell supernatant without bi-scFv protein was included in the assay. Finally, 50 ⁇ AP substrate solution (1.5 mg pNPP per ml substrate buffer, AppliChem GmbH, Darmstadt, Germany) were added per well after washing.
  • HEK293T human embryonic kidney cell line HEK293T (ATCC CRL-1 1268) was used for transfection.
  • lxlO 7 HEK293T cells were plated two days prior to transfection on 14.5 cm tissue culture dishes in 20 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics were added.
  • Example 2 Establishment of functional assays to monitor specific T cell activation and target cell lysis by redirected T cells mediated by bi-scFv proteins
  • FPLC -purified bi-scFv protein IBiMAB was used to establish in vitro assays to monitor the capability of bi-scFv proteins to specifically redirect human effector cells to TAA-positive target cells. The aim was to visualize the effects and to quantify the activation of human T cells and the specific target cell lysis. a. Microscopic analysis of T cells redirected to target cells by bi-scFv protein
  • Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Current Protocols in Immunology, 2012): briefly, blood was diluted with DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences, Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were collected from the interphase, washed with cold DPBS supplemented with 2 mM EDTA and counted. Human T cells were subsequently separated by magnetic-activated cell separation (MACS) from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) according to the manufacturer's guidelines.
  • PBMCs Peripheral blood mononuclear cells
  • lxlO 5 NugC4 cells were seeded per well into tissue culture 6-well plates. Human cells were prepared as described above and added in an effector to target (E:T) ratio of 5: 1. RPMI 1640 medium supplemented with 5% heat inactivated human AB serum, 0.5% penicillin-streptomycin, lx NEAA and 1 mM sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt, Germany) was used for all cells and the final volume per well was adjusted to 2 ml per well. Control samples comprised target or T cells alone with and without bi-scFv protein. Tissue culture plates were subsequently incubated at 37°C, 5% C0 2 .
  • the assay was continuously observed with a Wilovert S inverted microscope (Hund, Wetzlar, Germany) from 6h to 48h of coincubation. Significant effects in terms of T cell clustering on target cells, formation of an immunologic synapse and target cell killing in the presence of bi-scFv protein IBiMAB were seen at 24h. After 48h viable target cells could hardly be found. Pictures were taken at 24h with a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). See also Figure 5.
  • a flow cytometric assay was established.
  • the early activation marker CD69 and the late activation marker CD25 were selected for staining by fluorescence-conjugated antibodies.
  • CD3 on T cells was stained.
  • Example 2. a The assay set-up from above was chosen (Example 2. a). Briefly, NugC4 target cells were seeded with human T cells in an E:T ratio of 5: 1 in 2 ml complete medium and bi-scFv protein I BiMAB was added in a concentration within the range of 0.001 - 1000 ng/ml. Control samples contained target or T cells alone with and without bi-scFv protein IBiMAB. After 24h and/or 48h - depending on the result of the visibility control - all cells were harvested by gentle scraping with Cell Scrapers (Sarstedt AG & Co, Nurmbrecht, Germany) and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS.
  • Mouse Anti-Human CD3-FITC, Mouse Anti-Human CD69-APC, and Mouse Anti- Human CD25-PE were used.
  • Cell pellets were resuspended in 50 ⁇ FACS-buffer (DPBS supplemented with 5% FBS) containing the fluorescence-conjugated antibodies. After incubation for 20 min at 4°C in the dark, samples were washed with 4 ml DPBS and cell pellets were resuspended in 200 ⁇ FACS buffer containing propidium iodide (PI) or 7-AAD (both Sigma Aldrich, Germany) in a final dilution of 1 : 1000 for the detection of dead cells.
  • PI propidium iodide
  • 7-AAD both Sigma Aldrich, Germany
  • this assay also allows the qualitative analysis of bi-scFv mediated effects on target cell killing by gating on the target cell population and estimating the percentage of PI- or 7-AAD-positive target cells (no data shown). All analyses were performed with FlowJo software (Tree Star, San Carlos, CA, USA). c. Luciferase cytotox assay
  • luciferase cytotox assay was chosen. Herewith the measurement of luciferase-expression by viable target cells allows to indirectly determine the target cell lysis mediated by cytotoxic effector cells in the presence of antibody.
  • NugC4 cells (described above) were transduced with a lentiviral vector carrying firefly luciferase, an EGFP reporter gene and an antibiotic selection marker. After antibiotic selection of transduced cells, EGFP high expressing cells were sorted by a FACSAria cell sorter (BD Biosciences, Heidelberg, Germany), analyzed for high luciferase expression and subsequently expanded for further studies.
  • a FACSAria cell sorter BD Biosciences, Heidelberg, Germany
  • Human effector cells were prepared as described under Example 2. a. Establishment of the assay was performed within the range of 1 - 100 ng/ml of the bi-scFv protein IBiMAB, whereby a concentration of 5 ng/ml was found to result in highly efficient and reproducible effects and was further used as standard concentration. NugC4 cells stably expressing luciferase (described above) were used as target cells. lxlO 4 target cells were seeded per well into white flat bottom 96-well plates. Human T cells (prepared as described under Example 2. a) were added in an E:T ratio of 5:1. The medium described above (Example 2. a) was used and the final volume per well was adjusted to 100 ⁇ . Test samples and control samples were plated at least in triplicates.
  • % specific lysis [1— (luminescencetest sample- Lmax) (Lmin - Lmax)] x 100, whereas "L” indicates lysis.
  • Lmin refers to the minimum lysis in the absence of bi-scFv and L max to the maximum lysis (equal to spontaneous luminescence counts) in the absence of bi-scFv achieved by addition of Triton X- 100 (2% final concentration).
  • This assay was used for further studies to investigate the specific T cell mediated lysis of target cells. Modifications were implemented e.g. by varying bi-scFv concentrations, bi-scFv proteins, E:T ratios, or effector cells (CD8+, CD4+ T cells, PBMCs).
  • Example 3 Selection of a CLDN18.2-specific bi-scFv lead candidate Luciferase cytotox assay with various CLDN18.2-specific bi-scFv proteins for the selection of the most potent bi-scFv variant
  • control bi-scFv protein no.35 was seeded with target and T cells ninefold, test samples were plated sixfold. Per time point one plate was prepared for analysis.
  • bi-scFv proteins IBiMAB SEQ ID NO: 39
  • no.15 SEQ ID NO: 41
  • IBiMAB and no.15 are equal in their efficiency
  • the so far better investigated bi-scFv protein IBiMAB was selected for all following assays. Constructs 18PHU3 and 18PHU5 (see Table 1 and 2) were compared at a later time point to IBiMAB. Efficiency of 18PHU5 was equivalent to IBiMAB, 18PHU3 was less potent (data not shown).
  • CLDN18.2 To assess the binding capacity of the CLDN18.2 and the CD3-targeting moieties of bi-scFv proteins a flow cytometric assay was established.
  • CLDN18.2 endogenously expressing NugC4 cells were used to investigate the anti-CLDN18.2 site and human T cells were used to investigate the anti-CD3 site.
  • NugC4 cells were trypsinized, washed with complete RPMI 1640 medium and subsequently with DPBS. All washing steps were conducted by centrifugation at 1200 rpm for 6 min at 4°C. 2.5x10 5 NugC4 cells were transferred to 5 ml round bottom tubes and incubated with 50 ⁇ g/ml FPLC-purified IBiMAB protein in FACS-buffer for 30 min at 4°C. Cells were washed with 2 ml FACS-buffer and subsequently incubated with 3.3 g/ml of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) for 30 min at 4°C.
  • the cell pellet was incubated with an APC-conjugated goat-anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, England) in a 1 :200 dilution in FACS-buffer for 20 min at 4°C in the dark.
  • Cells were washed twice with 2 ml FACS-buffer and finally resuspended in 150 ⁇ FACS-buffer supplemented with 1 ⁇ / ⁇ 1 PI (Sigma Aldrich, Germany) to counterstain dead cells.
  • Cancer cell lines that endogenously express high or low levels of CLDN18.2 and cancer cell lines that do not express CLDN18.2 were chosen to prove the strict target dependency of bi-scFv protein 1 BiMAB in an in vitro cytotox assay.
  • the chosen cell lines were of the two predominant carcinoma types that express CLDN18.2: gastric (NugC4, MKN7, SNU-1 ) and pancreatic (DanG, KP-4) carcinoma.
  • Breast carcinoma cell line MCF7 was used as negative control.
  • RT-PCR analyses was run on an ABI Prism 7300 Real Time PCR System (Applied Biosystems/Life Technologies GmbH, Darmstadt, Germany) using Sybr Green dye and the following primers:
  • Delta Ct was calculated by subtraction of the Ct- value of the housekeeping gene HPRT from the Ct-value of CLDN18.2 (for results see Fig. 7A). b. Exclusive T cell activation in the presence of CLDN18.2
  • a cytotoxic assay was set up as described under Example 2. a. The carcinoma cell lines examined for CLDN18.2 transcripts under Example 5. a via quantitative RT-PCR were used as target cells. The concentration of bi-scFv protein 1 BiMAB in this assay was set to 5 ng/ml. Target cells were seeded with human T cells and 1 BiMAB in duplicates to analyze T cell activation. To monitor any potential alloreactivity of T cells against target cells independently of bi-scF protein 1 BiMAB, target and T cells were seeded without 1 BiMAB in duplicates. Cells were continuously sighted through a microscope to observe T cell clustering and target cell binding.
  • T cells coincubated with NugC4 and I BiMAB were CD25 positive but CD69 negative indicating a longterm activation of T cells when CD69 downregulation already occurred.
  • Roughly 75% of T cells coincubated with DanG and I BiMAB were activated, of which about 40 % simultaneously expressed CD25 and CD69 indicating a T cell activation that is still ongoing.
  • T cells coincubated with the CLDN18.2 negative cell lines did not show any sign of T cell activation induction: neither CD69 nor CD25 expression was significantly elevated compared to the levels of samples without IBiMAB (see also Fig. 7B).
  • Example 6 Investigation of bi-scFv protein IBiMAB induced T cell function a. Induction of T cell proliferation
  • T cell proliferation is an indicator of T cell activation.
  • a flow cytometric assay was used. Briefly, lxlO 6 human T cells isolated as described under Example 2. a were stained in the dark at 37°C for 10 min with 0.5 ⁇ carboxyfluorescein diacetate succinimidyl ester (CellTrace CFSE, Invitrogen/Life Technologies GmbH, Germany) dissolved in DPBS. Staining was stopped by addition of 5 volumes of cold complete RPMI 1640 medium.
  • Samples included T cells alone, T cells with 1 ng/ml IBiMAB, T cells and NugC4 cells, and T cells with 1 ng/ml IBiMAB and NugC4 cells. After 120h of coincubation, the T cells were harvested, collected in 5 ml round bottom tubes, washed and stained with a 1 : 1000 7-AAD DPBS solution to counterstain dead cells for 15 min at 4°C. After washing with DPBS, cells were resuspended in FACS-buffer and analyzed with a FACSCanto II (BD Biosciences, Heidelberg, Germany).
  • a cytotox assay as described under Example 2.b was set up with CLDN18.2 endogenously expressing NugC4 cells and human T cells as effector cells. Samples included T cells alone, T cells with 5 ng/ml IBiMAB, T cells and NugC4 cells, and T cells with 5 ng/ml IBiMAB and NugC4 cells.
  • the T cells were harvested, collected in 5 ml round bottom tubes, washed and stained with a 1 : 1000 7-AAD DPBS solution to counterstain dead cells for 15 min at 4°C. After washing with DPBS, cells were fixed with 100 ⁇ Cytoperm/Cytofix solution for 20 min at RT. Cells were washed with lx Perm/Wash and subsequently stained with PE-conjugated Mouse Anti-Human Granzyme B antibody for 20 min at RT. After washing, cells were resuspended in FACS-buffer and analyzed with a FACSCanto II (all reagents and FACS machine BD Biosciences, Heidelberg, Germany).
  • FACSCanto II all reagents and FACS machine BD Biosciences, Heidelberg, Germany.
  • Granzyme B upregulation in T cells was detected only in the presence of target cells and bi-scFv protein IBiMAB (see also Fig. 8B).
  • Example 7 Determination of EC50 of bi-scFv protein IBiMAB in an in vitro cytotox assay Luciferase cytotox assay
  • Example 2.c Stably luciferase-expressing NugC4 cells described under Example 2.c were incubated with human T cells and bi-scFv protein IBiMAB concentrations within the range of 1 pg/ml to 1 ⁇ g/ml (in steps of 10) or without 1 BiMAB to determine the Lmi n values. Luminescence of viable cells was measured with an Infinite M200 Tecan plate reader 24h and 48h after assay set up. Specific target cell lysis was calculated by the formula exemplified under Example 2.c.
  • Example 8 Efficacy in a mouse xenograft model
  • mice 40 female NSG mice at the age of 8 weeks were subcutaneously inoculated with lxlO 7 HEK293 cells stably expressing high levels of human CLDN18.2 (HEK293-CLDN18.2). 5 days after tumor cell inoculation mice were stratified according to their tumor volume into treatment groups, mice without tumor growth were excluded.
  • peripheral blood mononuclear cells PBMCs
  • PBMCs peripheral blood mononuclear cells
  • 2 l0 7 PBMCs diluted in 300 ⁇ DPBS were injected intraperitoneally at the day of isolation to the experimental treatment groups designated with "PBMC".
  • PBS designated treatment groups received 300 ⁇ plain DPBS intraperitoneally instead and served as control without human effector cells.
  • control groups the investigation of a potential effect on tumor growth by IBiMAB itself or any potential side effects which are caused by IBiMAB or vehicle and not by human effector cells against mouse tissue (i.e. graft- versus-host reaction exerted by human effector cells against murine tissue) could be examined.
  • the therapy was started 1 day after DPBS or PBMC application: groups "PBS/1 BiMAB” and "PBMC/1 BiMAB” received intraperitoneally 5 ⁇ g purified bi-scFv protein IBiMAB diluted in 200 ⁇ of DPBS per animal. Groups “PBS/vehicle” and “PBMC/vehicle” received intraperitoneally 200 ⁇ of vehicle buffer (200 mM L-Arginin-monohydrochloride dissolved in H 2 0, sterile filtered) diluted in DPBS. Treatment groups are summarized in Table 3. Therapy was conducted on a daily basis for 22 days.
  • Fig. 10A and B exemplify the inhibition of tumor growth and the elimination of tumor burden in half of the mice of the "PBMC/lBiMAB" group only by the antibody in the presence of human effector cells. Mice were sacrificed by cervical dislocation when the tumor volume exceeded 500 mm 3 or in case of severe morbidity (graft-versus-host symptoms were observed in some mice).
  • mice in both "PBMC" groups showed symptoms of a graft-versus-host reaction 4 weeks after PBMC injection and several days after the end of treatment. Effects by IBiMAB itself on body weight or any other side effects concerning the health of the mice were not observed. c. Tissue conservation and splenocyte isolation
  • mice After killing of mice, tumors were dissected and the tissue was immediately fixed in 10 ml Roti- Histofix 4% (Carl Roth, Düsseldorf, Germany) for immunohistochemical analysis. Moreover, spleens were dissected to detect the engraftment of human cells by flow cytometric analysis. Splenocyte isolation was performed immediately after spleen dissection by mashing the spleens through a 70 ⁇ cell strainer placed into a 50 ml reaction tube with a sterile plunger of a 3 - 5 ml syringe and repeated flushing of the cell strainer with warm DPBS.
  • Isolated splenocytes were centrifuged, DPBS decanted and the splenocyte pellets resuspended in 1 ml heat inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen at -80°C and stored until splenocyte samples from all mice were complete. d. Analysis of engraftment of human T lymphocytes in mouse spleens
  • Example 9 Generation and testing of bispecific binding agents targeting CLDN6 and CD3 a. Sequence origin, design of bi-scFv constructs, and clonig into expression vectors
  • bispecific tandem single chain antibody constructs contained binding domains specific for the human T cell receptor component CD3 and human tumor associated antigens (TAA).
  • TAA human tumor associated antigens
  • VH variable heavy chain regions
  • V L variable light chain regions
  • Table 4 summarizes all bi-scFv constructs specific for the TAA CLDN6 that were generated in the course of the invention.
  • the CLDN18.2 specific bi-scFv construct IBiMAB was used as control antibody.
  • the bi-scFv constructs were generated by gene synthesis by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies.
  • Codon optimizations such as Homo sapiens (HS) or Mus musculus (MM) were implemented by GeneArt's GeneOptimizer® software, and are listed in Table 5. Information on specificity, sequence origin from monoclonal antibodies (mAB), codon usage, additional sequence features and references of all applied domains are summarized in Table 5. Variable domain sequence origin of the respective CD3 antibodies are listed in Table 5. Due to the high homology of human and mouse TAAs, the same anti-TAA VH and VL sequences could be used for the generation of bi-scFv constructs for mouse assays, but in combination with the VH, L sequences of the mouse specific anti-CD3 antibody clone 145-2C1 1.
  • DNA cloning and expression vector construction was carried out according to standard procedures (Sambrook, 1989) well known by the skilled person. Briefly, the bi-scFv DNA sequences were provided with a 5 ' Hindlll and a 3' BamHl restriction for cloning into expression plasmids. A secretion signal sequence was introduced at the 5' end upstream of the bi-scFv sequence for protein secretion from cellular cytoplasm into the culture medium. A sequence coding for a 15 to 18 amino acid flexible glycine-serine peptide linker was inserted to join the VH and VL domains for the composition of the single chain variable antibody fragments (scFv) of which one binds to CD3 and the other to the TAA.
  • scFv single chain variable antibody fragments
  • GGGGS short peptide linker
  • HS Homo sapiens
  • MM Mus musculus
  • TAA tumor associated antigen
  • IBi AB (GGGGS VE(GGSGGS)2GGVD MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger,
  • HS Homo sapiens
  • mAB monoclonal antibody
  • MM Mus musculus
  • TAA tumor associated antigen
  • lxlO 7 HEK293 cells were plated two days prior to transfection on 14.5 cm tissue culture dishes in 20 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics were added. 20 ⁇ g of linearized DNA of the constructs pcDNA3.1/6PHU5 and pcDNA3.1/6PHU3 (described under Example 9.a) were diluted in 0.5 ml plain DMEM/F-12 medium.
  • Bi-scFv proteins 6PHU5 and 6PHU3 were small-scale produced and purified from polyclonal HE 293 cell supernatants for in vitro comparison. Briefly, at confluent state, supernatant without FBS was harvested from the polyclonal cell lines described under Example 9.b and filtered with 0.2 ⁇ Minisart syringe filters (Sigma-Aldrich, Germany). Subsequently, bi-scFv proteins were small-scale purified from cell culture supernatants by Ni-NTA spin columns according to the manufacturer's protocol (Qiagen, Hilden, Germany).
  • Bi-scFv protein concentrations were determined by measurement at 280 nm with a NanoDrop 2000c under consideration of the extinction coefficient and molecular weight - determined via the ProtParam tool (http://web.expasv.org piOtparam/) - of bi-scFv protein 6PHU5 and 6PHU3. Purified proteins were stored at 4°C for immediate use.
  • Bi-scFv proteins were tested by polyacrylamid gel electrophoresis followed by coomassie staining and western blot analysis performed by standard procedures (Current Protocols in Protein Science, 2012). Small-scale purified proteins were separated on NuPAGE Novex 4 - 12% Bis-Tris Gels (Invitrogen/Life Technologies GmbH, Darmstadt, Germany). Subsequently, the gels were stained with Coomassie Brilliant Blue solution according to standard procedures (Current Protocols in Protein Science, 2012) to detect bi-scFv proteins 6PHU5, 6PHU3, and other proteins contained in the cell culture supernatant. Western blot analysis was performed to specifically detect bi-scFv proteins 6PHU5 and 6PHU3 via their 6xHis-tag.
  • the membrane was incubated for lh at 4°C with primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1 :500 in blocking buffer. After washing with blocking buffer, membranes were incubated with Fc-specific secondary peroxidase-conjugated goat-anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1 : 10000 in blocking buffer for lh at 4°C.
  • the polyclonal producer cell line was cultured in a 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin- streptomycin and 0.8 mg/ml G418 (all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's guidelines.
  • DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin- streptomycin and 0.8 mg/ml G418 (all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's guidelines.
  • cells were washed with DPBS and medium was changed to DMEM/F-12 medium with antibiotics but without FBS.
  • Cell supernatant containing bi-scFv protein 6PHU3 was harvested every 3 - 5 days for up to 3 weeks. Supernatant was filtered with 500 ml Steritop Filter Units (Merck Millipore, Bill
  • bi-scFv protein 6PHU3 was immediately dialyzed against lx PBS using a Slide- A-Lyzer G2 Dialysis Cassette 10K MWCO (Pierce/Thermo Fisher Scientific, Rockford, IL, USA). After PBS dialysis, bi-scFv was dialyzed against a 200 mM arginine buffer (L-Arginin- monohydrochloride; Roth, Düsseldorf, Germany) based on H 2 0.
  • arginine buffer L-Arginin- monohydrochloride
  • Bi-scFv concentration was determined by measurement at 280 nm with a NanoDrop 2000c under consideration of the extinction coefficient and molecular weight of bi-scFv protein 6PHU3. Purified protein was aliquoted and stored at -80°C for long time storage or kept at 4°C for immediate use.
  • Example 10 Efficiency of CLDN6-targeting bi-scFv candidates 6PHU5 and 6PHU3 a. Microscopic analysis of T cells redirected to target cells by bi-scFv proteins 6PHU5 and 6PHU3
  • Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Current Protocols in Protein Science, 2012): briefly, blood was diluted with DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences, Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were collected from the interphase, washed with cold DPBS supplemented with 2 mM EDTA and counted. Human T cells were subsequently separated by magnetic-activated cell separation (MACS) from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) according to the manufacturer's guidelines.
  • PBMCs Peripheral blood mononuclear cells
  • Tissue culture plates were subsequently incubated at 37°C, 5% C0 2 .
  • the assay was continuously observed with a Wilovert S inverted microscope (Hund, Wetzlar, Germany) from 6h to 24h of coincubation.
  • Significant effects in terms of T cell clustering on target cells, formation of an immunologic synapse and target cell killing in the presence of bi-scFv protein 6PHU5 and 6PHU3 were seen at 24h and photographed with a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). Both bi-scFv proteins lead to strong T cell clustering and target cell killing as shown in Fig. 12.
  • T cell activation For the detection of T cell activation and to define differences in the efficiency of the two CLDN6-specific bi-scFv variants, a FACS-based T cell activation assay was used.
  • the early activation marker CD69 and the late activation marker CD25 were selected for staining by fluorescence-conjugated antibodies.
  • CD3 on T cells was stained.
  • Example lO.a PA-1 target cells endogenously expressing CLDN6 were seeded with human T cells in an E:T ratio of 5: 1 in 2 ml complete medium and bi-scFv proteins 6PHU5 or 6PHU3 were added in a concentration within the range of 5 - 200 ng/ml.
  • Control samples comprised target or T cells alone with and without bi-scFv proteins. After 24h and 48h the T cells were harvested by flushing and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS.
  • Mouse Anti-Human CD3-FITC, Mouse Anti-Human CD69-APC, and Mouse Anti-Human CD25-PE were used.
  • Cell pellets were resuspended in 50 ⁇ FACS-buffer (DPBS supplemented with 5% FBS) containing the fluorescence-conjugated antibodies and and 2 ⁇ 7-AAD (BD Biosciences, Heidelberg, Germany).
  • FACS-buffer DPBS supplemented with 5% FBS
  • 2 ⁇ 7-AAD BD Biosciences, Heidelberg, Germany
  • samples were washed with 4 ml DPBS and cell pellets were resuspended in 200 ⁇ FACS buffer. Samples were kept on ice and dark throughout the measurement with a FACSCanto II flow cytometer (both BD Biosciences, Heidelberg, Germany). Analysis was evaluated by Flow Jo software (Tree Star, San Carlos, CA, USA).
  • CLDN6- and the CD3-targeting moieties of bi-scFv protein 6PHU3 were used as control cells.
  • CLDN6 positive cells PA-1 , OV-90
  • CLDN6 negative cells NugC4
  • All washing steps were conducted by centrifugation at 1200 rpm for 6 min at 4°C.
  • lxl 0 5 cells were transferred to 5 ml round bottom tubes and incubated with 0.01 - 10 ⁇ g/ml ⁇ g ml FPLC-purified 6PHU3 protein or control bi-scFv protein IBiMAB in FACS- buffer for 30 min at 4°C.
  • Cells were washed with 2 ml FACS-buffer and subsequently incubated with 3.3 ⁇ g/ml of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) for 30 min at 4°C. After washing with 2 ml FACS-buffer, the cell pellets were incubated with APC-conjugated goat-anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, England) in a 1 :200 dilution in FACS-buffer for 20 min at 4°C in the dark.
  • APC-conjugated goat-anti-mouse secondary antibody Jackson ImmunoResearch Europe, Suffolk, England
  • 5x10 5 T cells were transferred to 5 ml round bottom tubes and incubated with FPLC-purified 6PHU3 protein within a range of lOOng/ml - 10 ⁇ g/ml in FACS-buffer for 30 min at 4°C. Further staining procedure was as described above. Control samples included secondary goat-anti-mouse APC antibody alone and monoclonal antibody Anti-HIS Epitope-Tag plus secondary goat-anti-mouse PE antibody. Measurement and analysis were performed as described above. A significant signal was obtained with 100 ng/ml 6PHU3 (see also Fig. 15B).
  • Example 12 Investigation of target dependent T cell activation by bi-scFv 6PHU3 A cytotox assay as described under Example 10. a and b was performed. Briefly, PA-1 target cells endogenously expressing CLDN6 were seeded with human T cells in an E:T ratio of 5: 1 in 2 ml complete medium and bi-scFv protein 6PHU3 was added in a concentration within the range of 0.001 - 1000 ng/ml. To analyze the target dependency for bi-scFv mediated T cell activation, T cells were seeded without target cells but were incubated with the same bi-scFv 6PHU3 concentrations as the target plus T cell samples. After 24h and 48h the T cells were harvested by flushing and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cell staining and analysis was conducted as described under Example lO.b.
  • % specific lysis [1 - (luminescencetest sample- Lmax) / (Lmin - Lmax)] x 100, whereas "L” indicates lysis.
  • L m i n refers to the minimum lysis in the absence of bi-scFv and L max to the maximum lysis (equal to spontaneous luminescence counts) in the absence of bi-scFv achieved by addition of Triton X-100 (2% final concentration).
  • Example 14 Efficacy in a mouse xenograft model
  • mice with bi-scFv protein 6PHU3 were chosen.
  • the mouse strain NOD.Cg-Prkd scid IL2rg tmlwjl /SzJ or short NSG was chosen.
  • the engraftment of human effector cells and human T lymphocytes in mice is indispensable to study the effects of T cell engaging bi-scFv in vivo.
  • the mouse strain NSG is suitable for this kind of xenograft studies.
  • a mouse model with mainly engrafted human T cells after PBMC injection was established as part of the invention.
  • mice 25 female and 25 male NSG mice at the age of 8 - 1 1 weeks were subcutaneously inoculated with lxlO 7 PA-1 cells endogenously expressing high levels of human CLDN6. 15 days after tumor cell inoculation mice were stratified according to their tumor volume into treatment groups, mice without tumor growth were excluded. At the same day peripheral blood mononuclear cells (PBMCs) were isolated from human blood of healthy donors by Ficoll density gradient technique and used as effector cells in vivo. 2x10 7 PBMCs diluted in 200 ⁇ DPBS were injected intraperitoneally at the day of isolation to the experimental treatment groups designated with "PBMC".
  • PBMCs peripheral blood mononuclear cells
  • PBS designated treatment groups received 200 ⁇ plain DPBS intraperitoneally instead and served as control without human effector cells.
  • control groups the investigation of a potential effect on tumor growth by 6PHU3 itself or any potential side effects which are caused by 6PHU3 or vehicle and not by human effector cells against mouse tissue (i.e. graft-versus-host reaction exerted by human effector cells against murine tissue) could be examined.
  • the therapy was started 7 days after DPBS or PBMC application: groups "PBS/6PHU3", “PBMC/6PHU3” and “PBMC/lBiMAB” received intraperitoneally 5 ⁇ g purified bi-scFv protein 6PHU3 or IBiMAB diluted in 200 ⁇ of DPBS per animal. Groups “PBS/vehicle” and “PBMC/vehicle” received intraperitoneally 200 ⁇ of vehicle buffer (200 mM L-Arginin-monohydrochloride dissolved in H 2 0, sterile filtered) diluted in DPBS. Treatment groups are summarized in Table 6. Therapy was conducted on a daily basis for 26 days.
  • Fig. 18A and B exemplify the inhibition of tumor growth in all mice of the "PBMC/6PHU3" group by the antibody in the presence of human effector cells. Mice were sacrificed by cervical dislocation when the tumor volume reached 1500 mm 3 or in case of severe morbidity (graft- versus-host symptoms were observed in some mice). Table 6: Treatment groups
  • mice After killing of mice, tumors were dissected and the tissue was immediately fixed in 10 ml Roti- Histofix 4% (Carl Roth, Düsseldorf, Germany) for immunohistochemical analysis. Moreover, spleens were dissected to detect the engraftment of human cells by flow cytometric analysis. Splenocyte isolation was performed immediately after spleen dissection by mashing the spleens through a 70 ⁇ cell strainer placed into a 50 ml reaction tube with a sterile plunger of a 3 - 5 ml syringe and repeated flushing of the cell strainer with warm DPBS.
  • Isolated splenocytes were centrifuged, DPBS decanted and the splenocyte pellets resuspended in 1 ml heat inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen at -80°C and stored until splenocyte samples from all mice were complete. d. Analysis of engraftment of human T lymphocytes in mouse spleens
  • Splenocytes from all mice were collected and frozen as decribed under Example 14.c.
  • the complete collection of splenocyte samples was thawed at one time, all cells were washed twice with warm DPBS and lxlO 6 splenocytes per sample were incubated with fluorescence- conjugated antibodies for 20 min at 4°C in the dark to detect the engraftment of human cells by anti-CD45 staining and the percentage of human T cells by anti-CD3, anti-CD4, and anti-CD8 staining.
  • Flow cytometric analysis was conducted with a FACSCalibur (BD Biosciences, Heidelberg, Germany).
  • Tumors were fixed after dissection using 4% buffered formaldehyde-solution (Roti-Histofix, Carl Roth, Düsseldorf, Germany) for 48 h at 4°C.
  • the fixed tumors were divided into two parts and transferred into the automated vacuum tissue processor ASP200 for dehydration (Leica Microsystems GmbH, Wetzlar, Germany) followed by embedding into paraffin (Paraplast, Carl Roth, Düsseldorf, Germany) via the paraffin dispenser station MPS/C (Slee Medical GmbH, Mainz, Germany).
  • ASP200 automated vacuum tissue processor
  • paraffin Paraffin dispenser station
  • 3 ⁇ thick sections of the formalin-fixed and paraffin-embedded tissues were generated using the rotary microtome RM2255 (Leica Microsystems GmbH, Wetzlar, Germany).
  • TAA Claudin 6 was detected by incubation with the polyclonal primary antibody Anti-Mouse Claudin 6 (C) Rabbit (IBL-America, Minneapolis, MN, USA) at 4°C over night; T cells were detected on consecutive sections using the polyclonal anti-CD3 AB (Abeam, Cambridge, UK) at 4°C over night followed by incubation with a Bright Vision polymer HRP- conjugated anti-rabbit secondary antibody (ImmunoLogic, Duiven, Netherlands). Binding reactions were visualized using the Vector NovaRED kit (Vector Laboratories Ltd., Peterborough, UK) according to the manufacturer's instructions, followed by hematoxylin counterstaining (Carl Roth), dehydration and mounting. Analysis and documentation were performed using either the Axio Imager M2 or the Mirax scanner (both Carl Zeiss Microscopy GmbH, Goettingen, Germany).

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides binding agents that contain a binding domain that is specific for CD3 allowing binding to T cells and a binding domain that is specific for a tumor-associated claudin molecule and methods of using these binding agents or nucleic acids encoding therefor for treating cancer.

Description

AGENTS FOR TREATMENT OF CLAUDIN EXPRESSING CANCER DISEASES
Claudins are integral membrane proteins located within the tight junctions of epithelia and endothelia. Claudins are predicted to have four transmembrane segments with two extracellular loops, and N- and C-termini located in the cytoplasm. The claudin (CLDN) family of transmembrane proteins plays a critical role in the maintenance of epithelial and endothelial tight junctions and might also play a role in the maintenance of the cytoskeleton and in cell signaling.
The claudin 18 (CLDN 18) molecule is an integral transmembrane protein (tetraspanin) having four membrane spanning hydrophobic regions and two extracellular loops (loopl embraced by hydrophobic region 1 and hydrophobic region 2; loop2 embraced by hydrophobic regions 3 and 4). CLDN 18 exists in two different splice variants, which are described in mouse and in human (Niimi, Mol. Cell. Biol. 21 :7380-90, 2001 ). The splice variants (Genbank accession number: splice variant 1 (CLDN 18.1 ): NP_057453, NM_016369, and splice variant 2 (CLDN18.2): NM 001002026, NP 001002026) have a molecular weight of approximately 27,9 / 27,72 kD. The splice variants CLDN 18.1 and CLDN 18.2 differ in the N-terminal portion which comprises the first transmembrane (TM) region and loopl , whereas the primary protein sequence of the C- terminus is identical. In normal tissues, there is no detectable expression of CLDN 18.2 with exception of stomach where CLDN 18.2 is expressed exclusively on short-lived differentiated gastric epithelial cells. CLDN 18.2 is maintained in the course of malignant transformation and thus frequently displayed on the surface of human gastric cancer cells. Moreover, this pan-tumoral antigen is ectopically activated at significant levels in esophageal, pancreatic and lung adenocarcinomas. The CLDN 18.2 protein is also localized in lymph node metastases of gastric cancer adenocarcinomas and in distant metastases especially into the ovary (so-called Krukenberg tumors).
CLDN6 is expressed in a series of different human cancer cells while expression in normal tissues is limited to placenta.
The differential expression of claudins such as CLDN18.2 and CLDN6 between cancer and normal cells, their membrane localization and their absence from the vast majority of toxicity relevant normal tissues makes these molecules attractive targets for cancer immunotherapy and the use of antibody-based therapeutics for targeting claudins in cancer therapy promises a high level of therapeutic specificity.
Approaches using the potential of T cells for the treatment of cancer include vaccination with tumor-derived proteins, RNA or peptide antigen, infusion of tumor-derived, ex-vivo expanded T cells (called adoptive transfer), T cell receptor gene transfer or direct engagement of T cells by bi- or trispecific antibodies. Likewise, many stimulants of T cell responses are clinically tested in combination or as monotherapy, such as ligands for Toll-like receptors, antibodies blocking CTLA-4 on T cells, immune stimulatory cytokines, or antibodies neutralizing molecules involved in immune escape of cancer cells such as TGF-beta or B7-H1. The intense development of T cell-based therapies is motivated by the observation that patients appear to live significantly longer if their tumors are infiltrated by T cells. Moreover, numerous mouse models have shown that engagement of T cells by various means can eradicate even large tumors and a number of T cell therapies have recently made significant progress in treating various cancer indications.
It has been an object of the invention to provide novel agents and methods for the therapy of cancer diseases.
The solution of the problem underlying the invention is based on the concept of generating a binding agent that contains a binding domain that is specific for a tumor-associated claudin molecule, i.e. cancer cells . The other binding domain is specific for CD3 allowing binding to T cells and allows to pull the T cells into the complex, thus making it possible to target the cytotoxic effect of the T cells to the cancer cells. Formation of this complex can induce signalling in cytotoxic T cells, either on its own or in combination with accessory cells, which leads to the release of cytotoxic mediators.
We report for the first time that binding agents targeting claudin and CD3 can induce potent T cell-mediated lysis and are effective in treating tumor diseases. SUMMARY OF THE INVENTION
In one aspect the invention relates to a binding agent comprising at least two binding domains, wherein a first binding domain binds to claudin and a second binding domain binds to CD3. The binding agent of the invention may bind to a cytotoxic cell (by engaging the CD3 receptor) and a cancer cell expressing CLDN to be destroyed as a target.
In one embodiment the binding agent is a bispecific molecule such as a bispecific antibody, in particular a bispecific single chain antibody. In one embodiment said claudin is expressed in a cancer cell. In one embodiment said claudin is expressed on the surface of a cancer cell. In one embodiment said claudin is selected from the group consisting of claudin 18.2 and claudin 6. In one embodiment said first binding domain binds to an extracellular domain of said claudin. In one embodiment said first binding domain binds to native epitopes of CLDN present on the surface of living cells. In one embodiment said first binding domain binds to the first extracellular loop of CLDN. In one embodiment said second binding domain binds to the epsilon-chain of CD3. In one embodiment said CD3 is expressed on the surface of a T cell. In one embodiment binding of said binding agent to CD3 on T cells results in proliferation and/or activation of said T cells, wherein said activated T cells preferably release cytotoxic factors, e.g. perforins and granzymes, and initiate cytolysis and apoptosis of cancer cells. In one embodiment said binding to claudin and/or said binding to CD3 is a specific binding.
In one embodiment the binding agent is in the format of a full-length antibody or an antibody fragment. In one embodiment the binding agent comprises four antibody variable domains with at least two binding domains, wherein at least one binding domain binds to claudin and at least one binding domain binds to CD3. In one embodiment the binding agent comprises a variable domain of a heavy chain of an immunoglobulin (VH) with a specificity for a claudin antigen (VH(CLDN)), a variable domain of a light chain of an immunoglobulin (VL) with a specificity for a claudin antigen (VL(CLDN)), a variable domain of a heavy chain of an immunoglobulin (VH) with a specificity for CD3 (VH(CD3)), and a variable domain of a light chain of an immunoglobulin (VL) with a specificity for CD3 (VL(CD3)).
In one embodiment the binding agent is in the format of a diabody that comprises a heavy chain variable domain connected to a light chain variable domain on the same polypeptide chain such that the two domains do not pair. In one embodiment the diabody comprises two polypeptide chains, wherein one polypeptide comprises VH(CLDN) and VL(CD3) and the other polypeptide chain comprises VH(CD3) and VL(CLDN). In one embodiment the binding agent is in the format of a bispecific single chain antibody that consists of two scFv molecules connected via a linker peptide, wherein the heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are preferably arranged, from N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)-VL(CLDN) or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). In one embodiment said heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are connected via a long peptide linker, preferably, a peptide linker comprising the amino acid sequences (GGGGS)3 or VE(GGGGS)2GGVD. In one embodiment said two VH-VL or VL-VH scFv units are connected via a short peptide linker, preferable a peptide linker comprising the amino acid sequence SGGGGS or GGGGS.
In one embodiment said CLDN is CLDN18.2 and said VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof or a variant of said amino acid sequence or fragment.
In one embodiment said CLDN is CLDN6 and said VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof or a variant of said amino acid sequence or fragment.
In one embodiment said VH(CD3) comprises an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CD3) comprises an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof or a variant of said amino acid sequence or fragment.
In one embodiment said CLDN is CLDN 18.2 and said binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a fragment or variant thereof.
In one embodiment said CLDN is CLDN6 and said binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a fragment or variant thereof. In one embodiment said cancer cells expressing CLDN18.2 are cancer cells of a cancer selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, cancer of the gallbladder and the metastasis thereof, a rukenberg tumor, peritoneal metastasis and/or lymph node metastasis.
In one embodiment said cancer cells expressing CLDN6 are cancer cells of a cancer selected from the group consisting of urinary bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum, in particular small bowel adenocarcinoma and adenocarcinoma of the ileum, testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as a teratocarcinoma or an embryonal carcinoma, in particular germ cell tumors of the testis, and the metastatic forms thereof.
In one embodiment the binding agent has an N-terminal secretion signal and/or a C-terminal histidin epitope tag, preferable a six hisidin epitope tag.
In one aspect the invention relates to a recombinant nucleic acid which encodes a binding agent of the invention. In one embodiment the recombinant nucleic acid is in the form of a vector. In one aspect the invention relates to a host cell comprising a recombinant nucleic acid of the invention. In one aspect the invention relates to the binding agent of the invention or the recombinant nucleic acid of the invention for use in therapy, in particular for use in treating or preventing cancer. In one aspect the invention relates to a pharmaceutical composition comprising the binding agent of the invention or the recombinant nucleic acid of the invention.
In one aspect the invention relates to a method of treating or preventing a cancer disease comprising administering to a patient the pharmaceutical composition of the invention.
In one embodiment cells of said cancer express a claudin to which said binding agent is capable of binding.
In one embodiment said claudin is CLDN18.2 and said cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer, hepatic cancer, head- neck cancer, cancer of the gallbladder and the metastasis thereof, a Krukenberg tumor, peritoneal metastasis and/or lymph node metastasis. In one embodiment said claudin is CLDN6 and said cancer is selected from the group consisting of urinary bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum, in particular small bowel adenocarcinoma and adenocarcinoma of the ileum, testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as a teratocarcinoma or an embryonal carcinoma, in particular germ cell tumors of the testis, and the metastatic forms thereof.
In one aspect, the invention provides a binding agent or nucleic acid coding therefor as described herein for use in the methods of treatment described herein. In one embodiment, the invention provides a pharmaceutical composition as described herein for use in the methods of treatment described herein.
According to the invention, CLDN18.2 preferably has the amino acid sequence according to SEQ ID NO: 1 and CLDN6 preferably has the amino acid sequence according to SEQ ID NO: 2 or 3.
Other features and advantages of the instant invention will be apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1. Modular scheme illustrating the design of recombinant bi-scFv proteins targeting TAA CLDN18.2.
Design of the bi-scFvs in (A) N-terminal and (B) C-terminal position regarding the anti-TAA variable regions. Anti-CLDN18.2 VH and VL regions are generated from the sequence of a monoclonal CLDN18.2 antibody (mCLDN18.2ab). Anti-CD3 stands comprehensive for VH and VL regions generated from the sequences of the following monoclonal CD3 antibodies: UCHT1- HU (humanized mAB), UCHT1, CLB-T3, TR66, 145-2C11. Bi-scFv indicates bispecific single chain variable fragment; His, hexahistidyl-tag; HU, humanized; LL, long linker (15-18 amino acids); Sec, secretion signal; SL, short linker (5-6 amino acids); TAA, tumor associated antigen; V, variable region of the heavy (H) and light (L) chain of the antibody.
FIGURE 2. Effect of domain orientation and anti-CD3-scFv selection on specific target cell lysis: 5'-mCLDN18.2ab v H "VL _ TR66 VL-3' bi-scFvs IBiMAB and no.15 are the most potent variants.
Several bi-scFv variants directed against CLDN18.2 and CD3 were transiently expressed in HEK293T cells and small-scale purified with Ni-NTA columns for the comparison of their potency in a cytotox assay. CLDN18.2 endogenously expressing NugC4 cells which stably express luciferase were taken as target cells. Human T cells and target cells were incubated in an E:T ratio of 5: 1 with 5 ng/ml of each bi-scFv protein in a 96-well format. As negative controls no.35 targeting a non-expressed TAA, no.l 1, and no.16 - both targeting murine but not human T cells - were taken. Each test sample was plated sixfold, the control sample for Lmjn was plated ninefold. Coincubation times before analysis were 8h, 16h, and 24h. After addition of luciferin solution at the given time points, the luminescence was measured in an Infinite M200 TECAN reader. Specific target cell lysis was calculated by normalization to samples with control bi-scFv no.35 (Lmin). The most potent bi-scFv proteins - 1 BiMAB and no.15 - share the domain orientation and the anti-CD3 origin of mAB TR66 but differ in their codon optimization (HS and CHO, respectively) and the long linker sequences. CHO indicates Chinese Hamster Ovary; mAB, monoclonal antibody; HU, humanized; TAA, tumor associated antigen.
FIGURE 3. Coomassie gel and western blot analysis of bi-scFv protein 1 BiMAB.
Supernatant without FCS of monoclonal HE 293 cells stably expressing 1 BiMAB was purified via Ni-NTA affinitiy chromatography (IMAC). Aliquots of different purification steps were loaded to 4 - 12% Bis-Tris gels. (A) Coomassie staining of cell supernatant, flow through and eight fractions of the eluate. Fractions of the first eluted peak were discarded, fractions of the second eluted peak were pooled for further studies, dialyzed against PBS and subsequently against 200 mM arginine buffer. (Lane 1 : HEK293/ 1 BiMAB SN; lane 2: IMAC flow through fraction; lanes 3-4: Fractions of elution peak 1 (discarded); lanes 5-10: Fractions of elution peak 2 (pooled)) (B) Western blot analysis of 0.5 μg of 1 BiMAB from three independent purifications (lane 1 , 2, 3). Detection was performed with primary monoclonal anti-His and secondary peroxidase conjugated anti-mouse antibody. IMAC indicates immobilized metal affinity chromatography; PBS, phosphate buffered saline; SN, supernatant; WB, western blot.
FIGURE 4. Bi-scFv protein 1 BiMAB binds efficiently and specifically to CLDN18.2- expressing target cells and human T cells.
(A) 2.5xl05 CLDN18.2 endogenously expressing NugC4 cells were incubated with 50 μ©^ηι1 1 BiMAB or 10 μg ml mCLDN18.2ab as positive control and the corresponding APC-conjugated secondary antibodies. Control stainings included secondary APC-conjugated antibodies alone (g- a-h, g-a-m), anti-His and g-a-m APC, or 1 BiMAB and g-a-m APC. Analysis was performed via flow cytometry. MFI of APC signal was calculated by FlowJo software. (B) lxlO5 CLDN18.2 endogenously expressing NugC4 cells were stained with escalating 1 BiMAB concentrations (20 pg/ml - 20 μg/ml), anti-His and g-a-m APC. As negative control cells were incubated with anti- His and g-a-m APC. As positive control mCLDN18.2ab and g-a-h APC was used. MFI of APC signal was calculated by FlowJo software. (C) l xlO6 human T cells were incubated with escalating IBiMAB concentrations (2 ng ml-2 μg/ml), anti-His and g-a-m APC. As negative control cells were incubated with anti-His and g-a-m APC or g-a-m APC alone. MFI of APC signal was calculated by FlowJo software. (D) lxlO5 CLDN18.2 negative PA-1 cells were incubated with escalating IBiMAB concentrations (10 ng/ml - 10 μg/ml), anti-His and g-a-m APC. As negative control, cells were stained with anti-His and g-a-m APC or g-a-h APC alone. 10 μg/ml mCLDN18.2ab and g-a-h APC were used to confirm CLDN18.2 negativity of cells. G-a-h indicates goat-anti-human; g-a-m, goat-anti mouse; MFI, mean fluorescence intensity; TL, T lymphocyte.
FIGURE 5. Bi-scFv protein IBiMAB leads to T cell clustering on CLDN18.2 positive target cells. CLDN18.2 endogenously expressing NugC4 cells were incubated for 24h with 1 ng/ml and 1 μg/ml IBiMAB and human T cells in an effector to target ratio of 5:1 in 6- well plates. T cells alone (TL), target cells alone (NugC4) and human T cells with target cells (-Ctrl) were chosen as control samples. After 24h samples were photographed with a Nikon Eclipse Ti microscope with 200x magnification. White arrowheads point to T cell clusters on target cells. TL indicates T lymphocyte. FIGURE 6. IBiMAB mediates T cell activation in a dose dependent manner.
CLDN18.2 endogenously expressing NugC4 cells were incubated for 24h and 48h with escalating concentrations of bi-scFv protein IBiMAB (0.001 - 1000 ng/ml) and human T cells in an effector to target ratio of 5:1 in duplicates in a 24- well format. As control human T cells were incubated with 1-1000 ng/ml IBiMAB without NugC4 target cells to verify the target dependent activation of T cells mediated by IBiMAB. After 24h (A) and 48h (B) T cells were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC and analyzed by flow cytometry. TL indicates T lymphocyte.
FIGURE 7. IBiMAB mediates strictly target dependent T cell activation even after long term incubation with CLDN18.2 high, low, and non-expressing cell lines.
(A) RT-PCR data generated from total RNA of six tumor cell lines are shown. Ct-values of CLDN18.2 expression normalized to housekeeping gene HPRT has been calculated from two independent experiments. Breast cancer cell line MCF7 (grey bar) was chosen as negative CLDN18.2-expressing control cell line.(B) Cancer cell lines from (A) were incubated for 144h with 5 ng/ml bi-scFv protein 1 BiMAB with or without human T cells in an effector to target ratio of 5: 1 in duplicates in a 6-well format. T cells were labeled with anti-CD3-FITC, anti-CD25-PE and anti-CD69-APC to analyze total T cell population (CD3), early activation (CD69), and late activation (CD25) of T cells by flow cytometry. TL indicates T lymphocyte.
FIGURE 8. IBiMAB induces T cell proliferation and Granzyme B upregulation only in the presence of CLDN18.2 positive target cells.
(A) Human T cells were CFSE stained and cultivated alone (TL) or in the presence of 1 ng/ml IBiMAB (TL + 1 ng/ml IBiMAB), NugC4 cells (TL + NugC4), or NugC4 cells and 1 ng/ml 1 BiMAB (TL + 1 ng/ml 1 BiMAB + NugC4) for 120h. A 5: 1 effector to target ratio was selected. Decrease of CFSE signal indicating T cell proliferation was analyzed by flow cytometry. (B) Human T cells were incubated with or without NugC4 target cells and with or without 5 ng/ml bi-scFv IBiMAB protein. Effector to target ratio was of 5: 1 in a 6-well format. After 96h of coincubation T cells were harvested and intracellularly stained with anti-GrB-PE and analyzed by flow cytometry. MFI of anti-GrB-PE signal was calculated by FlowJo software. The signal of unstained sample TL + NugC4 + 5 ng/ml IBiMAB was substracted from all samples. CFSE indicates carboxyfluorescein succinimidyl ester; GrB, Granzyme B; MFI, mean fluorescence intensity; PE, phycoerythrin; TL, T lymphocytes. FIGURE 9. EC50 of IBiMAB for specific target cell lysis after 48h is approximately 10 pg/ml.
CLDN18.2 endogenously expressing NugC4 cells which stably express luciferase were incubated for 24h and 48h with bi-scFv protein IBiMAB in escalating concentrations (0.001 - 1000 ng/ml) with human T cells in an effector to target ratio of 5: 1 in triplicates in a 96- well format. As minimum lysis (1™η) control effector and target cells were plated without bi-scFv IBiMAB. Maximum lysis (Lmax) for the normalization to spontaneous luminescence counts was achieved by addition of Triton X-100 to control wells containing effector and target cells in the absence of bi-scFv shortly prior to luciferin addition. After addition of luciferin solution the luminescence was measured in an Infinite M200 Tecan microplate reader after 24h and 48h. Specific target cell lysis was calculated by the formula: % specific lysis = [ 1 -
Figure imgf000011_0001
sample - Lmax) / (Lmin - Lmax)] x 100. Values were plotted against loglO of IBiMAB concentration. EC50 indicates the half maximal effective concentration; L, lysis. FIGURE 10. IBiMAB shows therapeutic in vivo efficacy in an advanced SC tumor model.
NOD.Cg-Prkdscid IL2rgtmlWjl/SzJ (NSG) mice were injected SC with l xl O7 HE 293 stably expressing CLDN18.2. Five days later 2xl07 human PBMC effector cells were injected IP to groups G3 and G4, control groups (Gl and G2) received PBS only. Daily IP application of 5 μg bi-scFv protein 1 BiMAB per animal or vehicle as control started at the following day. Therapy was administered for 22 days, tumor volume was measured using a caliper and calculated by the formula mm3 = length mm x width mm x (width mm/2). (A) The tumor volume of single mice and the median per group is shown for treatment days 0 and 15 (upper row), and 3 and 13 days after the end of treatment (bottom row). (B) The mean tumor volume of the two treatment groups engrafted with human effector cells is shown. Dashes indicate sacrificed animals. (C) Kaplan- Meier survival curve presenting all groups from the day of tumor inoculation to day 41. Animals were sacrificed as soon as the tumor volume exceeded 500 mm3. After day 41 all remaining animals were sacrificed to analyze the engraftment of human effector cells in the spleens of mice. (D) Splenocytes of all mice were isolated and stained with anti-CD45-APC and anti-CD3- FITC to detect human T cells by flow cytometry. Median engraftment is shown in a boxplot diagram. G indicates group; IP, intraperitoneal; PBMC, peripheral blood mononuclear cells; PBS, phosphate buffered saline; SC, subcutaneous.
FIGURE 11. Modular scheme illustrating the design of recombinant bi-scFv proteins targeting TAA CLDN6.
Design of the bi-scFvs in (A) N-terminal and (B) C-terminal position regarding the anti-TAA variable regions. Anti-CLDN6 VH and VL regions are generated from the sequence of a monoclonal CLDN6 antibody (mCLDN6ab). Anti-CD3 VH and VL regions are generated from the sequence of the monoclonal CD3 antibody TR66. Bi-scFv indicates bispecific single chain variable fragment; His, hexahistidyl-tag; LL, long linker (15-18 amino acids); Sec, secretion signal; SL, short linker (5 amino acids); TAA, tumor associated antigen; V, variable region of the heavy (H) and light (L) chain of the antibody.
FIGURE 12. Bi-scFv proteins 6PHU5 and 6PHU3 lead to T cell clustering on CLDN6 positive target cells.
CLDN6 endogenously expressing PA-1 cells were incubated for 24h with 50 ng/ml 6PHU5 or 6PHU3 and human T cells in an effector to target ratio of 5: 1 in 6-well plates. T cells alone (TL), target cells alone (PA-1) and human T cells with target cells (-Ctrl) were chosen as control samples. After 24h samples were photographed with a Nikon Eclipse T; microscope with 200x magnification. White arrowheads point to T cell clusters on target cells. TL indicates T lymphocyte.
FIGURE 13. Effect of domain orientation on efficacy: bi-scFv protein 6PHU3 is slightly more efficient in inducing T cell activation than 6PHU5.
CLDN6 endogenously expressing PA-1 cells were incubated for 44h with escalating concentrations (5 - 200 ng/ml) of 6PHU5 or 6PHU3 and human T cells in an effector to target ratio of 5: 1 in duplicates in a 6-well format. As control human T cells were incubated with 100 and 200 ng/ml 6PHU5 or 6PHU3 without target cells. After 44h T cells were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC. Dose-dependent T cell activation was analyzed by flow cytometry. Hu indicates human; TL, T lymphocyte.
FIGURE 14. Coomassie gel and western blot analysis of 6PHU3 protein.
Supernatant without FCS of polyclonal HEK293 cells stably expressing 6PHU3 was purified via Ni-NTA affinitiy chromatography (IMAC). Aliquots of different purification steps were loaded to 4 - 12% Bis-Tris gels. (A) Coomassie staining of cell supernatant, flow through and nine fractions of eluate. Fractions of the first eluted peak were discarded, fractions of the second and third eluted peaks were pooled for further studies, dialyzed against PBS and subsequently against 200 mM arginine buffer. (Lane 1 : HEK293/6PHU3 SN; lane 2: IMAC flow through fraction; lanes 3 - 5: Fractions of elution peak 1 (discarded); lanes 6-1 1 : Fractions of elution peaks 2 and 3 (pooled)) (B) Western blot analysis of 0.5 μg of 6PHU3 from two independent purifications. Detection was performed with primary monoclonal anti-His and secondary peroxidase conjugated anti-mouse antibody. IMAC indicates immobilized metal affinity chromatography; PBS; phosphate buffered saline; SN, supernatant; WB, western blot.
FIGURE 15. Bi-scFv protein 6PHU3 binds efficiently and specifically to CLDN6-expressing target cells and human T cells.
(A) 1x10s CLDN6 endogenously expressing PA-1 and OV-90 cells were incubated with escalating concentrations of 6PHU3 or control bi-scFv IBiMAB (10 ng/ml - 10 μg/ml) and 10 Mg/ml mCLDN6ab or control mAB mCLDN18.2ab with the corresponding APC-conjugated secondary antibodies. Control stainings were secondary APC-conjugated antibodies alone (g-a-h, g-a-m). Analysis was performed via flow cytometry. MFI of APC signal was calculated by Flow Jo software. (B) 5xl05 human T cells were incubated with escalating 6PHU3 concentrations (100 ng/ml - 10 μg/ml), anti-His and g-a-m PE. As negative control cells were incubated with anti-His and g-a-m PE, or g-a-m PE alone. MFI of PE signal was calculated by Flow Jo software. (C) lxlO5 CLDN6 negative NugC4 cells were incubated with escalating 6PHU3 and IBiMAB concentrations (10 ng ml - 10 μg/ml), anti-His and g-a-m APC. As negative control cells were incubated with g-a-m APC alone. 10 μg/ml mCLDN6ab and g-a-h APC were used to confirm CLDN6 negativity of cells. As positive control mCLDN18.2ab and g-a-h APC was used. MFI of APC signal was calculated by Flow Jo software. APC indicates allophycocyanin; g-a-h, goat-anti- human; g-a-m, goat-anti-mouse; mAB, monoclonal antibody; MFI, mean fluorescence intensity; PE, phycoerythrin; TL, T lymphocyte. FIGURE 16. 6PHU3 mediates T cell activation in a dose dependent manner.
CLDN6 endogenously expressing PA-1 cells were incubated for 24h and 48h with escalating concentrations of bi-scFv protein 6PHU3 (0.001 - 1000 ng/ml) and human T cells in an effector to target ratio of 5: 1 in duplicates in a 24-well format. As control human T cells were incubated with 1 - 1000 ng/ml 6PHU3 without PA-1 target cells to verify the target dependent activation of T cells mediated by 6PHU3. After 24h (A) and 48h (B) T cells were harvested and labeled with anti-CD3-FITC, anti-CD25-PE, and anti-CD69-APC and analyzed by flow cytometry. TL indicates T lymphocyte.
FIGURE 17. EC50 of 6PHU3 for specific target cell lysis after 48h is approximately 10 pg/ml.
CLDN6 endogenously expressing PA-1 cells which stably express luciferase were incubated for 24h and 48h with 6PHU3 protein in escalating concentrations (0.001 - 1000 ng/ml) with human T cells in an effector to target ratio of 5: 1 in triplicates in a 96-well format. As minimum lysis control (Lmin) effector and target cells were plated without bi-scFv 6PHU3. Maximum lysis (Lmax) for the normalization to spontaneous luminescence counts was achieved by addition of Triton X-100 to control wells containing effector and target cells in the absence of bi-scFv shortly prior to luciferin addition. After addition of luciferin solution the luminescence was measured in an Infinite M200 Tecan microplate reader after 24h and 48h. Specific target cell lysis was calculated by the formula: % specific lysis = [1 - (luminescencetest sample - Lmax) / (Lmin - Lmax)] x 100. Values were plotted against log 10 of 6PHU3 concentration. EC50 indicates the half maximal effective concentration; L, lysis. FIGURE 18. 6PHU3 shows therapeutic in vivo efficacy in an advanced SC tumor model.
NOD.Cg-Prkdscid IL2rgtml wjl/SzJ (NSG) mice were injected SC with lxlO7 PA-1 endogenously expressing CLDN6. 15 days later 2xl07 human PBMC were injected IP to groups G3 and G4, control groups (Gl and G2) received PBS only. Daily IP application of 5 μg 6PHU3 per animal or control bi-scFv IBiMAB or vehicle alone as control started five days after PBMC injection. Therapy was administered for 25 days, tumor volume was measured using a caliper and calculated by the formula mm3 = length mm x width mm x (width mm/2). (A) The tumor volume of single mice and the median per group is shown for treatment days 0 and 14 (upper row), and 21 and 25 (bottom row). (B) The mean tumor volume of all treatment groups is shown. Dashes indicate sacrificed animals. (C) A Kaplan-Meier survival curve of all groups from the day of tumor inoculation till day 45 is shown. Animals were sacrificed at a tumor volume >1500 mm3. After day 45 all remaining animals were sacrificed to analyze the engraftment of human effector cells in the spleens of mice. (D) Splenocytes of all mice were isolated and stained with anti- CD45-APC and anti-CD3-FITC to detect human T cells by flow cytometry. Median engraftment is shown in a boxplot diagram. IP indicates intraperitoneal; PBMC, peripheral blood mononuclear cells; PBS, phosphate buffered saline; SC, subcutaneous.
FIGURE 19. Enhanced T cell infiltration into SC PA-1 tumors in response to 6PHU3 treatment.
NSG mice were injected SC with lxl 07 PA-1 endogenously expressing CLDN6. 15 days later 2xl 07 human PBMC were injected IP to groups G3 and G4, control groups (Gl and G2) received PBS only. Daily IP application of 5 μg 6PHU3 per animal or control bi-scFv IBiMAB or vehicle alone as control started five days after PBMC injection. Tumors were dissected at a size of 1500 mm3 or at the end of the experiment, and conserved in 4% buffered formaldehyde solution for paraffin embedding.
Paraffin embedded tumor tissues of SC PA-1 tumors were subjected to immunohistochemical stainings. Consecutive sections were stained either with polyclonal primary antibody anti- Claudin 6 or anti-human CD3. Primary antibodies were detected using secondary HRP- conjugated anti-rabbit antibodies. Upper rows of A-E show the CLDN6 staining, lower rows the CD3 staining. Images were taken with a Mirax scanner. (A) and (B) show the PBS control groups Gl and G2 that received no human effector cells and vehicle or bi-scFv 6PHU3, respectively, (C) shows control group G3 that received human effector cells and vehicle as treatment, (D) shows group G4 that received human effector cells and bi-scFv 6PHU3 as treatment, and (E) shows control group G5 that received human effector cells and control bi-scFv IBiMAB. Positive signals appear as red staining. Black arrowheads point to examples of CD3 signals. IP indicates intraperitoneal; PBMC, peripheral blood mononuclear cells; PBS, phosphate buffered saline; SC, subcutaneous. DETAILED DESCRIPTION OF THE INVENTION
Although the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. In the following, the elements of the present invention will be described. These elements are listed with specific embodiments, however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and/or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise. Preferably, the terms used herein are defined as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", H.G.W. Leuenberger, B. Nagel, and H. Kolbl, Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995).
The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques which are explained in the literature in the field (cf, e.g., Molecular Cloning: A Laboratory Manual, 2nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps although in some embodiments such other member, integer or step or group of members, integers or steps may be excluded, i.e. the subject-matter consists in the inclusion of a stated member, integer or step or group of members, integers or steps. The terms "a" and "an" and "the" and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as"), provided herein is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
Claudins are a family of proteins that are the most important components of tight junctions, where they establish the paracellular barrier that controls the flow of molecules in the intercellular space between cells of an epithelium. Claudins are transmembrane proteins spanning the membrane 4 times with the N-terminal and the C-terminal end both located in the cytoplasm. The first extracellular loop, termed ECl or ECL1, consists on average of 53 amino acids, and the second extracellular loop, termed EC2 or ECL2, consists of around 24 amino acids. Cell surface proteins of the claudin family, such as CLDN6 and CLDN18.2, are expressed in tumors of various origins, and are particularly suited as target structures in connection with antibody-mediated cancer immunotherapy due to their selective expression (no expression in a toxicity relevant normal tissue) and localization to the plasma membrane.
In the context of the present invention, the preferred claudins are CLDN6 and CLDN18.2. CLDN6 and CLDN18.2 have been identified as differentially expressed in tumor tissues, with the only normal tissues expressing CLDN18.2 being stomach and the only normal tissue expressing CLDN6 being placenta.
CLDN18.2 is selectively expressed in normal tissues in differentiated epithelial cells of the gastric mucosa. CLDN18.2 is expressed in cancers of various origins such as pancreatic carcinoma, esophageal carcinoma, gastric carcinoma, bronchial carcinoma, breast carcinoma, and ENT tumors. CLDN18.2 is a valuable target for the prevention and/or treatment of primary tumors, such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, and cancers of the gallbladder, and metastases thereof, in particular gastric cancer metastasis such as Krukenberg tumors, peritoneal metastasis, and lymph node metastasis.
CLDN6 has been found to be expressed, for example, in ovarian cancer, lung cancer, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, melanomas, head neck cancer, sarcomas, bile duct cancer, renal cell cancer, and urinary bladder cancer. CLDN6 is a particularly preferred target for the prevention and/or treatment of ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum, in particular small bowel adenocarcinoma and adenocarcinoma of the ileum, testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as a teratocarcinoma or an embryonal carcinoma, in particular germ cell tumors of the testis, and the metastatic forms thereof. In one embodiment, the cancer disease associated with CLDN6 expression is selected from the group consisting of ovarian cancer, lung cancer, metastatic ovarian cancer and metastatic lung cancer. Preferably, the ovarian cancer is a carcinoma or an adenocarcinoma. Preferably, the lung cancer is a carcinoma or an adenocarcinoma, and preferably is bronchiolar cancer such as a bronchiolar carcinoma or bronchiolar adenocarcinoma.
The term "CLDN" as used herein means claudin and includes CLDN18.2 and CLDN6. Preferably, a claudin is a human claudin. The term "CLDN18" relates to claudin 18 and includes any variants, including claudin 18 splice variant 1 (claudin 18.1 (CLDN18.1)) and claudin 18 splice variant 2 (claudin 18.2 (CLDN18.2)).
The term "CLDN18.2" preferably relates to human CLDN18.2, and, in particular, to a protein comprising, preferably consisting of the amino acid sequence according to SEQ ID NO: 1 of the sequence listing or a variant of said amino acid sequence. The first extracellular loop of CLDN18.2 preferably comprises amino acids 27 to 81 , more preferably amino acids 29 to 78 of the amino acid sequence shown in SEQ ID NO: 1. The second extracellular loop of CLDN18.2 preferably comprises amino acids 140 to 180 of the amino acid sequence shown in SEQ ID NO: 1. Said first and second extracellular loops preferably form the extracellular portion of CLDN18.2.
The term "CLDN6" preferably relates to human CLDN6, and, in particular, to a protein comprising, preferably consisting of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 of the sequence listing or a variant of said amino acid sequence. The first extracellular loop of CLDN6 preferably comprises amino acids 28 to 80, more preferably amino acids 28 to 76 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3. The second extracellular loop of CLDN6 preferably comprises amino acids 138 to 160, preferably amino acids 141 to 159, more preferably amino acids 145 to 157 of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 3. Said first and second extracellular loops preferably form the extracellular portion of CLDN6.
The term "variant" according to the invention refers, in particular, to mutants, splice variants, conformations, isoforms, allelic variants, species variants and species homologs, in particular those which are naturally present. An allelic variant relates to an alteration in the normal sequence of a gene, the significance of which is often unclear. Complete gene sequencing often identifies numerous allelic variants for a given gene. A species homolog is a nucleic acid or amino acid sequence with a different species of origin from that of a given nucleic acid or amino acid sequence. The term "variant" shall encompass any posttranslationally modified variants and conformation variants.
The second target molecule of the binding agents described herein is CD3 (cluster of differentiation 3). The CD3 complex denotes an antigen that is expressed on mature human T- cells, thymocytes and a subset of natural killer cells as part of the multimolecular T-cell receptor (TCR) complex. The T-cell co-receptor is a protein complex and is composed of four distinct chains. In mammals, the complex contains a CD3y chain, a CD36 chain, and two CD3e chains. These chains associate with a molecule known as the T-cell receptor (TCR) and the ζ-chain to generate an activation signal in T lymphocytes. The TCR, ζ-chain, and CD3 molecules together comprise the TCR complex.
The human CD3 epsilon is indicated in GenBank Accession No. NM_000733 and comprises SEQ ID NO: 4. The human CD3 gamma is indicated in GenBank Accession No. NM 000073. The human CD3 delta is indicated in GenBank Accession No. NM_000732. CD3 is responsible for the signal transduction of the TCR. As described by Lin and Weiss, Journal of Cell Science 1 14, 243-244 (2001), activation of the TCR complex by binding of MHC-presented specific antigen epitopes results in the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) by Src family kinases, triggering recruitment of further kinases which results in T cell activation including Ca2+ release. Clustering of CD3 on T cells, e.g. by immobilized anti- CD3 -antibodies, leads to T cell activation similar to the engagement of the T cell receptor, but independent from its clone typical specificity.
As used herein, "CD3" includes human CD3 and denotes an antigen that is expressed on human T cells as part of the multimolecular T cell receptor complex. With respect to CD3, the binding agent of the invention preferably recognizes the epsilon-chain of CD3, particular, it recognizes an epitope that corresponds to the first 27 N-terminal amino acids of CD3 epsilon or functional fragments of this 27 amino acid stretch. According to the invention, the term "claudin positive cancer" or similar terms means a cancer involving cancer cells expressing a claudin, preferably on the surface of said cancer cells.
"Cell surface" is used in accordance with its normal meaning in the art, and thus includes the outside of the cell which is accessible to binding by proteins and other molecules
A claudin is expressed on the surface of cells if it is located at the surface of said cells and is accessible to binding by claudin-specific antibodies added to the cells.
The term "extracellular portion" in the context of the present invention refers to a part of a molecule such as a protein that is facing the extracellular space of a cell and preferably is accessible from the outside of said cell, e.g., by antigen-binding molecules such as antibodies located outside the cell. Preferably, the term refers to one or more extracellular loops or domains or a fragment thereof.
The terms "part" or "fragment" are used interchangeably herein and refer to a continuous element. For example, a part of a structure such as an amino acid sequence or protein refers to a continuous element of said structure. A portion, a part or a fragment of a structure preferably comprises one or more functional properties of said structure. For example, a portion, a part or a fragment of an epitope or peptide is preferably immunologically equivalent to the epitope or peptide it is derived from. A part or fragment of a protein sequence preferably comprises a sequence of at least 6, in particular at least 8, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids of the protein sequence. According to the invention, CLDN18.2 is not substantially expressed in a cell if the level of expression is lower compared to expression in stomach cells or stomach tissue. Preferably, the level of expression is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the expression in stomach cells or stomach tissue or even lower. Preferably, CLDN18.2 is not substantially expressed in a cell if the level of expression exceeds the level of expression in non- cancerous tissue other than stomach by no more than 2-fold, preferably 1.5-fold, and preferably does not exceed the level of expression in said non-cancerous tissue. Preferably, CLDN18.2 is not substantially expressed in a cell if the level of expression is below the detection limit and/or if the level of expression is too low to allow binding by CLDN18.2-specific antibodies added to the cells. According to the invention, CLDN18.2 is expressed in a cell if the level of expression exceeds the level of expression in non-cancerous tissue other than stomach preferably by more than 2- fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold. Preferably, CLDN 18.2 is expressed in a cell if the level of expression is above the detection limit and/or if the level of expression is high enough to allow binding by CLDN18.2-specific antibodies added to the cells. Preferably, CLDN18.2 expressed in a cell is expressed or exposed on the surface of said cell.
According to the invention, CLDN6 is not substantially expressed in a cell if the level of expression is lower compared to expression in placenta cells or placenta tissue. Preferably, the level of expression is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1% or 0.05% of the expression in placenta cells or placenta tissue or even lower. Preferably, CLDN6 is not substantially expressed in a cell if the level of expression exceeds the level of expression in noncancerous tissue other than placenta by no more than 2-fold, preferably 1.5-fold, and preferably does not exceed the level of expression in said non-cancerous tissue. Preferably, CLDN6 is not substantially expressed in a cell if the level of expression is below the detection limit and/or if the level of expression is too low to allow binding by CLDN6-specific antibodies added to the cells. According to the invention, CLDN6 is expressed in a cell if the level of expression exceeds the level of expression in non-cancerous tissue other than placenta preferably by more than 2-fold, preferably 10-fold, 100-fold, 1000-fold, or 10000-fold. Preferably, CLDN6 is expressed in a cell if the level of expression is above the detection limit and/or if the level of expression is high enough to allow binding by CLDN6-specific antibodies added to the cells. Preferably, CLDN6 expressed in a cell is expressed or exposed on the surface of said cell.
According to the invention, the term "disease" refers to any pathological state, including cancer, in particular those forms of cancer described herein. Any reference herein to cancer or particular forms of cancer also includes cancer metastasis thereof. In a preferred embodiment, a disease to be treated according to the present application involves cells expressing claudin (CLDN) such as CLDN18.2 and/or CLDN6.
"Diseases associated with cells expressing CLDN" or similar expressions means according to the invention that CLDN is expressed in cells of a diseased tissue or organ. In one embodiment, expression of CLDN in cells of a diseased tissue or organ is increased compared to the state in a healthy tissue or organ. An increase refers to an increase by at least 10%, in particular at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more. In one embodiment, expression is only found in a diseased tissue, while expression in a healthy tissue is repressed. According to the invention, diseases associated with cells expressing CLDN include cancer diseases. Furthermore, according to the invention, cancer diseases preferably are those wherein the cancer cells express CLDN.
As used herein, a "cancer disease" or "cancer" includes a disease characterized by aberrantly regulated cellular growth, proliferation, differentiation, adhesion, and/or migration. By "cancer cell" is meant an abnormal cell that grows by a rapid, uncontrolled cellular proliferation and continues to grow after the stimuli that initiated the new growth cease. Preferably, a "cancer disease" is characterized by cells expressing CLDN and a cancer cell expresses CLDN. A cell expressing CLDN preferably is a cancer cell, preferably of the cancers described herein.
The term "cancer" according to the invention comprises leukemias, seminomas, melanomas, teratomas, lymphomas, neuroblastomas, gliomas, rectal cancer, endometrial cancer, kidney cancer, adrenal cancer, thyroid cancer, blood cancer, skin cancer, cancer of the brain, cervical cancer, intestinal cancer, liver cancer, colon cancer, stomach cancer, intestine cancer, head and neck cancer, gastrointestinal cancer, lymph node cancer, esophagus cancer, colorectal cancer, pancreas cancer, ear, nose and throat (ENT) cancer, breast cancer, prostate cancer, cancer of the uterus, ovarian cancer and lung cancer and the metastases thereof. Examples thereof are lung carcinomas, mamma carcinomas, prostate carcinomas, colon carcinomas, renal cell carcinomas, cervical carcinomas, or metastases of the cancer types or rumors described above. The term cancer according to the invention also comprises cancer metastases.
According to the invention, a "carcinoma" is a malignant rumor derived from epithelial cells. This group represents the most common cancers, including the common forms of breast, prostate, lung and colon cancer.
"Adenocarcinoma" is a cancer that originates in glandular tissue. This tissue is also part of a larger tissue category known as epithelial tissue. Epithelial tissue includes skin, glands and a variety of other tissue that lines the cavities and organs of the body. Epithelium is derived embryologically from ectoderm, endoderm and mesoderm. To be classified as adenocarcinoma, the cells do not necessarily need to be part of a gland, as long as they have secretory properties. This form of carcinoma can occur in some higher mammals, including humans. Well differentiated adenocarcinomas tend to resemble the glandular tissue that they are derived from, while poorly differentiated may not. By staining the cells from a biopsy, a pathologist will determine whether the tumor is an adenocarcinoma or some other type of cancer. Adenocarcinomas can arise in many tissues of the body due to the ubiquitous nature of glands within the body. While each gland may not be secreting the same substance, as long as there is an exocrine function to the cell, it is considered glandular and its malignant form is therefore named adenocarcinoma. Malignant adenocarcinomas invade other tissues and often metastasize given enough time to do so. Ovarian adenocarcinoma is the most common type of ovarian carcinoma. It includes the serous and mucinous adenocarcinomas, the clear cell adenocarcinoma and the endometrioid adenocarcinoma.
By "metastasis" is meant the spread of cancer cells from its original site to another part of the body. The formation of metastasis is a very complex process and depends on detachment of malignant cells from the primary tumor, invasion of the extracellular matrix, penetration of the endothelial basement membranes to enter the body cavity and vessels, and then, after being transported by the blood, infiltration of target organs. Finally, the growth of a new tumor at the target site depends on angiogenesis. Tumor metastasis often occurs even after the removal of the primary tumor because tumor cells or components may remain and develop metastatic potential. In one embodiment, the term "metastasis" according to the invention relates to "distant metastasis" which relates to a metastasis which is remote from the primary tumor and the regional lymph node system. In one embodiment, the term "metastasis" according to the invention relates to lymph node metastasis. One particular form of metastasis which is treatable using the therapy of the invention is metastasis originating from gastric cancer as primary site. In preferred embodiments such gastric cancer metastasis is Krukenberg tumors, peritoneal metastasis and/or lymph node metastasis.
Krukenberg tumor is an uncommon metastatic tumor of the ovary accounting for 1% to 2% of all ovarian tumors. Prognosis of Krukenberg tumor is still very poor and there is no established treatment for Krukenberg tumors. Krukenberg tumor is a metastatic signet ring cell adenocarcinoma of the ovary. Stomach is the primary site in most Krukenberg tumor cases (70%). Carcinomas of colon, appendix, and breast (mainly invasive lobular carcinoma) are the next most common primary sites. Rare cases of Krukenberg tumor originating from carcinomas of the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix, and urinary bladder/urachus have been reported.
By "treat" is meant to administer a compound or composition or a combination of compounds or compositions to a subject in order to prevent or eliminate a disease, including reducing the size of a tumor or the number of tumors in a subject; arrest or slow a disease in a subject; inhibit or slow the development of a new disease in a subject; decrease the frequency or severity of symptoms and/or recurrences in a subject who currently has or who previously has had a disease; and/or prolong, i.e. increase the lifespan of the subject.
In particular, the term "treatment of a disease" includes curing, shortening the duration, ameliorating, preventing, slowing down or inhibiting progression or worsening, or preventing or delaying the onset of a disease or the symptoms thereof. In the context of the present invention, terms such as "protect", "prevent", "prophylactic", "preventive", or "protective" relate to the prevention or treatment or both of the occurrence and/or the propagation of a disease in a subject and, in particular, to minimizing the chance that a subject will develop a disease or to delaying the development of a disease. For example, a person at risk for cancer would be a candidate for therapy to prevent cancer.
By "being at risk" is meant a subject that is identified as having a higher than normal chance of developing a disease, in particular cancer, compared to the general population. In addition, a subject who has had, or who currently has, a disease, in particular cancer, is a subject who has an increased risk for developing a disease, as such a subject may continue to develop a disease. Subjects who currently have, or who have had, a cancer also have an increased risk for cancer metastases.
The term "patient" means according to the invention a subject for treatment, in particular a diseased subject, including human beings, nonhuman primates or another animals, in particular mammals such as cows, horses, pigs, sheeps, goats, dogs, cats or rodents such as mice and rats.
In a particularly preferred embodiment, a patient is a human being.
"Target cell" shall mean any undesirable cell such as a cancer cell. In preferred embodiments, the target cell expresses CLDN. The term "antigen" relates to an agent such as a protein or peptide comprising an epitope against which an immune response is directed and/or is to be directed. In a preferred embodiment, an antigen is a tumor-associated antigen, such as CLDN18.2 or CLDN6, i.e., a constituent of cancer cells which may be derived from the cytoplasm, the cell surface and the cell nucleus, in particular those antigens which are produced, preferably in large quantity, intracellular or as surface antigens on cancer cells.
In the context of the present invention, the term "tumor-associated antigen" preferably relates to proteins that are under normal conditions specifically expressed in a limited number of tissues and/or organs or in specific developmental stages and are expressed or aberrantly expressed in one or more tumor or cancer tissues. In the context of the present invention, the tumor-associated antigen is preferably associated with the cell surface of a cancer cell and is preferably not or only rarely expressed in normal tissues.
The term "epitope" refers to an antigenic determinant in a molecule, i.e., to the part in a molecule that is recognized by the immune system, for example, that is recognized by an antibody. For example, epitopes are the discrete, three-dimensional sites on an antigen, which are recognized by the immune system. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and non- conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. An epitope of a protein preferably comprises a continuous or discontinuous portion of said protein and is preferably between 5 and 100, preferably between 5 and 50, more preferably between 8 and 30, most preferably between 10 and 25 amino acids in length, for example, the epitope may be preferably 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 amino acids in length.
The term "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. The term "antibody" includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies and chimeric antibodies. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FRl , CDRl , FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody displays a single binding specificity and affinity. In one embodiment, the monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a non-human animal, e.g., mouse, fused to an immortalized cell. The term "recombinant antibody", as used herein, includes all antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal with respect to the immunoglobulin genes or a hybridoma prepared therefrom, (b) antibodies isolated from a host cell transformed to express the antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of immunoglobulin gene sequences to other DNA sequences.
The term "human antibody", as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). The term "humanized antibody" refers to a molecule having an antigen binding site that is substantially derived from an immunoglobulin from a non-human species, wherein the remaining immunoglobulin structure of the molecule is based upon the structure and/or sequence of a human immunoglobulin. The antigen binding site may either comprise complete variable domains fused onto constant domains or only the complementarity determining regions (CDR) grafted onto appropriate framework regions in the variable domains. Antigen binding sites may be wild-type or modified by one or more amino acid substitutions, e.g. modified to resemble human immunoglobulins more closely. Some forms of humanized antibodies preserve all CDR sequences (for example a humanized mouse antibody which contains all six CDRs from the mouse antibody). Other forms have one or more CDRs which are altered with respect to the original antibody.
The term "chimeric antibody" refers to those antibodies wherein one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class, while the remaining segment of the chain is homologous to corresponding sequences in another. Typically the variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to sequences of antibodies derived from another. One clear advantage to such chimeric forms is that the variable region can conveniently be derived from presently known sources using readily available B-cells or hybridomas from non-human host organisms in combination with constant regions derived from, for example, human cell preparations. While the variable region has the advantage of ease of preparation and the specificity is not affected by the source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non human source. However the definition is not limited to this particular example.
Antibodies may be derived from different species, including but not limited to mouse, rat, rabbit, guinea pig and human.
Antibodies described herein include IgA such as IgAl or IgA2, IgGl, IgG2, IgG3, IgG4, IgE, IgM, and IgD antibodies. In various embodiments, the antibody is an IgGl antibody, more particularly an IgGl, kappa or IgGl, lambda isotype (i.e. IgGl, κ, λ), an IgG2a antibody (e.g. IgG2a, K, λ), an IgG2b antibody (e.g. IgG2b, κ, λ), an IgG3 antibody (e.g. IgG3, κ, λ) or an IgG4 antibody (e.g. IgG4, , λ).
As used herein, a "heterologous antibody" is defined in relation to a transgenic organism producing such an antibody. This term refers to an antibody having an amino acid sequence or an encoding nucleic acid sequence corresponding to that found in an organism not consisting of the transgenic organism, and being generally derived from a species other than the transgenic organism.
As used herein, a "heterohybrid antibody" refers to an antibody having light and heavy chains of different organismal origins. For example, an antibody having a human heavy chain associated with a murine light chain is a heterohybrid antibody.
The antibodies described herein are preferably isolated. An "isolated antibody" as used herein, is intended to refer to an antibody which is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds to CLDN18.2 is substantially free of antibodies that specifically bind antigens other than CLDN18.2). An isolated antibody that specifically binds to an epitope, isoform or variant of human CLDN18.2 may, however, have cross-reactivity to other related antigens, e.g., from other species (e.g., CLDN18.2 species homologs). Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals. In one embodiment of the invention, a combination of "isolated" monoclonal antibodies relates to antibodies having different specificities and being combined in a well defined composition or mixture.
The terms "antigen-binding portion" of an antibody (or simply "binding portion") or "antigen- binding fragment" of an antibody (or simply "binding fragment") or similar terms refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen- binding portion" of an antibody include (i) Fab fragments, monovalent fragments consisting of the VL, VH, CL and CH domains; (ii) F(ab')2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) Fd fragments consisting of the VH and CH domains; (iv) Fv fragments consisting of the VL and VH domains of a single arm of an antibody, (v) dAb fragments (Ward et al., (1989) Nature 341 : 544-546), which consist of a VH domain; (vi) isolated complementarity determining regions (CDR), and (vii) combinations of two or more isolated CDRs which may optionally be joined by a synthetic linker. Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. (1988) Science 242: 423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. A further example is binding-domain immunoglobulin fusion proteins comprising (i) a binding domain polypeptide that is fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an immunoglobulin heavy chain CH3 constant region fused to the CH2 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. The binding-domain immunoglobulin fusion proteins are further disclosed in US 2003/01 18592 and US 2003/0133939. These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
The term "binding domain" characterizes in connection with the present invention a structure, e.g. of an antibody, which binds to/interacts with a given target structure/antigen epitope. Thus, the binding domain according to the invention designates an "antigen-interaction-site".
All antibodies and derivatives of antibodies such as antibody fragments as described herein for the purposes of the invention are encompassed by the term "antibody". The term "antibody derivatives" refers to any modified form of an antibody, e.g., a conjugate of the antibody and another agent or antibody, or an antibody fragment. Furthermore, the antibodies and derivatives of antibodies as described herein are useful for producing binding agents of the invention such as antibody fragments.
Naturally occurring antibodies are generally monospecific, i.e. they bind to a single antigen. The present invention provides binding agents binding to a cytotoxic cell (by engaging the CD3 receptor) and a cancer cell (by engaging CLDN). The binding agents of the present invention are at least bispecific or multispecific such as trispecific, tetraspecific and so on.
The binding agent of the invention may be in the format of an antibody molecule or of an antibody-like molecule or of a protein scaffold with antibody-like properties or of a cyclic peptide with at least two binding specificities. Thus, the binding agent may comprise one or more antibodies as described herein or fragments thereof. According to the invention, a bispecific molecule, in particular a bispecific protein, such as a bispecific antibody is a molecule that has two different binding specificities and thus may bind to two different types of antigen such as CLDN and CD3. Particularly, the term "bispecific antibody" as used herein refers to an antibody comprising two antigen-binding sites, a first binding site having affinity for a first antigen or epitope and a second binding site having binding affinity for a second antigen or epitope distinct from the first. In particular, a bispecific antibody is an artificial protein that is composed of fragments of two different antibodies (said fragments of two different antibodies forming two binding domains) and consequently binds to two different types of antigen. A bispecific antibody according to the invention is engineered to simultaneously bind to an immune cell, such as an immune effector cell, in particular a T cell such as a cytotoxic cell (by binding to CD3) and a target cell like a cancer cell (by binding to the rumor-associated antigen CLDN) to be destroyed.
The term "bispecific antibody" also includes diabodies. Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that is too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites (see e.g. , Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444- 6448; Poljak, R. J., et al. (1994) Structure 2: 1 121-1 123).
"Multispecific binding agents" are molecules which have more than two different binding specificities.
Particularly preferred according to the invention are bispecific antibodies including bispecific antibody fragments, in particular bispecific single chain antibodies including bispecific single chain antibody fragments. The term "bispecific single chain antibody" denotes a single polypeptide chain comprising two binding domains. In particular, the term "bispecific single chain antibody" or "single chain bispecific antibody" or related terms in accordance with the present invention preferably mean antibody constructs resulting from joining at least two antibody variable regions in a single polypeptide chain devoid of the constant and/or Fc portion(s) present in full immunoglobulins.
For example, a bispecific single chain antibody may be a construct with a total of two antibody variable regions, for example two VH regions, each capable of specifically binding to a separate antigen, and connected with one another through a short polypeptide spacer such that the two antibody variable regions with their interposed spacer exist as a single contiguous polypeptide chain. Another example of a bispecific single chain antibody may be a single polypeptide chain with three antibody variable regions. Here, two antibody variable regions, for example one VH and one VL, may make up an scFv, wherein the two antibody variable regions are connected to one another via a synthetic polypeptide linker, the latter often being genetically engineered so as to be minimally immunogenic while remaining maximally resistant to proteolysis. This scFv is capable of specifically binding to a particular antigen, and is connected to a further antibody variable region, for example a VH region, capable of binding to a different antigen than that bound by the scFv. Yet another example of a bispecific single chain antibody may be a single polypeptide chain with four antibody variable regions. Here, the first two antibody variable regions, for example a VH region and a VL region, may form one scFv capable of binding to one antigen, whereas the second VH region and VL region may form a second scFv capable of binding to another antigen. Within a single contiguous polypeptide chain, individual antibody variable regions of one specificity may advantageously be separated by a synthetic polypeptide linker, whereas the respective scFvs may advantageously be separated by a short polypeptide spacer as described above.
According to one embodiment of the invention, the first binding domain of the bispecific antibody comprises one antibody variable domain, preferably a VHH domain. According to one embodiment of the invention, the first binding domain of the bispecific antibody comprises two antibody variable domains, preferably a scFv, i.e. VH-VL or VL-VH. According to one embodiment of the invention, the second binding domain of the bispecific antibody comprises one antibody variable domain, preferably a VHH domain. According to one embodiment of the invention, the second binding domain of the bispecific antibody comprises two antibody variable domains, preferably a scFv, i.e. VH-VL or VL-VH. In its minimal form, the total number of antibody variable regions in the bispecific antibody according to the invention is thus only two. For example, such an antibody could comprise two VH or two VHH domains. According to one embodiment of the invention, the first binding domain and the second binding domain of the bispecific antibody each comprise one antibody variable domain, preferably a VHH domain. According to one embodiment of the invention, the first binding domain and the second binding domain of the bispecific antibody each comprise two antibody variable domains, preferably a scFv, i.e. VH-VL or VL-VH. In this embodiment, the binding agent of the invention preferably comprises (i) a heavy chain variable domain (VH) of a CLDN antibody, (ii) a light chain variable domain (VL) of a CLDN antibody, (iii) a heavy chain variable domain (VH) of a CD3 antibody and (iv) a light chain variable domain (VL) of a CD3 antibody. Bispecific full-length antibodies may be obtained by covalently linking two monoclonal antibodies or by conventional hybrid-hybridoma techniques. Covalent linking of two monoclonal antibodies is described in Anderson, Blood 80 (1992), 2826-34. In the context of this invention, one of the antibodies is specific for CLDN and the other one for CD3.
In one embodiment, the bispecific binding agent is in the format of an antibody-like molecule with a heavy chain containing two consecutive N-terminal variable domains with different specificities and a light chain with two consecutive variable domains with different specificities resulting in four binding domains with two different specificities (Wu et al., Nat. Biotechnology, 2007, 25(1 1)), wherein one specificity is CD3 and the other specificity is CLDN.
In a preferred embodiment, the bispecific binding agent of the invention is in the format of an antibody fragment.
In one embodiment, the bispecific molecules according to the invention comprises two Fab regions, one being directed against CLDN and the other being directed against CD3. In one embodiment, the molecule of the invention is an antigen binding fragment (Fab)2 complex. The Fab2 complex is composed of two Fab fragments, one Fab fragment comprising a Fv domain, i.e. VH and VL domains, specific for a CD3 antigen, and the other Fab fragment comprising a Fv domain specific for CLDN. Each of the Fab fragments may be composed of two single chains, a VL-CL module and a VH-CH module. Alternatively, each of the individual Fab fragments may be arranged in a single chain, preferably, VL-CL-CH-VH, and the individual variable and constant domains may be connected with a peptide linker. In general, the individual single chains and Fab fragments may be connected via disulfide bonds, adhesive domains, chemically linked and/or peptide linker. The bispecific molecule may also comprise more than two Fab fragments, in particular, the molecule may be a Fab3, Fab4, or a multimeric Fab complex with specificity for 2, 3, 4, or more different antigens. The invention also includes chemically linked Fabs.
In one embodiment, the binding agent according to the invention includes various types of bivalent and trivalent single-chain variable fragments (scFvs), fusion proteins mimicking the variable domains of two antibodies. A single-chain variable fragment (scFv) is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of immunoglobulins, connected with a short linker peptide of ten to about 25 amino acids. The linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility, and can either connect the N-terminus of the VH with the C-terminus of the VL, or vice versa. Divalent (or bivalent) single-chain variable fragments (di-scFvs, bi-scFvs) can be engineered by linking two scFvs. This can be done by producing a single peptide chain with two VH and two VL regions, yielding tandem scFvs. The invention also includes multispecific molecules comprising more than two scFvs binding domains. This makes it possible that the molecule comprises either multiple antigen specificities and is a trispecific, tetraspecific, or multispecific molecule, or the molecule is a bispecific molecule comprising more than one scFv binding domain with specificity for the same antigen. In particular, the molecule of the invention may be a multispecific single chain Fv.
Another possibility is the creation of scFvs with linker peptides that are too short for the two variable regions to fold together (about five amino acids), forcing scFvs to dimerize. This type is known as diabodies. Still shorter linkers (one or two amino acids) lead to the formation of trimers, so-called triabodies or tribodies. Tetrabodies have also been produced. They exhibit an even higher affinity to their targets than diabodies. A particularly preferred example of a bispecific antibody fragment is a diabody (Kipriyanov, Int. J. Cancer 77 (1998), 763-772), which is a small bivalent and bispecific antibody fragment. Diabodies comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) on the same polypeptide chain (VH-VL) connected by a peptide linker that is too short to allow pairing between the two domains on the same chain. This forces pairing with the complementary domains of another chain and promotes the assembly of a dimeric molecule with two functional antigen binding sites. To construct bispecific diabodies of the invention, the V- domains of an anti-CD3 antibody and an anti-CLDN antibody may be fused to create the two chains VH(CD3)-VL(CLDN), VH(CLDN)-VL(CD3). Each chain by itself is not able to bind to the respective antigen, but recreates the functional antigen binding sites of an anti-CD3 antibody and an anti-CLDN antibody on pairing with the other chain. To this end, a peptide linker that is too short to allow pairing between the two domains on the same chain is used. The two scFv molecules, with a linker between heavy chain variable domain and light chain variable domain that is too short for intramolecular dimerization, are co-expressed and self assemble to form bispecific molecules with the two binding sites at opposite ends. In one embodiment, the multispecific molecule according to the invention comprises variable (VH, VL) and constant domains (C) of immunoglobulins. In one embodiment the bispecific molecule is a minibody, preferably, a minibody comprising two single VH-VL-C chains that are connected with each other via the constant domains (C) of each chain. According to this aspect, the corresponding variable heavy chain regions (VH), corresponding variable light chain regions (VL) and constant domains (C) are arranged, from N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-(C) and VH(CD3)-VL(CD3)-C, wherein C is preferably a CH3 domain. Pairing of the constant domains results in formation of the minibody.
According to another particularly preferred aspect, the bispecific binding agent of the invention is in the format of a bispecific single chain antibody construct, whereby said construct comprises or consists of at least two binding domains, whereby one of said domains binds to CLDN and a second domain binds to CD3. Such molecules, also termed "bispecific T cell engagers" (BiTEs; the term BiTE only refers to bi-specific molecules of which one arm is specific for CD3) consist of two scFv molecules connected via a linker peptide.
As used herein, a "bispecific single chain antibody" denotes a single polypeptide chain comprising two binding domains. Each binding domain comprises one variable region from an antibody heavy chain ("VH region"), wherein the VH region of the first binding domain specifically binds to the CLDN, and the VH region of the second binding domain specifically binds to CD3. The two binding domains are optionally linked to one another by a short polypeptide spacer. A non-limiting example for a polypeptide spacer is Gly-Gly-Gly-Gly-Ser (G- G-G-G-S) and repeats thereof. Each binding domain may additionally comprise one variable region from an antibody light chain (" VL region"), the VH region and VL region within each of the first and second binding domains being linked to one another via a polypeptide linker long enough to allow the VH region and VL region of the first binding domain and the VH region and VL region of the second binding domain to pair with one another. According to this aspect, the corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) are arranged, from N-terminus to C-terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(CLDN)- VL(CLDN) or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN). It is, however, also envisaged that the bispecific single chain antibodies of the invention comprise other domain arrangements, such as VL(CLDN)-VH(CLDN)-VH(CD3)-VL(CD3), VL(CLDN)-VH(CLDN)-VL(CD3)-VH(CD3), VH(CLDN)-VL(CLDN)-VL(CD3)-VH(CD3), VL(CD3)-VH(CD3)-VH(CLDN)-VL(CLDN), VL(CD3)-VH(CD3)-VL(CLDN)-VH(CLDN). A long linker generally connects the corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) to create a scFv binding domain while a short linker generally connects two scFv binding domains. The linker is generally designed to provide flexibility and protease resistance, and preferably, the linker comprises glycine and/or serine amino acid residues. Short peptide linkers may consist of 12 or less such as 1 1, 10, 9, 8, 7, 6, 5, 4, 3 or 2 amino acids, and preferably, 5 or 6 amino acids. Short peptide linkers preferably comprise the amino acid sequences SGGGGS or GGGGS. Long peptide linkers may consist of 12 or more, such as 15 to 25 or 15 to 20 or 15 to 18 amino acids. Long peptide linkers preferably comprise the amino acid sequences (GGGGS)3 or VE(GGSGGS)2GGVD. Binding agents according to the invention may also comprises an amino acid sequence for facilitating secretion of the molecule, such as a N-terminal secretion signal, and/or one or more epitope tags facilitating binding, purification or detection of the molecule.
Preferably, the secretion signal is a signal sequence (e.g. selected from any one of SEQ ID NOs: 51 , 52, 53, 54, 55) that allows a sufficient passage through the secretory pathway and/or secretion of the binding agent into the extracellular environment. Preferably, the secretion signal sequence is cleavable and is removed from the mature binding agent. The secretion signal sequence preferably is chosen with respect to the cell or organism wherein the binding agent is produced in.
The amino acid sequence of an epitope tag may be introduced to any position within the amino acid sequence of the binding agent, and may take the shape of a loop within the encoded protein structure, or it may be N-terminally or C-terminally fused to the binding agent. Preferably, the epitope tag is C-terminally fused to the binding agent. The epitope tag may contain a cleavage site that allows a removal of the tag from the binding agent. Said epitope tag can be any kind of epitope tag that is functional under native and/or denaturing conditions, preferable a histidin tag, most preferable a tag comprising six histidins. The bispecific binding agent of the invention may contain, in addition to said first and second binding domain, a further binding domain which serves e.g. to enhance selectivity for tumor cells. This can be achieved e.g. by providing binding domains that bind to other antigens expressed on tumor cells.
In the context of the present invention, the binding agents generated are preferably capable of eliciting immune effector functions as described herein. Preferably, said immune effector functions are directed against cells carrying the tumor-associated antigen CLDN on their surface. The term "immune effector functions" in the context of the present invention includes any functions mediated by components of the immune system that result e.g. in the inhibition of tumor growth and/or inhibition of tumor development, including inhibition of tumor dissemination and metastasis. Preferably, immune effector functions result in killing of tumor cells. Such functions comprise complement dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), induction of apoptosis in the cells carrying the tumor-associated antigen, cytolysis of the cells carrying the tumor-associated antigen, and/or inhibition of proliferation of the cells carrying the tumor-associated antigen. Binding agents may also exert an effect simply by binding to tumor- associated antigens on the surface of a cancer cell. For example, antibodies may block the function of the tumor-associated antigen or induce apoptosis just by binding to the tumor- associated antigen on the surface of a cancer cell.
The binding agents described herein may be conjugated to a therapeutic moiety or agent, such as a cytotoxin, a drug (e.g., an immunosuppressant) or a radioisotope. A cytotoxin or cytotoxic agent includes any agent that is detrimental to and, in particular, kills cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 -dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Suitable therapeutic agents for forming conjugates include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabin, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC), and anti-mitotic agents (e.g., vincristine and vinblastine). In a preferred embodiment, the therapeutic agent is a cytotoxic agent or a radiotoxic agent. In another embodiment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF. In a preferred embodiment, the therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide or ricin A.
Binding agents also can be conjugated to a radioisotope, e.g., iodine-131 , yttrium-90 or indium- 1 1 1 , to generate cytotoxic radiopharmaceuticals.
Techniques for conjugating such therapeutic moiety to antibodies are well known, see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds. ), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pincheraet al. (eds. ), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62: 119-58 (1982).
The term "binding" according to the invention preferably relates to a specific binding.
According to the present invention, an agent such as an antibody is capable of binding to a predetermined target if it has a significant affinity for said predetermined target and binds to said predetermined target in standard assays. "Affinity" or "binding affinity" is often measured by equilibrium dissociation constant ( p). Preferably, the term "significant affinity" refers to the binding to a predetermined target with a dissociation constant (KD) of 10"5 M or lower, 10"6 M or lower, 10"7 M or lower, 10"8 M or lower, 10"9 M or lower, 10" 10 M or lower, 10"" M or lower, or 10"12 M or lower. An agent is not (substantially) capable of binding to a target if it has no significant affinity for said target and does not bind significantly, in particular does not bind detectably, to said target in standard assays. Preferably, the agent does not detectably bind to said target if present in a concentration of up to 2, preferably 10, more preferably 20, in particular 50 or 100 μg/ml or higher. Preferably, an agent has no significant affinity for a target if it binds to said target with a D that is at least 10-fold, 100-fold, 103-fold, 104-fold, 105-fold, or 106-fold higher than the KD for binding to the predetermined target to which the agent is capable of binding. For example, if the D for binding of an agent to the target to which the agent is capable of binding is 10"7 M, the KD for binding to a target for which the agent has no significant affinity would be at least 10"6 M, 10"5 M, 10^ M, 10"3 M, 10"2 M, or 10"' M.
An agent such as an antibody is specific for a predetermined target if it is capable of binding to said predetermined target while it is not capable of binding to other targets, i.e. has no significant affinity for other targets and does not significantly bind to other targets in standard assays. According to the invention, an agent is specific for CLDN if it is capable of binding to CLDN but is not (substantially) capable of binding to other targets. Preferably, an agent is specific for CLDN if the affinity for and the binding to such other targets does not significantly exceed the affinity for or binding to CLDN-unrelated proteins such as bovine serum albumin (BSA), casein, human serum albumin (HSA) or non-claudin transmembrane proteins such as MHC molecules or transferrin receptor or any other specified polypeptide. Preferably, an agent is specific for a predetermined target if it binds to said target with a KD that is at least 10-fold, 100-fold, 103-fold, 104-fold, 105-fold, or 106-fold lower than the KD for binding to a target for which it is not specific. For example, if the KD for binding of an agent to the target for which it is specific is 10" 7 M, the KD for binding to a target for which it is not specific would be at least 10"6 M, 10"5 M, 10"4 M, 10"3 M, 10"2 M, or 10"' M.
Binding of an agent to a target can be determined experimentally using any suitable method; see, for example, Berzofsky et al., "Antibody-Antigen Interactions" In Fundamental Immunology, Paul, W. E., Ed., Raven Press New York, N Y (1 84), Kuby, Janis Immunology, W. H. Freeman and Company New York, N Y (1 92), and methods described herein. Affinities may be readily determined using conventional techniques, such as by equilibrium dialysis; by using the BIAcore 2000 instrument, using general procedures outlined by the manufacturer; by radioimmunoassay using radiolabeled target antigen; or by another method known to the skilled artisan. The affinity data may be analyzed, for example, by the method of Scatchard et al., Ann N.Y. Acad. ScL, 51 :660 ( 1949). The measured affinity of a particular antibody-antigen interaction can vary if measured under different conditions, e.g., salt concentration, pH. Thus, measurements of affinity and other antigen-binding parameters, e.g., D, IC5O, are preferably made with standardized solutions of antibody and antigen, and a standardized buffer.
As used herein, "isotype" refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.
As used herein, "isotype switching" refers to the phenomenon by which the class, or isotype, of an antibody changes from one Ig class to one of the other Ig classes.
The term "naturally occurring" as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
The term "rearranged" as used herein refers to a configuration of a heavy chain or light chain immunoglobulin locus wherein a V segment is positioned immediately adjacent to a D-J or J segment in a conformation encoding essentially a complete VH or VL domain, respectively. A rearranged immunoglobulin (antibody) gene locus can be identified by comparison to germline DNA; a rearranged locus will have at least one recombined heptamer/nonamer homology element.
The term "unrearranged" or "germline configuration" as used herein in reference to a V segment refers to the configuration wherein the V segment is not recombined so as to be immediately adjacent to a D or J segment.
In one embodiment, a binding agent of the invention has the ability of binding to CLDN18.2, i.e. the ability of binding to an epitope present in CLDN18.2, preferably an epitope located within the extracellular domains of CLDN 18.2, in particular the first extracellular loop, preferably amino acid positions 29 to 78 of CLDN18.2. In particular embodiments, an agent having the ability of binding to CLDN 1 8.2 binds to an epitope on CLDN 18.2 which is not present on CLDN18.1. An agent having the ability of binding to CLDN18.2 preferably binds to CLDN18.2 but not to CLDN18.1. Preferably, an agent having the ability of binding to CLDN18.2 is specific for CLDN18.2. Preferably, an agent having the ability of binding to CLDN18.2 binds to CLDN18.2 expressed on the cell surface. In particular preferred embodiments, an agent having the ability of binding to CLDN18.2 binds to native epitopes of CLDN18.2 present on the surface of living cells.
In a preferred embodiment, an agent having the ability of binding to CLDN18.2 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 6, 7, 8, 9, 10, and a fragment thereof.
In a preferred embodiment, an agent having the ability of binding to CLDN18.2 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 18, 19, and a fragment thereof.
In certain preferred embodiments, an agent having the ability of binding to CLDN18.2 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities (i) to (ix):
(i) the VH comprises an amino acid sequence represented by SEQ ID NO: 5 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof,
(ii) the VH comprises an amino acid sequence represented by SEQ ID NO: 6 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 1 1 or a fragment thereof,
(iii) the VH comprises an amino acid sequence represented by SEQ ID NO: 7 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof,
(iv) the VH comprises an amino acid sequence represented by SEQ ID NO: 9 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 16 or a fragment thereof,
(v) the VH comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof, (vi) the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 14 or a fragment thereof,
(vii) the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 17 or a fragment thereof,
(viii) the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 18 or a fragment thereof,
(ix) the VH comprises an amino acid sequence represented by SEQ ID NO: 10 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof.
In a particularly preferred embodiment, an agent having the ability of binding to CLDN18.2 comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof.
The term "fragment" refers, in particular, to one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and/or of the light chain variable region (VL). In one embodiment said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementarity- determining regions CDR1 , CDR2 and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
In one embodiment a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their intervening framework regions. Preferably, the portion will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. Construction of binding agents made by recombinant DNA techniques may result in the introduction of residues N- or C-terminal to the variable regions encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers to join variable regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the production of diabodies) or protein labels.
In one embodiment a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework. In one embodiment, a binding agent of the invention has the ability of binding to CLDN6, i.e. the ability of binding to an epitope present in CLDN6, preferably an epitope located within the extracellular domains of CLDN6, in particular the first extracellular loop, preferably amino acid positions 28 to 76 of CLDN6 or the second extracellular loop, preferably amino acid positions 141 to 159 of CLDN6. In particular embodiments, an agent having the ability of binding to CLDN6 binds to an epitope on CLDN6 which is not present on CLDN9. Preferably, an agent having the ability of binding to CLDN6 binds to an epitope on CLDN6 which is not present on CLDN4 and/or CLDN3. Most preferably, an agent having the ability of binding to CLDN6 binds to an epitope on CLDN6 which is not present on a CLDN protein other than CLDN6. An agent having the ability of binding to CLDN6 preferably binds to CLDN6 but not to CLDN9 and preferably does not bind to CLDN4 and/or CLDN3. Preferably, an agent having the ability of binding to CLDN6 is specific for CLDN6. Preferably, an agent having the ability of binding to CLDN6 binds to CLDN6 expressed on the cell surface. In particular preferred embodiments, an agent having the ability of binding to CLDN6 binds to native epitopes of CLDN6 present on the surface of living cells.
In a preferred embodiment, an agent having the ability of binding to CLDN6 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 22, 24, 26, and a fragment thereof.
In a preferred embodiment, an agent having the ability of binding to CLDN6 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 21 , 23, 25, 27, 28, 29, and a fragment thereof. In certain preferred embodiments, an agent having the ability of binding to CLDN6 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities (i) to (vii):
(i) the VH comprises an amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof,
(ii) the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof,
(iii) the VH comprises an amino acid sequence represented by SEQ ID NO: 24 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 25 or a fragment thereof,
(iv) the VH comprises an amino acid sequence represented by SEQ ID NO: 26 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 27 or a fragment thereof,
(v) the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof,
(vi) the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 28 or a fragment thereof,
(vii) the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 29 or a fragment thereof.
In a particularly preferred embodiment, an agent having the ability of binding to CLDN6 comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof.
The term "fragment" refers, in particular, to one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and/or of the light chain variable region (VL). In one embodiment said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementarity- determining regions CDR1 , CDR2 and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
In one embodiment a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their intervening framework regions. Preferably, the portion will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. Construction of binding agents made by recombinant DNA techniques may result in the introduction of residues N- or C-terminal to the variable regions encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers to join variable regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the production of diabodies) or protein labels.
In one embodiment a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework.
Anti-CD3 antibodies which are useful for providing binding agents according to the invention include but are not limited to UCHT1-HS (humanized mAB), UCHT1-MM (murine mAB), CLB-T3, TR66, 145-2C1 1.
UCHT1 is a monoclonal IgGl anti-CD3 monoclonal antibody which detects CD3 in human and primate sample types. CLB-T3 is a mouse monoclonal anti-CD3 antibody which is directed against the CD3 antigen and reacts with 80-90% human peripheral T lymphocytes and medullary thymocytes. TR66 is a mouse IgGl monoclonal anti-CD3 antibody which recognizes the epsilon-chain of human CD3. 145-2C1 1 is an armenian hamster monoclonal anti-mouse CD3 antibody.
Preferably, the VH and VL regions of the CD3 -binding domain are derived from antibodies/antibody molecules and antibody-like molecules which are capable of specifically recognizing the human CD3 in the context of other TCR subunits as present on activated primary human T cells expressing the TCR in its native configuration. The VH and VL regions derived from an antibody specific for the CD3-epsilon chain are most preferred and said (parental) antibodies should be capable of specifically binding epitopes reflecting the native or near-native structure or a conformational epitope of human CD3 presented in the context of the TCR complex. In a preferred embodiment of the invention, the VH and VL regions of the CD3- binding domain are derived from a CD3 specific antibody selected from the group consisting of UCHT1-HS, UCHT1-MM, CLB-T3 and TR66, preferably TR66. In a preferred embodiment, an agent having the ability of binding to CD3 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 32, 34, 36, and a fragment thereof.
In a preferred embodiment, an agent having the ability of binding to CD3 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 31, 33, 35, 37, and a fragment thereof.
In certain preferred embodiments, an agent having the ability of binding to CD3 comprises a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities (i) to (iv):
(i) the VH comprises an amino acid sequence represented by SEQ ID NO: 30 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 31 or a fragment thereof,
(ii) the VH comprises an amino acid sequence represented by SEQ ID NO: 32 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 33 or a fragment thereof,
(iii) the VH comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof,
(iv) the VH comprises an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof. In a particularly preferred embodiment, an agent having the ability of binding to CD3 comprises the following combination of heavy chain variable region (VH) and light chain variable region (VL):
the VH comprises an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof and the VL comprises an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof.
The term "fragment" refers, in particular, to one or more of the complementarity-determining regions (CDRs), preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and/or of the light chain variable region (VL). In one embodiment said one or more of the complementarity-determining regions (CDRs) are selected from a set of complementarity- determining regions CDR1, CDR2 and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity-determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and/or of the light chain variable region (VL).
In one embodiment a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs together with their intervening framework regions. Preferably, the portion will also include at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. Construction of binding agents made by recombinant DNA techniques may result in the introduction of residues N- or C-terminal to the variable regions encoded by linkers introduced to facilitate cloning or other manipulation steps, including the introduction of linkers to join variable regions of the invention to further protein sequences including immunoglobulin heavy chains, other variable domains (for example in the production of diabodies) or protein labels.
In one embodiment a binding agent comprising one or more CDRs, a set of CDRs or a combination of sets of CDRs as described herein comprises said CDRs in a human antibody framework.
According to the invention, a preferred binding agent targeting CLDN18.2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a variant thereof. According to the invention, a preferred binding agent targeting CLDN6 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a variant thereof. It is to be understood that the binding agents described herein may be delivered to a patient by administering a nucleic acid such as RNA encoding the agent. The nucleic acid provided can produce the agent over extended time periods in a sustained manner mitigating the instability at least partially observed for therapeutic antibodies, in particular bispecific antibodies. Nucleic acids to be delivered to a patient can be produced by recombinant means.
The term "recombinant" in the context of the present invention means "made through genetic engineering". Preferably, a "recombinant object" such as a recombinant nucleic acid in the context of the present invention is not occurring naturally. The term "naturally occurring" as used herein refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring. The term "nucleic acid", as used herein, is intended to include DNA and RNA such as genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules. A nucleic acid may be single-stranded or double-stranded. RNA includes in vitro transcribed RNA (IVT RNA) or synthetic RNA. Nucleic acids may be comprised in a vector. The term "vector" as used herein includes any vectors known to the skilled person including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as adenoviral or baculoviral vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or PI artificial chromosomes (PAC). Said vectors include expression as well as cloning vectors. Expression vectors comprise plasmids as well as viral vectors and generally contain a desired coding sequence and appropriate DNA sequences necessary for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in in vitro expression systems. Cloning vectors are generally used to engineer and amplify a certain desired DNA fragment and may lack functional sequences needed for expression of the desired DNA fragments.
In the context of the present invention, the term "RNA" relates to a molecule which comprises ribonucleotide residues and preferably being entirely or substantially composed of ribonucleotide residues. "Ribonucleotide" relates to a nucleotide with a hydroxyl group at the 2'-position of a β- D-ribofuranosyl group. The term includes double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of a RNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in RNA molecules can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
According to the present invention, the term "RNA" includes and preferably relates to "mRNA" which means "messenger RNA" and relates to a "transcript" which may be produced using DNA as template and encodes a peptide or protein. mRNA typically comprises a 5' non translated region (5'-UTR), a protein or peptide coding region and a 3' non translated region (3 -UTR). mRNA has a limited halftime in cells and in vitro. Preferably, mRNA is produced by in vitro transcription using a DNA template. In one embodiment of the invention, the RNA is obtained by in vitro transcription or chemical synthesis. The in vitro transcription methodology is known to the skilled person. For example, there is a variety of in vitro transcription kits commercially available.
In order to increase expression and/or stability of the RNA used according to the present invention, it may be modified, preferably without altering the sequence of the expressed peptide or protein. The term "modification" in the context of RNA as used according to the present invention includes any modification of RNA which is not naturally present in said RNA.
In one embodiment of the invention, the RNA used according to the invention does not have uncapped 5 '-triphosphates. Removal of such uncapped 5'-triphosphates can be achieved by treating RNA with a phosphatase.
The RNA according to the invention may have modified naturally occurring or synthetic ribonucleotides in order to increase its stability and/or decrease cytotoxicity. For example, in one embodiment, in the RNA used according to the invention 5-methylcytidine is substituted partially or completely, preferably completely, for cytidine. Alternatively or additionally, in one embodiment, in the RNA used according to the invention pseudouridine is substituted partially or completely, preferably completely, for uridine.
In one embodiment, the term "modification" relates to providing an RNA with a 5 '-cap or 5 '-cap analog. The term "5'-cap" refers to a cap structure found on the 5'-end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via an unusual 5' to 5' triphosphate linkage. In one embodiment, this guanosine is methylated at the 7-position. The term "conventional 5 '-cap" refers to a naturally occurring RNA 5 '-cap, preferably to the 7- methylguanosine cap (m7G). In the context of the present invention, the term "5 '-cap" includes a 5 '-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA if attached thereto, preferably in vivo and/or in a cell.
Providing an RNA with a 5'-cap or 5'-cap analog may be achieved by in vitro transcription of a DNA template in the presence of said 5'-cap or 5'-cap analog, wherein said 5'-cap is co- transcriptionally incorporated into the generated RNA strand, or the RNA may be generated, for example, by in vitro transcription, and the 5 '-cap may be attached to the RNA post- transcriptionally using capping enzymes, for example, capping enzymes of vaccinia virus. The RNA may comprise further modifications. For example, a further modification of the RNA used in the present invention may be an extension or truncation of the naturally occurring poly(A) tail.
Preferably, RNA if delivered to, i.e. transfected into, a cell, in particular a cell present in vivo, expresses the protein, peptide or antigen it encodes.
The term "transfection" relates to the introduction of nucleic acids, in particular RNA, into a cell. For purposes of the present invention, the term "transfection" also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such cell, wherein the cell may be present in a subject, e.g., a patient.
The term "stability" of RNA relates to the "half-life" of RNA. "Half-life" relates to the period of time which is needed to eliminate half of the activity, amount, or number of molecules. In the context of the present invention, the half-life of an RNA is indicative for the stability of said RNA. The half-life of RNA may influence the "duration of expression" of the RNA. It can be expected that RNA having a long half-life will be expressed for an extended time period.
In the context of the present invention, the term "transcription" relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA may be translated into protein. According to the present invention, the term "transcription" comprises "in vitro transcription", wherein the term "in vitro transcription" relates to a process wherein RNA, in particular mRNA, is in vitro synthesized in a cell-free system, preferably using appropriate cell extracts. Preferably, cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are according to the present invention encompassed by the term "vector".
The term "translation" according to the invention relates to the process in the ribosomes of a cell by which a strand of messenger RNA directs the assembly of a sequence of amino acids to make a peptide or protein.
The term "expression" is used according to the invention in its most general meaning and comprises the production of RNA and/or peptides or proteins, e.g. by transcription and/or translation. With respect to RNA, the term "expression" or "translation" relates in particular to the production of peptides or proteins. It also comprises partial expression of nucleic acids. Moreover, expression can be transient or stable. According to the invention, the term expression also includes an "aberrant expression" or "abnormal expression".
"Aberrant expression" or "abnormal expression" means according to the invention that expression is altered, preferably increased, compared to a reference, e.g. a state in a subject not having a disease associated with aberrant or abnormal expression of a certain protein, e.g., a tumor antigen. An increase in expression refers to an increase by at least 10%, in particular at least 20%, at least 50% or at least 100%, or more. In one embodiment, expression is only found in a diseased tissue, while expression in a healthy tissue is repressed. The term "specifically expressed" means that a protein is essentially only expressed in a specific tissue or organ. For example, a tumor antigen specifically expressed in gastric mucosa means that said protein is primarily expressed in gastric mucosa and is not expressed in other tissues or is not expressed to a significant extent in other tissue or organ types. Thus, a protein that is exclusively expressed in cells of the gastric mucosa and to a significantly lesser extent in any other tissue, such as testis, is specifically expressed in cells of the gastric mucosa. In some embodiments, a tumor antigen may also be specifically expressed under normal conditions in more than one tissue type or organ, such as in 2 or 3 tissue types or organs, but preferably in not more than 3 different tissue or organ types. In this case, the tumor antigen is then specifically expressed in these organs. For example, if a tumor antigen is expressed under normal conditions preferably to an approximately equal extent in lung and stomach, said tumor antigen is specifically expressed in lung and stomach. According to the invention, the term "RNA encoding" means that RNA, if present in the appropriate environment, preferably within a cell, can be expressed to produce a protein or peptide it encodes.
The term "peptide" according to the invention comprises oligo- and polypeptides and refers to substances comprising two or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 9 or more, preferably 10 or more, preferably 13 or more, preferably 16 more, preferably 21 or more and up to preferably 8, 10, 20, 30, 40 or 50, in particular 100 amino acids joined covalently by peptide bonds. The term "protein" refers to large peptides, preferably to peptides with more than 100 amino acid residues, but in general the terms "peptides" and "proteins" are synonyms and are used interchangeably herein.
The teaching given herein with respect to specific amino acid sequences, e.g. those shown in the sequence listing, is to be construed so as to also relate to variants of said specific sequences resulting in sequences which are functionally equivalent to said specific sequences, e.g. amino acid sequences exhibiting properties identical or similar to those of the specific amino acid sequences. One important property is to retain binding to a target or to sustain effector functions. Preferably, a sequence which is a variant with respect to a specific sequence, when it replaces the specific sequence in an antibody retains binding of said antibody to CLDN and/or CD3 and preferably functions of said antibody as described herein, e.g. CDC mediated lysis or ADCC mediated lysis.
For example, the sequences shown in the sequence listing can be modified so as to remove one or more, preferably all free cysteine residues, in particular by replacing the cysteine residues by amino acids other than cysteine, preferably serine, alanine, threonine, glycine, tyrosine, leucine or methionine, most preferably alanine or serine. For example, the cysteine at position 103 of the sequence shown in SEQ ID NO: 36 of the sequence listing or the corresponding cysteine in a sequence comprising said sequence may be modified in this way. Further cysteines which can be modified this way are the cysteines at position 178 of SEQ ID NO: 42, at position 197 of SEQ ID NO: 43, at position 427 of SEQ ID NO: 44 or at position 446 of SEQ ID NO: 45.
It will be appreciated by those skilled in the art that in particular the sequences of the CDR, hypervariable and variable regions can be modified without losing the ability to bind CLDN and/or CD3. For example, CDR regions will be either identical or highly homologous to the regions of antibodies specified herein. By "highly homologous" it is contemplated that from 1 to 5, preferably from 1 to 4, such as 1 to 3 or 1 or 2 substitutions may be made in the CDRs. In addition, the hypervariable and variable regions may be modified so that they show substantial homology with the regions of antibodies specifically disclosed herein.
For the purposes of the present invention, "variants" of an amino acid sequence comprise amino acid insertion variants, amino acid addition variants, amino acid deletion variants and/or amino acid substitution variants. Amino acid deletion variants that comprise the deletion at the N- terminal and/or C-terminal end of the protein are also called N-terminal and/or C-terminal truncation variants.
Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insertion, one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible.
Amino acid addition variants comprise amino- and/or carboxy-terminal fusions of one or more amino acids, such as 1 , 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1 , 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein. Amino acid substitution variants are characterized by at least one residue in the sequence being removed and another residue being inserted in its place. Preference is given to the modifications being in positions in the amino acid sequence which are not conserved between homologous proteins or peptides and/or to replacing amino acids with other ones having similar properties. Preferably, amino acid changes in protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains. Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.
Preferably the degree of similarity, preferably identity between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of similarity or identity is given preferably for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is given preferably for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, preferably continuous amino acids. In preferred embodiments, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. The alignment for determining sequence similarity, preferably sequence identity can be done with art known tools, preferably using the best sequence alignment, for example, using Align, using standard settings, preferably EMBOSS ::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5. "Sequence similarity" indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. The term "percentage identity" is intended to denote a percentage of amino acid residues which are identical between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. Sequence comparisons between two amino acid sequences are conventionally carried out by comparing these sequences after having aligned them optimally, said comparison being carried out by segment or by "window of comparison" in order to identify and compare local regions of sequence similarity. The optimal alignment of the sequences for comparison may be produced, besides manually, by means of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, by means of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, by means of the similarity search method of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 85, 2444, or by means of computer programs which use these algorithms (GAP, BESTFIT, FAST A, BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.). The percentage identity is calculated by determining the number of identical positions between the two sequences being compared, dividing this number by the number of positions compared and multiplying the result obtained by 100 so as to obtain the percentage identity between these two sequences. The binding agents of the invention can be produced either intracellullarly (e.g. in the cytosol, in the periplasma or in inclusion bodies) and then isolated from the host cells and optionally further purified; or they can be produced extracellularly (e.g. in the medium in which the host cells are cultured) and then isolated from the culture medium and optionally further purified. Methods and reagents used for the recombinant production of polypeptides, such as specific suitable expression vectors, transformation or transfection methods, selection markers, methods of induction of protein expression, culture conditions, and the like, are known in the art. Similarly, protein isolation and purification techniques are well known to the skilled person. The term "cell" or "host cell" preferably relates to an intact cell, i.e. a cell with an intact membrane that has not released its normal intracellular components such as enzymes, organelles, or genetic material. An intact cell preferably is a viable cell, i.e. a living cell capable of carrying out its normal metabolic functions. Preferably said term relates according to the invention to any cell which can be transfected with an exogenous nucleic acid. The term "cell" includes bacterial cells; other useful cells are yeast cells, fungal cells or mammalian cells. Suitable bacterial cells include cells from gram-negative bacterial strains such as strains of Escherichia coli, Proteus, and Pseudomonas, and gram-positive bacterial strains such as strains of Bacillus, Streptomyces, Staphylococcus, and Lactococcus. Suitable fungal cell include cells from species of Trichoderma, Neurospora, and Aspergillus. Suitable yeast cells include cells from species of Saccharomyces (Tor example Saccharomyces cerevisiae), Schizosaccharomyces (for example Schizo saccharomyces pombe), Pichia (for example Pichia pastoris and Pichia methanolicd), and Hansenula. Suitable mammalian cells include for example CHO cells, BHK cells, HeLa cells, COS cells, 293 HEK and the like. However, amphibian cells, insect cells, plant cells, and any other cells used in the art for the expression of heterologous proteins can be used as well.
"Reduce", "decrease" or "inhibit" as used herein means an overall decrease or the ability to cause an overall decrease, preferably of 5% or greater, 10% or greater, 20% or greater, more preferably of 50% or greater, and most preferably of 75% or greater, in the level, e.g. in the level of expression or in the level of proliferation of cells.
Terms such as "increase" or "enhance" preferably relate to an increase or enhancement by about at least 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 80%», and most preferably at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000% or even more.
Antibody-dependent cell-mediated cytotoxicity
ADCC describes the cell-killing ability of effector cells as described herein, in particular lymphocytes, which preferably requires the target cell being marked by an antibody.
ADCC preferably occurs when antibodies bind to antigens on tumor cells and the antibody Fc domains engage Fc receptors (FcR) on the surface of immune effector cells. Several families of Fc receptors have been identified, and specific cell populations characteristically express defined Fc receptors. ADCC can be viewed as a mechanism to directly induce a variable degree of immediate tumor destruction that leads to antigen presentation and the induction of tumor- directed T-cell responses. Preferably, in vivo induction of ADCC will lead to tumor-directed T- cell responses and host-derived antibody responses. Complement-dependent cytotoxicity
CDC is another cell-killing method that can be directed by antibodies. IgM is the most effective isotype for complement activation. IgGl and IgG3 are also both very effective at directing CDC via the classical complement-activation pathway. Preferably, in this cascade, the formation of antigen-antibody complexes results in the uncloaking of multiple Clq binding sites in close proximity on the CH2 domains of participating antibody molecules such as IgG molecules (Clq is one of three subcomponents of complement CI). Preferably these uncloaked Clq binding sites convert the previously low-affinity Clq-IgG interaction to one of high avidity, which triggers a cascade of events involving a series of other complement proteins and leads to the proteolytic release of the effector-cell chemotactic/activating agents C3a and C5a. Preferably, the complement cascade ends in the formation of a membrane attack complex, which creates pores in the cell membrane that facilitate free passage of water and solutes into and out of the cell.
Antibodies described herein for e.g. providing VL and VH regions can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell hybridization procedures are preferred, in principle, other techniques for producing monoclonal antibodies can be employed, e.g., viral or oncogenic transformation of B- lymphocytes or phage display techniques using libraries of antibody genes. The preferred animal system for preparing hybridomas that secrete monoclonal antibodies is the murine system. Hybridoma production in the mouse is a very well established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.
Other preferred animal systems for preparing hybridomas that secrete monoclonal antibodies are the rat and the rabbit system (e.g. described in Spieker-Polet et al., Proc. Natl. Acad. Sci. U.S.A. 92:9348 (1995), see also Rossi et al., Am. J. Clin. Pathol. 124: 295 (2005)). In yet another preferred embodiment, human monoclonal antibodies can be generated using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system. These transgenic and transchromosomic mice include mice known as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice." The production of human antibodies in such transgenic mice can be performed as described in detail for CD20 in WO2004 035607
Yet another strategy for generating monoclonal antibodies is to directly isolate genes encoding antibodies from lymphocytes producing antibodies of defined specificity e.g. see Babcock et al., 1996; A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. For details of recombinant antibody engineering see also Welschof and Kraus, Recombinant antibodes for cancer therapy ISBN-0-89603-918-8 and Benny K.C. Lo Antibody Engineering ISBN 1-58829-092-1. To generate antibodies, mice can be immunized with carrier-conjugated peptides derived from the antigen sequence, i.e. the sequence against which the antibodies are to be directed, an enriched preparation of recombinantly expressed antigen or fragments thereof and/or cells expressing the antigen, as described. Alternatively, mice can be immunized with DNA encoding the antigen or fragments thereof. In the event that immunizations using a purified or enriched preparation of the antigen do not result in antibodies, mice can also be immunized with cells expressing the antigen, e.g., a cell line, to promote immune responses.
The immune response can be monitored over the course of the immunization protocol with plasma and serum samples being obtained by tail vein or retroorbital bleeds. Mice with sufficient titers of immunoglobulin can be used for fusions. Mice can be boosted intraperitonealy or intravenously with antigen expressing cells 3 days before sacrifice and removal of the spleen to increase the rate of specific antibody secreting hybridomas.
To generate hybridomas producing monoclonal antibodies, splenocytes and lymph node cells from immunized mice can be isolated and fused to an appropriate immortalized cell line, such as a mouse myeloma cell line. The resulting hybridomas can then be screened for the production of antigen-specific antibodies. Individual wells can then be screened by ELISA for antibody secreting hybridomas. By Immunofluorescence and FACS analysis using antigen expressing cells, antibodies with specificity for the antigen can be identified. The antibody secreting hybridomas can be replated, screened again, and if still positive for monoclonal antibodies can be subcloned by limiting dilution. The stable subclones can then be cultured in vitro to generate antibody in tissue culture medium for characterization. Antibodies also can be produced in a host cell transfectoma using, for example, a combination of recombinant DNA techniques and gene transfection methods as are well known in the art (Morrison, S. (1985) Science 229: 1202).
For example, in one embodiment, the gene(s) of interest, e.g., antibody genes, can be ligated into an expression vector such as a eukaryotic expression plasmid such as used by the GS gene expression system disclosed in WO 87/04462, WO 89/01036 and EP 338 841 or other expression systems well known in the art. The purified plasmid with the cloned antibody genes can be introduced in eukaryotic host cells such as CHO cells, NS/0 cells, HEK293T cells or HEK293 cells or alternatively other eukaryotic cells like plant derived cells, fungal or yeast cells. The method used to introduce these genes can be methods described in the art such as electroporation, lipofectine, lipofectamine or others. After introduction of these antibody genes in the host cells, cells expressing the antibody can be identified and selected. These cells represent the transfectomas which can then be amplified for their expression level and upscaled to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and/or cells.
Alternatively, the cloned antibody genes can be expressed in other expression systems, including prokaryotic cells, such as microorganisms, e.g. E. coli. Furthermore, the antibodies can be produced in transgenic non-human animals, such as in milk from sheep and rabbits or in eggs from hens, or in transgenic plants; see e.g. Verma, R., et al. (1998) J. Immunol. Meth. 216: 165- 181 ; Pollock, et al. (1999) J. Immunol. Meth. 231 : 147-157; and Fischer, R., et al. (1999) Biol. Chem. 380: 825-839.
Chimerization
Nonlabeled murine antibodies are highly immunogenic in man when repetitively applied leading to reduction of the therapeutic effect. The main immunogenicity is mediated by the heavy chain constant regions. The immunogenicity of murine antibodies in man can be reduced or completely avoided if respective antibodies are chimerized or humanized. Chimeric antibodies are antibodies, the different portions of which are derived from different animal species, such as those having a variable region derived from a murine antibody and a human immunoglobulin constant region. Chimerisation of antibodies is achieved by joining of the variable regions of the murine antibody heavy and light chain with the constant region of human heavy and light chain (e.g. as described by raus et al., in Methods in Molecular Biology series, Recombinant antibodies for cancer therapy ISBN-0-89603-918-8). In a preferred embodiment chimeric antibodies are generated by joining human kappa-light chain constant region to murine light chain variable region. In an also preferred embodiment chimeric antibodies can be generated by joining human lambda-light chain constant region to murine light chain variable region. The preferred heavy chain constant regions for generation of chimeric antibodies are IgGl, IgG3 and IgG4. Other preferred heavy chain constant regions for generation of chimeric antibodies are IgG2, IgA, IgD and IgM.
Humanization
Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody- antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al. (1998) Nature 332: 323-327; Jones, P. et al. (1986) Nature 321 : 522-525; and Queen, C. et al. (1989) Proc. Natl. Acad. Sci. U. S. A. 86: 10029-10033). Such framework sequences can be obtained from public DNA databases that include germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they will not include completely assembled variable genes, which are formed by V (D) J joining during B cell maturation. Germline gene sequences will also differ from the sequences of a high affinity secondary repertoire antibody at individual evenly across the variable region. The ability of antibodies and other binding agents to bind an antigen can be determined using standard binding assays (e.g., ELISA, Western Blot, Immunofluorescence and flow cytometric analysis). To purify antibodies, selected producer cell lines can be grown in two-liter spinner-flasks for recombinant antibody purification. Alternatively, antibodies can be produced in dialysis based bioreactors. Supematants can be filtered and, if necessary, concentrated before affinity chromatography with protein L-sepharose. Eluted IgG can be checked by gel electrophoresis and high performance liquid chromatography to ensure purity. The buffer solution can be exchanged into PBS, and the concentration can be determined by OD280 using the respective extinction coefficient. The recombinant antibodies can be aliquoted and stored at -80°C.
In order to demonstrate binding of monoclonal antibodies to living cells expressing antigen, flow cytometry can be used. Cell lines expressing naturally or after transfection antigen and negative controls lacking antigen expression (grown under standard growth conditions) can be mixed with various concentrations of monoclonal antibodies in hybridoma supematants or in PBS containing 1% FBS, and can be incubated at 4°C for 30 min. After washing, the APC- or Alexa647-labeled anti IgG antibody can bind to antigen-bound monoclonal antibody under the same conditions as the primary antibody staining. The samples can be analyzed by flow cytometry with a FACS instrument using light and side scatter properties to gate on single, living cells. In order to distinguish antigen-specific monoclonal antibodies from non-specific binders in a single measurement, the method of co-transfection can be employed. Cells transiently transfected with plasmids encoding antigen and a fluorescent marker can be stained as described above. Transfected cells can be detected in a different fluorescence channel than antibody-stained cells. As the majority of transfected cells express both transgenes, antigen-specific monoclonal antibodies bind preferentially to fluorescence marker expressing cells, whereas non-specific antibodies bind in a comparable ratio to non-transfected cells. An alternative assay using fluorescence microscopy may be used in addition to or instead of the flow cytometry assay. Cells can be stained exactly as described above and examined by fluorescence microscopy.
In order to demonstrate binding of monoclonal antibodies to living cells expressing antigen, immunofluorescence microscopy analysis can be used. For example, cell lines expressing either spontaneously or after transfection antigen and negative controls lacking antigen expression are grown in chamber slides under standard growth conditions in DMEM/F12 medium, supplemented with 10 % fetal calf serum (FCS), 2 mM L-glutamine, 100 IU/ml penicillin and 100 μg ml streptomycin. Cells can then be fixed with methanol or paraformaldehyde or left untreated. Cells can then be reacted with monoclonal antibodies against the antigen for 30 min. at 25°C. After washing, cells can be reacted with an Alexa555-labelled anti-mouse IgG secondary antibody (Molecular Probes) under the same conditions. Cells can then be examined by fluorescence microscopy.
Cell extracts from cells expressing antigen and appropriate negative controls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens will be transferred to nitrocellulose membranes, blocked, and probed with the monoclonal antibodies to be tested. IgG binding can be detected using anti- mouse IgG peroxidase and developed with ECL substrate. Antibodies can be further tested for reactivity with antigen by Immunohistochemistry in a manner well known to the skilled person, e.g. using paraformaldehyde or acetone fixed cryosections or paraffin embedded tissue sections fixed with paraformaldehyde from non-cancer tissue or cancer tissue samples obtained from patients during routine surgical procedures or from mice carrying xenografted tumors inoculated with cell lines expressing spontaneously or after transfection antigen. For immunostaining, antibodies reactive to antigen can be incubated followed by horseradish-peroxidase conjugated goat anti-mouse or goat anti-rabbit antibodies (DAKO) according to the vendors instructions.
Preclinical studies
Binding agents described herein also can be tested in an in vivo model (e.g. in immune deficient mice carrying xenografted tumors inoculated with cell lines expressing CLDN to determine their efficacy in controlling growth of CLDN-expressing tumor cells.
In vivo studies after xenografting CLDN-expressing tumor cells into immunocompromised mice or other animals can be performed using binding agents described herein. Binding agents can be administered to tumor free mice followed by injection of tumor cells to measure the effects of the binding agents to prevent formation of tumors or tumor-related symptoms. Binding agents can be administered to tumor-bearing mice to determine the therapeutic efficacy of respective binding agents to reduce tumor growth, metastasis or tumor related symptoms. Application of binding agents can be combined with application of other substances as cystostatic drugs, growth factor inhibitors, cell cycle blockers, angiogenesis inhibitors or antibodies to determine synergistic efficacy and potential toxicity of combinations. To analyze toxic side effects mediated by binding agents animals can be inoculated with binding agents or control reagents and thoroughly investigated for symptoms possibly related to CLDN-binding agent therapy. Mapping of epitopes recognized by binding agents can be performed as described in detail in "Epitope Mapping Protocols (Methods in Molecular Biology) by Glenn E. Morris ISBN-089603- 375-9 and in "Epitope Mapping: A Practical Approach" Practical Approach Series, 248 by Olwyn M. R. Wesrwood, Frank C. Hay.
The compounds and agents described herein may be administered in the form of any suitable pharmaceutical composition. The pharmaceutical compositions of the invention are preferably sterile and contain an effective amount of the binding agents described herein and optionally of further agents as discussed herein to generate the desired reaction or the desired effect.
Pharmaceutical compositions are usually provided in a uniform dosage form and may be prepared in a manner known per se. A pharmaceutical composition may e.g. be in the form of a solution or suspension.
A pharmaceutical composition may comprise salts, buffer substances, preservatives, carriers, diluents and/or excipients all of which are preferably pharmaceutically acceptable. The term "pharmaceutically acceptable" refers to the non-toxicity of a material which does not interact with the action of the active component of the pharmaceutical composition.
Salts which are not pharmaceutically acceptable may be used for preparing pharmaceutically acceptable salts and are included in the invention. Pharmaceutically acceptable salts of this kind comprise in a non limiting way those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic acids, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts or calcium salts. Suitable buffer substances for use in a pharmaceutical composition include acetic acid in a salt, citric acid in a salt, boric acid in a salt and phosphoric acid in a salt.
Suitable preservatives for use in a pharmaceutical composition include benzalkonium chloride, chlorobutanol, paraben and thimerosal. An injectible formulation may comprise a pharmaceutically acceptable excipient such as Ringer Lactate. The term "carrier" refers to an organic or inorganic component, of a natural or synthetic nature, in which the active component is combined in order to facilitate, enhance or enable application. According to the invention, the term "carrier" also includes one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for administration to a patient.
Possible carrier substances for parenteral administration are e.g. sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide/glycolide copolymers or polyoxyethylene/polyoxy- propylene copolymers.
The term "excipient" when used herein is intended to indicate all substances which may be present in a pharmaceutical composition and which are not active ingredients such as, e.g., carriers, binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, or colorants.
The agents and compositions described herein may be administered via any conventional route, such as by parenteral administration including by injection or infusion. Administration is preferably parenterally, e.g. intravenously, intraarterially, subcutaneously, intradermally or intramuscularly.
Compositions suitable for parenteral administration usually comprise a sterile aqueous or nonaqueous preparation of the active compound, which is preferably isotonic to the blood of the recipient. Examples of compatible carriers and solvents are Ringer solution and isotonic sodium chloride solution. In addition, usually sterile, fixed oils are used as solution or suspension medium.
The agents and compositions described herein are administered in effective amounts. An "effective amount" refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In the case of treatment of a particular disease or of a particular condition, the desired reaction preferably relates to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease or of a condition may also be delay of the onset or a prevention of the onset of said disease or said condition.
An effective amount of an agent or composition described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration and similar factors. Accordingly, the doses administered of the agents described herein may depend on various of such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used. The agents and compositions described herein can be administered to patients, e.g., in vivo, to treat or prevent a variety of disorders such as those described herein. Preferred patients include human patients having disorders that can be corrected or ameliorated by administering the agents and compositions described herein. This includes disorders involving cells characterized by an altered expression pattern of CLDN such as CLDN18.2 and/or CLDN6.
For example, in one embodiment, agents described herein can be used to treat a patient with a cancer disease, e.g., a cancer disease such as described herein characterized by the presence of cancer cells expressing CLDN. The pharmaceutical compositions and methods of treatment described according to the invention may also be used for immunization or vaccination to prevent a disease described herein.
The pharmaceutical composition of the invention may be administered together with supplementing immunity-enhancing substances such as one or more adjuvants and may comprise one or more immunity-enhancing substances to further increase its effectiveness, preferably to achieve a synergistic effect of immunostimulation. The term "adjuvant" relates to compounds which prolongs or enhances or accelerates an immune response. Various mechanisms are possible in this respect, depending on the various types of adjuvants. For example, compounds which allow the maturation of the DC, e.g. lipopolysaccharides or CD40 ligand, form a first class of suitable adjuvants. Generally, any agent which influences the immune system of the type of a "danger signal" (LPS, GP96, dsRNA etc.) or cytokines, such as GM-CSF, can be used as an adjuvant which enables an immune response to be intensified and/or influenced in a controlled manner. CpG oligodeoxynucleotides can optionally also be used in this context, although their side effects which occur under certain circumstances, as explained above, are to be considered. Particularly preferred adjuvants are cytokines, such as monokines, lymphokines, interleukins or chemokines, e.g. IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INFa, INF-γ, GM-CSF, LT-a, or growth factors, e.g. hGH. Further known adjuvants are aluminium hydroxide, Freund's adjuvant or oil such as Montanide®, most preferred Montanide® IS A51. Lipopeptides, such as Pam3Cys, are also suitable for use as adjuvants in the pharmaceutical composition of the present invention.
The agents and compositions provided herein may be used alone or in combination with conventional therapeutic regimens such as surgery, irradiation, chemotherapy and/or bone marrow transplantation (autologous, syngeneic, allogeneic or unrelated).
Treatment of cancer represents a field where combination strategies are especially desirable since frequently the combined action of two, three, four or even more cancer drugs/therapies generates synergistic effects which are considerably stronger than the impact of a monotherapeutic approach. Thus, in another embodiment of the present invention, a cancer treatment which utilizes immune- or vaccination-based mechanisms such as the methods and pharmaceutical compositions of the present invention may be effectively combined with various other drugs and/or methods targeting similar or other specific mechanisms. Among those are e.g. combinations with conventional tumor therapies, multi-epitope strategies, additional immunotherapy, and treatment approaches targeting angiogenesis or apoptosis (for review see e.g. Andersen et al. 2008: Cancer treatment: the combination of vaccination with other therapies. Cancer Immunology Immunotherapy, 57(1 1): 1735-1743.) Sequential administration of different agents may inhibit cancer cell growth at different check points, while other agents may e.g. inhibit neo-angiogenesis, survival of malignant cells or metastases, potentially converting cancer into a chronic disease. The following list provides some non-limiting examples of anti-cancer drugs and therapies which can be used in combination with the present invention: 1. Chemotherapy
Chemotherapy is the standard of care for multiple types of cancer. The most common chemotherapy agents act by killing cells that divide rapidly, one of the main properties of cancer cells. Thus, a combination with conventional chemotherapeutic drugs such as e.g. alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents which either affect cell division or DNA synthesis may significantly improve the therapeutic effects of the present invention by clearing suppressor cells, reboot of the immune system, by rendering tumor cells more susceptible to immune mediated killing, or by additional activation of cells of the immune system. A synergistic anti-cancer action of chemotherapeutic and vaccination-based immunotherapeutic drugs has been demonstrated in multiple studies (see e.g. Quoix et al. 201 1 : Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial. Lancet Oncol. 12(12): 1 125-33.; see also Liseth et al. 2010: Combination of intensive chemotherapy and anticancer vaccines in the treatment of human malignancies: the hematological experience. J Biomed Biotechnol. 2010: 6920979; see also Hirooka et al 2009: A combination therapy of gemcitabine with immunotherapy for patients with inoperable locally advanced pancreatic cancer. Pancreas 38(3): e69-74). There are hundreds of chemotherapeutic drugs available which are basically suitable for combination therapies. Some (non-limiting) examples of chemotherapeutic drugs which can be combined with the present invention are carboplatin (Paraplatin), cisplatin (Platinol, Platinol-AQ), cyclophosphamide (Cytoxan, Neosar), docetaxel (Taxotere), doxorubicin (Adriamycin), erlotinib (Tarceva), etoposide (VePesid), fluorouracil (5- FU), gemcitabine (Gemzar), imatinib mesylate (Gleevec), irinotecan (Camptosar), methotrexate (Folex, Mexate, Amethopterin), paclitaxel (Taxol, Abraxane), sorafinib (Nexavar), sunitinib (Sutent), topotecan (Hycamtin), vincristine (Oncovin, Vincasar PFS), and vinblastine (Velban).
2. Surgery
Cancer surgery - an operation to remove the tumor - remains the foundation of cancer treatment. Surgery can be combined with other cancer treatments in order to delete any remaining tumor cells. Combining surgical methods with subsequent immunotherapeutic treatment is a promising approach which has been demonstrated countless times.
3. Radiation
Radiation therapy remains an important component of cancer treatment with approximately 50% of all cancer patients receiving radiation therapy during their course of illness. The main goal of radiation therapy is to deprive cancer cells of their multiplication (cell division) potential. The types of radiation used to treat cancer are photons radiation (x-rays and gamma rays) and particle radiations (electron, proton and neutron beams.) There are two ways to deliver the radiation to the location of the cancer. External beam radiation is delivered from outside the body by aiming high-energy rays (photons, protons or particle radiation) to the location of the tumor. Internal radiation or brachytherapy is delivered from inside the body by radioactive sources, sealed in catheters or seeds directly into the tumor site. Radiation therapy techniques which are applicable in combination with the present invention are e.g. fractionation (radiation therapy delivered in a fractionated regime, e.g. daily fractions of 1.5 to 3 Gy given over several weeks), 3D conformal radiotherapy (3DCRT; delivering radiation to the gross tumor volume), intensity modulated radiation therapy (IMRT; computer-controlled intensity modulation of multiple radiation beams), image guided radiotherapy (IGRT; a technique comprising pre-radiotherapy imaging which allows for correction), and stereotactic body radiation therapy (SRBT, delivers very high individual doses of radiation over only a few treatment fractions). For a radiation therapy review see Baskar et al. 2012: Cancer and radiation therapy: current advances and future directions. Int. J Med Sci. 9(3): 193-199.
4. Antibodies
Antibodies (preferably monoclonal antibodies) achieve their therapeutic effect against cancer cells through various mechanisms. They can have direct effects in producing apoptosis or programmed cell death. They can block components of signal transduction pathways such as e.g. growth factor receptors, effectively arresting proliferation of tumor cells. In cells that express monoclonal antibodies, they can bring about anti-idiotype antibody formation. Indirect effects include recruiting cells that have cytotoxicity, such as monocytes and macrophages. This type of antibody-mediated cell kill is called antibody-dependent cell mediated cytotoxicity (ADCC). Antibodies also bind complement, leading to direct cell toxicity, known as complement dependent cytotoxicity (CDC). Combining surgical methods with immunotherapeutic drugs or methods is an successful approach, as e.g. demonstrated in Gadri et al. 2009: Synergistic effect of dendritic cell vaccination and anti-CD20 antibody treatment in the therapy of murine lymphoma. J Immunother. 32(4): 333-40. The following list provides some non-limiting examples of anti-cancer antibodies and potential antibody targets (in brackets) which can be used in combination with the present invention: Abagovomab (CA-125), Abciximab (CD41), Adecatumumab (EpCAM), Afutuzumab (CD20), Alacizumab pegol (VEGFR2), Altumomab pentetate (CEA), Amatuximab (MORAb-009), Anatumomab mafenatox (TAG-72), Apolizumab (HLA-DR), Arcitumomab (CEA), Bavituximab (phosphatidylserine), Bectumomab (CD22), Belimumab (BAFF), Bevacizumab (VEGF-A), Bivatuzumab mertansine (CD44 v6), Blinatumomab (CD19), Brentuximab vedotin (CD30 TNFRSF8), Cantuzumab mertansin (mucin CanAg), Cantuzumab ravtansine (MUC1), Capromab pendetide (prostatic carcinoma cells), Carlumab (CNT0888), Catumaxomab (EpCAM, CD3), Cetuximab (EGFR), Citatuzumab bogatox (EpCAM), Cixutumumab (IGF-1 receptor), Claudiximab (Claudin), Clivatuzumab tetraxetan (MUC1), Conatumumab (TRAIL-R2), Dacetuzumab (CD40), Dalotuzumab (insulinlike growth factor I receptor), Denosumab (RANKL), Detumomab (B-lymphoma cell), Drozitumab (DR5), Ecromeximab (GD3 ganglioside), Edrecolomab (EpCAM), Elotuzumab (SLAMF7), Enavaruzumab (PDL192), Ensituximab (NPC-1C), Epratuzumab (CD22), Ertumaxomab (HER2/neu, CD3), Etaracizumab (integrin ανβ3), Farletuzumab (folate receptor 1), FBTA05 (CD20), Ficlatuzumab (SCH 900105), Figitumumab (IGF-1 receptor), Flanvorumab (glycoprotein 75), Fresolimumab (TGF-β), Galiximab (CD80), Ganitumab (IGF-I), Gemtuzumab ozogamicin (CD33), Gevokizumab (IL-Ι β), Girentuximab (carbonic anhydrase 9 (CA-IX)), Glembatumumab vedotin (GPNMB), Ibritumomab tiuxetan (CD20), Icrucumab (VEGFR-1), Igovoma (CA-125), Indatuximab ravtansine (SDC1), Intetumumab (CD51), Inotuzumab ozogamicin (CD22), Ipilimumab (CD 152), Iratumumab (CD30), Labetuzumab (CEA), Lexatumumab (TRAIL-R2), Libivirumab (hepatitis B surface antigen), Lintuzumab (CD33), Lorvotuzumab mertansine (CD56), Lucatumumab (CD40), Lumiliximab (CD23), Mapatumumab (TRAIL-R1), Matuzumab (EGFR), Mepolizumab (IL-5), Milatuzumab (CD74), Mitumomab (GD3 ganglioside), Mogamulizumab (CCR4), Moxetumomab pasudotox (CD22), Nacolomab tafenatox (C242 antigen), Naptumomab estafenatox (5T4), Narnatumab (RON), Necitumumab (EGFR), Nimotuzumab (EGFR), Nivolumab (IgG4), Ofatumumab (CD20), Olaratumab (PDGF- R a), Onartuzumab (human scatter factor receptor kinase), Oportuzumab monatox (EpCAM), Oregovomab (CA-125), Oxelumab (OX-40), Panitumumab (EGFR), Patritumab (HER3), Pemtumoma (MUC1), Pertuzumab (HER2/neu), Pintumomab (adenocarcinoma antigen), Pritumumab (vimentin), Racotumomab (N-glycolylneuraminic acid), Radretumab (fibronectin extra domain-B), Rafivirumab (rabies virus glycoprotein), Ramucirumab (VEGFR2), Rilotumumab (HGF), Rituximab (CD20), Robatumumab (IGF-1 receptor), Samalizumab (CD200), Sibrotuzumab (FAP), Siltuximab (IL-6), Tabalumab (BAFF), Tacatuzumab tetraxetan (alpha- fetoprotein), Taplitumomab paptox (CD 19), Tenatumomab (tenascin C), Teprotumumab (CD221), Ticilimumab (CTLA-4), Tigatuzumab (TRAIL-R2), TNX-650 (IL-13), Tositumomab (CD20), Trastuzumab (HER2/neu), TRBS07 (GD2), Tremelimumab (CTLA-4), Tucotuzumab celmoleukin (EpCAM), Ublituximab (MS4A1), Urelumab (4- I BB), Volociximab (integrin α5β1), Votumumab (tumor antigen CTAA16.88), Zalutumumab (EGFR), Zanolimumab (CD4).
5. Cytokines, chemokines, costimulatory molecules, fusion proteins
Combined usage of the antigen-coding pharmaceutical compositions of the present invention with cytokines, chemokines, costimulatory molecules and/or fusion proteins thereof to evoke beneficial immune modulation or tumor inhibition effects is another embodiment of the present invention. In order to increase the infiltration of immune cells into the tumor and facilitate the movement of antigen-presenting cells to tumor-draining lymph nodes, various chemokines with C, CC, CXC and CX3C structures might be used. Some of the most promising chemokines are e.g CCR7 and its ligands CCL19 and CCL21, furthermore CCL2, CCL3, CCL5, and CCL16. Other examples are CXCR4, CXCR7 and CXCL12. Furthermore, costimulatory or regulatory molecules such as e.g. B7 ligands (B7.1 and B7.2) are useful. Also useful are other cytokines such as e.g. interleukins especially (e.g. IL-1 to IL17), interferons (e.g. IFNalphal to IFNalpha8, IFNalphalO, IFNalphal3, IFNalphal4, IFNalphal6, IFNalphal7, IFNalpha21, IFNbetal, IFNW, IFNE1 and IFNK), hematopoietic factors, TGFs (e.g. TGF-a, TGF-β, and other members of the TGF family), finally members of the rumor necrosis factor family of receptors and their ligands as well as other stimulatory molecules, comprising but not limited to 4- IBB, 4-1BB-L, CD 137, CD137L, CTLA-4GITR, GITRL, Fas, Fas-L, TNFR1 , TRAIL-R1 , TRAIL-R2, p75NGF-R, DR6, LT.beta.R, RANK, EDAR1 , XEDAR, Fnl 14, Troy/Trade, TAJ, TNFRII, HVEM, CD27, CD30, CD40, 4-1 BB, OX40, GITR, GITRL, TACI, BAFF-R, BCMA, RELT, and CD95 (Fas/APO-1), glucocorticoid-induced TNFR-related protein, TNF receptor-related apoptosis- mediating protein (TRAMP) and death receptor-6 (DR6). Especially CD40/CD40L and OX40/OX40L are important targets for combined immunotherapy because of their direct impact on T cell survival and proliferation. For a review see Lechner et al. 201 1 : Chemokines, costimulatory molecules and fusion proteins for the immunotherapy of solid tumors. Immunotherapy 3 ( 1 1 ), 1317- 1340.
6. Bacterial treatments
Researchers have been using anaerobic bacteria, such as Clostridium novyi, to consume the interior of oxygen-poor tumours. These should then die when they come in contact with the tumour's oxygenated sides, meaning they would be harmless to the rest of the body. Another strategy is to use anaerobic bacteria that have been transformed with an enzyme that can convert a non-toxic prodrug into a toxic drug. With the proliferation of the bacteria in the necrotic and hypoxic areas of the tumour, the enzyme is expressed solely in the tumour. Thus, a systemically applied prodrug is metabolised to the toxic drug only in the tumour. This has been demonstrated to be effective with the nonpathogenic anaerobe Clostridium sporogenes. 7. Kinase inhibitors
Another large group of potential targets for complementary cancer therapy comprises kinase inhibitors, because the growth and survival of cancer cells is closely interlocked with the deregulation of kinase activity. To restore normal kinase activity and therefor reduce tumor growth a broad range of inhibitors is in used. The group of targeted kinases comprises receptor tyrosine kinases e.g. BCR-ABL, B-Raf, EGFR, HER-2/ErbB2, IGF-IR, PDGFR-a, PDGFR-β, c- Kit, Flt-4, Flt3, FGFR1, FGFR3, FGFR4, CSF1R, c-Met, RON, c-Ret, ALK, cytoplasmic tyrosine kinases e.g. c-SRC, c-YES, Abl, JAK-2, serine/threonine kinases e.g. ATM, Aurora A & B, CDKs, mTOR, PKCi, PLKs, b-Raf, S6K, STK1 1/LKB1 and lipid kinases e.g. PI3K, SKI . Small molecule kinase inhibitors are e.g. PHA-739358, Nilotinib, Dasatinib, and PD166326, NSC 74341 1 , Lapatinib (GW-572016), Canertinib (CI-1033), Semaxinib (SU5416), Vatalanib (PTK787/ZK222584), Sutent (SU11248), Sorafenib (BAY 43-9006) and Leflunomide (SU101). For more information see e.g. Zhang et al. 2009: Targeting cancer with small molecule kinase inhibitors. Nature Reviews Cancer 9, 28-39. 8. Toll-like receptors
The members of the Toll-like receptor (TLRs) family are an important link between innate and adaptive immunity and the effect of many adjuvants rely on the activation of TLRs. A large number of established vaccines against cancer incorporate ligands for TLRs for boosting vaccine responses. Besides TLR2, TLR3, TLR4 especially TLR7 and TLR 8 have been examined for cancer therapy in passive immunotherapy approaches. The closely related TLR7 and TLR8 contribute to antitumor responses by affecting immune cells, tumor cells, and the tumor microenvironment and may be activated by nucleoside analogue structures. All TLR's have been used as stand-alone immunotherapeutics or cancer vaccine adjuvants and may be synergistically combined with the formulations and methods of the present invention. For more information see van Duin et al. 2005: Triggering TLR signaling in vaccination. Trends in Immunology, 27(1):49- 55. 9. Angiogenesis inhibitors
In addition to therapies which target immune modulatory receptors affected by tumor-mediated escape mechanisms and immune suppression there are therapies which target the tumor environment. Angiogenesis inhibitors prevent the extensive growth of blood vessels (angiogenesis) that tumors require to survive. The angiogenesis promoted by tumor cells to meet their increasing nutrient and oxygen demands for example can be blocked by targeting different molecules. Non-limiting examples of angiogenesis-mediating molecules or angiogenesis inhibitors which may be combined with the present invention are soluble VEGF (VEGF isoforms VEGF121 and VEGF 165, receptors VEGFR1, VEGFR2 and co-receptors Neuropilin-1 and Neuropilin-2) 1 and NRP-1, angiopoietin 2, TSP-1 and TSP-2, angiostatin and related molecules, endostatin, vasostatin, calreticulin, platelet factor-4, TIMP and CDAI, Meth-1 and Meth-2, IFN- α, -β and -γ, CXCL10, IL-4, -12 and -18, prothrombin (kringle domain-2), antithrombin III fragment, prolactin, VEGI, SPARC, osteopontin, maspin, canstatin, proliferin-related protein, restin and drugs like e.g. bevacizumab, itraconazole, carboxyamidotriazole, TNP-470, CM101 , IFN-a„ platelet factor-4, suramin, SU5416, thrombospondin, VEGFR antagonists, angiostatic steroids + heparin, cartilage-derived angiogenesis Inhibitory factor, matrix metalloproteinase inhibitors, 2-methoxyestradiol, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, prolactina νβ3 inhibitors, linomide, tasquinimod, For review see Schoenfeld and Dranoff 201 1 : Anti-angiogenesis immunotherapy. Hum Vaccin. (9):976-81.
10. Small molecule targeted therapy drugs
Small molecule targeted therapy drugs are generally inhibitors of enzymatic domains on mutated, overexpressed, or otherwise critical proteins within the cancer cell. Prominent and non- limiting examples are the tyrosine kinase inhibitors imatinib (Gleevec/Glivec) and gefitinib (Iressa). The use of small molecules e.g. sunitinib malate and/or sorafenib tosylate targeting some kinases in combination with vaccines for cancer therapy is also described in previous patent application US2009004213.
1 1. Virus-based vaccines
There are a number of virus-based cancer vaccines available or under development which can be used in a combined therapeutic approach together with the formulations of the present invention. One advantage of the use of such viral vectors is their intrinsic ability to initiate immune responses, with inflammatory reactions occurring as a result of the viral infection creating the danger signal necessary for immune activation. An ideal viral vector should be safe and should not introduce an anti-vector immune response to allow for boosting antitumour specific responses. Recombinant viruses such as vaccinia viruses, herpes simplex viruses, adenoviruses, adeno-associated viruses, retroviruses and avipox viruses have been used in animal tumour models and based on their encouraging results, human clinical trials have been initiated. Especially important virus-based vaccines are virus-like particles (VLPs), small particles that contain certain proteins from the outer coat of a virus. Virus-like particles do not contain any genetic material from the virus and cannot cause an infection but they can be constructed to present tumor antigens on their coat. VLPs can be derived from various viruses such as e.g. the hepatitis B virus or other virus families including Parvoviridae (e.g. adeno-associated virus), Retroviridae (e.g. HIV), and Flaviviridae (e.g. Hepatitis C virus). For a general review see Sorensen and Thompsen 2007: Virus-based immunotherapy of cancer: what do we know and where are we going? APMIS 1 15(1 1): 1 177-93; virus-like particles against cancer are reviewed in Buonaguro et al. 201 1 : Developments in virus-like particle-based vaccines for infectious diseases and cancer. Expert Rev Vaccines 10(11): 1569-83; and in Guillen et al. 2010: Virus-like particles as vaccine antigens and adjuvants: application to chronic disease, cancer immunotherapy and infectious disease preventive strategies. Procedia in Vaccinology 2 (2), 128-133.
12. Multi-epitope strategies
The use of multi epitopes shows promising results for vaccination. Fast sequencing technologies combined with intelligent algorithms systems allow the exploitation of the tumor mutanome and may provide multi epitopes for individualized vaccines which can be combined with the present invention. For more information see 2007: Vaccination of metastatic colorectal cancer patients with matured dendritic cells loaded with multiple major histocompatibility complex class I peptides. J Immunother 30: 762-772; furthermore Castle et al. 2012: Exploiting the mutanome for tumor vaccination. Cancer Res 72 (5): 1081-91.
13. Adoptive T cell transfer
For example, a combination of a tumor antigen vaccination and T cell transfer is described in: Rapoport et al. 201 1 : Combination immunotherapy using adoptive T-cell transfer and tumor antigen vaccination on the basis of hTERT and survivin after ASCT for myeloma. Blood 1 17(3):788-97. 14. Peptide-based target therapies
Peptides can bind to cell surface receptors or affected extracellular matrix surrounding the tumor. Radionuclides which are attached to these peptides (e.g. RGDs) eventually kill the cancer cell if the nuclide decays in the vicinity of the cell. Especially oligo- or multimers of these binding motifs are of great interest, since this can lead to enhanced tumor specificity and avidity. For non-limiting examples see Yamada 201 1 : Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant glioma. Nihon Rinsho 69(9): 1657-61.
15. Other therapies
There are numerous other cancer therapies which can be combined with the formulations and methods of the present invention in order to create synergistic effects. Non-limiting examples are treatments targeting apoptosis, hyperthermia, hormonal therapy, telomerase therapy, insulin potentiation therapy, gene therapy and photodynamic therapy. The present invention is further illustrated by the following examples which are not be construed as limiting the scope of the invention.
EXAMPLES
Example 1: Generation and testing of bispecific binding agents targeting CLDN18.2 and CP3 a. Sequence origin, design ofbi-scFv constructs, and clonig into expression vectors
Bispecific tandem single chain antibody constructs (bi-scFv) containing binding domains specific for the human T cell receptor component CD3 and human tumor associated antigens (TAA) were prepared. The corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) for each construct were specifically arranged from N- to C-terminus in consecutive order:
N . vH aCLDN182 - vL aCLDN182 - VH aCD3 - VL aCD3-C {IBiMAB, 18PHU5, no.11-15) N - VH aCD3 - VL aCD3 - vH aCLDN'8 2 - VL aCLDN18 2-C (18PHU3, no.16-20)
Table 1 summarizes all bi-scFv constructs specific for the TAA CLDN18.2 and PLAC1 that were generated in the course of the invention. The bi-scFv constructs were generated by gene synthesis by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimizations such as Homo sapiens (HS), Mus musculus (MM), or Chinese Hamster Ovary (CHO) were implemented by GeneArt's GeneOptimizer® software, and are listed in Table 1. Information on specificity, sequence origin from monoclonal antibodies (mAB), codon usage, additional sequence features and references of all applied domains are summarized in Table 2. Variable domain sequence origin of the respective CD3 antibodies are listed in Table 2. Due to the high homology of human and mouse TAAs, the same anti-TAA VH and VL sequences could be used for the generation of bi-scFv constructs for mouse assays, but in combination with the VH, VL sequences of the mouse specific anti-CD3 antibody clone 145-2C1 1.
DNA cloning and expression vector construction was carried out according to standard procedures (Green/Sambrook, Molecular Cloning, 2012) well known by the skilled person. Briefly, the leadoff bi-scFv DNA sequences were provided with a 5 ' H/'ndlll and a 3' Xhol restriction site (Hwdlll and Xbal in case of bi-scFv I BiMAB) for cloning into expression plasmids. A secretion signal sequence was introduced at the 5' end upstream of the bi-scFv sequence for protein secretion from cellular cytoplasm into the culture medium. A sequence coding for a 15 to 18 amino acid flexible glycine-serine peptide linker was inserted to join the VH and VL domains for the composition of the single chain variable antibody fragments (scFv) of which one binds to CD3 and the other to the TAA. To form a bispecific single chain antibody, the two scFv domain sequences were connected by a sequence coding for a short peptide linker (GGGGS). Together with this linker sequence a BamHl restriction site was introduced for scFv domain exchanges for the cloning of upcoming bi-scFV constructs. In-depth, 5 'scFv-domains could be exchanged by HmdIII and BamHl restriction and 3 'scFv-domains by BamHl and Xhol restriction. For construct schemata see also Fig. 1.
All used bi-scFv antibody constructs were cloned into the standard mammalian expression vector pcDNA™3.1/myc-His (+) (Invitrogen/Life Technologies GmbH, Darmstadt, Germany). The C- terminal 6xHis-tag served for metal affinity purification of the protein and for detection analysis. All constructs were verified by sequencing via MWG's single read sequence service (Euro fins MWG Operon, Ebersberg, Germany). Table 1 : Summary of TAA and CD3 specific bispecific single chain antibody constructs
Internal name TAA Specificity 5'-VH-VL 3'-VH-VL Codon usage
1 ΒΪΜΑΒ CLDN18.2 human mCLDN18.2ab TR66 HS
no.11 CLDN18.2 murine mCLDN18.2ab 145-2C11 CHO
no.12 CLDN18.2 human mCLDN18.2ab UCHT1-HU CHO
no.13 CLDN18.2 human mCLDN18.2ab UCHT1 CHO
no.14 CLDN18.2 human mCLDN18.2ab CLB-T3 CHO
no.15 CLDN18.2 human mCLDN18.2ab TR66 CHO
no.16 CLDN18.2 murine 145-2C11 mCLDN18.2ab CHO
no.17 CLDN18.2 human UCHT1-HU mCLDN18.2ab CHO
no.18 CLDN18.2 human UCHT1 mCLDN18.2ab CHO
no.19 CLDN18.2 human CLB-T3 mCLDN18.2ab CHO
no.20 CLDN18.2 human TR66 mCLDN18.2ab CHO
18PHU5 CLDN18.2 human mCLDN18.2ab TR66 HS
18PHU3 CLDN18.2 human TR66 mCLDN18.2ab HS
18PMU5 CLDN18.2 murine mCLDN18.2ab 145-2C11 MM
18PMU3 CLDN18.2 murine 145-2C11 mCLDN18.2ab MM
control bi-scFv
no.35 PLAC1 human 78H11 TR66 CHO
CHO, Chinese Hamster Ovary; HS, Homo sapiens; HU, humanized; MM, Mus
Table 2: Summary of bi-scFv construct information
CD3 binding moiety TAA binding moiety
Internal mAB origin Species TAA mAB origin Species 5'-VH-VL 3*-VH-VL Short name reactivity reactivity linker
1ΒΪΜΑΒ TR66 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 GGGGS
murine
no.11 145-2C11 murine CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab 145-2C11 SGGGGS
murine
no.12 UCHT1-HU human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab UCHT1-HU SGGGGS
murine
no.13 UCHT1 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab UCHT1 SGGGGS
murine no.14 CLB-T3 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab CLB-T3 SGGGGS
murine
no.15 T 66 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 SGGGGS
murine
no.16 145-2C11 murine CLDN18.2 mCLDN18.2ab human, 145-2C11 mCL.DN18.2ab SGGGGS
murine
no.17 UCHT1-HU human CLDN18.2 mCLDN18.2ab human, UCHT1-HU mCLDN18.2ab SGGGGS
murine
no.18 UCHT1 human CLDN18.2 mCLDN18.2ab human, UCHT1 mCLDN18.2ab SGGGGS
murine
no.19 CLB-T3 human CLDN18.2 mCLDN18.2ab human, CLB-T3 mCLDN18.2ab SGGGGS
murine
no.20 TR66 human CLDN18.2 mCL0N18.2ab human, TR66 mCLDN18.2ab SGGGGS
murine
18PHU5 TR66 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 SGGGGS
murine
18PHU3 TR66 human CLDN18.2 mCLDN18.2ab human, TR66 mCLDN18.2ab SGGGGS
murine
18PMU5 145-2C11 murine CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab 145-2C11 SGGGGS
murine
18PMU3 145-2C11 murine CLDN18.2 mCLDN18.2ab human, 145-2C11 mCLDN18.2ab SGGGGS
murine
no.35 TR66 human PLAC1 78H11 human, 78H11 TR66 SGGGGS
murine
Table 2
Continuation
Internal 5 -long linker 3 -long linker Secretion signal Cod Anti-CD3
name on mAB
usa reference
ge
IBi AB (GGGGS VE(GGSGGS)2GGVD MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger, Eur
J Immunol 1987
no.11 (GGGGS (GGGGS)3 GWSCIILFLVATATGVHS CHO Leo et al., Proc Natl Acad Sci,
1987
no.12 (GGGGSh (GGGGS)3 MGWSCIILFLVATATGVHS CHO Shalab ef a/.J Exp Med 1992 no.13 (GGGGS (GGGGS)3 MGWSCIILFLVATATGVHS CHO Beveriey era/., Eur J Immunol
1981
no.14 (GGGGS (GGGGSh MGWSCIILFLVATATGVHS CHO Van Liereia/., Immunology 1989 no.15 (GGGGS (GGGGSh MGWSCIILFLVATATGVHS CHO Lanzavecchia & Scheidegger, Eur
J Immunol 1987
no.16 (GGGGS (GGGGSh MNSGLQLVFFVLTLKGIQG CHO Leo et al., Proc Natl Acad Sci,
1987
no.17 (GGGGS (GGGGSh MGWSCIILFLVATATGVHS CHO Shalaby ef a/., J Exp ed 1992 no.18 (GGGGS)3 (GGGGSh MNSGLQLVFFVLTLKGIQG CHO Beveriey era/., Eur J Immunol
1981
no.19 (GGGGS)3 (GGGGSh MNFGLSLIFLALILKGVQC CHO Van Liere/ al., Immunology 1989 no.20 (GGGGSh (GGGGSh MEWSWIFLFLLSVTTGVHS CHO Lanzavecchia & Scheidegger, Eur
J Immunol 1987
18PHU5 (GGGGSh VE(GGSGGShGGVD MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger, Eur
J Immunol 1987
18PHU3 VE(GGSGGS)2GGVD (GGGGSh MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger, Eur
J Immunol 1987
18PMU5 (GGGGS)3 VE(GGSGGS)2GGVD MGWSCIILFLVATATGVHS MM Leo ef a/., Proc Natl Acad Sci,
1987
18PMU3 VEfGGSGGShGGVD (GGGGSh MNSGLQLVFFVLTLKGIQG MM Leo et al., Proc Natl Acad Sci,
1987
no.35 (GGGGSh (GGGGSh MGWLWNLLFLMAAAQSAQA CHO Lanzavecchia & Scheidegger, Eur
J Immunol 1987
CHO indicates Chinese Hamster Ovary; HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus musculus; TAA, tumor associated antigen.
b. Generation of stable producer cell lines
To generate stable producer cell clones of CLDN18.2 specific bi-scFv proteins the human embryonic kidney cell line HEK293 (ATCC CRL-1573) and the Chinese Hamster Ovary cell line CHO- 1 (ATCC CCL-61) were used. HE 293 transfection
lxlO7 HEK293 cells were plated two days prior to transfection on 14.5 cm tissue culture dishes in 20 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics were added. 20 μg of linearized DNA of the constructs described under Example l .a were diluted in 0.5 ml plain DMEM/F-12 medium. 75 μΐ of 1 mg/ml linear PEI solution (Polyethylenimine; Polysciences Europe GmbH, Eppelheim, Germany) were added to the diluted DNA and rigorously vortexed. After 15 min incubation at RT, the DNA/PEI complexes were added dropwise to the cells, cell culture dishes were gently rotated and then incubated at 37°C, 5% C02. 24h after transfection the medium was changed. Selection of transfected cells started 48h after transfection with G418 sulfate (Gibco/Life Technologies GmbH, Darmstadt, Germany) in a final concentration of 0.8 mg/ml. G418 was added permanently to the culture medium for cell culturing.
CHO-K1 transfection
lxlO6 CHO- 1 cells were plated one day prior to transfection on 6-well tissue culture plates in 2 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS, without antibiotics; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 1.5 ml of plain DMEM medium without FCS or antibiotics were added. 4 μg of linearized DNA of the constructs described under Example l .a were diluted in 0.25 ml plain DMEM F-12 medium and mixed gently. In a second reaction tube, 2.5 μΐ Lipofectamine 2000 (Invitrogen/Life Technologies GmbH, Darmstadt, Germany) were diluted in 0.25 ml plain DMEM/F12 medium, mixed gently and incubated for 5 min at RT. DNA mix and Lipofectamine mix were combined in a 1 : 1 ratio, mixed gently and incubated for 20 min at RT. The DNA/Lipofectamine 2000 complexes were added dropwise to the cells, cell culture dishes were gently rotated and then incubated at 37°C, 5% C02. 6h after transfection the medium was changed to complete DMEM/F-12 medium. Cells were splitted the following day in a 1 : 10 ratio. Selection of transfected cells started 48h after transfection with G418 sulfate (Gibco/Life Technologies GmbH, Darmstadt, Germany) in a final concentration of 0.5 mg/ml. G418 was added permanently to the culture medium for cell culturing. c. Selection of HEK293 as producer cells
Expression of bi-scFv proteins by stably transfected HEK293 and CHO-K1 cell lines described under Example l .b was characterized by immunofluorescence staining to detect bi-scFv expression according to standard procedures (Current Protocols in Immunology, 2012). Briefly, 2x10s cells were grown on glass slides for 24h and then permealized with 2% PFA. DPBS supplemented with 5% BSA and 0.2% Saponin was used as blocking buffer. After washing with DPBS and blocking with blocking buffer, cells were incubated with primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1 :500 in blocking buffer for 30 min at RT. After washing with blocking buffer, secondary Cy3-conjugated goat-anti-mouse IgG (H+L) antibody (Jackson ImmunoResearch Europe, Suffolk, England) diluted 1 :500 in blocking buffer was added and incubated for 3h at RT. After washing with blocking buffer and H20, cells were embedded in DAKO-mounting medium (Dako, Carpinteria, CA, USA) supplemented with Hoechst 33342 dye (Pierce/Thermo Fisher Scientific, Rockford, IL, USA). Slides were investigated and photographed with a Nikon-Eclipse Ti fluorescence microscope for the presence of bi-scFv positive cells (data not shown). HEK293 cells showed an overall better expression of bi-scFv proteins than CHO-K1 cells and were therefore chosen as producer cell line. d. Production and detection of bi-scFv protein IBiMAB with HEK293 clone #28
Bi-scFv 1 BiMAB was chosen as first bi-scFv protein to be produced, purified and used for the establishment of various assays. For this purpose, clonal cell lines of HEK293 bulk cells stably expressing IBiMAB (see Example l .b) were produced by single cell sorting using a F ACS Aria cell sorter (BD Biosciences, Heidelberg, Germany). After expansion of nearly 40 clonal lines, the best producer clone was selected by immunofluorescence as described under Example 1.c. Selected producer clone #28 was expanded and cultured in a 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin- streptomycin and 0.8 mg/ml G418 (all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's guidelines. At confluent stage, cells were washed with DPBS and medium was changed to DMEM/F-12 medium with antibiotics but without FBS. Cell supernatant containing bi-scFv protein I BiMAB was harvested every 3 - 5 days for up to 4 weeks. Supernatant was filtered with 500 ml Steritop Filter Units (Merck Millipore, Billerica, MA, USA) and stored at 4°C until FPLC-purification.
Before FPLC-purification, presence of bi-scFv in the cell culture supernatant was tested by polyacrylamid gel electrophoresis followed by coomassie staining and western blot analysis performed by standard (Current Protocols in Protein Science, 2012). The supernatant was concentrated 5x - lOx by Centricon Centrifugal Filter Devices -10 MWCO (Merck Millipore, Billerica, MA, USA) according to the manufacturer's protocol. Concentrated and non- concentrated supernatants were separated on NuPAGE Novex 4 - 12% Bis-Tris Gels (Invitrogen/Life Technologies GmbH, Darmstadt, Germany). Subsequently, the gels were stained with Coomassie Brilliant Blue solution according to standard procedures to detect bi- scFv protein IBiMAB between 50 and 60 kD and other proteins contained in the cell culture supernatant. Western blot analysis was performed to specifically detect bi-scFc protein 1 BiMAB via its 6xHis-tag. Briefly, after blotting proteins on PVDF membrane and blocking with PBST/3% milk powder, the membrane was incubated for lh at 4°C with primary antibody Anti- HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1 :500 in blocking buffer. After washing with blocking buffer, membranes were incubated with Fc-specific secondary peroxidase-conjugated goat-anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1 : 10000 in blocking buffer for lh at 4°C. After washing with blocking buffer, the signals were visualized by SuperSignal West Femto Chemiluminescent Substrate (Pierce/Thermo Fisher Scientific, Rockford, IL, USA) and recorded by an ImageQuant LAS 4000 Imager (GE Healthcare Life Sciences, Munich, Germany). Signals of bi-scFv were detected between 50 and 60 kD as compared to the internal molecular weight standard (see Fig. 3 A and B). e. Purification and quantification of bi-scFv protein IBiMAB
Cell culture supernatant of HEK293 clone #28 containing bi-scFv protein IBiMAB (described under Example 1.d) was subjected to immobilized metal affinity chromatography (IMAC) using standard procedures (Current Protocols in Protein Science, 2012). Briefly, filtered cell culture supernatant was loaded onto a His Trap FF 5 ml column connected to an AKTA Purifier 10 FPLC system (both GE Healthcare Life Sciences, Munich, Germany). PBS washing buffer contained 10 mM imidazol, PBS elution buffer contained 500 mM NaCl, 50 mM NaH2P04 and 250 mM imidazol, pH of both buffers was adjusted to 7.4. Elution was performed by a stepwise gradient. Eluted bi-scFv protein IBiMAB was immediately dialyzed against lx PBS using a Slide- A-Lyzer G2 Dialysis Cassette 10K MWCO (Pierce/Thermo Fisher Scientific, Rockford, IL, USA). After dialysis against lx PBS, bi-scFv was dialyzed against an H20 based 200 mM arginine buffer (L-Arginin-monohydrochloride; Roth, Karlsruhe, Germany).
Bi-scFv concentration was determined by measurement at 280 nm with a NanoDrop 2000c under consideration of the extinction coefficient and the molecular weight of bi-scFv protein 1 BiMAB determined via the ProtParam tool (http://web.expasy.org/protparam/). Purified protein was aliquoted and stored at -80°C for long time storage or kept at 4°C for immediate use.
Quality and purity of bi-scFv protein 1 BiMAB was tested by Coomassie staining and western blot analysis as described under Example 1.d (see also Fig. 3 A and B). A BSA standard dilution was included in the Coomassie procedure to roughly confirm the concentration measured by NanoDrop (data not shown). Establishment of an ELISA assay
For the quantification of 1 BiMAB in cell culture supernatant of HEK293 cells, a specific ELISA assay had to be established. For this purpose, supernatant from Example 1.d and purified bi-scFv protein 1 BiMAB described under Example l .e was used. BSA pre-blocked Ni-NTA plates (Thermo Fisher Scientific, Rockford, IL, USA) were used to immobilize bi-scFv protein 1 BiMAB via its 6xHis-tag. All washing steps were conducted three times with 200 μΐ lx PBS/0.05 % Tween (washing buffer) per well and all steps were executed at room temperature. As standard, purified 1 BiMAB protein was used, diluted in lx PBS within the range of 10 - 500 ng/ml. Supernatants were diluted 1 : 10 in lx PBS. 100 μΐ of diluted protein or supernatant were transferred to each well and incubated for one hour while shaking. After washing, an anti- idiotypic antibody against the VH-VL domains of mCLDN18.2ab was diluted to a final concentration of 0.5 μg/ml in lx PBS/3 % BSA. 100 μΐ of the anti-mCLDN18.2ab solution were added per well and incubated for one hour while shaking. After washing, an AP-conjugated anti- mouse-Fc antibody (Jackson ImmunoResearch Europe, Suffolk, England) was diluted to a final concentration of 300 ng/ml in lx PBS/3 % BSA. 100 μΐ of this secondary antibody solution were added per well and incubated for an additional hour while shaking. As negative controls, secondary antibody only, 1 BiMAB plus secondary antibody, and anti-mCLDN18.2ab plus secondary antibody were used. In addition, HEK293 cell supernatant without bi-scFv protein was included in the assay. Finally, 50 μΐ AP substrate solution (1.5 mg pNPP per ml substrate buffer, AppliChem GmbH, Darmstadt, Germany) were added per well after washing. After 5, 15, and 30 min incubation in the dark absorption at 405 run with an excitation wavelength of 492 nm was measured with an Infinite M200 Tecan microplate-reader (Tecan, Mannedorf, Switzerland). Concentration of bi-scFv protein from supernatant was determined by calculation against the standard row (data not shown). g. Transient transfection of CLDN18.2-specific bi-scFv proteins for comparison studies
To transiently generate preferably high amounts of CLDN18.2 specific bi-scFv proteins the human embryonic kidney cell line HEK293T (ATCC CRL-1 1268) was used for transfection. lxlO7 HEK293T cells were plated two days prior to transfection on 14.5 cm tissue culture dishes in 20 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics were added. 20 μg of the circular DNA constructs IBiMAB, no.l 1 - 20, and no.35 (described under Example l .b) were diluted in 0.5 ml plain DMEM/F-12 medium. 75 μΐ of 1 mg/ml linear PEI solution (Polyethylenimine; Polysciences Europe GmbH, Eppelheim, Germany) were added to the diluted DNA and rigorously vortexed. After 15 min incubation at RT, the DNA/PEI complexes were added dropwise to the cells, cell culture dishes were gently rotated and then incubated at 37°C, 5% C02 for 24h. After a medium change with plain DMEM/F-12 cells were incubated for another 48h at 33°C, 5% C02. Cell supernatant was harvested after incubation and sterile filtered with 0.2 μπι Minisart syringe filters (Sigma-Aldrich, Germany). Subsequently, bi-scFv proteins were small-scale purified from cell culture supernatants by Ni-NTA spin columns according to the manufacturer's protocol (Qiagen, Hilden, Gemany). Bi-scFv protein concentrations were estimated by an ELISA as described under Example 1.f and verified by western blot analysis as described under Example l .e (data not shown). Purified proteins were stored at 4°C for immediate use.
Example 2: Establishment of functional assays to monitor specific T cell activation and target cell lysis by redirected T cells mediated by bi-scFv proteins
FPLC -purified bi-scFv protein IBiMAB was used to establish in vitro assays to monitor the capability of bi-scFv proteins to specifically redirect human effector cells to TAA-positive target cells. The aim was to visualize the effects and to quantify the activation of human T cells and the specific target cell lysis. a. Microscopic analysis of T cells redirected to target cells by bi-scFv protein
For the visualization of bi-scFv protein functionality, an assay to show the redirection of effector cells to CLDN18.2-expressing target cells by bi-scFv proteins via microscope had to be established. For this purpose, the gastric carcinoma cell line NugC4 that endogenously expresses relatively high levels of human CLDN18.2 (Sahin U. et al., Clin Cancer Res. 2008 Dec l ;14(23):7624-34) was used as target cell line.
Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Current Protocols in Immunology, 2012): briefly, blood was diluted with DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences, Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were collected from the interphase, washed with cold DPBS supplemented with 2 mM EDTA and counted. Human T cells were subsequently separated by magnetic-activated cell separation (MACS) from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) according to the manufacturer's guidelines.
lxlO5 NugC4 cells were seeded per well into tissue culture 6-well plates. Human cells were prepared as described above and added in an effector to target (E:T) ratio of 5: 1. RPMI 1640 medium supplemented with 5% heat inactivated human AB serum, 0.5% penicillin-streptomycin, lx NEAA and 1 mM sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt, Germany) was used for all cells and the final volume per well was adjusted to 2 ml per well. Control samples comprised target or T cells alone with and without bi-scFv protein. Tissue culture plates were subsequently incubated at 37°C, 5% C02. The assay was continuously observed with a Wilovert S inverted microscope (Hund, Wetzlar, Germany) from 6h to 48h of coincubation. Significant effects in terms of T cell clustering on target cells, formation of an immunologic synapse and target cell killing in the presence of bi-scFv protein IBiMAB were seen at 24h. After 48h viable target cells could hardly be found. Pictures were taken at 24h with a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). See also Figure 5.
This assay was further on included as visibility control in all cytotox assays in various well formats. b. Target-dependent T cell activation by bi-scFv protein IBiMAB
For the detection of a specific activation of human T cells by bi-scFv proteins a flow cytometric assay was established. For the detection of T cell activation, the early activation marker CD69 and the late activation marker CD25 were selected for staining by fluorescence-conjugated antibodies. For the detection of human T cells in the mixture of target and T cells, CD3 on T cells was stained.
The assay set-up from above was chosen (Example 2. a). Briefly, NugC4 target cells were seeded with human T cells in an E:T ratio of 5: 1 in 2 ml complete medium and bi-scFv protein I BiMAB was added in a concentration within the range of 0.001 - 1000 ng/ml. Control samples contained target or T cells alone with and without bi-scFv protein IBiMAB. After 24h and/or 48h - depending on the result of the visibility control - all cells were harvested by gentle scraping with Cell Scrapers (Sarstedt AG & Co, Nurmbrecht, Germany) and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. For cell staining Mouse Anti-Human CD3-FITC, Mouse Anti-Human CD69-APC, and Mouse Anti- Human CD25-PE (all antibodies BD Biosciences, Heidelberg, Germany) were used. Cell pellets were resuspended in 50 μΐ FACS-buffer (DPBS supplemented with 5% FBS) containing the fluorescence-conjugated antibodies. After incubation for 20 min at 4°C in the dark, samples were washed with 4 ml DPBS and cell pellets were resuspended in 200 μΐ FACS buffer containing propidium iodide (PI) or 7-AAD (both Sigma Aldrich, Germany) in a final dilution of 1 : 1000 for the detection of dead cells. Samples were kept on ice and dark throughout the measurement. Establishment of the assay was performed with a FACSCalibur, later measurements were performed with a FACSCanto II flow cytometer (both BD Biosciences, Heidelberg, Germany). Analysis was evaluated by FlowJo software (Tree Star, San Carlos, CA, USA).
As shown in Fig. 6A and B, no IBiMAB mediated T cell activation is detectable in the absence of target cells underlining the strict target dependency of bi-scFv functionality. A significant T cell activation in the presence of target cells occurred with only 0.01 ng/ml IBiMAB after 24h. Maximum efficiency was reached using 100 ng/ml IBiMAB.
Besides the study of T cell activation, this assay also allows the qualitative analysis of bi-scFv mediated effects on target cell killing by gating on the target cell population and estimating the percentage of PI- or 7-AAD-positive target cells (no data shown). All analyses were performed with FlowJo software (Tree Star, San Carlos, CA, USA). c. Luciferase cytotox assay
To determine subtle differences in the target cell killing potential of bi-scFv proteins directed against CLDN18.2 and CD3, a highly sensitive assay had to be developed. The aim was, to establish an assay with which the target cell killing could be quantitatively monitored in a high throughput fashion. To achieve this, a luciferase cytotox assay was chosen. Herewith the measurement of luciferase-expression by viable target cells allows to indirectly determine the target cell lysis mediated by cytotoxic effector cells in the presence of antibody.
First, NugC4 cells (described above) were transduced with a lentiviral vector carrying firefly luciferase, an EGFP reporter gene and an antibiotic selection marker. After antibiotic selection of transduced cells, EGFP high expressing cells were sorted by a FACSAria cell sorter (BD Biosciences, Heidelberg, Germany), analyzed for high luciferase expression and subsequently expanded for further studies.
Human effector cells were prepared as described under Example 2. a. Establishment of the assay was performed within the range of 1 - 100 ng/ml of the bi-scFv protein IBiMAB, whereby a concentration of 5 ng/ml was found to result in highly efficient and reproducible effects and was further used as standard concentration. NugC4 cells stably expressing luciferase (described above) were used as target cells. lxlO4 target cells were seeded per well into white flat bottom 96-well plates. Human T cells (prepared as described under Example 2. a) were added in an E:T ratio of 5:1. The medium described above (Example 2. a) was used and the final volume per well was adjusted to 100 μΐ. Test samples and control samples were plated at least in triplicates.
Cell culture microplates were incubated for 24h and 48h at 37°C, 5% C02. For analysis, 50 μΐ of a water solution containing 1 mg/ml luciferin (BD Monolight, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES were added per well and plates subsequently incubated for 30 min in the dark at 37°C. Luminescence arising from oxidation of luciferin by luciferase expressing viable cells was measured in a microplate-reader (Infinite M200, Tecan, Mannedorf, Switzerland). Percentage of specific target cell lysis was calculated by the following formula: % specific lysis = [1— (luminescencetest sample- Lmax) (Lmin - Lmax)] x 100, whereas "L" indicates lysis. Lmin refers to the minimum lysis in the absence of bi-scFv and Lmax to the maximum lysis (equal to spontaneous luminescence counts) in the absence of bi-scFv achieved by addition of Triton X- 100 (2% final concentration).
Potential direct effects of bi-scFv proteins on target cells independent of effector cells were determined by plating target cells without human T cells including all controls such as Lmin and
Lmax-
This assay was used for further studies to investigate the specific T cell mediated lysis of target cells. Modifications were implemented e.g. by varying bi-scFv concentrations, bi-scFv proteins, E:T ratios, or effector cells (CD8+, CD4+ T cells, PBMCs).
Example 3: Selection of a CLDN18.2-specific bi-scFv lead candidate Luciferase cytotox assay with various CLDN18.2-specific bi-scFv proteins for the selection of the most potent bi-scFv variant
All 10 CHO-codon optimized constructs (no.11-20) specific for the TAA CLDN18.2 were tested in comparison to the human codon optimized bi-scFv protein IBiMAB in a luciferase cytotox assay with NugC4 target cells that endogenously express CLDN18.2 and ectopically express luciferase (see also Example 2.c). Characteristics of used bi-scFv proteins are specified in Table 2. Bi-scFv no.35 specific for TAA PLACl was used as isotype control because PLACl is not expressed by NugC4 cells. Binding activity to CD3 on human T cells had been proven in a FACS binding assay (data not shown). All bi-scFv proteins were generated as described under Example 1.g and used for a cytotox assay set up as described under Example 2.c.
All bi-scFv proteins were used in a final concentration of 5 ng/ml. For the determination of Lmjn, control bi-scFv protein no.35 was seeded with target and T cells ninefold, test samples were plated sixfold. Per time point one plate was prepared for analysis.
The specific lysis at each analyzed time point (8h, 16h, 24h) was plotted against the used bi-scFv proteins. Bi-scFv proteins IBiMAB (SEQ ID NO: 39) and no.15 (SEQ ID NO: 41) - which are constructed in the same orientation and contain the same anti-CD3 sequence (TR66) and differ only in their codon usage on nucleic acid level and in the linker sequences - proved to be the most potent antibodies in mediating target cell lysis (see Fig. 2). Because IBiMAB and no.15 are equal in their efficiency, the so far better investigated bi-scFv protein IBiMAB was selected for all following assays. Constructs 18PHU3 and 18PHU5 (see Table 1 and 2) were compared at a later time point to IBiMAB. Efficiency of 18PHU5 was equivalent to IBiMAB, 18PHU3 was less potent (data not shown).
Example 4: Binding capacity of bi-scFv protein IBiMAB
Establishment of a FACS-based binding assay
To assess the binding capacity of the CLDN18.2 and the CD3-targeting moieties of bi-scFv proteins a flow cytometric assay was established. CLDN18.2 endogenously expressing NugC4 cells were used to investigate the anti-CLDN18.2 site and human T cells were used to investigate the anti-CD3 site.
For the investigation of the anti-CLDN18.2 binding capacity, NugC4 cells were trypsinized, washed with complete RPMI 1640 medium and subsequently with DPBS. All washing steps were conducted by centrifugation at 1200 rpm for 6 min at 4°C. 2.5x105 NugC4 cells were transferred to 5 ml round bottom tubes and incubated with 50 μg/ml FPLC-purified IBiMAB protein in FACS-buffer for 30 min at 4°C. Cells were washed with 2 ml FACS-buffer and subsequently incubated with 3.3 g/ml of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) for 30 min at 4°C. After washing with 2 ml FACS-buffer, the cell pellet was incubated with an APC-conjugated goat-anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, England) in a 1 :200 dilution in FACS-buffer for 20 min at 4°C in the dark. Cells were washed twice with 2 ml FACS-buffer and finally resuspended in 150 μΐ FACS-buffer supplemented with 1 μ§/πι1 PI (Sigma Aldrich, Germany) to counterstain dead cells. Another staining with the same procedure was included using 50 g/ml IBiMAB and APC-conjugated goat-anti-mouse secondary antibody (1 :200) but without Anti-HIS Epitope-Tag antibody. Negative control samples included secondary goat-anti-mouse APC antibody alone, monoclonal antibody Anti-HIS Epitope-Tag plus secondary goat-anti-mouse APC antibody. As positive control 10 μg ml monoclonal CLDN18.2-specific antibody mCLDN18.2ab stained with secondary goat-anti-human APC antibody (Jackson ImmunoResearch Europe, Suffolk, England) and its secondary antibody only control were implemented.
Samples were measured with a FACSCalibur flow cytometer (BD Biosciences, Heidelberg, Germany) and analyzed by FlowJo Software (Tree Star, San Carlos, CA, USA). Strong signals were detected by sequential staining with IBiMAB, Anti-HIS Epitope-Tag and goat- anti-mouse APC. Signal intensity was comparable to positive control mCLDN18.2ab with goat-anti-human APC. A low direct binding of goat-anti-mouse APC to IBiMAB was observed in the sample stained with IBiMAB and goat-anti-mouse APC without Anti-HIS Epitope-Tag (see Fig. 4A).
For all further FACS-binding assays to investigate the binding capacity of bi-scFv proteins the sequential staining protocol with bi-scFv, Anti-HIS Epitope-Tag and goat-anti-mouse APC was used (see Fig. 4B, C, and D). To rule out an unspecific binding of IBiMAB, target cells that do not express CLDN18.2 as verified by RT-PCR (data not shown) were subjected to the FACS- based binding assay. No unspecific binding of 1 BiMAB was detected as shown in Fig. 4D.
For investigation of the binding capacity of the anti-CD3 arm of bi-scFv protein IBiMAB, human T cells were used. l lO6 T cells prepared as described in Example 2. a were transferred to 5 ml round bottom tubes and incubated with FPLC-purified IBiMAB protein within a range of 0.002 - 2 μg/ml in FACS-buffer for 30 min at 4°C. Further staining procedure was as described above. Control samples included secondary goat-anti-mouse APC antibody alone and monoclonal antibody Anti-HIS Epitope-Tag plus secondary goat-anti-mouse APC antibody. Measurement and analysis were performed as described above. A significant signal was obtained with 2 μg/ml IBiMAB (see Fig. 4C). Example 5: Investigation of highly specific, target dependent T cell activation by bi-scFv 1 BiMAB
Cancer cell lines that endogenously express high or low levels of CLDN18.2 and cancer cell lines that do not express CLDN18.2 were chosen to prove the strict target dependency of bi-scFv protein 1 BiMAB in an in vitro cytotox assay. The chosen cell lines were of the two predominant carcinoma types that express CLDN18.2: gastric (NugC4, MKN7, SNU-1 ) and pancreatic (DanG, KP-4) carcinoma. Breast carcinoma cell line MCF7 was used as negative control. a. CLDN18.2 R T-PCR of cancer cell lines
Total RNA was extracted from the carcinoma cell lines mentioned above by RNEasy Mini Kit procedure according to the manufacturer's protocol (Quiagen, Hilden, Germany). 5 μg of RNA were used for cDNA synthesis with Superscript II Reverse Transcriptase (Life Technologies GmbH, Darmstadt, Germany).
RT-PCR analyses was run on an ABI Prism 7300 Real Time PCR System (Applied Biosystems/Life Technologies GmbH, Darmstadt, Germany) using Sybr Green dye and the following primers:
CLDN18.2: for TGGCTCTGTGTCGACACTGTG; rev GTGTACATGTTAGCTGTGGAC HPRT: for TGACACTGGCAAAACAATGCA; rev GGTCCTTTTCACCAGCAAGCT
Delta Ct was calculated by subtraction of the Ct- value of the housekeeping gene HPRT from the Ct-value of CLDN18.2 (for results see Fig. 7A). b. Exclusive T cell activation in the presence of CLDN18.2
A cytotoxic assay was set up as described under Example 2. a. The carcinoma cell lines examined for CLDN18.2 transcripts under Example 5. a via quantitative RT-PCR were used as target cells. The concentration of bi-scFv protein 1 BiMAB in this assay was set to 5 ng/ml. Target cells were seeded with human T cells and 1 BiMAB in duplicates to analyze T cell activation. To monitor any potential alloreactivity of T cells against target cells independently of bi-scF protein 1 BiMAB, target and T cells were seeded without 1 BiMAB in duplicates. Cells were continuously sighted through a microscope to observe T cell clustering and target cell binding. In the case of the high CLDN 18.2-expressing cell line NugC4, significant effects occurred after 24h; after 48h viable target cells were hardly visible. In the case of the low CLDN18.2- expressing cell line DanG, first effects were seen after 96h and significant effects after 120h. With the CLDN18.2 negative cell lines no effects indicating any T cell activation could be seen even after 144h. T cells of all samples were analyzed after 144h of coincubation with target cells via flow cytometry as described under Example 2. a for the early T cell activation marker CD69 and the late activation marker CD25, counterstained with CD3 for the T cell population and PI for dead cells. Intriguingly, up to 100% of the T cells coincubated with NugC4 and I BiMAB were CD25 positive but CD69 negative indicating a longterm activation of T cells when CD69 downregulation already occurred. Roughly 75% of T cells coincubated with DanG and I BiMAB were activated, of which about 40 % simultaneously expressed CD25 and CD69 indicating a T cell activation that is still ongoing. T cells coincubated with the CLDN18.2 negative cell lines did not show any sign of T cell activation induction: neither CD69 nor CD25 expression was significantly elevated compared to the levels of samples without IBiMAB (see also Fig. 7B).
Example 6: Investigation of bi-scFv protein IBiMAB induced T cell function a. Induction of T cell proliferation
T cell proliferation is an indicator of T cell activation. To show T cell proliferation in response to bi-scFv protein IBiMAB in the presence of CLDN18.2 positive target cells, a flow cytometric assay was used. Briefly, lxlO6 human T cells isolated as described under Example 2. a were stained in the dark at 37°C for 10 min with 0.5 μΜ carboxyfluorescein diacetate succinimidyl ester (CellTrace CFSE, Invitrogen/Life Technologies GmbH, Germany) dissolved in DPBS. Staining was stopped by addition of 5 volumes of cold complete RPMI 1640 medium. Cells were kept on ice for 5 min and washed 3 times with complete RPMI medium (5% heat inactivated human AB serum, 0.5% penicillin-streptomycin, lx NEAA and 1 raM sodium pyruvate) and were subsequently resuspended to lxlO5 cells per ml. A cytotox assay as described under Example 2.b was set up with CLDN18.2 endogenously expressing NugC4 cells and human T cells as effector cells. 50 U IL-2 per ml medium were added to the cells. Samples included T cells alone, T cells with 1 ng/ml IBiMAB, T cells and NugC4 cells, and T cells with 1 ng/ml IBiMAB and NugC4 cells. After 120h of coincubation, the T cells were harvested, collected in 5 ml round bottom tubes, washed and stained with a 1 : 1000 7-AAD DPBS solution to counterstain dead cells for 15 min at 4°C. After washing with DPBS, cells were resuspended in FACS-buffer and analyzed with a FACSCanto II (BD Biosciences, Heidelberg, Germany).
Proliferation of T cells was detected by decreasing CFSE-signal only in the presence of target cells and bi-scFv protein 1 BiMAB (see also Fig. 8A). b. Induction of serine protease Granzyme B
To demonstrate the upregulation of proteolytic molecules after T cell activation mediated by bi- scFv protein I BiMAB in the presence of CLDN18.2 positive target cells, the detection of serine protease Granzyme B via flow cytometric analysis was elected. A cytotox assay as described under Example 2.b was set up with CLDN18.2 endogenously expressing NugC4 cells and human T cells as effector cells. Samples included T cells alone, T cells with 5 ng/ml IBiMAB, T cells and NugC4 cells, and T cells with 5 ng/ml IBiMAB and NugC4 cells. After 96h of coincubation, the T cells were harvested, collected in 5 ml round bottom tubes, washed and stained with a 1 : 1000 7-AAD DPBS solution to counterstain dead cells for 15 min at 4°C. After washing with DPBS, cells were fixed with 100 μΐ Cytoperm/Cytofix solution for 20 min at RT. Cells were washed with lx Perm/Wash and subsequently stained with PE-conjugated Mouse Anti-Human Granzyme B antibody for 20 min at RT. After washing, cells were resuspended in FACS-buffer and analyzed with a FACSCanto II (all reagents and FACS machine BD Biosciences, Heidelberg, Germany).
Granzyme B upregulation in T cells was detected only in the presence of target cells and bi-scFv protein IBiMAB (see also Fig. 8B).
Example 7: Determination of EC50 of bi-scFv protein IBiMAB in an in vitro cytotox assay Luciferase cytotox assay
For the determination of the half maximal effective dose of bi-scFv protein IBiMAB, a titration row of IBiMAB was tested in an in vitro luciferase cytotox assay, mainly as described under Example 2.c.
Stably luciferase-expressing NugC4 cells described under Example 2.c were incubated with human T cells and bi-scFv protein IBiMAB concentrations within the range of 1 pg/ml to 1 μg/ml (in steps of 10) or without 1 BiMAB to determine the Lmin values. Luminescence of viable cells was measured with an Infinite M200 Tecan plate reader 24h and 48h after assay set up. Specific target cell lysis was calculated by the formula exemplified under Example 2.c.
Maximum lysis was reached after 48h with 1 - 10 ng/ml IBiMAB. The determined EC50 after 48h in this assay is approximately 10 pg ml (see also Fig. 9). Outcome of this assay strongly depends on the potency of the human T cells which varies according to the immune status of the donor as also reported by others (e.g. Lutterbuese, R et al., Proc. Natl. Acad. Sci. USA. 2010 Jul 13; 107(28): 12605-10). In addition to that, the used target cell line NugC4 shows varying expression of CLDN18.2 also influencing the outcome. Thus, an EC50 value variation of bi-scFv protein IBiMAB in a range within 10 - 300 pg ml has been observed during the course of this invention.
Example 8: Efficacy in a mouse xenograft model
To investigate the therapeutic potential of bi-scFv protein 1 BiMAB in vivo, the mouse strain NOD.Cg-Prkdscid IL2rg,ml wjl/SzJ or short NSG (Jackson laboratory, Bar Harbour, ME, USA) was chosen. For the described study the engraftment of human effector cells and human T lymphocytes in mice is indispensable to study the effects of T cell engaging bi-scFv in vivo. Because of the complete lack of B-, T- and NK cells the mouse strain NSG is suitable for this kind of xenograft studies. A mouse model with mainly engrafted human T cells after PBMC injection was established as partof the invention. a. Late onset treatment of advanced highly CLDN18.2 expressing tumors in mice with bi-scFv protein IBiMAB
In the exemplified study, 40 female NSG mice at the age of 8 weeks were subcutaneously inoculated with lxlO7 HEK293 cells stably expressing high levels of human CLDN18.2 (HEK293-CLDN18.2). 5 days after tumor cell inoculation mice were stratified according to their tumor volume into treatment groups, mice without tumor growth were excluded. At the same day peripheral blood mononuclear cells (PBMCs) were isolated from human blood of healthy donors by Ficoll density gradient technique as described under Example 2. a and used as effector cells in vivo. 2 l07 PBMCs diluted in 300 μΐ DPBS were injected intraperitoneally at the day of isolation to the experimental treatment groups designated with "PBMC". With "PBS" designated treatment groups received 300 μΐ plain DPBS intraperitoneally instead and served as control without human effector cells. With the "PBS" control groups the investigation of a potential effect on tumor growth by IBiMAB itself or any potential side effects which are caused by IBiMAB or vehicle and not by human effector cells against mouse tissue (i.e. graft- versus-host reaction exerted by human effector cells against murine tissue) could be examined. Group "PBS/vehicle" comprised 4 mice (n=4), "PBS/1 BiMAB" 5 mice (n=5), "PBMC/vehicle" 13 mice (n=13) and "PBMC/1 BiMAB" 15 mice (n=15). The therapy was started 1 day after DPBS or PBMC application: groups "PBS/1 BiMAB" and "PBMC/1 BiMAB" received intraperitoneally 5 μg purified bi-scFv protein IBiMAB diluted in 200 μΐ of DPBS per animal. Groups "PBS/vehicle" and "PBMC/vehicle" received intraperitoneally 200 μΐ of vehicle buffer (200 mM L-Arginin-monohydrochloride dissolved in H20, sterile filtered) diluted in DPBS. Treatment groups are summarized in Table 3. Therapy was conducted on a daily basis for 22 days. Twice per week tumor dimensions were measured with a digital calibrated caliper and the tumor volume calculated according to the formula mm3 = length x width x (width/2). Fig. 10A and B exemplify the inhibition of tumor growth and the elimination of tumor burden in half of the mice of the "PBMC/lBiMAB" group only by the antibody in the presence of human effector cells. Mice were sacrificed by cervical dislocation when the tumor volume exceeded 500 mm3 or in case of severe morbidity (graft-versus-host symptoms were observed in some mice).
Table 3: Treatment groups
Treatment # of mice Effector cells Bi-scFv μg bi-scFv
group (G) (n) protein protein/mouse
Gl 4
G2 5 IBiMAB 5
G3 13 PBMC
G4 15 PBMC IBiMAB 5
b. Determination of therapy influence on body weight
The body weight of each mouse was examined twice per week using a laboratory scale. No mouse in any group showed weight loss over the time of treatment (data not shown). Some mice in both "PBMC" groups showed symptoms of a graft-versus-host reaction 4 weeks after PBMC injection and several days after the end of treatment. Effects by IBiMAB itself on body weight or any other side effects concerning the health of the mice were not observed. c. Tissue conservation and splenocyte isolation
After killing of mice, tumors were dissected and the tissue was immediately fixed in 10 ml Roti- Histofix 4% (Carl Roth, Karlsruhe, Germany) for immunohistochemical analysis. Moreover, spleens were dissected to detect the engraftment of human cells by flow cytometric analysis. Splenocyte isolation was performed immediately after spleen dissection by mashing the spleens through a 70 μπι cell strainer placed into a 50 ml reaction tube with a sterile plunger of a 3 - 5 ml syringe and repeated flushing of the cell strainer with warm DPBS. Isolated splenocytes were centrifuged, DPBS decanted and the splenocyte pellets resuspended in 1 ml heat inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen at -80°C and stored until splenocyte samples from all mice were complete. d. Analysis of engraftment of human T lymphocytes in mouse spleens
Splenocytes from all mice were collected and frozen as described under Example 8.c The complete collection of splenocyte samples was thawed at one time, all cells were washed twice with warm DPBS and lxlO6 splenocytes per sample were incubated with fluorescence- conjugated antibodies for 20 min at 4°C in the dark to detect the engraftment of human cells by anti-CD45 staining and the percentage of human T cells by anti-CD3, anti-CD4, and anti-CD8 staining. Flow cytometric analysis was conducted with a FACSCalibur (BD Biosciences, Heidelberg, Germany). Human T cell engraftment in both "PBMC" groups could be confirmed by high percentage of CD45-CD3 double positive splenocytes as shown in Fig.10D.
Example 9: Generation and testing of bispecific binding agents targeting CLDN6 and CD3 a. Sequence origin, design of bi-scFv constructs, and clonig into expression vectors
The bispecific tandem single chain antibody constructs (bi-scFv) contained binding domains specific for the human T cell receptor component CD3 and human tumor associated antigens (TAA). The corresponding variable heavy chain regions (VH) and the corresponding variable light chain regions (VL) are for each construct specifically arranged from N- to C-terminus in consecutive order:
N- vH aCLDN6 - VL aCLDN6 - VH aCD3 - VL aCD3 - C (6PHU5; SEQ ID NO: 43)
N- VH aCD3 - VL aCD3 - vH aCLDN6 - VL aCLDN6 - C (6PHU3; SEQ ID NO: 45) Table 4 summarizes all bi-scFv constructs specific for the TAA CLDN6 that were generated in the course of the invention. The CLDN18.2 specific bi-scFv construct IBiMAB was used as control antibody. The bi-scFv constructs were generated by gene synthesis by GeneArt AG (GeneArt/Life Technologies GmbH, Regensburg, Germany) using the VH and VL sequences of the corresponding antibodies. Codon optimizations such as Homo sapiens (HS) or Mus musculus (MM) were implemented by GeneArt's GeneOptimizer® software, and are listed in Table 5. Information on specificity, sequence origin from monoclonal antibodies (mAB), codon usage, additional sequence features and references of all applied domains are summarized in Table 5. Variable domain sequence origin of the respective CD3 antibodies are listed in Table 5. Due to the high homology of human and mouse TAAs, the same anti-TAA VH and VL sequences could be used for the generation of bi-scFv constructs for mouse assays, but in combination with the VH, L sequences of the mouse specific anti-CD3 antibody clone 145-2C1 1.
DNA cloning and expression vector construction was carried out according to standard procedures (Sambrook, 1989) well known by the skilled person. Briefly, the bi-scFv DNA sequences were provided with a 5 ' Hindlll and a 3' BamHl restriction for cloning into expression plasmids. A secretion signal sequence was introduced at the 5' end upstream of the bi-scFv sequence for protein secretion from cellular cytoplasm into the culture medium. A sequence coding for a 15 to 18 amino acid flexible glycine-serine peptide linker was inserted to join the VH and VL domains for the composition of the single chain variable antibody fragments (scFv) of which one binds to CD3 and the other to the TAA. To form a bispecific single chain antibody, the two scFv domain sequences were connected by a sequence coding for a short peptide linker (GGGGS). Together with this linker sequence a BamHl restriction site was introduced for scFv domain exchanges for the cloning of upcoming bi-scFV constructs. In-depth, 5 'scFv-domains could be exchanged by Hzndlll and BamHl restriction and 3 'scFv-domains by BamHl and Xhol restriction.
All used bi-scFv antibody constructs were cloned into the standard mammalian expression vector pcDNA™3.1/myc-His (+) (Invitro gen/Life Technologies GmbH, Darmstadt, Germany). The C- terminal 6xHis-tag served for metal affinity purification of the protein and for detection analysis. All constructs were verified by sequencing via MWG's single read sequence service (Eurofins MWG Operon, Ebersberg, Germany). For construct schemata see also Fig. 1 1.
Table 4: Summary of TAA and CD3 specific bispecific single chain antibody constructs
Internal name TAA Specificity 5'-VH-VL 3 -VH-VL Codon usage
I BiMAB CLDN18.2 human mCLDN18.2ab TR66 HS
6PHU5 CLDN6 human mCLDN6ab TR66 HS
6PHU3 CLDN6 human TR66 mCLDN6ab HS
6PMU5 CLDN6 murine mCLDN6ab 145-2C11 MM
6PMU3 CLDN6 murine 145-2C11 mCLDN6ab MM
HS, Homo sapiens; MM, Mus musculus; TAA, tumor associated antigen.
Table 5: Summary of bi-scFv construct information
CD3 binding moiety TAA binding moiety
Internal mAB Species TAA mAB origin Species 5'-VH-VL 3'-VH-V,. Short linker name origin reactivity reactivity
IBiMAB TR66 human CLDN18.2 mCLDN18.2ab human, mCLDN18.2ab TR66 GGGGS
murine
6PHU5 TR66 human CLDN6 mCLDN6ab human, mCLDN6ab TR66 SGGGGS
murine
6PHU3 TR66 human CLDN6 mCLDN6ab human, TR66 mCLDN6ab SGGGGS
murine 6PMU5 145-2C11 murine CLDN6 mCLDN6ab human, mCLDN6ab 145-2C11 SGGGGS
murine
6PMU3 145-2C11 murine CLDN6 mCLDN6ab human, 145-2C11 mCLDN6ab SGGGGS
murine
Continuation
Table 5
Internal 5 -long linker 3 -long linker SSeeccrreettiioonn Codon Anti-CD3
name ssignal usage mAB
reference
IBi AB (GGGGS VE(GGSGGS)2GGVD MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger,
Eur J Immunol 1987
6PHU5 (GGGGS VEfGGSGGSfcGGVD MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger,
Eur J Immunol 1987
6PHU3 VEfGGSGGS^GGVD (GGGGS MGWSCIILFLVATATGVHS HS Lanzavecchia & Scheidegger,
Eur J Immunol 1987
6PMU5 (GGGGS)3 VE(GGSGGS)2GGVD MGWSCIILFLVATATGVHS MM Leo er a/., Proc Natl Acad Sci,
1987
6PMU3 VE(GGSGGS)jGGVD (GGGGS MNSGLQLVFFVLTLKGIQG MM Leo er a/., Proc Natl Acad Sci,
1987
HS, Homo sapiens; mAB, monoclonal antibody; MM, Mus musculus; TAA, tumor associated antigen.
b. Generation of stable producer cell tines
To generate stable producer cell clones of CLDN6 specific bi-scFv proteins the human embryonic kidney cell line HEK293 (ATCC CRL-1573) was used.
lxlO7 HEK293 cells were plated two days prior to transfection on 14.5 cm tissue culture dishes in 20 ml complete DMEM medium (DMEM/F-12 GlutaMax supplemented with 10% heat inactivated FBS and 0.5% penicillin-streptomycin; all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany). Before transfection, cells were washed with DPBS supplemented with 2 mM EDTA, then 20 ml of plain DMEM medium without FBS or antibiotics were added. 20 μg of linearized DNA of the constructs pcDNA3.1/6PHU5 and pcDNA3.1/6PHU3 (described under Example 9.a) were diluted in 0.5 ml plain DMEM/F-12 medium. 75 μΐ of 1 mg/ml linear PEI solution (Polyethylenimine; Polysciences Europe GmbH, Eppelheim, Germany) were added to the diluted DNA and rigorously vortexed. After 15 min incubation at RT, the DNA/PEI complexes were added dropwise to the cells, cell culture dishes were gently rotated and then incubated at 37°C, 5% C02. 24h after transfection the medium was changed. Selection of transfected cells was started 48h after transfection with G418 sulfate (Gibco/Life Technologies GmbH GmbH, Darmstadt, Germany) in a final concentration of 0.8 mg/ml. G418 was added permanently to the culture medium for cell culturing. c. Small-scale production of bi-scFv proteins 6PHU5 and 6PHU3 with polyclonal HEK293 cells
Bi-scFv proteins 6PHU5 and 6PHU3 were small-scale produced and purified from polyclonal HE 293 cell supernatants for in vitro comparison. Briefly, at confluent state, supernatant without FBS was harvested from the polyclonal cell lines described under Example 9.b and filtered with 0.2 μπι Minisart syringe filters (Sigma-Aldrich, Germany). Subsequently, bi-scFv proteins were small-scale purified from cell culture supernatants by Ni-NTA spin columns according to the manufacturer's protocol (Qiagen, Hilden, Germany). Bi-scFv protein concentrations were determined by measurement at 280 nm with a NanoDrop 2000c under consideration of the extinction coefficient and molecular weight - determined via the ProtParam tool (http://web.expasv.org piOtparam/) - of bi-scFv protein 6PHU5 and 6PHU3. Purified proteins were stored at 4°C for immediate use.
Bi-scFv proteins were tested by polyacrylamid gel electrophoresis followed by coomassie staining and western blot analysis performed by standard procedures (Current Protocols in Protein Science, 2012). Small-scale purified proteins were separated on NuPAGE Novex 4 - 12% Bis-Tris Gels (Invitrogen/Life Technologies GmbH, Darmstadt, Germany). Subsequently, the gels were stained with Coomassie Brilliant Blue solution according to standard procedures (Current Protocols in Protein Science, 2012) to detect bi-scFv proteins 6PHU5, 6PHU3, and other proteins contained in the cell culture supernatant. Western blot analysis was performed to specifically detect bi-scFv proteins 6PHU5 and 6PHU3 via their 6xHis-tag. Briefly, after blotting proteins on PVDF membrane and blocking with PBST/3% milk powder, the membrane was incubated for lh at 4°C with primary antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) diluted 1 :500 in blocking buffer. After washing with blocking buffer, membranes were incubated with Fc-specific secondary peroxidase-conjugated goat-anti-mouse IgG antibody (Sigma Aldrich, Germany) diluted 1 : 10000 in blocking buffer for lh at 4°C. After washing with blocking buffer again, the signals were visualized by SuperSignal West Femto Chemiluminescent Substrate (Pierce/Thermo Fisher Scientific, Rockford, IL, USA) and recorded by an ImageQuant LAS 4000 Imager (GE Healthcare Life Sciences, Munich, Germany). Signals of bi-scFv proteins were detected between 50 and 60 kD as compared to the internal molecular weight standard.
<L Large scale production of bi-scFv protein 6PHU3 with polyclonal HEK293 cells
The polyclonal producer cell line was cultured in a 10-layer Cell Factory (Nunc, Roskilde, Denmark) in DMEM/F-12 GlutaMax supplemented with 10% FBS, 0.5% penicillin- streptomycin and 0.8 mg/ml G418 (all reagents from Gibco/Life Technologies GmbH, Darmstadt, Germany) according to the manufacturer's guidelines. At confluent stage, cells were washed with DPBS and medium was changed to DMEM/F-12 medium with antibiotics but without FBS. Cell supernatant containing bi-scFv protein 6PHU3 was harvested every 3 - 5 days for up to 3 weeks. Supernatant was filtered with 500 ml Steritop Filter Units (Merck Millipore, Billerica, MA, USA) and stored at 4°C until FPLC-purification.
Before FPLC-purification, presence of bi-scFv in the cell culture supernatant was tested by polyacrylamid gel electrophoresis followed by coomassie staining and western blot analysis performed by standard procedures as briefly described under Example 9.c. e. Purification and quantification of bi-scFv protein 6PHU3
Cell culture supernatant of polyclonal HEK293 cells containing bi-scFv protein 6PHU3 (described under Example 9.b) was subjected to immobilized metal affinity chromatography (IMAC) using standard procedures (Current Protocols in Protein Science, 2012). Briefly, cell culture supernatant was loaded onto a His Trap FF 5 ml column connected to an AKTA Purifier 10 FPLC system (both GE Healthcare Life Sciences, Munich, Germany). PBS washing buffer contained 10 raM imidazol, PBS elution buffer contained 500 mM NaCl, 50 raM NaH2P04 and 250 mM imidazol, pH of both buffers was adjusted to 7.4. Elution was performed by a stepwise gradient. Eluted bi-scFv protein 6PHU3 was immediately dialyzed against lx PBS using a Slide- A-Lyzer G2 Dialysis Cassette 10K MWCO (Pierce/Thermo Fisher Scientific, Rockford, IL, USA). After PBS dialysis, bi-scFv was dialyzed against a 200 mM arginine buffer (L-Arginin- monohydrochloride; Roth, Karlsruhe, Germany) based on H20.
Bi-scFv concentration was determined by measurement at 280 nm with a NanoDrop 2000c under consideration of the extinction coefficient and molecular weight of bi-scFv protein 6PHU3. Purified protein was aliquoted and stored at -80°C for long time storage or kept at 4°C for immediate use.
Quality and purity of bi-scFv protein 6PHU3 was tested by Coomassie staining and western blot analysis as described under Example 9.c. A BSA standard dilution was included in the Coomassie procedure to roughly confirm the concentration measured by NanoDrop (data not shown).
Example 10: Efficiency of CLDN6-targeting bi-scFv candidates 6PHU5 and 6PHU3 a. Microscopic analysis of T cells redirected to target cells by bi-scFv proteins 6PHU5 and 6PHU3
To visualize the redirection of effector cells to CLDN6-expressing target cells by bi-scFv proteins via microscopic analysis, an in vitro cytotox assay was performed. NiNTA column- purified bi-scFv proteins 6PHU3 and 6PHU5 (see Example 9.c) were used to compare these two variants according to their efficiency. As target cell line the ovarian teratocarcinoma cell line PA-1 that endogenously expresses high levels of human CLDN6 was used.
Human effector cells were freshly isolated from human blood from healthy donors according to standard procedures (Current Protocols in Protein Science, 2012): briefly, blood was diluted with DPBS, layered on Ficoll-Paque Plus (GE Healthcare Life Sciences, Munich, Germany) and centrifuged. Peripheral blood mononuclear cells (PBMCs) were collected from the interphase, washed with cold DPBS supplemented with 2 mM EDTA and counted. Human T cells were subsequently separated by magnetic-activated cell separation (MACS) from PBMCs by Pan T Cell Isolation Kit II (Miltenyi Biotec, Teterow, Germany) according to the manufacturer's guidelines.
1x10s PA-1 cells per well were seeded into tissue culture 6- well plates. Human cells were prepared as described above and added in an effector to target (E:T) ratio of 5:1. MEM medium supplemented with 10% heat inactivated FBS, 0.5% penicillin-streptomycin, lx NEAA, 1 mM sodium bicarbonate and 1 mM sodium pyruvate (Gibco/Life Technologies GmbH, Darmstadt, Germany) was used for all cells and the final volume per well was adjusted to 2 ml per well. The used bi-scFv protein concentration was 50 ng/ml in this assay. Control samples comprised target or T cells alone without bi-scFv protein. Tissue culture plates were subsequently incubated at 37°C, 5% C02. The assay was continuously observed with a Wilovert S inverted microscope (Hund, Wetzlar, Germany) from 6h to 24h of coincubation. Significant effects in terms of T cell clustering on target cells, formation of an immunologic synapse and target cell killing in the presence of bi-scFv protein 6PHU5 and 6PHU3 were seen at 24h and photographed with a Nikon Eclipse TS100 inverted microscope (Nikon, Japan). Both bi-scFv proteins lead to strong T cell clustering and target cell killing as shown in Fig. 12. b. T cell activation mediated by bi-scFv proteins 6PHU5 and 6PHU3
For the detection of T cell activation and to define differences in the efficiency of the two CLDN6-specific bi-scFv variants, a FACS-based T cell activation assay was used. The early activation marker CD69 and the late activation marker CD25 were selected for staining by fluorescence-conjugated antibodies. For the detection of human T cells in the mixture of target and T cells, CD3 on T cells was stained.
In general, the assay set-up from above was chosen (Example lO.a). Briefly, PA-1 target cells endogenously expressing CLDN6 were seeded with human T cells in an E:T ratio of 5: 1 in 2 ml complete medium and bi-scFv proteins 6PHU5 or 6PHU3 were added in a concentration within the range of 5 - 200 ng/ml. Control samples comprised target or T cells alone with and without bi-scFv proteins. After 24h and 48h the T cells were harvested by flushing and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cells were centrifuged and washed with DPBS. For cell staining Mouse Anti-Human CD3-FITC, Mouse Anti-Human CD69-APC, and Mouse Anti-Human CD25-PE (all antibodies BD Biosciences, Heidelberg, Germany) were used. Cell pellets were resuspended in 50 μΐ FACS-buffer (DPBS supplemented with 5% FBS) containing the fluorescence-conjugated antibodies and and 2 μΐ 7-AAD (BD Biosciences, Heidelberg, Germany). After incubation for 20 min at 4°C in the dark, samples were washed with 4 ml DPBS and cell pellets were resuspended in 200 μΐ FACS buffer. Samples were kept on ice and dark throughout the measurement with a FACSCanto II flow cytometer (both BD Biosciences, Heidelberg, Germany). Analysis was evaluated by Flow Jo software (Tree Star, San Carlos, CA, USA).
Both CDLN6-specific bi-scFv variants resulted in efficient T cell activation of up to 60%. Variant 6PHU3 (bi-scFv CD3 x CLDN6) was more potent in the low concentration range of 5 - 10 ng/ml (see also Fig. 13) and was therefore chosen for further studies.
Example 11: Binding capacity of bi-scFv 6PHU3
FA CS binding assay
To assess the binding capacity of the CLDN6- and the CD3-targeting moieties of bi-scFv protein 6PHU3 a flow cytometric assay was used. CLDN6 endogenously expressing PA-1 and OV-90 cells were used to investigate the anti-CLDN6 site and human T cells were used to investigate the anti-CD3 site. CLDN6-negative NugC4 cells were used as control cells.
For the investigation of the anti-CLDN6 binding capacity, CLDN6 positive cells (PA-1 , OV-90) and CLDN6 negative cells (NugC4) were trypsinized, washed with complete medium and subsequently with DPBS. All washing steps were conducted by centrifugation at 1200 rpm for 6 min at 4°C. lxl 05 cells were transferred to 5 ml round bottom tubes and incubated with 0.01 - 10 μg/ml μg ml FPLC-purified 6PHU3 protein or control bi-scFv protein IBiMAB in FACS- buffer for 30 min at 4°C. Cells were washed with 2 ml FACS-buffer and subsequently incubated with 3.3 μg/ml of monoclonal antibody Anti-HIS Epitope-Tag (Dianova GmbH, Hamburg, Germany) for 30 min at 4°C. After washing with 2 ml FACS-buffer, the cell pellets were incubated with APC-conjugated goat-anti-mouse secondary antibody (Jackson ImmunoResearch Europe, Suffolk, England) in a 1 :200 dilution in FACS-buffer for 20 min at 4°C in the dark. Cells were washed twice with 2 ml FACS-buffer and finally resuspended in 150 μΐ FACS-buffer supplemented with 1 μg/ml PI (Sigma Aldrich, Germany) to counterstain dead cells. Negative control samples included secondary goat-anti-mouse APC antibody alone. As positive control 10 μg/ml monoclonal CLDN6-specific antibody mCLDN6ab stained with secondary goat-anti- human APC antibody (Jackson ImmunoResearch Europe, Suffolk, England) and the proper secondary antibody only control were implemented.
Samples were measured with a FACSCalibur flow cytometer (BD Biosciences, Heidelberg, Germany) and analyzed by FlowJo Software (Tree Star, San Carlos, CA, USA). Signal intensity of 10 μg/ml 6PHU3 was 4-9 times lower than the positive control mCLDN6ab (see Fig. 15 A). Unspecific binding of 6PHU3 to CLDN6-negative cell line NugC4 was not detected (Fig. 15C). For investigation of the binding capacity of the anti-CD3 arm of bi-scFv protein 6PHU3, human T cells were used. 5x105 T cells were transferred to 5 ml round bottom tubes and incubated with FPLC-purified 6PHU3 protein within a range of lOOng/ml - 10 μg/ml in FACS-buffer for 30 min at 4°C. Further staining procedure was as described above. Control samples included secondary goat-anti-mouse APC antibody alone and monoclonal antibody Anti-HIS Epitope-Tag plus secondary goat-anti-mouse PE antibody. Measurement and analysis were performed as described above. A significant signal was obtained with 100 ng/ml 6PHU3 (see also Fig. 15B).
Example 12: Investigation of target dependent T cell activation by bi-scFv 6PHU3 A cytotox assay as described under Example 10. a and b was performed. Briefly, PA-1 target cells endogenously expressing CLDN6 were seeded with human T cells in an E:T ratio of 5: 1 in 2 ml complete medium and bi-scFv protein 6PHU3 was added in a concentration within the range of 0.001 - 1000 ng/ml. To analyze the target dependency for bi-scFv mediated T cell activation, T cells were seeded without target cells but were incubated with the same bi-scFv 6PHU3 concentrations as the target plus T cell samples. After 24h and 48h the T cells were harvested by flushing and transferred to 5 ml round bottom tubes (BD Falcon, Heidelberg, Germany). Cell staining and analysis was conducted as described under Example lO.b.
As shown in Fig. 16A and B, no 6PHU3 mediated T cell activation is detectable in the absence of target cells underlining the strict target dependency of bi-scFv functionality. A significant T cell activation occurred with only 0.1 ng/ml 6PHU3 after 48h. Example 13: Determination of EC50 of bi-scFv 6PHU3 in an in vitro cytotox assay Lucif erase cytotox assay
For the determination of the half maximal effective dose of bi-scFv protein 6PHU3, a titration row of 6PHU3 was tested in an in vitro luciferase cytotox assay.
Stably luciferase-expressing PA-1 cells and human T cells in an E:T ratio of 5: 1 were incubated with bi-scFv protein 6PHU3 concentrations within the range of 1 pg/ml to 1 μg/ml (in steps of 10) or without 6PHU3 to determine the Lmjn values.
Cell culture microplates were incubated for 24h and 48h at 37°C, 5% C02. For analysis, 50 μΐ of a water solution containing 1 mg/ml luciferin (BD Monolight, BD Biosciences, Heidelberg, Germany) and 50 mM HEPES were added per well and plates were subsequently incubated for 30 min in the dark at 37°C. Luminescence arising from oxidation of luciferin by luciferase expressing viable cells was measured with an Inifinite M200 Tecan microplate-reader (Tecan, Mannedorf, Switzerland). Percentage of specific target cell lysis was calculated by the following formula: % specific lysis = [1 - (luminescencetest sample- Lmax) / (Lmin - Lmax)] x 100, whereas "L" indicates lysis. Lmin refers to the minimum lysis in the absence of bi-scFv and Lmax to the maximum lysis (equal to spontaneous luminescence counts) in the absence of bi-scFv achieved by addition of Triton X-100 (2% final concentration).
Maximum lysis was reached after 48h with 1 - 10 ng/ml 6PHU3, the determined EC50 after 48h is approximately 10 pg ml (see also Fig. 17). Outcome of this assay strongly depends on the potency of the human T cells which varies according to the immune status of the donor as also reported by others (see e.g. Lutterbuese, R et al., 2010, Proc. Natl. Acad. Sci USA. 2010 Jul 13;107(28): 12605-10). Thus, an EC50 value variation of bi-scFv protein 6PHU3 by the factor of 3 has been observed during the course of this invention.
Example 14: Efficacy in a mouse xenograft model
To investigate the therapeutic potential of bi-scFv protein 6PHU3 in vivo, the mouse strain NOD.Cg-Prkdscid IL2rgtmlwjl/SzJ or short NSG (Jackson laboratory, Bar Harbour, ME, USA) was chosen. For the described study the engraftment of human effector cells and human T lymphocytes in mice is indispensable to study the effects of T cell engaging bi-scFv in vivo. Because of the complete lack of B-, T- and N cells the mouse strain NSG is suitable for this kind of xenograft studies. A mouse model with mainly engrafted human T cells after PBMC injection was established as part of the invention. a. Late onset treatment of advanced highly CLDN6 expressing tumors in mice with bi-scFv protein 6PHU3
In the exemplified study, 25 female and 25 male NSG mice at the age of 8 - 1 1 weeks were subcutaneously inoculated with lxlO7 PA-1 cells endogenously expressing high levels of human CLDN6. 15 days after tumor cell inoculation mice were stratified according to their tumor volume into treatment groups, mice without tumor growth were excluded. At the same day peripheral blood mononuclear cells (PBMCs) were isolated from human blood of healthy donors by Ficoll density gradient technique and used as effector cells in vivo. 2x107 PBMCs diluted in 200 μΐ DPBS were injected intraperitoneally at the day of isolation to the experimental treatment groups designated with "PBMC". With "PBS" designated treatment groups received 200 μΐ plain DPBS intraperitoneally instead and served as control without human effector cells. With the "PBS" control groups the investigation of a potential effect on tumor growth by 6PHU3 itself or any potential side effects which are caused by 6PHU3 or vehicle and not by human effector cells against mouse tissue (i.e. graft-versus-host reaction exerted by human effector cells against murine tissue) could be examined. Group "PBS/vehicle" comprised 8 mice (n=8), "PBS/6PHU3" 8 mice (n=8), "PBMC/vehicle" 7 mice (n=7), "PBMC/6PHU3" 7 mice (n=7) and "PBMC/lBiMAB" 8 mice (n=8). The therapy was started 7 days after DPBS or PBMC application: groups "PBS/6PHU3", "PBMC/6PHU3" and "PBMC/lBiMAB" received intraperitoneally 5 μg purified bi-scFv protein 6PHU3 or IBiMAB diluted in 200 μΐ of DPBS per animal. Groups "PBS/vehicle" and "PBMC/vehicle" received intraperitoneally 200 μΐ of vehicle buffer (200 mM L-Arginin-monohydrochloride dissolved in H20, sterile filtered) diluted in DPBS. Treatment groups are summarized in Table 6. Therapy was conducted on a daily basis for 26 days. Twice per week tumor dimensions were measured with a digital calibrated caliper and the tumor volume calculated according to the formula mm3 = length x width x width / 2. Fig. 18A and B exemplify the inhibition of tumor growth in all mice of the "PBMC/6PHU3" group by the antibody in the presence of human effector cells. Mice were sacrificed by cervical dislocation when the tumor volume reached 1500 mm3 or in case of severe morbidity (graft- versus-host symptoms were observed in some mice). Table 6: Treatment groups
Treatment # of mice Effector cells Bi-scFv g bi-scFv
group (G) (n) protein protein/mouse
G1 8
G2 8 6PHU3 5
G3 7 PBMC
G4 7 PBMC 6PHU3
G5 8 PBMC I BiMAB b. Determination of therapy influence on body weight
The body weight of each mouse was examined twice per week using a laboratory scale. No mouse in any group showed weight loss over the time of treatment (data not shown). c. Tissue conservation and splenocyte isolation
After killing of mice, tumors were dissected and the tissue was immediately fixed in 10 ml Roti- Histofix 4% (Carl Roth, Karlsruhe, Germany) for immunohistochemical analysis. Moreover, spleens were dissected to detect the engraftment of human cells by flow cytometric analysis. Splenocyte isolation was performed immediately after spleen dissection by mashing the spleens through a 70 μπι cell strainer placed into a 50 ml reaction tube with a sterile plunger of a 3 - 5 ml syringe and repeated flushing of the cell strainer with warm DPBS. Isolated splenocytes were centrifuged, DPBS decanted and the splenocyte pellets resuspended in 1 ml heat inactivated fetal bovine serum supplemented with 10% DMSO. Samples were immediately frozen at -80°C and stored until splenocyte samples from all mice were complete. d. Analysis of engraftment of human T lymphocytes in mouse spleens
Splenocytes from all mice were collected and frozen as decribed under Example 14.c. The complete collection of splenocyte samples was thawed at one time, all cells were washed twice with warm DPBS and lxlO6 splenocytes per sample were incubated with fluorescence- conjugated antibodies for 20 min at 4°C in the dark to detect the engraftment of human cells by anti-CD45 staining and the percentage of human T cells by anti-CD3, anti-CD4, and anti-CD8 staining. Flow cytometric analysis was conducted with a FACSCalibur (BD Biosciences, Heidelberg, Germany). Human T cell engraftment in both "PBMC" groups could be confirmed by high percentage of CD45 - CD3 double positive splenocytes as shown in Fig. 18D. e. Immunohistochemistry for the determination of target expression and T cell infiltration
Tumors were fixed after dissection using 4% buffered formaldehyde-solution (Roti-Histofix, Carl Roth, Karlsruhe, Germany) for 48 h at 4°C. The fixed tumors were divided into two parts and transferred into the automated vacuum tissue processor ASP200 for dehydration (Leica Microsystems GmbH, Wetzlar, Germany) followed by embedding into paraffin (Paraplast, Carl Roth, Karlsruhe, Germany) via the paraffin dispenser station MPS/C (Slee Medical GmbH, Mainz, Germany). For immunohistochemical stainings, 3 μπι thick sections of the formalin-fixed and paraffin-embedded tissues were generated using the rotary microtome RM2255 (Leica Microsystems GmbH, Wetzlar, Germany). Deparaffinization and re-hydrations were conducted in the bi-linear batch stainer StainMate Max (Thermo Fisher Scientific, Rockford, IL, USA) followed by heat-induced epitope retrieval in 10 mM citric buffer, pH6 with 0,05% Tween20 for 10 min at 120°C. Endogenous peroxidases were quenched subsequently using 0,3% H202 solution in PBS for 15 min (Carl Roth), followed by incubation with 10% goat serum in PBS (PAA Laboratories GmbH/GE Healthcare, Pasching, Austria) for 30min to block unspecific antibody binding sites. TAA Claudin 6 was detected by incubation with the polyclonal primary antibody Anti-Mouse Claudin 6 (C) Rabbit (IBL-America, Minneapolis, MN, USA) at 4°C over night; T cells were detected on consecutive sections using the polyclonal anti-CD3 AB (Abeam, Cambridge, UK) at 4°C over night followed by incubation with a Bright Vision polymer HRP- conjugated anti-rabbit secondary antibody (ImmunoLogic, Duiven, Netherlands). Binding reactions were visualized using the Vector NovaRED kit (Vector Laboratories Ltd., Peterborough, UK) according to the manufacturer's instructions, followed by hematoxylin counterstaining (Carl Roth), dehydration and mounting. Analysis and documentation were performed using either the Axio Imager M2 or the Mirax scanner (both Carl Zeiss Microscopy GmbH, Goettingen, Germany).
As shown in Fig. 19, highest T cell infiltration was detected in the tumors of the "PBMC/6PHU3" group by CD3 staining, especially in the border areas of CLDN6 expression. The heterogeneous expression pattern of TAA CLDN6 in the control groups (Fig. 19 A, B, C, and D) changed to more compact areas of CLDN6 expression in the tumors of the "PBMC/6PHU3" group as a result of the therapy (Fig. 19D).

Claims

A binding agent comprising at least two binding domains, wherein a first binding domain binds to claudin (CLDN) and a second binding domain binds to CD3.
The binding agent of claim 1 , wherein the binding agent is a bispecific molecule.
The binding agent of claim 2, wherein the bispecific molecule is a bispecific antibody.
The binding agent of claim 3, wherein the bispecific antibody is a bispecific single chain antibody.
The binding agent of any one of claims 1 to 4, wherein said claudin is expressed in a cancer cell.
The binding agent of any one of claims 1 to 5, wherein said claudin is expressed on the surface of a cancer cell.
The binding agent of any one of claims 1 to 6, wherein said claudin is selected from the group consisting of claudin 18.2 and claudin 6.
The binding agent of any one of claims 1 to 7, wherein said first binding domain binds to an extracellular domain of said claudin.
The binding agent of any one of claims 1 to 8, wherein said second binding domain binds to the epsilon-chain of CD3.
The binding agent of any one of claims 1 to 9, wherein said CD3 is expressed on the surface of a T cell.
The binding agent of any one of claims 1 to 10, wherein binding of said binding agent to CD3 on T cells results in proliferation and/or activation of said T cells, wherein said activated T cells preferably release cytotoxic factors, e.g. perforins and granzymes, and initiate cytolysis and apoptosis of cancer cells.
12. The binding agent of any one of claims 1 to 1 1 , wherein said binding to claudin and/or said binding to CD3 is a specific binding.
13. The binding agent of any one of claims 1 to 12, wherein the binding agent is in the format of a full-length antibody or an antibody fragment.
14. The binding agent of any one of claims 1 to 13, wherein the binding agent comprises a set of antibody variable domains, preferably four antibody variable domains, with at least two binding domains, wherein at least one binding domain binds to claudin and at least one binding domain binds to CD3.
15. The binding agent of any one of claims 1 to 14, wherein the binding agent comprises a variable domain of a heavy chain of an immunoglobulin (VH) with a specificity for a claudin antigen (VH(CLDN)), a variable domain of a light chain of an immunoglobulin (VL) with a specificity for a claudin antigen (VL(CLDN)), a variable domain of a heavy chain of an immunoglobulin (VH) with a specificity for CD3 (VH(CD3)), and a variable domain of a light chain of an immunoglobulin (VL) with a specificity for CD3 (VL(CD3)).
16. The binding agent of any one of claims 1 to 15, wherein the binding agent is in the format of a diabody that comprises a heavy chain variable domain connected to a light chain variable domain on the same polypeptide chain such that the two domains do not pair.
17. The binding agent of claim 16, wherein the diabody comprises two polypeptide chains, wherein one polypeptide comprises VH(CLDN) and VL(CD3) and the other polypeptide chain comprises VH(CD3) and VL(CLDN).
18. The binding agent of any one of claims 1 to 15, wherein the binding agent is in the format of a bispecific single chain antibody that consists of two scFv molecules connected via a linker peptide.
19. The binding agent of claim 18, wherein the heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are arranged, from N-terminus to C- terminus, in the order VH(CLDN)-VL(CLDN)-VH(CD3)-VL(CD3), VH(CD3)- VL(CD3)-VH(CLDN)-VL(CLDN) or VH(CD3)-VL(CD3)-VL(CLDN)-VH(CLDN).
20. The binding agent of claim 19, wherein said heavy chain variable regions (VH) and the corresponding light chain variable regions (VL) are connected via a long peptide linker, preferably, a peptide linker comprising the amino acid sequences (GGGGS)3 or VE(GGGGS)2GGVD .
21. The binding agent of claim 19 or 20, wherein said two VH-VL or VL-VH scFv units are connected via a short peptide linker, preferable a peptide linker comprising the amino acid sequence SGGGGS or GGGGS.
The binding agent of any one of claims 15 to 21 , wherein said CLDN is CLDN18.2 and said VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 8 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof or a variant of said amino acid sequence or fragment.
The binding agent of any one of claims 15 to 21, wherein said CLDN is CLDN6 and said VH(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CLDN) comprises an amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof or a variant of said amino acid sequence or fragment.
The binding agent of any one of claims 15 to 23, wherein said VH(CD3) comprises an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof or a variant of said amino acid sequence or fragment and the VL(CD3) comprises an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof or a variant of said amino acid sequence or fragment.
25. The binding agent of any one of claims 1 to 22 and 24, wherein said CLDN is CLDN18.2 and said binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38, 39, 40 and 41 or a fragment or variant thereof.
The binding agent of any one of claims 1 to 21, 23 and 24, wherein said CLDN is CLDN6 and said binding agent comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 42, 43, 44 and 45 or a fragment or variant thereof.
27. The binding agent of any one of claims 5 to 22, 24 and 25, wherein said cancer cells expressing CLDN18.2 are cancer cells of a cancer selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, cancer of the gallbladder and the metastasis thereof, a Krukenberg tumor, peritoneal metastasis and/or lymph node metastasis.
28. The binding agent of any one of claims 5 to 21, 23, 24 and 26, wherein said cancer cells expressing CLDN6 are cancer cells of a cancer selected from the group consisting of urinary bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum, in particular small bowel adenocarcinoma and adenocarcinoma of the ileum, testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as a teratocarcinoma or an embryonal carcinoma, in particular germ cell tumors of the testis, and the metastatic forms thereof.
29. The binding agent of any one of claims 1 to 28, wherein the binding agent has an N- terminal secretion signal and/or a C-terminal histidin epitope tag, preferable a six histidin epitope tag.
30. A recombinant nucleic acid which encodes a binding agent of any one of claims 1 to 29.
31. The recombinant nucleic acid of claim 30 which is in the form of a vector.
32. A host cell comprising a recombinant nucleic acid of claim 30 or 31.
33. The binding agent of any one of claims 1 to 29 or the recombinant nucleic acid of claim 30 or 31 for use in therapy, in particular for use in treating or preventing cancer.
34. A pharmaceutical composition comprising the binding agent of any one of claims 1 to 29 or the recombinant nucleic acid of claim 30 or 31.
35. A method of treating or preventing a cancer disease comprising administering to a patient the pharmaceutical composition of claim 34.
36. The binding agent or the recombinant nucleic acid of claim 33 or the method of claim 35, wherein cells of said cancer express a claudin to which said binding agent is capable of binding.
37. The binding agent, the recombinant nucleic acid or the method of claim 36, wherein said claudin is CLDN18.2 and said cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non small cell lung cancer (NSCLC), breast cancer, ovarian cancer, colon cancer, hepatic cancer, head-neck cancer, cancer of the gallbladder and the metastasis thereof, a Krukenberg tumor, peritoneal metastasis and/or lymph node metastasis.
38. The binding agent, the recombinant nucleic acid or the method of claim 36, wherein said claudin is CLDN6 and said cancer is selected from the group consisting of urinary bladder cancer, ovarian cancer, in particular ovarian adenocarcinoma and ovarian teratocarcinoma, lung cancer, including small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), in particular squamous cell lung carcinoma and adenocarcinoma, gastric cancer, breast cancer, hepatic cancer, pancreatic cancer, skin cancer, in particular basal cell carcinoma and squamous cell carcinoma, malignant melanoma, head and neck cancer, in particular malignant pleomorphic adenoma, sarcoma, in particular synovial sarcoma and carcinosarcoma, bile duct cancer, cancer of the urinary bladder, in particular transitional cell carcinoma and papillary carcinoma, kidney cancer, in particular renal cell carcinoma including clear cell renal cell carcinoma and papillary renal cell carcinoma, colon cancer, small bowel cancer, including cancer of the ileum, in particular small bowel adenocarcinoma and adenocarcinoma of the ileum, testicular embryonal carcinoma, placental choriocarcinoma, cervical cancer, testicular cancer, in particular testicular seminoma, testicular teratoma and embryonic testicular cancer, uterine cancer, germ cell tumors such as a teratocarcinoma or an embryonal carcinoma, in particular germ cell tumors of the testis, and the metastatic forms thereof.
PCT/EP2012/004712 2012-11-13 2012-11-13 Agents for treatment of claudin expressing cancer diseases Ceased WO2014075697A1 (en)

Priority Applications (41)

Application Number Priority Date Filing Date Title
PCT/EP2012/004712 WO2014075697A1 (en) 2012-11-13 2012-11-13 Agents for treatment of claudin expressing cancer diseases
JP2015542186A JP6499079B2 (en) 2012-11-13 2013-11-12 Agents for treating cancer diseases that express claudin
PCT/EP2013/003399 WO2014075788A1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
MX2015006003A MX369276B (en) 2012-11-13 2013-11-12 AGENTS FOR THE TREATMENT OF CANCER DISEASES THAT EXPRESS CLAUDIN.
RU2015122484A RU2678127C2 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
NZ707831A NZ707831A (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
EP20189087.8A EP3766903A3 (en) 2012-11-13 2013-11-12 Bispecific anti claudin xcd3 antibodies for treatment of claudin expressing cancer diseases
RU2019100107A RU2798990C2 (en) 2012-11-13 2013-11-12 Agents for the treatment of claudine-expressing cancer diseases
CN201380070299.1A CN105073776B (en) 2012-11-13 2013-11-12 Agents for the treatment of cancer diseases expressing claudin
KR1020247006822A KR20240033145A (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
UAA201805270A UA128182C2 (en) 2012-11-13 2013-11-12 AGENTS FOR THE TREATMENT OF CLAUDIN-EXPRESSING CANCER DISEASES
NZ746691A NZ746691A (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
IL282953A IL282953B2 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
BR122020024124-1A BR122020024124B1 (en) 2012-11-13 2013-11-12 AGENTS FOR THE TREATMENT OF CANCEROUS DISEASES EXPRESSING CLAUDIN
SG11201503593UA SG11201503593UA (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
KR1020157015900A KR102240664B1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
NZ748133A NZ748133A (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
CN201910208606.7A CN110144012A (en) 2012-11-13 2013-11-12 Agents for the treatment of cancer diseases expressing claudin
HK15110113.4A HK1209434A1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
BR112015010740-0A BR112015010740B1 (en) 2012-11-13 2013-11-12 AGENTS FOR THE TREATMENT OF CANCEROUS DISEASES EXPRESSING CLAUDIN
AU2013347184A AU2013347184B2 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
CA2890438A CA2890438C (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
KR1020217010605A KR102381936B1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
CA3169263A CA3169263A1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
KR1020227010407A KR102643443B1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
US14/442,445 US10093736B2 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
EP13789492.9A EP2920209B1 (en) 2012-11-13 2013-11-12 Agents for treatment of claudin expressing cancer diseases
UAA201505768A UA117741C2 (en) 2012-11-13 2013-12-11 Agents for treatment of claudin expressing cancer diseases
ZA2015/02737A ZA201502737B (en) 2012-11-13 2015-04-22 Agents for treatment of claudin expressing cancer diseases
IL238464A IL238464B (en) 2012-11-13 2015-04-26 Substances for the treatment of cancer diseases that express claudin
MX2020011710A MX2020011710A (en) 2012-11-13 2015-05-13 AGENTS FOR THE TREATMENT OF CANCER DISEASES THAT EXPRESS CLAUDIN.
MX2019012846A MX2019012846A (en) 2012-11-13 2015-05-13 AGENTS FOR THE TREATMENT OF CANCER DISEASES THAT EXPRESS CLAUDIN.
MX2020011716A MX2020011716A (en) 2012-11-13 2015-05-13 AGENTS FOR THE TREATMENT OF CANCER DISEASES THAT EXPRESS CLAUDIN.
AU2018211278A AU2018211278B2 (en) 2012-11-13 2018-08-02 Agents for treatment of claudin expressing cancer diseases
US16/117,197 US10717780B2 (en) 2012-11-13 2018-08-30 Agents for treatment of claudin expressing cancer diseases
JP2019046753A JP6799101B2 (en) 2012-11-13 2019-03-14 Agents for treating claudin-expressing cancer diseases
US16/898,892 US20200399370A1 (en) 2012-11-13 2020-06-11 Agents for Treatment of Claudin Expressing Cancer Diseases
JP2020192368A JP2021040641A (en) 2012-11-13 2020-11-19 Agents for treating claudin-expressing cancer diseases
US18/051,850 US20240228616A1 (en) 2012-11-13 2022-11-01 Agents for Treatment of Claudin Expressing Cancer Diseases
JP2022193268A JP2023022247A (en) 2012-11-13 2022-12-02 Agents for treatment of claudin expressing cancer diseases
JP2025003505A JP2025063140A (en) 2012-11-13 2025-01-09 Agents for treating cancer diseases expressing claudins

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2012/004712 WO2014075697A1 (en) 2012-11-13 2012-11-13 Agents for treatment of claudin expressing cancer diseases

Publications (1)

Publication Number Publication Date
WO2014075697A1 true WO2014075697A1 (en) 2014-05-22

Family

ID=47215490

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2012/004712 Ceased WO2014075697A1 (en) 2012-11-13 2012-11-13 Agents for treatment of claudin expressing cancer diseases

Country Status (1)

Country Link
WO (1) WO2014075697A1 (en)

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017008844A1 (en) * 2015-07-14 2017-01-19 Biontech Ag Peptide mimotopes of the cd3 t-cell co-receptor epsilon chain and uses thereof
KR20170023181A (en) * 2014-07-17 2017-03-02 카르스젠 테라퓨틱스 리미티드 Immunologic effector cell of targeted cld18a2, and preparation method and use thereof
WO2017096163A1 (en) * 2015-12-04 2017-06-08 Abbvie Stemcentrx Llc Novel anti-claudin antibodies and methods of use
EP3199548A4 (en) * 2014-09-26 2018-03-07 Attogen Biomedical (Suzhou) Inc. Ltd. Cervial cancer-related hpv e7 protein monoclonal antibody and use thereof
WO2018054484A1 (en) * 2016-09-23 2018-03-29 Biontech Ag Bispecific trivalent antibodies binding to claudin 6 or claudin18.2 and cd3 for treatment of claudin expressing cancer diseases
US10053511B2 (en) 2013-11-06 2018-08-21 Abbvie Stemcentrx Llc Anti-claudin antibodies and methods of use
WO2020135201A1 (en) * 2018-12-28 2020-07-02 四川科伦博泰生物医药股份有限公司 Antibody and use thereof
US10780021B2 (en) 2015-02-26 2020-09-22 Sio2 Medical Products, Inc. Cycloolefin polymer container with a scratch resistant and anti-static coating
WO2020191342A1 (en) * 2019-03-20 2020-09-24 The Regents Of The University Of California Claudin-6 antibodies and drug conjugates
WO2020191344A1 (en) 2019-03-20 2020-09-24 The Regents Of The University Of California Claudin-6 bispecific antibodies
US20200385460A1 (en) * 2013-07-31 2020-12-10 Biontech Ag Diagnosis and therapy of cancer involving cancer stem cells
WO2021027850A1 (en) * 2019-08-12 2021-02-18 I-Mab Biopharma Co., Ltd. Anti-claudin 18.2 and anti-4-1bb bispecific antibodies and uses thereof
WO2021200939A1 (en) * 2020-03-31 2021-10-07 Chugai Seiyaku Kabushiki Kaisha Claudin-6 targeting multispecific antigen-binding molecules and uses thereof
US11154615B2 (en) 2014-11-11 2021-10-26 Chugai Seiyaku Kabushiki Kaisha Library of antigen-binding molecules including modified antibody variable region
CN113784980A (en) * 2019-03-29 2021-12-10 东莞凡恩世生物医药有限公司 Humanized anti-Claudin18.2 chimeric antigen receptor and use thereof
EP3762031A4 (en) * 2018-03-08 2021-12-22 Phanes Therapeutics, Inc. ANTI-CLAUDINE ANTIBODIES 18.2 AND THEIR USES
EP3735463A4 (en) * 2018-01-05 2022-03-02 Chugai Seiyaku Kabushiki Kaisha CYTOTOXICITY-INDUCING THERAPEUTIC
KR20220033493A (en) 2019-07-10 2022-03-16 추가이 세이야쿠 가부시키가이샤 Claudine 6 Binding Molecules and Their Uses
WO2022096700A1 (en) * 2020-11-06 2022-05-12 Amgen Research (Munich) Gmbh Polypeptide constructs selectively binding to cldn6 and cd3
EP3878863A4 (en) * 2018-08-27 2022-06-22 Nanjing Sanhome Pharmaceutical Co., Ltd. Anti-claudin18.2 antibody and use thereof
EP3929214A4 (en) * 2019-05-30 2022-06-22 Shandong Boan Biotechnology Co., Ltd. ANTIBODY OR CHIMERIC ANTIGEN RECEPTOR TARGETING CLAUDIN 18.2
CN114907483A (en) * 2016-03-22 2022-08-16 国家医疗保健研究所 Humanized anti-claudin-1antibodies and uses thereof
WO2022266219A1 (en) * 2021-06-15 2022-12-22 Xencor, Inc. Heterodimeric antibodies that bind claudin18.2 and cd3
US11583590B2 (en) 2017-09-29 2023-02-21 Daiichi Sankyo Company, Limited Antibody-pyrrolobenzodiazepine derivative conjugate and method of use thereof for treating a tumor
EP3947689A4 (en) * 2019-03-27 2023-03-29 National Research Council of Canada ANTIGEN BINDING AGENTS THAT SPECIFICALLY BIND TO VARIANT III OF THE EPIDERMAL GROWTH FACTOR RECEPTOR
KR20230047009A (en) 2021-09-29 2023-04-06 추가이 세이야쿠 가부시키가이샤 Cytotoxicity-inducing thrapeutic agent for using in cancer treatment
CN115947851A (en) * 2022-12-19 2023-04-11 华润生物医药有限公司 Antibodies binding to CLDN18.2 and uses thereof
CN116178555A (en) * 2018-05-18 2023-05-30 礼新医药科技(上海)有限公司 Anti-claudin 18.2 antibody and use thereof
CN116327915A (en) * 2015-04-03 2023-06-27 佐马技术有限公司 Treatment of cancer using TGF-beta inhibitors and PD-1 inhibitors
RU2798988C2 (en) * 2016-09-23 2023-06-30 Бионтех Аг Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and cd3 for the treatment of oncological diseases with claudin expression
US11739144B2 (en) 2021-03-09 2023-08-29 Xencor, Inc. Heterodimeric antibodies that bind CD3 and CLDN6
US11739149B2 (en) 2013-11-11 2023-08-29 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule containing modified antibody variable region
US11952422B2 (en) 2017-12-05 2024-04-09 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule comprising altered antibody variable region binding CD3 and CD137
WO2024137619A1 (en) 2022-12-20 2024-06-27 Bolt Biotherapeutics, Inc. Anti-claudin, bis-benzimid azole sting agonist immunoconjugates, and uses thereof
WO2024173387A1 (en) 2023-02-14 2024-08-22 Bolt Biotherapeutics, Inc. Aza-benzazepine immunoconjugates, and uses thereof
EP4245317A4 (en) * 2020-11-10 2024-11-06 Shanghai Qilu Pharmaceutical Research and Development Centre Ltd. BISPECIFIC ANTIBODY FOR CLAUDIN 18A2 AND CD3 AND APPLICATION OF THE BISPECIFIC ANTIBODY
EP4223778A4 (en) * 2020-09-29 2024-11-06 Innovent Biologics (Singapore) Pte. Ltd. ANTI-CLAUDIN18.2 AND CD3 BISPECIFIC ANTIBODIES AND USE THEREOF
US12247071B2 (en) 2016-12-21 2025-03-11 Amgen Inc. Anti-TNF alpha antibody formulations
US12403202B2 (en) 2023-05-25 2025-09-02 The Regents Of The University Of California Dosage of claudin-6 conjugates for cancer treatment
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US12497450B2 (en) 2019-02-15 2025-12-16 Integral Molecular, Inc. Claudin 6 antibodies and uses thereof
WO2026050214A1 (en) 2024-08-27 2026-03-05 Bolt Biotherapeutics, Inc. Anti-claudin, tlr agonist immunoconjugates and uses thereof
KR102944460B1 (en) 2018-08-03 2026-03-27 암젠 리서치 (뮌헨) 게엠베하 Antibody constructs for CLDN18.2 and CD3

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1987004462A1 (en) 1986-01-23 1987-07-30 Celltech Limited Recombinant dna sequences, vectors containing them and method for the use thereof
WO1989001036A1 (en) 1987-07-23 1989-02-09 Celltech Limited Recombinant dna expression vectors
EP0338841A1 (en) 1988-04-18 1989-10-25 Celltech Limited Recombinant DNA methods, vectors and host cells
US20030118592A1 (en) 2001-01-17 2003-06-26 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
US20030133939A1 (en) 2001-01-17 2003-07-17 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
WO2004035607A2 (en) 2002-10-17 2004-04-29 Genmab A/S Human monoclonal antibodies against cd20
US20090004213A1 (en) 2007-03-26 2009-01-01 Immatics Biotechnologies Gmbh Combination therapy using active immunotherapy

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1987004462A1 (en) 1986-01-23 1987-07-30 Celltech Limited Recombinant dna sequences, vectors containing them and method for the use thereof
WO1989001036A1 (en) 1987-07-23 1989-02-09 Celltech Limited Recombinant dna expression vectors
EP0338841A1 (en) 1988-04-18 1989-10-25 Celltech Limited Recombinant DNA methods, vectors and host cells
US20030118592A1 (en) 2001-01-17 2003-06-26 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
US20030133939A1 (en) 2001-01-17 2003-07-17 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
WO2004035607A2 (en) 2002-10-17 2004-04-29 Genmab A/S Human monoclonal antibodies against cd20
US20090004213A1 (en) 2007-03-26 2009-01-01 Immatics Biotechnologies Gmbh Combination therapy using active immunotherapy

Non-Patent Citations (67)

* Cited by examiner, † Cited by third party
Title
"Green/Sambrook, Molecular Cloning", 2012
"Helvetica Chimica Acta", 1995, article "A multilingual glossary of biotechnological terms: (IUPAC Recommendations"
"Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, COLD SPRING HARBOR
"Monoclonal Antibodies For Cancer Detection And Therapy", 1985, ACADEMIC PRESS, article "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", pages: 303 - 16
"Vaccination of metastatic colorectal cancer patients with matured dendritic cells loaded with multiple major histocompatibility complex class I peptides", J IMMUNOTHER, vol. 30, 2007, pages 762 - 772
AMON ET AL.: "Monoclonal Antibodies And Cancer Therapy", 1985, ALAN R. LISS, INC., article "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", pages: 243 - 56
ANDERSEN ET AL.: "Cancer treatment: the combination of vaccination with other therapies", CANCER IMMUNOLOGY IMMUNOTHERAPY, vol. 57, no. 11, 2008, pages 1735 - 1743, XP019624403
ANDERSON, BLOOD, vol. 80, 1992, pages 2826 - 34
BASKAR ET AL.: "Cancer and radiation therapy: current advances and future directions", INT. J MED SCI., vol. 9, no. 3, 2012, pages 193 - 199
BENNY K.C., LO ANTIBODY ENGINEERING
BERZOFSKY ET AL.: "Fundamental Immunology", 1984, RAVEN PRESS, article "Antibody-Antigen Interactions"
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
BUONAGURO ET AL.: "Developments in virus-like particle-based vaccines for infectious diseases and cancer", EXPERT REV VACCINES, vol. 10, no. 11, 2011, pages 1569 - 83
CASTLE ET AL.: "Exploiting the mutanome for tumor vaccination", CANCER RES, vol. 72, no. 5, 2012, pages 1081 - 91, XP055231746, DOI: doi:10.1158/0008-5472.CAN-11-3722
CHAD MAY ET AL: "Advances in bispecific biotherapeutics for the treatment of cancer", BIOCHEMICAL PHARMACOLOGY, vol. 84, no. 9, 25 July 2013 (2013-07-25), pages 1105 - 1112, XP055071310, ISSN: 0006-2952, DOI: 10.1016/j.bcp.2012.07.011 *
CURRENT PROTOCOLS IN IMMUNOLOGY, 2012
CURRENT PROTOCOLS IN PROTEIN SCIENCE, 2012
FISCHER, R. ET AL., BIOL. CHEM., vol. 380, 1999, pages 825 - 839
GADRI ET AL.: "Synergistic effect of dendritic cell vaccination and anti-CD20 antibody treatment in the therapy of murine lymphoma", J IMMUNOTHER, vol. 32, no. 4, 2009, pages 333 - 40
GLENN E. MORRIS: "Epitope Mapping Protocols", METHODS IN MOLECULAR BIOLOGY
GUILLEN ET AL.: "Virus-like particles as vaccine antigens and adjuvants: application to chronic disease, cancer immunotherapy and infectious disease preventive strategies", PROCEDIA IN VACCINOLOGY, vol. 2, no. 2, 2010, pages 128 - 133
HELLSTROM ET AL.: "Controlled Drug Delivery", 1987, MARCEL DEKKER, INC., article "Antibodies For Drug Delivery", pages: 623 - 53
HIROOKA ET AL.: "A combination therapy of gemcitabine with immunotherapy for patients with inoperable locally advanced pancreatic cancer", PANCREAS, vol. 38, no. 3, 2009, pages E69 - 74
HOLLIGER, P. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448
HUSTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883
JONES, P. ET AL., NATURE, vol. 321, 1986, pages 522 - 525
KERSTIN FORTMÜLLER ET AL: "Effective targeting of prostate cancer by lymphocytes redirected by a PSMA * CD3 bispecific single-chain diabody", PROSTATE, WILEY-LISS, NEW YORK, NY, US, vol. 71, no. 6, 14 October 2010 (2010-10-14), pages 588 - 596, XP002648688, ISSN: 0270-4137, [retrieved on 20101013], DOI: 10.1002/PROS.21274 *
KIPRIYANOV, INT. J. CANCER, vol. 77, 1998, pages 763 - 772
KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495
KRAUS ET AL.: "Methods in Molecular Biology series", RECOMBINANT ANTIBODIES FOR CANCER THERAPY
KUBY; JANIS: "Immunology", 1992, W. H. FREEMAN AND COMPANY
LECHNER ET AL.: "Chemokines, costimulatory molecules and fusion proteins for the immunotherapy of solid tumors", IMMUNOTHERAPY, vol. 3, no. 11, 2011, pages 1317 - 1340
LIN; WEISS, JOURNAL OF CELL SCIENCE, vol. 114, 2001, pages 243 - 244
LISETH ET AL.: "Combination of intensive chemotherapy and anticancer vaccines in the treatment of human malignancies: the hematological experience", J BIOMED BIOTECHNOL., 2010, pages 6920979
LUTTERBUESE, R ET AL., PROC. NATL. ACAD. SCI USA., vol. 107, no. 28, 13 July 2010 (2010-07-13), pages 12605 - 10
LUTTERBUESE, R ET AL., PROC. NATL. ACAD. SCI. USA., vol. 107, no. 28, 13 July 2010 (2010-07-13), pages 12605 - 10
M LAL-NAG ET AL: "Claudin-6: a novel receptor for CPE-mediated cytotoxicity in ovarian cancer", ONCOGENESIS, vol. 1, no. 11, 1 November 2012 (2012-11-01), pages e33, XP055071624, DOI: 10.1038/oncsis.2012.32 *
MORRISON, S., SCIENCE, vol. 229, 1985, pages 1202
NEDDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
NIIMI, MOL. CELL. BIOL., vol. 21, 2001, pages 7380 - 90
OLWYN M. R. WESTWOOD; FRANK C. HAY, EPITOPE MAPPING: A PRACTICAL APPROACH, vol. 248
PEARSON; LIPMAN, PROC. NATL ACAD. SCI. USA, vol. 85, 1988, pages 2444
PENNA ET AL: "Antitumor x anti-CD3 bifunctional antibodies redirect T-cells activated in vivo with staphylococcal enterotoxin B to neutralize pulmonary metastases.", CANCER RESEARCH, vol. 54, no. 10, 1 May 1994 (1994-05-01), pages 2738 - 2743, XP055071351, ISSN: 0008-5472 *
POLJAK, R. J. ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123
POLLOCK ET AL., J. IMMUNOL. METH., vol. 231, 1999, pages 147 - 157
QUEEN, C. ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 86, 1989, pages 10029 - 10033
QUOIX ET AL.: "Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial", LANCET ONCOL., vol. 12, no. 12, 2011, pages 1125 - 33, XP055079143, DOI: doi:10.1016/S1470-2045(11)70259-5
RAPOPORT ET AL.: "Combination immunotherapy using adoptive T-cell transfer and tumor antigen vaccination on the basis of hTERT and survivin after ASCT for myeloma", BLOOD, vol. 117, no. 3, 2011, pages 788 - 97
RIECHMANN, L. ET AL., NATURE, vol. 332, 1998, pages 323 - 327
ROSSI ET AL., AM. J. CLIN. PATHOL., vol. 124, 2005, pages 295
SAHIN U. ET AL., CLIN CANCER RES., vol. 14, no. 23, 1 December 2008 (2008-12-01), pages 7624 - 34
SAHIN UGUR ET AL: "Claudin-18 splice variant 2 is a pan-cancer target suitable for therapeutic antibody development", CLINICAL CANCER RESEARCH, THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 14, no. 23, 1 December 2008 (2008-12-01), pages 7624 - 7634, XP002588324, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-08-1547 *
SCATCHARD ET AL., ANN N.Y. ACAD. SCL, vol. 51, 1949, pages 660
SCHOENFELD; DRANOFF: "Anti-angiogenesis immunotherapy", HUM VACCIN, vol. 9, 2011, pages 976 - 81
SMITH; WATERMAN, ADS APP. MATH., vol. 2, 1981, pages 482
SORENSEN; THOMPSEN: "Virus-based immunotherapy of cancer: what do we know and where are we going", APMIS, vol. 115, no. 11, 2007, pages 1177 - 93
SPIEKER-POLET ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 92, 1995, pages 9348
THORPE ET AL.: "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", IMMUNOL. REV., vol. 62, 1982, pages 119 - 58, XP001179872, DOI: doi:10.1111/j.1600-065X.1982.tb00392.x
THORPE: "Monoclonal Antibodies '84: Biological And Clinical Applications", 1985, article "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", pages: 475 - 506
THORSTEN KLAMP ET AL: "Highly Specific Auto-Antibodies against Claudin-18 Isoform 2 Induced by a Chimeric HBcAg Virus-Like Particle Vaccine Kill Tumor Cells and Inhibit the Growth of Lung Metastases", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US; BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US, vol. 71, no. 2, 15 January 2011 (2011-01-15), pages 516 - 527, XP002678744, ISSN: 0008-5472, [retrieved on 20110111], DOI: 10.1158/0008-5472.CAN-10-2292 *
VAN DUIN ET AL.: "Triggering TLR signaling in vaccination", TRENDS IN IMMUNOLOGY, vol. 27, no. 1, 2005, pages 49 - 55, XP028058539, DOI: doi:10.1016/j.it.2005.11.005
VERMA, R. ET AL., J. IMMUNOL. METH., vol. 216, 1998, pages 165 - 181
WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546
WELSCHOF; KRAUS, RECOMBINANT ANTIBODES FOR CANCER THERAPY
WU ET AL., NAT. BIOTECHNOLOGY, vol. 25, no. 11, 2007
YAMADA: "Peptide-based cancer vaccine therapy for prostate cancer, bladder cancer, and malignant glioma", NIHON RINSHO, vol. 69, no. 9, 2011, pages 1657 - 61
ZHANG ET AL.: "Targeting cancer with small molecule kinase inhibitors", NATURE REVIEWS CANCER, vol. 9, 2009, pages 28 - 39, XP002570143, DOI: doi:10.1038/NRC2559

Cited By (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12522669B2 (en) 2010-11-30 2026-01-13 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US12479929B2 (en) 2010-11-30 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Cytotoxicity-inducing therapeutic agent
US20200385460A1 (en) * 2013-07-31 2020-12-10 Biontech Ag Diagnosis and therapy of cancer involving cancer stem cells
US11795218B2 (en) * 2013-07-31 2023-10-24 Biontech Ag Diagnosis and therapy of cancer involving cancer stem cells
US10053511B2 (en) 2013-11-06 2018-08-21 Abbvie Stemcentrx Llc Anti-claudin antibodies and methods of use
US11739149B2 (en) 2013-11-11 2023-08-29 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule containing modified antibody variable region
US12479916B2 (en) 2013-11-11 2025-11-25 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule containing modified antibody variable region
KR101950747B1 (en) 2014-07-17 2019-02-21 카르스젠 테라퓨틱스 리미티드 Immunologic effector cell of targeted cld18a2, and preparation method and use thereof
CN120137056A (en) * 2014-07-17 2025-06-13 恺兴生命科技(上海)有限公司 T lymphocytes targeting CLD18A2 and preparation method and application thereof
KR20170023181A (en) * 2014-07-17 2017-03-02 카르스젠 테라퓨틱스 리미티드 Immunologic effector cell of targeted cld18a2, and preparation method and use thereof
EP3199548A4 (en) * 2014-09-26 2018-03-07 Attogen Biomedical (Suzhou) Inc. Ltd. Cervial cancer-related hpv e7 protein monoclonal antibody and use thereof
US11154615B2 (en) 2014-11-11 2021-10-26 Chugai Seiyaku Kabushiki Kaisha Library of antigen-binding molecules including modified antibody variable region
US12234573B2 (en) 2014-11-11 2025-02-25 Chugai Seiyaku Kabushiki Kaisha Library of antigen-binding molecules including modified antibody variable region
US10780021B2 (en) 2015-02-26 2020-09-22 Sio2 Medical Products, Inc. Cycloolefin polymer container with a scratch resistant and anti-static coating
CN116327915A (en) * 2015-04-03 2023-06-27 佐马技术有限公司 Treatment of cancer using TGF-beta inhibitors and PD-1 inhibitors
WO2017008844A1 (en) * 2015-07-14 2017-01-19 Biontech Ag Peptide mimotopes of the cd3 t-cell co-receptor epsilon chain and uses thereof
US11046745B2 (en) 2015-07-14 2021-06-29 BioNTech SE Peptide mimotopes of the CD3 T-cell co-receptor epsilon chain and uses thereof
CN108473588A (en) * 2015-12-04 2018-08-31 艾伯维施特姆森特克斯有限责任公司 Novel anti-sealing protein antibodies and application method
WO2017096163A1 (en) * 2015-12-04 2017-06-08 Abbvie Stemcentrx Llc Novel anti-claudin antibodies and methods of use
CN114907483A (en) * 2016-03-22 2022-08-16 国家医疗保健研究所 Humanized anti-claudin-1antibodies and uses thereof
CN110023336A (en) * 2016-09-23 2019-07-16 生物技术公司 Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and CD3 for the treatment of claudin expressing cancer diseases
US11787862B2 (en) 2016-09-23 2023-10-17 BioNTech SE Bispecific trivalent antibodies binding to Claudin6 or Claudin18.2 and CD3 for treatment of Claudin expressing cancer diseases
KR102537091B1 (en) * 2016-09-23 2023-05-31 비온테크 에스이 A bispecific trivalent antibody that binds to claudin6 or claudin18.2 and CD3 for the treatment of claudin expressing cancer disease
CN110023336B (en) * 2016-09-23 2024-05-17 生物技术公司 Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and CD3 for use in the treatment of claudin-expressing cancer diseases
WO2018054484A1 (en) * 2016-09-23 2018-03-29 Biontech Ag Bispecific trivalent antibodies binding to claudin 6 or claudin18.2 and cd3 for treatment of claudin expressing cancer diseases
RU2798988C2 (en) * 2016-09-23 2023-06-30 Бионтех Аг Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and cd3 for the treatment of oncological diseases with claudin expression
EP4043494A1 (en) * 2016-09-23 2022-08-17 BioNTech SE Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and cd3 for treatment of claudin expressing cancer diseases
AU2017331331B2 (en) * 2016-09-23 2022-03-10 Astellas Pharma Inc. Bispecific trivalent antibodies binding to claudin6 or claudin18.2 and cd3 for treatment of claudin expressing cancer diseases
WO2018054973A1 (en) * 2016-09-23 2018-03-29 Biontech Ag Bispecific trivalent antibodies binding to claudin6 or claudin18.2 and cd3 for treatment of claudin expressing cancer diseases
KR20190052002A (en) * 2016-09-23 2019-05-15 비온테크 아게 Claudin 6 or Claudin 18.2 for the treatment of claudin-expressing cancer disease and a bispecific trivalent antibody that binds to CD3
US12247071B2 (en) 2016-12-21 2025-03-11 Amgen Inc. Anti-TNF alpha antibody formulations
US12350344B2 (en) 2017-09-29 2025-07-08 Daiichi Sankyo Company, Limited Methods of treating a tumor by administering a claudin-6 (CLDN6) or CLDN9 antibody-pyrrolobenzodiazepine derivative conjugate
US12606634B2 (en) 2017-09-29 2026-04-21 Daiichi Sankyo Company, Limited Antibody-pyrrolobenzodiazepine derivative conjugate which binds caludin-6 and claudin-9
US11628223B2 (en) 2017-09-29 2023-04-18 Daiichi Sankyo Company, Limited Antibody-drug conjugates comprising substituted benzo[e]pyrrolo[1,2-α][1,4]diazepines
US12246196B2 (en) 2017-09-29 2025-03-11 Daiichi Sankyo Company, Limited Antibody-drug conjugates comprising substituted benzo[e]pyrrolo[1,2-a][1,4]diazepines
US11583590B2 (en) 2017-09-29 2023-02-21 Daiichi Sankyo Company, Limited Antibody-pyrrolobenzodiazepine derivative conjugate and method of use thereof for treating a tumor
US11952422B2 (en) 2017-12-05 2024-04-09 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule comprising altered antibody variable region binding CD3 and CD137
EP3735463A4 (en) * 2018-01-05 2022-03-02 Chugai Seiyaku Kabushiki Kaisha CYTOTOXICITY-INDUCING THERAPEUTIC
EP3762031A4 (en) * 2018-03-08 2021-12-22 Phanes Therapeutics, Inc. ANTI-CLAUDINE ANTIBODIES 18.2 AND THEIR USES
US11555070B2 (en) 2018-03-08 2023-01-17 Phanes Therapeutics, Inc. Anti-claudin 18.2 antibodies and uses thereof
CN116178555A (en) * 2018-05-18 2023-05-30 礼新医药科技(上海)有限公司 Anti-claudin 18.2 antibody and use thereof
KR102944460B1 (en) 2018-08-03 2026-03-27 암젠 리서치 (뮌헨) 게엠베하 Antibody constructs for CLDN18.2 and CD3
EP3878863A4 (en) * 2018-08-27 2022-06-22 Nanjing Sanhome Pharmaceutical Co., Ltd. Anti-claudin18.2 antibody and use thereof
CN113166246A (en) * 2018-12-28 2021-07-23 四川科伦博泰生物医药股份有限公司 Antibody and application thereof
US12297265B2 (en) 2018-12-28 2025-05-13 Sichuan Kelun-Biotech Biopharmaceutical Co., Ltd. Antibody and use thereof
CN113166246B (en) * 2018-12-28 2024-10-18 四川科伦博泰生物医药股份有限公司 An antibody and its use
WO2020135201A1 (en) * 2018-12-28 2020-07-02 四川科伦博泰生物医药股份有限公司 Antibody and use thereof
US12497450B2 (en) 2019-02-15 2025-12-16 Integral Molecular, Inc. Claudin 6 antibodies and uses thereof
WO2020191342A1 (en) * 2019-03-20 2020-09-24 The Regents Of The University Of California Claudin-6 antibodies and drug conjugates
EP3941944A4 (en) * 2019-03-20 2022-11-30 The Regents of the University of California BISPECIFIC CLAUDIN-6 ANTIBODIES
WO2020191344A1 (en) 2019-03-20 2020-09-24 The Regents Of The University Of California Claudin-6 bispecific antibodies
US12065489B2 (en) 2019-03-20 2024-08-20 The Regents Of The University Of California Claudin-6 antibodies and drug conjugates
US12576133B2 (en) 2019-03-27 2026-03-17 National Research Council Of Canada Antigen-binding agents that specifically bind epidermal growth factor receptor variant III
EP3947689A4 (en) * 2019-03-27 2023-03-29 National Research Council of Canada ANTIGEN BINDING AGENTS THAT SPECIFICALLY BIND TO VARIANT III OF THE EPIDERMAL GROWTH FACTOR RECEPTOR
CN113784980B (en) * 2019-03-29 2024-04-30 凡恩世制药(北京)有限公司 Humanized anti-Claudin18.2 chimeric antigen receptor and its use
CN113784980A (en) * 2019-03-29 2021-12-10 东莞凡恩世生物医药有限公司 Humanized anti-Claudin18.2 chimeric antigen receptor and use thereof
EP3929214A4 (en) * 2019-05-30 2022-06-22 Shandong Boan Biotechnology Co., Ltd. ANTIBODY OR CHIMERIC ANTIGEN RECEPTOR TARGETING CLAUDIN 18.2
US12312402B2 (en) 2019-05-30 2025-05-27 Shandong Boan Biotechnology Co., Ltd. Antibody or chimeric antigen receptor which targets Claudin 18.2
US12528863B2 (en) 2019-07-10 2026-01-20 Chugai Seiyaku Kabushiki Kaisha Claudin-6 binding molecules and uses thereof
EP3997230A4 (en) * 2019-07-10 2023-08-02 Chugai Seiyaku Kabushiki Kaisha CLAUDIN-6 BINDING MOLECULES AND THEIR USES
KR20220033493A (en) 2019-07-10 2022-03-16 추가이 세이야쿠 가부시키가이샤 Claudine 6 Binding Molecules and Their Uses
WO2021027850A1 (en) * 2019-08-12 2021-02-18 I-Mab Biopharma Co., Ltd. Anti-claudin 18.2 and anti-4-1bb bispecific antibodies and uses thereof
US12577313B2 (en) 2019-08-12 2026-03-17 I-Mab Biopharma Us Limited Anti-claudin 18.2 and anti-4-1BB bispecific antibodies and uses thereof
US11261259B2 (en) 2019-08-12 2022-03-01 I-Mab Biopharma Us Limited Anti-claudin 18.2 and anti-4-1BB bispecific antibodies and uses thereof
WO2021200939A1 (en) * 2020-03-31 2021-10-07 Chugai Seiyaku Kabushiki Kaisha Claudin-6 targeting multispecific antigen-binding molecules and uses thereof
EP4126956A4 (en) * 2020-03-31 2024-04-24 Chugai Seiyaku Kabushiki Kaisha MULTISPECIFIC ANTIGEN-BINDING MOLECULES TARGETING CLAUDIN 6 AND THEIR USES
TWI900776B (en) * 2020-03-31 2025-10-11 日商中外製藥股份有限公司 Claudin-6 targeting multispecific antigen-binding molecules and uses thereof
JP2021168648A (en) * 2020-03-31 2021-10-28 中外製薬株式会社 Multispecific antigen-binding molecule targeting claudin 6 and its use
TWI770917B (en) * 2020-03-31 2022-07-11 日商中外製藥股份有限公司 Claudin-6 targeting multispecific antigen-binding molecules and uses thereof
KR20210143923A (en) 2020-03-31 2021-11-29 추가이 세이야쿠 가부시키가이샤 Multispecific antigen binding molecules targeting clodin-6 and uses thereof
KR20220149774A (en) 2020-03-31 2022-11-08 추가이 세이야쿠 가부시키가이샤 Claudin-6 targeting multispecific antigen-binding molecules and uses thereof
CN115397855A (en) * 2020-03-31 2022-11-25 中外制药株式会社 Claudin-6 targeted multispecific antigen binding molecules and uses thereof
JP2022009816A (en) * 2020-03-31 2022-01-14 中外製薬株式会社 Multispecific antigen binding molecules targeting claudin 6 and uses thereof
EP4223778A4 (en) * 2020-09-29 2024-11-06 Innovent Biologics (Singapore) Pte. Ltd. ANTI-CLAUDIN18.2 AND CD3 BISPECIFIC ANTIBODIES AND USE THEREOF
AU2021352532A9 (en) * 2020-09-29 2025-03-13 Fortvita Biologics (Singapore) Pte.Ltd. Anti-claudin18.2 and cd3 bispecific antibody and use thereof
AU2021352532B2 (en) * 2020-09-29 2026-01-15 Fortvita Biologics (Singapore) Pte.Ltd. Anti-claudin18.2 and cd3 bispecific antibody and use thereof
WO2022096700A1 (en) * 2020-11-06 2022-05-12 Amgen Research (Munich) Gmbh Polypeptide constructs selectively binding to cldn6 and cd3
EP4245317A4 (en) * 2020-11-10 2024-11-06 Shanghai Qilu Pharmaceutical Research and Development Centre Ltd. BISPECIFIC ANTIBODY FOR CLAUDIN 18A2 AND CD3 AND APPLICATION OF THE BISPECIFIC ANTIBODY
US11739144B2 (en) 2021-03-09 2023-08-29 Xencor, Inc. Heterodimeric antibodies that bind CD3 and CLDN6
US12398207B2 (en) 2021-03-09 2025-08-26 Xencor, Inc. Heterodimeric antibodies that bind CD3 and CLDN6
WO2022266219A1 (en) * 2021-06-15 2022-12-22 Xencor, Inc. Heterodimeric antibodies that bind claudin18.2 and cd3
EP4410308A4 (en) * 2021-09-29 2025-10-08 Chugai Pharmaceutical Co Ltd CytOTOxicity-inducing therapeutic for use in the treatment of cancer
KR20250007466A (en) 2021-09-29 2025-01-14 추가이 세이야쿠 가부시키가이샤 Cytotoxicity-inducing thrapeutic agent for using in cancer treatment
KR20230047009A (en) 2021-09-29 2023-04-06 추가이 세이야쿠 가부시키가이샤 Cytotoxicity-inducing thrapeutic agent for using in cancer treatment
CN115947851B (en) * 2022-12-19 2024-02-13 华润生物医药有限公司 Antibodies that bind CLDN18.2 and uses thereof
CN115947851A (en) * 2022-12-19 2023-04-11 华润生物医药有限公司 Antibodies binding to CLDN18.2 and uses thereof
WO2024137619A1 (en) 2022-12-20 2024-06-27 Bolt Biotherapeutics, Inc. Anti-claudin, bis-benzimid azole sting agonist immunoconjugates, and uses thereof
WO2024173387A1 (en) 2023-02-14 2024-08-22 Bolt Biotherapeutics, Inc. Aza-benzazepine immunoconjugates, and uses thereof
US12403202B2 (en) 2023-05-25 2025-09-02 The Regents Of The University Of California Dosage of claudin-6 conjugates for cancer treatment
WO2026050214A1 (en) 2024-08-27 2026-03-05 Bolt Biotherapeutics, Inc. Anti-claudin, tlr agonist immunoconjugates and uses thereof

Similar Documents

Publication Publication Date Title
US20240228616A1 (en) Agents for Treatment of Claudin Expressing Cancer Diseases
US20240158501A1 (en) Bispecific trivalent antibodies binding to claudin6 or claudin18.2 and cd3 for treatment of claudin expressing cancer diseases
EP2920209B1 (en) Agents for treatment of claudin expressing cancer diseases
US20260035458A1 (en) Bispecific binding agents binding to cldn18.2 and cd3
AU2020396896A1 (en) Antibodies against PD-L1 and methods of use thereof
RU2798990C2 (en) Agents for the treatment of claudine-expressing cancer diseases
HK40078730A (en) Bispecific trivalent antibodies binding to claudin 6 or claudin 18.2 and cd3 for treatment of claudin expressing cancer diseases
HK40043784A (en) Bispecific anti claudin xcd3 antibodies for treatment of claudin expressing cancer diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12788127

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 28/08/2015)

122 Ep: pct application non-entry in european phase

Ref document number: 12788127

Country of ref document: EP

Kind code of ref document: A1