WO2014062442A1 - Use of microrna for assessing fertility in a female patient - Google Patents

Abstract

Disclosed are methods of assessing fertility in a female patient by detecting miRNA expression in. a sample from the female patient. The methods may be utilized to assess fertility prior to implanting an embryo in the female patient. The methods also may be utilized to diagnose and treat the female patient for infertility.

Description

USE OF M1CRORNA FOR ASSESSING FERTI LITY IN A FEMALE PATIENT

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[00013 The present application claims the benefit of priority under 35 U.^'S.C. § 1 1 (e) to U.S. Provisional Patent Application No. 61/713,978, filed o October 15, 2012, the content of which is incorporated herein by reference in its entirety.

FIELD

[0002] The field of the invention relates to microRNAs and the use thereof for assessing fertilit in a female patient, to particular, the field of the invention relates to the analysis of expressed microRNA in a sample from a female patient for assessing uterine .receptivity, for example in those undergoing assisted reproductive treatment, and for evaluating endometrial receptivity in female patients otherwise diagnosed with unexplained infertility.

BACKGROUND

[0003] MicroRNAs (miRNAs), also known as "mature raiRNA" are small

(approximately 18-24 nucleotides in length), non-coding R A molecules encoded in the genomes of plants and animals, in certain instances, highly conserved, endogenously expressed miRNAs regulate the expression, of genes by binding to the 3 -untra«slated regions (3 -UTR) of specific n RNAs. More than 1000 different miRNAs have been identified in plants and animals. Certain mature miRNAs appear to originate from long endogenous primary miR.NA transcripts (also known as pfi-miRNAs, pri-mirs, pri-miRs or pri-pre-miRNAs) that are often hundreds of nucleotides in length (Lee, et al., EMBO J., 2002, 21(17), 4663-4670). Functional analyses of miRNAs have revealed that these small non-coding R As contribute to different physiological processes in animals, including developmental timing, organogenesis, differentiation, patterning, embryogenesis, growth control, and programmed cell death. Examples of particular processes in which miRNAs participate include stem cell differentiation, neurogenesis, angiogenesis, hematopo.ies.is, and exocytosis (reviewed by Alvarez-Garcia and Mtska, Development, 2005, 132, 4653-4662). Here, miRNAs have- been identified whose expression is associated with female fertiUtity and in particular are indicative that a female patient has entered the window of implantation and is a suitable candidate for embryo implantation, for example, with respect to an embryo that has been obtained via in vitro fertilization of an oocyte.

SUMMARY

[0004] Disclosed are methods for utilizing mi NAs for assessing fertility in a female patient. The methods may include assessing uterine receptivity in the female patient and diagnosing infertility in the female patient via detecting expression of one or more miRNAs in sample from the female patient. In particular, the methods may include utilizing miRNAs in order to assess whether a female patient has entered the window of implantation. The disclosed methods of assessment may include assessing the likelihood of success for implantation of an embryo into the female patient, for example, where the embryo has been obtained via in vitro fertilization of an oocyte. Hie methods further may include implanting an embryo obtained via in vitro fertilization of an oocyte into a patient who has been assessed by the method and has been selected based on an assessment that the patient, is within the window of implantation.. Where a patient has been diagnosed with unexplained infertility based on detecting expression of one or more miRNAs, the disciosed methods further may include treating the female patient for the unexplained infertility.

[0005] The disclosed methods may be practiced by. (a) requesting a test providing results of an analysis to determine whether a female patient is expressing mlRNA in a biological sample; and (b) implanting an embryo in the female patient based on the results of the tes The disclosed methods a!so may be practiced by (a) requesting a test providing results of an analysis to determine whether a female patient is expressing mi NA in a biological sample; and (b) administering treatment to the female patient for infertility based on the results of the test.

[0006] Suitable miRNAs for the disclosed methods may include, but are not limited to hsa-miR- 17, hsa-miR- 19, has-miR-l9a, hsa-miR- 39b, hsa-miR- 20a, hsa-miR-24, hsa-miR-25, hsa-miR.-26b, hsa-miR~26b#, hsa-miR-27b, hsa-miR-29b, hsa-miR-29b~l , hsa-miR-29b-2, hsa- miR-30a-5p, hsa-mtR-SOb, ^'hsa-miR-30c, hsa-miR-3Qc-I, hsa-miR -3Cfc-2, hsa-raiR- 1, hsa-miR- 92a, hsanmiR-93, hsa-miR- 106, hsa-miR-106a, hsa-miR- 106b, hsa~miR~140-5p, hsa-miR- 141, hsa-miR- 146b-5p, has-miRNA- 148a, hsa-miR- 149, hsa-miR-l51-3p, hsa-miR- 15 l-5p, has- 155, hsa-ffiIR-182#, hsa-miR- 19.1 , lisa-niiS -192, hsa-miR-t93b, hsa-miR-200c, hsa-miR-206, hsa- miR-302a, nsa-rniR-302a#, h$a-miR-302b, hsa~miR~302b#, hsa-miR-302c, hsa-niiR-302d, hsa~ raiR-320, hsa-rmR-339, hsa~miR~339-3p, hsa-miR-345, hsa-miR~346, hsa-miR-347, hsa-miR- 362-3p, hsa-miR-367, hsa-mi -37 -3p, hsa-miR-372, hsa~miR~3?3, hsa~raiR-374a, hsa-miR- 376a, hsa.-miR-376a, hsa-mi.R-376a-l, hsa-miR.~376a-2_s hsa-miR-378, fcas~miR-3SO~5p, hsa- tniR-454, hsa-mIR-484, hsa-miR -487b, hsa-miR-494, hsa-mtR-500, bsa-.miRr509-.5p, hsa-miR- 512-1, bsa-miR-512-2, hsa-miR-512-3p, hsa-miR-512-5p, hsa-miR-5I7e, hsa-trtiR-5 8a-l, hsa- miR-5l8a-2, hsa-raiR-518a-3p, hsa-.miR.-518c, hsa-miR-518d, hsa-.miR-518d-5p, hsa-raiR-518e, hsa-miR-519a, hsa-miR-520c-3p, bsa-miR-520D-3p, hsa-miR-520d-5p, hsa-niiR-522, hsa-miR- 525-3p, tea-mi R-548a-3p, tea-mi R-S48c-3p, hsa-mir-548d-3p, tea-miR-566, hsa-miR-576-3p, hsa-miR-590-3p, lisa-miR-597, hsa-KviR-601, hsa-miR-603, hsa-miR-604, hsa-miR-645, hsa- miR-660, hsa-miR-720, hsa-miR-875-5p, hsa-miR-886-3p, tea-mi R-886-5p, hsa-miR-1244, hsa-miR- 1260, hsa-miR- 274 A, hsa-m.iR-1275, hsa-miR-1276, and combinations thereof, to some embodiments, the disclosed methods may include detecting one or more nucleic acid molecules co.mp.risi.ng a sequence of any of SEQ ID NOs: 1-103 or combinations thereof.

[0007] in some embodiments, the methods of assessment include detecting extracellular expression of one or more niiRNAs. In other embodiments, the methods of assessment include detecting intracellular expression of one or more niiRNAs. Accordingly, the tests in the disclosed methods may provide the results of an analysis to determine whether the female patient is expressing rruRNA extracelhilarly and/or intraceliularly in a. biological sample.

[0008] in the disclosed methods, the miRNAs may be detected in any suitable biological sample. Suitable biological samples may include blood or blood products such as a serum and plasma. Suitable biological samples may include biological samples of female reproductive organs such as the endomeirium/cervica! mucous. Accordingly, the tests in the disclosed methods may provide the results of an analysis to determine whether the female patient is expressing miRNA in biological samples that may include, but are not limited to, samples of blood or blood products such as a serum and plasma, and samples from female reproductive organs such as samples from the endometriunvcervical mucous.

[0009] The methods may include detecting expression of one or more miR As i an endometrial biological, sample from the patient where the miRNAs are selected from a group consisting of hsa-miR.-30b. hsa-m.iR.-30d, hsa~nii ~31 , hsa~miR~S 35a. hsa-mtR-145, hsa-miR- 203, hsa-miR.-503, or combinations thereof. Accordingly, the tests in the disclosed methods may provide the results of an analysis to determine whether the temale patient is expressing miRN A selected from a group consisting of hsa-miR-30b, hsa-miR-30d, hsa-miR-31. hsa-miR- 1 5a, hsa- miR-1.45, hsa-miR-203, hsa~miR~503, or combinations thereof in a biological sample. Based on the results of the test, the methods further may include implanting an embryo in the female patient based on the results of the test, or administering treatment to the female patient for infertility based on the results of the test,

BRIEF DESCRIPTION OF THE FIGURES

[0010] Figure . . Endometrial and serum miRN A changes in the window of implantation. (A) Differentially regulated endometrial miRNAs (see also Table 2) were assayed in the serum. Data are reported as the fold change in expression between the mid-secretory and proliferative and phases as determined by AACT method. * P < 0.05 (B) Distribution of serum expression of miR-3.1 in patient samples on CD 7-10 and CD 20-24.

[0011] Figure 2, Downregu!atkm of immunomodulatory miR-31 targets m the endometrium during the window of implantation. (A) Fold change in endometrial expression of miR-31 and its validated targets CXCL12, E-seieetra, and FOXP3 during the window of implantation relative to the proliferative phase. (B) Schematic of dynamic changes in miR-31 and its targets in the endometrium and serum during the menstrual cycle. Our data demonstrate significant upreguiation of miR-3.1 during the window of implantation in both the endometrium and serum. Conversely,. miR-31 targets of FQXP3, CXCL12, and E-selectin were decreased in the endometrium. Also depicted are findings by Arruvito ei aL, who quantitated FOXP3- positive Treg cells in peripheral blood throughout the menstrual cycle. (See Arruvito et αί,. Journal of Immunology 2007; 178:2572-8).

DETAILED DESCRIPTIO

[0012] The disclosed subject matter further may be described utilizing terms as defined below,

[0013] Unless otherwise specified or indicated b context the terms " ", "aiT, and "the" mean "one or more." For example, a "roiRNA" should be interpreted to mean "one or more m As."

[0014J As used herein, "about", "approximately " "substantially," and "significandy" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, "about'^' and "approximately" will mean plus or minus <10% of the particular term and "substantially" and "significantly" will mean plus or minus >10 of the particular term.

[00153 As used herein, the terms "include" and 'including" may be used interchangeably with the terms "comprise" and "comprising."

[0016] The presently disclosed methods related to methods of assessing fertilit in a female patient via detecting expression of one or more miRNAs. In particular, the methods may include assessing uterine receptivity in the patient (e.g., receptivity to implantation with an embryo that, has been fertilized in vitro) via detecting expression of one or more miRNAs. For example, the methods may include determining whether the female patient is in a window of implantation for transfer of an embryo. The disclosed, methods further may include evaluating infertility in a female patient via detecting expression of one or more miRNAs and further may include treating the patient diagnosed with infertility. [0017] As used herein, the term "detecting expression of an miRNA" may include determining that the miRNA is being expressed or determining that the miRNA is not being expressed. In some embodiments, expression may be detected relative to expression of a control nucleic acid and may be characterized as "increased" expression or "decreased" expression relative to the control nucleic acid. For example, detecting expression of an miRNA may include detecting reduced expressio of an miRNA relative to expression of a control nucleic acid, for example relative to expression of RN1J48. Detecting expression of an miRNA also may include detecting increased expression of an miRNA relative to expression of a control nucleic acid, for example relative to expression of RNA48. Accordingly, the tests in the disclosed methods may provide the results of an analysis to determine whether the female patient is expressing miRNA relative to a control miRNA such as RNA.48.

[0018] in some embodiments, expression of an miRNA in a patient's biological sample may be deteeted relative to expression of an mi UNA in a control biological sample and may be characterized as "increased" expression or "decreased" expression relative to expression of the miRNA in the control biological sample. Accordingly, the tests in the disclosed methods may provide the results of an analysis to determine whether a patient's biological sample expresses or comprises an miRNA relative to a control biological sample. For example, a control biological sample may include a biological sample taken from a female that is within the window of implantation or a biological sample taken from a female that is not within the window of implantation, in another example, a control biological sample may include a biological sample taken from a female that is exhibiting unexplained infertility or a biological sample taken from a female that is not exhibiting unexplained infertility (i.e., a fertile female).

[0019] "MicroRNA" means an endogenous non-coding R between 1 8 and 25 nucleobases in length, which is the product of cleavage of a pre -miRNA by the enzyme Dicer, Examples of mature miRNA.s are found in the miRN A database known as mi RBase. in certain embodiments. mieroRNA is abbreviated as "miRNA" or "miR." [0020] "Pre-miRNA" or "pre-miR" means a non-coding RNA having a hairpin structure, which is the product of cleavage of a pri-niiR by the double-stranded RNA-specific nbonuciease known as Drosha.

[0021] "Stem-loop sequence" means an RNA having a hairpin structure and containing a mature tniRNA sequence. Pre-miRNA sequences and stem-loop sequences may overlap. Examples of stem-loop sequences are found in the miRNA database known as miRBase.

[0022] "Pri-miRNA" or "pri-niill" means a non-coding RNA having a hairpin structure that is a substrate for the double-stranded RNA-specific ribonuclease Drosha.

[0023] "miRNA precursor" means a transcript that originates from a genomic D.NA and that comprises a non-coding, structured RNA comprising one or more tniRNA sequences. For example, in certain embodiments a miRN A precursor is a pre-miRNA. In certain embodimenis,, a miRNA precursor is a pri-miRNA.

[0024] The presently disclosed methods may include detecting expression of miRNA.

"Expression" means any functions and steps by which a gene's coded information is converted into structures present and operating in a cell. Detecting expression of miRNA may include detecting nucleic acid comprising miRNA, pre-miRNA. or pri-miR A by suitable methods known i the art, including methods that include one or more of the following; reverse transcription, polymerase chain reaction, probing, targeting, and hybridization. MkroRNA expression may be assessed via detecting nucleic acid comprising miRNA, pre-miRNA, or pri- miR A in a extracellular sample {e.g., in culture media in which an embryo has been grown) or in an intracellular sample (e.g., an intracellular sample of an embryo).

[0025] Detection methods may include hybridizing a probe to the miRN A and detecting hybridization of the probe to the miRNA. Suitable probes may include RNA probes and DNA probes. [0028] Detection methods may include converting the miR A to DNA via performing reverse transcription and amplifying the DMA via performing a polymerase chain reaction. RNA linkers may be li gated to the miRNA prior to converting the miRNA to DNA and/or DNA linkers may be ligated to the DNA prior to amplifying the DNA. Multiple miRMAs may be detected in the methods (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, I I, 12, 13, 14, 15, 16, 17, 18, 19, or 20 miRNAs) and microarrays comprising probes for multiple miRNAs may be utilized to detect multiple miRNAs.

[0027] "Target nucleic acid" means a nucleic acid to which an oligomeric compound is designed to hybridize. "Targeting" means the process of design and selection of nucleobase sequence that will hybridize to a target nucleic acid. "Targeted to" means having a nucleobase sequence that will allow hybridizatio to a target nucleic acid.

[0028] "^'Nucleobase sequence" means the order of contiguous nucieobases, in a 5' to 3" orientation, independent of any sugar, linkage, and/or nucleobase modification. "Contiguous nucieobases" means nucieobases immediately adjacent to each other in a nucleic acid. "Nucleobase complementarity"^' means the ability of two nucieobases to pair non-covalently via hydrogen bonding. "Complementary" means that an oligomeric compound is capable of hybridizing to a target nucleic acid under stringent hybridization conditions. "Fully complementary" means each nucleobase of an oligomeric compound is capable of pairing with a nucleobase at each corresponding position in a target nucleic acid. For example, in certain embodiments, an oligomeric compound wherein each nucleobase has complementarity to a nucleobase within a region of a miRNA stem-loop sequence is full complementary to the miRNA stem-loop sequence. "Percent complementarity" means the percentage of nucieobases of an oligomeric compound that are complementar to an equal -length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucieobases of the oligomeric compound that are complementary to nucieobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound, hi certain embodiments, percent complementarity means the number of nucieobases that are complementary to the target nucleic acid, divided by the total number of nucieobases of the modified oligonucleotide. "Percent identity'^* means th number of seleobases in first nucleic acid that are identical to nueieobases at corresponding positions in a second nucleic acid divided by the total number of mseleobases in the first nucleic acid. "Hybridize" means the annealing of complementary nucleic acids that occurs through nucleobase complementarity. "Mismatch'^' means a nucleobase of a first nucleic acid thai is not capable of pairing with a nucleobase at a corresponding position of a second nucleic acid. "Identical" means having the same nucleobase sequence.

[0029] The disclosed methods may be utilized to detect, expression of one or mote miRNAs by in a biological sample from a femaie patient. Biological samples may include, but are not limited to, blood and blood products (e.g., serum or plasma), and biological samples from female reproduction tissue (e.g., endometrium).

[0030] Suitable miRNA's for the disclosed methods may include, but are not limited to, hsa-mi -17, hsa-miR-1 , has-miR-1 a, hsa-miR-1 b, hsa-mi^'R-20a, hsa-miR-24, hsa-miR-25, hsa-miR^«26b, hsa~raiR~20b#, hsa~miR-27b, hsa-miR~29b, hsa~miR~29b- 1 , hsa~raiR~29b-2_} hsa- miR~30a~5p, hsa~ffiiR~30b, hsa-m.iR.-3Qe, hsa~m,iR~30c~t, hsa~raiR~30c~2, hsa~raiR~31, hsa-miR- 92a, hsa-miR-93, hsa-miR- 106, hsa~.miR~106a, hsa~miR~106b, hsa-miR-1 0~Sp, hsa-miR-1 1„ hsa-miR- 146b-5p, has-miRNA-l 48a, hsa-miR- 149, hsa-miR- 351 ~3p, hsa-miR-15 l.-5p, has-155, hsa-miR- 182#, hsa-miR- 191 , hsa-miR- 192, hsa-miR- 193b, hsa-miR-200c, hsa-miR-206, hsa- mtR~302a, hsa-miR.-302a#, hsa.-miR-302b, hsa-miR-302b#, hsa-miR-302c, hsa-miR-302d, hsa- miR -320, hsa-miR-339, hsa-miR-339-3p, hsa-miR-345, hsa-miR-346, hsa-miR-347, hsa-miR- 362-3p, hsa-miR-367, hsa-miR-371~3p, hsa-miR-372, hsa-miR-373, hsa-miR-374a, hsa-miR- 376a, hsa-miR-376a, hsa-miR-3?6a-l, hsa-mi -376a-2. hsa-miR-378, has-miR-380-5p, hsa- miR-454, hsa-miR-484, hsa-miR-487b, hsa-miR-494, hsa-miR-500, hsa-miR-509-5p, hsa-miR- 512- 1 , hsa-miR-512-2. hsa-miR-512-3p_$ hsa-miR-512-5p, hsa-miR-517c, hsa-miR-518a- 1 , hsa- miR-5 l8a-2, hsa-raiR-5I8a-3p, hsa-miR-518c, hsa-miR-518d, hsa-miR- 1 Sd-5p, hsa-miR-518e, hsa-miR- 19a, hsa~.ra.iR~520c~3p, hsa-miR-520D-3p, hsa.~miR~520d-5p, hsa-miR-522, hsa-miR- 525-3p, hsa-miR-548a-3p, hsa-miR-548c-3p, hsa~rair-548d-3p, hsa-raiR-566, hsa-miR-576-3p, hsa-miR.-590-3p, hsa-.miR.-597, hsa-miR-601, hsa-mi -603, hsa-miR-604, hsa-.miR.~645, hsa- miR-660, hsa-miR~720, lisa-miR-875-5 , Hsa-miR>886-3p_s hsa-miR-886-5p, hsa-miR-1244, sa-miR.-!260, hsa-miR~1274A.. hsa-miR-i 275, and hsa-miR-1276. (See Table 1.)

Table

SiQ Jj jD Accession umber hsa-miR-i 7 CAAAGUGCU^'UACAGUGCAGGUAG Mi000007 i hsa-miR-19

hsa-miR-i9a UGUGCAAAUCUAliGCAAAACUGA Mi000(X)73

hsa-miR-i 9b UGUGCAA UCCAUGC AA ACUG A ΜΪ0000074/

1OO0OO7S

hsa-miR~20a U AA AG OGClllJA U AG UGC AGG DAG 1Ό000076

hsa-miR-24 UGGCUCAGUUCAGCAGGAACA ΜΪ0000080/

ΜΪ.0000081

hsa-nriR- CAUUGCACUUGUCUCGGUCUGA MI0000O82

hsa-miR- UUC AAGU A UUCAGG AUAGGU MIOGO0OSS4

hsa-miR- 26b# CCliGUUCUCCAlilJACLJUGGCUC 8 Μ.ΪΜΑΤ00045 0 hsa-miR- ^■27b UUCACAGUGGCUAAGUUCUGC 9 M10 0044

hsa-miR- 29h UAGCACCAUUUGAAAliCAGUGUlJ i0 ΜΪΜΑΤ0000100 hsa-miR- 29b- 1 GCUGGUUUCAUAUGGUGGUUUAGA H MiOOOO!OS

hsa-iraR- 29b-2 CUGG UUUCACAUGG UGGCUU AG Ϊ2 IOOOO i.07

hsa-imR- 30a-5p UGUAAACAUCCUCGACUGGAAG 5 -MAT0000087 hsa-miR- :30b UGUAAACAUCCUACACUCAGCU 14 Mi000044i hsa-miR- 30c UGUAAACAUCCUACACUCUCAGC 35 ΜΪΜ.ΑΤ0000244 hsa-miR- ^■30c- 1 CUGGGAGAGGGIJUGIIIJUACUCC 1 ΜΪΟϋΟ(⁾736

hsa-mlR- 30e-2 CUGGGAGAAGGC UG UUUACUCU i? ΜΪ0000254

hsa-rraR- 31 AGGCAAG AUGCUGGCA!J AGCU ! 8 MM>00!X⁾8

hsa-miR- UAUUGCACUUGUCCCGGCCUGU 1 MI000(K⁾93/

Mi000i»94

hsa-miR-9. A A AG UGC U GIJOCGUGC A GGU A G Ϊ0000095

hsa-miR- i.06

hsa-miR- i 06a AAAAGUGCUUACAGUGCAGGU G 2 1 MiOOOO UM

hsa-miR-i 06b UAAAGUGCUGACAGUGCAGAU 22 Μ.Ϊ0000734

hsa-miR-i 4(⁾-5p CAGUGGUUUUACCCUAUGGUAG 2 M.iMATO( O043 i hsa-miR-141 UAACACUGUCOGGUAAAGAUGG 24 ΜΪ.0000437

hsa-miR-1.46b-5p IJGAGAACIJGAAIJUCCAUAGGCU 25 ΜΪΜΑΤ 00280 hsa-miR- i4S;t UCAGUGCACUACAGAACUUUGU 26 MI0G00253

hsa-miR- i 49 27

UCUGGCUCCGUGUCUUCACUCCC MM>000478

hsa-miR-i 5 K3p CUAGACUGAAGCUCCUUGAGG 28 MiMATOU00757 hsa-iraR-iSl-Sp UCG AGGAGCUCAC AGUCU AGU 29 Ϊ ΑΤΟΟ04697 h.su-i.v UOAAUGCU AAUCGUG AUAGGGGU 30 Mi0f)0068i hsii-miR-}82# UGGUUCU G ACUUGCCAAC U A 1 M]MAT t^'f 0260 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 2 ΜΪ0000465 sa-n»R-i 2 CUGACCUAUGAAUUGACAGCC ΜΪ.0000234

|^}sa-miR-i 3b AACUGGCCCUCAAAGUCCCGCU 34 MI003!3? bsa-tmR-200c U A A U ACUG CCGGGl ; A UG A ϋ GG A M1 0 065 hsa-tniR-206 UGGA AUGU AAGG AAG UGUGUGG 36 Μ.Ϊ0000 0 hsa-miR-3 2a U A AGUGCt^; UCC AUGOU U UGG L?G A 7 ΜΪ0000738

S:}sa-raiR-302a# ACUUAAACGUGGAUGUACUUGCU 8 IMAT 0OQ683 fea-raiR-302b UAAGUGCUUCCAUGUUUIJAGUAG 39 MI0000772 hsa-traR.-302b?? AOJUOAACAUGGAAGUGCUiruC 40 ΜίΜΑΤ0000714 hs;i-mlR~302c UAAGUGCUDCCAUGUtJUCAGUGG 4! Μ.ΪΟ0ΟΟ773

!(«·-:;» R-^o!ki UAAGUGCUUCCAUGUUUGAGUGU 42 Ϊ000Ο774 hsa-miR-320 AAAAGCUGGGUUGAGAGGGCGA 43 Μΐ.0000542 hsa-rniR-339 UCCCUGUCCUCCAGGAGCUCA 44 ίΟΟΟϋ8ί hsa-raiR-3 9-3p UG AGCGC CUCGACGAC AG AGCCG 45 ΜΙΜΑΤ0Θ04702 sa-miR-345 GCUGACUCCUAGUCCAGGGCUC 46 Μ.ΪΟ0ΟΟ825 hsa-tniR-346 UGUCUGCCCGCAUGCCUGCCIICU 47 Μ.Ϊ0000826 hsa-iBiR-347

S:}sa-raiR-362~3p AACACACCUAUUCAAGGAUUCA 48 ΜΙΜΑΤ004683 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA 49 ΜΙ0000775 hsa-miR-371-3p AAGUGCCGCCAUCU^'UUUGAGUGU 50 M1MAT0000723 hsa-miR-372 AAAGUGCUGCGACAUU^'UGAGCGU 51 ΜΤΟΟ0Ο78Ο sa-i»iR- 73 GAAGL!GCUUCGAUU UUGGGGUGU 52 ΜΚΪ00781 hsa-i«i^'R- 74a UUAUAAUACAACCUGAUAAGUG 5 ΜΙ.0000782 i!sa-iiiiR-37 a AUCAUAG GG AAAAUCCACG U 54 ΜΪ0000784/

ΙΟ0Ο3529 iiss-iraR~376a~l AOCA AGAGGAAAAUCCAUGUU 5 Μ.ΪΟ000784 hsa-miR-376a-2 UGGUGGGCCGCAGAACAUGUGC 56 ΜΪΟΟ03529 hsa-miR- 78 CUCCUGACUCCAGGUCCUGUGli 57 ΜΙ0000786 iisa-imR-380-Sp UGGUUGACC AIJAG AAC AUGCGC 58 ΜΙΜΑΤΟΟ0Ο734 hsa-iniR-454 UAGUGCAAUAUUGCUUAUAGGGU 59 Μ3Ο0Ο3820 hsa-n«R.-484 UCAGGCUCAGLJCCCCUCCCGAU 60 MJ 0246S hsa-miR-48?b AAUCG UACAGGG UC AU CCACUU 1 ΜΤΟΟ0 5 Ο hsa-miR-494 UGAAACAiJACACGGGAAACCUC 62 Μΐ.000 134 i:isa-)¾iR-50() UAAUCCUUGCUACCUGGGUGAGA 63 ΜΪ0003Ι84 hsa-n)iR~509-5p UACUGCAGACAGUGGCAAUCA 64 M ATOO04779 hsa-traR~ i2-i AA.GUGCUGOCAOAGCUGAGGUC 65 Ϊ000 Ι4 hsa-miR-512-2 CACUCAGCCU UGAGGGCACU^'UUC 66 Μ.Ϊ000 Ϊ41 iisa-iiti - AAGUCCUGUCAUAGCUGAGGUC 1 ATOO02823 hsa-miR- ^•512-5p CACUCAGCCU^'UGAGGGCACIJUUC ΜΪΜΑΤ0002822 hsa-miR-^•5i?c AlJCGlJGC AlJCCUiiUOAGAG UGU MiOO031 4 hsa-miR- 518;;-] CGGCAAAGGGAAGCCCOUUC M10003I70 hsa-miR- 5;8; 2 GAAAGCGCliUCCCliUUGCUGGA 71 ΜΪ.0003Ι73 hsa-roiR- 5i&t-3p GAAAGCGCUUCCCUUUGCUGGA ΜΪΜΑ^'Γ0002863 hsa-miR - 518c CAAAGCGCUUCUCUUUAGAGUGU M1000 159 hsa-πliR- 5l8d CAAAGCGCUUCCCUUUGGAGC MiO0O3i7I hsa-miR- 5 i8d-5p CUCUAGAGGGAAGCACUUUCUG ΜΪΜΑΤ00 5456 hsa-miR- ^■5I8e AAAGCGCUliCCCUliCAGAGUG Ϊ.0003169 hsa-n«R- 559a AAAGUGCAUCCliliU^'UAGAGUGU^' ί0003ϊ78

M10O31 2 hsa-r R ~520c~ AAAGUGCiiDCCU^'UlIUAGAGGGU Μ.ΪΜΑΤ000 46 hsa-miR-520D-3p AAAGUGC UUC UCUUUGGUGGGD ΜΪΜΑΤ0ΟΟ2856 hsa-miR-520d-5p CGACAAAGGGAAGCCCUUUC 8» M1MATO0O2855 hsa-rm R-522 AAAAUGGUUCCCUUUAGAGUGU Si I 0 3!77 hsa-roiR-525-3p AGGCGCU UCCCUUU AGAGCG 82 MI AT00028 9 hsa-miR~548a~3p CAAAACliGGCAAUUACUtlDUGC 83 MI AT000325S hsa-miR-548c-3p CAAAAAUCUCAAUi!ACUUUUGC 84 MiMAT00032S5 hsa-mir-548d-3p CAAAAACCACAGUUUCUUOUGC 85 MIMAT000 323 hsa-miR-566 GGGCGCCliGUGAOCCCAAC 8 MI 0O3572 lisa-imR-576-3p AAGAUGUGGAAAAAUUGGAAUC 87 M3MATOO04796 h.sa-miR-590-3p UAAUUUUAliGUAliAAGCUAGU 88 Μ.ΪΜΑΤ0004 0] hsa-nitR-597 UGUGUCACGCGAUGACCACUGU 89 MT0003609 hsa-miR-601 UGGUCUAGGAUUGULiGGAGGAG 90 Mi0003614 hsa-mi^'R-603 CACACACUGCAAUUACliUlJUGC 9! Ml.000361.6 hsa-miR-604 AGGCUGCGGAA^'UUCAGGAC 92 M 50003 !? hsa-miR-645 UCU AGGCUGGl ACUGCUGA 93 Ϊ000366 hsa-tr«R~660 UACCCAOUGCAUAUCGGAGUOG 94 Μ.Ϊ0003684 hsa-iXH R-720 UCUCGCUGGGGCCUCCA 95 ΜΪ0006654 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG 96 MIMAT0004922 hsa-miR-886~3p CGCGGGGGCUUACUGACCCUU 97

hsa-miR-886-5p CGGG UCGGAGUUAGC ϋ C A AGCGG 98 MIMAT0004905 hsa-miR- 1244 AAGUAGlJUGGlilJUGlJAUGAGAUGGliU 99 MI00O6 9/

MI0035974/

MiOO 13975 hsa-miR-1260 AUCCCACCUCUGCCACCA 100 M100063 4 hsa-miR- i274A GUCCCUGUUCAGGCGCCA 101 MIMATOO0S92? hsa-miR- S 275 GUGGGGGAGAGGCUGUC 102 M10006 15 hsa-mtR-! 276 UAAAGAGCCCUGUGGAGACA 103 Μ.Ϊ0006 16 EXAMPLES

[0031] The following example is illustrative and is not intended to limit the scope of the claimed subject matter. Reference is made to "MicroRNA 31 is Upregu!ated in the Serum During the Window of implantation," Jessica DK Kresowik D, Eric J Devor PhD, Bradley J Van Voorhis MD, Kimberly Leslie MD, Journal of Fertility and Sterility, Vol. 98, issue 3, Supplement, Page SI 87, the content of which is incorporated herein by reference in its entirety.

[0032] Abstract

[0033] MicroKNAs (miRs) are stable h serum exosomes and have been studied as biomarkers for several diseases. Towards identifying a noninvasive biomarker for the receptive endometrium, we investigated serum exosomal miRNA expression in the window of implantation. Serum and endometrial biopsies were collected on cycle day (CD) 7-10 and 20-24. Expression of specific miRs in endometrial tissue and serum exosomes was evaluated by quantitative PCR, Endometrial mRNA expression of miR-31 targets was also examined. The main outcome measures included fold change in expression of miRNAs and miR-31 targets in endometrium and serum between the proliferative and mid-secretory phases. Five of the si measured miRs were differentially expressed in the endometrium between CD 7-10 and 20-24. In the serum, only miR- 1 showed a statistically significant 3.8~fold increase during the window of implantation. Analysis of validated immunomodulatory miR-31 targets demonstrated a concomitant decrease in endometrial FOXP3 and CXCL12 mRNA expression. In conclusion, serum miR-31 was upregulated during the window of implantation, identifying it as a potential biomarker for a receptive endometrium. The associated decrease in endometrial FOXP3 and CXCLI 2 mRNA suggest miR-31 produces an immune-tolerant maternal environment favoring implantation.

[00343 introduction [00353 The human endometrium is a dynamic tissue that undergoes cyclic changes each, month to prepare the uterus for embryo implantation. The window of implantation is accepted to be 4 days in length, spanning cycle day (CD) 20-24 in a 28 day cyeie.(l ) With fresh m vitro fertilization (IVF), transfer of embryos reaching blastocyst stage on Day 6 results in decreased implantation rates when compared to transfer of embryos reaching blastocyst stage on Day 5.(2) However, when Day 5 & 6 blastocyst embryos are transferred to an identically prepared endometrium, implantation rates are equivalent, highlighting the importance of endometrial receptivity. (3)

[0036] Although the relative importance of the state of the endometrium is appreciated, definitive biomarkers that predict endometrial receptivity have remained elusive. For example, the Noyes criteria were previously used to predict endometrial receptivity, yet a prospective trial evaluating endometrial histology found, that histologic dating failed to discriminate fertile from infertile paiienis.{4) The biologic presence of pinopodes in the endometrium has also been reported to mark the receptive state, (5, 6) though subsequent studies did not support this conclusion.(7-9) Expression of the ανβ3 integ m correlates with the window of irapla»tation,(10) but an invasive biopsy is required to measure levels. In addition, its predictive clinical utility has been questioned.(l 1-13) While circulating levels of inhibin correspond with luteal fimction, mid-Suteai serum levels of inhibin did not reflect endometrial receptivity.(14) Progesterone values are generally accepted as an indicator of ovulation, but are not able to predict implantation potential of the endometrium. (15) These studies collectively demonstrate that a noninvasive, accurate marker is needed both to help identify patients with implantation defects and to signal the optima! timing for embryo transfer.

[60371 Emerging literature supports an important role for microRNAs (miR^' As) in human embryo implantation.(1 , 17) MiRNAs are small non-coding RNAs, 18-24 nucleotides in length. Binding of miR As to the 3 'untranslated region (UT .) of target mRNAs results in repression of translation(18) through a variety of mechanisms including mRNA decay.(l9_s 20) One miRNA. can have myriad of target mRNAs, which serves to amplify the effects of each individual mtRNA.(21) in addition to expression in tissues, miRNAs have been identified in the peripheral circulation either as a complex with miRNA processing proteins or enclosed in secreted microvesicles called exosoraes.(22) Exosomal microRNAs have been shown to be extremely stable over time and are protected from RNase degradation. (23, 24) Currently, serom miRNAs have been utilized as noninvasive biomarkeis to predict survival or treatment response in cancer patients and are being investigated as markers for other diseases.(25)

[0038] While the miRNA profile of the normal cycling endometrium has been characterized, (26) no studies have examined changes in the circulating miRNA profile during the menstrual cycle. The goal of this study was to investigate whether expression of select miRNAs in the normal cycling endometrium corresponds with the serum exosomal miRNA profile in order to identify a noninvasive miRNA biomarker for the receptive endometrium.

[0039] Materials & Methods

[0040] Human Subjects

[0041] The study was reviewed and approved by the 1RB. Fifteen naturally cycling fertile females were recruited. nclusion criteria were women aae 18-40. with a live birth in the last 7 years, and regular menstrual cycles occurring every 26-32 days. Patients were excluded for any of the following: pregnancy, actively attempting pregnancy, use of hormonal, contraception or intrauterine device (TUD) for the preceding 3 months, lactation in the preceding 3 months, history or treatment of infertility, or unprotected intercourse with no pregnancy for at least one year. Study participants were compensated. Those qualifying to participate were subjected to a pregnancy test, peripheral venipuncture (8 «iL), transvaginal ultrasound, and endometrial biopsy in the proliferative phase (CD 7-10) and the secretory phase (CD 20-24). A progesterone level was determined in the secretory phase blood sample by the University of Iowa Diagnostic Laboratories. Patients were included if the progesterone level was >3 ng/tr L. consistent with ovulation. Two patients withdrew from the study after initial recruitment. One patient was excluded due to an inadequate progesterone level. Twelve patient samples were included in the final analysis. [0042] Tissue Collection and RNA Preparation

[0043] Endometrial tissue collect ton and RNA preparation: Endometrial biopsies were obtained with an endometrial vacuum curette (Pipelle) and immediately flash frozen in liquid nitrogen. Total celiu!ar RNA was purified using the miRvana miRNA isolation Kit according to the manufacturer's protocol (Applied Biosystems/Life Technologies). RNA yield, and purity was assessed on a ^' anodrop Model 1000 (Thermo Scientific).

[0044] Serum Collection and RNA Preparation: For miRNA isolation from e osomes, serum was collected in a heparin- free seaim separator tube (BD Biosciences) and spun at 1300 x g for 10 min. Serum was removed and stored at -S01C. Serum exosoraes were isolated from 400 μ^'Ι of serum using the Exoquick solution (System Biosciences). Briefly, 120 μ! of Exoquick solution (System Biosciences) was added to 400 μΐ of serum, mixed and incubated at 4°C overnight. Following incubation, tubes were centrifuged at 1500 x g for 30 minutes. The supernatant was then removed and the e-xosome-containing pellet resuspended in 100 μΐ PBS. Total RNA was isolated via a standard Trizol extraction (Life Technologies). The presence of a small miRN A fraction was confirmed ^'using an Agilent pico-chip on an Agilent Model 2100 Bioanalyzer.

[0045] miRNA Reverse Tramcriptkm and Expression Assay

[0046] Endometrium: MiRNA-specific reverse transcriptions and expression assays were carried out on 350 ng total cellular RN A aliquots using Applied Biosystems/Life Technologies miR-specific TaqMan PCR primer sets and reagents. For the mRN A analysis, 500 ng of total RN A was reverse transcribed into cDNA using the Superscript 111 First Strand Synthesis SuperMix kit (Life Technologies). FOXP3, CXCL12, and E-seiectin mRNA expression in endometrial biopsies were measured using SYBR Green real-time PCR using 18S as the reference gene. All primer sequences were previously validated in prior studies (27-29):

FOXP3 Forward 5 '-GAGAAGCTGAGTGCCATGCA-3 ' (SEQ ID NO: 104) (T_w = 57.9°C) Reverse 5 AGG AGCCCTTGTCGG ATG AT-3 ' (SEQ ID NO: 05) (T_m - 58.3°C); CXCL12 Forward 5 '-TCAGCCTGAGCACAGATGC-3 ' (SEQ ID NO: 106) (T_m - 56.8°C) CXCL12 Reverse 5 '-CTTTAGCTTCGGGTCAATGC~3 ' (SEQ ID NO: 107) (T_m == 54.1 °C):

E-SE LECTI Forward 5 ' -GGC AGTGG AC AC AGC A A ATC- " (SEQ ID NO: 108) (T_ro ^« 56.8^SC) E-SELECTIN Reverse S'-TGOACAGCATCGCATCTCA^ (SEQ ID NO: 109) (T_m = 56.6*C),

[0047] Amplification was carried out in an HT7 00 Fast. Real-Time PCR System (Applied Biosystems, Inc). cDNA prepared from the tnRNA extracted from each biopsy or ceil sample was analyzed in triplicate.

[0048] Serum: Fixed a!kjuots (3 μΙ each) of exosome RNA were reversed transcribed using the Megaplex A & B set primers pools (Human Pools Set v3.0, Applied Biosystems, Inc). Resulting cDNAs were then pre-ampiified using Megaplex A & B set pre -amp primers (Applied Biosystems, Inc). Equal aliquots of pre~arnplification products were assayed for rojRNA expression levels using the Applied Biosystems/Life Technologies imR-specific Taq an. q~PCR primer sets and reagents as described for the endometrium tissue samples. Amplification was carried out in an HT7900 Fast Real-Time PCR System (Applied Biosystems, inc).

[0049] QalQAf /ysA

[0050] The single rrsiRNA assay real -time data were analyzed by using SDS RQ manager v2.4 and DataAssist v3.0 software (Applied Biosystems, Inc.). Both tissue and serum microRNA. expression was assessed following normalization against endogenous controls. Endometrium miRNA expression was normalized against RNU48 while serum miRNA expression was normalized against snRNA U6 (Applied Biosystems). R U48 normalization was selected for the endometrium due to its consistent expression across endometrial tissue samples. snRNA U6 normalization was used for the serum because of its consistent serum expression and presence in both the A & B Megaplex Pool Sets. Comparison of normalized expression values (ACt) for both tissue and serum miRNAs was carried out using the conventional AACt fold change(30) assessing differential expression between the proliferative phase and mid-secretory phase samples. Statistical significance of fold, changes was determined by performing a two-sample, two-tailed Student's i-test of the ACt values. Standard Pearson correlation coefficients were determined for endometrial Fox 3 and CXCLi 2 mRNA levels versus endometrial miR-3.1 levels. A P value < 0.05 was considered statistically significant.

[0051] Results

[0052] A total of fifteen patients were enrolled in the study. Two patients withdrew from the study prior to completion. One patient was excluded as her progesterone value was less than 3 ng/ml. A total of twelve patients were included in the analysis. The average age of participants was 33.3 years. Patient-identified ethnicity revealed 75% Caucasian, 16.7% Black, and 8.3% Hispanic, Patient and cycle characteristics are provided in Table 2.

Table 2. Demographic and cycle characteristics of study participants.

[00533 Differentia}, endometrial miMNA expression in the window ofimplmitation [0054] Endometrial expression of several miRNAs has been reported to change during the window of implantation (31-33) or vary in patients with implantation tailure.il 7) We limited our analysis to those miRNAs that had been reported by other investigators, using microarray or deep sequencing, to be differentially regulated in the window of implantation.(31, 32) We confirmed with single-assay quantitative PCR that miR-SOb, -30d, -31. and -203 were upregulated and iniR-503 and -345 were do nregulated in endometrial tissue obtained in the mid-secretory phase as compared to the proliferative phase (Table2). Since raiR~135a and -135b have been implicated as important regulators of HOX genes during implantation, (34, 35) we also examined their expression bat found no difference between CD 7- 10 and 20-24 (Table 3).

Table 3. Expression of endometrial miRNAs in the window of implantation relative to the

proliferative phase

[00533

[0054] Gi ven that the endometrium is regenerated and shed each month, we hypothesized the endometrium releases exosomes info the blood such that miRNAs in the serum reflect, changes in endometrial miRNA expression. Therefore, we isolated small RNi.As from patient serum collected during the proliferative and mid-secretory phases. Wit the exception of miR- 503, all miRN As detected in endometrial tissue were also present in serum. (Figure J A). Furthermore, serum expression of .raiR-30b, -30d and -203 demonstrated a trend towards upregnlation at CD 20-24 as compared to CD 7-10, consistent with the observed changes in tissue miRNA expression. Similarly, a non-significant decrease in serum mill- 145 paraiieied its decrease in the endometrium. By contrast, miR-31 was significantly elevated in the serum in the window of implantation when compared to the proliferative phase serum (Figure J A, B). These data suggest that, although the overall irends of specific miRNA expression in serum mirror those in endometrium, miR-31 was the only miRNA with significant upregulation in both tissue and serum during the window of implantation.

[005S] We next evaluated whether increasing progesterone levels in the mid- luteal phase might contribute to the increase in miR-31. Treatment of progesterone receptor-positive type I Ishikawa B endometrial cancer cel ls with 100 nM progesterone for 24 hrs resulted, in an 85% increase in miR-31 expression (data not shown); suggesting that progesterone in part promotes expression of miR-31 in vitro.

[0056] Irtcr a miR-31 [ corresponds with άυπηηι ιύαΓι η (tfimmijne tgrgeis

[0057] Since miR-3 J was the only miRNA upregulated in both endometrium, and serum in the window of implantation, we next investigated endometrial expression of validated targets of .miR- 1 that have a plausible role in embryo implantation. Targets include FOXP3,(36) a transcription factor denoting T regulatory (Τ,_¾3) cells, CXCL12, a ehemokine or lymphocyte trafficking, and E-selectie (SELE), a receptor involved in lymphocyte trafficking. Using realtime PCR, we found both FOXP3 and CXCL.12 to be significantly downregulated in endometrial tissue in the window of implantation as compared to the proliferative phase (Figure 2A). Calculation of Pearson's correlation coefficient demonstrated an inverse relationship between endometrial miR-31 and FOXP3 (r - -0.40, p - 0.05) and CXCLI2 (r - -0.53, p - 0.008). E- seiecti also trended towards dowiiregulation in CD 20-24. These data suggest that increased miR-31 mechanistically contributes to immune regulation during the window of implantation.

[0058] Discussion

[0059] A receptive endometrium is a prerequisite for successful embryo implantation, yet corresponding biomarkers have remained elusive. Using single assay q-PCR, we demonstrated differential expression of six miRNAs, miR.-30b, -30d, -3.1 , -145, -203 and -503, in the endometrium during the window of implantation. Investigation of these miRNAs in the serum revealed wpregulaiion of miR-31 in the mid-secretory phase. In addition, mRNA levels of miR- 31 targets FOXP3, a transcription factor denoting T regulatory cells, and CXCL12, a chemoaitractant for uterine natural killer cells, were inversely associated with changes in miR-31 levels in the endometrium. Our data suggest a model (Figure 2 B) in which miR-3.1 produces an immune-to!erant maternal environment favoring implantation via targeting FOXP3 and CXCL12.

[0060] MiRNAs have been proposed as potential serum biomarkers for myriad conditions, especially cancer. For example, in ovarian cancer, serum microRNA levels were found to correspond with tumor microRNA levels. (37) During the window of implantation, miR-31 was the only miRNA surveyed that was significantly unregulated in both serum and endometrium. The remaining five miRNAs we examined were not found to be significantly different in the serum despite our data and prior reports finding endometrial levels of these miRNAs to vary in the mid-secretory phase.il 7, 31 -33) The fact that miR-31 levels were more substantially increased in serum relative to the endometrium suggests that other cellular sources of miR-31, such as immune cells, may contribute to elevated serum levels. Alternatively, the endometrium may actively release miR-31 into the periphery.

[00813 Studies have found an important role for miR-3! in regulating the immune system, including directly targeting the transcription factor FOXP3, a master regulator of T«„ differentiation and functional activity.(36) T_feg cells induce tolerance by inhibiting proliferation and cytokine production of lymphocytes, cytotoxic activity of natural killer cells, and maturation of dendritic cells, although the precise mechanisms are unknown.{38) Emerging evidence suggests I _eg cells are critical for embryo implantation and pregnancy. For instance, the number of Tre_g cells in the peripheral blood increase during the follicular phase and are reduced in the luteal phase in normal cycling fertile females. (39) By contrast, the follicular phase expansion is absent in women with recurrent spontaneous abortion (RSA).(39) FOXP3 expression is 43% lower in mid-luteal endometrial biopsies of women with unexplained infertility when compared with normal fertile controls, suggesting a diminished T. _i; cell population may compromise implantation success.(27) Taken together, these data indicate that successful implantation may require a preovulatory increase in 1 to induce immune tolerance. Our findings extend these observations by demonstrating that serum mi -31, a negative regulator of FOXP3, is upregulated during the mid-hrteal phase (Figure 2B). Moreover, endometrial FOXP3 expression also mirrored the reported serum FO.XP3 T expression pattern, with a decrease in the mid- lineal phase when compared to the follicular phase.

[0062] in addition to FOXP3, miR-31 has also been reported to target other immunomodulatory factors such as CXCLI2 and E-selectin thai may have a role in maternal immune acceptance of an implanted embryo. (40, 41) CXCL12, a chemokine. and its receptor CXCR4 have been shown to be important in uterine natural killer cell recruitment, pSacentation, implantation, and embryogenesis.(42-44) CXCL12 mRNA levels were decreased in the mid- luteai endometrium when compared to the follicular phase, which is in contrast to a prior report that found no difference in CXCL12 mRNA expression in endometrial biopsies obtained at different times in the menstrual cycle. (28) Our findings may be different due to alternative categorizations of the biopsies as well as the larger sample size in our study during the window of implantation (CD 20-24). E-selectiu, another validated target of mir~31 , is exclusively expressed by the endothelium and preferentially binds Thl lymphocytes directing lymphocyte traffickmg.(45) Although currently debated, the classic paradigm is that a Th2>Th l cytokine response at the maternal fetal interface supports pregnancy. We observed a trend towards downregulation of E-selectin during the mid-hiteal phase, which may result in blocking Thl recruitment, thereby allowing a Tli2>Thl cytokine response.

[0063] Strengths of our study include its prospective design, novelty, and inclusion of naturally cycling females with proven fertility. Ovulation was confirmed during the study cycle. The power of the study may have been improved if endometrial biopsies were precisely timed seven days following positive ovulation predictor kits, although the window of implantation does span five lays. Because both biopsies were taken during the same cycle, it is plausible that the proliferative phase biopsy affected the miRNA profile of the mid-secretory biopsy. However, this seems unlikely because our endometrial miRNA results confirmed those previously reported with microarray and deep sequencing of patients -undergoing only one biopsy per cyci.e.(3 L 32)

[0084] In. summary, our data identify mi.R-3! to be up-regulated in the serum, daring the window of im lantation, of norma! cycling fertile females when compared to the proliferative phase. Use of a biomarker to denote a receptive endometrium has important implications not only to determine the appropriate time for embryo transfer but also to identify patients with deficits in endometrial receptivity, in contrast to endometrial biopsy, serum collection is noninvasive and can he done during the cycle of attempted pregnancy without the concern of interfering with embryo implantation. Serum exosomal raiRNAs are extremely stable biomarkers. Future prospective studies to evaluate the ability of serum miRNA-3! levels to predict embryo implantation could establish it as a biomarker of a receptive endometrium.

[0065] References

[0066] 1 . Achache H, Revel A. Endometrial receptivity markers, the journey to successful embryo implantation. Hum Reprod Update 2006;12:731-46.

[0067] 2. Barrenetxea G, Lopez tie Larruzea A, Ganzahal T, Jimenez R, Carbonero K, Mandiola . Blastocyst euliure after repeated failure- of cleavage-stage embryo transfers: a comparison of day 5 and day 6 transfers. Ferti! Steril 2005;83:49-53.

[00683 3. Richter S, Shipley SK, McVearry Tucker MJ, Widra EA. Cryopreserved embryo transfers suggest that endometrial receptivity may contribute to reduced success rates of later developing embryos. Ferti 1 Steril 2006;86:862-6.

[0069] 4. Coutifaris C, Myers ER, Giizick DS, Diamond MP, Carson S , Legro RS et al. Histological dating of timed endometrial biopsy tissue is not related to fertility sta tus. Ferti! Steril 2004;82: 1264-72. [0070] 5, Nikas G, Drakakis P, Loutradis D, Mara-Skoufari C, Koimiantakis E, icha!as S et al. Uterine pinopodes as markers of die 'nidation window' in cycling women receiving exogenous oestradiol and progesterone. Hum Reprod 1995;10:1208-13.

[0071] 6. Nikas G. Pinopodes as markers of endometrial receptivity in clinical practice. Horn Reprod 1 99; 14 Sapp! .2:99-106.

[0072] 7. Creus M, Ordi J, Fabregues F, Casamitjana R, Ferrer B, Coll E et al, alphavbeta3 integrin expression and pinopod formation in normal and oui-of-pliase endometria of fertile and infertile women. Hum Reprod 2002; 17:2279-86.

[0073] 8. Quinn Ryan E, Claessens EA. Greenblatt E, Hawrylyshyn P, Cruickshank B et al. The presence of pinopodes in the human endometrium does not delineate the implantation window. Fertil Steril 2007;87: 1015-21.

[0074] 9. Quinn CE, Casper RF. Pinopodes: a questionable role in endometrial receptivity. Hum Reprod Update 2009;15:229-36.

[0075] 10. Lessey BA, Castelbaum AJ. Integrals and implantation in the human.

Reviews in endocrine & metabolic disorders 2002;3: 107-17.

[0076] .1 1. Creus M, Balasch J, Ordi L Fabregues F, Casamitjana R, Quinto L et al. Integrin expression in normal and out-of-phase endometria. Hum Reprod 1998;13:3460-8.

[0077] 12. Ordi J, Creus , Casamitjana !l, Cardesa A, Vanrell JA, Balasch .1.

Endometrial pinopode and aiphavbeta.3 integrin expression is not impaired, in infertile patients with endometriosis. J Assist Reprod Genet 2003;20:465-73.

[0078] 13. Ordi J, Creus M, Quinto L, Casamitjana R, Cardesa A, Balasch J. Within- subject ^'between-eyc!e variability of histological dating, alpha v beta 3 integrin expression, and pinopod formation in the human endometrium. J Clin Endocrinol Meiab 2O03;88:2i .1 -25. [0079] 14, Crews , Grdi I, Fabregues F, Casarnitjana R, Vanrell JA, Balasch J. Mid- iuteal serum inhibin-A concentration as a marker of endometrial differentiation. Hum eprod 2001 ; 16: 1347-52.

[0080] 15. Costello MF, Emerson S, Lnkic J, Sjoblom P, Garrett 11. Hughes G et al

Predictive value of mid luteal, progesterone concentration before luteal support in controlled ovarian hyperstimulafkm with intrauterine insemination. The Australian & New Zealand journal of obstetrics & gynaecology 2004;44:51-6.

[0081] 16. McCaliie B, Schoolcraft. WB, Katz-Jaffe MG. Aberration of blastocyst mtcroRNA. expression is associated with human infertility. Fertility and Sterility 2010;93:2374~ 82.

[0082] 17. Revel A, Achache H. Stevens J₅ Smith Y, Reich R. MicroRNAs are associated with human embryo implantation, defects. Human reproduction 201 1 ;26:2830~40,

[0083] IS. Hammond SM RNAi, microRNAs, and human disease. Cancer chemotherapy and pharmacology 2006;58 Suppl l :s63-8.

[0084] 19. Lai EC. Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post -transcriptional regulation. Nat Genet 2002;30:363-4.

[0085] 20. Kim V . MicroRNA biogenesis: coordinated cropping and dicing. Nature reviews Molecular cell biology 2005;6:376-85.

[0086] 21 , Kwak PB, Jwasaki S, Tomari Y. The microRNA pathway and cancer.

Cancer science 2010; 101 :2309-15.

[0087] 22. Lasser C. Exosomal NA as biomarkers and the therapeutic potential of exosome vectors. Expert opinion on biological therapy 2012; 12 Suppl LSI 89-97. [0088] 23. Gai!o A, Tandon M, Alevizos I₅ IHei G<3. The majority of microRNAs detectable in serum and saliva is concentrated, in exosoraes. PloS one 2012;7:e30679.

[0089] 24. Grasedlecfc S_> Scholer N, Bommer M, Niess JH, Turnam , Rouhi. A et al.

Impact of serum storage conditions on microRNA stability. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, UK 2012.

[0090] 25, Scholer N, Langer C, uchenbauer F. Circulating microRNAs as biomarkers - True Blood? Genome medicine 201 1 ;3:72.

[0091] 26. Haouzi D, ahmoud K, Fourar , Bendhaou K, Deehaud H, De Vos J et ai. Identification of new biomarkers of human eiidometria! receptivity in tlie natural cycle. Hum Reprod 2009;24: 198-205.

[0092] 27, Jasper Mi, Trernellen P, Robertson SA. Primary unexplained infertility is associated with reduced expression of the T-reguiatory ceil transcription factor Foxp3 in endometrial tissue. Mo! Hum Reprod 2006;12:301-8.

[0093] 28. Laird SM, Widdowson R, El-Sheikht M, Hall AJ, Li TC. Expression of CXCL12 and CXCR4 in human endometrium; effects of CXCL.12 on MMP production by human endometrial cells. Hum Reprod 201 1;26:1 144-52,

[0094] 29. Berti R, Williams AJ, Moffett JR, Hale SL, Velarde LC, Elliott PJ et al. Quantitative real-time RT-PCR. analysis of inflammatory gene expression associated with ischemia-reperfusion brain injury. J Cereb Blood Flow Metab 2002;22: 1068-79.

[0095] 30. Livak J, Sch ittgen TD. Analysis of relative gene expression data using real-time quantitative FCR and the 2(-Delta Delta C(T)) Method. Methods 2001 ;25:402-8.

[0090] 31. Kuokkanen S, Chen B, Ojalvo L„ Benard L_} Santoro , Pollard JW. Genomic profilin of microRNAs and messenger R As reveals hormonal regulation in microRNA expression in human endometrium. Biol Reprod 2 1 ;82:791-80! . [0097] 32, Slia AG, Liu JL, Jiang XM, Ren JZ„ Ma CH, Lei W et al. Genome-wide identification of micro-ribonucleie acids associated with human endometrial receptivity in natural and stimulated cycles by deep sequencing. Fertil Sferil 201 1 :96: 150-5 e5,

[0098] 33. Altmae S, Martmez-Conejero JA, Esteban FJ, Ruiz-A onso M, Stavreus-

Evers A, Horcajadas JA et aL MicroRNAs mi -30b, miR~30d, and miR-494 Regulate Human Endometrial Receptivity. Reproductive sciences 2012.

[0099] 34. Zanatta A, Rociia AM. Carvalho FM, Pereira RM, Taylor HS, Motta EL et al. The role of the Hox I0 HOXA 10 gene in the etiology of endometriosis and its related infertility: a review. J Assist Reprod Genet 20.10;27:701 -10,

[00100] 35, Petracco , Grechukhina Q. Popkhadze S, Massasa E_s Zhou Y, Taylor HS. MicroRNA 135 regulates HOXA 10 expression in endometriosis. I Clin Endocrinol Metab 20t l;96:E 1925-33.

[00101] 36. Rouas R, Fayyad- azan H, El Zein N, Lewalle P, Rothe F, Simion A et al. Human natural Treg microRNA signature; role of microRNA-31 and m.icroRNA-21 in FOXP3 expression. European journal of immunology 2009;39: 1608-18.

[00102] 37. Taylor DD, Gercel-Taylor C. MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer. Gynecologic oncology 2008; 1 10:13-21.

[00103] 38, Sakagttchi S, Wing , Onishi Y, Prieto-Mart P, Yamaguchi T. Regulatory T cells: how do they suppress immune responses? International immunology 2009;2 i : i J 05-11.

[00104] 39. Arruvito L, Sanz M, Banham AH, Fainboim L, Expansio of CD -t-CJ325- nd FOXP3-S- regulatory T cells during the follicular phase of the menstrual cycle: implications for human reproduction. Journal of immunology 2007;178:2572-8. [00105] 40. Ren L₅ Liu YQ, Zhou WH, Zhang YZ, Trophoblast-derived chemokine CX.CL12 promotes CXCR4 expression and invasion of human fitst-tTimester decidual stromal cells. Horn Reprod 2012;27:366-74.

[00106] 41. Bertoja AZ, Zenclussen ML, CasaJis PA, Soiiwedel A, Schumacher A₅ Woiciechowsky C et. al, Anti-P- and E-selectin therapy prevents abortion in the CBA/J^' x DBA/2 J combination by blocking the migration of ThJ lymphocytes into the foetal-maternal interface. Ceil Immunol 2005;238:97-102.

[00107] 42. Hanna. J, Wald O, Goldman- Wohl D, Prus D, Market G_> Gazit R et al.

CXCL12 expression by invasive trophoblasts induces the specific migration of CD 1.6- human natural killer ceils. Blood 2003; 102: 1569-77.

[00108] 43. Jaieel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Stromal cell- derived factor- 1 (SDF-1 } signalling regulates human placental trophoblast ceil survival. Mol Hum Reprod 2004; ! .0:901-9.

[00109] 44. Jones RL, Hannan NJ, Kaitu'u IX Zhang J, Salamonsen LA. Identification of chemokioes important for leukocyte recruitment to the human endometrium at the times of embryo implantation and menstruation. J Clin Endocrinol Metab 2004;89:6155-67.

[00110] 45. Austrup F, Vestweber D, Borges E, Lohiiiug M, Brauer , Herz U et al. P- and E-selectin mediate recruitment of T-helper-1 but not T-heiper-2 cells into inflammed tissues. Nature 1997;385:81-3.

[001111 in the foregoing description, it will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, hot it is recognized that various modifications are possible within the scope of the invention. Thus, it should be understood that althoug the present invention has been illustrated by specific embodiments and optional features, modification and/or variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention. 0112] Citations to a number of patent and non-patent references are made herein. The cited references are incorporated by reference herein in their entireties. In the event that there is an inconsistency between a definition of a term in the specification as compared to a definition of the term in a cited reference, the term should be interpreted based on the definition in the specification.

Claims

We claim:

1. A metbod for assessing fertility in a female patsent, the method comprising delecting an miRNA in a biological sample from the patient

2. The method of claim 1 , wherein assessing fertility comprises assessing whether the patient has entered a window of implantation.

3. The method of claim 1, wherein assessing fertility comprises assessing whether the patient, is fertile.

4. The method of any of the preceding claims, wherein the miRNA is selected from a group consisting of hsa-miR-1.7, hsa-miR-1 , has-miR-.l9a, hsa-miR-1 h, hsa- miR-20a, hsa-miR-24, hsa-miR-25, hsa™miR-26b, hsa-miR-26b#, hsa-miR-27h₅ hsa-rniR-29b, hsa- iR.-29b-l , hsa~miR~29b-2₅ hsa-miR-30a-5p, hsa-nviR-30b. hsa~miR~30c, hsa-miR-30c~l , hsa-miR-30c-2, hsa-miR-3.1 , hsa-miR-92a_; hsa-miR-93, hsa-niiR-106, hsa-miR-106a, hsa-miR- 106b, hsa-miR-l40-5p, hsa-miR-141 , hsa-miR~146b-5p, has-miRNA-148a, hsa-miR-149, hsa- miR-151 -3p, bsa-niiR-151-5p₅ has-155, hsa-miR-182#, hsa-miR- 19 , hsa-miR- 92, hsa-miR- 193b, hsa-miR-200c, hsa-miR.-206, hsa.~miR~302a„ hsa-miR-302a#, hsa~miR-302b, hsa-miR- 302b#, hsa-mi R-302c, hsa-mi .-302d_i hsa-miR-320, hsa~miR-339, hsa-miR-339-3p. hsa-raiR- 345, hsa-miR-346, hsa-miR-347, hsa-rasR-362-3p, hsa-miR-367, hsa-miR-371-3p, hsa-miR-372, hsa-miR-373, hsa~rmR-374a_:, hsa~miR-376a, hsa-mi.R-37.6a_> hsa-miR-376a-.l , hsa-miR-376a-2_> hsa~mlR~37S, has-miR-380-5p, hsa-miR-454, hsa-miR-484, hsa-raiR-487b, hsa-m.iR-494, hsa- roiR-300, hsa~miR-509~5p, hsa~miR~512-l , hsa-miR-5 J 2-2, hsa-miR~SJ 2-3p. hsa-mi.R-512~5p, hsa-miR-5 7c, hsa-miR-518a~l, hsa-miR-518a-2, hsa~miR~5 8a~3p, hsa-miR-518c, hsa-m R- 518d, hsa-miR.-5. 8d-5p, hsa-miR-518e, hsa-miR-519a, hsa-miR-520c-3p, hsa-mlR-52QD-3p, hsa-miR-S20d-5p, hsa-iniR-522, hsa-miR-525-3p, hsa-miR-548a-3p, hsa-miR-548c-3p, hsa-mir- 548d-3p, hsa-miR-566, hsa-miR-576-3p, hsa-miR-590-3p, hsa-miR-597, hsa-miR-601, hsa-miR- 603, hsa~miR~6G4, hsa-m.iR.-645, hsa-.m.iR.-660, hsa~. .iR~720, hsa~ iR~S75-5p, hsa-miR-886-3p, hsa-rniR-886-5p, hsa-niiR-1244, hsa-miR-1260, hsa miR-I274A_s hsa-miR-12 5, and hsa- iiR-

1276.

5. The method of any of the preceding claims, comprising determining whether the female patient is expressin an extraceilular miRNA in the biological sample.

6. The method of any of the preceding claims, comprising determining whether the female patient is expressing an intracellular miRNA the biological sample.

7. The method of any of the preceding claims, wherein the biological sample is a blood product.

8. The method of any of the preceding claims, wherein the biological sample is endometrial tissue.

9. The method of any of the preceding claims, wherein the test provides results of an analysis that comprises contacting the biological sample with a reagent that detects the one or more miR As.

10. The method of claim 9. wherein the reagent is an. oligonucleotide tha hybridizes to the one or more iRNAs.

1 1. The method of claim 10, wherein the ol onucleotide is DNA.

12. The method of any of the preceding claims, comprising converting the one or more miRNAs to DNA via performing reverse transcription and amplifying the DMA via performing a polymerase chain reaction.

13. The method of any of the preceding claims, wherein the miRNA is selected from a group consisting of lisa-miR-30b, hsa-miR-SOd, hsa-miR.- l , hsa~miR~ 135a. hsa- miR~l35b, hsa-miR-145, hsa-miR-203, hsa-miR-503, and combinations thereof.

14, The method of any of the preceding claims, wherei the tm-R is miR-31 ,

15. Use of a test providing results of an analysis to determine whether a female patient is expressing roiRNA in a biological sample for assessing fertility in the patient.

.16. The use of claim 15, wherein assessing fertility comprises assessing whether the patient has entered a window of implantation.

17. The use of claim 15, wherein assessing fertility comprises assessing whether the patient is fertile.

18, The use of any of claims 15-17, wherein, the miRNA is selected from a. group consisting of hsa-miR~17_t hsa-miR-19, has-miR-I9a, hsa~miR- 1 b₅ lisa-miR.-20a, hsa- miR-24, hsa-miR-25, hsa-miR-26b, h$a-miR-26b#, hsa-miR-27b, hsa-miR-29b, h$a-miR-29b- i , sa-miR~291 2, hsa-miR~30a~5p, hsa-miR.-30b, hsa-miR-3Qc, hsa~miR-30c~l , hsa-.rmR~3i)e~2, lisa-mlR-31 , hsa-miR-92a, h$a-miR-93, hsa-miR-106, hsa-miR-l O&a, hsa-miR-106b, hsa-raiR- 140~5p, hsa~.m.iR~141 , hsa-miR.~146b-5p, has-miE A-MSa, hsa-miR-1 9, hsa~miR-1 1~3p, hsa- miR-15.1-5p, has- 1.55, hsa~miR~l 82#. hsa~miR~1.91, hsa-miR-H>2, hsa-miR-I 93b, hsa-miR-200c.. hsa-miR-206, hsa-miR-302a, hsa-rai.R-302a#, hsa-miR.-302b_> hsa~miR~302b#, hsa-rniR-302c, hsa-miR-302d, hsa-miR-320, hsa-miR-339, hsa-miR-339-3p, hsa-miR-345, hsa-raiR-346, hsa- miR-347, hsa-miR-362-3p, hsa-miR-367, hsa-miR-371-3p, hsa-miR-372, hsa-miR-373, hsa- miR-374a, hsa~miR-376a, hsa~.m.iR~376a, hsa-miR.-376a-.l _} hsa~miR~376a~2, hsa-miR-378, has- miR-3SO-5p, hsa-miR-454, hsa-miR-484, hsa-miR-487b, hsa-niiR-494, hsa-miR-500, hsa-miR- 509-5p, hsa-miR-512~L hsa-miR-5 i 2-2, hsa~miR-512-3p_i hsa-miR-5 2-5p, hsa-miR- 17c, hsa- miR-518a- 1, hsa-miR- 18a-2. hsa-miR-518a-3p, hsa-miR-518c, hsa-miR-51 Sd, hsa-miR-518d- 5p, hsa-miR-5 i8e, hsa.-miR-51 a_f hsa-miR-52Qc-3p, hsa-miR-520D-3p, hsa-miR-520d-5p, hsa- mtR-522, hsa-miR-525-3p, hsa-auR-S 8a-3p, hsa-miR-548c-3p_> hsa-mir-548d-3p, fcsa-mtR-566, hsa-rmR~576-3p, hsa-miR-590-3p, hsa-miR-597, hsa-miR-6 1 , bsa-miR-603, hsa-miR-604, hsa- miR-645, hsa-miR-660, hsa-miR-720, hsa-miR-875-5p, hsa~.n.iiR-886-3p, hsa-miR-886-5p, hsa- miR.-1 44, hsa-miR-1260, hsa-miR- 1274. A, hsa-miR-1275, and hsa-miR- 1276.

19. The use of any of claims 1548, wherein the test provides results of an analysis to determine whether the patient is expressing the miRNA exlracelhnariy ax the biologicai sample.

20. The use of any of claims 15-19, wherein the test provides results of an analysis to determine whether the patient is expressing the rniRNA intracellularly in the biological sample.

21. The use of any of claims 15-20, wherein the biologicai sample is a blood product.

22. The use of any of claims 15-21 , wherein the biological sample is endometrial tissue.

23. The use of any of claims 15-22, wherein the test provides the results of an analysis that comprises contacting the biological sample with a reagent that detects the one or more miRNAs,

24. The use of claim 23, wherein the reagent is an oligonucleotide that hybridizes to the one or more miRNAs.

25. The use of claim 24, wherein the oligonucleotide is DNA.

26. The use of any of claims 15-25, wherein, the test provides results of an analysis that comprises converting the one or more miRNAs to DNA via performing reverse transcription and amplifying the DNA via performing a polymerase chain reaction.

27. The use of any of claims 15-26, wherein the rniRNA is selected from a group consisting of hsa~miR-30b, hsa~raiR~3C)d, hsa~miR-31 , hsa-miR- 135a, hsa-iniR-135h, hsa- miR-145, hsa-m.iR.~203, hsa~rmR~503, and combinations thereof

28. The use of any of claims 15-27, wherein the mi-R is tniR-31.